### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ###
## Filter: (gene_public = SERPING1)
# charset = UTF-8
## Genes ## Do not remove or alter this header ##
## Count = 1
"{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}"
"SERPING1" "serpin family G member 1" "11" "q12.1" "unknown" "NG_009625.1" "UD_132118550284" "" "https://www.LOVD.nl/SERPING1" "" "1" "1228" "710" "606860" "1" "1" "1" "1" "alias C1NH.\r\nEstablishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "" "g" "https://databases.lovd.nl/shared/refseq/SERPING1_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2025-03-13 09:32:15" "03256" "2026-09-14 19:14:54"
## Transcripts ## Do not remove or alter this header ##
## Count = 1
"{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}"
"00018730" "SERPING1" "transcript variant 1" "001" "NM_000062.2" "" "NP_000053.2" "" "" "" "-191" "1775" "1503" "57365027" "57382326" "" "0000-00-00 00:00:00" "" ""
## Diseases ## Do not remove or alter this header ##
## Count = 11
"{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}"
"00000" "Healthy/Control" "Healthy individual / control" "" "" "" "" "" "00000" "2012-07-26 17:29:43" "" ""
"00138" "ASD" "autism spectrum disorder" "" "209850" "" "" "" "00084" "2013-06-04 18:17:33" "00006" "2026-09-08 10:43:23"
"00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12"
"01177" "HAE1;HAE2" "angioedema, hereditary, type 1" "AD;AR" "106100" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2025-03-13 09:32:51"
"01260" "C4D" "complement component 4, partial deficiency of (C4D)" "AD" "120790" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32"
"02963" "HAE3" "angioedema, hereditary, type 3" "AD" "610618" "" "" "" "00006" "2014-09-25 23:29:40" "03256" "2025-04-09 18:11:52"
"05292" "IMD" "immunodeficiency (IMD)" "" "" "" "" "" "00006" "2017-06-24 18:16:32" "00006" "2017-10-24 17:01:05"
"05309" "MAFD" "major affective disorder (MAFD, bipolar affective disorder, manic-depressive psychosis)" "" "125480" "" "" "" "00006" "2017-07-24 11:27:53" "" ""
"05412" "maculopathy" "maculopathy" "" "" "" "" "" "00006" "2018-03-23 12:21:26" "" ""
"06944" "HAE" "angioedema, hereditary" "" "" "" "" "" "00006" "2022-07-07 09:18:20" "" ""
"06980" "HAE4" "angioedema, hereditary, type 4" "AD" "619360" "" "" "" "00006" "2022-11-30 10:47:35" "" ""
## Genes_To_Diseases ## Do not remove or alter this header ##
## Count = 3
"{{geneid}}" "{{diseaseid}}"
"SERPING1" "01177"
"SERPING1" "01260"
"SERPING1" "06944"
## Individuals ## Do not remove or alter this header ##
## Count = 1233
"{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}"
"00229800" "" "" "" "6" "" "03256" "" "Three independent families." "" "no" "France" "" "0" "" "" "" ""
"00229801" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Spain" "" "0" "" "" "" ""
"00229802" "" "" "" "1" "" "03256" "" "Single family" "" "" "Spain" "" "0" "" "" "" ""
"00229804" "" "" "" "1" "" "03256" "" "Single family" "" "" "Algeria" "" "0" "" "" "" ""
"00229806" "" "" "" "4" "" "03256" "" "Two independent families have been shown as carrying a c.312dup variant\r\nFamily 1, France (n=2)\r\nFamily 2, Russia (n=2)" "" "no" "France" "" "0" "" "" "" ""
"00229807" "" "" "" "1" "" "03256" "" "Single family" "" "no" "France" "" "0" "" "" "" ""
"00229808" "" "" "" "4" "" "03256" "" "Two independent kindreds have been reported as carrying a c.390C>G variant\r\nFamily 1, Spain\r\nFamily 2, United States of America" "" "" "Spain" "" "0" "" "" "" ""
"00229809" "" "" "" "4" "" "03256" "" "Five independent pedigrees are carrying the c.403_404del variant\r\nFamily 1, France\r\nFamily 2, France\r\nFamily 3, Japan\r\nFamily 4, China\r\nFamily 5, Russia (n=4)" "" "no" "France" "" "0" "" "" "" ""
"00229810" "" "" "" "5" "" "03256" "" "Two independent families have been shown as carrying a c.430del variant\r\nFamily 1, Spain (n=3)\r\nFamily 2, East Russia (n=2)" "" "no" "Spain" "" "0" "" "" "" ""
"00229811" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Spain" "" "0" "" "" "" ""
"00229812" "" "" "" "1" "" "03256" "{DOI:Ponard 2019:10.1002/humu.23917}" "Single family" "F" "no" "France" "" "0" "" "" "" ""
"00229813" "" "" "" "5" "" "03256" "" "Single family with 5 affected individuals" "" "no" "France" "" "0" "" "" "(Algeria)" ""
"00229814" "" "" "" "2" "" "03256" "" "Two independent families have been shown as carrying a c.462C>G variant\r\nFamily 1, Spain\r\nFamily 2, (United States of America)" "" "no" "Spain" "" "0" "" "" "" ""
"00229815" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Netherlands" "" "0" "" "" "" ""
"00229816" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Netherlands" "" "0" "" "" "" ""
"00229817" "" "" "" "1" "" "03256" "" "Single family" "" "no" "France" "" "0" "" "" "" ""
"00229818" "" "" "" "3" "" "03256" "" "Single family with 3 affected individuals" "" "no" "France" "" "0" "" "" "" ""
"00229819" "" "" "" "3" "" "03256" "" "Single family, with father proband with a de novo situation and 2 affected daughters" "M" "no" "France" "" "0" "" "" "" ""
"00229820" "" "" "" "4" "" "03256" "" "Abundant observations of pathogenic variants at position c.550, but only three records of a c.550G>T variant\r\nThree independent pedigrees have been recorded\r\nFamily 1, Czech Republic\r\nFamily 2, Spain\r\nFamily 3, China (n=2)" "" "no" "Spain" "" "0" "" "" "" ""
"00229821" "" "" "" "2" "" "03256" "" "Two independent families have been shown as carrying a c.589C>G variant\r\nFamily 1, France\r\nFamily 2, (United States of America)" "F" "no" "France" "" "0" "" "" "" ""
"00229822" "" "" "" "4" "" "03256" "" "Family 1, France (n=1)\r\nFamily 2, France (n=3)" "" "" "France" "" "0" "" "" "" ""
"00229823" "" "" "" "1" "" "03256" "" "Single family" "" "" "Spain" "" "0" "" "" "" ""
"00229825" "" "" "" "4" "" "03256" "" "Four families have been shown as carrying a c.613T>C variant\r\nThree independent Spanish families,\r\nOne additional Russian family" "" "no" "Spain" "" "0" "" "" "" ""
"00229826" "" "" "" "2" "" "03256" "" "Two independent families have been shown as carrying a c.641C>G variant\r\nFamily 1, Spain\r\nFamily 2, (United States of America)" "" "" "Spain" "" "0" "" "" "" ""
"00229827" "" "" "" "2" "" "03256" "" "Single family with 2 affected individuals" "" "no" "France" "" "0" "" "" "" ""
"00229828" "" "" "" "1" "" "03256" "" "Single family with a de novo female proband" "F" "no" "France" "" "0" "" "" "" ""
"00229829" "" "" "" "1" "" "03256" "" "Single family with homozygous affected individual" "" "" "France" "" "0" "" "" "" ""
"00229830" "" "" "" "2" "" "03256" "" "Single family with 2 affected individuals" "" "no" "France" "" "0" "" "" "" ""
"00229831" "" "" "" "3" "" "03256" "" "Single family with 3 affected individuals" "F" "no" "France" "" "0" "" "" "" ""
"00229833" "" "" "" "1" "" "03256" "" "Single family" "F" "no" "France" "" "0" "" "" "" ""
"00229834" "" "" "" "4" "" "03256" "{DOI:Grombirikova 2023:10.1007/s10875-023-01565-w} {DOI:Kron 2023:10.1136/bcr-2023-257212}" "Three independent kindreds have been shown to carry a c.686-7C>G variant with a decreased function of C1-INH in plasma\r\n-Family 1, France (n=1)\r\n-Family 2, Czech Republic (n=2; mother and daughter)\r\n-Family 3, USA (n=1; female individual)" "F" "no" "France" "" "0" "" "" "" ""
"00229835" "" "" "" "1" "" "03256" "" "Single family" "" "no" "France" "" "0" "" "" "" ""
"00229836" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Netherlands" "" "0" "" "" "" ""
"00229837" "" "" "" "9" "" "03256" "{DOI:Sheikh 2022:10.1007/s10875-022-01399-y}" "Two independent kindreds have been shown as carrying a c.776T>A variant\r\n-1. France. Family of African origin (n=5)\r\n-2. Saudi Arabia (n=4)" "" "no" "France" "" "0" "" "" "(African)" ""
"00229838" "" "" "" "9" "" "03256" "" "Three independent pedigrees are carrying a c.785T>C variant\r\nFamily 1, France (n=3)\r\nFamily 2, France (n=4)\r\nFamily 3, France (n=2)" "" "" "France" "" "0" "" "" "" ""
"00229839" "" "" "" "4" "" "03256" "" "Single family with 4 affected individuals" "" "no" "France" "" "0" "" "" "" ""
"00229840" "" "" "" "1" "" "03256" "" "Single family" "" "no" "France" "" "0" "" "" "" ""
"00229841" "" "" "" "2" "" "03256" "" "Single family" "F" "no" "France" "" "0" "" "" "" ""
"00229842" "" "" "" "1" "" "03256" "" "Single family" "M" "no" "France" "" "0" "" "" "" ""
"00229843" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Netherlands" "" "0" "" "" "" ""
"00229844" "" "" "" "4" "" "03256" "" "Single family with affected grandmother, her daughter and her 2 granddaughters" "F" "no" "France" "" "0" "" "" "" ""
"00229845" "" "" "" "2" "" "03256" "" "Two independent French and Spanish pedigrees" "" "no" "France" "" "0" "" "" "Spain" ""
"00229846" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Spain" "" "0" "" "" "" ""
"00229848" "" "" "" "2" "" "03256" "" "Family 1 (n=1)\r\nFamily 2 (n=1)" "" "" "France" "" "0" "" "" "" ""
"00229849" "" "" "" "4" "" "03256" "" "Two independent pedigrees" "" "no" "France" "" "0" "" "" "" ""
"00229850" "" "" "" "4" "" "03256" "" "Single family with 4 affected individuals" "F" "no" "France" "" "0" "" "" "" ""
"00229851" "" "" "" "3" "" "03256" "" "Three independent families are carrying the c.938T>C variant\r\nFamily 1, United Kingdom (n=1)\r\nFamily 2, France (n=1) de novo proband\r\nFamily 3, France (n=1)" "" "" "France" "" "0" "" "" "" ""
"00229852" "" "" "" "4" "" "03256" "" "Single family with 4 affected individuals" "M" "no" "France" "" "0" "" "" "" ""
"00229853" "" "" "" "1" "" "03256" "" "Single family" "F" "no" "France" "" "0" "" "" "" ""
"00229854" "" "" "" "5" "" "03256" "" "Three independent pedigrees have been shown as carrying a c.950del varian\r\nFamily 1, Germany\r\nFamily 2, France (n=3)\r\nFamily 3, Russia" "" "no" "France" "" "0" "" "" "" ""
"00229855" "" "" "" "4" "" "03256" "" "Single family with 4 affected individuals" "F" "no" "France" "" "0" "" "" "" ""
"00229856" "" "" "" "1" "" "03256" "{DOI:Ponard 2019:10.1002/humu.23917}" "A single affected individual, France, presenting with a de novo situation" "F" "no" "France" "" "0" "" "" "" ""
"00229857" "" "" "" "4" "" "03256" "" "Family 1 France (n=1), with a probant presenting with a de novo condition\r\nFamily 2, Spain (n=3)" "" "no" "France" "" "0" "" "" "" ""
"00229858" "" "" "" "3" "" "03256" "" "Single family with 3 affected individuals" "F" "no" "France" "" "0" "" "" "" ""
"00229859" "" "" "" "3" "" "03256" "" "Single family with 3 affected individuals" "F" "no" "France" "" "0" "" "" "" ""
"00229860" "" "" "" "1" "" "03256" "" "Single family" "F" "no" "France" "" "0" "" "" "" ""
"00229861" "" "" "" "2" "" "03256" "" "Two independent families have been shown as carrying a c.990C>A variant\r\n-Spain (n=1)\r\n-China (n=1, de novo)" "" "no" "Spain" "" "0" "" "" "" ""
"00229862" "" "" "" "1" "" "03256" "" "Single family with a single female affected individual" "F" "no" "France" "" "0" "" "" "" ""
"00229863" "" "" "" "5" "" "03256" "" "Two independent kindreds have been recorded as carrying a c.995del variant\r\nFamily 1, France\r\nFamily 2, Brazil (n=3)" "" "no" "France" "" "0" "" "" "" ""
"00229864" "" "" "" "1" "" "03256" "" "Single family" "" "no" "France" "" "0" "" "" "" ""
"00229865" "" "" "" "4" "" "03256" "" "A single French pedigree with 4 affected individuals" "" "" "France" "" "0" "" "" "" ""
"00229867" "" "" "" "5" "" "03256" "" "Two independent pedrigrees have been shown as carrying a c.1030-1G>T variant\r\nFamily 1, France (n=3)\r\nFamily 2, Russia (n=2)" "" "" "France" "" "0" "" "" "" ""
"00229868" "" "" "" "9" "" "03256" "{DOI:Du 2025:10.3389/falgy.2025.1696666}" "Seven pedigrees are carrying a c.1034G>A variant\r\nFamily 1, France, de novo proband\r\nFamily 2, Spain\r\nFamily 3, France (n=2)\r\nFamily 4, France (n=2)\r\nFamily 5, France (n=1)\r\nFamily 6, Japan\r\nFamily 7, China (n=1, male)" "" "no" "France" "" "0" "" "" "" ""
"00229870" "" "" "" "3" "" "03256" "" "Single family with 3 affected individuals" "F" "no" "France" "" "0" "" "" "" ""
"00229871" "" "" "" "1" "" "03256" "" "Single individual" "" "no" "(Algeria)" "" "0" "" "" "" ""
"00229872" "" "" "" "2" "" "03256" "" "Single family with severely affected mother and daughter" "F" "no" "France" "" "0" "" "" "" ""
"00229873" "" "" "" "3" "" "03256" "" "Family 1, France (n=1)\r\nFamily 2, India (n=2)" "" "" "France" "" "0" "" "" "" ""
"00229875" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Netherlands" "" "0" "" "" "" ""
"00229876" "" "" "" "2" "" "03256" "" "Single family with 2 affected individuals" "" "no" "France" "" "0" "" "" "" ""
"00229877" "" "" "" "2" "" "03256" "" "Single family with 2 affected individuals" "M" "no" "France" "" "0" "" "" "" ""
"00229878" "" "" "" "1" "" "03256" "" "Single family with de novo proband" "" "no" "France" "" "0" "" "" "" ""
"00229879" "" "" "" "3" "" "03256" "" "Three independent pedigrees have been shown as carrying a c.1100T>C variant\r\nFamily 1, France (n=1)\r\nFamily 2, Spain Canary Island (n=1)\r\nFamily 2, Spain (n=1)" "" "no" "France" "" "0" "" "" "" ""
"00229880" "" "" "" "2" "" "03256" "" "Single family" "" "no" "France" "" "0" "" "" "" ""
"00229881" "" "" "" "5" "" "03256" "" "Two independent pedigrees are carrying a c.1114delC variant\r\nFamily 1, France (n=4)\r\nFamily 2, France (n=1)" "" "no" "France" "" "0" "" "" "" ""
"00229882" "" "" "" "1" "" "03256" "" "Single family with a severely affected proband" "F" "no" "France" "" "0" "" "" "" ""
"00229884" "" "" "" "3" "" "03256" "" "Two independent kindreds have been published as carrying a c.1195C>G variant\r\nFamily 1, France (n=2), with a de novo proband\r\nFamily 2, United States" "" "no" "France" "" "0" "" "" "United States" ""
"00229885" "" "" "" "2" "" "03256" "" "Two independent families are carrying the variant c.1202T>G" "" "no" "France" "" "0" "" "" "" ""
"00229886" "" "" "" "1" "" "03256" "" "Single family" "M" "no" "France" "" "0" "" "" "" ""
"00229887" "" "" "" "1" "" "03256" "" "Single individual" "M" "no" "France" "" "0" "" "" "" ""
"00229888" "" "" "" "5" "" "03256" "" "Single family" "F" "no" "France" "" "0" "" "" "" ""
"00229889" "" "" "" "3" "" "03256" "" "Two independent pedigrees have been recorded to carry a c.1249G>T variant\r\nFamily 1 (France), n=2\r\nFamily 2 (Germany), n=1" "" "no" "France" "" "0" "" "" "Germany" ""
"00229890" "" "" "" "2" "" "03256" "{DOI:Ponard 2019:10.1002/humu.23917}" "Two independent families have been shown as carrying a c.1249+1G>T variant\r\nFamily 1, France (n=1)\r\nFamily 2, Slovakia (n=1)" "" "no" "France" "" "0" "" "" "" ""
"00229891" "" "" "" "2" "" "03256" "" "Single family" "" "no" "United Kingdom (Great Britain)" "" "0" "" "" "" ""
"00229892" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Spain" "" "0" "" "" "" ""
"00229893" "" "" "" "6" "" "03256" "" "Four independent pedigrees are carrying a c.1312del variant, even if both families from Latvia and Hungary are independent or not\r\nFamily 1, France (n=1)\r\nFamily 2, China (n=1)\r\nFamily 3, Latvia (n=3)\r\nFamily 4, Hungary (n=2)" "" "no" "France" "" "0" "" "" "" ""
"00229894" "" "" "" "2" "" "03256" "" "A single pedigree has been recorded, with a female proband severely affected and his son presenting with a mild phenotype" "F" "no" "France" "" "0" "" "" "" ""
"00229895" "" "" "" "2" "" "03256" "" "Single family with 2 affected individuals" "F" "no" "France" "" "0" "" "" "" ""
"00229896" "" "" "" "1" "" "03256" "" "Single family" "F" "no" "France" "" "0" "" "" "" ""
"00229897" "" "" "" "2" "" "03256" "" "Two independent pedigrees" "" "" "France" "" "0" "" "" "" ""
"00229899" "" "" "" "2" "" "03256" "" "Two independent families have been shown as carrying a c.1379C>A variant\r\nFamily 1, France\r\nFamily 2, Russia" "" "no" "Spain" "" "0" "" "" "" ""
"00229900" "" "" "" "1" "" "03256" "" "Single family" "F" "no" "France" "" "0" "" "" "" ""
"00229901" "" "" "" "3" "" "03256" "" "Single family with 3 affected individuals" "" "no" "France" "" "0" "" "" "" ""
"00229902" "" "" "" "2" "" "03256" "" "Single family" "F" "no" "France" "" "0" "" "" "" ""
"00229903" "" "" "" "2" "" "03256" "" "Single family with 2 affected individuals" "F" "no" "France" "" "0" "" "" "" ""
"00229904" "" "" "" "3" "" "03256" "" "Two independent pedigrees have been recorded to carry a c.-23-5G>A variant\r\nFamily 1, France (n=2)\r\nFamily 2 (n=1)" "" "" "France" "" "0" "" "" "" ""
"00229905" "" "" "" "1" "" "03256" "" "Single family" "" "no" "France" "" "0" "" "" "" ""
"00229906" "" "" "" "1" "" "03256" "" "Single family" "" "no" "" "" "0" "" "" "" ""
"00229907" "" "" "" "5" "" "03256" "{DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "Three independent kindreds have been reported as carrying a c.-22-19_-22- 4del variant\r\nFamily 1, France (n=2)\r\nFamily 2, Poland with a de novo male proband\r\nFamily 3, Czech Republic (n=2)" "" "no" "France" "" "0" "" "" "Poland" ""
"00229908" "" "" "" "4" "" "03256" "" "Proband presenting with a HAE type I phenotype; one family with 4 affected individuals" "" "no" "France" "" "0" "" "" "" ""
"00229909" "" "" "" "2" "" "03256" "" "Single family" "" "no" "Spain" "" "0" "" "" "" ""
"00229911" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Spain" "" "0" "" "" "" ""
"00229912" "" "" "" "1" "" "03256" "" "Single family with a de novo proband" "" "no" "Spain" "" "0" "" "" "" ""
"00229913" "" "" "" "2" "" "03256" "" "Single family with 2 affected individuals" "M" "no" "France" "" "0" "" "" "" ""
"00229914" "" "" "" "4" "" "03256" "{DOI:Miguel Berenguel 2024:10.3389/fimmu.2024.1499415}" "A single Spanish family with 4 affected individuals has been shown as carrying a c.51T>A variant" "F" "no" "Spain" "" "0" "" "" "" ""
"00229915" "" "" "" "7" "" "03256" "" "Three independent pedigrees, with 7 affected individuals, have been recorded to carry a c.51+3A>C variant" "" "no" "France" "" "0" "" "" "" ""
"00229916" "" "" "" "2" "" "03256" "" "A single pedigree with 2 affected individuals" "" "" "France" "" "0" "" "" "" ""
"00229917" "" "" "" "1" "" "03256" "" "Single family" "" "no" "United Kingdom (Great Britain)" "" "0" "" "" "" ""
"00229918" "" "" "" "3" "" "03256" "" "Single family" "F" "no" "France" "" "0" "" "" "" ""
"00229919" "" "" "" "2" "" "03256" "" "Single family" "" "no" "France" "" "0" "" "" "" ""
"00229920" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Spain" "" "0" "" "" "" ""
"00229922" "" "" "" "1" "" "03256" "" "Single family" "" "no" "France" "" "0" "" "" "" ""
"00229923" "" "" "" "1" "" "03256" "" "Single family" "" "no" "" "" "0" "" "" "" ""
"00229924" "" "" "" "4" "" "03256" "" "Single family" "" "no" "France" "" "0" "" "" "" ""
"00229925" "" "" "" "1" "" "03256" "" "Single family" "" "no" "France" "" "0" "" "" "" ""
"00229926" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Algeria" "" "0" "" "" "" ""
"00229927" "" "" "" "3" "" "03256" "" "Single family" "" "no" "France" "" "0" "" "" "" ""
"00240405" "" "" "" "6" "" "03256" "" "Four independent pedigrees have been shown as carrying a c.722G>C\r\nFamily 1, Italy\r\nFamily 2, France (n=2)\r\nFamily 3, Czech Republic (n=2)\r\nFamily 4, Russia" "?" "no" "France" "" "0" "" "" "" "00229834"
"00240473" "" "" "" "3" "" "03256" "{PMID:Charignon 2018:29885370}, {DOI:Charignon 2018:10.1016/j.anai.2018.05.031}" "2-generation family, 2 affected (2F)" "F" "no" "France" "" "0" "" "" "" "FamPatIII1"
"00244421" "" "" "" "11" "" "03256" "" "Eight independent kindreds with\r\nFamily 1, France (n=1); proband presenting with a de novo situation\r\nFamily 2, UK (n=1)\r\nFamily 3, The Netherlands\r\nFamily 4, Italy\r\nFamily 5, Hungary\r\nFamily 6, Spain\r\nFamily 7, Brazil\r\nFamily 8, Russia (n=4)" "" "no" "United Kingdom (Great Britain)" "" "0" "" "" "" ""
"00244447" "" "" "" "2" "" "03256" "" "Single family with a de novo proband" "F" "no" "France" "" "0" "" "" "" ""
"00244472" "" "" "" "17" "" "03256" "" "Four independent pedigrees have been recorded to carry a c.-22-2A>G variant\r\nFamily 1, Denmark (n=10)\r\nFamily 2, Northern Africa (n=5)\r\nFamily 3, Japan\r\nFamily 4, Brazil" "" "" "France" "" "0" "" "" "" ""
"00244486" "" "" "" "10" "" "03256" "{DOI:Aabom 2017:10.1186/s13023-017-0604-6}" "Single family with 10 affected individuals" "M" "no" "Denmark" "" "0" "" "" "" ""
"00244489" "" "" "" "2" "" "03256" "{PMID:Verpy 1996:8755917}" "Family 1 with 2 affected individuals" "" "" "France" "" "0" "" "" "" ""
"00244494" "" "" "" "13" "" "03256" "{DOI:Bas 2026:10.3390/medicina62091635}" "Two independent families have been shown as carrying a c.1198C>T variant, with 6 homozygous individuals and symptomatic heterozygous carriers\r\n-Spain (n=6)\r\n-Turkey (n=7)" "M" "" "Spain" "" "0" "" "" "" ""
"00244495" "" "" "" "2" "" "03256" "{DOI:Bygum 2011:10.1111/j.1398-9995.2010.02456.x}" "Single family with 2 affected individuals" "" "no" "Denmark" "" "0" "" "" "" ""
"00244497" "" "" "" "2" "" "03256" "{DOI:Zuraw 2000:10.1067/mai.2000.104780} {DOI:Chan 2024:10.22541/au.170664625.53951073}" "Two independent families have been shown as carrying a c.15_16dup variant\r\n-Family 1, United States of America\r\n-Family 2, Australia" "" "" "(United States)" "" "0" "" "" "" ""
"00244500" "" "" "" "1" "" "03256" "{DOI:Johnsrud 2015:10.1371/journal. pone.0131637}" "Single family" "" "no" "Norway" "" "0" "" "" "" ""
"00244502" "" "" "" "1" "" "03256" "" "Single family" "" "no" "(Spain)" "" "0" "" "" "" ""
"00244872" "" "" "" "15" "" "03256" "{DOI:Roche 2005:10.1002/humu.20197} {DOI:Kang 2006:10.1111/j.1398-9995.2006.01010.x} {DOI:Gösswein 2008:10.1159/000138883} {DOI:Ponard 2019:10.1002/humu.23917}" "Five independent pedigrees are carrying a c.1033G>A variant\r\nFamily 1, Spain\r\nFamily 2, Korea (n=10)\r\nFamily 3, Germany (n=1)\r\nFamily 4, France (n=2)\r\nFamily 5, Japan" "" "no" "France" "" "0" "" "" "" ""
"00244873" "" "" "" "11" "" "03256" "{PMID:Verpy 1996:8755917} {DOI:Bygum 2011:10.1111/j.1398-9995.2010.02456.x} {DOI:Grombikirova 2023:10.1007/s10875-023-01565-w}" "Four independent pedigrees have been shown as carrying the c.506T>C variant\r\nFamily 1, France (n=5)\r\nFamily 2, Denmark (n=3)\r\nFamily 3, Czech Republic (n=2)\r\nFamily 4, Russia" "" "no" "France" "" "0" "" "" "" ""
"00244874" "" "" "" "1" "" "03256" "{DOI:Faiyaz-Ul-Haque 2010:10.1159/000236005}" "Compound heterozygosity with c.856C>T, the parent #1 variant" "M" "" "(Saudi Arabia)" "" "0" "" "" "Middle East Arab" ""
"00244875" "" "" "" "4" "" "03256" "{DOI:Davis 1992:10.1038/ng0892-354} {DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Pedrosa 2016:10.1007/s10875-015-0222-9}" "At least four independent pedigrees have been recorded to carry the c.1361T>A variant, United States, Italy, Spain" "" "" "United States" "" "0" "" "" "" ""
"00244876" "" "" "" "24" "" "03256" "{DOI:Gösswein 2008:10.1159/000138883} {DOI:Papadopoulou-Alataki 2008:10.1159/000137286} {DOI:Speletas 2009:10.1016/j.humimm.2009.08.010} {DOI:López-Lera 2011:10.1016/j.molimm.2011.07.010}" "Variant c.1A>G has been reported as carried by eight independent pedigrees from\r\nGermany, 4 families (n=9)\r\nGreece, 1 family (n=6), with a de novo condition\r\nSpain, 1 family\r\nHungary, 1 family (n=2)\r\nChina, 1 family (n=6)\r\nOne pedigree is presenting with a de novo mutation" "" "no" "Germany" "" "0" "" "" "" ""
"00245062" "" "" "" "18" "" "03256" "{PMID:Aulak 1990:2365061} {PMID:McPhaden:1674681} {PMID:Eldering:1551909} {PMID:Verpy 1996:8755917} {DOI:Pappalardo:10.1016/j.molimm.2008.05.007} {DOI:Xu 2012:10.1111/all.12024} {DOI:Ponard 2019:10.1002/humu.23917}{PMID:Obtulowicz 2020:33437182}" "Numerous pedigrees presenting with a HAE type II phenotype; United States, France, Italy, United Kingdom, China, Poland\r\nHighly recurrent variant at the strategic Arg P1 position of the RCL." "" "no" "France" "" "0" "" "" "" ""
"00245063" "" "" "" "15" "" "03256" "{DOI:Roche 2005:10.1002/humu.20197} {DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Gösswein 2008:10.1159/000138883} {DOI:Caccia 2018:10.1038/s41598-017-16667-w}" "Seven independent kindreds" "" "no" "France" "" "0" "" "" "" ""
"00245064" "" "" "" "6" "" "03256" "{DOI:Roche 2005:10.1002/humu.20197} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "Five independent pedigrees are carrying a c.65C>G variant\r\nFamily 1, Spain\r\nFamily 2, Germany\r\nFamily 3, Greece\r\nFamily 4, France\r\nFamily 5, Hungary (n=2)" "" "no" "France" "" "0" "" "" "" ""
"00245065" "" "" "" "14" "" "03256" "{DOI:Kalmár 2003:10.1002/humu.9202} {DOI:Roche 2005:10.1002/humu.20197}" "Five independent pedigrees have been recorded as carrying a c.94C>T variant\r\nFamilies 1 to 3, Hungary (n=12)\r\nFamily 4, Spain\r\nFamily 5, France" "" "" "Hungary" "" "0" "" "" "France, Spain" ""
"00245066" "" "" "" "48" "" "03256" "{DOI:Verpy 1995:10.1172/JCI117663} {DOI:Bygum 2011:10.1111/j.1398-9995.2010.02456.x} {DOI:Bors 2013:10.1016/j.jaci.2012.11.015} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Haslund 2019:10.1172/JCI98869} {DOI:Arias-Flórez 2024:10.1371/journal.pone.0311316 }" "Several pedigrees have been recorded to carry a c.1417G>A variant, France, Denmark, Hungary, Greece, Brazil, Colombia with 2 families (n=21; n=13)" "" "no" "France" "" "0" "" "" "Denmark, Hungary, Greece, Brazil" ""
"00245070" "" "" "" "11" "" "03256" "{PMID:Wiesnieski 1987:3477232} {PMID:Wisnieski 1994:8144914} {DOI:Zahedi 1995:10.1172/JCI117780} {DOI:Zahedi 2001:10.4049/jimmunol.167.3.1500}" "Single family: 11 members of a 5-family kindred spanning 3 generations" "M" "no" "United States" "" "0" "" "" "" ""
"00245071" "" "" "" "6" "" "03256" "{DOI:Cicardi 1987:10.1172/JCI112873} {DOI:Bors 2013:10.1016/j.jaci.2012.11.015} {DOI:Szabó 2022:10.3389/falgy.2022.836465}" "First report of a molecular identification of C1 inhibitor deficiency.\r\nThree independent kindreds have been shown as carrying a 0.2-kb deletion encompassing exon 7.\r\nHungarian family presenting with with 4 affected individuals." "F" "no" "United States" "" "0" "" "" "" ""
"00245199" "" "" "" "13" "" "03256" "{PMID:Verpy 1996:8755917} {DOI:Duponchel 2006:10.1002/humu.9414} {DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "Three independent pedigrees have been shown to carry a c.51+5G>A variant\r\nFamily 1, France (n=2)\r\nFamily 2, Romania (n=10)\r\nFamily 3, Czech republic (n=1)" "" "" "France" "" "0" "" "" "" ""
"00245200" "" "" "" "3" "" "03256" "{DOI:Gösswein 2008:10.1159/000138883} {DOI:Hashimura 2021:10.1111/all.15034} {DOI:Förster 2021:10.1186/s13023-021-02021-x}" "Three independent pedigrees have been recorded as carrying a c.52-1G>A variant\r\nFamily 1, Germany\r\nFamily 2, Japan\r\nFamily 3, Germany" "" "" "(Germany)" "" "0" "" "" "" ""
"00245203" "" "" "" "3" "" "03256" "{DOI:Lopez-Lera 2011:10.1016/j.molimm.2011.07.010} {DOI:Ponard 2019:10.1002/humu.23917}" "Two independent pedigrees have been recorded to carry a c.51+6T>G variant\r\nFamily 1, Spain\r\nFamily 2, France" "" "no" "France" "" "0" "" "" "" ""
"00245204" "" "" "" "3" "" "03256" "{DOI:Mete Gökmen 2018:10.1159/000492583}" "Two independent families have been shown as carrying a c.51+3A>T variant\r\nFamily 1, Turkey (n=2)\r\nFamily 2, United States" "F" "no" "(Turkey)" "" "0" "" "" "" ""
"00245205" "" "" "" "24" "" "03256" "{DOI:Roche 2005:10.1002/humu.20197} {DOI:Duponchel 2006:10.1002/humu.9414} {DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Bafunno 2014:10.1111/ahg.12052} {DOI:Guryanova 2021:10.1186/s12948-021-00141-0} {DOI:Markocsy 2024:10.1016/j.waojou.2024.100885}" "Eleven pedigrees are carrying a c.51+3A>G variant\r\nFamily 1, France, (n=1)\r\nFamily 2, France, (n=2)\r\nFamily 3, France, (n=2)\r\nFamily 4, Algeria, (n=6)\r\nFamily 5, Italy (n=3)\r\nFamily 6, Italy\r\nFamily 7, Spain\r\nFamily 8, Spain\r\nFamily 9, Belarus (n=2) with a de novo proband\r\nFamily 10, Germany (n=2)\r\nFamily 11, Slovakia (n=3)" "" "" "Spain" "" "0" "" "" "" ""
"00245207" "" "" "" "17" "" "03256" "{DOI:Ren 2023:10.1016/j.jaci.2022.11.027} {DOI:Du 2026:10.3389/falgy.2026.1899305}" "Recurrent variant.\r\nCarrying families in France, United States, Italy, Spain, China, Lithuania." "" "no" "" "" "0" "" "" "" ""
"00245210" "" "" "" "4" "" "03256" "{DOI:Verpy 1995:10.1172/JCI117663} {PMID:Verpy 1996:8755917} {DOI:Nabilou 2020:10.1080/08820139.2020.1817068}" "Three independent pedigrees have been recorded to carry a c.1442T>G variant\r\nFamily 1, with a French pedigree recorded as carrying both c.1420C>G and c.1442T>G variants, cis configuration, with a de novo proband\r\nFamily 2, Iran, with a single affected male individual\r\nFamily 3, Russia (n=2)" "" "no" "(France)" "" "0" "" "" "Iran" "Pat40"
"00245216" "" "" "" "14" "" "03256" "{PMID:Verpy 1996:8755917} {DOI:Kesim 2011:10.1159/000323915} {DOI:Loli‐Ausejo 2021:10.1007/s12016-021-08834-9} {DOI:Hashimura 2021:10.1111/all.15034} {DOI:Szabo 2022:10.3389/falgy.2022.836465}" "Eight independent pedigrees have been recorded to carry a c.106_107del\r\nFamily 1, (France)\r\nFamily 2, Turkey (n=2)\r\nFamily 3, Colombia (n=2)\r\nFamily 4, Iran (n=2, male)\r\nFamily 5, Spain (n=2)\r\nFamily 6, Japan\r\nFamily 7, Japan\r\nFamily 8, Japan\r\nFamily 9, Hungary (n=2)" "" "no" "(France)" "" "0" "" "" "" ""
"00245228" "" "" "" "4" "" "03256" "{DOI:Faiyaz-Ul-Haque 2010:10.1159/000236005} {DOI:Xu 2012:10.1111/all.12024} {DOI:Sheikh 2023:10.1007/s10875-022-01399-y}" "Three independent pedigrees have been shown as carrying a c.509C>T variant\r\nFamily 1, Saudi Arabia (n=2)\r\nFamily 2, China\r\nFamily 3, China" "" "no" "Saudi Arabia" "" "0" "" "C1 Inhibitor concentrate" "" ""
"00245229" "" "" "" "1" "" "03256" "{PMID:Verpy 1996:8755917}" "Single family" "" "no" "" "" "0" "" "" "" ""
"00245344" "" "" "" "60" "" "03256" "{PMID:Verpy 1996:8755917} {DOI:Pappalardo 2000:10.1067/mai.2000.110471} {DOI:Zuraw 2000:10.1067/mai.2000.104780} {DOI:Roche 2005:10.1002/humu.20197} {DOI:Bygum 2011:10.1111/j.1398-9995.2010.02456.x} {DOI:Förster 2021:10.1186/s13023-021-02021-x}{DOI:Kanepa 2023:10.1186/s13223-023-00783-6} {DOI:Grombirikova 2023:10.1007/s10875-023-01565-w} {DOI:Jiang 2025:10.22541/au.176675056.63979689/v1}" "Numerous independent pedigrees have been recorded as carrying the c.550G>A variant.\r\nFamily 1, France\r\nFamily 2, Italy, with a de novo proband\r\nFamily 3, United States (n=3)\r\nFamily 4, United States (n=2)\r\nFamily 5, United States (n=1)\r\nFamilies 6 to 8, Germany (n=5)\r\nFamily 9, Italy\r\nFamily 10, Turkey\r\nFamily 11, Denmark\r\nFamilies 12 and 13, China\r\nFamilies 14 & 15, Portugal (n=2)\r\nFamilies 16 & 17, Serbia (n=2)\r\nFamily 18, Norway\r\nFamily 19, Czech republic\r\nFamilies 20 & 21, Poland (n=2)\r\nFamily 22, Brazil\r\nFamilies 23 to 29, France (n=6)\r\nFamilies 30 & 31, Japan\r\nFamily 32, Brazil\r\nFamily 33, Germany (n=3)\r\nFamily 34, China\r\nFamily 35, Latvia\r\nFamily 36, Czech Republic\r\nFamily 37, Greece (n=2)" "" "no" "France" "" "0" "" "" "United Sates, Italy, Poland, Turkey, Germany, Norway, Denmark, Brazil, Czech republic, China, Japan" ""
"00245349" "" "" "" "11" "" "03256" "{DOI:Steiner 2017:10.1111/cei.12941}" "Family 1, Switzerland (n=7)\r\nFamily 2, Spain\r\nFamily 3, Russia (n=3)" "" "no" "Switzerland" "" "0" "" "" "" ""
"00245397" "" "" "" "2" "" "03256" "{DOI:Guarino 2006:10.1111/j.1399-0004.2006.00643.x}" "One pedigree" "M" "no" "(Italy)" "" "0" "" "" "" ""
"00245419" "" "" "" "1" "" "03256" "{PMID:Bafunno 2013:23688413}, {DOI:Bafunno 2013:10.1016/j.jaci.2013.04.006}" "Single family" "F" "yes" "(Italy)" "" "0" "" "" "" "patient"
"00245420" "" "" "" "7" "" "03256" "{DOI:Lopez-Lera 2011:10.1016/j.molimm.2011.07.010} {DOI:Xu 2012:10.1111/all.12024} {DOI:Maia 2019:10.1111/all.13699}" "Family 1, Spain\r\nFamily 2, China\r\nFamily 3, Brazil, with a de novo proband\r\nFamily 4, Spain, with a de novo proband\r\nFamily 5, Russia (n=3)" "" "no" "Spain" "" "0" "" "" "" ""
"00245421" "" "" "" "1" "" "03256" "{DOI:Cagini 2016:10.1515/hsz-2015-0222}" "Single family" "M" "no" "(Brazil)" "" "0" "" "" "" ""
"00245422" "" "" "" "6" "" "03256" "{DOI:[1]:[2]}{DOI:Gösswein 2008:10.1159/000138883} {DOI:Haslund 2019:10.1172/JCI98869} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "Four pedigrees\r\nFamily 1, Germany (n=2)\r\nFamily 2, France (n=2)\r\nFamily 3, Denmark\r\nFamily 4, Greece" "" "no" "France" "" "0" "" "" "" ""
"00245423" "" "" "" "6" "" "03256" "{DOI:Xu 2012:10.1111/all.12024} {DOI:Ponard 2019:10.1002/humu.23917}" "Three independent pedigrees are carrying a c.895T>C variant\r\nFamily 1, China\r\nFamily 2, Spain\r\nfamily 3, France (n=4)" "" "no" "France" "" "0" "" "" "" ""
"00245424" "" "" "" "3" "" "03256" "{DOI:Yamamoto 2012:10.1097/MAJ.0b013e31822bdb65} {DOI:Hashimura 2021:10.1111/all.15034}" "Two independent pedigrees have been recorded as carrying a c.895T>G variant\r\nFamily 1, Japan (n=2)\r\nFamily 2, Japan" "" "no" "Japan" "" "0" "" "" "" ""
"00245426" "" "" "" "13" "" "03256" "{DOI:Lopez-Lera 2011:10.1016/j.molimm.2011.07.010} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Kalmar 2003:10.1002/humu.9202} {DOI:Guryanova 2021:10.1186/s12948-021-00141-0}" "Five independent pedigrees have been recorded to carry a c.1106delA variant\r\nFamily 1, Spain, with a de novo proband\r\nFamily 2, Hungary (n=5)\r\nFamily 3, Greece (n=4)\r\nFamily 4, France (n=1), with a de novo proband\r\nFamily 5, Belarus (n=2), with a de novo proband" "" "no" "Spain" "" "0" "" "" "Hungary, Greece, France, Belarus" ""
"00245427" "" "" "" "4" "" "03256" "{DOI:Gösswein 2008:10.1159/000138883} {DOI:Xu 2012:10.1111/all.12024} {DOI:Haslund 2019:10.1172/JCI98869} {DOI:Obtulowicz 2020:10.5114/ceji.2020.101252}" "Three independent pedigrees have been recorded to carry a c.1322T>C variant\r\nFamily 1, Germany (n=1)\r\nFamily 2, China\r\n(Family 3, Denmark)\r\nFamily 4, Poland (n=1)" "" "no" "Germany" "" "0" "" "" "China, (Denmark)" ""
"00245429" "" "" "" "2" "" "03256" "{PMID:Siddique 1993:8396558}" "Single family with 2 affected individuals" "M" "no" "United Kingdom (Great Britain)" "" "0" "" "" "" ""
"00245431" "" "" "" "15" "" "03256" "{PMID:Levy 1990:2296585} {PMID:Davis 1992:1363816} {PMID:Aulak 1993:8349686} {DOI:Pappalardo 2008:0.1016/j.molimm.2008.05.007} {DOI:Suffritti 2014:10.1111/cea.12293} {DOI:Bafunno 2014:10.1111/ahg.12052} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "Several pedigrees have been recorded to carry a c.1372G>A variant\r\nFamilies 1 to 3, United States\r\nFamily 4, Italy (n=6)\r\nFamily 5, Italy\r\nFamily 6, Poland\r\nFamily 7, France (n=3)\r\nFamily 8, Germany" "" "no" "United States" "" "0" "" "" "" ""
"00245432" "" "" "" "8" "" "03256" "{DOI:Blanch 2002:10.1002/humu.9073}{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007}{DOI:Xu 2012:10.1111/all.12024}{DOI:Gábos 2019:10.2478/rrlm-2019-0029}" "Five independent pedigrees have been recorded to carry a c.1418T>G variant\r\nFamily 1, Spain\r\nFamily 2, Italy (n=4)\r\nFamily 3, China\r\nFamily 4, France (n=1)\r\nfamily 5, Romania (n=1)" "" "no" "Spain" "" "0" "" "" "" ""
"00245433" "" "" "" "3" "" "03256" "{DOI:Xu 2012:10.1111/all.12024}" "Poor clinical informations.\r\nTwo independent families have been found as carrying a c.1490A>G variant:\r\nFamily 1, China (n=1)\r\nFamily 2, Russia (n=2)" "" "" "China" "" "0" "" "" "" ""
"00245717" "" "" "" "2" "" "03256" "{DOI:Khang 2006:10.1111/j.1398-9995.2006.01010.x} {DOI:Xu 2012:10.1111/all.12024}" "Single family with 2 affected individuals" "?" "no" "" "" "0" "" "" "" ""
"00245718" "" "" "" "107" "" "03256" "{PMID:Verpy 1996:8755917}{PMID:Bissler 1997:9069585}{PMID:Kalmar 2003:14635117}{PMID:Bygum 2011:20804470}{PMID:Martinho 2013:23123409}{PMID:Cagini 2016:26812872} {PMID:Maia 2019:30556912} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Wang 2022:10.1186/s41065-022-00242-z} {DOI:Sheikh 2023:10.1007/s10875-022-01399-y} {DOI:Szabo 2022:10.3389/falgy.2022.836465} {DOI:Roosens 2024:10.1016/j.jaip.2024.12.023}" "Numerous independent pedigrees have been recorded as carrying a c.1480C>T variant\r\nFrance (4 families; 16 patients including 2 de novo probands)\r\nUnited States\r\nSpain (3 pedigrees)\r\nHungary (4 pedigrees, 6 affected patients)\r\nGermany (2 kindreds, 4 affected patients)\r\nItaly (n=5)\r\nDenmark\r\nPortugal\r\nSerbia\r\nBrazil (n=5, 12 affected patients), one family with a de novo proband \r\nGreece\r\nUnited Kingdom (2 families, 6 patients)\r\nIran\r\nChina (21 patients)\r\nSaudi Arabia (1 family, 3 patients)\r\nBelgium (1 family)" "" "no" "France" "" "0" "" "" "" ""
"00245745" "" "" "" "1" "" "03256" "{DOI:Rijavec 2013:10.1371/journal.pone.0056712}" "Homozygous female proband is presenting with a HAE type II phenotype with low grade severity. Heterozygous parents are asymptomatic." "" "" "Slovenia" "" "0" "" "" "" ""
"00245746" "" "" "" "2" "" "03256" "{PMID:Verpy 1996:8755917}" "A family with 2 homozygous individuals and 4 asymptomatic heterozygous carriers." "" "yes" "" "" "0" "" "" "" ""
"00245747" "" "" "" "5" "" "03256" "{DOI:Büyüköztürk 2009:10.1016/j.jaci.2008.12.022} {DOI:Kesim 2011:10.1159/000323915}" "Two families have been found as carrying a c.-161A>G variant\r\nFamily 1, Turkey; only homozygous female proband and her sisters have been recorded as symptomatic. Heterozygous carriers have been recorded as asymptomatic.\r\nFamily 2, Azerbaidjan; with 2 homozygous siblings." "F" "" "Turkey" "" "0" "" "" "" ""
"00245748" "" "" "" "3" "" "03256" "{DOI:Bygum 2011:10.1111/j.1398-9995.2010.02456.x}" "Single family with 3 affected individuals" "" "no" "Denmark" "" "0" "" "" "" ""
"00245749" "" "" "" "14" "" "03256" "{DOI:Bygum 2011:10.1111/j.1398-9995.2010.02456.x}" "Seven independent pedigrees have been recorded to carry a c.143_144del variant\r\nFamily 1, Denmark (n=1)\r\nFamily 2, Denmark (n=2)\r\nFamily 3, Denmark (n=1)\r\nFamily 4, Italy\r\nFamily 5, China\r\nFamily 6, Brazil (n=4)\r\nFamily 6, Spain (n=2)\r\nFamily 7, Slovakia (n=2)" "" "no" "Denmark" "" "0" "" "" "" ""
"00245750" "" "" "" "2" "" "03256" "{DOI:Bygum 2011:10.1111/j.1398-9995.2010.02456.x}" "Two independent families have been shonw as carrying a c.437del variant\r\nFamily 1, Denmark\r\nFamily 2, Russia (HAE1 patient with an unknown family HAE history)" "" "no" "Denmark" "" "0" "" "" "" ""
"00245752" "" "" "" "2" "" "03256" "{DOI:Gösswein 2008:10.1159/000138883}" "Single family with 2 affected individuals" "" "no" "Germany" "" "0" "" "" "" ""
"00245753" "" "" "" "1" "" "03256" "{DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "Single family" "" "no" "Poland" "" "0" "" "" "" ""
"00245755" "" "" "" "1" "" "03256" "{DOI:Gösswein 2008:10.1159/000138883}" "Single family" "" "no" "Germany" "" "0" "" "" "" ""
"00245758" "" "" "" "1" "" "03256" "{DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "Single family" "" "" "Bulgaria" "" "0" "" "" "" ""
"00245759" "" "" "" "2" "" "03256" "{DOI:Bos 2003:10.1074/jbc.M302977200}" "Single family" "" "no" "Netherlands" "" "0" "" "" "" ""
"00245762" "" "" "" "1" "" "03256" "{DOI:Gösswein 2008:10.1159/000138883}" "Single family" "" "no" "Germany" "" "0" "" "" "" ""
"00245763" "" "" "" "8" "" "03256" "{DOI:Gösswein 2008:10.1159/000138883} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "Two independent pedigrees (n=6) are carrying a c.329_341del variant\r\nFamily 1, Germany (n=6)\r\nFamily 2, Germany (n=2)" "F" "no" "Germany" "" "0" "" "" "" ""
"00245764" "" "" "" "5" "" "03256" "{DOI:Gösswein 2008:10.1159/000138883} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "Two independent pedigrees have been shown to carry a c.358_377dup variant\r\nFamily 1, Germany (n=4)\r\nFamily 2, Germany (n=1)" "" "" "Germany" "" "0" "" "" "" ""
"00245765" "" "" "" "1" "" "03256" "{DOI:Speletas 2015:10.1016/j.jaci.2014.08.007}" "Single family" "" "no" "Germany" "" "0" "" "" "" ""
"00245767" "" "" "" "2" "" "03256" "{DOI:Gösswein 2008:10.1159/000138883}" "Single family" "" "no" "Germany" "" "0" "" "" "" ""
"00245797" "" "" "" "5" "" "03256" "{DOI:Kalmár 2003:10.1002/humu.9202}" "Single family" "" "no" "Hungary" "" "0" "" "" "" ""
"00245800" "" "" "" "1" "" "03256" "{DOI:Gösswein 2008:10.1159/000138883}" "Single family" "" "no" "Germany" "" "0" "" "" "" ""
"00245802" "" "" "" "2" "" "03256" "{DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "Single family" "" "no" "Greece" "" "0" "" "" "" ""
"00245806" "" "" "" "1" "" "03256" "{DOI:Gösswein 2008:10.1159/000138883}" "Single family" "" "no" "Germany" "" "0" "" "" "" ""
"00245807" "" "" "" "4" "" "03256" "{DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "Single family" "" "no" "Greece" "" "0" "" "" "" ""
"00245808" "" "" "" "1" "" "03256" "{DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Gábos 2019:10.2478/rrlm-2019-0029}" "Single family" "F" "no" "Romania" "" "0" "" "" "" ""
"00245809" "" "" "" "6" "" "03256" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Salih 2023:/10.1016/j.jaip.2022.11.045}" "Six independent pedigrees have been recorded as carrying a c.666_667del variant\r\nFamily 1, Italy\r\nFamily 2, Japan\r\nFamily 3, China\r\nFamily 4, United States, with a 24-yr pregnant female presenting with HAE attack upon SARS-CoV2 infection\r\nFamily 5, Russia, a male affected individual with an unknown family HAE history\r\nFamily 6, Spain" "" "no" "Italy" "" "0" "" "" "Japan" ""
"00245810" "" "" "" "1" "" "03256" "{DOI:Gösswein 2008:10.1159/000138883}" "Single family" "" "no" "(Germany)" "" "0" "" "" "" ""
"00245849" "" "" "" "4" "" "03256" "{DOI:Speletas 2015:10.1016/j.jaci.2014.08.007}" "Single family" "" "no" "Hungary" "" "0" "" "" "" ""
"00245850" "" "" "" "5" "" "03256" "{DOI:Tarzi 2007:10.1111/j.1365-2249.2007.03438.x} {DOI:Nabilou 2020:10.1080/08820139.2020.1817068}" "Pedigree 1 (n=1): United Kingdom\r\nPedigree 2 (n=4): Iran, with male (n=2) and female (n=2) patients" "" "no" "United Kingdom (Great Britain)" "" "0" "" "" "" ""
"00245851" "" "" "" "1" "" "03256" "{DOI:Tarzi 2007:10.1111/j.1365-2249.2007.03438.x}" "Single family" "" "no" "United Kingdom (Great Britain)" "" "0" "" "" "" ""
"00245852" "" "" "" "1" "" "03256" "{DOI:Gösswein 2008:10.1159/000138883}" "Single family" "" "no" "Germany" "" "0" "" "" "" ""
"00245854" "" "" "" "1" "" "03256" "{DOI:Gösswein 2008:10.1159/000138883}" "Single family" "" "no" "Germany" "" "0" "" "" "" ""
"00245855" "" "" "" "3" "" "03256" "{DOI:Lopez-Lera 2011:10.1016/j.molimm.2011.07.010} {DOI:Ponard 2019:10.1002/humu.23917}" "Two independent predigrees\r\nFamily 1, Spain\r\nFamily 2, France" "" "no" "Spain" "" "0" "" "" "" ""
"00245856" "" "" "" "1" "" "03256" "{DOI:Gösswein 2008:10.1159/000138883}" "Single family" "" "no" "Germany" "" "0" "" "" "" ""
"00245857" "" "" "" "1" "" "03256" "" "Single family" "" "?" "(United States)" "" "0" "" "" "" ""
"00245858" "" "" "" "1" "" "03256" "{DOI:Gösswein 2008:10.1159/000138883}" "Single family" "F" "no" "Germany" "" "0" "" "" "" ""
"00245859" "" "" "" "1" "" "03256" "{DOI:Roche 2005:10.1002/humu.20197}" "Single family" "" "no" "Spain" "" "0" "" "" "" ""
"00245860" "" "" "" "1" "" "03256" "{DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "Single family" "" "no" "Germany" "" "0" "" "" "" ""
"00245861" "" "" "" "1" "" "03256" "{DOI:Gösswein 2008:10.1159/000138883}" "Single family" "" "no" "Germany" "" "0" "" "" "" ""
"00245862" "" "" "" "4" "" "03256" "{DOI:Gösswein 2008:10.1159/000138883}" "Single family" "" "no" "Germany" "" "0" "" "" "" ""
"00245863" "" "" "" "1" "" "03256" "{DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "Single family" "" "no" "Hungary" "" "0" "" "" "" ""
"00245865" "" "" "" "2" "" "03256" "{DOI:Speletas 2015:10.1016/j.jaci.2014.08.007}" "Single family" "" "no" "Hungary" "" "0" "" "" "" ""
"00245866" "" "" "" "1" "" "03256" "{DOI:Speletas 2015:10.1016/j.jaci.2014.08.007} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "Single family" "" "no" "Greece" "" "0" "" "" "" ""
"00245867" "" "" "" "1" "" "03256" "{DOI:Gösswein 2008:10.1159/000138883}" "Single family" "" "no" "Germany" "" "0" "" "" "" ""
"00245868" "" "" "" "3" "" "03256" "{DOI:Andrejević 2015:10.1371/journal.pone.0142174}" "Single family" "" "no" "Serbia" "" "0" "" "" "" ""
"00245869" "" "" "" "1" "" "03256" "{DOI:Gösswein 2008:10.1159/000138883}" "Single family" "" "no" "Germany" "" "0" "" "" "" ""
"00245870" "" "" "" "2" "" "03256" "{DOI:Gösswein 2008:10.1159/000138883}" "Single family" "" "no" "Germany" "" "0" "" "" "" ""
"00245871" "" "" "" "5" "" "03256" "{DOI:Gösswein 2008:10.1159/000138883}" "Three independent families have been shown as carrying a c.1216del variant\r\nFamilies 1 & 2, Germany with 4 affected individuals\r\nFamily 3, Russia with a single female affected individual" "" "no" "Germany" "" "0" "" "" "" ""
"00245872" "" "" "" "12" "" "03256" "{DOI:Yakushiji 2007:10.1001/archneur.64.5.731} {DOI:Gösswein 2008:10.1159/000138883} {DOI:Cagini 2016:10.1515/hsz-2015-0222} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "At least 8 independent pedigrees from Japan, Brazil (n=4), Germany, France and Greece" "" "no" "France" "" "0" "" "" "Japan, Germany, Brazil, Greece" ""
"00245873" "" "" "" "10" "" "03256" "{DOI:Gösswein 2008:10.1159/000138883}" "Three independent pedigrees with 10 affected individuals\r\nFamily 1, Germany (n=2)\r\nFamily 2, Slovakia (n=3)\r\nFamily 3, slovakia (n=5; consanguineous parents)" "" "no" "Germany" "" "0" "" "" "" ""
"00245874" "" "" "" "1" "" "03256" "{DOI:Gösswein 2008:10.1159/000138883} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "Single family" "" "no" "Germany" "" "0" "" "" "" ""
"00245875" "" "" "" "1" "" "03256" "{DOI:Speletas 2015:10.1111/all.12714} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "Single family" "M" "no" "Greece" "" "0" "" "" "" ""
"00245876" "" "" "" "2" "" "03256" "{DOI:Speletas 2015:10.1111/all.12714} {DOI:Steiner 2017:10.1111/cei.12941}" "Two independent kindreds have been reported as carrying a c.1352dup variant\r\nFamily 1, Greece\r\nFamily 2, Switzerland" "" "no" "Switzerland" "" "0" "" "" "Greece" ""
"00245877" "" "" "" "2" "" "03256" "{DOI:Gösswein 2008:10.1159/000138883}" "Single family" "" "no" "Germany" "" "0" "" "" "" ""
"00245878" "" "" "" "3" "" "03256" "{DOI:Gösswein 2008:10.1159/000138883}" "Two independent pedigrees, Germany, with 3 affected individuals" "" "no" "Germany" "" "0" "" "" "" ""
"00245879" "" "" "" "1" "" "03256" "{DOI:Speletas 2015:10.1111/all.12714} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "Single family" "" "no" "Germany" "" "0" "" "" "" ""
"00245880" "" "" "" "1" "" "03256" "{DOI:Lopez-Lera 2011:10.1016/j.molimm.2011.07.010}" "Single family" "" "no" "Spain" "" "0" "" "" "" ""
"00245881" "" "" "" "1" "" "03256" "{DOI:Gösswein 2008:10.1159/000138883}" "Single family" "" "no" "Germany" "" "0" "" "" "" ""
"00245903" "" "" "" "5" "" "03256" "{PMID:El-Meguid 2008:20306692} {DOI:Gösswein 2008:10.1159/000138883}" "Two pedigrees are carrying a c.1432delC variant\r\nFamily 1, Germany (n=2)\r\nFamily 2, Egypt (n=3), with probably common root" "" "no" "Germany" "" "0" "" "" "" ""
"00245904" "" "" "" "2" "" "03256" "{DOI:Bors 2013:10.1016/j.jaci.2012.11.015} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "Single family" "" "no" "Hungary" "" "0" "" "" "" ""
"00245905" "" "" "" "1" "" "03256" "{DOI:López-Lera 2011:10.1016/j.molimm.2011.07.010} {DOI:Pedrosa 2016:10.1007/s10875-015-0222-9}" "Probably the proband described by López-Lera 2011 is the same as in Pedrosa 2016" "" "" "Spain" "" "0" "" "" "" ""
"00245906" "" "" "" "1" "" "03256" "{DOI:Speletas 2015:10.1111/all.12714} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "Single family" "" "no" "" "" "0" "" "" "" ""
"00245907" "" "" "" "1" "" "03256" "{DOI:Pappalardo 2008:0.1016/j.molimm.2008.05.00}" "Single family" "" "no" "Italy" "" "0" "" "" "" ""
"00245908" "" "" "" "2" "" "03256" "{DOI:Steiner 2017:10.1111/cei.12941}" "Single pedigree with a de novo proband" "" "no" "Switzerland" "" "0" "" "" "" ""
"00245909" "" "" "" "2" "" "03256" "{DOI:Blanch 2002:10.1002/humu.9073}" "two independent pedigrees have been recorded to carry a c.1501T>A variant\r\nFamily 1, Spain\r\nFamily 2, Spain" "" "no" "Spain" "" "0" "" "" "" ""
"00246576" "" "" "" "1" "" "03256" "{DOI:Lopez-Lera 2011:10.1016/j.molimm.2011.07.010}" "Single family" "" "" "Spain" "" "0" "" "" "" ""
"00246579" "" "" "" "1" "" "03256" "{DOI:Speletas 2015:10.1016/j.jaci.2014.08.007}" "Single family" "" "no" "Germany" "" "0" "" "" "" ""
"00246580" "" "" "" "1" "" "03256" "{DOI:Gösswein 2008:10.1159/000138883}" "Single family" "" "" "Germany" "" "0" "" "" "" ""
"00246581" "" "" "" "1" "" "03256" "{DOI:Speletas 2015:10.1111/all.12714} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "Single family" "" "no" "(Greece)" "" "0" "" "" "" ""
"00246582" "" "" "" "1" "" "03256" "{DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "Single family" "" "no" "Poland" "" "0" "" "" "" ""
"00246584" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00246585" "" "" "" "1" "" "03256" "{DOI:Gösswein 2008:10.1159/000138883}" "Single family" "" "no" "Germany" "" "0" "" "" "" ""
"00246586" "" "" "" "1" "" "03256" "" "Single family" "" "no" "France" "" "0" "" "" "" ""
"00246613" "" "" "" "1" "" "03256" "{DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "Single family" "" "no" "Romania" "" "0" "" "" "" ""
"00246614" "" "" "" "2" "" "03256" "" "One family, from Ivory Coast, two brothers affected. \r\nNo biological function, no assertion ACMG criteria provided" "M" "" "Spain" "" "0" "" "" "Ivory Coast" ""
"00246616" "" "" "" "1" "" "03256" "" "Single family" "" "" "(United States)" "" "0" "" "" "" ""
"00246617" "" "" "" "1" "" "03256" "" "Sevilla, Spain, unpublished observation" "" "" "Spain" "" "0" "" "" "" ""
"00246619" "" "" "" "1" "" "03256" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007}" "Single family" "" "no" "Italy" "" "0" "" "" "" ""
"00246620" "" "" "" "6" "" "03256" "{DOI:Gösswein 2008:10.1159/000138883} {DOI:Ponard 2010:10.1002/humu.23917}" "Four families have been reported to carry a c.868_870del variant\r\nFamily 1, Germany (n=1)\r\nFamily 2, France (n=2)\r\nFamily 3, Armenia (n=2)\r\nFamily 4, Armenia" "" "no" "Germany" "" "0" "" "" "" ""
"00246621" "" "" "" "1" "" "03256" "" "Single family" "" "no" "(United States)" "" "0" "" "" "" ""
"00246622" "" "" "" "1" "" "03256" "{DOI:Speletas 2015:10.1016/j.jaci.2014.08.007} {DOI:Loules 2018:10.1016/j.gene.2018.05.02}" "Single family" "" "no" "Greece" "" "0" "" "" "" ""
"00246623" "" "" "" "5" "" "03256" "{DOI:Kalmar 2003:10.1002/humu.9202}" "Single family" "" "no" "Hungary" "" "0" "" "" "" ""
"00246624" "" "" "" "3" "" "03256" "{DOI:Kesim 2011:10.1159/000323915} {DOI:Mete Gökmen:10.1159/000492583}" "Single family" "" "no" "Turkey" "" "0" "" "" "" ""
"00246625" "" "" "" "1" "" "03256" "" "Single family" "" "" "(United States)" "" "0" "" "" "" ""
"00246876" "" "" "" "1" "" "03256" "{DOI:Andrejević 2015:10.1371/journal.pone.0142174}" "Single family" "" "no" "Serbia" "" "0" "" "" "" ""
"00246892" "" "" "" "17" "" "03256" "{DOI:Andrejević 2015:10.1371/journal.pone.0142174} {DOI:Karadža-Lapić 2016:10.1080/07853890.2016.1185144}" "Three independent families have been shown as carrying a c.74_75del variant\r\nFamilies 1 & 2, Serbia\r\nFamily 3, Croatia" "" "no" "Serbia" "" "0" "" "" "" ""
"00247517" "" "" "" "2" "" "03256" "{DOI:Roche 2005:10.1002/humu.20197}" "Two independent Spanish families have been shown as carrying a c.120del variant" "" "no" "Spain" "" "0" "" "" "" ""
"00247518" "" "" "" "12" "" "03256" "{DOI:Freiberger 2002:10.1002/humu.9029} {DOI:Roche 2005:10.1002/humu.20197} {DOI:Grodecka 2017:10.1016/j.clim.2017.03.010}" "Eight pedigrees are carrying a c.120_121delAG variant\r\nFamily 1, Czech republic (n=3)\r\nFamily 2, Czech republic\r\nFamily 3, Spain\r\nFamily 4, Italy\r\nFamily 5, France\r\nFamily 6, France, with a de novo proband\r\nFamily 7, China (n=1)\r\nFamily 8, Russia (n=3)" "" "" "Czech Republic" "" "0" "" "" "" ""
"00261345" "" "" "" "4" "" "03256" "" "Four independent pedigrees are carrying a c.124G>T variant, Italy (2 pedigrees), Romania (n=1), France (n=1, de novo)" "" "" "France" "" "0" "" "" "" ""
"00261346" "" "" "" "4" "" "03256" "" "Three independent pedigrees are carrying the c.164del variant\r\nFamily 1, Spain (n=1) de novo\r\nFamily 2, France (n=2)\r\nFamily 3, France (n=1)" "" "no" "Spain" "" "0" "" "" "" ""
"00261347" "" "" "" "2" "" "03256" "" "Two pedigrees are carrying a c.235delA variant, Germany, France" "" "no" "France" "" "0" "" "" "" ""
"00261348" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Greece" "" "0" "" "" "" ""
"00261349" "" "" "" "6" "" "03256" "{DOI:Sheikh 2023:10.1007/s10875-022-01399-y}" "Five independent pedigrees are carrying a c.265C>T variant, Italy, Slovenia, France (n=2), Japan, Saudi Arabia." "" "no" "France" "" "0" "" "" "" ""
"00261350" "" "" "" "14" "" "03256" "" "Probably seven independent pedigrees have been recorded as carrying a c.449C>T variant\r\nFamily 1, Slovenia\r\nFamily 2, Japan\r\nFamily 3, Japan\r\nFamily 4, Japan\r\nThe independency of the three Japanese pedigrees has not been found\r\nFamilies 5 and 6, Turkey (n=2 and n=6)\r\nFamily 7, Russia (n=2)" "" "no" "Slovenia" "" "0" "" "" "" ""
"00261351" "" "" "" "6" "" "03256" "" "Two independent families have been shown as carrying a c.466G>C variant\r\nFamily 1, France (n=5)\r\nFamily 2, Italy" "M" "no" "France" "" "0" "" "" "" ""
"00261352" "" "" "" "8" "" "03256" "" "Probably eight independent pedigrees have been recorded to carry a c.467C>A variant and presenting with a HAE of the intermediate type, where low antigenic C1nh is associated with a co-expression of both wt and p.(Ala156Asp) alleles\r\nFamily 1, Germany (n=1)\r\nFamily 2, France (n=1), with proband presenting with a de novo situation\r\nFamily 3, France (n=1)\r\nFamily 4, Japan\r\nFamily 5, Poland (n=1)\r\nFamily 6, Japan\r\nFamily 7, Japan\r\nFamily 8, Germany (n=1)\r\nIt is not shown whether the Japanese records are related to independent pedigrees." "" "no" "France" "" "0" "" "" "" ""
"00261353" "" "" "" "6" "" "03256" "" "Three independent pedigrees are carrying the c.535dupA variant.\r\nFamily 1 (n=1), Spain\r\nFamily 2 (n=2), Spain, with a de novo proband\r\nFamily 3 (n=3), France" "" "no" "France" "" "0" "" "" "" ""
"00261356" "" "" "" "14" "" "03256" "" "Seven independent pedigrees\r\nFamily 1, Spain\r\nFamily 2, Denmark\r\nFamily 3, France (n=2)\r\nFamily 4, Algeria (n=2)\r\nFamily 5, France (n=3)\r\nFamily 6, Brazil (n=3)\r\nFamily 7, Turkey (n=2)" "" "no" "France" "" "0" "" "" "" ""
"00261357" "" "" "" "9" "" "03256" "{DOI:Suffritti 2014:10.1111/cea.12293}" "Five independent pedigrees, \r\nFamily 1, France (n=4)\r\nFamily 2, Italy (n=2)\r\nFamily 3, Denmark\r\nFamily 4, Japan\r\nFamily 5, China" "" "no" "France" "" "0" "" "" "" ""
"00261358" "" "" "" "4" "" "03256" "" "Family living in both France and Portugal, with proband presenting with a HAE of the intermediate phenotype: low antigenic C1-INH associated with a co-expression of both variant and wt alleles" "" "no" "Portugal" "" "0" "" "" "" ""
"00261359" "" "" "" "1" "" "03256" "" "Single family" "F" "no" "France" "" "0" "" "" "" ""
"00262084" "" "" "" "12" "" "03256" "" "Six independent pedigrees.\r\nFamily 1, Italy with a de novo proband\r\nFamily 2, Denmark (n=5)\r\nFamily 3, Brazil\r\nFamily 4 and 5, France\r\nFamily 6, Greece" "" "no" "Italy" "" "0" "" "" "Brazil, Denmark, France, Greece" ""
"00262086" "" "" "" "9" "" "03256" "{DOI:Gurianova 2022:10.34883/PI.2022.8.3.009}" "Seven independent pedigrees are carrying a c.896G>A variant\r\nFamily 1, Italy, with a de novo proband\r\nFamily 2, China\r\nFamily 3, Greece\r\nFamily 4, France (n=2)\r\nFamily 5, Germany (n=1)\r\nFamily 6, Belarus (n=2)\r\nFamily 7, Russia" "" "no" "Italy" "" "0" "" "" "" ""
"00262087" "" "" "" "9" "" "03256" "" "Five independent pedigrees are carrying a c.908T>C variant\r\nfamily 1, Germany\r\nFamily 2, Greece\r\nFamily 3 , France (Mayotte, n=2)\r\nFamily 4, Russia (n=5)" "" "no" "France" "" "0" "" "" "" ""
"00262089" "" "" "" "2" "" "03256" "" "Two independent families have been shown as carrying a c.908T>G variant" "M" "no" "France" "" "0" "" "" "" ""
"00262090" "" "" "" "8" "" "03256" "{DOI:Imam 2021:10.1016/j.anai.2021.08.264}" "Six independent pedigrees have been recorded as carrying a c.937T>C variant\r\nFamily 1, United Kingdom\r\nFamily 2, France\r\nFamily 3, Japan\r\nFamily 4, USA (de novo)\r\nFamily 5, Russia (n=2)\r\nFamily 6, Spain (n=2)" "" "no" "United Kingdom (Great Britain)" "" "0" "" "" "France Japan" ""
"00262091" "" "" "" "6" "" "03256" "{DOI:Maia 2019:10.1111/all.13699}" "Three independent pedigrees\r\nFamily 1, United Kingdom (n=3)\r\nFamily 2, France (n=1), de novo proband presenting with a HAE of the intermediate type\r\nFamily 3, Brazil (n=2), with a de novo proband and including severe (n=1) and asymptomatic (n=1) individuals" "" "no" "France" "" "0" "" "" "" ""
"00262092" "" "" "" "14" "" "03256" "" "Five independent pedigrees are carrying the c.1012C>T variant\r\nFamily 1, Japan\r\nFamily 2, Greece (de novo male individual)\r\nFamily 3, France (n=4)\r\nFamily 4, France\r\nFamily 5, Spain (n=1)" "" "no" "France" "" "0" "" "" "Japan, Greece, Spain" ""
"00262093" "" "" "" "7" "" "03256" "{DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "Four indepedent pedigrees have been shown as carrying a c.1036C>T variant\r\nFamily 1, recorded by Verpy 1996\r\nFamily 2, Greece (n=1)\r\nFamily 3, France (n=2)\r\nFamily 4, Czech Republic (n=3)" "" "no" "France" "" "0" "" "" "" ""
"00262096" "" "" "" "5" "" "03256" "" "Three independent pedigrees carrying a c.1114C>T variant, \r\nFamily 1, Spain\r\nFamily 2, Serbia (n=2)\r\nFamily 3, France (n=2)" "" "no" "Spain" "" "0" "" "" "Serbia, France" ""
"00262097" "" "" "" "9" "" "03256" "" "Four pedigrees have been recorded to carry a c.1180A>C variant\r\nFamily 1, France by Verpy 1996\r\nFamily 2, Hungary, by Kalmár 2003 and Szabó 2022\r\nFamily 3, France (n=6) by Ponard 2019\r\nFamily 4, Belarus" "" "no" "France" "" "0" "" "" "" ""
"00262098" "" "" "" "7" "" "03256" "" "Three independent pedigrees have been recorded to carry a c.1187T>C variant\r\nFamilies 1 & 2, Germany (n=5)\r\nFamily 3, Romania (n=2)" "" "no" "Germany" "" "0" "" "" "" ""
"00262099" "" "" "" "8" "" "03256" "" "Four independent pedigrees have been recorded to carry a c.1193T>C variant\r\nFamily 1, Germany (n=3)\r\nFamily 2, France (n=1)\r\nFamily 3, Romania (n=1)\r\nFamily 4, Russia (n=3)" "" "no" "Germany" "" "0" "" "" "" ""
"00262100" "" "" "" "20" "" "03256" "" "Eleven independent kindreds have been recorded as carrying a c.1195C>T variant\r\nFamily 1, Switzerland\r\nFamily 2, United States\r\nFamilies 3 to 6, Serbia (n=12)\r\nFamily 7, Switzerland (n=1)\r\nFamily 8, Japan\r\nFamily 9, Latvia\r\nFamily 10, Czech Republic (n=2)\r\nFamily 11, Russia" "" "no" "United States" "" "0" "" "" "Serbia, France, Switzerland, Japan, Latvia" ""
"00262101" "" "" "" "4" "" "03256" "" "Four independent pedigrees are carrying a c.1226T>C variant\r\nFamilies 1 & 2, Spain\r\nFamily 3, France (n=1)\r\nFamily 4, Russia" "" "no" "Spain" "" "0" "" "" "France" ""
"00262103" "" "" "" "5" "" "03256" "" "Five independent pedigrees have been recorded to carry a c.1232C>G variant\r\nFamily 1, The Netherlands\r\nFamilies 2 & 3, Norway\r\nFamily 4, India (n=2)\r\nFamily 5, China" "" "no" "Netherlands" "" "0" "" "" "" ""
"00262104" "" "" "" "9" "" "03256" "" "Eight independent pedigrees have been reported as carrying a c.1340T>C variant\r\nFamily 1, France (n=2)\r\nFamily 2, China\r\nFamily 3, Spain\r\nFamily 4, China\r\nFamily 5, China\r\nFamily 6, China\r\nFamily 7, Japan\r\nFamily 8, China (n=1)" "" "no" "France" "" "0" "" "" "China, Spain, Japan" ""
"00262105" "" "" "" "5" "" "03256" "{DOI:Mak 2025:10.1111/cea.70001}" "Five families have been shown as carrying a c.1350dup variant\r\nFamily 1, Spain\r\nFamily 2, Switzerland (de novo)\r\nFamily 3, France (de novo proband)\r\nFamily 4, Saudi Arabia\r\nFamily 5, China" "" "no" "Spain" "" "0" "" "" "" ""
"00262106" "" "" "" "8" "" "03256" "" "Five independent pedigrees have been reported to carry the c.1356_1357delTG variant\r\nFrance (n=2)\r\nGreece (n=1, provisional)\r\nIran (n=2, 1 male, age of onset 6y; 1 female, age of onset 1y)\r\nChina (n=1)\r\nHungary (n=2)" "" "no" "France" "" "0" "" "" "" ""
"00262107" "" "" "" "3" "" "03256" "" "Two independent families have been shown as carrying a c.1360dup variant\r\n-Family 1, France (n=2)\r\n-Family 2, USA (n=1)" "F" "no" "France" "" "0" "" "" "" ""
"00262108" "" "" "" "7" "" "03256" "" "Four pedigrees have been recorded to carry a c.1373C>T variant\r\nFamily 1, United Kingdom\r\nFamily 2, Greece\r\nFamily 3, France (n=4)\r\nFamily 4, China (n=1)" "" "no" "France" "" "0" "" "" "" ""
"00262109" "" "" "" "39" "" "03256" "" "Thirteen independent pedigrees have been recorded to carry a c.1396C>G variant, from Germany, Brazil (2 families; n=8), Greece, Switzerland, France, China (n=11) and Russia (n=3)" "" "no" "France" "" "0" "" "" "" ""
"00262121" "" "" "" "204" "" "03256" "{DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}{DOI:Mak 2025:10.1111/cea.70001} {DOI:Fails 2025:10.17161/kjm.vol18.22749} {DOI:Bara 2026:10.2478/rrlm-2026-0026}" "Numerous independent pedigrees have been recorded to carry a c.1396C>T variant\r\nUnited States, 13 kindreds\r\nItaly\r\nIreland, 1 kindred (n=3)\r\nSpain, 7 kindreds\r\nCzech Republic, 5 kindreds (n=15)\r\nHungary, 5 kindreds with 13 affected individuals\r\nChina, 5 kindreds\r\nPortugal\r\nFrance, 17 kindreds\r\nSlovenia\r\nSerbia\r\nNorway\r\nGermany\r\nBrazil, 3 kindreds with 7 affected patients\r\nThe Netherlands\r\nDenmark\r\nTaiwan, 2 kindreds, one with a de novo mutation\r\nRomania (n=16)\r\nKorea, 2 kindreds\r\nJapan\r\nIran\r\nBelarus, 1 kindred (n=7)\r\nLatvia\r\nTurkey, 2 kindreds\r\nPortugal (several families, n=42)\r\nEstonia" "" "no" "France" "" "0" "" "" "" ""
"00262122" "" "" "" "112" "" "03256" "{DOI:Guan 2026:10.1097/MD.0000000000047283}" "Numerous independent pedigrees have been shown to carry a c.1397G>A variant\r\nUnited States, 9 kindreds\r\nUnited Kingdom\r\nCzech Republic, 6 kindreds (n=17)\r\nSpain\r\nItaly\r\nFrance, 6 kindreds with 2 de novo probands\r\nSerbia (n=2)\r\nGermany, 2 kindreds\r\nDenmark\r\nSlovenia\r\nSwitzerland\r\nBrazil, 2 kindreds, one with a de novo proband\r\nSaudi Arabia, with family 1 (n=12)\r\nRomania\r\nBelarus (de novo proband, n=3)\r\nSlovakia (n=2)\r\nTurkey, 2 kindreds\r\nChina, with 2 kindreds, one with a de novo proband\r\nGreece, 2 families (n=8)" "" "no" "France" "" "0" "" "" "" ""
"00262123" "" "" "" "1" "" "03256" "" "Single family" "M" "no" "Germany" "" "0" "" "" "" ""
"00262124" "" "" "" "8" "" "03256" "" "Six independent pedigrees have been recorded to carry a c.1427C>T\r\nFamily 1, Germany (n=1)\r\nFamily 2, Denmark (n=3)\r\nFamily 3, France (n=1)\r\nFamily 4, Korea (n=1)\r\nFamily 5, China (n=1)\r\nFamily 6, USA (n=1)" "" "no" "Germany" "" "0" "" "" "" ""
"00262125" "" "" "" "19" "" "03256" "" "Six independent pedigrees\r\nFamily 1, United Kingdom\r\nFamily 2, Spain\r\nFamilies 3 & 4, France\r\nFamily 5, Turkey (n=13)\r\nFamily 6, Russia (n=2)\r\nProbands presenting with a HAE type I phenotype" "" "no" "France" "" "0" "" "" "United Kingdom, Spain, Turkey" ""
"00262126" "" "" "" "6" "" "03256" "" "Four independent pedigrees have been recorded to carry a c.1466C>G variant\r\nFamily 1, France\r\nFamily 2, Spain\r\nFamily 3, Spain\r\nFamily 4, Russia (n=3)" "" "no" "Spain" "" "0" "" "" "" ""
"00262127" "" "" "" "17" "" "03256" "{DOI:Berra 2019:10.1186/s13223-019-0355-0}" "Seven independent pedigrees have been recorded to carry a c.1481G>A variant\r\nFamily 1, Italy (n=2)\r\nFamily 2, France (n=2)\r\nFamily 3, United States of America\r\nFamilies 4 to 7 (Italy, n=12)" "" "no" "Italy" "" "0" "" "" "" ""
"00262128" "" "" "" "6" "" "03256" "" "Three independent pedigrees have been recorded to carry a c.1481G>T variant\r\nFamily 1, Italy (n=3)\r\nFamily 2, France (n=1)\r\nFamily 3, China (n=2)" "" "no" "France" "" "0" "" "" "" ""
"00262129" "" "" "" "3" "" "03256" "" "Three independent pedigrees have been recorded to carry a c.1493C>A variant\r\nFamily 1, Algeria\r\nFamily 2, Japan\r\nFamily 3, Japan" "" "no" "Algeria" "" "0" "" "" "Japan" ""
"00262131" "" "" "" "8" "" "03256" "" "Four independent pedigrees have been recorded to carry a c.1493C>T variant\r\nFamily 1, Germany (n=1)\r\nFamily 2, Portugal (n=5)\r\nFamily 3, Belarus (n=1) de novo proband\r\nFamily 4, Japan" "" "no" "Germany" "" "0" "" "" "Portugal, Belarus, Japan" ""
"00262132" "" "" "" "4" "" "03256" "{DOI:Iuraşcu 2023:10.1002/clt2.12317}" "Four independent families have been shown as carrying a c.1493C>G variant\r\nFamily 1, Hungary\r\nFamily 2, Hungary\r\nFamily 3, Greece\r\nFamily 3, Russia" "" "no" "Hungary" "" "0" "" "" "" ""
"00263052" "" "" "" "2" "" "03256" "{DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "Single family" "" "no" "Czech Republic" "" "0" "" "" "" ""
"00263119" "" "" "" "6" "" "03256" "" "Two independent families have been shown as carrying a c.1265del variant\r\nFamily 1, China (n=5)\r\nFamiliy 2, Russia with a single male affected individual" "" "no" "China" "" "0" "" "" "" ""
"00264007" "" "" "" "3" "" "03256" "" "A single pedigree with 3 affected individuals presenting with a HAE type I phenotype" "" "no" "Austria" "" "0" "" "" "" ""
"00264013" "" "" "" "2" "" "03256" "{DOI:Wong 2019:10.1155/2019/7052062} {DOI:Mak 2025:10.1111/cea.70001}" "Single family with 2 affected individuals" "F" "no" "China" "" "0" "" "" "" ""
"00264016" "" "" "" "1" "" "03256" "" "Single family" "?" "?" "Turkey" "" "0" "" "" "" ""
"00264035" "" "" "" "11" "" "03256" "" "As reported in three pedigrees and 11 individuals, in combination with other variants" "?" "no" "Korea" "" "0" "" "" "" ""
"00264036" "" "" "" "1" "" "03256" "{DOI:Roche 2005:10.1002/humu.20197}" "A single observation probably associated with healthy individuals" "" "" "Spain" "" "0" "" "" "" ""
"00264064" "" "" "" "1" "" "03256" "" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" ""
"00264088" "" "" "" "18" "" "03256" "" "Nine independent pedigrees are carrying a c.794G>A variant\r\nFamily 1, Italy\r\nFamily 2, Turkey (n=4)\r\nFamily 3, Denmark (n=1)\r\nFamilies 4 & 5, Spain\r\nFamily 6, France (n=5)\r\nFamily 7, France (n=3)\r\nFamily 8, China (n=1)\r\nFamily 9, Russia" "" "no" "France" "" "0" "" "" "" ""
"00264129" "" "" "" "1" "" "03256" "" "" "" "" "Spain" "" "0" "" "" "" ""
"00264131" "" "" "" "1" "" "03256" "" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" ""
"00264148" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00264150" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00264155" "" "" "" "1" "" "03256" "" "" "" "" "China" "" "0" "" "" "" ""
"00264156" "" "" "" "1" "" "03256" "" "" "" "" "China" "" "0" "" "" "" ""
"00264157" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00264158" "" "" "" "1" "" "03256" "{DOI:Suffritti 2014:10.1111/cea.12293}" "Single family" "" "no" "Italy" "" "0" "" "" "" ""
"00265212" "" "" "" "2" "" "03256" "{DOI:Mete Gökmen 2019:10.1159/000492583}" "Two affected individuals with severe clinical phenotype" "" "" "Turkey" "" "0" "" "" "" ""
"00265213" "" "" "" "1" "" "03256" "" "" "" "" "(Italy)" "" "0" "" "" "" ""
"00265214" "" "" "" "1" "" "03256" "{DOI:Bafunno 2014:10.1111/ahg.12052}" "Single family" "M" "no" "Italy" "" "0" "" "" "" ""
"00265215" "" "" "" "1" "" "03256" "" "" "?" "no" "United States" "" "0" "" "" "" ""
"00265216" "" "" "" "1" "" "03256" "{DOI:Rijavec 2013:10.1371/journal.pone.0056712.t002}" "Single family" "?" "no" "Slovenia" "" "0" "" "" "" ""
"00265218" "" "" "" "1" "" "03256" "" "Both parents of proband are non affected; de novo variant not established" "?" "" "Brazil" "" "0" "" "" "" ""
"00265220" "" "" "" "1" "" "03256" "" "" "F" "" "Japan" "" "0" "" "" "" ""
"00265221" "" "" "" "1" "" "03256" "" "" "?" "" "Japan" "" "0" "" "" "" ""
"00265222" "" "" "" "1" "" "03256" "" "" "?" "" "Spain" "" "0" "" "" "" ""
"00265223" "" "" "" "3" "" "03256" "{DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "" "" "" "Czech Republic" "" "0" "" "" "" ""
"00265224" "" "" "" "2" "" "03256" "" "" "F" "" "Italy" "" "0" "" "" "" ""
"00265225" "" "" "" "1" "" "03256" "" "" "" "" "Spain" "" "0" "" "" "" ""
"00265226" "" "" "" "1" "" "03256" "" "" "" "" "China" "" "0" "" "" "" ""
"00265227" "" "" "" "6" "" "03256" "" "Three independent families are carrying a c.249del variant\r\n-Family 1, Brazil (n=2)\r\n-Family 2, Belarus (n=3)\r\n-Family 3, Hungary (n=1)" "" "no" "Brazil" "" "0" "" "" "" ""
"00265228" "" "" "" "1" "" "03256" "{DOI:de la Cruz 2012:10.1016/j.imlet.2011.07.011}" "Single family" "" "no" "Spain" "" "0" "" "" "" ""
"00265229" "" "" "" "2" "" "03256" "{DOI:Lopez-Lera 2011:10.1016/j.molimm.2011.07.010}" "Single family with 2 affected individuals" "" "no" "Spain" "" "0" "" "" "" ""
"00265231" "" "" "" "2" "" "03256" "{DOI:Mete Gökmen 1019:10.1159/000492583}" "" "" "" "Turkey" "" "0" "" "" "" ""
"00265235" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00265236" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00265260" "" "" "" "1" "" "03256" "" "" "" "" "Norway" "" "0" "" "" "" ""
"00265261" "" "" "" "3" "" "03256" "" "Three pedigrees are carrying a c. 387_388del variant\r\n-Germany\r\n-France\r\n-Belarus, with a de novo proband" "" "no" "France" "" "0" "" "" "Germany, Belarus" ""
"00265262" "" "" "" "2" "" "03256" "{DOI:Mete Gökmen 2018:10.1159/000492583}" "A family with 2 affected individuals with a severe phenotype" "" "" "Turkey" "" "0" "" "" "" ""
"00265286" "" "" "" "3" "" "03256" "" "" "" "" "(France)" "" "0" "" "" "" ""
"00265306" "" "" "" "2" "" "03256" "" "Two independent pedigrees have been recorded as carrying a c.553del variant\r\nFamily 1, Brazil\r\nFamily 2, Japan" "" "no" "Brazil" "" "0" "" "" "Japan" ""
"00265307" "" "" "" "1" "" "03256" "" "Single family" "" "no" "United States" "" "0" "" "" "" ""
"00265308" "" "" "" "1" "" "03256" "" "" "" "" "(France)" "" "0" "" "" "" ""
"00265310" "" "" "" "8" "" "03256" "{DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "Family 1, Greece (n=3)\r\nFamily 2, France (n=2)\r\nFamily 3, United States (n=1)\r\nFamily 4, Czech republic (n=2)" "" "no" "Greece" "" "0" "" "" "" ""
"00265311" "" "" "" "1" "" "03256" "" "" "" "" "Portugal" "" "0" "" "" "" ""
"00265316" "" "" "" "1" "" "03256" "" "" "" "" "France" "" "0" "" "" "" ""
"00265317" "" "" "" "2" "" "03256" "{PMID:Bissler 1997:9069585}" "Two independent kindreds have been reported as carrying a c.530T>C variant\r\nFamily 1, United States\r\nFamily 2, Denmark" "" "no" "United States" "" "0" "" "" "Denmark" ""
"00265318" "" "" "" "1" "" "03256" "{DOI:Martinho 2013:10.1016/j.molimm.2012.09.003}" "" "" "" "Portugal" "" "0" "" "" "" ""
"00265319" "" "" "" "1" "" "03256" "{DOI:Martinho 2013:10.1016/j.molimm.2012.09.003}" "" "" "" "Portugal" "" "0" "" "" "" ""
"00265320" "" "" "" "1" "" "03256" "{DOI:Martinho 2013:10.1016/j.molimm.2012.09.003}" "" "" "" "Portugal" "" "0" "" "" "" ""
"00265321" "" "" "" "1" "" "03256" "{DOI:Martinho 2013:10.1016/j.molimm.2012.09.003}" "" "" "" "Portugal" "" "0" "" "" "" ""
"00265322" "" "" "" "1" "" "03256" "{DOI:Martinho 2013:10.1016/j.molimm.2012.09.003}" "" "" "" "Portugal" "" "0" "" "" "" ""
"00265323" "" "" "" "1" "" "03256" "{DOI:Martinho 2013:10.1016/j.molimm.2012.09.003}" "" "" "" "Portugal" "" "0" "" "" "" ""
"00265324" "" "" "" "2" "" "03256" "{DOI:Rijavec 2013:10.1371/journal.pone.0056712}" "" "" "" "Slovenia" "" "0" "" "" "" ""
"00265325" "" "" "" "1" "" "03256" "{PMID:Bissler 1997:9069585}" "" "" "" "United States" "" "0" "" "" "" ""
"00265326" "" "" "" "1" "" "03256" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007}" "" "" "" "Italy" "" "0" "" "" "" ""
"00265328" "" "" "" "2" "" "03256" "" "" "" "" "Spain" "" "0" "" "" "" ""
"00265329" "" "" "" "7" "" "03256" "{PMID:Lei 2011:22299312}" "Two independent pedigrees have been identified as carrying a c.628delA variant\r\nFamily 1 (n=1) United States of America\r\nFamily 2 (n=6) Taiwan" "" "no" "United States" "" "0" "" "" "Taiwan" ""
"00265330" "" "" "" "1" "" "03256" "" "" "" "" "China" "" "0" "" "" "" ""
"00265331" "" "" "" "2" "" "03256" "{DOI:Lin 2011:10.1016/j.jfma.2021.02.006}" "Two possibly independent families have been recorded as carrying a c.660dup variant\r\nFamily 1, United States\r\nFamily 2, Taiwan, with a female proband presenting with linear wrist blisters" "" "" "United States" "" "0" "" "" "" ""
"00265332" "" "" "" "2" "" "03256" "{DOI:Bygum 2011:10.1111/j.1398-9995.2010.02456.x}" "" "" "no" "Denmark" "" "0" "" "" "" ""
"00265333" "" "" "" "2" "" "03256" "" "Two independent pedigrees have been recorded as carrying a c.669_670del variant\r\nFamily 1, Spain\r\nFamily 2, China" "" "" "Spain" "" "0" "" "" "" ""
"00265334" "" "" "" "15" "" "03256" "" "Three independent pedigrees have been recorded as carrying a c.674_675delinsAA variant\r\nFamily 1, Greece (n=13)\r\nFamily 2, Japan\r\nFamily 3, Japan" "" "" "Greece" "" "0" "" "" "Japan" ""
"00265335" "" "" "" "7" "" "03256" "" "Variant recorded in 4 reports\r\nThree pedigrees have been recorded\r\nFamily 1. Spain (Roche et al, 2005)\r\nFamily 2. Spain (López-Lera et al 2011); this pedigree presents with c.52-130C>T and c.671T>G combined variants.\r\nFamily 3. Serbia (Andrejević et al 2015)\r\nFamily 4. United States of America, n=4 (Ren et al 2023)" "" "" "Spain" "" "0" "" "" "" ""
"00265336" "" "" "" "4" "" "03256" "" "Two independent families have been shown as carrying a c.674T>C variant\r\nFamily 1, Germany (n=2)\r\nFamily 2, Russia (n=2)" "" "no" "Germany" "" "0" "" "" "" ""
"00265337" "" "" "" "5" "" "03256" "" "" "" "no" "France" "" "0" "" "" "" ""
"00265346" "" "" "" "7" "" "03256" "" "" "" "" "Taiwan" "" "0" "" "" "" ""
"00265347" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Italy" "" "0" "" "" "" ""
"00265348" "" "" "" "1" "" "03256" "" "" "" "" "China" "" "0" "" "" "" ""
"00265349" "" "" "" "1" "" "03256" "" "" "" "" "Italy" "" "0" "" "" "" ""
"00265350" "" "" "" "1" "" "03256" "" "" "" "" "(France)" "" "0" "" "" "" ""
"00265351" "" "" "" "2" "" "03256" "" "Two independent families have been shown as carrying a c.751del variant\r\nFamily 1, France\r\nFamily 2, Russia" "" "no" "(France)" "" "0" "" "" "" ""
"00265357" "" "" "" "5" "" "03256" "" "Two independent pedigrees have been recorded as carrying a c.762_763del variant\r\nFamily 1, Denmark (n=3)\r\nFamily 2, Brazil (n=2)" "" "" "Denmark" "" "0" "" "" "" ""
"00265358" "" "" "" "2" "" "03256" "{DOI:Iwamoto 2010:10.1016/j.jdermsci.2012.06.012} {DOI:Shibuya 2014:10.2332/allergolint.13-LE-0655}" "" "F" "no" "Japan" "" "0" "" "" "" ""
"00265359" "" "" "" "2" "" "03256" "{DOI:Cagini 2016:10.1515/hsz-2015-0222}" "" "F" "no" "Brazil" "" "0" "" "" "" ""
"00265360" "" "" "" "2" "" "03256" "" "" "" "" "Spain" "" "0" "" "" "" ""
"00265366" "" "" "" "4" "" "03256" "" "Three independent kindreds have been shown as carrying a c.818_820del variant\r\nFamily 1, USA (n=2)\r\nFamily 2, USA (1 affected male individual)\r\nFamily 3, USA (1 affected female individual)" "" "no" "United States" "" "0" "" "" "" ""
"00265368" "" "" "" "3" "" "03256" "" "Two (likely independent) pedigrees have been recorded to carry a c.813_818delCAACAA variant, Macedonia, Bulgaria" "" "" "Macedonia" "" "0" "" "" "" ""
"00265369" "" "" "" "1" "" "03256" "" "" "" "" "France" "" "0" "" "" "" ""
"00265373" "" "" "" "1" "" "03256" "" "" "" "" "United States" "" "0" "" "" "" ""
"00265374" "" "" "" "1" "" "03256" "" "" "" "" "United States" "" "0" "" "" "" ""
"00265375" "" "" "" "1" "" "03256" "" "" "" "" "Denmark" "" "0" "" "" "" ""
"00265376" "" "" "" "7" "" "03256" "{DOI:Mete Gökmen 2018:10.1159/000492583} {DOI:Bas 2026:10.3390/medicina62091635}" "Two independent families have been shown as carrying a c.856del variant\r\n-Family 1, 2 affected carriers\r\n-Family 2, 5 affected carriers" "" "no" "Turkey" "" "0" "" "" "" ""
"00265385" "" "" "" "1" "" "03256" "" "" "" "" "Spain" "" "0" "" "" "" ""
"00265388" "" "" "" "1" "" "03256" "" "" "" "" "Spain" "" "0" "" "" "" ""
"00265389" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Italy" "" "0" "" "" "" ""
"00265398" "" "" "" "3" "" "03256" "" "At least two independent families have been shown as carrying a c.963del variant\r\nFamily 1, Italy (n=2)\r\nFamily 2, Russia" "" "no" "Italy" "" "0" "" "" "" ""
"00265400" "" "" "" "1" "" "03256" "{DOI:Mete Gökmen 2018:10.1159/000492583}" "Isolated case of an affected male individual with a severe phenotype" "M" "" "Turkey" "" "0" "" "" "" ""
"00265426" "" "" "" "2" "" "03256" "" "" "" "no" "France" "" "0" "" "" "" ""
"00265427" "" "" "" "1" "" "03256" "" "" "" "" "Italy" "" "0" "" "" "" ""
"00265428" "" "" "" "2" "" "03256" "" "" "" "" "Italy" "" "0" "" "" "" ""
"00265429" "" "" "" "6" "" "03256" "{DOI:Suffritti 2014:10.1111/cea.12293}" "A single family with 6 affected individuals" "" "no" "Italy" "" "0" "" "" "" ""
"00265430" "" "" "" "1" "" "03256" "" "Single family" "" "no" "United States" "" "0" "" "" "" ""
"00265431" "" "" "" "1" "" "03256" "" "" "" "" "(France)" "" "0" "" "" "" ""
"00265432" "" "" "" "1" "" "03256" "{DOI:Mete Gökmen 2028:10.1159/000492583}" "" "F" "" "Turkey" "" "0" "" "" "" ""
"00265434" "" "" "" "2" "" "03256" "" "Single family with 2 affected individuals" "M" "no" "(Greece)" "" "0" "" "" "" ""
"00265443" "" "" "" "1" "" "03256" "" "" "" "" "Denmark" "" "0" "" "" "" ""
"00265445" "" "" "" "4" "" "03256" "{DOI:Xu 2012:10.1111/all.12024}" "Four independent Chinese families are carrying a c.1111del variant" "" "" "China" "" "0" "" "" "" ""
"00265446" "" "" "" "1" "" "03256" "" "" "" "" "Turkey" "" "0" "" "" "" ""
"00265447" "" "" "" "1" "" "03256" "" "" "" "" "Italy" "" "0" "" "" "" ""
"00265448" "" "" "" "4" "" "03256" "{DOI:Sheikh 2022:10.1007/s10875-022-01399-y}" "Probably the same pedigree already described by Faiyaz-Ul-Haque et al. Int Arch Allergy Immunol 2010;151:149–154" "" "" "Saudi Arabia" "" "0" "" "" "" ""
"00265483" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Italy" "" "0" "" "" "" ""
"00265489" "" "" "" "1" "" "03256" "" "" "" "" "China" "" "0" "" "" "" ""
"00265508" "" "" "" "1" "" "03256" "{DOI:Roche 2005:10.1002/humu.20197}" "Single family" "" "no" "Spain" "" "0" "" "" "" ""
"00265511" "" "" "" "1" "" "03256" "{DOI:Roche 2005:10.1002/humu.20197}" "Single family" "" "no" "Spain" "" "0" "" "" "" ""
"00265525" "" "" "" "2" "" "03256" "{DOI:Mete Gökmen 2018:10.1159/000492583}" "Two independent families have been shown as carrying a c.1264dup variant\r\nFamily 1, Turkey with a single affected female individual \r\nFamily 2, Russia with a single affected female individual" "F" "no" "Turkey" "" "0" "" "" "" ""
"00265526" "" "" "" "3" "" "03256" "" "Two independent pedigrees have been recorded to carry a c.1264delT variant\r\nUSA (n=2, provisional)\r\nIran (n=1, female)" "" "" "(United States)" "" "0" "" "" "Iran" ""
"00265527" "" "" "" "2" "" "03256" "{DOI:Suffritti 2014:10.1111/cea.12293}" "A single family with 2 affected individuals" "" "no" "Italy" "" "0" "" "" "" ""
"00265528" "" "" "" "6" "" "03256" "" "At least three pedigrees have been shown as carrying the c.1279del variant\r\nFamily 1, Italy (n=4)\r\nFamily 2, China \r\nFamily 3, Denmark" "" "no" "Italy" "" "0" "" "" "" ""
"00265529" "" "" "" "1" "" "03256" "{DOI:Suffritti 2014:10.1111/cea.12293}" "Single family" "" "no" "Italy" "" "0" "" "" "" ""
"00265530" "" "" "" "4" "" "03256" "{DOI:Grombirikova 2023]:10.1007/s10875-023-01565-w}" "Three independent kindreds have been shown to carry a c.1284_1285del variant \r\nCzech republic (n=4)" "" "" "Czech Republic" "" "0" "" "" "" ""
"00265531" "" "" "" "1" "" "03256" "" "Single family" "M" "no" "Turkey" "" "0" "" "" "" ""
"00265532" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Norway" "" "0" "" "" "" ""
"00265533" "" "" "" "4" "" "03256" "{DOI:Sheikh 2023:10.1007/s10875-022-01399-y}" "Two independent pedigrees have been shown to carry a c.1305delT\r\nUnited Kingdom (n=1)\r\nSaudi Arabia (n=3)" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" ""
"00265535" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Italy" "" "0" "" "" "" ""
"00265576" "" "" "" "1" "" "03256" "" "Single family with a single female affected individual" "" "" "Spain" "" "0" "" "" "" ""
"00265577" "" "" "" "2" "" "03256" "" "Probably two Italian families" "" "no" "Italy" "" "0" "" "" "" ""
"00265578" "" "" "" "1" "" "03256" "{DOI:Maia 2019:10.1111/all.13699}" "Single family" "F" "no" "Brazil" "" "0" "" "" "" ""
"00265579" "" "" "" "1" "" "03256" "{DOI:Bafunno 2014:10.1111/ahg.12052}" "Single family" "" "no" "Italy" "" "0" "" "" "" ""
"00265580" "" "" "" "1" "" "03256" "{DOI:Speletas 2015:10.1016/j.jaci.2014.08.007}" "Single family" "" "no" "Greece" "" "0" "" "" "" ""
"00265581" "" "" "" "1" "" "03256" "{DOI:Pappalardo 2000:10.1067/mai.2000.110471}" "Single family with a de novo affected carrier" "" "no" "Italy" "" "0" "" "" "" ""
"00265583" "" "" "" "2" "" "03256" "" "Two families with affected probands of different groups of severity." "" "no" "Italy" "" "0" "" "" "" ""
"00265584" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Hungary" "" "0" "" "" "" ""
"00265593" "" "" "" "1" "" "03256" "" "Single family" "" "no" "United States" "" "0" "" "" "" ""
"00265594" "" "" "" "1" "" "03256" "" "Sinle family" "" "no" "United States" "" "0" "" "" "" ""
"00265595" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Spain" "" "0" "" "" "" ""
"00265596" "" "" "" "11" "" "03256" "" "A large Chinese family with 11 affected individuals" "" "no" "China" "" "0" "" "" "" ""
"00265600" "" "" "" "1" "" "03256" "" "One family has been shwon as carrying a c.553G>A variant\r\nFamily 1, United States of America" "" "no" "United States" "" "0" "" "" "" ""
"00265602" "" "" "" "2" "" "03256" "" "Two independent families have been shown as carrying a c.1479del variant\r\nFamily 1, China\r\nFamily 2, Russia" "" "no" "China" "" "0" "" "" "" ""
"00265603" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Germany" "" "0" "" "" "" ""
"00265604" "" "" "" "6" "" "03256" "" "Three independent pedigrees have been recorded as carrying a c.1346T>G variant, \r\nSpain, \r\nGreece (n=4)\r\nGermany (n=1)" "" "" "Spain" "" "0" "" "" "Greece, Germany" ""
"00265605" "" "" "" "1" "" "03256" "" "Single family" "" "no" "(France)" "" "0" "" "" "" ""
"00265606" "" "" "" "2" "" "03256" "" "Single family" "" "no" "Germany" "" "0" "" "" "" ""
"00265607" "" "" "" "2" "" "03256" "" "Single family" "" "no" "Greece" "" "0" "" "" "" ""
"00265608" "" "" "" "1" "" "03256" "{PMID:Verpy 1996:8755917}" "Single family" "" "no" "(France)" "" "0" "" "" "" "Pat25"
"00265609" "" "" "" "4" "" "03256" "" "Two independent pedigrees have been recorded to carry a c.1A>T variant\r\nFamily 1, Italy\r\nFamily 2, Turkey (n=3)" "" "" "Italy" "" "0" "" "" "" ""
"00265610" "" "" "" "1" "" "03256" "" "Single family" "M" "no" "Greece" "" "0" "" "" "" ""
"00265611" "" "" "" "1" "" "03256" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007}" "Single family" "" "no" "Italy" "" "0" "" "" "" ""
"00265612" "" "" "" "1" "" "03256" "{DOI:Bafunno 2014:10.1111/ahg.12052}" "Single family" "" "no" "Italy" "" "0" "" "" "" ""
"00265613" "" "" "" "1" "" "03256" "{DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "Single family" "" "no" "(Greece)" "" "0" "" "" "" ""
"00265614" "" "" "" "5" "" "03256" "" "Three independent pedigrees have been recorded as carrying a c.3G>A variant\r\nFamily 1, Germany\r\nFamily 2, Italy (n=3)\r\nFamily 3, Japan" "" "no" "Germany" "" "0" "" "" "" ""
"00265615" "" "" "" "2" "" "03256" "" "Two independent families have been shown as carrying a c.35T>G variant\r\nFamily 1, Italy\r\nFamily 2, Russia" "" "no" "Italy" "" "0" "" "" "" ""
"00265616" "" "" "" "1" "" "03256" "" "Single family with a de novo affected carrier" "" "no" "(Greece)" "" "0" "" "" "" ""
"00265617" "" "" "" "2" "" "03256" "" "Two independent pedigrees are recorded to carry a c.352A>G variant" "" "" "China" "" "0" "" "" "" ""
"00265619" "" "" "" "4" "" "03256" "" "Three independent pedigrees have been reported to carry a c.130A>T variant\r\nFamilies 1 & 2, Italy\r\nFamily 3, Russia (n=2)" "" "no" "Italy" "" "0" "" "" "" ""
"00265620" "" "" "" "2" "" "03256" "" "Two families carrying the variant c.152C>T have been recorded\r\nFamily 1, Hungary (n=1), \r\nFamily 2, Poland (n=1, female individual)" "" "" "Hungary" "" "0" "" "" "Poland" ""
"00265621" "" "" "" "1" "" "03256" "" "Variant c.135C>T has been recorded in ClinVar database to be affected to hereditary angioedema" "" "" "" "" "0" "" "" "" ""
"00265622" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Italy" "" "0" "" "" "" ""
"00265623" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Czech Republic" "" "0" "" "" "" ""
"00265624" "" "" "" "1" "" "03256" "" "The c.227C>T variant has been ascribed to HAE without association with a clinical phenotype of the proband.\r\nDoes not fulfill the criteria retained by the expert committee" "" "" "" "" "0" "" "" "" ""
"00265625" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Hungary" "" "0" "" "" "" ""
"00265626" "" "" "" "6" "" "03256" "" "Four independent pedigrees are carrying a c.289C>T variant\r\n-Family 1. China\r\n-Family 2. Serbia\r\n-Family 3. China\r\n-Family 4. Belarus, with a de novo situation" "" "" "China" "" "0" "" "" "" ""
"00265627" "" "" "" "8" "" "03256" "{DOI:Peters 2024:10.1056/NEJMoa2400403}" "Five independent pedigrees are carrying a c.301C>T variant, -Family 1, Serbia (n=3)\r\n-Family 2, Poland\r\n-Family 3, France (n=1)\r\n-Family 4, USA (n=2)\r\n-Family 5, Russia" "" "no" "Serbia" "" "0" "" "" "" ""
"00265628" "" "" "" "4" "" "03256" "" "Four independent pedigrees are carrying a c.310C>T variant, Germany, Norway, Belarus, Russia" "" "" "Germany" "" "0" "" "" "" ""
"00265629" "" "" "" "3" "" "03256" "" "Three independent pedigrees are carrying a c.322C>T variant, \r\nFamily 1, Germany, \r\nFamily 2, China,\r\nFamily 3, China" "" "" "Germany" "" "0" "" "" "" ""
"00265630" "" "" "" "6" "" "03256" "" "Five independent pedigrees have been recorded to carry a c.346C>T variant, Italy, Serbia, Japan (n=2), Russia, Brazil" "" "no" "Italy" "" "0" "" "" "" ""
"00265631" "" "" "" "7" "" "03256" "{DOI:Szabó 2022:10.3389/falgy.2022.836465}" "Two independent Hungarian families have been shown as carrying a c.389G>A variant" "" "" "Hungary" "" "0" "" "" "" ""
"00265634" "" "" "" "4" "" "03256" "" "Two independent pedigrees have been reported as carrying a c.400G>T variant\r\nGermany, n=3\r\nItaly, n=1" "" "" "Germany" "" "0" "" "" "" ""
"00265635" "" "" "" "3" "" "03256" "" "A single Hungarian family with 3 affected individuals" "" "no" "Hungary" "" "0" "" "" "" ""
"00265636" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Spain" "" "0" "" "" "" ""
"00265637" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Germany" "" "0" "" "" "" ""
"00265638" "" "" "" "1" "" "03256" "" "Single family" "" "no" "United States" "" "0" "" "" "" ""
"00265639" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Germany" "" "0" "" "" "" ""
"00265641" "" "" "" "1" "" "03256" "{DOI:Mete Gökmen 2018:10.1159/000492583}" "Single family" "M" "no" "Turkey" "" "0" "" "" "" ""
"00265642" "" "" "" "2" "" "03256" "{DOI:Martinho 2013:10.1016/j.molimm.2012.09.003}" "A single Portugese family with 2 affected individuals" "" "no" "Portugal" "" "0" "" "" "" ""
"00265643" "" "" "" "2" "" "03256" "" "Two independent families have been shown as carrying a c.461A>G\r\nFamily 1, China\r\nFamily 2, Russia" "" "no" "China" "" "0" "" "" "" ""
"00265644" "" "" "" "1" "" "03256" "" "Single family with a de novo affected carrier" "" "no" "United States" "" "0" "" "" "" ""
"00265699" "" "" "" "6" "" "03256" "" "Four independent pedigrees are carrying the c.473C>G variant\r\nFamily 1, Spain (n=2)\r\nFamily 2, Greece (n=1)\r\nFamily 3, Lithuania (n=2; 2-year-old boy and his de novo father)\r\nFamily 4, Russia" "" "no" "Spain" "" "0" "" "" "" ""
"00265702" "" "" "" "9" "" "03256" "" "Two pedigrees have been recorded to carry a c.481A>T variant, Portugal (n=2), Macedonia (n=7)" "" "no" "Portugal" "" "0" "" "" "Macedonia" ""
"00265703" "" "" "" "1" "" "03256" "{DOI:Mete Gökmen 2028:10.1159/000492583}" "Single family" "M" "no" "Turkey" "" "0" "" "" "" ""
"00265704" "" "" "" "10" "" "03256" "" "Four independent pedigrees have been recorded to carry a c.498C>A variant\r\nFamily 1, Romania (n=5)\r\nFamily 2, Brazil (n=3; 3 asymptomatic siblings)\r\nFamily 3, Czech republic (n=1)\r\nFamily 4, Romania (n=1)" "" "no" "Romania" "" "0" "" "" "Brazil" ""
"00265705" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Greece" "" "0" "" "" "" ""
"00265706" "" "" "" "2" "" "03256" "" "Single family" "" "no" "Germany" "" "0" "" "" "" ""
"00265708" "" "" "" "14" "" "03256" "" "Five independent pedigrees have been recorded as carrying a c.503C>A variant\r\nFamily 1, Italy\r\nFamily 2, Romania\r\nFamily 3, Hungary (n=2)\r\nFamily 4, Czech Republic (n=3)\r\nFamily 5, Slovakia (n=7)" "" "no" "Romania" "" "0" "" "" "" ""
"00265709" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Germany" "" "0" "" "" "" ""
"00265710" "" "" "" "3" "" "03256" "" "Two pedigrees have been recorded to carry a c.508T>C variant\r\nFamily 1, Italy, with a de novo proband\r\nFamily 2, Denmark\r\nFamily 3, China" "" "" "(Italy)" "" "0" "" "" "" ""
"00265711" "" "" "" "2" "" "03256" "" "Two independent pedigrees are carrying a c.512C>A variant, Pappalardo 2008" "" "" "Italy" "" "0" "" "" "" ""
"00265712" "" "" "" "4" "" "03256" "" "Two independent pedigrees have been recorded to carry a c.533T>C variant" "" "" "Germany" "" "0" "" "" "" ""
"00265713" "" "" "" "4" "" "03256" "" "Three independent pedigrees are carrying a c.536C>T variant\r\nSpain, 2 families\r\nLithuania, 1 family" "" "no" "Spain" "" "0" "" "" "" ""
"00265714" "" "" "" "4" "" "03256" "" "Four independent pedigrees have been recorded as carrying a c.548T>C variant\r\nFamily 1, Spain\r\nFamily 2, Czech republic\r\nFamily 3, Japan\r\nFamily 4, Japan" "" "" "Spain" "" "0" "" "" "" ""
"00265716" "" "" "" "5" "" "03256" "" "Four independent pedigrees have been recorded for a c.551G>A variant, \r\nFamily 1, United States (n=2)\r\nFamily 2 and family 3, Germany (n=2)\r\nFamily 4, Serbia" "" "" "United States" "" "0" "" "" "Germany, Serbia" ""
"00265717" "" "" "" "9" "" "03256" "" "Three independent families have been recognized as carrying a c.553G>C variant\r\nFamily 1, Hungary (n=6)\r\nFamily 2, Russia (n=2)\r\nFamily 3, Korea" "" "no" "Hungary" "" "0" "" "" "" ""
"00265719" "" "" "" "1" "" "03256" "" "" "" "" "Germany" "" "0" "" "" "" ""
"00265720" "" "" "" "2" "" "03256" "" "Two independent kindreds from USA have been reported as carrying a c.571A>C variant" "" "" "United States" "" "0" "" "" "" ""
"00265721" "" "" "" "5" "" "03256" "" "Three independent kindreds have been recorded as carrying a c.578T>C variant\r\n-Family 1, Spain\r\n-Family 2, Brazil (n=2)\r\n-Family 3, Russia (n=2)" "" "no" "Spain" "" "0" "" "" "Brazil" ""
"00265722" "" "" "" "1" "" "03256" "{DOI:Roche 2005:10.1002/humu.20197}" "Single family" "" "no" "Spain" "" "0" "" "" "" ""
"00265742" "" "" "" "2" "" "03256" "" "A single family with 2 affected sons in a gonadal mosaicism" "" "no" "Italy" "" "0" "" "" "" ""
"00265743" "" "" "" "10" "" "03256" "" "Two pedigrees are carrying a c.601A>T variant\r\nFamily 1, Germany (n=1)\r\nFamily 2, Turkey (n=9)" "" "" "Germany" "" "0" "" "" "" ""
"00265744" "" "" "" "8" "" "03256" "" "Four independent pedigrees have been recorded to carry a c.614G>A variant\r\nFamily 1, United States (n=3)\r\nFamily 2, Spain, with a de novo proband\r\nFamily 3, Denmark\r\nFamily 4, Czech republic (n=3)" "" "no" "United States" "" "0" "" "" "Spain, Denmark" ""
"00265745" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Spain" "" "0" "" "" "" ""
"00265746" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00265748" "" "" "" "1" "" "03256" "" "Singe family" "" "no" "Portugal" "" "0" "" "" "" ""
"00265749" "" "" "" "4" "" "03256" "" "Three independent pedigrees have been recorded to carry a c.629T>C variant\r\nFamily 1, Japan\r\nFamily 2, Czech Republic (n=2)\r\nFamily 3, Japan" "F" "no" "Japan" "" "0" "" "" "Czech republic" ""
"00265750" "" "" "" "5" "" "03256" "" "Two independent pedigrees have been recorded as carrying a c.653T>A variant\r\nFamily 1, United States of America (n=3)\r\nFamilies 2 and 3, probably independent families, Japan" "" "" "United States" "" "0" "" "" "Japan" ""
"00265751" "" "" "" "5" "" "03256" "{DOI:Obtulowicz 2020:10.5114/ceji.2020.101252} {DOI:Szabo 2022:10.3389/falgy.2022.836465}" "At least three independent families have been recorded to carry a c.667C>T variant, from Hungary (n=3), Poland (n=1) and Russia (n=1)" "" "no" "Hungary" "" "0" "" "" "" ""
"00265752" "" "" "" "3" "" "03256" "" "Family 1, Germany (n=1)\r\nFamily 2, Germany (n=2)" "" "" "Germany" "" "0" "" "" "" ""
"00265753" "" "" "" "1" "" "03256" "" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "China" ""
"00265754" "" "" "" "5" "" "03256" "" "Four independent Chinese pedigrees are reported to carry a c.695T>A variant\r\nAn additional Japanese pedigree has been recorded as carrying a c.695T>A variant" "" "" "China" "" "0" "" "" "Japan" ""
"00265755" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Norway" "" "0" "" "" "" ""
"00265756" "" "" "" "5" "" "03256" "{DOI:Salih 2023:/10.1016/j.jaip.2022.11.045}" "Five independent pedigrees have been shown as carrying a c.707T>C variant\r\nFamily 1, France\r\nFamily 2, Denmark\r\nFamily 3, Spain\r\nFamily 4, United States, a 22-yr female individual with HAE attack precipitated by SARS-CoV2 infection\r\nFamily 5, Russia" "" "no" "(France)" "" "0" "" "" "" ""
"00265757" "" "" "" "1" "" "03256" "{DOI:Maia 2019:10.1111/all.13699}" "Single family" "" "no" "Brazil" "" "0" "" "" "" ""
"00265758" "" "" "" "1" "" "03256" "" "Single family" "" "no" "United States" "" "0" "" "" "" ""
"00265759" "" "" "" "8" "" "03256" "{DOI:Grombikirova 2023:10.1007/s10875-023-01565-w}" "Four independent pedigrees have been shown as carrying a c.743C>G variant\r\nFamilies 1 & 2, Spain\r\nFamily 3, Czech Republic (n=3)\r\nFamily 4, Russia (n=3)" "" "no" "Spain" "" "0" "" "" "" ""
"00265760" "" "" "" "2" "" "03256" "" "Two independent pedigrees are carrying a c.764G>C variant\r\nFamily 1, Germany\r\nFamily 2, Denmark" "" "" "Germany" "" "0" "" "" "" ""
"00265761" "" "" "" "2" "" "03256" "" "Single family with 2 affected individuals" "" "no" "Hungary" "" "0" "" "" "" ""
"00265762" "" "" "" "2" "" "03256" "" "Two independent pedigrees\r\nFamily 1, Germany (n=1)\r\nFamily 2, Denmark" "" "no" "Germany" "" "0" "" "" "" ""
"00265763" "" "" "" "8" "" "03256" "{DOI:Roche 2005:10.1002/humu.20197}" "Two independent families have been shown as carrying a p.(Gly260*) variant\r\n-Family 1, Spain (n=1)\r\n-Family 2, Turkey (n=7)" "" "no" "Spain" "" "0" "" "" "" ""
"00265834" "" "" "" "3" "" "03256" "" "Three independent pedigrees are carrying a c.793T>C variant\r\nFamily 1, Italy\r\nFamily 2, Poland\r\nFamily 3, Russia" "" "no" "Italy" "" "0" "" "" "Poland" ""
"00265837" "" "" "" "2" "" "03256" "" "Single family with compound heterozygous carriers" "" "no" "Jordan" "" "0" "" "" "" ""
"00265838" "" "" "" "4" "" "03256" "" "Compound heterozygous family with a c.800C>T variant.\r\nAt least 3 affected individuals are demonstrated to carry a single c.203C>T variant.\r\nAnother HAE family from US has been considered as carrying a c.203C>T variant." "" "no" "Jordan" "" "0" "" "" "" ""
"00265839" "" "" "" "3" "" "03256" "{PMID:Jaradat 2016:26895475}, {DOI:Jaradat 2016:10.1016/j.molimm.2016.02.001}" "3-generation family with 5 affected, incl. 3 compound heterozygotes" "" "no" "Jordan" "" "0" "" "" "" "family"
"00265842" "" "" "" "1" "" "03256" "" "Single family with a compound heterozygous affected carrier" "" "no" "France" "" "0" "" "" "" ""
"00265843" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Saudi Arabia" "" "0" "" "" "" ""
"00265844" "" "" "" "3" "" "03256" "{DOI:Gábos 2019:10.2478/rrlm-2019-0029}" "Two families have been shown as carrying a c.860T>C variant\r\nFamily 1, Romania\r\nFamily 2, Russia (n=2)" "F" "no" "Romania" "" "0" "" "" "" ""
"00265845" "" "" "" "3" "" "03256" "{DOI:Maia 2019:10.1111/all.13699}" "Single family" "" "no" "Brazil" "" "0" "" "" "" ""
"00265846" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Portugal" "" "0" "" "" "" ""
"00265849" "" "" "" "1" "" "03256" "" "Single family" "" "no" "China" "" "0" "" "" "" ""
"00265850" "" "" "" "5" "" "03256" "" "Three independent pedigrees are carrying a c.882C>G variant\r\n-Families 1 and 2, Spain\r\n-Family 3, China (n=3)" "" "no" "Spain" "" "0" "" "" "" ""
"00265851" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Spain" "" "0" "" "" "" ""
"00265852" "" "" "" "24" "" "03256" "" "Three independent pedigrees have been reported to carry a c.889G>A variant\r\nFamily 1, Portugal (n=4)\r\nFamilies 2 and 3, Brazil (n=20)" "" "" "Portugal" "" "0" "" "" "Brazil" ""
"00265853" "" "" "" "2" "" "03256" "" "Two independent Italian pedigrees are carrying a c.892A>T variant" "" "" "Italy" "" "0" "" "" "" ""
"00265854" "" "" "" "1" "" "03256" "" "Single family with an apparently affected individual" "" "no" "United States" "" "0" "" "" "" ""
"00265855" "" "" "" "1" "" "03256" "" "Single family" "" "no" "United States" "" "0" "" "" "" ""
"00265856" "" "" "" "3" "" "03256" "" "Single family with 3 affected individuals" "" "no" "Hungary" "" "0" "" "" "" ""
"00265857" "" "" "" "1" "" "03256" "" "Single family presenting with a compound heterozygous proband" "" "no" "United Kingdom (Great Britain)" "" "0" "" "" "" ""
"00265858" "" "" "" "2" "" "03256" "" "Single family with 2 affected individuals" "" "no" "Portugal" "" "0" "" "" "" ""
"00265859" "" "" "" "9" "" "03256" "" "Six independent pedigrees are carrying a c.953C>G variant\r\nFamilies 1-4, Italy (n=7), within 4 families\r\nFamily 5, Switzerland (n=1)\r\nfamily 6, China (n=1)" "" "" "Italy" "" "0" "" "" "" ""
"00265861" "" "" "" "3" "" "03256" "" "Three independent families have been recorded as carrying a c.971T>G variant\r\nFamily 1, Italy\r\nFamily 2, Japan\r\nFamily 3, Russia" "" "no" "Italy" "" "0" "" "" "Japan" ""
"00265862" "" "" "" "15" "" "03256" "{DOI:Galata 2025:10.1016/j.jaip.2025.03.020}" "Five pedigrees have been shown as carrying a c.974T>C variant\r\nFamily 1, Italy\r\nFamily 2, France\r\nFamilies 3 and 4, Turkey (n=3 and n=6)\r\nFamily 5, Portugal (n=4)" "" "no" "Italy" "" "0" "" "" "" ""
"00265863" "" "" "" "2" "" "03256" "{DOI:Suffritti 2014:10.1111/cea.12293}" "A single Italian family (n=2) has been shown as carrying a c.988T>A variant" "" "no" "Italy" "" "0" "" "" "" ""
"00265871" "" "" "" "7" "" "03256" "" "Three independent pedigrees have been recorded as carrying a c.889+1G>A variant\r\nFamily 1, France (n=3)\r\nFamily 2, Japan\r\nFamily 3, Hungary (n=3)" "" "no" "France" "" "0" "" "" "Japan" ""
"00265873" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Italy" "" "0" "" "" "" ""
"00265874" "" "" "" "5" "" "03256" "" "Three (likely) independent affected pedigrees have been recorded as carrying a c.998C>A variant\r\nFamily 1, Japan (n=3)\r\nFamily 2, Japan (n=1)\r\nFamily 3, Japan" "F" "" "Japan" "" "0" "" "" "" ""
"00265875" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Italy" "" "0" "" "" "" ""
"00265876" "" "" "" "3" "" "03256" "" "Two independent pedigrees have been shown as carrying a c.1010A>G variant\r\nFamily 1, Italy\r\nFamily 2, Brazil (n=2)" "" "no" "Italy" "" "0" "" "" "" ""
"00265877" "" "" "" "3" "" "03256" "" "Two independent pedigrees have been recorded to carry a c.1024G>C variant\r\nFamily 1, Germany (n=2)\r\nFamily 2, Germany (n=1)" "" "" "Germany" "" "0" "" "" "" ""
"00265881" "" "" "" "3" "" "03256" "" "Two indepedent families have been recorded as carrying a c.1033G>C variant \r\n-Family 1, France (n=2)\r\n-Family 2, USA (n=1)" "F" "no" "France" "" "0" "" "" "" ""
"00265885" "" "" "" "7" "" "03256" "" "Five pedigrees are recorded as c.1042C>T variant carriers, from Italy, Germany (n=2), China, Romania (n=2), Brazil (n=1)" "" "" "Italy" "" "0" "" "" "Italy, Germany, China, Romania, Brazil" ""
"00265886" "" "" "" "3" "" "03256" "" "Two independent families have been shown as carrying a c.1048T>C variant\r\nFamily 1, Spain (n=2)\r\nFamily 2, Germany" "" "no" "Spain" "" "0" "" "" "" ""
"00265887" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Germany" "" "0" "" "" "" ""
"00265888" "" "" "" "7" "" "03256" "" "Three independent pedigreees have been recorded to carry a c.1058T>C variant\r\nGermany, n=2\r\nBelarus, n=4\r\nRussia" "" "no" "Germany" "" "0" "" "" "" ""
"00265889" "" "" "" "2" "" "03256" "" "Two indpendent families have been shown as carrying a c.1070T>A variant\r\nFamily 1, Italy\r\nFamily 2, Russia" "M" "no" "Italy" "" "0" "" "" "" ""
"00265890" "" "" "" "1" "" "03256" "" "Single family" "" "no" "United States" "" "0" "" "" "" ""
"00265891" "" "" "" "3" "" "03256" "" "Single family with a single affected individual" "" "no" "United Kingdom (Great Britain)" "" "0" "" "" "" ""
"00265892" "" "" "" "1" "" "03256" "{DOI:Mete Gökmen 2018:10.1159/000492583}" "No family history for the proband carrying a c.1079C>T variant" "F" "" "Turkey" "" "0" "" "" "" ""
"00265893" "" "" "" "2" "" "03256" "" "Two independent families have been shown as carrying a c.1121T>C variant\r\n-United States (n=1)\r\n-China (n=1)" "" "no" "(United States)" "" "0" "" "" "" ""
"00265894" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Spain" "" "0" "" "" "" ""
"00265895" "" "" "" "4" "" "03256" "" "Two independent families have been shown as carrying a c.1391_1392del variant\r\nFamily 1, Hungary (n=3)\r\nFamily 2, Russia" "" "no" "Hungary" "" "0" "" "" "" ""
"00265896" "" "" "" "26" "" "03256" "" "Four independent Hungarian families have been recorded as carrying a c.435_476del variant, with a total of 26 affected individuals" "" "no" "Hungary" "" "0" "" "" "" ""
"00265898" "" "" "" "4" "" "03256" "" "At least four independent pedigrees have been found as carrying a c.1223A>T variant\r\nFamily 1, Hungary\r\nFamily 2, Portugal\r\nFamily 3, Italy\r\nFamily 4, Romania" "" "no" "Hungary" "" "0" "" "" "Italy, Portugal, Romania" ""
"00265900" "" "" "" "2" "" "03256" "" "Two independent families have been shown as carrying a c.1418T>A variant\r\nFamily 1, Hungary with a de novo proband\r\nFamily 2, Italy" "" "no" "Hungary" "" "0" "" "" "Italy" ""
"00265902" "" "" "" "3" "" "03256" "" "Three independent pedigrees\r\nFamily 1, Spain, with a de novo proband\r\nFamilies 2 & 3, Japan" "" "no" "Spain" "" "0" "" "" "" ""
"00265916" "" "" "" "3" "" "03256" "" "Two independent families have been shown as carrying a c.1136T>C variant\r\nSpain, 1 family\r\nLatvia, 1 family (n=2)" "" "no" "Spain" "" "0" "" "" "" ""
"00265982" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Italy" "" "0" "" "" "" ""
"00265983" "" "" "" "2" "" "03256" "" "Single family with 2 affected individuals" "" "no" "Germany" "" "0" "" "" "" ""
"00265984" "" "" "" "4" "" "03256" "" "Four pedigrees are recorded to carry a c.1174C>T variant\r\nFamily 1, Italy\r\nFamily 2, Turkey\r\nFamily 3, Portugal\r\nFamily 4, Brazil, with a de novo proband" "" "" "Italy" "" "0" "" "" "Turkey, Portugal, Brazil" ""
"00265985" "" "" "" "5" "" "03256" "" "Single family" "" "no" "Germany" "" "0" "" "" "" ""
"00265986" "" "" "" "3" "" "03256" "" "Three independent pedigrees have been recorded to carry a c.1196C>T variant\r\nFamily 1, Spain\r\nFamily 2, Germany (n=1)\r\nFamily 3, Spain, with a de novo proband" "" "" "Spain" "" "0" "" "" "Germany" ""
"00266100" "" "" "" "5" "" "03256" "" "Three independent pedigrees have been shown as carrying a c.1195C>G variant\r\nFamily 1, Spain\r\nFamily 2, Spain\r\nFamily 3, United States of America" "" "" "Spain" "" "0" "" "" "" ""
"00266101" "" "" "" "1" "" "03256" "" "Single family" "" "no" "United States" "" "0" "" "" "" ""
"00266106" "" "" "" "6" "" "03256" "{DOI:Gábos 2019:10.2478/rrlm-2019-0029}" "Three independent pedigrees are carrying a c.1223A>G variant\r\nFamily 1, Romania/Poland (n=2)\r\nFamily 2, Portugal (n=2)\r\nFamily 3, Serbia (n=1)\r\nFamily 4, China (n=1)" "" "" "Portugal" "" "0" "" "" "Serbia, Romania/Poland" ""
"00266107" "" "" "" "2" "" "03256" "" "Two independent families have been shown as carrying a c.1229T>C variant\r\nFamily 1, Germany\r\nFamily 2, Russia" "" "no" "Germany" "" "0" "" "" "" ""
"00266108" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Italy" "" "0" "" "" "" ""
"00266109" "" "" "" "3" "" "03256" "" "Two pedigrees are carrying a c.1247T>A variant\r\nFamily 1, Italy\r\nFamily 2, Greece (n=2); the variant has been detected to two monozygotic male twins with phenotype of type I HAE and no family history. Other asymptomatic members of the family were tested (father, mother, brother). The absence of the mutation from all these family members, implies its association with the disease." "" "" "Italy" "" "0" "" "" "Greece" ""
"00266110" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00266111" "" "" "" "3" "" "03256" "" "A single pedigree, Portugal (n=3), is carrying a c.1265C>T variant" "" "no" "Portugal" "" "0" "" "" "" ""
"00266112" "" "" "" "1" "" "03256" "" "Single family with a single individual" "M" "" "Turkey" "" "0" "" "" "" ""
"00266113" "" "" "" "4" "" "03256" "" "Single pedigree (n=4), with a compound heterozygous proband, cis configuration c.[1282T>C;1342G>C]" "" "" "Germany" "" "0" "" "" "" ""
"00266120" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Spain" "" "0" "" "" "" ""
"00266127" "" "" "" "1" "" "03256" "" "Single family" "" "no" "(United States)" "" "0" "" "" "" ""
"00266128" "" "" "" "3" "" "03256" "" "Three independent families have been shown as carrying a c.1289T>C variant\r\nFamily 1, Italy\r\nFamily 2, China\r\nFamily 3, Russia" "" "no" "Italy" "" "0" "" "" "" ""
"00266129" "" "" "" "2" "" "03256" "{DOI:Mete Gökmen 2020:10.1111/imcb.12362}" "Single family with two homozygous symptomatic carriers" "" "yes" "Turkey" "" "0" "" "" "" ""
"00266130" "" "" "" "3" "" "03256" "{DOI:Mete Gökmen 2018:10.1159/000492583} {DOI:Mete Gökmen 2020:10.1111/imcb.12362}" "Pedigree with 2 affected female homozygous individuals with a severe clinical phenotype (2/3) and a single heterozygous individual (1/3) presenting with a mild clinical phenotype" "" "yes" "Turkey" "" "0" "" "" "" "FamD"
"00266131" "" "" "" "4" "" "03256" "" "Two families have been shown as carrying a c.1289T>A variant\r\n-Family 1, China\r\n-Family 2, Russia (n=3)" "" "no" "China" "" "0" "" "" "" ""
"00266132" "" "" "" "5" "" "03256" "" "Three independent families have been shown as carrying a c.1309C>T variant\r\nFamily 1, Italy (n=3)\r\nFamily 2, Germany\r\nFamily 3, Russia" "" "no" "Italy" "" "0" "" "" "" ""
"00266133" "" "" "" "5" "" "03256" "" "Three independent families have been shown as carrying a c.1324C>T variant\r\nFamily 1, Germany\r\nFamily 2, Portugal (n=2)\r\nFamily 3, Russia (n=2)" "" "no" "Germany" "" "0" "" "" "" ""
"00266134" "" "" "" "6" "" "03256" "" "Three independent pedigrees have been recorded to carry a c.1328A>G variant\r\nFamily 1, United States (n=1)\r\nFamily 2, Spain, with a de novo proband\r\nFamily 3, Russia (n=4)" "" "no" "United States" "" "0" "" "" "Spain" ""
"00266135" "" "" "" "3" "" "03256" "" "Two independent pedigrees have been recorded to carry a c.1330C>T variant\r\nFamily 1, Turkey (n=2) with a de novo proband\r\nFamily 2, Bulgaria" "" "" "Turkey" "" "0" "" "" "Bulgaria" ""
"00266136" "" "" "" "1" "" "03256" "" "Single observation" "" "no" "Poland" "" "0" "" "" "" ""
"00266137" "" "" "" "5" "" "03256" "" "Two independent pedigrees have been found as carrying a c.1342 G>C variant\r\nFamily 1, Germany (n=4)\r\nFamily 2, Denmark" "" "" "Germany" "" "0" "" "" "Denmark" ""
"00266139" "" "" "" "1" "" "03256" "" "Single family" "" "no" "China" "" "0" "" "" "" ""
"00266140" "" "" "" "4" "" "03256" "{DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "Four independent kindreds have been shown as carrying a c.1346T>C variant\r\nFamily 1, Italy\r\nFamily 2, Germany\r\nFamily 3, Czech Republic (n=1)\r\nFamily 4, China" "" "no" "Italy" "" "0" "" "" "Germany" ""
"00266141" "" "" "" "3" "" "03256" "" "Three independent pedigrees have been recorded as carrying a c.1346T>G variant\r\nFamily 1, Italy\r\nFamily 2, Germany\r\nFamily 3, Germany (n=1)" "" "" "Italy" "" "0" "" "" "Germany" ""
"00266142" "" "" "" "3" "" "03256" "" "Two independent pedigrees have been shown as carrying a c.1351G>A variant\r\nFamily 1, Slovenia (n=2)\r\nFamily 2, China (n=1)" "" "no" "Slovenia" "" "0" "" "" "" ""
"00266143" "" "" "" "5" "" "03256" "" "Four independent pedigrees have been recorded to carry a c.1367C>A variant\r\nFamily 1, United States\r\nFamily 2, Spain\r\nFamily 3, Romania\r\nFamily 4, Russia with a female de novo proband" "" "no" "United States" "" "0" "" "" "" ""
"00266147" "" "" "" "12" "" "03256" "" "Two independent kindreds have been reported as carrying a c.1369G>C variant\r\nFamily 1, Brazil (n=11)\r\nFamily 2, Japan" "" "no" "Brazil" "" "0" "" "" "Japan" ""
"00266148" "" "" "" "3" "" "03256" "" "Two independent families have been shown as carrying a c.1375G>C variant\r\nFamily 1, Portugal\r\nFamily 2, Russia (n=2)" "" "no" "Portugal" "" "0" "" "" "" ""
"00266163" "" "" "" "2" "" "03256" "" "Two independent families have been shown as carrying a c.1376C>A variant\r\nFamily 1, Brazil\r\nFamily 2, Russia" "F" "no" "Brazil" "" "0" "" "" "" ""
"00266166" "" "" "" "2" "" "03256" "" "A single pedigree has been recorded" "F" "no" "Brazil" "" "0" "" "" "" ""
"00266167" "" "" "" "5" "" "03256" "" "Single family with 5 affected individuals" "" "no" "Romania" "" "0" "" "" "" ""
"00266168" "" "" "" "1" "" "03256" "" "Single family" "F" "no" "Romania" "" "0" "" "" "" ""
"00266169" "" "" "" "8" "" "03256" "{DOI:Gábos 2019:10.2478/rrlm-2019-0029} {DOI:Szabo 2022:10.3389/falgy.2022.836465}" "Two independent kindreds have been shown as carrying a c.988T>G variant\r\nFamily 1, Romania (n=2)\r\nFamily 2, Hungary (n=6)" "" "no" "Romania" "" "0" "" "" "" ""
"00266178" "" "" "" "2" "" "03256" "" "A single Spanish family has been shown as carrying a c.1378T>C variant.\r\nAn additional observation has been introduced by LabCorp Genetics San francisco CA." "" "no" "Spain" "" "0" "" "" "" ""
"00266179" "" "" "" "1" "" "03256" "{DOI:Bygum 2011:10.1111/j.1398-9995.2010.02456.x}" "A single Danish pedigree has been recorded as carrying a c.1381G>C variant" "M" "no" "Denmark" "" "0" "" "" "" ""
"00266180" "" "" "" "1" "" "03256" "" "Single family" "" "no" "United States" "" "0" "" "" "" ""
"00266181" "" "" "" "2" "" "03256" "{DOI:Blanch 2006:10.1016/j.jaci.2006.07.035}" "Single family with 2 affected homozygous carriers" "M" "yes" "Spain" "" "0" "" "" "" ""
"00266203" "" "" "" "36" "" "03256" "{DOI:Suffritti 2014:10.1111/cea.12293}" "Numerous pedigrees have been recorded to carry a c.1397G>T variant,\r\nUnited States, 6 kindreds\r\nItaly (including a de novo proband)\r\nSpain\r\nJapan\r\nChina, 2 kindreds\r\nSlovakia, 1 kindred (n=3)\r\nBrazil" "" "no" "United States" "" "0" "" "" "" ""
"00266205" "" "" "" "1" "" "03256" "{DOI:Blanch 2002:10.1002/humu.9073}" "Single family" "" "no" "Spain" "" "0" "" "" "" ""
"00266206" "" "" "" "5" "" "03256" "" "Single family" "" "no" "Spain" "" "0" "" "" "" ""
"00266207" "" "" "" "2" "" "03256" "" "Two independent families have been reported as carrying a likely benign c.1420C>G variant with a compound heterozygous carrier." "" "" "United States" "" "0" "" "" "" ""
"00266216" "" "" "" "49" "" "03256" "{DOI:Arias-Flórez 2024:10.1371/journal.pone.0311316.t001}" "Four independent pedigrees have been shown as carrying a c.1420C>T variant\r\nFamily 1, Greece (n=4)\r\nFamily 2, China\r\nFamily 3, Czech Republic (n=3)\r\nFamily 4, Colombia (n=41)" "" "no" "Greece" "" "0" "" "" "" ""
"00266217" "" "" "" "6" "" "03256" "" "Two independent families have been recognized as carrying a c.1493C>G variant\r\nFamily 1, France\r\nFamily 2, Hungary (n=5)" "" "no" "France" "" "0" "" "" "" ""
"00266218" "" "" "" "3" "" "03256" "" "Two independent families have been shown as carrying a c.1430T>C variant\r\nFamily 1, France (n=2)\r\nFamily 2, Russia" "" "no" "France" "" "0" "" "" "" ""
"00266219" "" "" "" "1" "" "03256" "" "Family with a de novo proband" "F" "" "Brazil" "" "0" "" "" "" ""
"00266220" "" "" "" "3" "" "03256" "" "Three independent kindreds have been reported as carrying a c.1431C>G variant\r\nFamily 1, Brazil\r\nFamily 2, Japan\r\nFamily 3, United Arab Emirates" "" "no" "Brazil" "" "0" "" "" "Japan" ""
"00266221" "" "" "" "1" "" "03256" "" "Single family" "F" "no" "United States" "" "0" "" "" "" ""
"00266222" "" "" "" "4" "" "03256" "" "Two indepedent families have been recorded as carrying a c.1459A>T variant\r\nFamily 1, Portugal (n=3)\r\nFamily 2, USA (n=1)" "" "no" "Portugal" "" "0" "" "" "" ""
"00266223" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Spain" "" "0" "" "" "" ""
"00266224" "" "" "" "4" "" "03256" "{DOI:Suffritti 2014:10.1111/cea.12293} {DOI:Cicardi 2016:10.1016/j.jaci.2016.10.044}" "Three independent kindreds have been reported as carrying a c.1475T>A variant\r\nFamily 1, USA (n=2)\r\nFamily 2, Italy\r\nFamily 3, Japan" "" "no" "United States" "" "0" "" "" "" ""
"00266225" "" "" "" "1" "" "03256" "" "Single observation" "" "" "Germany" "" "0" "" "" "" ""
"00266226" "" "" "" "5" "" "03256" "" "Two independent pedigrees have been recorded to carry a c.1477G>A variant\r\nFamily 1, Japan, with a de novo female proband\r\nFamily 2, Portugal (n=3)\r\nFamily 3, Japan" "" "" "Japan" "" "0" "" "" "" ""
"00266227" "" "" "" "3" "" "03256" "" "Three independent families have been shown as carrying a c.1477G>C variant\r\nFamily 1, Italy\r\nFamily 2, Iran\r\nFamily 3, China" "F" "no" "Italy" "" "0" "" "" "" ""
"00266228" "" "" "" "12" "" "03256" "" "Seven independent pedigrees have been recorded to carry a c.1478G>A variant\r\nFamily 1, Spain\r\nFamily 2, Hungary\r\nFamily 3 Italy (n=1)\r\nFamily 4 Belarus (n=6)\r\nFamily 5, Japan\r\nFamily 6, Russia\r\nFamily 7, China" "" "no" "Spain" "" "0" "" "" "Hungary, Italy, Belarus, Japan" ""
"00266229" "" "" "" "2" "" "03256" "" "Single family" "" "no" "Macedonia" "" "0" "" "" "" ""
"00266230" "" "" "" "5" "" "03256" "" "Four independent pedigrees have been recorded to carry a c.1492C>T variant\r\nFamily 1, (France)\r\nFamily 2, Germany (n=1)\r\nFamily 3, China (n=1)\r\nFamily 4, Russia (n=2)" "" "no" "(France)" "" "0" "" "" "" ""
"00266231" "" "" "" "14" "" "03256" "" "Three independent pedigrees have been recorded to carry a c.1081C>T variant\r\nFamily 1, Japan (n=5)\r\nFamily 2, Colombia (n=8)\r\nFamily 3, Japan" "" "" "Japan" "" "0" "" "" "Colombia" ""
"00266232" "" "" "" "1" "" "03256" "" "" "?" "no" "United States" "" "0" "" "" "" ""
"00266233" "" "" "" "2" "" "03256" "" "Two probably independent pedigrees have been recorded as carrying a c.1157delT variant\r\nFamily 1, Japan\r\nFamily 2, Japan" "" "" "Japan" "" "0" "" "" "" ""
"00266234" "" "" "" "3" "" "03256" "" "Three independent pedigrees have been recorded to carry a c.1056dupT variant\r\nFamily 1, Italy\r\nFamilies 2 & 3, Japan" "" "" "Italy" "" "0" "" "" "Japan" ""
"00266235" "" "" "" "4" "" "03256" "{DOI:Yu 2007:10.1016/S1081-1206(10)60557-1}" "Proband and 2 brothers presenting with HAE type I. A paternal mosaicism has been demonstrated" "M" "" "Taiwan" "" "0" "" "" "" ""
"00266236" "" "" "" "10" "" "03256" "" "Four independent pedigrees have been recorded to carry a c.1423C>T variant\r\nFamily 1, Hungary\r\nFamily 2, Serbia (n=1)\r\nFamily 3, China (n=1)\r\nFamily 4, Russia (n=7)" "" "" "Hungary" "" "0" "" "" "" ""
"00266238" "" "" "" "1" "" "03256" "" "Single family" "F" "no" "Algeria" "" "0" "" "" "" ""
"00266242" "" "" "" "9" "" "03256" "" "Two independent Japanese kindreds have been reported as carrying a c.1235T>A variant\r\nFamily 1, Japan (n=6)\r\nFamily 2, Japan (n=3)" "" "no" "Japan" "" "0" "" "" "" ""
"00266243" "" "" "" "1" "" "03256" "" "Single family" "" "no" "United States" "" "0" "" "" "" ""
"00266244" "" "" "" "6" "" "03256" "" "Four independent pedigrees have been recorded to carry a c.890-2A>G variant\r\nFamily 1, United States\r\nFamily 2, Germany\r\nfamily 3, Belarus (n=2)\r\nfamily 4, China (n=2)" "" "" "United States" "" "0" "" "" "" ""
"00266245" "" "" "" "11" "" "03256" "" "Six independent pedigrees have been recorded to carry a c.-22-1G>A variant\r\nFamily 1, France\r\nFamily 2, Germany (n=2)\r\nFamily 3, Slovenia\r\nfamily 4, Serbia\r\nFamily 5, Bulgaria\r\nFamily 6, Russia (n=5)" "" "no" "France" "" "0" "" "" "" ""
"00266246" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Spain" "" "0" "" "" "" ""
"00266248" "" "" "" "21" "" "03256" "" "At least nine independent pedigrees have been recorded to carry a c.51+1G>A variant\r\nFamily 1, Hungary\r\nFamily 2, Hungary\r\nFamily 3, Italy\r\nFamily 4, Germany (n=3)\r\nFamily 5, (Greece)\r\nFamily 6, India (n=4)\r\nfamilies 7 & 8, Hungary (n=7)\r\nfamily 9, Japan (n=3)" "" "no" "Italy" "" "0" "" "" "" ""
"00266249" "" "" "" "7" "" "03256" "" "Four independent pedigrees have been recorded to carry a c.51+1G>T variant\r\nFamily 1, Japan\r\nFamily 2, Brazil (n=1)\r\nFamily 3, Brazil (n=2)\r\nFamily 4, Russia (n=3)" "" "no" "Japan" "" "0" "" "" "" ""
"00266250" "" "" "" "5" "" "03256" "" "Three independent pedigrees have been reported as carrying the variant c.51+2T>C\r\n-Family 1, Brazil, n=2\r\n-Family 2, Iran, n=1, female patient\r\n-Family 3, Brazil, n=2" "?" "no" "Brazil" "" "0" "" "" "" ""
"00266252" "" "" "" "1" "" "03256" "" "De novo proband" "" "" "Italy" "" "0" "" "" "" ""
"00266253" "" "" "" "3" "" "03256" "{DOI:Miguel Berenguel 2024:10.3389/fimmu.2024.1499415}" "Three independent families are carrying a c.52-2A>G variant\r\nFamily 1, Italy\r\nFamily 2, Russia\r\nFamily 3, Spain, with a de novo affected male individual" "" "no" "Italy" "" "0" "" "" "" ""
"00266271" "" "" "" "10" "" "03256" "" "Six pedigrees have been recorded as carrying a c.550+1G>A variant\r\nFamily 1, Hungary\r\nFamily 2, Bulgaria\r\nFamily 3, France (n=3)\r\nfamily 4, Hungary (n=3)\r\nFamily 5, China\r\nFamily 6, Russia" "" "no" "Hungary" "" "0" "" "" "" ""
"00266272" "" "" "" "11" "" "03256" "" "Five independent pedigrees have been recorded to carry a c.550+2T>C variant\r\nFamily 1, Spain with a de novo proband\r\nFamily 2, Spain\r\nFamily 3, Greece\r\nFamily 4, France\r\nfamily 5, Belarus (n=7)" "" "" "Spain" "" "0" "" "" "" ""
"00266273" "" "" "" "7" "" "03256" "" "Three independent pedigrees have been recorded to carry a c.550+2dupT variant has been recognized as carried by three families\r\nFamily 1, Hungary\r\nFamily 2, Greece\r\nFamily 3, Hungary (n=5)" "" "" "Hungary" "" "0" "" "" "" ""
"00266274" "" "" "" "7" "" "03256" "{DOI:Klausegger 2012:10.1038/bmt.2012.7}" "Four independent pedigrees have been recorded to carry a c.550+5G>C variant\r\nFamilies 1 & 2, Spain (n=5)\r\nFamily 3, Austria, with a 7-year-old boy with Evans Syndrom and concomitant HAE and correction of HAE after BM transplantation\r\nFamily 3, Spain" "" "no" "Spain" "" "0" "" "" "" ""
"00266275" "" "" "" "8" "" "03256" "" "Six independent pedigrees have been recorded to carry a c.550+5G>A variant\r\nFamily 1, Spain\r\nFamily 2, Austria (n=3)\r\nFamily 3, Greece\r\nFamily 4, France\r\nfamily 5, Hungary\r\nfamily 6, Russia" "" "" "Spain" "" "0" "" "" "" ""
"00266276" "" "" "" "1" "" "03256" "" "Single family" "M" "no" "France" "" "0" "" "" "" ""
"00266278" "" "" "" "2" "" "03256" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007}" "Two independent families have been shown as carrying a c.551-5T>A variant\r\nFamily 1, Germany\r\nFamily 2, Italy" "" "no" "Germany" "" "0" "" "" "" ""
"00266279" "" "" "" "2" "" "03256" "" "Single family" "" "no" "Germany" "" "0" "" "" "" ""
"00266280" "" "" "" "21" "" "03256" "" "Eight independent pedigrees have been shown to carry a c.551-2A>G variant\r\nFamilies 1 to 3, Germany (n=4)\r\nFamilies 4 and 5, Czech Republic (n=11)\r\nFamily 6, France with a de novo proband (both parents tested)\r\nFamily 7, Germany (n=1)\r\nFamily 8, France (n=4)" "" "no" "Germany" "" "0" "" "" "" ""
"00266281" "" "" "" "3" "" "03256" "" "Three independent Spanish pedigrees have been recorded to carry a c.551-2del variant\r\nFamilies #1 and #2, Spain, n=2\r\nFamily 3, Italy, n=1" "" "" "Spain" "" "0" "" "" "" ""
"00266282" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Poland" "" "0" "" "" "" ""
"00266283" "" "" "" "4" "" "03256" "{DOI:Guryanova 2021:10.1186/s12948-021-00141-0}" "Two independent pedigrees have been reported to carry a c551-1G>A variant\r\n-Greece, n=2\r\n-Belarus, n=2" "" "" "Greece" "" "0" "" "" "" ""
"00266284" "" "" "" "7" "" "03256" "{DOI:Guryanova 2019:10.29235/1814-6023-2019-16-3-349-356}" "Two independent families have been shown as carrying a c.551-1G>C variant\r\n-Family 1, Japan (n=1)\r\n-Family 2, Belarus (n=6)" "" "no" "Belarus" "" "0" "" "" "Japan" ""
"00266285" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Czech Republic" "" "0" "" "" "" ""
"00266286" "" "" "" "8" "" "03256" "" "Six independent pedigrees have been recorded to carry a c.685+1G>A variant\r\nFamilies 1 and 2, Germany (n=4)\r\nFamily 3, China\r\nFamily 4, The Netherlands\r\nFamily 5, Spain\r\nFamily 6, Brazil" "" "no" "Germany" "" "0" "" "" "" ""
"00266287" "" "" "" "4" "" "03256" "{DOI:Liu 2017:10.1016/j.jfma.2017.04.016}" "Three independent pedigrees have been shown as carrying a c.685+1G>T variant\r\nFamily 1, Italy (n=2)\r\nFamily 2, China\r\nFamily 3, Taiwan" "" "no" "Italy" "" "0" "" "" "" ""
"00266288" "" "" "" "3" "" "03256" "" "Single family" "F" "no" "Spain" "" "0" "" "" "" ""
"00266295" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Italy" "" "0" "" "" "" ""
"00266296" "" "" "" "4" "" "03256" "{DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "Single family" "" "no" "Czech Republic" "" "0" "" "" "" ""
"00266297" "" "" "" "2" "" "03256" "" "Two independent Italian families (2 probands) have been shown as carrying a c.685+31G>A variant" "" "" "Italy" "" "0" "" "" "" ""
"00266298" "" "" "" "12" "" "03256" "" "Six independent pedigrees have been recorded to carry a c.686-12A>G variant\r\nFamily 1, Italy\r\nFamily 2, Serbia\r\nFamily 3, Czech Republic\r\nFamily 4, Spain (2 families, n=6)\r\nFamily 5, Russia (n=3)" "" "no" "Italy" "" "0" "" "" "Serbia, Czech Republic" ""
"00266299" "" "" "" "14" "" "03256" "{DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "Two independent kindreds have been shown to carry a c.305_317del variant\r\n-Families 1 & 2, Czech Republic (n=14)" "" "" "Czech Republic" "" "0" "" "" "" ""
"00266300" "" "" "" "1" "" "03256" "" "" "" "" "Czech Republic" "" "0" "" "" "" ""
"00266301" "" "" "" "3" "" "03256" "{DOI:Grombikirova 2023:10.1007/s10875-023-01565-w}" "Two independent families have been shown as carrying a c.706T>G variant\r\nFamily 1, Czech Republic (n=2)\r\nFamily 2, Russia" "" "no" "Czech Republic" "" "0" "" "" "" ""
"00266302" "" "" "" "5" "" "03256" "" "Three pedigrees have been recorded to carry a c.897G>A variant\r\nFamily 1, Bulgaria\r\nFamily 2, Czech Republic (n=3)\r\nFamily 3, Brazil" "" "" "Czech Republic" "" "0" "" "" "Bulgaria, Brazil" ""
"00266305" "" "" "" "1" "" "03256" "" "" "" "" "Germany" "" "0" "" "" "" ""
"00266306" "" "" "" "5" "" "03256" "{DOI:Seikh 2023:10.1007/s10875-022-01399-y} {DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "Two independent pedigrees have been shown to carry a c.1202T>A variant\r\n-1. Czech republic (n=2). Mother (onset 29y) and daughter (onset 18y) are affected\r\n-2. Saudi Arabia (n=3)" "F" "no" "Czech Republic" "" "0" "" "" "" ""
"00266307" "" "" "" "3" "" "03256" "{DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "Single family" "" "no" "Czech Republic" "" "0" "" "" "" ""
"00266308" "" "" "" "16" "" "03256" "" "Three kindreds have been recorded as carrying a c.686-3C>G variant\r\nFamily 1, Spain (n=3)\r\nFamily 2, Germany (n=1)\r\nFamily 3, Hungary (n=12)" "" "" "Spain" "" "0" "" "" "Germany" ""
"00266309" "" "" "" "2" "" "03256" "" "Single family" "" "no" "Germany" "" "0" "" "" "" ""
"00266310" "" "" "" "1" "" "03256" "{DOI:Roche 2005:10.1002/humu.20197}" "Single family" "" "no" "Spain" "" "0" "" "" "" ""
"00266311" "" "" "" "2" "" "03256" "" "Single family" "" "no" "Korea" "" "0" "" "" "" ""
"00266313" "" "" "" "1" "" "03256" "{DOI:Johnsrud 2015:10.1371/journal. pone.0131637}" "Single family" "" "no" "Norway" "" "0" "" "" "" ""
"00266314" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Italy" "" "0" "" "" "" ""
"00266315" "" "" "" "5" "" "03256" "" "Single family with 5 affected individuals" "" "no" "Greece" "" "0" "" "" "" ""
"00266317" "" "" "" "2" "" "03256" "" "Two independent families have been shownas carrying a c.890-1G>A variant\r\nFamily 1, Japan\r\nFamily 2, Spain (gonosomal mosaicism)" "" "no" "Japan" "" "0" "" "" "" ""
"00266319" "" "" "" "2" "" "03256" "" "Two independent families have been shown as carrying a c.1029+1G>T\r\nFamily 1, United Kingdom\r\nFamily 2, (United States of America)" "" "no" "United Kingdom (Great Britain)" "" "0" "" "" "" ""
"00266320" "" "" "" "9" "" "03256" "" "Five independent pedigrees have been recorded to carry a c.1029+1G>A variant\r\nFamily 1, Germany (n=2)\r\nFamily 2, France (n=3\r\nFamily 3, France (n=1)\r\nFamily 4, Saudi Arabia (n=2)\r\nFamily 4, Estonia" "" "no" "Germany" "" "0" "" "" "" ""
"00266321" "" "" "" "5" "" "03256" "" "A single Danish pedigree with 5 affected individuals" "" "" "Denmark" "" "0" "" "" "" ""
"00266322" "" "" "" "2" "" "03256" "" "A single pedigree with 2 affected individuals carrying a c.1029+3_1029+6del variant" "" "" "Germany" "" "0" "" "" "" ""
"00266323" "" "" "" "1" "" "03256" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007}" "Single family with a symptomatic carrier" "" "no" "Italy" "" "0" "" "" "" ""
"00266324" "" "" "" "1" "" "03256" "" "Single family" "" "no" "(France)" "" "0" "" "" "" ""
"00266325" "" "" "" "1" "" "03256" "" "Single family" "" "no" "(France)" "" "0" "" "" "" ""
"00266328" "" "" "" "58" "" "03256" "{DOI:Ozkars 2019:10.5114/ada.2018.78898} {DOI:Aydoğdu 2024:10.1620/tjem.2023.J083}" "Family 1, an extended distribution of a c.1033G>T variant in a very large family\r\nFamilies 2-5, Turkey (n=16)" "" "no" "Turkey" "" "0" "" "" "" ""
"00266329" "" "" "" "3" "" "03256" "" "Single family with 3 affected individuals" "M" "no" "France" "" "0" "" "" "" ""
"00266331" "" "" "" "3" "" "03256" "" "Three independent pedigrees have been recorded to carry a c.1030-1G>A variant\r\nFamily 1, United Kingdom\r\nFamily 2, Germany\r\nFamily 3, Japan" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "Germany Japan" ""
"00266332" "" "" "" "8" "" "03256" "" "Six independent pedigrees hava been recorded to carry a c.1030-1G>C variant\r\nFamily 1, (France)\r\nFamily 2, Germany (n=2)\r\nFamily 3, Spain\r\nFamily 4, Japan\r\nFamily 5, Germany\r\nFamily 6, Russia (n=2)" "" "" "(France)" "" "0" "" "" "Germany, Spain, Japan" ""
"00266333" "" "" "" "2" "" "03256" "" "Two independent pedigrees have been shown as carrying a c.1030-1del variant\r\nFamily 1, China\r\nFamily 2, Russia" "" "" "China" "" "0" "" "" "" ""
"00266335" "" "" "" "2" "" "03256" "{DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "A single family with 2 affected individuals" "" "no" "Czech Republic" "" "0" "" "" "" ""
"00266336" "" "" "" "8" "" "03256" "" "Family 1, Germany (n=1)\r\nFamily 2, Spain\r\nFamily 3, India (n=2)\r\nFamily 4, Brazil, with a de novo proband\r\nFamily 5, Czech Republic (n=1)\r\nFamily 6, Russia (n=2)" "" "no" "Germany" "" "0" "" "" "Spain, India, Brazil" ""
"00266337" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Spain" "" "0" "" "" "" ""
"00266338" "" "" "" "2" "" "03256" "{DOI:Kawachi 1998:10.1046/j.1523-1747.1998.00170.x}" "Single family" "F" "no" "Japan" "" "0" "" "" "" ""
"00266339" "" "" "" "5" "" "03256" "" "Three independent pedigrees have been recorded to carry a c.1249+4A>G variant, even if it has not been established whether both families from Latvia and Hungary are independent or not\r\nFamily 1, France (n=1)\r\nFamily 2, Latvia (n=2)\r\nFamily 3, Hungaria (n=2)" "F" "" "France" "" "0" "" "" "" ""
"00266340" "" "" "" "6" "" "03256" "" "Four independent pedigrees have been recorded to carry a c.1249+5G>T\r\nFamily 1, Colombia\r\nFamily 2, Czech Republic\r\nfamily 3, France (n=2)\r\nfamily 4, Poland (n=2)" "" "" "Colombia" "" "0" "" "" "" ""
"00266341" "" "" "" "2" "" "03256" "" "Family 1, Italy\r\nFamily 2, Germany" "" "" "Italy" "" "0" "" "" "Germany" ""
"00266342" "" "" "" "1" "" "03256" "" "" "" "" "Korea" "" "0" "" "" "" ""
"00266343" "" "" "" "3" "" "03256" "" "Two independent pedigrees have been recorded to carry a c.1250-13G>A variant\r\nFamily 1, Turkey\r\nFamily 2, Germany (n=2)" "" "" "Turkey" "" "0" "" "" "" ""
"00266344" "" "" "" "8" "" "03256" "" "Three independent pedigrees have been found as carrying a c.1250-2A>G variant\r\nFamily 1, Germany (n=5)\r\nFamily 2, Germany (n=2)\r\nFamily 3, China (n=1)" "" "" "Germany" "" "0" "" "" "" ""
"00266345" "" "" "" "8" "" "03256" "" "Four independent pedigrees have been recorded to carry a c.1250-1G>A variant\r\nFamily 1, Denmark (n=4)\r\nFamily 2, Germany (n=1)\r\nFamily 3, Germany (n=1)\r\nFamily 4, Russia (n=2)" "" "no" "Denmark" "" "0" "" "" "" ""
"00266346" "" "" "" "40" "" "03256" "{DOI:Maia 2019:10.1111/all.13699}" "Three independent Brazilian pedigrees have been recorded to carry a c.351delC variant\r\nFamily 1, Brazil (n=8)\r\nFamily 2, Brazil (n=13)\r\nFamily 3, Brazil (n=19)" "" "no" "Brazil" "" "0" "" "" "" ""
"00266348" "" "" "" "7" "" "03256" "" "Single family" "" "yes" "Turkey" "" "0" "" "" "" ""
"00266359" "" "" "" "3" "" "03256" "" "Three independent pedigrees have been identified by Loules 2018 with the same 1.464-kb deletion encompassing exon4\r\nFamily 1, Germany\r\nFamily 2, Romania\r\nFamily 3, Poland" "" "" "Germany" "" "0" "" "" "" ""
"00266360" "" "" "" "4" "" "03256" "" "Single family" "" "no" "Romania" "" "0" "" "" "" ""
"00266362" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Poland" "" "0" "" "" "" ""
"00266363" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Poland" "" "0" "" "" "" ""
"00266364" "" "" "" "4" "" "03256" "" "Four independent pedigrees have been recorded to carry a long 17,645-kb deletion encompassing exons 1 to 8\r\nFamilies 1 & 2, Spain\r\nFamilies 3 & 4, Greece" "" "" "Spain" "" "0" "" "" "" ""
"00266365" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Spain" "" "0" "" "" "" ""
"00266366" "" "" "" "3" "" "03256" "" "Two independent German kindreds have been found as carrying a deletion of exons 3 to 4\r\nFamily 1, n=1\r\nFamily 2, n=2" "" "" "Germany" "" "0" "" "" "" ""
"00266367" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Romania" "" "0" "" "" "" ""
"00266368" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Romania" "" "0" "" "" "" ""
"00266369" "" "" "" "2" "" "03256" "" "two independent pedigrees have been recorded to carry a c.551-508_685+1214dup variant, with a duplication of exon 4 mapping the same boundaries\r\nFamily 1, Spain\r\nFamily 2, (Greece)" "" "" "Spain" "" "0" "" "" "" ""
"00266370" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Spain" "" "0" "" "" "" ""
"00266371" "" "" "" "1" "" "03256" "" "Single family" "" "no" "" "" "0" "" "" "" ""
"00266372" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Spain" "" "0" "" "" "" ""
"00266373" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Spain" "" "0" "" "" "" ""
"00266374" "" "" "" "1" "" "03256" "" "Single family" "" "no" "" "" "0" "" "" "" ""
"00266375" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Spain" "" "0" "" "" "" ""
"00266376" "" "" "" "1" "" "03256" "" "Single family" "" "no" "" "" "0" "" "" "" ""
"00266377" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Spain" "" "0" "" "" "" ""
"00266379" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00266380" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00266460" "" "" "" "81" "" "03256" "{DOI:Grombikirova 2023:10.1007/s10875-023-01565-w}" "Numerous pedigrees have been recorded as carrying a deletion of exon 4 without identified length and boundaries,\r\nUnited Kingdom\r\nFrance (including 2 de novo probands)\r\nItaly (including 1 de novo proband)\r\nSpain, 2 pedigrees\r\nGermany, 6 pedigrees (16 individuals)\r\nJapan, 6 pedigrees\r\nNorway\r\nDenmark\r\nTurkey, 4 pedigrees\r\nBelarus, with one de novo proband\r\nChina\r\nHungary, 5 pedigrees (9 affected individuals)\r\nCzech Republic, 9 pedigrees (15 affected individuals)" "" "no" "France" "" "0" "" "" "United Kingdom, Italy, Spain, Germany, Japan, Norway, Denmark, Turkey, Belarus" ""
"00266473" "" "" "" "1" "" "03256" "" "Single pedigree" "" "no" "Spain" "" "0" "" "" "" ""
"00266628" "" "" "" "6" "" "03256" "" "Six independent pedigrees have been recognized as carrying a deletion of exon 7 with unknown length and non identified boundaries)\r\nFamily 1, United Kingdom\r\nFamily 2, Spain\r\nFamilies 3 to 6, France with one de novo proband\r\nThese families might differ from distinct boundaries." "" "" "France" "" "0" "" "" "" ""
"00266659" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Spain" "" "0" "" "" "" ""
"00266660" "" "" "" "4" "" "03256" "" "Four pedigrees have been recorded to carry a long deletion encompassing exons 1 and 2\r\nFamily 1, Spain\r\nFamily 2, France\r\nFamily 3, France\r\nFamily 4, China" "" "" "Spain" "" "0" "" "" "" ""
"00266662" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Spain" "" "0" "" "" "" ""
"00266663" "" "" "" "6" "" "03256" "" "Six independent pedigrees have been recorded to carry a long deletion encompassing exons 1 to 4 (unknown length)\r\nFamily 1, France\r\nFamily 2, Norway\r\nFamily 3, France\r\nFamily 4, Spain\r\nFamily 5, Japan\r\nFamily 6, China" "" "no" "France" "" "0" "" "" "Norway, Spain, Japan" ""
"00266664" "" "" "" "3" "" "03256" "" "Three independent pedigrees have been recorded to carry a long (17-kb) deletion encompassing the first 6 exons with an additional flanking 5\' intron 6 sequence\r\nFamilies 1 and 2, France\r\nFamily 3, Germany (n=1)" "" "" "France" "" "0" "" "" "Germany" ""
"00266665" "" "" "" "1" "" "03256" "" "Single family" "" "no" "(United States)" "" "0" "" "" "" ""
"00266666" "" "" "" "1" "" "03256" "{DOI:Pedrosa 2016:10.1007/s10875-015-0222-9}" "Single family" "" "no" "Spain" "" "0" "" "" "" ""
"00266667" "" "" "" "20" "" "03256" "" "Eleven independent pedigrees have been reported as carrying a long deletion encompassing the exons 1 to 8, unknown length\r\nFamily 1, Spain with a probable de novo proband\r\nFamily 2, Italy with a non certified de novo proband\r\nFamily 3, Japan with a de novo proband\r\nFamily 4, France (n=3)\r\nFamily 5, Norway\r\nFamily 6, Spain\r\nFamilies 7 & 8, Japan\r\nFamily 9, Hungary (n=7)\r\nFamilies 10 & 11, Czech republic (n=2)" "" "no" "Spain" "" "0" "" "" "Italy, Japan, France, Norway, Spain, Hungary" ""
"00266668" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Spain" "" "0" "" "" "" ""
"00266670" "" "" "" "1" "" "03256" "" "Single family" "" "no" "(France)" "" "0" "" "" "" ""
"00266671" "" "" "" "3" "" "03256" "" "Three independent pedigrees have been recorded to carry an exon 4 deletion variant with a 1.4-kb deletion\r\nFamily 1 United States\r\nFamily 2, United Kingdom\r\nFamily 3, Denmark" "" "" "" "" "0" "" "" "" ""
"00266672" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Hungary" "" "0" "" "" "" ""
"00266673" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Spain" "" "0" "" "" "" ""
"00267016" "" "" "" "3" "" "03256" "" "Two independent pedigrees have been shown as carrying exon 4 deletion with a 3.2 kb length\r\nFamily 1, France (n=1)\r\nFamily 2, Spain (n=2)" "" "" "France" "" "0" "" "" "" ""
"00267017" "" "" "" "2" "" "03256" "" "two independent pedigrees have been recorded to carry an exon-4 deletion variant with 2.75-kb deletion\r\nFamily 1 Italy\r\nFamily 2, Hungary" "" "" "Italy" "" "0" "" "" "" ""
"00267018" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Hungary" "" "0" "" "" "" ""
"00267019" "" "" "" "1" "" "03256" "" "Single family" "" "no" "France" "" "0" "" "" "" ""
"00267020" "" "" "" "1" "" "03256" "" "Single family" "" "no" "United States" "" "0" "" "" "" ""
"00267021" "" "" "" "3" "" "03256" "" "Single family" "" "no" "France" "" "0" "" "" "" ""
"00267022" "" "" "" "1" "" "03256" "" "" "" "" "Spain" "" "0" "" "" "" ""
"00267023" "" "" "" "12" "" "03256" "{DOI:Banerji 2022:10.1056/NEJMcpc2027087}" "Seven independent pedigrees have been recorded to carry a exons 5_6 deletion variant\r\nFamily 1, Italy including a de novo proband\r\nFamily 2, Germany (n=2)\r\nFamily 3, France including a de novo proband\r\nFamily 4, Japan\r\nFamily 5, Germany (n=1)\r\nFamily 6, USA, possible de novo proband\r\nFamily 7, Turkey (n=5)" "" "" "France" "" "0" "" "" "" ""
"00267024" "" "" "" "2" "" "03256" "{DOI:Xu 2018:10.4168/aair.2018.10.3.285}" "Single family with an affected female compound heterozygous individual for both c.49GG variant\r\nfamily 1, Italy\r\nfamily 2, Denmark" "" "" "Denmark" "" "0" "" "" "" ""
"00269110" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Germany" "" "0" "" "" "" ""
"00269111" "" "" "" "6" "" "03256" "{DOI:Brix 2000:10.1136/bcr-2019-231906}" "Six independent families have been shown as carrying a c.55+5G>T variant" "" "no" "Denmark" "" "0" "" "" "Sweden, Germany, Syria, Saoudi Arabia, USA" ""
"00269113" "" "" "" "1" "" "03256" "" "Single family" "" "no" "France" "" "0" "" "" "" ""
"00269303" "" "" "" "1" "" "03256" "" "" "" "" "United States" "" "0" "" "" "" ""
"00269304" "" "" "" "1" "" "03256" "" "Single family" "" "no" "United States" "" "0" "" "" "" ""
"00269305" "" "" "" "1" "" "03256" "" "" "" "" "United States" "" "0" "" "" "" ""
"00269306" "" "" "" "1" "" "03256" "{DOI:Kaminsky 2011:10.1097/GIM.0b013e31822c79f9}" "" "" "" "United States" "" "0" "" "" "" ""
"00269323" "" "" "" "31" "" "03256" "{DOI:Maaser 2019:10.1371/journal.pone.0205895}" "Exome sequencing identified a total of 17 rare and potentially damaging variants in 17 genes of bipolar disorder Cuban patients; the most promising variant was located in the gene SERPING1." "" "" "Cuba" "" "0" "" "" "" ""
"00275695" "" "" "" "2" "" "03256" "" "" "F" "" "" "" "0" "" "" "" ""
"00275696" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00275697" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00275941" "" "" "" "4" "" "03256" "" "Single family" "" "no" "Greece" "" "0" "" "" "" ""
"00276003" "" "" "" "2" "" "03256" "" "Single family" "" "no" "Brazil" "" "0" "" "" "" ""
"00276112" "" "" "" "27" "" "03256" "{DOI:Hujová 2020:10.1007/s10875-020-00753-2} {DOI:Germenis 2020:10.1007/s10875-020-00887-3} {DOI:Hida 2023:10.1111/1346-8138.16817} {DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "With a probable common ancestor, two pedigrees have been found affected by HAE and carrying a c.1029+384A>G variant\r\n-1. Czech family (n=19), reported by Hujová et al, 2020\r\n-2. Hungarian family (n=4), with a segregation of the variant with HAE phenotype, reported by Germenis et al, 2020, ClinVar submitter accession ID VCV000870445.1\r\nThree additional pedigrees have been shown to carry this deep-intronic variant:\r\n-Family 3, Japan (n=2;mother and daughter)\r\n-Families 4 and 5, Czech republic" "M" "no" "Czech Republic" "" "0" "" "" "Hungary" ""
"00290454" "" "" "" "14" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" ""
"00303167" "" "" "" "12" "" "03256" "{DOI:Mete Gökmen 2020:10.1111/imcb.12362} {DOI:Guryanova 2021:10.1186/s12948-021-00141-0}" "Four independent pedigrees have been reported to carry a c.1202T>C variant\r\nFamily 1, Turkey, n=5, with consanguineous parents, two homozygous carriers and three heterozygous carriers; 1 heterozygous carrier affected\r\nFamily 2, Belarus, n=1 (de novo heterozygous proband)\r\nFamily 3, France n=2 (heterozygous carriers)\r\nFamily 4, Russia n=4 (Armenian roots), variant in cis configuration with c.1477G>C; c.[1202T>C;1477G>C]" "" "yes" "Turkey" "" "0" "" "" "" "FamA"
"00310605" "" "" "" "1" "" "03256" "" "Single family" "M" "no" "Belgium" "" "0" "" "" "" ""
"00311095" "" "" "" "1" "" "03256" "" "Report of a single male patient presenting a HAE type I phenotype with onset at 47 years old" "M" "no" "Iran" "" "0" "" "" "" ""
"00311096" "" "" "" "1" "" "03256" "{DOI:Nabilou 2020:10.1080/08820139.2020.1817068}" "Single family" "M" "?" "Iran" "" "0" "" "" "" ""
"00311191" "" "" "" "3" "" "03256" "" "Three independent kindreds have been shown to carry a c.650del variant\r\n-Families 1 & 2, Iran with two probands, one female and one male\r\n-Family 3, Czech republic (n=1)" "" "no" "Iran" "" "0" "" "" "" ""
"00311379" "" "" "" "1" "" "03256" "{DOI:Nabilou 2020:10.1080/08820139.2020.1817068}" "Pedigree with a female proband who was presenting with a HAE onset at 3 years old" "F" "" "Iran" "" "0" "" "" "" ""
"00313943" "" "" "" "1" "" "03256" "" "" "" "" "Kuwait" "" "0" "" "" "" ""
"00314648" "" "" "" "1" "" "03256" "{DOI:López-Lera 2011:10.1016/j.molimm.2011.07.010}" "Single family" "" "no" "Spain" "" "0" "" "" "" ""
"00320369" "" "" "" "1" "" "03256" "" "Single family" "M" "no" "India" "" "0" "" "" "" ""
"00320370" "" "" "" "2" "" "03256" "" "Single family" "F" "no" "India" "" "0" "" "" "" ""
"00320372" "" "" "" "2" "" "03256" "" "Single family" "M" "no" "India" "" "0" "" "" "" ""
"00320373" "" "" "" "4" "" "03256" "{DOI:Grombikirova 2023:10.1007/s10875-023-01565-w}" "Two independent kindreds have been shown as carrying a c.1046T>C variant\r\nFamily 1, India (n=2)\r\nFamily 2, Czech Republic (n=2)" "M" "no" "India" "" "0" "" "" "" ""
"00320374" "" "" "" "2" "" "03256" "" "Two independent pedigrees have been reported as carrying a c.1284T>A variant\r\nFamily 1, India\r\nfamily 2, Japan" "F" "no" "India" "" "0" "" "" "Japan" ""
"00320429" "" "" "" "3" "" "03256" "" "" "F" "?" "India" "" "0" "" "" "" ""
"00320430" "" "" "" "2" "" "03256" "" "Single family" "F" "no" "India" "" "0" "" "" "" ""
"00320431" "" "" "" "10" "" "03256" "" "Six likely independent pedigrees have been recorded as carrying a c.686-1G>T variant\r\nFamily 1, USA, submitter UCSD see ClinVar ID\r\nFamily 2, Japan\r\nFamily 3, Brazil\r\nFamily 4, China\r\nFamily 5, China\r\nFamily 6, Russia (n=5)" "?" "no" "United States" "" "0" "" "" "Japan, Brazil, China, Russia" ""
"00320446" "" "" "" "1" "" "03256" "" "" "" "" "Hungary" "" "0" "" "" "" ""
"00324138" "" "" "" "3" "" "03256" "" "Two independent families have been found to carry a c.44del variant\r\nFamily 1, China (n=2)\r\nFamily 2, Russia" "F" "" "China" "" "0" "" "" "" ""
"00324139" "" "" "" "3" "" "03256" "" "Two independent pedigrees have been shown to carry a c.538C>T variant\r\nFamily 1, China\r\nFamily 2, China (n=2)" "M" "" "China" "" "0" "" "" "" ""
"00324141" "" "" "" "1" "" "03256" "" "Single family" "M" "no" "China" "" "0" "" "" "" ""
"00324143" "" "" "" "1" "" "03256" "" "Single family" "M" "no" "China" "" "0" "" "" "" ""
"00324144" "" "" "" "1" "" "03256" "" "Single family" "F" "no" "China" "" "0" "" "" "" ""
"00324294" "" "" "" "1" "" "03256" "" "Observation introduced in ClinVar by UCSD; probably related to the Brazilian family" "?" "" "United States" "" "0" "" "" "Brazil" ""
"00324295" "" "" "" "1" "" "03256" "" "Variant confirmed to be a de novo variant after both\r\nproband’s parents were screened\r\nObservation introduced in ClinVar by UCSD; probably related to the Brazilian family" "?" "no" "United States" "" "0" "" "" "Brazil" ""
"00324296" "" "" "" "1" "" "03256" "{DOI:Veronez 2021:10.1016/j.jaip.2020.11.039}" "Observation introduced in ClinVar by UCSD; probably related to the Brazilian family" "?" "" "Brazil" "" "0" "" "" "" ""
"00324297" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00324298" "" "" "" "1" "" "03256" "" "" "" "" "(United States)" "" "0" "" "" "" ""
"00324299" "" "" "" "1" "" "03256" "" "" "" "" "Germany" "" "0" "" "" "" ""
"00324386" "" "" "" "1" "" "03256" "" "" "-" "" "" "" "0" "" "" "" ""
"00324395" "" "" "" "1" "" "03256" "" "" "?" "" "" "" "0" "" "" "" ""
"00327484" "" "" "" "1" "" "03256" "{DOI:Obtulowicz 2020:10.5114/ceji.2020.101252}" "Single family" "M" "no" "Poland" "" "0" "" "" "" ""
"00327486" "" "" "" "5" "" "03256" "{DOI:Obtulowicz 2020:10.5114/ceji.2020.101252}" "Three families have been recorded to carry the c.178del variant\r\nFamily 1, France (n=1)\r\nFamily 2, Poland (n=3)\r\nFamily 3, United States of America (n=1)" "" "no" "Poland" "" "0" "" "" "" ""
"00327487" "" "" "" "1" "" "03256" "" "Single family" "F" "no" "Poland" "" "0" "" "" "" ""
"00328547" "" "" "" "2" "" "03256" "{DOI:Obtulowicz 2020:10.5114/ceji.2020.101252}" "Single family" "F" "no" "Poland" "" "0" "" "" "" ""
"00328548" "" "" "" "1" "" "03256" "{DOI:Obtulowicz 2020:10.5114/ceji.2020.101252}" "Single family" "F" "no" "Poland" "" "0" "" "" "" ""
"00329010" "" "" "" "1" "" "03256" "{DOI:Obtulowicz 2020:10.5114/ceji.2020.101252}" "Single family" "F" "no" "Poland" "" "0" "" "" "" ""
"00329011" "" "" "" "3" "" "03256" "{DOI:Obtulowicz 2020:10.5114/ceji.2020.101252}" "Two independent families have been shown as carrying a c.622C>T variant\r\n-Family 1, Poland\r\n-Family 2, Russia (n=2)" "F" "no" "Poland" "" "0" "" "" "" ""
"00329133" "" "" "" "1" "" "03256" "{DOI:Obtulowicz 2020:10.5114/ceji.2020.101252}" "Single family" "F" "no" "Poland" "" "0" "" "" "" ""
"00329134" "" "" "" "2" "" "03256" "{DOI:Obtulowicz 2020:10.5114/ceji.2020.101252}" "Two independent pedigrees have been recorded as carrying a c.990C>G variant\r\nFamily 1, described in France by Pasteur Institute\r\nFamily 2, Poland" "F" "" "France" "" "0" "" "" "Poland" ""
"00329169" "" "" "" "1" "" "03256" "{DOI:Obtulowicz 2020:10.5114/ceji.2020.101252}" "Single family" "F" "no" "Poland" "" "0" "" "" "" ""
"00331237" "" "" "" "5" "" "03256" "{DOI:Obtulowicz 2020:10.5114/ceji.2020.101252}" "Two independent kindreds have been shown as carrying a duplication of exon 5 to exon 6\r\nFamily 1, Poland (n=4)\r\nFamily 2, Czech Republic (n=1)" "" "no" "Poland" "" "0" "" "" "" ""
"00331238" "" "" "" "4" "" "03256" "{DOI:Obtulowicz 2020:10.5114/ceji.2020.101252}" "Two independent pedigrees have been shown as carrying an exon 8 deletion\r\n-Family 1, Poland (n=2)\r\n-Family 2, Slovakia (n=2)" "" "no" "Poland" "" "0" "" "" "" ""
"00331602" "" "" "" "2" "" "03256" "" "One patient and one relative" "" "" "Spain" "" "0" "" "" "" ""
"00332426" "" "" "" "2" "" "03256" "{DOI:Loli‐Ausejo 2021:10.1007/s12016-021-08834-9}" "Single family" "" "no" "Spain" "" "0" "" "" "" ""
"00332550" "" "" "" "1" "" "03256" "{DOI:Loli‐Ausejo 2021:10.1007/s12016-021-08834-9}" "" "" "" "Spain" "" "0" "" "" "" ""
"00332551" "" "" "" "1" "" "03256" "{DOI:Loli-Ausejo 2021:10.1007/s12016-021-08834-9}" "" "" "" "Spain" "" "0" "" "" "" ""
"00359618" "" "" "" "2" "" "03256" "{DOI:Loules 2020:10.3390/jcm911340}" "" "F" "" "Hungary" "" "0" "" "" "" ""
"00361729" "" "" "" "1" "" "03256" "{DOI:Guryanova 2021:10.1186/s12948-021-00141-0}" "Single family" "" "no" "Belarus" "" "0" "" "" "" ""
"00361731" "" "" "" "2" "" "03256" "{DOI:Guryanova 2021:10.1186/s12948-021-00141-0}" "Single family" "" "no" "Belarus" "" "0" "" "" "" ""
"00361732" "" "" "" "3" "" "03256" "" "Single family" "" "no" "Belarus" "" "0" "" "" "" ""
"00361733" "" "" "" "4" "" "03256" "{DOI:Guryanova 2021:10.1186/s12948-021-00141-0} {DOI:Wang 2022:10.1186/s41065-022-00242-z}" "Two independent pedigrees have been shown to carry a c.744_745del variant\r\nFamily 1, Belarus (n=2)\r\nFamily 2, China (n=2)" "" "" "Belarus" "" "0" "" "" "" ""
"00361734" "" "" "" "2" "" "03256" "{DOI:Guryanova 2021:10.1186/s12948-021-00141-0}" "Two families have been found as carrying a c.1001C>A variant\r\nFamily 1, Belarus with a family HAE history\r\nFamily 2, Russia with an unknown family HAE history" "F" "no" "Belarus" "" "0" "" "" "" ""
"00361746" "" "" "" "1" "" "03256" "{DOI:Guryanova 2021:10.1186/s12948-021-00141-0}" "Single family" "" "no" "Belarus" "" "0" "" "" "" ""
"00361747" "" "" "" "6" "" "03256" "{DOI:Guryanova 2021:10.1186/s12948-021-00141-0}" "Two independent families have been shown as carrying a c.1293del variant\r\nFamily 1, Belarus (n=5)\r\nFamily 2, Russia" "" "no" "Belarus" "" "0" "" "" "" ""
"00361762" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00361763" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00361767" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00361768" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00361769" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00361771" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00361772" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00361773" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00361774" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00361776" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00361777" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00361803" "" "" "" "12" "" "03256" "{DOI:Bork 2020:10.1111/ddg.14036}" "One family with compound heterozygous individuals and 12 affected patients" "" "" "Germany" "" "0" "" "" "" ""
"00361891" "" "" "" "1" "" "03256" "" "" "" "no" "United States" "" "0" "" "" "" ""
"00361892" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00361910" "" "" "" "1" "" "03256" "{DOI:Veronez 2021:10.1016/j.jaip.2020.11.039}" "Single family" "" "no" "Brazil" "" "0" "" "" "" ""
"00361911" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00361912" "" "" "" "2" "" "03256" "{DOI:Veronez 2021:10.1016/j.jaip.2020.11.039}" "Two likely independent pedigrees have been recorded\r\n-United States, submitted by UCSD, see ClinVar ID\r\n-Brazil, with a de novo proband, see Veronez 2021" "" "no" "United States" "" "0" "" "" "Brazil" ""
"00362032" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00362033" "" "" "" "1" "" "03256" "{DOI:Vatsiou 2020:10.1016/j.alit.2019.12.009}" "" "" "" "" "" "0" "" "" "" ""
"00362034" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00362035" "" "" "" "1" "" "03256" "" "Single family" "" "no" "United States" "" "0" "" "" "" ""
"00362036" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00363484" "" "" "" "1" "" "03256" "" "SARSCoV2-SERPING1 gene interactions: meta-analysis of a computational study" "-" "" "" "" "0" "" "" "" ""
"00363485" "" "" "" "1" "" "03256" "{DOI:Holcomb 2021:10.1371/journal.pcbi.1008805\r\n}" "SARSCoV2-SERPING1 gene interactions: meta-analysis of a computational study" "-" "" "" "" "0" "" "" "" ""
"00363486" "" "" "" "1" "" "03256" "{DOI:Holcomb 2021:10.1371/journal.pcbi.1008805\r\n}" "SARSCoV2-SERPING1 gene interactions: analysis and meta-analysis of a computational study" "-" "" "" "" "0" "" "" "" ""
"00363487" "" "" "" "1" "" "03256" "{DOI:Holcomb 2021:10.1371/journal.pcbi.1008805\r\n}" "SARSCoV2-SERPING1 gene interactions: meta-analysis of a computational study" "-" "" "" "" "0" "" "" "" ""
"00363493" "" "" "" "1" "" "03256" "{DOI:Holcomb 2021:10.1371/journal.pcbi.1008805}" "SARSCoV2-SERPING1 gene interactions: a meta-analysis" "-" "" "" "" "0" "" "" "" ""
"00363494" "" "" "" "1" "" "03256" "{DOI:Holcomb 2021:10.1371/journal.pcbi.1008805}" "SARSCoV2-SERPING1 gene interactions: data from a meta-analysis" "-" "" "" "" "0" "" "" "" ""
"00363495" "" "" "" "1" "" "03256" "{DOI:Holcomb 2021:10.1371/journal.pcbi.1008805}" "" "-" "" "" "" "0" "" "" "" ""
"00363496" "" "" "" "1" "" "03256" "{DOI:Holcomb 2021:10.1371/journal.pcbi.1008805}" "SARSCoV2-SERPING1 gene interactions: a meta-analysis" "-" "" "" "" "0" "" "" "" ""
"00363497" "" "" "" "1" "" "03256" "{DOI:Holcomb 2021:10.1371/journal.pcbi.1008805}" "SARSCoV2-SERPING1 gene interactions: an analysis" "-" "" "" "" "0" "" "" "" ""
"00363498" "" "" "" "1" "" "03256" "{DOI:Holcomb 2021:10.1371/journal.pcbi.1008805}" "" "-" "" "" "" "0" "" "" "" ""
"00363762" "" "" "" "1" "" "03256" "{DOI:Holcomb 2021:10.1371/journal.pcbi.1008805 }" "SARSCoV2-SERPING1 gene interactions: an analysis" "-" "" "" "" "0" "" "" "" ""
"00363763" "" "" "" "1" "" "03256" "{DOI:Holcomb 2021:10.1371/journal.pcbi.1008805}" "SARSCoV2-SERPING1 gene interactions: an analysis" "-" "" "" "" "0" "" "" "" ""
"00373797" "" "" "" "1" "" "03256" "" "" "" "no" "United States" "" "0" "" "" "" ""
"00376134" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00376136" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00379688" "" "" "" "1" "" "03256" "{DOI:Hashimura 2021:10.1111/all.15034}" "" "" "" "Japan" "" "0" "" "" "" ""
"00379691" "" "" "" "1" "" "03256" "{DOI:Hashimura 2021:10.1111/all.15034}" "A single Japanese family" "" "no" "Japan" "" "0" "" "" "" ""
"00379692" "" "" "" "1" "" "03256" "" "" "" "" "Japan" "" "0" "" "" "" ""
"00379693" "" "" "" "1" "" "03256" "" "" "" "" "Japan" "" "0" "" "" "" ""
"00379694" "" "" "" "1" "" "03256" "" "" "" "" "Japan" "" "0" "" "" "" ""
"00379695" "" "" "" "1" "" "03256" "" "" "" "" "Japan" "" "0" "" "" "" ""
"00379696" "" "" "" "1" "" "03256" "" "" "" "" "Japan" "" "0" "" "" "" ""
"00379697" "" "" "" "1" "" "03256" "{DOI:Hashimura 2021:10.1111/all.15034}" "Single Japanese family" "" "no" "Japan" "" "0" "" "" "" ""
"00379698" "" "" "" "1" "" "03256" "" "" "" "" "Japan" "" "0" "" "" "" ""
"00379722" "" "" "" "1" "" "03256" "" "" "" "" "Japan" "" "0" "" "" "" ""
"00379723" "" "" "" "1" "" "03256" "" "" "" "no" "Japan" "" "0" "" "" "" ""
"00379724" "" "" "" "9" "" "03256" "" "Nine independent pedigrees have been recorded as carrying a c.820A>G variant\r\nFamily 1, United States of America\r\nFamily 2 and 3, Italy\r\nFamilies 4 to 7, Japan\r\nFamily 8, Russia, North Ossetia\r\nFamily 9, China" "" "no" "United States" "" "0" "" "" "Italy, Japan" ""
"00379725" "" "" "" "1" "" "03256" "{DOI:Hashimura 2021:10.1111/all.15034}" "Single Japanese family" "" "no" "Japan" "" "0" "" "" "" ""
"00379726" "" "" "" "2" "" "03256" "" "Two independent Japanese pedigrees have been recorded as carrying a c.965T>G variant" "" "" "Japan" "" "0" "" "" "" ""
"00379727" "" "" "" "2" "" "03256" "" "Two independent pedigrees have been shown as carrying a c.1030-2A>G variant\r\nFamily 1, Japan\r\nFamily 2, China" "" "" "Japan" "" "0" "" "" "" ""
"00379728" "" "" "" "1" "" "03256" "" "" "" "" "Japan" "" "0" "" "" "" ""
"00379730" "" "" "" "3" "" "03256" "" "Three independent pedigrees have been shown as carrying a c.1157_1158del variant\r\nFamilies 1 & 2, Japan\r\nFamily 3, China" "" "no" "Japan" "" "0" "" "" "" ""
"00379731" "" "" "" "3" "" "03256" "" "Three independent Japanese pedigrees have been reported as carrying a c.1184_1185del variant" "" "" "Japan" "" "0" "" "" "" ""
"00379732" "" "" "" "2" "" "03256" "" "Two independent Japanese kindreds have been reported as carrying a c.1219C>T variant" "" "no" "Japan" "" "0" "" "" "" ""
"00379733" "" "" "" "1" "" "03256" "{DOI:Hashimura 2021:10.1111/all.15034}" "Single Japanese family" "" "no" "Japan" "" "0" "" "" "" ""
"00379734" "" "" "" "2" "" "03256" "" "Two independent Japanese kindreds have been reported as carrying a c.1396del variant" "" "" "Japan" "" "0" "" "" "" ""
"00379735" "" "" "" "1" "" "03256" "" "" "" "" "Japan" "" "0" "" "" "" ""
"00379736" "" "" "" "1" "" "03256" "{DOI:Hashimura 2021:10.1111/all.15034}" "A single Japanese family" "" "no" "Japan" "" "0" "" "" "" ""
"00379737" "" "" "" "1" "" "03256" "{DOI:Hashimura 2021:10.1111/all.15034}" "Single Japanese family" "" "no" "Japan" "" "0" "" "" "" ""
"00379738" "" "" "" "1" "" "03256" "" "" "" "no" "Japan" "" "0" "" "" "" ""
"00379739" "" "" "" "1" "" "03256" "{DOI:Hashimura 2021:10.1111/all.15034}" "A single Japanese family" "" "no" "Japan" "" "0" "" "" "" ""
"00379740" "" "" "" "13" "" "03256" "" "Eight kindreds have been reported as to carry a c.5C>T variant\r\nFamilies 1 & 2, Germany, with 4 affected individuals carrying c.5C>T \r\nFamily 3, France, a single affected individual presenting with a HAE type I phenotype\r\nFamily 4, France, with 2 affected compound heterozygous individuals c.[5C>T(;)1045C>T]\r\nFamily 5, Denmark, with an individual carrying a c.5C>T variant associated with anti-C1INH antibody\r\nFamily 6, Iran, with 2 male patients affected presenting a HAE type I phenotype\r\nFamily 7, Belarus, with a single affected female individual, who manifested HAE at the age of 10, skin and abdominal attacks 5 times a year. HAE type not documented.\r\nFamily 8, Turkey (n=2) with a female patient suffering since 2.5 years old (moderate) and a male individual since 10 years old from laryngeal attacks." "" "no" "Germany" "" "0" "" "" "France, Denmark, Iran, Belarus, Turkey" ""
"00379741" "" "" "" "3" "" "03256" "" "" "" "" "Turkey" "" "0" "" "" "" ""
"00379742" "" "" "" "1" "" "03256" "" "" "" "" "France" "" "0" "" "" "" ""
"00380169" "" "" "" "3" "" "03256" "{DOI:Shukla 2020:10.1177/0961203320935980}" "An Indian family with two children (elder son and younger daughter) diagnosed with juvenile-onset systemic lupus erythematosus (SLE) and the father diagnosed with HAE." "" "no" "India" "" "0" "" "" "" ""
"00382959" "" "" "" "1" "" "03256" "{DOI:Veronez 2021:10.1016/j.jaip.2020.11.039}" "Assumed de novo proband" "" "no" "Brazil" "" "0" "" "" "" ""
"00384555" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00384558" "" "" "" "1" "" "03256" "" "" "-" "" "" "" "0" "" "" "" ""
"00384607" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Germany" "" "0" "" "" "" ""
"00384608" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Germany" "" "0" "" "" "" ""
"00384609" "" "" "" "2" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00387358" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00387369" "" "" "" "1" "" "03256" "{DOI:Vatsiou 2020:10.1016/j.alit.2019.12.009}" "" "" "" "(Greece)" "" "0" "" "" "" ""
"00387408" "" "" "" "1" "" "03256" "" "" "" "" "(Germany)" "" "0" "" "" "" ""
"00387409" "" "" "" "1" "" "03256" "" "" "" "" "(Greece)" "" "0" "" "" "" ""
"00391496" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00392764" "" "" "" "6" "" "03256" "" "Recurrent variant, shown to be carried by multiple families\r\nFamily 1, Spain (n=3)\r\nFamily 2, China (n=2)\r\nFamily 3,Russia" "" "" "Spain" "" "0" "" "" "" ""
"00398236" "" "" "" "3" "" "03256" "" "Single family with 3 affected female patients" "" "no" "Spain" "" "0" "" "" "" ""
"00398651" "" "" "" "2" "" "03256" "{DOI:Ebo 2018:10.1016/j.jaip.2017.07.002}" "Single family with parental disomy" "F" "no" "Belgium" "" "0" "" "" "" ""
"00402847" "" "" "" "3" "" "03256" "" "Single family" "" "no" "Taiwan" "" "0" "" "" "" ""
"00404859" "" "" "" "1" "" "03256" "{DOI:Beken 2022:10.1111/pai.13747}" "Co-existence of HAE and familial mediterranean fever" "F" "no" "Turkey" "" "0" "" "" "" ""
"00405454" "" "" "" "9" "" "03256" "{DOI:Szabó 2022:10.3389/falgy.2022.836465}" "Hungarian pedigree with 9 affected individuals" "" "no" "Hungary" "" "0" "" "" "" ""
"00405459" "" "" "" "2" "" "03256" "{DOI:Szabó 2022:10.3389/falgy.2022.836465}" "Hungarian pedigree with 2 affected individuals" "" "no" "Hungary" "" "0" "" "" "" ""
"00405460" "" "" "" "3" "" "03256" "" "Single family with 3 affected individuals" "F" "no" "Hungary" "" "0" "" "" "" ""
"00405461" "" "" "" "1" "" "03256" "{DOI:Szabó 2022:10.3389/falgy.2022.836465}" "" "" "no" "Hungary" "" "0" "" "" "" ""
"00405462" "" "" "" "1" "" "03256" "{DOI:Szabó 2022:10.3389/falgy.2022.836465}" "Variant detected in a patient without available\r\nfamily members" "" "?" "Hungary" "" "0" "" "" "" ""
"00405803" "" "" "" "6" "" "03256" "{DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "Two independent families have been shown as carrying a c.685+1del variant\r\nFamily 1, Csech Republic (n=4)\r\nFamily 2, Russia (n=2)" "" "no" "Czech Republic" "" "0" "" "" "" ""
"00406680" "" "" "" "1" "" "03256" "" "Single family" "" "no" "United States" "" "0" "" "" "" ""
"00406730" "" "" "" "1" "" "03256" "" "" "" "" "(Italy)" "" "0" "" "" "" ""
"00406731" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00406732" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00406735" "" "" "" "2" "" "03256" "" "At least two families have been shown as carrying a c.1429T>C variant\r\nFamily 1, United States\r\nFamily 2, Russia" "" "no" "(United States)" "" "0" "" "" "" ""
"00408782" "" "" "" "1" "" "03256" "{DOI:Xu 2020:10.1186/s13601-020-00360-9}" "Single family" "F" "no" "China" "" "0" "" "" "" ""
"00416999" "" "" "" "2" "" "03256" "" "A Chinese family with 2 affected individuals has been described to carry a c.49G>A variant" "" "" "China" "" "0" "" "" "" ""
"00417001" "" "" "" "1" "" "03256" "" "An affected individual in a Chinese family is carrying a c.74del variant" "" "" "China" "" "0" "" "" "" ""
"00417002" "" "" "" "1" "" "03256" "" "A single affected individual in a Chinese family is found as carrier of a c.100C>A variant" "" "" "China" "" "0" "" "" "" ""
"00417004" "" "" "" "1" "" "03256" "" "A single affected individual in a Chinese family is carrying a c.172_181del variant" "" "" "China" "" "0" "" "" "" ""
"00417007" "" "" "" "1" "" "03256" "" "A single affected individual in a Chinese family is carrying a c.197dup variant" "" "" "China" "" "0" "" "" "" ""
"00417246" "" "" "" "1" "" "03256" "" "A single affected individual in a Chinese family is carrying a c.229A > T variant" "" "no" "China" "" "0" "" "" "" ""
"00417247" "" "" "" "1" "" "03256" "" "A single affected individual in a Chinese family has been found as carrying a c.232del variant" "" "" "China" "" "0" "" "" "" ""
"00417248" "" "" "" "1" "" "03256" "" "A single affected individual in a chinese family is carrying a c.377del variant" "" "no" "China" "" "0" "" "" "" ""
"00417249" "" "" "" "2" "" "03256" "" "Two independent pedigrees have been shown as carrying a c.550+1G>T variant\r\n-1. China, 1 individual\r\n-2. Saudi Arabia, 1 individual" "" "no" "China" "" "0" "" "" "" ""
"00417251" "" "" "" "1" "" "03256" "" "A single affected individual in a Chinese family has been shown to carry a c.623dup variant" "" "no" "China" "" "0" "" "" "" ""
"00417252" "" "" "" "1" "" "03256" "" "A single affected individual in a Chinese family has been shown to carry a c.635dup variant" "" "no" "China" "" "0" "" "" "" ""
"00417253" "" "" "" "1" "" "03256" "" "A single affected individual in a Chinese family has been shown as carrying a c.673_675del variant" "" "no" "China" "" "0" "" "" "" ""
"00417286" "" "" "" "9" "" "03256" "{DOI:Wang 2022:10.1186/s41065-022-00242-z} {DOI:Jiang 2024:10.1186/s13023-024-03306-7}" "Two independent Chinese families shown as carrying a c.708T>G variant\r\n-Family 1 (n=1)\r\n-Family 2 (n=8)" "" "no" "China" "" "0" "" "" "" ""
"00417287" "" "" "" "1" "" "03256" "" "A single affected individual in a Chinese family is shown to carry a c.733_736dup variant" "" "" "China" "" "0" "" "" "" ""
"00417288" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00417289" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00417290" "" "" "" "1" "" "03256" "" "" "" "" "China" "" "0" "" "" "" ""
"00417291" "" "" "" "1" "" "03256" "" "A single affected individual in a Chinese family has been shown to carry a c.779dup variant" "" "" "China" "" "0" "" "" "" ""
"00417292" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00417293" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00417294" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00417295" "" "" "" "1" "" "03256" "" "A single affected individual has been shown as carrying a c.785dup variant" "" "no" "China" "" "0" "" "" "" ""
"00417296" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00417297" "" "" "" "1" "" "03256" "" "" "" "no" "China" "" "0" "" "" "" ""
"00417329" "" "" "" "1" "" "03256" "" "A single affected individual in a Chinese family is shown to carry a c.951dup variant" "" "no" "China" "" "0" "" "" "" ""
"00417330" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00417331" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00417332" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00417333" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00417335" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00417336" "" "" "" "1" "" "03256" "" "" "" "no" "China" "" "0" "" "" "" ""
"00417337" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00417338" "" "" "" "1" "" "03256" "" "" "?" "" "" "" "0" "" "" "" ""
"00417339" "" "" "" "1" "" "03256" "" "" "" "no" "Italy" "" "0" "" "" "" ""
"00417340" "" "" "" "1" "" "03256" "" "A single affected individual in a Chinese family has been shown as carrying a c.1019del variant" "" "no" "China" "" "0" "" "" "" ""
"00417341" "" "" "" "2" "" "03256" "" "Two affected individuals in a Chinese family have been shown as carrying a c.1051del variant" "" "no" "China" "" "0" "" "" "" ""
"00417342" "" "" "" "1" "" "03256" "" "" "?" "" "" "" "0" "" "" "" ""
"00417343" "" "" "" "1" "" "03256" "" "" "" "" "Italy" "" "0" "" "" "" ""
"00417344" "" "" "" "3" "" "03256" "{DOI:Jiang 2025:10.22541/au.176675056.63979689/v1}" "Two independent Chinese families\r\n-family 1 (n=2)\r\n-family 2 (n=1)" "" "no" "China" "" "0" "" "" "" ""
"00417345" "" "" "" "1" "" "03256" "" "A single affected individual in a Chinese family is shown as carrying a c.1100T>G variant" "" "no" "China" "" "0" "" "" "" ""
"00417346" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00417347" "" "" "" "1" "" "03256" "" "" "" "no" "China" "" "0" "" "" "" ""
"00417348" "" "" "" "1" "" "03256" "" "" "" "" "China" "" "0" "" "" "" ""
"00417349" "" "" "" "1" "" "03256" "" "" "" "" "China" "" "0" "" "" "" ""
"00417350" "" "" "" "2" "" "03256" "{DOI:Grombirikova 2013:10.1007/s10875-023-01565-w}" "Two independent kindreds have been shown to carry a c.1249+2T>C variant\r\n-Family 1, China (n=1)\r\n-Family 2, Czech Republic (n=1)" "" "" "China" "" "0" "" "" "" ""
"00417351" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00417429" "" "" "" "1" "" "03256" "" "" "" "no" "China" "" "0" "" "" "" ""
"00417431" "" "" "" "1" "" "03256" "" "" "" "no" "China" "" "0" "" "" "" ""
"00417434" "" "" "" "1" "" "03256" "" "" "" "no" "China" "" "0" "" "" "" ""
"00417436" "" "" "" "1" "" "03256" "" "" "" "no" "China" "" "0" "" "" "" ""
"00417437" "" "" "" "1" "" "03256" "" "" "" "no" "China" "" "0" "" "" "" ""
"00417438" "" "" "" "1" "" "03256" "" "" "" "no" "China" "" "0" "" "" "" ""
"00417439" "" "" "" "1" "" "03256" "{DOI:Wang 2022:10.1186/s41065-022-00242-z}" "A single Chinese family" "" "no" "China" "" "0" "" "" "" ""
"00417440" "" "" "" "1" "" "03256" "" "" "" "no" "China" "" "0" "" "" "" ""
"00417865" "" "" "" "3" "" "03256" "{DOI:Wang 2022:10.1186/s41065-022-00242-z}" "Combined variants c.1192C>G;c.1424A>C are carried by Chinese family with 3 affected individuals" "" "no" "China" "" "0" "" "" "" ""
"00423227" "" "" "" "10" "" "03256" "{DOI:Sheikh 2022:10.1007/s10875-022-01399-y}" "Single family" "" "no" "Saudi Arabia" "" "0" "" "" "" ""
"00423228" "" "" "" "1" "" "03256" "{DOI:Sheikh 2023:10.1007/s10875-022-01399-y}" "" "F" "" "Saudi Arabia" "" "0" "" "" "" ""
"00423229" "" "" "" "1" "" "03256" "{DOI:Sheikh 2023:10.1007/s10875-022-01399-y}" "" "F" "" "Saudi Arabia" "" "0" "" "" "" ""
"00423230" "" "" "" "1" "" "03256" "{DOI:Sheikh 2023:10.1007/s10875-022-01399-y}" "" "F" "" "Saudi Arabia" "" "0" "" "" "" ""
"00423231" "" "" "" "1" "" "03256" "{DOI:Sheikh 2023:10.1007/s10875-022-01399-y}" "" "" "" "Saudi Arabia" "" "0" "" "" "" ""
"00424788" "" "" "" "1" "" "03256" "" "" "" "" "Hungary" "" "0" "" "" "" ""
"00424789" "" "" "" "1" "" "03256" "{DOI:Szabo 2022:10.3389/falgy.2022.836465}" "" "" "no" "Hungary" "" "0" "" "" "" ""
"00424942" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00425007" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00425008" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00425009" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00425760" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00425770" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00425779" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00425797" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00425798" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00425799" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00426385" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00426386" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00426387" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00426388" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00426389" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00426390" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00426391" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00426392" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00426393" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00427666" "" "" "" "3" "" "03256" "{DOI:Takimoto-Ito 2021:10.1002/cia2.12161}" "Single family" "F" "no" "Japan" "" "0" "" "" "" ""
"00427833" "" "" "" "1" "" "03256" "" "" "?" "" "" "" "0" "" "" "" ""
"00428376" "" "" "" "1" "" "03256" "" "" "F" "" "United States" "" "0" "" "" "" ""
"00428377" "" "" "" "1" "" "03256" "{DOI:Ren 2023:10.1016/j.jaci.2022.11.027}" "Single observation" "F" "no" "United States" "" "0" "" "" "" ""
"00428403" "" "" "" "1" "" "03256" "{DOI:Ren 2023:10.1016/j.jaci.2022.11.027}" "A compound heterozygous male carrier as proband" "M" "no" "United States" "" "0" "" "" "" ""
"00428404" "" "" "" "1" "" "03256" "{DOI:Ren 2023:10.1016/j.jaci.2022.11.027}" "Single family" "F" "no" "United States" "" "0" "" "" "" ""
"00428405" "" "" "" "3" "" "03256" "{DOI:Ren 2023:10.1016/j.jaci.2022.11.027}" "Single family" "" "no" "United States" "" "0" "" "" "" ""
"00428406" "" "" "" "1" "" "03256" "{DOI:Ren 2023:10.1016/j.jaci.2022.11.027}" "Single family" "M" "no" "United States" "" "0" "" "" "" ""
"00428411" "" "" "" "1" "" "03256" "" "Single family" "M" "" "United States" "" "0" "" "" "" ""
"00430264" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00431161" "" "" "" "1" "" "03256" "" "Single family" "" "no" "(China)" "" "0" "" "" "" ""
"00434103" "" "" "" "12" "" "03256" "{DOI:Ukhanova 2023:10.33029/0206-4952-2023-44-1-103-108}" "Single family with 12 affected individuals, incl 2 deaths" "" "no" "Russia" "" "0" "" "" "" ""
"00434644" "" "" "" "1" "" "03256" "" "Introduced in ClinVar by InVitae" "?" "" "(United States)" "" "0" "" "" "" ""
"00434645" "" "" "" "1" "" "03256" "" "Introduced in ClinVar by InVitae" "?" "" "(United States)" "" "0" "" "" "" ""
"00434646" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00434650" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00434652" "" "" "" "3" "" "03256" "{DOI:Ren 2023:10.1016/j.jaci.2022.11.027}" "Single family" "F" "no" "United States" "" "0" "" "" "" ""
"00434653" "" "" "" "1" "" "03256" "{DOI:Ren 2023:/10.1016/j.jaci.2022.11.027}" "Single family" "M" "no" "United States" "" "0" "" "" "" ""
"00434654" "" "" "" "1" "" "03256" "{DOI:Ren 2023:10.1016/j.jaci.2022.11.027}" "Single family" "M" "no" "United States" "" "0" "" "" "" ""
"00435005" "" "" "" "2" "" "03256" "{DOI:Kanepa 2023:10.1186/s13223-023-00783-6}" "Two families have been shown as carrying a c.550+352_685+842del variant, even if it has not been established whether both families are independent or not\r\n-family 1, Latvia\r\n-family 2, Hungary" "M" "no" "Latvia" "" "0" "" "" "" ""
"00435159" "" "" "" "1" "" "03256" "" "" "" "" "(United States)" "" "0" "" "" "" ""
"00435317" "" "" "" "1" "" "03256" "{DOI:Guryanova 2023:10.24412/2709-1201-2023-179-186}" "Single family" "M" "no" "Belarus" "" "0" "" "" "" ""
"00436402" "" "" "" "1" "" "03256" "{DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "Single family" "" "no" "Czech Republic" "" "0" "" "" "" ""
"00436403" "" "" "" "1" "" "03256" "{DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "Single family" "" "no" "Czech Republic" "" "0" "" "" "" ""
"00436404" "" "" "" "2" "" "03256" "{DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "Single family" "" "no" "Czech Republic" "" "0" "" "" "" ""
"00436405" "" "" "" "7" "" "03256" "{DOI:Grombikirova 2023:10.1007/s10875-023-01565-w}" "A single Czech kindred with 7 male affected individuals" "M" "no" "Czech Republic" "" "0" "" "" "" ""
"00436406" "" "" "" "2" "" "03256" "{DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "Single family" "" "no" "Czech Republic" "" "0" "" "" "" ""
"00436407" "" "" "" "2" "" "03256" "{DOI:Grombikirova 2023:10.1007/s10875-023-01565-w}" "" "" "no" "Czech Republic" "" "0" "" "" "" ""
"00436408" "" "" "" "1" "" "03256" "{DOI:Grodecká 2017:10.1016/j.clim.2017.03.010} {DOI:Grombikirova 2023:10.1007/s10875-023-01565-w}" "" "" "no" "Czech Republic" "" "0" "" "" "" ""
"00436409" "" "" "" "5" "" "03256" "{DOI:Grombikirova 2023:10.1007/s10875-023-01565-w}" "" "" "no" "Czech Republic" "" "0" "" "" "" ""
"00436413" "" "" "" "3" "" "03256" "{DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "" "" "no" "Czech Republic" "" "0" "" "" "" ""
"00436415" "" "" "" "8" "" "03256" "{DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "Four independent kindreds have been shown as carrying a c.1361T>G variant\r\nCzech Republic (n=8)" "" "no" "Czech Republic" "" "0" "" "" "" ""
"00436482" "" "" "" "3" "" "03256" "{DOI:Grombikirova 2023:10.1007/s10875-023-01565-w}" "A Czech pedigree with 3 affected individuals" "" "no" "Czech Republic" "" "0" "" "" "" ""
"00436635" "" "" "" "1" "" "03256" "{DOI:Pappalardo 2000:10.1067/mai.2000.110471}" "Single family" "" "no" "Italy" "" "0" "" "" "" ""
"00436647" "" "" "" "1" "" "03256" "" "Single family" "" "no" "(United States)" "" "0" "" "" "" ""
"00442612" "" "" "" "2" "" "03256" "{DOI:Maia 2023:10.3390/jcm12237299}" "Single family with 2 affected homozygous carriers" "F" "yes" "Brazil" "" "0" "" "" "" ""
"00443696" "" "" "" "5" "" "03256" "{DOI:Roman 2023:10.1016/j.anai.2023.08.428}" "A Mexican family with 5 affected individuals, 4 females, 1 male" "F" "no" "Mexico" "" "0" "" "" "" ""
"00444078" "" "" "" "3" "" "03256" "{DOI:Karam 2023:10.1016/j.neurol.2023.10.006}" "A 39-year-old man suffering more than 30 short episodes of right hemiparesis and aphasia. The variant is also carried by the patient’s father and daughter with C1 inhibitor deficiency" "M" "no" "France" "" "0" "" "" "" ""
"00445030" "" "" "" "10" "" "03256" "{DOI:Shchagina 2024:10.3390/biomedicines12010072}" "Single family with 10 affected individuals, incl 3 deaths" "F" "no" "Russia" "" "0" "" "" "" ""
"00448053" "" "" "" "1" "" "03256" "" "Single family" "" "?" "(United States)" "" "0" "" "" "" ""
"00448367" "" "" "" "1" "" "03256" "{DOI:Hamidou 2024:10.1016/j.reval.2023.103765}" "Single family with a homozygous female carrier" "F" "likely" "Niger" "" "0" "" "" "" ""
"00448400" "" "" "" "3" "" "03256" "{DOI:Markocsy 2024:10.1016/j.waojou.2024.100885}" "A family with 3 affected patients: mother, son, daughter" "F" "no" "Slovakia (Slovak Republic)" "" "0" "" "" "" ""
"00448401" "" "" "" "1" "" "03256" "{DOI:Markocsy 2024:10.1016/j.waojou.2024.100885}" "Single family" "" "no" "Slovakia (Slovak Republic)" "" "0" "" "" "" ""
"00448402" "" "" "" "1" "" "03256" "{DOI:Markocsy 2024:10.1016/j.waojou.2024.100885}" "c.416A>G variant was found in a sporadic female patient with the diagnosis of HAE-C1–INH" "F" "no" "Slovakia (Slovak Republic)" "" "0" "" "" "" ""
"00448403" "" "" "" "3" "" "03256" "{DOI:Markocsy 2024:10.1016/j.waojou.2024.100885}" "A Slovakian family with 3 affected patients: father, son, daughter" "" "no" "Slovakia (Slovak Republic)" "" "0" "" "" "" ""
"00448422" "" "" "" "6" "" "03256" "{DOI:Markocsy 2024:10.1016/j.waojou.2024.100885}" "" "" "no" "Slovakia (Slovak Republic)" "" "0" "" "" "" ""
"00448423" "" "" "" "3" "" "03256" "{DOI:Markocsy 2024:10.1016/j.waojou.2024.100885}" "Two independent families have been shown as carrying a c.954del variant\r\nFamily 1, Slovakia (n=2; mother and daughter)\r\nFamily 2, Russia" "F" "no" "Slovakia (Slovak Republic)" "" "0" "" "" "" ""
"00448424" "" "" "" "4" "" "03256" "{DOI:Markocsy 2024:10.1016/j.waojou.2024.100885}" "" "M" "no" "Slovakia (Slovak Republic)" "" "0" "" "" "" ""
"00448481" "" "" "" "5" "" "03256" "{DOI:Markocsy 2024:10.1016/j.waojou.2024.100885}" "" "F" "no" "Slovakia (Slovak Republic)" "" "0" "" "" "" ""
"00448482" "" "" "" "1" "" "03256" "{DOI:Markocsy 2024:10.1016/j.waojou.2024.100885}" "" "" "no" "Slovakia (Slovak Republic)" "" "0" "" "" "" ""
"00448483" "" "" "" "1" "" "03256" "{DOI:Markocsy 2024:10.1016/j.waojou.2024.100885}" "" "?" "" "Slovakia (Slovak Republic)" "" "0" "" "" "" ""
"00448484" "" "" "" "4" "" "03256" "{DOI:Markocsy 2024:10.1016/j.waojou.2024.100885}" "" "F" "no" "Slovakia (Slovak Republic)" "" "0" "" "" "" ""
"00448485" "" "" "" "6" "" "03256" "{DOI:Markocsy 2024:10.1016/j.waojou.2024.100885} {DOI:Du 2026:10.3389/falgy.2026.1899305}" "Two independent families have been shown as carrying a c.1346T>A variant\r\n-Slovakia (n=4)\r\n-China (n=2)" "" "no" "Slovakia (Slovak Republic)" "" "0" "" "" "" ""
"00448486" "" "" "" "1" "" "03256" "{DOI:Markocsy 2024:10.1016/j.waojou.2024.100885}" "A single individual has been shown as carrying a combined c.[5C>T(;)1397G>A]" "F" "no" "Slovakia (Slovak Republic)" "" "0" "" "" "" ""
"00448487" "" "" "" "2" "" "03256" "{DOI:Markocsy 2024:10.1016/j.waojou.2024.100885}" "Two independent families have been shown as carrying a whole SERPING1 gene deletion of unknown length\r\nFamily 1, Slovakia\r\nFamily 2, Hungary" "" "no" "Slovakia (Slovak Republic)" "" "0" "" "" "" ""
"00449568" "" "" "" "3" "" "03256" "{DOI:Aydoğdu 2024:10.1620/tjem.2023.J083}" "" "" "" "Turkey" "" "0" "" "" "" ""
"00452067" "" "" "" "1" "" "03256" "" "" "" "" "(United States)" "" "0" "" "" "" ""
"00452068" "" "" "" "7" "" "03256" "" "Single family with 7 affected individuals" "" "no" "Russia" "" "0" "" "" "" ""
"00452086" "" "" "" "3" "" "03256" "" "Single family with 3 affected individuals" "" "no" "Russia" "" "0" "" "" "" ""
"00452087" "" "" "" "3" "" "03256" "" "Two independent families have been shown as carrying a c.550+2T>A variant in SERPING1\r\nFamily 1, France\r\nFamily 2, Russia (n=2)" "" "no" "France" "" "0" "" "" "" ""
"00452100" "" "" "" "4" "" "03256" "" "Single family from Udmurt Republic in Russia with 4 affected individuals" "" "no" "Russia" "" "0" "" "" "" ""
"00452102" "" "" "" "1" "" "03256" "" "Single family" "M" "no" "Russia" "" "0" "" "" "" ""
"00452103" "" "" "" "1" "" "03256" "" "Single family" "F" "" "Russia" "" "0" "" "" "" ""
"00452104" "" "" "" "1" "" "03256" "" "" "" "" "(United States)" "" "0" "" "" "" ""
"00452105" "" "" "" "1" "" "03256" "" "" "" "" "(United States)" "" "0" "" "" "" ""
"00452108" "" "" "" "1" "" "03256" "" "" "" "" "(United States)" "" "0" "" "" "" ""
"00452109" "" "" "" "1" "" "03256" "" "Single family" "M" "no" "Russia" "" "0" "" "" "" ""
"00452110" "" "" "" "1" "" "03256" "" "" "" "" "(United States)" "" "0" "" "" "" ""
"00452111" "" "" "" "2" "" "03256" "" "Single family with 2 female and male affected individuals" "" "no" "Russia" "" "0" "" "" "" ""
"00452112" "" "" "" "1" "" "03256" "" "Single family" "M" "no" "Armenia" "" "0" "" "" "" ""
"00452113" "" "" "" "1" "" "03256" "" "" "" "" "(United States)" "" "0" "" "" "" ""
"00452114" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00452115" "" "" "" "4" "" "03256" "" "Single family with 4 affected individuals" "" "no" "Russia" "" "0" "" "" "" ""
"00452116" "" "" "" "1" "" "03256" "" "Single family" "M" "no" "Russia" "" "0" "" "" "" ""
"00452117" "" "" "" "2" "" "03256" "" "Single family with 2 affected individuals" "F" "no" "Russia" "" "0" "" "" "" ""
"00452118" "" "" "" "1" "" "03256" "" "" "" "" "(United States)" "" "0" "" "" "" ""
"00452119" "" "" "" "4" "" "03256" "" "" "" "" "(United States)" "" "0" "" "" "" ""
"00452268" "" "" "" "1" "" "03256" "" "" "" "" "(United States)" "" "0" "" "" "" ""
"00452269" "" "" "" "3" "" "03256" "" "Single family with 3 afected individuals" "M" "no" "Russia" "" "0" "" "" "" ""
"00452270" "" "" "" "1" "" "03256" "" "" "" "" "(United States)" "" "0" "" "" "" ""
"00452271" "" "" "" "1" "" "03256" "" "" "" "" "" "" "0" "" "" "" ""
"00452272" "" "" "" "2" "" "03256" "" "Single family with 2 affected individuals" "F" "no" "Russia" "" "0" "" "" "" ""
"00452273" "" "" "" "1" "" "03256" "" "" "" "" "(United States)" "" "0" "" "" "" ""
"00452274" "" "" "" "1" "" "03256" "" "" "" "" "(United States)" "" "0" "" "" "" ""
"00452275" "" "" "" "1" "" "03256" "" "Single family" "F" "no" "Russia" "" "0" "" "" "" ""
"00452322" "" "" "" "1" "" "03256" "" "" "" "" "(United States)" "" "0" "" "" "" ""
"00452323" "" "" "" "1" "" "03256" "" "Single family" "" "no" "(United States)" "" "0" "" "" "" ""
"00452324" "" "" "" "1" "" "03256" "" "" "" "" "(United States)" "" "0" "" "" "" ""
"00452325" "" "" "" "1" "" "03256" "" "" "" "" "(United States)" "" "0" "" "" "" ""
"00452326" "" "" "" "1" "" "03256" "" "" "" "" "(United States)" "" "0" "" "" "" ""
"00452327" "" "" "" "1" "" "03256" "" "" "" "" "(United States)" "" "0" "" "" "" ""
"00452328" "" "" "" "4" "" "03256" "" "Two independent families have been shown as carrying an exon-4 deletion of unknown boundaries\r\nFamily 1, United States of America\r\nFamily 2, Romania (n=3)" "" "no" "(United States)" "" "0" "" "" "" ""
"00454688" "" "" "" "1" "" "03256" "" "Single family" "F" "no" "Russia" "" "0" "" "" "" ""
"00454689" "" "" "" "2" "" "03256" "" "Two independent families have been shown as carrying a c.382dup variant in SERPING1" "F" "no" "Russia" "" "0" "" "" "" ""
"00454690" "" "" "" "1" "" "03256" "" "Single family" "M" "no" "Russia" "" "0" "" "" "" ""
"00454693" "" "" "" "1" "" "03256" "" "Single family" "F" "no" "Russia" "" "0" "" "" "" ""
"00457983" "" "" "" "1" "" "03256" "" "Single family" "F" "no" "Russia" "" "0" "" "" "" ""
"00457987" "" "" "" "1" "" "03256" "" "Single family" "M" "no" "Russia" "" "0" "" "" "" ""
"00457991" "" "" "" "1" "" "03256" "" "Single family" "M" "no" "Russia" "" "0" "" "" "" ""
"00457995" "" "" "" "1" "" "03256" "" "Single family" "M" "no" "Russia" "" "0" "" "" "" ""
"00457996" "" "" "" "1" "" "03256" "" "Single family" "F" "no" "Russia" "" "0" "" "" "" ""
"00457997" "" "" "" "2" "" "03256" "" "Single family" "M" "no" "Russia" "" "0" "" "" "" ""
"00457998" "" "" "" "1" "" "03256" "" "Single family" "F" "no" "Russia" "" "0" "" "" "" ""
"00457999" "" "" "" "2" "" "03256" "" "Single family" "F" "no" "Russia" "" "0" "" "" "" ""
"00458000" "" "" "" "1" "" "03256" "" "Single family" "F" "no" "Russia" "" "0" "" "" "" ""
"00458001" "" "" "" "1" "" "03256" "" "Single family" "M" "no" "Russia" "" "0" "" "" "" ""
"00458002" "" "" "" "3" "" "03256" "" "Single family" "" "no" "Russia" "" "0" "" "" "" ""
"00458003" "" "" "" "1" "" "03256" "" "Single family" "" "" "(United States)" "" "0" "" "" "" ""
"00458004" "" "" "" "1" "" "03256" "" "Single family" "F" "no" "Russia" "" "0" "" "" "" ""
"00458005" "" "" "" "1" "" "03256" "" "A single HAE1 patient with a family HAE history." "F" "no" "Russia" "" "0" "" "" "" ""
"00458028" "" "" "" "1" "" "03256" "" "Single family; an isolated case with an unknown family history" "F" "no" "Russia" "" "0" "" "" "" ""
"00458029" "" "" "" "1" "" "03256" "" "Single family; a single affected individual with an unknown family history" "M" "no" "Russia" "" "0" "" "" "" ""
"00458037" "" "" "" "2" "" "03256" "" "Single family with 2 affected individuals" "F" "no" "Russia" "" "0" "" "" "" ""
"00458044" "" "" "" "1" "" "03256" "" "Single family" "M" "no" "Russia" "" "0" "" "" "" ""
"00458045" "" "" "" "2" "" "03256" "" "Single family with 2 female and male affected individuals" "" "no" "Russia" "" "0" "" "" "" ""
"00458048" "" "" "" "1" "" "03256" "" "Single family" "F" "no" "Russia" "" "0" "" "" "" ""
"00458049" "" "" "" "1" "" "03256" "" "Single family (Altai region of Russia)" "F" "no" "Russia" "" "0" "" "" "" ""
"00458050" "" "" "" "1" "" "03256" "" "Single family" "F" "no" "Russia" "" "0" "" "" "" ""
"00458051" "" "" "" "2" "" "03256" "" "Single family with 2 affected individuals" "F" "no" "Russia" "" "0" "" "" "" ""
"00458052" "" "" "" "1" "" "03256" "" "Single family from North Caucasus of Russia" "M" "no" "Russia" "" "0" "" "" "Armenian" ""
"00458053" "" "" "" "2" "" "03256" "" "Single family" "" "no" "Russia" "" "0" "" "" "" ""
"00458054" "" "" "" "2" "" "03256" "" "Single family with a history of angioedema and with 2 affected individuals" "F" "no" "Russia" "" "0" "" "" "" ""
"00458055" "" "" "" "1" "" "03256" "" "Single family" "F" "no" "Russia" "" "0" "" "" "" ""
"00458057" "" "" "" "3" "" "03256" "" "Two independent families have been found in Russia as carrying a c.809C>A variant, with 3 affected individuals" "" "no" "Russia" "" "0" "" "" "" ""
"00458058" "" "" "" "4" "" "03256" "" "Single family with 4 affected individuals, the mother, her siblings and her son" "F" "no" "Russia" "" "0" "" "" "" ""
"00458059" "" "" "" "1" "" "03256" "" "Single family with a single individual without a family HAE history" "F" "no" "Russia" "" "0" "" "" "" ""
"00458060" "" "" "" "2" "" "03256" "" "Single family with 2 affected individuals" "F" "no" "Russia" "" "0" "" "" "" ""
"00458061" "" "" "" "2" "" "03256" "" "Single family with 2 affected individuals, mother and daughter" "F" "no" "Russia" "" "0" "" "" "" ""
"00458063" "" "" "" "10" "" "03256" "" "Two independent families have been shown as carrying a c.1109T>A variant\r\nRussia, 1 family with 8 affected individuals, incl 3 deaths\r\nEstonia, 1 family" "F" "no" "Russia" "" "0" "" "" "" ""
"00458064" "" "" "" "4" "" "03256" "" "Two families with a HAE history have been shown as carrying a c.1193_1195dup variant\r\n-Family 1, Russia\r\n-Family 2, France (n=3)" "M" "no" "Russia" "" "0" "" "" "" ""
"00458065" "" "" "" "2" "" "03256" "" "Single family with 2 affected individuals" "" "no" "Russia" "" "0" "" "" "" ""
"00458066" "" "" "" "1" "" "03256" "" "Single family" "F" "no" "Russia" "" "0" "" "" "" ""
"00458067" "" "" "" "1" "" "03256" "" "Single family" "F" "no" "Russia" "" "0" "" "" "" ""
"00458068" "" "" "" "1" "" "03256" "" "Single family" "F" "no" "Russia" "" "0" "" "" "" ""
"00458069" "" "" "" "1" "" "03256" "" "Single family" "M" "no" "Russia" "" "0" "" "" "" ""
"00458070" "" "" "" "1" "" "03256" "" "Single family" "F" "no" "Russia" "" "0" "" "" "" ""
"00458071" "" "" "" "1" "" "03256" "" "Single family" "F" "no" "Russia" "" "0" "" "" "" ""
"00458072" "" "" "" "1" "" "03256" "" "Single family" "M" "no" "Russia" "" "0" "" "" "" ""
"00458073" "" "" "" "1" "" "03256" "" "Single family" "M" "no" "Russia" "" "0" "" "" "" ""
"00458074" "" "" "" "3" "" "03256" "" "Single family" "F" "no" "Russia" "" "0" "" "" "" ""
"00458075" "" "" "" "1" "" "03256" "" "Single family with a HAE history" "M" "no" "Russia" "" "0" "" "" "" ""
"00458076" "" "" "" "1" "" "03256" "" "Single family" "F" "no" "Russia" "" "0" "" "" "" ""
"00458077" "" "" "" "2" "" "03256" "" "Single family with an affected male compound heterozygous individual for c.[167T>C(;)1328A>G] and an affected female heterozygous individual for c.1328A>G" "M" "no" "China" "" "0" "" "" "" ""
"00458078" "" "" "" "1" "" "03256" "" "Single family with a compound heterozygous affected individual c.[52-130C>T];[671T>G]" "" "no" "Spain" "" "0" "" "" "" ""
"00458081" "" "" "" "1" "" "03256" "" "Single family" "F" "no" "Russia" "" "0" "" "" "" ""
"00458082" "" "" "" "3" "" "03256" "" "Single family" "F" "no" "Russia" "" "0" "" "" "" ""
"00458083" "" "" "" "2" "" "03256" "" "Single family with 2 affected individuals" "M" "no" "Russia" "" "0" "" "" "" ""
"00458084" "" "" "" "2" "" "03256" "" "Single family with 2 affected individuals" "" "no" "Russia" "" "0" "" "" "" ""
"00458085" "" "" "" "1" "" "03256" "" "Single family" "M" "no" "Russia" "" "0" "" "" "" ""
"00458086" "" "" "" "2" "" "03256" "" "Single family with 2 affected individuals" "F" "no" "Russia" "" "0" "" "" "" ""
"00458087" "" "" "" "5" "" "03256" "" "Single family with 5 affected individuals" "" "no" "Russia" "" "0" "" "" "" ""
"00458088" "" "" "" "3" "" "03256" "" "Single family with 3 affected individuals" "F" "no" "Russia" "" "0" "" "" "" ""
"00458090" "" "" "" "2" "" "03256" "" "Single family with 2 affected individuals" "" "no" "Russia" "" "0" "" "" "" ""
"00458091" "" "" "" "1" "" "03256" "" "Single family" "M" "no" "Russia" "" "0" "" "" "" ""
"00458092" "" "" "" "2" "" "03256" "" "Single family with 2 affected individuals" "" "no" "Russia" "" "0" "" "" "" ""
"00458093" "" "" "" "2" "" "03256" "" "Single family with 2 affected individuals" "" "no" "Russia" "" "0" "" "" "" ""
"00458094" "" "" "" "1" "" "03256" "" "Single family" "M" "no" "Russia" "" "0" "" "" "" ""
"00458098" "" "" "" "4" "" "03256" "" "Single family with 4 affected individuals" "" "no" "Russia" "" "0" "" "" "" ""
"00458106" "" "" "" "1" "" "03256" "" "Single observation from clinical testing" "" "" "United States" "" "0" "" "" "" ""
"00458173" "" "" "" "1" "" "03256" "" "No information on carrier(s) or family(ies)" "?" "" "(United States)" "" "0" "" "" "" ""
"00458246" "" "" "" "1" "" "03256" "" "Single family with a single female affected individual" "F" "no" "Russia" "" "0" "" "" "" ""
"00459523" "" "" "" "1" "" "03256" "{DOI:Roosens 2024:10.1016/j.jaip.2024.12.023}" "Single family with a female proband submitted to a preimplantation genetic testing." "F" "no" "Belgium" "" "0" "" "" "" ""
"00459792" "" "" "" "1" "" "03256" "" "Single family" "" "no" "Germany" "" "0" "" "" "" ""
"00460571" "" "" "" "1" "" "03256" "{DOI:Rodriguez 2018:10.1007/s10875-018-0491-1}" "Single family with a compound heterozygous proband" "M" "no" "Colombia" "" "0" "" "" "" ""
"00460587" "" "" "" "1" "" "03256" "{DOI:Zhang 2025:10.1016/j.jdcr.2024.10.023}" "Single affected individual in a family presenting with apparently healthy relatives." "F" "no" "China" "" "0" "" "" "" ""
"00462228" "" "" "" "3" "" "03256" "{DOI:Mak 2025:10.1111/cea.70001}" "A female individual with olfactory dysfunction in a HAE Chinese family" "F" "no" "China" "" "0" "" "" "" ""
"00462230" "" "" "" "2" "" "03256" "{DOI:Mak 2025:10.1111/cea.70001}" "A family with 2 individuals presenting with HAE. A male individual is presenting with functional anosmia." "M" "no" "China" "" "0" "" "" "" ""
"00462231" "" "" "" "1" "" "03256" "" "A single family" "?" "no" "(United States)" "" "0" "" "" "" ""
"00462232" "" "" "" "1" "" "03256" "{DOI:Mak 2025:10.1111/cea.70001}" "A single individual presenting with type I HAE and hyposmia" "F" "no" "China" "" "0" "" "" "" ""
"00462233" "" "" "" "1" "" "03256" "{DOI:Batlle-Masó 2025:10.3389/fimmu.2025.1550380}" "A single family" "F" "no" "Spain" "" "0" "" "" "" ""
"00462290" "" "" "" "1" "" "03256" "" "Single family" "" "no" "(United States)" "" "0" "" "" "" ""
"00464426" "" "" "" "1" "" "03256" "" "" "" "?" "(United States)" "" "0" "" "" "" ""
"00464427" "" "" "" "1" "" "03256" "" "" "" "?" "(United States)" "" "0" "" "" "" ""
"00464428" "" "" "" "1" "" "03256" "" "Single family" "" "?" "(United States)" "" "0" "" "" "" ""
"00464429" "" "" "" "1" "" "03256" "" "Single family" "" "?" "(United States)" "" "0" "" "" "" ""
"00464430" "" "" "" "2" "" "03256" "A single family with affected individuals including a de novo situation" "" "" "no" "(United States)" "" "0" "" "" "" ""
"00464519" "" "" "" "1" "" "03256" "{DOI:Baysheva 2024:10.25557/2073-7998.2024.03.49-53}" "Single family" "" "no" "Russia" "" "0" "" "" "" ""
"00464575" "" "" "" "1" "" "03256" "" "Single family" "" "no" "(Germany)" "" "0" "" "" "" ""
"00464576" "" "" "" "2" "" "03256" "{DOI:Arias-Flórez 2025:10.1371/journal.pone.0311316}" "A single family with 2 affected individuals" "F" "no" "Colombia" "" "0" "" "" "" ""
"00464624" "" "" "" "3" "" "03256" "{DOI:Whetherby 2025:10.3389/falgy.2025.1565283}" "Single family with 3 affected carriers" "" "no" "United States" "" "0" "" "" "" ""
"00465314" "" "" "" "3" "" "03256" "{DOI:Du 2025:10.3389/falgy.2025.1554940}" "" "M" "no" "China" "" "0" "" "" "" ""
"00466060" "" "" "" "2" "" "03256" "{DOI:Khodan 2025:10.21802/artm.2025.2.34.119}" "A single Ukrainian family" "F" "no" "Ukraine" "" "0" "" "" "" ""
"00466371" "" "" "" "1" "" "03256" "{PMID:Gao 2025:40848077}, {DOI:Gao 2025:10.1007/s10875-025-01912-z}" "" "" "no" "China" "" "0" "" "" "" ""
"00466372" "" "" "" "2" "" "03256" "{PMID:Gao 2025:40848077}, {PMID:Gao 2025:40848077}, {DOI:Gao 2025:10.1007/s10875-025-01912-z}" "Two Chinese individuals in a single family have been shown as carrying a c.1327C>A variant." "" "no" "China" "" "0" "" "" "" ""
"00466373" "" "" "" "1" "" "03256" "{PMID:Gao 2025:40848077}, {DOI:Gao 2025:10.1007/s10875-025-01912-z}" "" "" "no" "China" "" "0" "" "" "" ""
"00466374" "" "" "" "1" "" "03256" "{PMID:Gao 2025:40848077}, {DOI:Gao 2025:10.1007/s10875-025-01912-z}" "Single family" "" "no" "China" "" "0" "" "" "" ""
"00466375" "" "" "" "1" "" "03256" "{PMID:Gao 2025:40848077}, {DOI:Gao 2025:10.1007/s10875-025-01912-z}" "Single family" "" "no" "China" "" "0" "" "" "" ""
"00466376" "" "" "" "1" "" "03256" "{PMID:Gao 2025:40848077}, {DOI:Gao 2025:10.1007/s10875-025-01912-z}" "Single family" "" "no" "China" "" "0" "" "" "" ""
"00466587" "" "" "" "1" "" "03256" "{DOI:Liu 2019:10.1684/ejd.2018.3487}" "Single family" "" "no" "China" "" "0" "" "" "" ""
"00466588" "" "" "" "1" "" "03256" "{DOI:Liu 2019:10.1684/ejd.2018.3487}" "Single family" "" "no" "China" "" "0" "" "" "" ""
"00466589" "" "" "" "1" "" "03256" "{DOI:Liu 2019:10.1684/ejd.2018.3487}" "Single family without information" "" "no" "China" "" "0" "" "" "" ""
"00466590" "" "" "" "1" "" "03256" "{DOI:Liu 2019:10.1684/ejd.2018.3487}" "Single family" "" "no" "China" "" "0" "" "" "" ""
"00466614" "" "" "" "1" "" "03256" "{DOI:Liu 2019:10.1684/ejd.2018.3487}" "Single family without clinical information" "" "no" "China" "" "0" "" "" "" ""
"00466615" "" "" "" "1" "" "03256" "{DOI:Liu 2019:10.1684/ejd.2018.3487}" "Single family without clinical documentation" "" "" "China" "" "0" "" "" "" ""
"00466875" "" "" "" "1" "" "03256" "{DOI:Ferriani 2025:10.1016/j.jaip.2025.08.026}" "A single Brazilian family" "" "no" "Brazil" "" "0" "" "" "" ""
"00466876" "" "" "" "1" "" "03256" "{DOI:Ferriani 2025:10.1016/j.jaip.2025.08.026}" "A single Brazilian family" "" "no" "Brazil" "" "0" "" "" "" ""
"00466877" "" "" "" "1" "" "03256" "{DOI:Ferriani 2025:10.1016/j.jaip.2025.08.026}" "" "" "no" "Brazil" "" "0" "" "" "" ""
"00466878" "" "" "" "1" "" "03256" "{DOI:Ferriani 2025:10.1016/j.jaip.2025.08.026}" "A single Brazilian family" "" "no" "Brazil" "" "0" "" "" "" ""
"00467148" "" "" "" "3" "" "03256" "{DOI:Xie 2025:10.2147/JAA.S536943}" "Single Chinese family" "M" "no" "China" "" "0" "" "" "" ""
"00468019" "" "" "" "1" "" "03256" "{DOI:Marchionni 2025:10.1186/s13023-025-04092-6}" "" "F" "no" "Italy" "" "0" "" "" "" ""
"00468441" "" "" "" "1" "" "03256" "{DOI:Reddy 2025:10.1016/j.anai.2025.08.482}" "" "M" "no" "United States" "" "0" "" "" "" ""
"00469532" "" "" "" "3" "" "03256" "{DOI:Du 2025: 10.3389/falgy.2025.1696666}" "A single Chinese family carrying a c.1483G>A variant." "F" "no" "China" "" "0" "" "" "" ""
"00469541" "" "" "" "1" "" "03256" "{DOI:Chi 2018:10.1097/MD.0000000000012695}" "" "M" "no" "China" "" "0" "" "" "" ""
"00470139" "" "" "" "2" "" "03256" "{DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "Two independent families have been shown as carrying a c.550+616_685+288del variant\r\nFamily 1, Germany\r\nFamily 2, Romania" "" "no" "Germany" "" "0" "" "" "" ""
"00470140" "" "" "" "1" "" "03256" "{DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "Single Bulgarian family" "" "no" "Bulgaria" "" "0" "" "" "" ""
"00470371" "" "" "" "1" "" "03256" "" "" "" "no" "Germany" "" "0" "" "" "" ""
"00470372" "" "" "" "1" "" "03256" "" "" "F" "no" "Germany" "" "0" "" "" "" ""
"00471500" "" "" "" "2" "" "03256" "" "A single observation from the US.\r\nObservation from a French family, with a 67-year-old proband, no angioedema, incidental discovery of C1-INH deficiency during investigations for unexplained thrombosis; lack of segregation in the family, variant identified in 1 brother and 1 sister with normal C1-INH." "" "no" "(United States)" "" "0" "" "" "" ""
"00471979" "" "" "" "3" "" "03256" "{DOI:Jiang 2025:10.22541/au.176675056.63979689/v1}" "A single family with 2 affected individuals - male proband, his sister, his son - have been shown as carrying a c.23_26dup variant." "M" "no" "China" "" "0" "" "" "" ""
"00471980" "" "" "" "1" "" "03256" "{DOI:Jiang 2025:10.22541/au.176675056.63979689/v1}" "A single Chinese family" "" "" "China" "" "0" "" "" "" ""
"00472183" "" "" "" "1" "" "03256" "{PMID:Gao 2025:40848077}, {DOI:Gao 2025:10.1007/s10875-025-01912-z}" "" "" "no" "China" "" "0" "" "" "" ""
"00472430" "" "" "" "2" "" "03256" "{DOI:Cosme Ferreira 2026:10.20344/amp.24214}" "" "M" "no" "Portugal" "" "0" "" "" "" ""
"00474344" "" "" "" "2" "" "03256" "{DOI:Kurjane 2026:10.3389/fimmu.2026.1696479}" "" "" "no" "Estonia" "" "0" "" "" "" ""
"00474347" "" "" "" "1" "" "03256" "{DOI:Kurjane 2026:10.3389/fimmu.2026.1696479}" "" "" "no" "Estonia" "" "0" "" "" "" ""
"00474866" "" "" "" "1" "" "03256" "{DOI:Wang 2026:10.2147/CCID.S581977}" "Sporadic angioedema with C1-INH deficiency without significant family or allergic history." "F" "no" "China" "" "0" "" "" "" ""
"00477139" "" "" "" "1" "" "03256" "" "" "?" "no" "(United States)" "" "0" "" "" "" ""
"00477212" "" "" "" "1" "" "03256" "" "" "" "no" "United States" "" "0" "" "" "" ""
"00477213" "" "" "" "1" "" "03256" "" "" "" "no" "United States" "" "0" "" "" "" ""
"00477214" "" "" "" "1" "" "03256" "" "" "" "no" "United States" "" "0" "" "" "" ""
"00477216" "" "" "" "1" "" "03256" "" "Single family" "?" "no" "United States" "" "0" "" "" "" ""
"00477217" "" "" "" "1" "" "03256" "" "" "" "no" "United States" "" "0" "" "" "" ""
"00478512" "" "" "" "1" "" "03256" "{DOI:Tarsitano 2026:10.3390/life16020200}" "Angioedema attack after intravenous thrombolysis with recombinant tissue-type plasminogen activator" "" "no" "Italy" "" "0" "" "" "" ""
"00480000" "" "" "" "1" "" "03256" "" "" "" "" "(United States)" "" "0" "" "" "" ""
"00480003" "" "" "" "1" "" "03256" "{DOI:Guo 2026:10.1186/s13023-026-04421-3}" "" "F" "no" "China" "" "0" "" "" "" ""
"00480004" "" "" "" "1" "" "03256" "{DOI:Guo 2026:10.1186/s13023-026-04421-3}" "" "F" "no" "China" "" "0" "" "" "" ""
"00480063" "" "" "" "1" "" "03256" "" "" "?" "" "(United States)" "" "0" "" "" "" ""
"00481118" "" "" "" "1" "" "03256" "{DOI:Marchionni 2026:10.1186/s13023-025-04092-6}" "" "F" "no" "Italy" "" "0" "" "" "" ""
"00482023" "" "" "" "1" "" "03256" "" "" "" "no" "Mexico" "" "0" "" "" "" ""
"00482024" "" "" "" "1" "" "03256" "" "" "" "?" "United Kingdom (Great Britain)" "" "0" "" "" "" ""
"00482025" "" "" "" "1" "" "03256" "" "" "F" "no" "China" "" "0" "" "" "" ""
"00484149" "" "" "" "2" "" "03256" "{DOI:Du 2026:10.3389/falgy.2026.1899305}" "Single family, with 2 sons asymptomatic carriers" "M" "no" "China" "" "0" "" "" "" ""
"00484818" "" "" "" "1" "" "03256" "{DOI:Mendoza-Alvarez 2026:10.21203/rs.3.rs-10662999/v1}" "Single family" "" "no" "Spain" "" "0" "" "" "" ""
"00484819" "" "" "" "2" "" "03256" "{DOI:Mendoza-Alvarez 2026:10.21203/rs.3.rs-10662999/v1}" "Single family" "M" "no" "Spain" "" "0" "" "" "" ""
"00484820" "" "" "" "1" "" "03256" "{DOI:Mendoza-Alvarez 2026:10.21203/rs.3.rs-10662999/v1}" "" "" "no" "Spain" "" "0" "" "" "" ""
"00484821" "" "" "" "1" "" "03256" "{DOI:Mendoza-Alvarez 2026:10.21203/rs.3.rs-10662999/v1}" "" "" "no" "Spain" "" "0" "" "" "" ""
"00484822" "" "" "" "1" "" "03256" "{DOI:Mendoza-Alvarez 2026:10.21203/rs.3.rs-10662999/v1}" "" "" "no" "Spain" "" "0" "" "" "" ""
## Individuals_To_Diseases ## Do not remove or alter this header ##
## Count = 1233
"{{individualid}}" "{{diseaseid}}"
"00229800" "01177"
"00229801" "01177"
"00229802" "01177"
"00229804" "01177"
"00229806" "01177"
"00229807" "01177"
"00229808" "01177"
"00229809" "01177"
"00229810" "01177"
"00229811" "01177"
"00229812" "01177"
"00229813" "01177"
"00229814" "01177"
"00229815" "01177"
"00229816" "01177"
"00229817" "01177"
"00229818" "01177"
"00229819" "01177"
"00229820" "01177"
"00229821" "01177"
"00229822" "01177"
"00229823" "01177"
"00229825" "01177"
"00229826" "01177"
"00229827" "01177"
"00229828" "01177"
"00229829" "01177"
"00229830" "01177"
"00229831" "01177"
"00229833" "01177"
"00229834" "01177"
"00229835" "01177"
"00229836" "01177"
"00229837" "01177"
"00229838" "01177"
"00229839" "01177"
"00229840" "01177"
"00229841" "01177"
"00229842" "01177"
"00229843" "01177"
"00229844" "01177"
"00229845" "01177"
"00229846" "01177"
"00229848" "01177"
"00229849" "01177"
"00229850" "01177"
"00229851" "01177"
"00229852" "01177"
"00229853" "01177"
"00229854" "01177"
"00229855" "01177"
"00229856" "01177"
"00229857" "01177"
"00229858" "01177"
"00229859" "01177"
"00229860" "01177"
"00229861" "01177"
"00229862" "01177"
"00229863" "01177"
"00229864" "01177"
"00229865" "01177"
"00229867" "01177"
"00229868" "01177"
"00229870" "01177"
"00229871" "01177"
"00229872" "01177"
"00229873" "01177"
"00229875" "01177"
"00229876" "01177"
"00229877" "01177"
"00229878" "01177"
"00229879" "01177"
"00229880" "01177"
"00229881" "01177"
"00229882" "01177"
"00229884" "01177"
"00229885" "01177"
"00229886" "01177"
"00229887" "01177"
"00229888" "01177"
"00229889" "01177"
"00229890" "01177"
"00229891" "01177"
"00229892" "01177"
"00229893" "01177"
"00229894" "01177"
"00229895" "01177"
"00229896" "01177"
"00229897" "01177"
"00229899" "01177"
"00229900" "01177"
"00229901" "01177"
"00229902" "01177"
"00229903" "01177"
"00229904" "01177"
"00229905" "01177"
"00229906" "01177"
"00229907" "01177"
"00229908" "01177"
"00229909" "01177"
"00229911" "01177"
"00229912" "01177"
"00229913" "01177"
"00229914" "01177"
"00229915" "01177"
"00229916" "01177"
"00229917" "01177"
"00229918" "01177"
"00229919" "01177"
"00229920" "01177"
"00229922" "01177"
"00229923" "01177"
"00229924" "01177"
"00229925" "01177"
"00229926" "01177"
"00229927" "01177"
"00240405" "01177"
"00240473" "01177"
"00244421" "01177"
"00244447" "01177"
"00244472" "01177"
"00244486" "01177"
"00244489" "01177"
"00244494" "01177"
"00244495" "01177"
"00244497" "01177"
"00244500" "01177"
"00244502" "01177"
"00244872" "01177"
"00244873" "01177"
"00244874" "01177"
"00244875" "01177"
"00244876" "01177"
"00245062" "01177"
"00245063" "01177"
"00245064" "01177"
"00245065" "01177"
"00245066" "01177"
"00245070" "01177"
"00245071" "01177"
"00245199" "01177"
"00245200" "01177"
"00245203" "01177"
"00245204" "01177"
"00245205" "01177"
"00245207" "01177"
"00245210" "01177"
"00245216" "01177"
"00245228" "01177"
"00245229" "01177"
"00245344" "01177"
"00245349" "01177"
"00245397" "01177"
"00245419" "01177"
"00245420" "01177"
"00245421" "01177"
"00245422" "01177"
"00245423" "01177"
"00245424" "01177"
"00245426" "01177"
"00245427" "01177"
"00245429" "01177"
"00245431" "01177"
"00245432" "01177"
"00245433" "01177"
"00245717" "01177"
"00245718" "01177"
"00245745" "01177"
"00245746" "01177"
"00245747" "01177"
"00245748" "01177"
"00245749" "01177"
"00245750" "01177"
"00245752" "01177"
"00245753" "01177"
"00245755" "01177"
"00245758" "01177"
"00245759" "01177"
"00245762" "01177"
"00245763" "01177"
"00245764" "01177"
"00245765" "01177"
"00245767" "01177"
"00245797" "01177"
"00245800" "01177"
"00245802" "01177"
"00245806" "01177"
"00245807" "01177"
"00245808" "01177"
"00245809" "01177"
"00245810" "01177"
"00245849" "01177"
"00245850" "01177"
"00245851" "01177"
"00245852" "01177"
"00245854" "01177"
"00245855" "01177"
"00245856" "01177"
"00245857" "01177"
"00245858" "01177"
"00245859" "01177"
"00245860" "01177"
"00245861" "01177"
"00245862" "01177"
"00245863" "01177"
"00245865" "01177"
"00245866" "01177"
"00245867" "01177"
"00245868" "01177"
"00245869" "01177"
"00245870" "01177"
"00245871" "01177"
"00245872" "01177"
"00245873" "01177"
"00245874" "01177"
"00245875" "01177"
"00245876" "01177"
"00245877" "01177"
"00245878" "01177"
"00245879" "01177"
"00245880" "01177"
"00245881" "01177"
"00245903" "01177"
"00245904" "01177"
"00245905" "01177"
"00245906" "01177"
"00245907" "01177"
"00245908" "01177"
"00245909" "01177"
"00246576" "01177"
"00246579" "01177"
"00246580" "01177"
"00246581" "01177"
"00246582" "01177"
"00246584" "01177"
"00246585" "01177"
"00246586" "01177"
"00246613" "01177"
"00246614" "01177"
"00246616" "01177"
"00246617" "01177"
"00246619" "01177"
"00246620" "01177"
"00246621" "01177"
"00246622" "01177"
"00246623" "01177"
"00246624" "01177"
"00246625" "01177"
"00246876" "01177"
"00246892" "01177"
"00247517" "01177"
"00247518" "01177"
"00261345" "01177"
"00261346" "01177"
"00261347" "01177"
"00261348" "01177"
"00261349" "01177"
"00261350" "01177"
"00261351" "01177"
"00261352" "01177"
"00261353" "01177"
"00261356" "01177"
"00261357" "01177"
"00261358" "01177"
"00261359" "01177"
"00262084" "01177"
"00262086" "01177"
"00262087" "01177"
"00262089" "01177"
"00262090" "01177"
"00262091" "01177"
"00262092" "01177"
"00262093" "01177"
"00262096" "01177"
"00262097" "01177"
"00262098" "01177"
"00262099" "01177"
"00262100" "01177"
"00262101" "01177"
"00262103" "01177"
"00262104" "01177"
"00262105" "01177"
"00262106" "01177"
"00262107" "01177"
"00262108" "01177"
"00262109" "01177"
"00262121" "01177"
"00262122" "01177"
"00262123" "01177"
"00262124" "01177"
"00262125" "01177"
"00262126" "01177"
"00262127" "01177"
"00262128" "01177"
"00262129" "01177"
"00262131" "01177"
"00262132" "01177"
"00263052" "01177"
"00263119" "01177"
"00264007" "01177"
"00264013" "01177"
"00264016" "01177"
"00264035" "01177"
"00264036" "01177"
"00264064" "05412"
"00264088" "01177"
"00264129" "01177"
"00264131" "01177"
"00264148" "01177"
"00264150" "01177"
"00264155" "01177"
"00264156" "01177"
"00264157" "01177"
"00264158" "01177"
"00265212" "01177"
"00265213" "01177"
"00265214" "01177"
"00265215" "01177"
"00265216" "01177"
"00265218" "01177"
"00265220" "01177"
"00265221" "01177"
"00265222" "01177"
"00265223" "01177"
"00265224" "01177"
"00265225" "01177"
"00265226" "01177"
"00265227" "01177"
"00265228" "01177"
"00265229" "01177"
"00265231" "01177"
"00265235" "01177"
"00265236" "01177"
"00265260" "01177"
"00265261" "01177"
"00265262" "01177"
"00265286" "01177"
"00265306" "01177"
"00265307" "01177"
"00265308" "01177"
"00265310" "01177"
"00265311" "01177"
"00265316" "01177"
"00265317" "01177"
"00265318" "01177"
"00265319" "01177"
"00265320" "01177"
"00265321" "01177"
"00265322" "01177"
"00265323" "01177"
"00265324" "01177"
"00265325" "01177"
"00265326" "01177"
"00265328" "01177"
"00265329" "01177"
"00265330" "01177"
"00265331" "01177"
"00265332" "01177"
"00265333" "01177"
"00265334" "01177"
"00265335" "01177"
"00265336" "01177"
"00265337" "01177"
"00265346" "01177"
"00265347" "01177"
"00265348" "01177"
"00265349" "01177"
"00265350" "01177"
"00265351" "01177"
"00265357" "01177"
"00265358" "01177"
"00265359" "01177"
"00265360" "01177"
"00265366" "01177"
"00265368" "01177"
"00265369" "01177"
"00265373" "01177"
"00265374" "01177"
"00265375" "01177"
"00265376" "01177"
"00265385" "01177"
"00265388" "01177"
"00265389" "01177"
"00265398" "01177"
"00265400" "01177"
"00265426" "01177"
"00265427" "01177"
"00265428" "01177"
"00265429" "01177"
"00265430" "01177"
"00265431" "01177"
"00265432" "01177"
"00265434" "01177"
"00265443" "01177"
"00265445" "01177"
"00265446" "01177"
"00265447" "01177"
"00265448" "01177"
"00265483" "01177"
"00265489" "01177"
"00265508" "01177"
"00265511" "01177"
"00265525" "01177"
"00265526" "01177"
"00265527" "01177"
"00265528" "01177"
"00265529" "01177"
"00265530" "01177"
"00265531" "01177"
"00265532" "01177"
"00265533" "01177"
"00265535" "01177"
"00265576" "01177"
"00265577" "01177"
"00265578" "01177"
"00265579" "01177"
"00265580" "01177"
"00265581" "01177"
"00265583" "01177"
"00265584" "01177"
"00265593" "01177"
"00265594" "01177"
"00265595" "01177"
"00265596" "01177"
"00265600" "01177"
"00265602" "01177"
"00265603" "01177"
"00265604" "01177"
"00265605" "01177"
"00265606" "01177"
"00265607" "01177"
"00265608" "01177"
"00265609" "01177"
"00265610" "01177"
"00265611" "01177"
"00265612" "01177"
"00265613" "01177"
"00265614" "01177"
"00265615" "01177"
"00265616" "01177"
"00265617" "01177"
"00265619" "01177"
"00265620" "01177"
"00265621" "01177"
"00265622" "01177"
"00265623" "01177"
"00265624" "01177"
"00265625" "01177"
"00265626" "01177"
"00265627" "01177"
"00265628" "01177"
"00265629" "01177"
"00265630" "01177"
"00265631" "01177"
"00265634" "01177"
"00265635" "01177"
"00265636" "01177"
"00265637" "01177"
"00265638" "01177"
"00265639" "01177"
"00265641" "01177"
"00265642" "01177"
"00265643" "01177"
"00265644" "01177"
"00265699" "01177"
"00265702" "01177"
"00265703" "01177"
"00265704" "01177"
"00265705" "01177"
"00265706" "01177"
"00265708" "01177"
"00265709" "01177"
"00265710" "01177"
"00265711" "01177"
"00265712" "01177"
"00265713" "01177"
"00265714" "01177"
"00265716" "01177"
"00265717" "01177"
"00265719" "01177"
"00265720" "01177"
"00265721" "01177"
"00265722" "01177"
"00265742" "01177"
"00265743" "01177"
"00265744" "01177"
"00265745" "01177"
"00265746" "01177"
"00265748" "01177"
"00265749" "01177"
"00265750" "01177"
"00265751" "01177"
"00265752" "01177"
"00265753" "05412"
"00265754" "01177"
"00265755" "01177"
"00265756" "01177"
"00265757" "01177"
"00265758" "01177"
"00265759" "01177"
"00265760" "01177"
"00265761" "01177"
"00265762" "01177"
"00265763" "01177"
"00265834" "01177"
"00265837" "01177"
"00265838" "01177"
"00265839" "01177"
"00265842" "01177"
"00265843" "01177"
"00265844" "01177"
"00265845" "01177"
"00265846" "01177"
"00265849" "01177"
"00265850" "01177"
"00265851" "01177"
"00265852" "01177"
"00265853" "01177"
"00265854" "01177"
"00265855" "01177"
"00265856" "01177"
"00265857" "01177"
"00265858" "01177"
"00265859" "01177"
"00265861" "01177"
"00265862" "01177"
"00265863" "01177"
"00265871" "01177"
"00265873" "01177"
"00265874" "01177"
"00265875" "01177"
"00265876" "01177"
"00265877" "01177"
"00265881" "01177"
"00265885" "01177"
"00265886" "01177"
"00265887" "01177"
"00265888" "01177"
"00265889" "01177"
"00265890" "01177"
"00265891" "01177"
"00265892" "01177"
"00265893" "01177"
"00265894" "01177"
"00265895" "01177"
"00265896" "01177"
"00265898" "01177"
"00265900" "01177"
"00265902" "01177"
"00265916" "01177"
"00265982" "01177"
"00265983" "01177"
"00265984" "01177"
"00265985" "01177"
"00265986" "01177"
"00266100" "01177"
"00266101" "01177"
"00266106" "01177"
"00266107" "01177"
"00266108" "01177"
"00266109" "01177"
"00266110" "01177"
"00266111" "01177"
"00266112" "01177"
"00266113" "01177"
"00266120" "01177"
"00266127" "01177"
"00266128" "01177"
"00266129" "01177"
"00266130" "01177"
"00266131" "01177"
"00266132" "01177"
"00266133" "01177"
"00266134" "01177"
"00266135" "01177"
"00266136" "01177"
"00266137" "01177"
"00266139" "01177"
"00266140" "01177"
"00266141" "01177"
"00266142" "01177"
"00266143" "01177"
"00266147" "01177"
"00266148" "01177"
"00266163" "01177"
"00266166" "01177"
"00266167" "01177"
"00266168" "01177"
"00266169" "01177"
"00266178" "01177"
"00266179" "01177"
"00266180" "01177"
"00266181" "01177"
"00266203" "01177"
"00266205" "01177"
"00266206" "01177"
"00266207" "01177"
"00266216" "01177"
"00266217" "01177"
"00266218" "01177"
"00266219" "01177"
"00266220" "01177"
"00266221" "01177"
"00266222" "01177"
"00266223" "01177"
"00266224" "01177"
"00266225" "01177"
"00266226" "01177"
"00266227" "01177"
"00266228" "01177"
"00266229" "01177"
"00266230" "01177"
"00266231" "01177"
"00266232" "01177"
"00266233" "01177"
"00266234" "01177"
"00266235" "01177"
"00266236" "01177"
"00266238" "01177"
"00266242" "01177"
"00266243" "01177"
"00266244" "01177"
"00266245" "01177"
"00266246" "01177"
"00266248" "01177"
"00266249" "01177"
"00266250" "01177"
"00266252" "01177"
"00266253" "01177"
"00266271" "01177"
"00266272" "01177"
"00266273" "01177"
"00266274" "01177"
"00266275" "01177"
"00266276" "01177"
"00266278" "01177"
"00266279" "01177"
"00266280" "01177"
"00266281" "01177"
"00266282" "01177"
"00266283" "01177"
"00266284" "01177"
"00266285" "01177"
"00266286" "01177"
"00266287" "01177"
"00266288" "01177"
"00266295" "01177"
"00266296" "01177"
"00266297" "01177"
"00266298" "01177"
"00266299" "01177"
"00266300" "01177"
"00266301" "01177"
"00266302" "01177"
"00266305" "01177"
"00266306" "01177"
"00266307" "01177"
"00266308" "01177"
"00266309" "01177"
"00266310" "01177"
"00266311" "01177"
"00266313" "01177"
"00266314" "01177"
"00266315" "01177"
"00266317" "01177"
"00266319" "01177"
"00266320" "01177"
"00266321" "01177"
"00266322" "01177"
"00266323" "01177"
"00266324" "01177"
"00266325" "01177"
"00266328" "01177"
"00266329" "01177"
"00266331" "01177"
"00266332" "01177"
"00266333" "01177"
"00266335" "01177"
"00266336" "01177"
"00266337" "01177"
"00266338" "01177"
"00266339" "01177"
"00266340" "01177"
"00266341" "01177"
"00266342" "01177"
"00266343" "01177"
"00266344" "01177"
"00266345" "01177"
"00266346" "01177"
"00266348" "01177"
"00266359" "01177"
"00266360" "01177"
"00266362" "01177"
"00266363" "01177"
"00266364" "01177"
"00266365" "01177"
"00266366" "01177"
"00266367" "01177"
"00266368" "01177"
"00266369" "01177"
"00266370" "01177"
"00266371" "01177"
"00266372" "01177"
"00266373" "01177"
"00266374" "01177"
"00266375" "01177"
"00266376" "01177"
"00266377" "01177"
"00266379" "00000"
"00266380" "00000"
"00266460" "01177"
"00266473" "01177"
"00266628" "01177"
"00266659" "01177"
"00266660" "01177"
"00266662" "01177"
"00266663" "01177"
"00266664" "01177"
"00266665" "01177"
"00266666" "01177"
"00266667" "01177"
"00266668" "01177"
"00266670" "01177"
"00266671" "01177"
"00266672" "01177"
"00266673" "01177"
"00267016" "01177"
"00267017" "01177"
"00267018" "01177"
"00267019" "01177"
"00267020" "01177"
"00267021" "01177"
"00267022" "01177"
"00267023" "01177"
"00267024" "01177"
"00267026" "01177"
"00267040" "01177"
"00267041" "01177"
"00267042" "01177"
"00267043" "01177"
"00267044" "01177"
"00267045" "01177"
"00267240" "01177"
"00267241" "01177"
"00267242" "01177"
"00267243" "01177"
"00267250" "01177"
"00267251" "01177"
"00267252" "01177"
"00267253" "01177"
"00269106" "01177"
"00269107" "01177"
"00269110" "01177"
"00269111" "01177"
"00269113" "01177"
"00269303" "01177"
"00269304" "01177"
"00269305" "01177"
"00269306" "00138"
"00269323" "05309"
"00275695" "01177"
"00275696" "01177"
"00275697" "01177"
"00275941" "01177"
"00276003" "01177"
"00276112" "01177"
"00290454" "00198"
"00303167" "01177"
"00310605" "01177"
"00311095" "01177"
"00311096" "01177"
"00311191" "01177"
"00311379" "01177"
"00313943" "01177"
"00314648" "01177"
"00320369" "01177"
"00320370" "01177"
"00320372" "01177"
"00320373" "01177"
"00320374" "01177"
"00320429" "01177"
"00320430" "01177"
"00320431" "01177"
"00320446" "01177"
"00324138" "01177"
"00324139" "01177"
"00324141" "01177"
"00324143" "01177"
"00324144" "01177"
"00324294" "01177"
"00324295" "01177"
"00324296" "01177"
"00324297" "01177"
"00324298" "01177"
"00324299" "01177"
"00324386" "00000"
"00324395" "00000"
"00327484" "01177"
"00327486" "01177"
"00327487" "01177"
"00328547" "01177"
"00328548" "01177"
"00329010" "01177"
"00329011" "01177"
"00329133" "01177"
"00329134" "01177"
"00329169" "01177"
"00331237" "01177"
"00331238" "01177"
"00331602" "01177"
"00332426" "01177"
"00332550" "01177"
"00332551" "01177"
"00359618" "02963"
"00361729" "01177"
"00361731" "01177"
"00361732" "01177"
"00361733" "01177"
"00361734" "01177"
"00361746" "01177"
"00361747" "01177"
"00361762" "00000"
"00361763" "00000"
"00361767" "01177"
"00361768" "01177"
"00361769" "01177"
"00361771" "01177"
"00361772" "01177"
"00361773" "01177"
"00361774" "01177"
"00361776" "01177"
"00361777" "01177"
"00361803" "06980"
"00361891" "01177"
"00361892" "01177"
"00361910" "01177"
"00361911" "01177"
"00361912" "01177"
"00362032" "01177"
"00362033" "01177"
"00362034" "01177"
"00362035" "01177"
"00362036" "01177"
"00363484" "00000"
"00363485" "00000"
"00363486" "00000"
"00363487" "00000"
"00363493" "00000"
"00363494" "00000"
"00363495" "00000"
"00363496" "00000"
"00363497" "00000"
"00363498" "00000"
"00363762" "00000"
"00363763" "00000"
"00373797" "01177"
"00376134" "01177"
"00376136" "01177"
"00379688" "01177"
"00379691" "01177"
"00379692" "01177"
"00379693" "01177"
"00379694" "01177"
"00379695" "01177"
"00379696" "01177"
"00379697" "01177"
"00379698" "01177"
"00379722" "01177"
"00379723" "01177"
"00379724" "01177"
"00379725" "01177"
"00379726" "01177"
"00379727" "01177"
"00379728" "01177"
"00379730" "01177"
"00379731" "01177"
"00379732" "01177"
"00379733" "01177"
"00379734" "01177"
"00379735" "01177"
"00379736" "01177"
"00379737" "01177"
"00379738" "01177"
"00379739" "01177"
"00379740" "01177"
"00379741" "01177"
"00379742" "01177"
"00380169" "01177"
"00382959" "01177"
"00384555" "00000"
"00384558" "00000"
"00384607" "01177"
"00384608" "01177"
"00384609" "01177"
"00387358" "00000"
"00387369" "01177"
"00387408" "01177"
"00387409" "01177"
"00391496" "00000"
"00392764" "01177"
"00398236" "01177"
"00398651" "01177"
"00402847" "01177"
"00404859" "01177"
"00405454" "01177"
"00405459" "01177"
"00405460" "01177"
"00405461" "01177"
"00405462" "01177"
"00405803" "01177"
"00406680" "01177"
"00406730" "01177"
"00406731" "01177"
"00406732" "01177"
"00406735" "01177"
"00408782" "01177"
"00416999" "01177"
"00417001" "01177"
"00417002" "01177"
"00417004" "01177"
"00417007" "01177"
"00417246" "01177"
"00417247" "01177"
"00417248" "01177"
"00417249" "01177"
"00417251" "01177"
"00417252" "01177"
"00417253" "01177"
"00417286" "01177"
"00417287" "01177"
"00417288" "00000"
"00417289" "00000"
"00417290" "01177"
"00417291" "01177"
"00417292" "00000"
"00417293" "00000"
"00417294" "00000"
"00417295" "01177"
"00417296" "00000"
"00417297" "01177"
"00417329" "01177"
"00417330" "00000"
"00417331" "00000"
"00417332" "00000"
"00417333" "00000"
"00417335" "00000"
"00417336" "01177"
"00417337" "00000"
"00417338" "00000"
"00417339" "01177"
"00417340" "01177"
"00417341" "01177"
"00417342" "00000"
"00417343" "01177"
"00417344" "01177"
"00417345" "01177"
"00417346" "00000"
"00417347" "01177"
"00417348" "01177"
"00417349" "01177"
"00417350" "01177"
"00417351" "01177"
"00417429" "01177"
"00417431" "01177"
"00417434" "01177"
"00417436" "01177"
"00417437" "01177"
"00417438" "01177"
"00417439" "01177"
"00417440" "01177"
"00417865" "01177"
"00423227" "01177"
"00423228" "01177"
"00423229" "01177"
"00423230" "01177"
"00423231" "01177"
"00424788" "01177"
"00424789" "01177"
"00424942" "00000"
"00425007" "00000"
"00425008" "00000"
"00425009" "00000"
"00425760" "00000"
"00425770" "00000"
"00425779" "00000"
"00425797" "00000"
"00425798" "00000"
"00425799" "00000"
"00426385" "00000"
"00426386" "00000"
"00426387" "00000"
"00426388" "00000"
"00426389" "00000"
"00426390" "00000"
"00426391" "00000"
"00426392" "00000"
"00426393" "00000"
"00427666" "01177"
"00427833" "00198"
"00428376" "01177"
"00428377" "01177"
"00428403" "01177"
"00428404" "01177"
"00428405" "01177"
"00428406" "01177"
"00428411" "01177"
"00430264" "01177"
"00431161" "01177"
"00434103" "01177"
"00434644" "01177"
"00434645" "01177"
"00434646" "00000"
"00434650" "00000"
"00434652" "01177"
"00434653" "01177"
"00434654" "01177"
"00435005" "01177"
"00435159" "00000"
"00435317" "01177"
"00436402" "01177"
"00436403" "01177"
"00436404" "01177"
"00436405" "01177"
"00436406" "01177"
"00436407" "01177"
"00436408" "01177"
"00436409" "01177"
"00436413" "01177"
"00436415" "01177"
"00436482" "01177"
"00436635" "01177"
"00436647" "01177"
"00442612" "01177"
"00443696" "01177"
"00444078" "01177"
"00445030" "01177"
"00448053" "01177"
"00448367" "01177"
"00448400" "01177"
"00448401" "01177"
"00448402" "01177"
"00448403" "01177"
"00448422" "01177"
"00448423" "01177"
"00448424" "01177"
"00448481" "01177"
"00448482" "01177"
"00448483" "01177"
"00448484" "01177"
"00448485" "01177"
"00448486" "01177"
"00448487" "01177"
"00449568" "01177"
"00452067" "01177"
"00452068" "01177"
"00452086" "01177"
"00452087" "01177"
"00452100" "01177"
"00452102" "01177"
"00452103" "01177"
"00452104" "01177"
"00452105" "01177"
"00452108" "01177"
"00452109" "01177"
"00452110" "01177"
"00452111" "01177"
"00452112" "01177"
"00452113" "01177"
"00452114" "01177"
"00452115" "01177"
"00452116" "01177"
"00452117" "01177"
"00452118" "01177"
"00452119" "01177"
"00452268" "01177"
"00452269" "01177"
"00452270" "01177"
"00452271" "01177"
"00452272" "01177"
"00452273" "01177"
"00452274" "01177"
"00452275" "01177"
"00452322" "01177"
"00452323" "01177"
"00452324" "01177"
"00452325" "01177"
"00452326" "01177"
"00452327" "01177"
"00452328" "01177"
"00454688" "01177"
"00454689" "01177"
"00454690" "01177"
"00454693" "01177"
"00457983" "01177"
"00457987" "01177"
"00457991" "01177"
"00457995" "01177"
"00457996" "01177"
"00457997" "01177"
"00457998" "01177"
"00457999" "01177"
"00458000" "01177"
"00458001" "01177"
"00458002" "01177"
"00458003" "01177"
"00458004" "01177"
"00458005" "01177"
"00458028" "01177"
"00458029" "01177"
"00458037" "01177"
"00458044" "01177"
"00458045" "01177"
"00458048" "01177"
"00458049" "01177"
"00458050" "01177"
"00458051" "01177"
"00458052" "01177"
"00458053" "01177"
"00458054" "01177"
"00458055" "01177"
"00458057" "01177"
"00458058" "01177"
"00458059" "01177"
"00458060" "01177"
"00458061" "01177"
"00458063" "01177"
"00458064" "01177"
"00458065" "01177"
"00458066" "01177"
"00458067" "01177"
"00458068" "01177"
"00458069" "01177"
"00458070" "01177"
"00458071" "01177"
"00458072" "01177"
"00458073" "01177"
"00458074" "01177"
"00458075" "01177"
"00458076" "01177"
"00458077" "01177"
"00458078" "01177"
"00458081" "01177"
"00458082" "01177"
"00458083" "01177"
"00458084" "01177"
"00458085" "01177"
"00458086" "01177"
"00458087" "01177"
"00458088" "01177"
"00458090" "01177"
"00458091" "01177"
"00458092" "01177"
"00458093" "01177"
"00458094" "01177"
"00458098" "01177"
"00458106" "01177"
"00458173" "01177"
"00458246" "01177"
"00459523" "01177"
"00459792" "01177"
"00460571" "01177"
"00460587" "01177"
"00462228" "01177"
"00462230" "01177"
"00462231" "01177"
"00462232" "01177"
"00462233" "01177"
"00462290" "01177"
"00464426" "01177"
"00464427" "01177"
"00464428" "01177"
"00464429" "01177"
"00464430" "01177"
"00464519" "01177"
"00464575" "01177"
"00464576" "01177"
"00464624" "01177"
"00465314" "01177"
"00466060" "01177"
"00466371" "01177"
"00466372" "01177"
"00466373" "01177"
"00466374" "01177"
"00466375" "01177"
"00466376" "01177"
"00466587" "01177"
"00466588" "01177"
"00466589" "01177"
"00466590" "01177"
"00466614" "01177"
"00466615" "01177"
"00466875" "01177"
"00466876" "01177"
"00466877" "01177"
"00466878" "01177"
"00467148" "01177"
"00468019" "01177"
"00468441" "06980"
"00469532" "01177"
"00469541" "05292"
"00470139" "01177"
"00470140" "01177"
"00470371" "01177"
"00470372" "01177"
"00471500" "00000"
"00471979" "01177"
"00471980" "01177"
"00472183" "01177"
"00472430" "01177"
"00474344" "01177"
"00474347" "01177"
"00474866" "01177"
"00477139" "01177"
"00477212" "01177"
"00477213" "01177"
"00477214" "01177"
"00477216" "01177"
"00477217" "01177"
"00478512" "06944"
"00480000" "00000"
"00480003" "01177"
"00480004" "01177"
"00480063" "01177"
"00481118" "01177"
"00482023" "01177"
"00482024" "01177"
"00482025" "01177"
"00484149" "01177"
"00484818" "01177"
"00484819" "01177"
"00484820" "01177"
"00484821" "01177"
"00484822" "01177"
## Phenotypes ## Do not remove or alter this header ##
## Note: Only showing Phenotype columns active for Diseases 00000, 00138, 00198, 01177, 01260, 02963, 05292, 05309, 05412, 06944, 06980
## Count = 1209
"{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}"
"0000180469" "01177" "00240405" "03256" "Familial" "" "Probands presenting with a HAE of the intermediate type, where low antigenic C1-INH is associated with a co-expression of both variant and wt alleles" "" "" "" "" "" "" "" "" "" ""
"0000184420" "01177" "00244447" "03256" "Familial, autosomal dominant" "" "Severe HAE phenotype" "" "" "" "" "" "" "" "" "" ""
"0000184468" "01177" "00244502" "03256" "Familial" "" "HAE-I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000184837" "01177" "00244873" "03256" "Familial" "" "Three independent pedigrees are carrying the variant, Denmark, France\r\nProbands presenting with a HAE of the intermediate type, where low antigenic C1 Inhibitor is associated with a co-expression of both variant and wt alleles." "" "" "" "" "" "" "" "" "" ""
"0000184838" "01177" "00244874" "03256" "Unknown" "" "HAE type II" "" "" "" "" "" "" "" "HAE with C1 Inhibitor deficiency" "" ""
"0000185024" "01177" "00245063" "03256" "Familial, autosomal dominant" "" "7 pedigrees with heterozygous individuals presenting with a HAE type II." "" "" "" "" "" "" "" "HAE with C1 Inhibitor deficiency" "" ""
"0000185030" "01177" "00245070" "03256" "Familial" "" "Proband presenting with SLE-like syndrome, with polyarthritis, pleuropericarditis, Raynaud\'s phenomenon and alopecia (Zahedi 1997).\r\nThe proband had partial deficiency of complement C4: Unusual hereditary C4 deficiency, with a normal C4 gene." "" "" "" "" "" "" "" "" "" ""
"0000185048" "01177" "00245071" "03256" "Familial" "" "HAE-I with heterozygous C1 inhibitor deficiency." "" "" "" "" "" "" "" "" "" ""
"0000185176" "01177" "00245199" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185177" "01177" "00245207" "03256" "Familial" "" "Probands presenting with a HAE of intermediate type, with a low antigenic C1Inh and an co-expression of both variant and wild-type alleles." "" "" "" "" "" "" "" "" "" ""
"0000185179" "01177" "00245210" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype, in line with in vitro investigations.\r\nFrench proband is sporadic, Iranian and Russian probands are familial cases" "" "" "" "" "" "" "" "" "" ""
"0000185185" "01177" "00245216" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185293" "01177" "00245344" "03256" "Familial" "" "Numerous pedigrees carrying a c.550G>A variant.\r\nProbands presenting with a HAE type I.\r\nA proband is presenting with a de novo mutation, Pappalardo 2000." "" "" "" "" "" "" "" "" "" ""
"0000185298" "01177" "00245349" "03256" "Familial" "" "Probands presenting with a HAE type I." "" "" "" "" "" "" "" "" "" ""
"0000185343" "01177" "00245397" "03256" "Complex" "" "Proband and his brother suffering from a HAE type I phenotype." "" "" "" "" "" "" "" "" "" ""
"0000185363" "01177" "00245419" "03256" "Isolated (sporadic)" "" "Proband presenting with a HAE type I.\r\nAsymptomatic parents." "" "" "" "" "" "" "" "" "" ""
"0000185364" "01177" "00245420" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185365" "01177" "00245422" "03256" "Familial" "" "Probands from 3 pedigrees presenting with a HAE type I.\r\nA sporadic proband with a de novo mutation has been reported." "" "" "" "" "" "" "" "" "" ""
"0000185366" "01177" "00245423" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "HAE-1" "" ""
"0000185367" "01177" "00245424" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185369" "01177" "00245426" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype." "" "" "" "" "" "" "" "" "" ""
"0000185370" "01177" "00245427" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype." "" "" "" "" "" "" "" "" "" ""
"0000185372" "01177" "00245429" "03256" "Familial" "" "Proband presenting with a HAE type II phenotype" "" "47y" "" "" "" "" "" "" "" ""
"0000185374" "01177" "00245431" "03256" "Familial" "" "Probands presenting with a HAE type II phenotype." "" "" "" "" "" "" "" "" "" ""
"0000185401" "01177" "00245432" "03256" "Familial" "" "probands presenting with HAE of the intermediate type: low antigenic C1 Inhibitor and detectable variant product p.(Val473Gly)" "" "" "" "" "" "" "" "" "" ""
"0000185402" "01177" "00245433" "03256" "Unknown" "" "Proband presenting with a HAE type I phenotype of medium severity." "" "" "" "Low antigenic C1 Inhibitor" "" "" "" "" "" ""
"0000185612" "01177" "00245717" "03256" "Familial" "" "Variant associated with a HAE type I phenotype, but probably not causative" "" "" "" "" "" "" "" "" "" ""
"0000185613" "01177" "00245718" "03256" "Familial" "" "Probands from French pedigrees have been identified with a HAE of the intermediate type, where low antigenic C1-INH is associated with a co-expression of both variant p.(Arg494*) and wt alleles." "" "" "" "" "" "" "" "" "HAE-I" ""
"0000185614" "01177" "00245745" "03256" "Familial, autosomal recessive" "" "Homozygous proband presenting with a mild HAE type II phenotype, heterozygotes are asymptomatic; c.[-21T>C];[-21T>C] might be a condition responsible for the disease" "" "" "" "" "" "" "" "" "" ""
"0000185615" "01177" "00245746" "03256" "Familial" "" "Proband and his uncle presenting with a severe HAE type I phenotype, with a normal antigenic C4." "" "" "" "" "" "" "" "" "" ""
"0000185616" "01177" "00245747" "03256" "Familial, autosomal recessive" "" "Homozygous probands presenting with a HAE type I phenotype" "" "53y" "" "" "" "" "" "" "" ""
"0000185617" "01177" "00245748" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185618" "01177" "00245749" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185619" "01177" "00245750" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185620" "01177" "00245752" "03256" "Familial" "" "Proband presenting with a HAE phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185621" "01177" "00245753" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185623" "01177" "00245755" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185626" "01177" "00245758" "03256" "Familial" "" "Proband presenting with a HAE phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185627" "01177" "00245759" "03256" "Familial" "" "Proband presenting with a HAE phenotype.\r\nInitially identified as a type I HAE based on levels of functional and antigenic C1 Inhibitor (17% both) and low C4 levels.\r\nVariant provisionnally attributed to a HAE of the intermediate type.\r\nUpon analysis of plasma by immunoblotting, low level of an aberrant, low molecular mass form of C1 Inhibitor of about 70 kDa has been detected.\r\nThis species displays a smaller MW than the intact and cleaved forms C1 Inhibitor of 104 kDa and 97 kDa, respectively, naturally occuring in human plasma." "" "" "" "" "" "" "" "" "" ""
"0000185630" "01177" "00245762" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185631" "01177" "00245763" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185632" "01177" "00245764" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185633" "01177" "00245765" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185634" "01177" "00245767" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185660" "01177" "00245797" "03256" "Familial, autosomal dominant" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185663" "01177" "00245800" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185665" "01177" "00245802" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185669" "01177" "00245806" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185670" "01177" "00245807" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185671" "01177" "00229843" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185672" "01177" "00229875" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185673" "01177" "00229816" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185674" "01177" "00245808" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185675" "01177" "00245809" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185676" "01177" "00245810" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185687" "01177" "00245849" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185688" "01177" "00245850" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185689" "01177" "00245851" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185690" "01177" "00245852" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185692" "01177" "00245854" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185693" "01177" "00245855" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype." "" "" "" "" "" "" "" "" "" ""
"0000185694" "01177" "00245856" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185695" "01177" "00245857" "03256" "Unknown" "" "Proband without specified phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185696" "01177" "00245858" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185697" "01177" "00245859" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185698" "01177" "00245860" "03256" "Familial" "" "Proband with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185699" "01177" "00245861" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185700" "01177" "00245862" "03256" "Familial" "" "Proband likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185701" "01177" "00245863" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185703" "01177" "00245865" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185704" "01177" "00245866" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185705" "01177" "00245868" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185706" "01177" "00245869" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185707" "01177" "00245870" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185708" "01177" "00245871" "03256" "Familial" "" "Probands likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185709" "01177" "00245872" "03256" "Familial" "" "Probands in many independent pedigrees presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185710" "01177" "00245873" "03256" "Familial" "" "Probands in 3 independent pedigrees presenting with a HAE type I phenotype." "" "" "" "" "" "" "" "" "" ""
"0000185711" "01177" "00245874" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185712" "01177" "00245875" "03256" "Familial" "" "Proband likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185713" "01177" "00245876" "03256" "Familial" "" "Probands from 2 independent pedigrees presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185714" "01177" "00245877" "03256" "Familial" "" "proband likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185715" "01177" "00245878" "03256" "Familial" "" "Probands likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185716" "01177" "00245879" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185717" "01177" "00245880" "03256" "Unknown" "" "proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185718" "01177" "00245881" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185738" "01177" "00245903" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185739" "01177" "00245904" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185740" "01177" "00245905" "03256" "Familial" "" "Probands presenting with a HAE type II phenotype \r\nA de novo condition has been recorded in a pedigree by Lopez-Lera 2011" "" "" "" "" "" "" "" "" "" ""
"0000185741" "01177" "00245906" "03256" "Familial" "" "Proband likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185742" "01177" "00245907" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185743" "01177" "00245908" "03256" "Familial" "" "proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185744" "01177" "00245909" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185745" "01177" "00229908" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype; family with 4 affected individuals" "" "" "" "" "" "" "" "" "" ""
"0000185746" "01177" "00229904" "03256" "Familial, autosomal dominant" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185964" "01177" "00229907" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype; two families" "" "" "" "" "" "" "" "" "" ""
"0000185965" "01177" "00244486" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185966" "01177" "00244472" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185967" "01177" "00229911" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185968" "01177" "00229909" "03256" "Familial" "" "proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185969" "01177" "00244489" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185970" "01177" "00229912" "03256" "Familial" "" "Proband carrying a de novo variant and presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185971" "01177" "00229913" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185972" "01177" "00229914" "03256" "Familial" "" "Male proband presenting with a HAE type I phenotype; Impaired C1INH function - 25.25% compared to a healthy donor." "" "" "" "" "" "" "" "" "" ""
"0000185973" "01177" "00229915" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185974" "01177" "00245205" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185975" "01177" "00229916" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185977" "01177" "00229905" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000185978" "01177" "00229891" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000186427" "01177" "00229868" "03256" "Familial" "" "Probands from 7 independent families presenting with a HAE type I phenotype.\r\nFamily 1, France, with a proband presenting with a de novo condition; family 2, Spain, published by Pedrosa 2016; families 3-5, France; family 6, Japan; family 7, China" "" "" "" "" "" "" "" "" "" ""
"0000186428" "01177" "00246576" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000186429" "01177" "00229890" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000186434" "01177" "00229923" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000186435" "01177" "00229820" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000186436" "01177" "00246579" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000186437" "01177" "00246580" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000186438" "01177" "00246581" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000186439" "01177" "00246582" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000186441" "01177" "00246584" "03256" "Familial" "" "" "" "" "" "" "" "" "" "" "" ""
"0000186442" "01177" "00246585" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000186443" "01177" "00246586" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000186470" "01177" "00246613" "03256" "Familial" "" "Proband presenting with a HAE type I phenotye" "" "" "" "" "" "" "" "" "" ""
"0000186472" "01177" "00246616" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000186473" "01177" "00246617" "03256" "Unknown" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000186474" "01177" "00246619" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000186475" "01177" "00246620" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000186476" "01177" "00246621" "03256" "Familial" "" "Proband not described, no citation.\r\nThe variant is not observed in large population cohorts (ClinVar report)." "" "" "" "" "" "" "" "" "" ""
"0000186477" "01177" "00246622" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000186478" "01177" "00246623" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000186479" "01177" "00246624" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000186480" "01177" "00246625" "03256" "Unknown" "" "Proband phenotype not documented." "" "" "" "" "" "" "" "" "" ""
"0000186686" "01177" "00246876" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000186687" "01177" "00246892" "03256" "Familial" "" "Probands from 3 independent pedigrees presenting with a HAE type I phenotype.\r\nFamily 1 (n=1), Serbia, Andrejević 2015\r\nFamily 2 (n=12) and family 3 (n=3), Croatia, Karadza-Lapic 2016" "" "" "" "" "" "" "" "" "" ""
"0000186755" "01177" "00247517" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype\r\nTwo independent pedigrees." "" "" "" "" "" "" "" "" "" ""
"0000186756" "01177" "00247518" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype." "" "" "" "" "" "" "" "" "" ""
"0000199715" "01177" "00229924" "03256" "Familial, autosomal dominant" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199716" "01177" "00229906" "03256" "Unknown" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199717" "01177" "00229864" "03256" "Familial" "" "Proband presenting with a HAE of the intermediate phenotype, where a low antigenic C1 Inhibitor is associated with an expression of the variant allele" "" "" "" "" "" "" "" "" "" ""
"0000199718" "01177" "00229865" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199719" "01177" "00229867" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199722" "01177" "00229873" "03256" "Unknown" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199723" "01177" "00229876" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199724" "01177" "00229877" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199725" "01177" "00229879" "03256" "Unknown" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199726" "01177" "00229918" "03256" "Unknown" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199727" "01177" "00229884" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199728" "01177" "00229885" "03256" "Familial" "" "Heterozygous probands in both families are presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199729" "01177" "00229887" "03256" "Unknown" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199730" "01177" "00229888" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199731" "01177" "00229893" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199732" "01177" "00229894" "03256" "Familial" "" "Proband presenting with a HAE type II phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199733" "01177" "00229895" "03256" "Familial" "" "Proband presenting with a HAE type II phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199734" "01177" "00229896" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199736" "01177" "00229899" "03256" "Familial" "" "Probands presenting with a HAE type II phenotype, where the variant allele is fully expressed with the wt allele" "" "" "" "" "" "" "" "" "" ""
"0000199737" "01177" "00229900" "03256" "Unknown" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199738" "01177" "00229901" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199739" "01177" "00229902" "03256" "Familial" "" "Proband with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199740" "01177" "00229919" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199741" "01177" "00229920" "03256" "Unknown" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199743" "01177" "00229800" "03256" "Familial" "" "Three independent families.\r\nProbands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199744" "01177" "00229804" "03256" "Unknown" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199745" "01177" "00229806" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "11y" "" "" "" "" "" "" "" ""
"0000199746" "01177" "00229808" "03256" "Unknown" "" "Probands presenting with a HAE type II phenotype or an intermediate type with a defective C1-INH expression" "" "" "" "" "" "" "" "" "" ""
"0000199747" "01177" "00229813" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199749" "01177" "00229810" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199750" "01177" "00229812" "03256" "Unknown" "" "Proband presenting with a HAE of the intermediate type, where low antigenic C1 Inhibitor is associated with an expression of the variant allele\r\nMild clinical phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199751" "01177" "00229814" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199752" "01177" "00229815" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199753" "01177" "00229817" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199754" "01177" "00229819" "03256" "Familial" "" "Proband presenting with a HAE of the intermediate type, where low antigenic C1 Inhibitor is associated with co-expression of both variant and wt alleles" "" "" "" "" "" "" "" "" "" ""
"0000199755" "01177" "00229821" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199756" "01177" "00229917" "03256" "Unknown" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199757" "01177" "00229822" "03256" "Familial" "" "Family 1, France (n=1)\r\nFamily 2, France (n=3)\r\nProbands presenting with a HAE of the intermediate type where low antigenic C1 Inhibitor is associated with a co-expression of both variant and wt alleles" "" "" "" "Protein variant detected by anti-C1 Inhibitor immunoblot" "" "" "" "" "" ""
"0000199758" "01177" "00229823" "03256" "Unknown" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199759" "01177" "00229825" "03256" "Unknown" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199760" "01177" "00229826" "03256" "Unknown" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199761" "01177" "00229827" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199762" "01177" "00229828" "03256" "Isolated (sporadic)" "" "Proband presenting with a HAE type I phenotype and a de novo mutation" "" "" "" "" "" "" "" "" "" ""
"0000199763" "01177" "00229830" "03256" "Familial" "" "Proband presenting with a HAE phenotype of the intermediate type: low antigenic C1-INH and a co-expression of both wt and variant alleles" "" "" "" "" "" "" "" "" "" ""
"0000199764" "01177" "00229831" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199765" "01177" "00229833" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199766" "01177" "00229836" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199767" "01177" "00229837" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199768" "01177" "00229838" "03256" "Familial" "" "Probands presenting with a HAE of the intermediate type, with expression of both variant and wild-type alleles" "" "" "" "" "" "" "" "" "" ""
"0000199769" "01177" "00229839" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199770" "01177" "00229840" "03256" "Unknown" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199771" "01177" "00229842" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199773" "01177" "00229846" "03256" "Unknown" "" "Proband likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199774" "01177" "00229848" "03256" "Familial" "" "Probands in 2 independent families presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199775" "01177" "00229850" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199777" "01177" "00229852" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199778" "01177" "00229853" "03256" "Unknown" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199779" "01177" "00229854" "03256" "Familial" "" "Two independent pedigrees; Germany and France.\r\nProbands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199780" "01177" "00229855" "03256" "Unknown" "" "Proband presenting with a HAE of the intermediate type where low antigenic C1 Inhibitor is associated with co-expression of both variant and wt alleles" "" "" "" "" "" "" "" "" "" ""
"0000199781" "01177" "00229851" "03256" "Familial" "" "Family 1 (n=1)\r\nFamily 2 (n=1) with a proband presenting with a de novo condition, identified as isolated (sporadic) inheritance\r\nFamily 3 (n=1)\r\nProbands presenting with a HAE of the intermediate type, where low antigenic C1 Inhibitor is associated with co-expression of both variant and wt alleles" "" "" "" "" "" "" "" "" "" ""
"0000199782" "01177" "00229856" "03256" "Isolated (sporadic)" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199783" "01177" "00229857" "03256" "Familial" "" "Family 1 (n=1), with a proband presenting with a de novo condition\r\nFamily 2 (n=3)\r\nProbands presenting with a HAE of the intermediate type, where low antigenic C1 Inhibitor is associated with a co-expression of both variant and wt alleles" "" "" "" "" "" "" "" "" "" ""
"0000199784" "01177" "00229859" "03256" "Familial" "" "Proband with a HAE of the intermediate type, where low antigenic C1 Inhibitor is associated with a co-expression of both variant and wt alleles.\r\nModerate symptomatolgy for 3 carriers." "" "" "" "" "" "" "" "" "" ""
"0000199785" "01177" "00229861" "03256" "Unknown" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199786" "01177" "00229862" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199787" "01177" "00244876" "03256" "Familial" "" "Maybe one proband with a possible de novo mutation\r\nProbands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199789" "01177" "00244495" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199790" "01177" "00261345" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199791" "01177" "00261346" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199792" "01177" "00261347" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199793" "01177" "00261348" "03256" "Unknown" "" "" "" "" "" "" "" "" "" "" "" ""
"0000199794" "01177" "00261349" "03256" "Familial" "" "Probands are presenting with a HAE type I phenotype." "" "" "" "" "" "" "" "" "" ""
"0000199795" "01177" "00261350" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199796" "01177" "00261351" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199797" "01177" "00261352" "03256" "Familial" "" "Probands presenting with a HAE of the intermediate type, where low antigenic C1 Inhibitor is associated with a co-expression of both variant and wt alleles" "" "" "" "" "" "" "" "" "" ""
"0000199798" "01177" "00229818" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199799" "01177" "00261353" "03256" "Isolated (sporadic)" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199802" "01177" "00261356" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199803" "01177" "00261357" "03256" "Familial" "" "Family 1 (n=4), France, with proband presenting with a HAE of the intermediate phenotype\r\nFamily 2, Italy\r\nFamily 3, Denmark\r\nFamily 4, Japan\r\nFamily 5, China" "" "" "" "" "" "" "" "" "" ""
"0000199804" "01177" "00261358" "03256" "Familial" "" "Proband presenting with a HAE of the intermediate phenotype: low antigenic C1-INH associated with a co-expression of both variant and wt alleles" "" "" "" "" "" "" "" "" "" ""
"0000199805" "01177" "00261359" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199806" "01177" "00229801" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199807" "01177" "00229802" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199808" "01177" "00229807" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199809" "01177" "00229903" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199810" "01177" "00229811" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199811" "01177" "00229809" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199812" "01177" "00229829" "03256" "Familial" "" "Homozygous proband with c.[668A>C];[668A>C] presenting with a HAE type II phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199813" "01177" "00229889" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199814" "01177" "00229834" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype\r\nCarrier of a c.686-7C>G variant initially characterized as VUS, next as likely pathogenic from additional demonstration of splicing defect (2023)" "" "" "" "" "" "" "" "" "" ""
"0000199815" "01177" "00229835" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199816" "01177" "00229841" "03256" "Familial" "" "Proband presenting with a HAE of the intermediate type, where low antigenic C1-INH is associated with co-expression of both variant and wt alleles" "" "" "" "" "" "" "" "" "" ""
"0000199817" "01177" "00229897" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199818" "01177" "00229844" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199819" "01177" "00229845" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199820" "01177" "00229849" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199821" "01177" "00229860" "03256" "Familial" "" "Proband presenting with HAE of the intermediate type, where low antigenic C1-INH is associated with a co-expression of both variant and wt alleles" "" "" "" "" "" "" "" "" "" ""
"0000199822" "01177" "00229858" "03256" "Familial" "" "Proband presenting with a HAE of the intermediate type, where low antigenic C1-INH is associated with a co-expression of both variant and wt alleles" "" "" "" "" "" "" "" "" "" ""
"0000199823" "01177" "00229863" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype\r\nBrazil (n=3), with severe (n=1) and mild (n=2) individuals\r\nFrance (n=1)" "" "" "" "" "" "" "" "" "" ""
"0000199825" "01177" "00229870" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199826" "01177" "00229871" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199827" "01177" "00229872" "03256" "Familial, autosomal dominant" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199828" "01177" "00229878" "03256" "Isolated (sporadic)" "" "Proband presenting with a HAE type I phenotype and in a de novo condition" "" "" "" "" "" "" "" "" "" ""
"0000199829" "01177" "00229880" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199830" "01177" "00229881" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199831" "01177" "00229882" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199833" "01177" "00229886" "03256" "Unknown" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199834" "01177" "00229892" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199835" "01177" "00229925" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199836" "01177" "00229922" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199837" "01177" "00229926" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199838" "01177" "00229927" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199839" "01177" "00240473" "03256" "Familial" "" "Proband and her daughter presenting with a HAE type I phenotype, severe disease" "" "" "" "" "" "" "" "HAE-1" "angioedema" ""
"0000199840" "01177" "00244421" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199841" "01177" "00244872" "03256" "Familial" "" "Probands presenting with a HAE of the intermediate type, where low antigenic C1-INH is associated with a co-expression of both variant and wt alleles" "" "" "" "" "" "" "" "" "" ""
"0000199842" "01177" "00245228" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199844" "01177" "00244875" "03256" "Familial" "" "Probands presenting with a HAE type II phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199847" "01177" "00244494" "03256" "Familial" "" "Heterozygous and asymptomatic individuals (n=4) are presenting with a HAE of the intermediate type, where low antigenic C1-INH is associated with a co-expression of both variant and wt alleles.\r\nBoth homozygous probands with c.[1198C>T];[1198C>T] are presenting with a decreased control of plasma kallikrein activity in plasma." "" "" "" "" "" "" "" "" "" ""
"0000199848" "01177" "00245867" "03256" "Familial" "" "Proband likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199849" "01177" "00244497" "03256" "Familial" "" "Probands presenting with a HAE phenotype; one female proband displays C1-INH function within normal range" "" "72y" "" "" "" "" "" "" "" ""
"0000199850" "01177" "00244500" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199851" "01177" "00245062" "03256" "Familial" "" "Probands presenting with a HAE type II phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199852" "01177" "00245064" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199853" "01177" "00245065" "03256" "Familial" "" "Probands of the three pedigrees presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199854" "01177" "00245066" "03256" "Familial" "" "Probands presenting with a HAE of the intermediate type, where low antigenic C1-INH is associated with a co-expression of both variant and wt alleles" "" "" "" "" "" "" "" "" "" ""
"0000199855" "01177" "00245200" "03256" "Familial" "" "Proband likely to present with a HAE type I phenotype; not identified by Gösswein 2008" "" "" "" "" "" "" "" "" "" ""
"0000199858" "01177" "00245203" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199859" "01177" "00245204" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199860" "01177" "00245229" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000199861" "01177" "00245421" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype without family history of HAE, suggesting a de novo proband" "02y" "19y" "" "" "" "" "" "" "" ""
"0000199862" "01177" "00246614" "03256" "Unknown" "" "Proband likely to present with a HAE type I phenotype; functional data not recorded" "" "" "" "" "" "" "" "" "" ""
"0000200567" "01177" "00262084" "03256" "Familial" "" "Probands presenting with a HAE of the intermediate phenotype, where low antigenic C1-INH is associated with a co-expression of both variant and wt alleles" "" "" "" "" "" "" "" "" "" ""
"0000200569" "01177" "00262086" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000200570" "01177" "00262087" "03256" "Familial" "" "Probands presenting with a HAE of the intermediate type, where low antigenic C1-INH is associated with a co-expression of both variant and wt alleles" "" "" "" "" "" "" "" "" "" ""
"0000200572" "01177" "00262089" "03256" "Familial" "" "Probands presenting with a HAE of the intermediate type, where low antigenic C1-INH is associated with co-expression of both variant and wt alleles" "" "" "" "" "" "" "" "HAE with C1 Inhibitor deficiency" "HAE-1" ""
"0000200573" "01177" "00262090" "03256" "Familial" "" "Probands presenting with a HAE of the intermediate type, where low antigenic C1-INH is associated with a co-expression of both variant and wt alleles" "" "" "" "" "" "" "" "" "" ""
"0000200574" "01177" "00262092" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000200575" "01177" "00262093" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000200578" "01177" "00262096" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000200579" "01177" "00262097" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000200580" "01177" "00262098" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000200581" "01177" "00262099" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000200582" "01177" "00262100" "03256" "Familial" "" "Probands presenting with a HAE of the intermediate type, where low antigenic C1-INH is associated with a co-expression of variant and wt alleles" "" "" "" "" "" "" "" "" "" ""
"0000200583" "01177" "00262101" "03256" "Familial" "" "Probands presenting with a HAE of the intermediate type, where low antigenic C1-INH is associated with a co-expression of both variant and wt alleles" "" "" "" "" "" "" "" "" "" ""
"0000200585" "01177" "00262103" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000200586" "01177" "00262104" "03256" "Familial" "" "Probands presenting with a HAE of the intermediate phenotype, where low antigenic C1-INH is associated with co-expression of both variant and wt alleles" "" "" "" "" "" "" "" "" "" ""
"0000200587" "01177" "00262105" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000200588" "01177" "00262106" "03256" "Familial" "" "Three independent pedigrees are carrying a c.1356_1357delTG variant, Greece, France, Iran\r\nProbands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000200589" "01177" "00262107" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000200590" "01177" "00262108" "03256" "Familial" "" "Probands presenting with a HAE type II phenotype, where a normal antigenic C1-INH is associated with co-expression of both variant and wt alleles" "" "" "" "" "" "" "" "" "" ""
"0000200591" "01177" "00262109" "03256" "Familial" "" "Numerous independent pedigrees have been recorded.\r\nProbands presenting with a real HAE type II phenotype, with low C1-INH function and normal antigenic C1-INH." "" "" "" "" "" "" "" "" "" ""
"0000200601" "01177" "00262121" "03256" "Familial, autosomal dominant" "" "Many clinical and biological reports, including an original hyposmia observation in 2 affected female Chinese carriers.\r\nProbands presenting with a real HAE type II phenotype, mostly with an increased antigenic C1-INH in plasma." "" "" "" "" "" "" "" "" "" ""
"0000200602" "01177" "00262122" "03256" "Familial, autosomal dominant" "" "Many recurrent clinical and biological observations\r\nProbands presenting with a real HAE type II phenotype\r\nSlovakian family members are presenting with a mild course of disease - from 1 to 2 attacks per year without laryngeal edemas and symptom onset between 3 to 21 years" "" "" "" "" "" "" "" "" "" ""
"0000200604" "01177" "00262123" "03256" "Familial" "" "Proband likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000200606" "01177" "00262124" "03256" "Familial" "" "Probands presenting with a HAE of the intermediate type, where low antigenic C1-INH is associated with a co-expression of both variant and wt alleles" "" "" "" "" "" "" "" "" "" ""
"0000200607" "01177" "00262125" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000200608" "01177" "00262126" "03256" "Familial" "" "Probands presenting with a HAE type II phenotype" "" "" "" "" "" "" "" "" "" ""
"0000200609" "01177" "00262127" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype; robands in each of the 4 Italian families #4 to #7 were identified due to urticaria symptoms." "" "" "" "" "" "" "" "" "" ""
"0000200610" "01177" "00262128" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000200611" "01177" "00262129" "03256" "Familial" "" "Probands presenting with a HAE of the intermediate type, where low antigenic C1-INH is associated with a co-expression of both variant p.(Pro498Thr) and wt alleles" "" "" "" "" "" "" "" "" "" ""
"0000200613" "01177" "00262131" "03256" "Familial" "" "Probands presenting with a HAE phenotype" "" "" "" "" "" "" "" "" "" ""
"0000200614" "01177" "00262132" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000201528" "01177" "00263052" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000201559" "01177" "00263119" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000201864" "01177" "00264007" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype." "" "" "" "" "" "" "" "" "" ""
"0000201872" "01177" "00264016" "03256" "Unknown" "" "Proband presenting with a HAE type I" "" "" "" "" "" "" "" "" "" ""
"0000201890" "01177" "00264035" "03256" "Familial" "" "Individuals carrying the variant c.* 84dupG in a combination with other pathogenic variants" "" "" "" "" "" "" "" "" "" ""
"0000201891" "01177" "00264036" "03256" "Unknown" "" "" "" "" "" "" "" "" "" "" "" ""
"0000201911" "05412" "00264064" "03256" "Unknown" "" "Large population study of Age-related Macular Degeneration (AMD) in UK." "" "" "" "" "" "" "" "" "" ""
"0000201932" "01177" "00264088" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000201969" "01177" "00264129" "03256" "Unknown" "" "Variant found in one asymptomatic individual" "" "" "" "" "" "" "" "" "" ""
"0000201971" "01177" "00264131" "03256" "Unknown" "" "HAE criteria provided, single submitter" "" "" "" "" "" "" "" "" "" ""
"0000201988" "01177" "00264148" "03256" "Unknown" "" "Variant of uncertain significance" "" "" "" "" "" "" "" "" "" ""
"0000201990" "01177" "00264150" "03256" "Unknown" "" "Variant with unknown significance.\r\nUnknown clinical phenotype." "" "" "" "" "" "" "" "" "" ""
"0000201997" "01177" "00264155" "03256" "Unknown" "" "SNP present in patients and controls" "" "" "" "" "" "" "" "" "" ""
"0000201998" "01177" "00264156" "03256" "Unknown" "" "Polymorphism in patients and control subjects" "" "" "" "" "" "" "" "" "" ""
"0000201999" "01177" "00264157" "03256" "Unknown" "" "No information" "" "" "" "" "" "" "" "" "" ""
"0000202000" "01177" "00264158" "03256" "Unknown" "" "Proband likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203036" "01177" "00265212" "03256" "Unknown" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203037" "01177" "00265213" "03256" "Unknown" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203038" "01177" "00265214" "03256" "Unknown" "" "Proband presenting with a HAE type I phenotype" "" "10y" "" "" "" "" "" "" "" ""
"0000203040" "01177" "00265216" "03256" "Unknown" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203042" "01177" "00265218" "03256" "Unknown" "" "Proband presenting with a HAE type I phenotype" "01y" "38y" "" "" "" "" "" "" "" ""
"0000203044" "01177" "00265220" "03256" "Familial" "" "Female proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203045" "01177" "00265221" "03256" "Unknown" "" "Proband with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203046" "01177" "00265222" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203047" "01177" "00265223" "03256" "Unknown" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203048" "01177" "00265224" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "30y" "" ""
"0000203049" "01177" "00265225" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203050" "01177" "00265226" "03256" "Unknown" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203051" "01177" "00265227" "03256" "Unknown" "" "Probands presenting with a HAE type I phenotype\r\nFamily presenting with severe (n=1) and moderate (n=1) individuals" "" "" "" "" "" "" "" "" "" ""
"0000203052" "01177" "00265228" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203053" "01177" "00265229" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203054" "01177" "00265231" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203058" "01177" "00265235" "03256" "Unknown" "" "Proband likely to present with a HAE type I phenotype, see ClinVar ID" "" "" "" "" "" "" "" "" "" ""
"0000203060" "01177" "00265236" "03256" "Unknown" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203079" "01177" "00265260" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203080" "01177" "00265261" "03256" "Familial" "" "Probands of 2 families from Germany and France are presenting with a HAE type I phenotype." "" "" "" "" "" "" "" "" "" ""
"0000203081" "01177" "00265262" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203084" "01177" "00265286" "03256" "Familial" "" "Three kindreds have been described: France, Germany, Switzerland.\r\nProbands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203103" "01177" "00265306" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203104" "01177" "00265307" "03256" "Unknown" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203105" "01177" "00265308" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203107" "01177" "00265310" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203108" "01177" "00265311" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203114" "01177" "00265316" "03256" "Familial, autosomal recessive" "" "Proband presenting with a HAE type I phenotype\r\nHer both parents are asymptomatic." "" "" "" "" "" "" "" "" "" ""
"0000203115" "01177" "00265317" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203116" "01177" "00265318" "03256" "Familial" "" "Proband presenting with a HAE type II phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203117" "01177" "00265319" "03256" "Familial" "" "proband presenting with a HAE type II phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203118" "01177" "00265320" "03256" "Familial" "" "Proband presenting with a HAE type II phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203119" "01177" "00265321" "03256" "Familial" "" "proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203120" "01177" "00265322" "03256" "Familial" "" "proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203121" "01177" "00265323" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203122" "01177" "00265324" "03256" "Unknown" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203123" "01177" "00265325" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203124" "01177" "00265326" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203125" "01177" "00265328" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203126" "01177" "00265329" "03256" "Familial" "" "Probands of both families are presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203127" "01177" "00265330" "03256" "Unknown" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203128" "01177" "00265331" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203129" "01177" "00265332" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203130" "01177" "00265333" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203131" "01177" "00265334" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203132" "01177" "00265335" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203133" "01177" "00265336" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203134" "01177" "00265337" "03256" "Unknown" "" "Proband presenting with a HAE phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203143" "01177" "00265346" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203144" "01177" "00265347" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203145" "01177" "00265348" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203146" "01177" "00265349" "03256" "Isolated (sporadic)" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203147" "01177" "00265350" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203148" "01177" "00265351" "03256" "Unknown" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203154" "01177" "00265357" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203155" "01177" "00265358" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203156" "01177" "00265359" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "03y" "36y" "" "" "" "" "" "" "" ""
"0000203157" "01177" "00265360" "03256" "Familial" "" "Two carrying families.\r\nBoth probands are presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203158" "01177" "00265366" "03256" "Familial" "" "Probands presenting with a HAE type II phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203160" "01177" "00265368" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203161" "01177" "00265369" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203165" "01177" "00265373" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203166" "01177" "00265374" "03256" "Familial" "" "Proband presenting with a non-characterized HAE phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203167" "01177" "00265375" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203168" "01177" "00265376" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203177" "01177" "00265385" "03256" "Familial" "" "Proband presenting a HAE phenotype, with an initial type I biological identification and next characterized as an intermediate type with oligomers." "" "" "" "" "" "" "" "" "" ""
"0000203180" "01177" "00265388" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203181" "01177" "00265389" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203212" "01177" "00265398" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203213" "01177" "00265400" "03256" "Isolated (sporadic)" "" "Proband presenting with a HAE type I phenotype" "13y" "" "" "" "" "" "" "69y" "" ""
"0000203229" "01177" "00265426" "03256" "Familial" "" "proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203230" "01177" "00265427" "03256" "Unknown" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203231" "01177" "00265428" "03256" "Familial" "" "Two Italian families described by Pappalardo 2008 and Bafunno 2014\r\nProbands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203232" "01177" "00265429" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203233" "01177" "00265430" "03256" "Familial" "" "proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203234" "01177" "00265431" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203235" "01177" "00265432" "03256" "Familial" "" "proband presenting with a HAE type I phenotype" "20y" "" "" "" "" "" "" "35y" "" ""
"0000203237" "01177" "00265434" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203241" "01177" "00265443" "03256" "Isolated (sporadic)" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203242" "01177" "00265445" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203243" "01177" "00265446" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203244" "01177" "00265447" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203245" "01177" "00265448" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203280" "01177" "00265483" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203283" "01177" "00265489" "03256" "Familial" "" "Proband presnting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203300" "01177" "00265508" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203301" "01177" "00265511" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203313" "01177" "00265525" "03256" "Familial" "" "Proband presenting with a severe HAE type I phenotype" "06y" "" "" "" "" "" "" "41y" "" ""
"0000203314" "01177" "00265526" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203315" "01177" "00265527" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203316" "01177" "00265528" "03256" "Familial" "" "At least three pedigrees are carrying the c.1279del variant, Italy, China, Denmark\r\nProbands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203317" "01177" "00265529" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203318" "01177" "00265530" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203319" "01177" "00265531" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203320" "01177" "00265532" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203321" "01177" "00265533" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203322" "01177" "00265535" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203364" "01177" "00265577" "03256" "Familial" "" "Probably two independent Italian pedigrees are carrying the c.1316delC variant, with probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203365" "01177" "00265578" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "23y" "35y" "" "" "" "" "" "" "" ""
"0000203366" "01177" "00265579" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203367" "01177" "00265580" "03256" "Unknown" "" "Proband likely to present with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203368" "01177" "00265581" "03256" "Isolated (sporadic)" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203370" "01177" "00265583" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203371" "01177" "00265584" "03256" "Unknown" "" "Proband likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203380" "01177" "00265593" "03256" "Familial" "" "proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203381" "01177" "00265594" "03256" "Unknown" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203382" "01177" "00265595" "03256" "Familial" "" "proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203383" "01177" "00265596" "03256" "Familial" "" "proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203389" "01177" "00265602" "03256" "Familial" "" "Probands likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203390" "01177" "00265603" "03256" "Familial" "" "Proband likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203391" "01177" "00265604" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203392" "01177" "00265605" "03256" "Familial" "" "Proband presenting with a HAE type II phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203393" "01177" "00265606" "03256" "Familial" "" "Proband likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203394" "01177" "00265607" "03256" "Familial" "" "Proband presenting with a likely HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203395" "01177" "00265608" "03256" "Unknown" "" "Proband carrying both variants in a cis configuration is presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203396" "01177" "00265609" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203397" "01177" "00265610" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203398" "01177" "00265611" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203399" "01177" "00265612" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203400" "01177" "00265613" "03256" "Familial" "" "Proband likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203401" "01177" "00265614" "03256" "Familial" "" "Proband likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203402" "01177" "00265615" "03256" "Familial" "" "Probands likely presenting with a HAE type phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203403" "01177" "00265616" "03256" "Familial" "" "Proband likeley presenting a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203404" "01177" "00265617" "03256" "Unknown" "" "Probands without consistent information on HAE clinical phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203406" "01177" "00265619" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203407" "01177" "00265620" "03256" "Familial" "" "Probands likely presenting a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203408" "01177" "00265621" "03256" "Unknown" "" "No HAE phenotype has been recorded" "" "" "" "" "" "" "" "" "" ""
"0000203409" "01177" "00265622" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203410" "01177" "00265623" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203411" "01177" "00265624" "03256" "Unknown" "" "No clinical phenotype for the c.227C>T proband" "" "" "" "" "" "" "" "" "" ""
"0000203412" "01177" "00265625" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203413" "01177" "00265626" "03256" "Familial" "" "Probands are presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203414" "01177" "00265627" "03256" "Familial" "" "Probands of five pedigrees are presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203415" "01177" "00265628" "03256" "Familial" "" "Probands of two pedigrees (Germany, Norway) are presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203416" "01177" "00265629" "03256" "Familial" "" "Probands are presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203417" "01177" "00265630" "03256" "Familial" "" "Probands of four pedigrees are presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203418" "01177" "00265631" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203421" "01177" "00265634" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203422" "01177" "00265635" "03256" "Familial" "" "Proband likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203423" "01177" "00265636" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203424" "01177" "00265637" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203425" "01177" "00265638" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203426" "01177" "00265639" "03256" "Familial" "" "Proband likely presenting a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203428" "01177" "00265641" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "12y" "" "" "" "" "" "" "42y" "" ""
"0000203429" "01177" "00265642" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203430" "01177" "00265643" "03256" "Unknown" "" "Probands likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203431" "01177" "00265644" "03256" "Unknown" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203484" "01177" "00265699" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203487" "01177" "00265702" "03256" "Familial" "" "Two pedigrees have been recorded, Portugal, Macedonia\r\nProbands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203488" "01177" "00265703" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "25y" "" "" "" "" "" "" "47y" "" ""
"0000203489" "01177" "00265704" "03256" "Familial" "" "Probands presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203490" "01177" "00265705" "03256" "Familial" "" "proband likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203491" "01177" "00265706" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203493" "01177" "00265708" "03256" "Unknown" "" "probands presenting with a HAE-C1INH phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203494" "01177" "00265709" "03256" "Familial" "" "proband likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203495" "01177" "00265710" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203496" "01177" "00265711" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203497" "01177" "00265712" "03256" "Familial" "" "probands likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203498" "01177" "00265713" "03256" "Familial" "" "proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203499" "01177" "00265714" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203501" "01177" "00265716" "03256" "Familial" "" "probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203502" "01177" "00265717" "03256" "Familial" "" "Proband likely presenting a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203504" "01177" "00265719" "03256" "Familial" "" "Proband likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203505" "01177" "00265720" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203506" "01177" "00265721" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203507" "01177" "00265722" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203529" "01177" "00265742" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203530" "01177" "00265743" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203531" "01177" "00265744" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203532" "01177" "00265745" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203533" "01177" "00265746" "03256" "Unknown" "" "Proband without diagnosis information" "" "" "" "" "" "" "" "" "" ""
"0000203535" "01177" "00265748" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203536" "01177" "00265749" "03256" "Isolated (sporadic)" "" "probands likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203537" "01177" "00265750" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203538" "01177" "00265751" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203539" "01177" "00265752" "03256" "Familial" "" "Proband likely presenting a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203540" "05412" "00265753" "03256" "Unknown" "" "Patients presenting with age-related macular degeneration" "" "" "" "" "" "" "" "" "" ""
"0000203541" "01177" "00265754" "03256" "Unknown" "" "Probands likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203542" "01177" "00265755" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203543" "01177" "00265756" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203544" "01177" "00265757" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203545" "01177" "00265758" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203546" "01177" "00265759" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203547" "01177" "00265760" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203548" "01177" "00265761" "03256" "Unknown" "" "Proband likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203549" "01177" "00265762" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203550" "01177" "00265763" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203619" "01177" "00265834" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203622" "01177" "00265837" "03256" "Familial" "" "Proband carrying the c.800C>T variant is affected when occurring as a compound heterozygous with a c.203C>T variant; 3 affected compound heterozygotes out of 5 HAE siblings" "" "" "" "" "" "" "" "" "" ""
"0000203623" "01177" "00265838" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203624" "01177" "00265839" "03256" "Familial" "" "proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203627" "01177" "00265842" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203628" "01177" "00265843" "03256" "Familial" "" "Proband presenting with a HAE type II phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203629" "01177" "00265844" "03256" "Familial" "" "Probands likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203630" "01177" "00265845" "03256" "Familial" "" "Proband likely presenting with a HAE type I phenotype\r\nThree affected individuals, severe (n=1), moderate (n=1), mild (n=1)" "" "" "" "" "" "" "" "" "" ""
"0000203631" "01177" "00265846" "03256" "Familial" "" "proband likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203634" "01177" "00265849" "03256" "Familial" "" "Proband likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203635" "01177" "00265850" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203636" "01177" "00265851" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203637" "01177" "00265852" "03256" "Familial" "" "probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203638" "01177" "00265853" "03256" "Familial" "" "proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203639" "01177" "00265854" "03256" "Familial" "" "proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203640" "01177" "00265855" "03256" "Familial" "" "proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203641" "01177" "00265856" "03256" "Familial" "" "Proband likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203642" "01177" "00265857" "03256" "Familial" "" "proband likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203643" "01177" "00265858" "03256" "Familial" "" "proband likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203644" "01177" "00265859" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203646" "01177" "00265861" "03256" "Familial" "" "Probands likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203647" "01177" "00265862" "03256" "Familial" "" "Probands likely presenting with a HAE type I phenotype. A Turkish proband is presenting with an exceptional ereteral edema and hydronephrosis." "" "" "" "" "" "" "" "" "" ""
"0000203648" "01177" "00265863" "03256" "Familial" "" "Proband likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203652" "01177" "00265871" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203653" "01177" "00265873" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203654" "01177" "00265874" "03256" "Familial" "" "Probands likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203655" "01177" "00265875" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203656" "01177" "00265876" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype\r\nBrazilian family presenting with severe (n=1) and asymptomatic (n=1) individuals" "" "" "" "" "" "" "" "" "" ""
"0000203657" "01177" "00265877" "03256" "Familial" "" "Probands likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203661" "01177" "00265881" "03256" "Familial" "" "Female proband and her son presenting with HAE of the intermediate type where low antigenic C1-INH is associated with a co-expression of both wt and c.1033G>C alleles" "" "" "" "" "" "" "" "" "" ""
"0000203664" "01177" "00265885" "03256" "Familial" "" "probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203665" "01177" "00265886" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203666" "01177" "00265887" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203667" "01177" "00265888" "03256" "Familial" "" "Probands in two families likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203668" "01177" "00265889" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "30y" "" "" "" "" "" "" "" ""
"0000203669" "01177" "00265890" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203670" "01177" "00265891" "03256" "Familial" "" "Proband presenting with a HAE type I" "" "" "" "" "" "" "" "" "" ""
"0000203671" "01177" "00265892" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203672" "01177" "00265893" "03256" "Familial" "" "The female proband of the Chinese family is presenting with a HAE type 1 phenotype with attacks on limbs, abdomen (incl severe abdominal pain requiring bed rest), perineum, buttocks." "" "" "" "" "" "" "" "" "" ""
"0000203673" "01177" "00265894" "03256" "Familial" "" "Proband likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203674" "01177" "00265895" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203675" "01177" "00265896" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203677" "01177" "00265898" "03256" "Familial" "" "probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203678" "01177" "00265900" "03256" "Familial" "" "Probands presenting with a HAE of the intermediate type, where low antigenic C1-INH is associated with a co-expression of both wt and c.1418T>A variant product" "" "" "" "" "" "" "" "" "" ""
"0000203679" "01177" "00265902" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203694" "01177" "00265916" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203762" "01177" "00265982" "03256" "Familial" "" "Proband likely presenting a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203763" "01177" "00265983" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203764" "01177" "00265984" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203765" "01177" "00265985" "03256" "Familial" "" "Proband likely presenting a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203766" "01177" "00265986" "03256" "Familial" "" "Probands presenting with a HAE type II phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203880" "01177" "00266100" "03256" "Familial" "" "Probands presenting with a HAE type II phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203881" "01177" "00266101" "03256" "Familial" "" "Proband presenting with a HAE type II phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203886" "01177" "00266106" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203887" "01177" "00266107" "03256" "Familial" "" "Proband presenting with a HAE type i phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203888" "01177" "00266108" "03256" "Isolated (sporadic)" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203889" "01177" "00266109" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203890" "01177" "00266110" "03256" "Unknown" "" "No phenotype recorded for a c.1257C>A variant" "" "" "" "" "" "" "" "" "" ""
"0000203891" "01177" "00266111" "03256" "Familial" "" "Proband likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203892" "01177" "00266112" "03256" "Familial" "" "Proband likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203893" "01177" "00266113" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203900" "01177" "00266120" "03256" "Familial" "" "Proband presenting with a HAE type II phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203907" "01177" "00266127" "03256" "Unknown" "" "Proband presenting with a HAE type II phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203908" "01177" "00266128" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203909" "01177" "00266129" "03256" "Familial, autosomal recessive" "" "Homozygous probands with a HAE type I phenotype; two female homozygous individuals and one heterozygous affected male individual (1/3) have been recorded in this family." "" "" "" "" "" "" "" "" "" ""
"0000203910" "01177" "00266130" "03256" "Familial, autosomal recessive" "" "Homozygous probands presenting with a severe HAE type I phenotype\r\na single male heterozygous individual (1/3) presenting with a mild clinical phenotype, later disease onset, attacks with low frequency" "" "" "" "" "" "" "" "" "" ""
"0000203911" "01177" "00266131" "03256" "Familial" "" "Proband likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203912" "01177" "00266132" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203913" "01177" "00265576" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203914" "01177" "00266133" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203915" "01177" "00266134" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203916" "01177" "00266135" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203917" "01177" "00266136" "03256" "Familial" "" "Proband likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203918" "01177" "00266137" "03256" "Familial" "" "Compound heterozygous proband with a c.[1282T>C];[1342G>C] variant and presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203919" "01177" "00266139" "03256" "Familial" "" "Proband likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203920" "01177" "00266140" "03256" "Familial" "" "Probands likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203921" "01177" "00266141" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203922" "01177" "00266142" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203923" "01177" "00266143" "03256" "Familial" "" "Probands presenting with a HAE type II phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203926" "01177" "00266147" "03256" "Familial" "" "Proband presenting with a HAE type II phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203927" "01177" "00266148" "03256" "Familial" "" "Proband not identified with a type I or type II HAE" "" "" "" "" "" "" "" "" "" ""
"0000203941" "01177" "00266163" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "10y" "" "" "" "" "" "" "" ""
"0000203942" "01177" "00266166" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype; one sibling carrier is asymptomatic" "13y" "34y" "" "" "" "" "" "" "" ""
"0000203943" "01177" "00266167" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203944" "01177" "00266168" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203945" "01177" "00266169" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203953" "01177" "00266178" "03256" "Familial" "" "Proband presenting with a HAE type II phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203954" "01177" "00266179" "03256" "Isolated (sporadic)" "" "Proband presenting with a HAE type II phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203955" "01177" "00266180" "03256" "Familial" "" "Proband presenting with a HAE type II phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203956" "01177" "00266181" "03256" "Familial" "" "A single pedigree with 2 homozygous affected individuals; only 1/5 heterozygous individual has been recorded as affected.\r\nBoth patients had a complement profile similar to that found in acquired HAE, i.e., they had undetectable C1q levels, reduced C1s levels, the circulating active form of C1r, and C1INH that was mostly in its cleaved inactive form in plasma." "" "" "" "" "" "" "" "" "" ""
"0000203980" "01177" "00266203" "03256" "Familial" "" "Probands presenting with a HAE of the intermediate type, where a low antigenic C1Inh is associated with a co-expression of both c.1397G>T and wt alleles.\r\nSlovakian family members are presenting with a mild course of disease - from 1 to 2 attacks per year without laryngeal edemas and symptom onset between 3 to 21 years" "" "" "" "" "" "" "" "" "" ""
"0000203981" "01177" "00266205" "03256" "Familial" "" "proband presenting with a HAE type II phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203982" "01177" "00266206" "03256" "Familial" "" "Proband presenting with a HAE type II phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203983" "01177" "00266207" "03256" "Unknown" "" "Few informations on the heterozygous proband, possibly presenting with a HAE type II phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203992" "01177" "00266216" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203993" "01177" "00266217" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203994" "01177" "00266218" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203995" "01177" "00266219" "03256" "Isolated (sporadic)" "" "De novo proband presenting with a HAE type I phenotype" "07y" "42y" "" "" "" "" "" "" "" ""
"0000203996" "01177" "00266220" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203997" "01177" "00266221" "03256" "Isolated (sporadic)" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203998" "01177" "00266222" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000203999" "01177" "00266223" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204000" "01177" "00266224" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204001" "01177" "00266225" "03256" "Unknown" "" "No information on a HAE phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204002" "01177" "00266226" "03256" "Familial" "" "Probands presenting with a HAE type II phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204003" "01177" "00266227" "03256" "Familial" "" "Probands presenting with a HAE type II phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204004" "01177" "00266228" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204005" "01177" "00266229" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204006" "01177" "00266230" "03256" "Familial" "" "Probands presenting with a HAE of the intermediate type, where low antigenic C1Inh are associated with a co-expression of p.(Pro476Ser) and wt alleles." "" "" "" "" "" "" "" "" "" ""
"0000204007" "01177" "00266231" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204009" "01177" "00266233" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204010" "01177" "00266234" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204011" "01177" "00266235" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204012" "01177" "00266236" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204015" "01177" "00266238" "03256" "Unknown" "" "Proband likely presenting with a HAE of the intermediate type, where low antigenic C1Inh is associated with a co-expression of p.(Pro476Thr) and wt alleles" "" "" "" "" "" "" "" "" "" ""
"0000204018" "01177" "00266242" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204019" "01177" "00266243" "03256" "Familial" "" "Proband likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204020" "01177" "00266244" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204021" "01177" "00266245" "03256" "Familial" "" "Probands likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204022" "01177" "00266246" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204023" "01177" "00266248" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204024" "01177" "00266249" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204025" "01177" "00266250" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204028" "01177" "00266252" "03256" "Isolated (sporadic)" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204029" "01177" "00266253" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype. Spanish proband with impaired C1INH function assay - 12.05 % compared to a healthy donor." "" "" "" "" "" "" "" "" "" ""
"0000204046" "01177" "00266271" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204047" "01177" "00266272" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204048" "01177" "00266273" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204049" "01177" "00266274" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype; a Spanish proband presenting low antigenic C1-INH with impaired C1INH function - 31.64% compared to a healthy donor." "" "" "" "" "" "" "" "" "" ""
"0000204050" "01177" "00266275" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204052" "01177" "00266276" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204054" "01177" "00266278" "03256" "Unknown" "" "No information on the HAE phenotype of the proband" "" "" "" "" "" "" "" "" "" ""
"0000204055" "01177" "00266279" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204056" "01177" "00266280" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204057" "01177" "00266281" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204058" "01177" "00266282" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204059" "01177" "00266283" "03256" "Familial" "" "Probands likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204060" "01177" "00266284" "03256" "Unknown" "" "Unpublished information on proband HAE phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204061" "01177" "00266285" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204062" "01177" "00266286" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204063" "01177" "00266287" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype\r\nThe Taiwan proband is presenting with a Graves\' disease" "" "" "" "" "" "" "" "" "" ""
"0000204064" "01177" "00266288" "03256" "Familial" "" "Female proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204071" "01177" "00266295" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204072" "01177" "00266296" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204073" "01177" "00266297" "03256" "Unknown" "" "Probands likely presenting with a HAE-nC1-INH phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204074" "01177" "00266298" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204075" "01177" "00266299" "03256" "Familial, autosomal dominant" "" "Probands presenting with a HAE type 1 clinical phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204076" "01177" "00266300" "03256" "Unknown" "" "Proband without clinical record" "" "" "" "" "" "" "" "" "" ""
"0000204077" "01177" "00266301" "03256" "Unknown" "" "Proband without information on HAE clinical phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204078" "01177" "00266302" "03256" "Unknown" "" "Probands without information on a clinical phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204081" "01177" "00266305" "03256" "Unknown" "" "Proband without information on her/his clinical phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204082" "01177" "00266306" "03256" "Familial" "" "Both probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204084" "01177" "00266307" "03256" "Unknown" "" "No information on clinical phenotype of the proband" "" "" "" "" "" "" "" "" "" ""
"0000204085" "01177" "00266308" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204086" "01177" "00266309" "03256" "Familial" "" "Proband likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204087" "01177" "00266310" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204088" "01177" "00266311" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204090" "01177" "00266313" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204091" "01177" "00266314" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204092" "01177" "00266315" "03256" "Unknown" "" "No information on the HAE clinical phenotype of the proband" "" "" "" "" "" "" "" "" "" ""
"0000204093" "01177" "00266317" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204095" "01177" "00266319" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204096" "01177" "00266320" "03256" "Familial" "" "probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204097" "01177" "00266321" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204098" "01177" "00266322" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204099" "01177" "00266323" "03256" "Familial" "" "Proband likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204100" "01177" "00266324" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204101" "01177" "00266325" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204105" "01177" "00266328" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204106" "01177" "00266329" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204107" "01177" "00266331" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204108" "01177" "00266332" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204109" "01177" "00266333" "03256" "Familial" "" "Probands likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204110" "01177" "00266335" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204111" "01177" "00266336" "03256" "Familial" "" "Probands likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204112" "01177" "00266337" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204113" "01177" "00266338" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "19y" "" "" "" "" "" "" "42y" "" ""
"0000204114" "01177" "00266339" "03256" "Familial" "" "French proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204115" "01177" "00266340" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204116" "01177" "00266341" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204117" "01177" "00266342" "03256" "Unknown" "" "No information on HAE phenotype of the proband" "" "" "" "" "" "" "" "" "" ""
"0000204118" "01177" "00266343" "03256" "Familial" "" "Probands likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204119" "01177" "00266344" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204120" "01177" "00266345" "03256" "Familial" "" "Probands likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204121" "01177" "00266346" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204122" "01177" "00266348" "03256" "Familial" "" "Homozygous female proband and her homozygous sister presenting with a HAE type I phenotype; 5 heterozygous siblings presenting with a mild phenotype or non affected" "" "" "" "" "" "" "" "" "" ""
"0000204125" "01177" "00266359" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204126" "01177" "00266360" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204128" "01177" "00266362" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204129" "01177" "00266363" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204130" "01177" "00266364" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204131" "01177" "00266365" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204132" "01177" "00266366" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204133" "01177" "00266367" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204134" "01177" "00266368" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204135" "01177" "00266369" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204136" "01177" "00266370" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204137" "01177" "00266371" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204138" "01177" "00266372" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204139" "01177" "00266373" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204140" "01177" "00266374" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204141" "01177" "00266375" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204142" "01177" "00266376" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204143" "01177" "00266377" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204146" "00000" "00266379" "03256" "-" "" "No clinical phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204148" "00000" "00266380" "03256" "-" "" "No clinical information" "" "" "" "" "" "" "" "" "" ""
"0000204160" "01177" "00264013" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "28y" "" ""
"0000204198" "01177" "00266460" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204220" "01177" "00266473" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204363" "01177" "00266628" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204368" "01177" "00266659" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204369" "01177" "00266660" "03256" "Familial" "" "De novo proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204371" "01177" "00266662" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204372" "01177" "00266663" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204373" "01177" "00266664" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204374" "01177" "00266665" "03256" "Unknown" "" "Proband likely presenting a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204375" "01177" "00266666" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204376" "01177" "00266667" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204377" "01177" "00266668" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204379" "01177" "00266670" "03256" "Familial" "" "Proband likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204380" "01177" "00266671" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204381" "01177" "00266672" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204382" "01177" "00266673" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204952" "01177" "00267016" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204953" "01177" "00267017" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204954" "01177" "00267018" "03256" "Familial" "" "proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204955" "01177" "00267019" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204956" "01177" "00267020" "03256" "Familial" "" "proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204957" "01177" "00267021" "03256" "Familial" "" "proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204958" "01177" "00267022" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204959" "01177" "00267023" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204960" "01177" "00267024" "03256" "Familial" "" "Compoud heterozygous proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204964" "01177" "00267026" "03256" "Familial" "" "probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204970" "01177" "00267040" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204971" "01177" "00267041" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204972" "01177" "00267042" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204973" "01177" "00267043" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204974" "01177" "00267044" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000204975" "01177" "00267045" "03256" "Unknown" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000205085" "01177" "00267240" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000205086" "01177" "00267241" "03256" "Familial" "" "Proband resenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000205087" "01177" "00267242" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000205088" "01177" "00267243" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000205093" "01177" "00267250" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000205094" "01177" "00267251" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000205095" "01177" "00267252" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000205096" "01177" "00267253" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000206949" "01177" "00269106" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000206950" "01177" "00269107" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000206952" "01177" "00269110" "03256" "Unknown" "" "Proband likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000206953" "01177" "00269111" "03256" "Unknown" "" "Proband likely presenting with a HAE type i phenotype" "" "" "" "" "" "" "" "" "" ""
"0000206954" "01177" "00269113" "03256" "Familial" "" "proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000207137" "01177" "00269303" "03256" "Isolated (sporadic)" "" "De novo proband\r\nNo information on a clinical phenotype" "" "" "" "" "" "" "" "" "" ""
"0000207138" "01177" "00269304" "03256" "Unknown" "" "No information on a clinical phenotype" "" "" "" "" "" "" "" "" "" ""
"0000207139" "01177" "00269305" "03256" "Unknown" "" "No information on a clinical phenotype" "" "" "" "" "" "" "" "" "" ""
"0000207140" "00138" "00269306" "03256" "Unknown" "" "" "" "" "" "" "" "" "" "" "no record on a clinical phenotype" ""
"0000207155" "05309" "00269323" "03256" "Familial" "" "Families presenting with type I and type II Bipolar Disorder" "" "" "" "" "" "" "" "" "" ""
"0000210293" "01177" "00275695" "03256" "Familial" "" "Proband presenting with a likely type I HAE phenotype" "" "" "" "" "" "" "" "" "" ""
"0000210294" "01177" "00275696" "03256" "Familial" "" "Proband putatively presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000210295" "01177" "00275697" "03256" "Familial" "" "Proband likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000210541" "01177" "00275941" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000210555" "01177" "00276003" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype\r\nBrazilian family presenting with moderate (n=1) and mild (n=1) individuals" "" "" "" "" "" "" "" "" "" ""
"0000210699" "01177" "00276112" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype, in 3 independent pedigrees found as carrying the c.1029+384A>G variant\r\n-1. Czech family (n=19), reported by Hujová et al, 2020\r\n-2. Hungarian family (n=4), reported by ClinVar submitter accession ID VCV000870445.1\r\n-3. Japanese Family (n=2), reported by Hida et al 2023" "" "16y" "" "" "" "" "" "" "" ""
"0000230251" "01177" "00303167" "03256" "Familial, autosomal recessive" "" "Family, Turkey, with 2 female homozygous individuals (2/5) presenting with a clinical phenotype at very late disease onset age and less severe course of the disease than usually recorded and with a single male heterozygous individual (1/5) presenting with a clinical phenotype of low grade. Other carriers asymptomatic.\r\nFamily 2, Belarus, with a de novo proband; first attack at 12 years old, classified as mild with a severity score of 3 (Bygum et al 2011).\r\nFamily 4, Russia, variant found in cis configuration with c.1477G>C" "" "" "" "" "" "" "" "" "" ""
"0000235900" "01177" "00310605" "03256" "Isolated (sporadic)" "" "Acute episode of vomiting and right fossa pain, mimicking appendicitis, with a large amount of serous fluid in the abdomen. Recurrent episodes of abdominal pain." "" "" "" "" "" "" "" "" "" ""
"0000236350" "01177" "00311095" "03256" "Unknown" "" "Male patient presenting with a HAE type I phenotype" "47y" "" "" "" "" "" "" "" "" ""
"0000236351" "01177" "00311096" "03256" "Unknown" "" "Single male homozygous proband presenting with a HAE type I phenotype" "05y" "" "" "" "" "" "" "" "" ""
"0000236439" "01177" "00311191" "03256" "Familial" "" "Probands reported to display a HAE type I clinical phenotype" "" "" "" "" "" "" "" "" "" ""
"0000236626" "01177" "00311379" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "03y" "" "" "" "" "" "" "" "" ""
"0000238243" "01177" "00313943" "03256" "Unknown" "" "Proband reported to present with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000238436" "01177" "00314648" "03256" "Unknown" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000242376" "01177" "00320369" "03256" "Unknown" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000242377" "01177" "00320370" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000242379" "01177" "00320372" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000242380" "01177" "00320373" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000242381" "01177" "00320374" "03256" "Familial" "" "Probands presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000242405" "01177" "00320429" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000242406" "01177" "00320430" "03256" "Unknown" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000242407" "01177" "00320431" "03256" "Unknown" "" "Probands presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000242423" "01177" "00320446" "03256" "Unknown" "" "The c.686-179A>G variant is observed in a healthy adult individual, is predicted to be benign by multiple in silico algorithms and is found in a case with an alternate molecular basis for the disease" "" "" "" "" "" "" "" "" "" ""
"0000242721" "01177" "00324138" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000242722" "01177" "00324139" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000242724" "01177" "00324141" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000242726" "01177" "00324143" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000242727" "01177" "00324144" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000242860" "01177" "00324296" "03256" "Unknown" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000242935" "00000" "00324395" "03256" "Unknown" "" "no disease phenotype associated" "" "" "" "" "" "" "" "" "" ""
"0000245769" "01177" "00327484" "03256" "Familial" "41y" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000245771" "01177" "00327486" "03256" "Familial" "" "Two families, France and Poland\r\nProbands presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000245772" "01177" "00327487" "03256" "Familial" "22y" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000246774" "01177" "00328547" "03256" "Familial" "52y" "Proband presenting with a HAE type I phenotype\r\nFamily with 2 affected carriers" "" "" "" "" "" "" "" "" "" ""
"0000246775" "01177" "00328548" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000247214" "01177" "00329010" "03256" "Familial" "29y" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000247215" "01177" "00329011" "03256" "Familial" "41y" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000247331" "01177" "00329133" "03256" "Familial" "75y" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000247332" "01177" "00329134" "03256" "Familial" "51y" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000247353" "01177" "00329169" "03256" "Familial" "69y" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000249429" "01177" "00331237" "03256" "Familial" "" "Probands presenting with a HAE-C1-INH type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000249430" "01177" "00331238" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000249795" "01177" "00331602" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000250610" "01177" "00332426" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000250738" "01177" "00332550" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000250739" "01177" "00332551" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000254891" "02963" "00359618" "03256" "Familial" "" "Proband presenting with a HAE with normal C1 inhibitor and non identified type" "" "" "" "" "" "" "" "" "" ""
"0000257131" "01177" "00361729" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000257132" "01177" "00361731" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000257133" "01177" "00361732" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000257134" "01177" "00361733" "03256" "Familial" "" "probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000257136" "01177" "00361734" "03256" "Unknown" "" "Proband presenting with a HAE type I/II phenotype - inermediate type - from the Belarus observation" "" "" "" "" "" "" "" "" "" ""
"0000257137" "01177" "00361746" "03256" "Unknown" "" "De novo proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000257138" "01177" "00361747" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000257155" "00000" "00361762" "03256" "Unknown" "" "no clinical phenotype associated" "" "" "" "" "" "" "" "" "" ""
"0000257156" "00000" "00361763" "03256" "Unknown" "" "no clinical phenotype associated" "" "" "" "" "" "" "" "" "" ""
"0000257161" "00000" "00361767" "03256" "Unknown" "" "no clinical phenotype associated" "" "" "" "" "" "" "" "" "" ""
"0000257162" "01177" "00361768" "03256" "Unknown" "" "no clinical phenotype associated" "" "" "" "" "" "" "" "" "" ""
"0000257163" "01177" "00361769" "03256" "Unknown" "" "no clinical phenotype associated" "" "" "" "" "" "" "" "" "" ""
"0000257165" "01177" "00361771" "03256" "Unknown" "" "no clinical phenotype associated" "" "" "" "" "" "" "" "" "" ""
"0000257166" "01177" "00361772" "03256" "Unknown" "" "no clinical phenotype associated" "" "" "" "" "" "" "" "" "" ""
"0000257167" "01177" "00361773" "03256" "Unknown" "" "no clinical phenotype associated" "" "" "" "" "" "" "" "" "" ""
"0000257168" "01177" "00361774" "03256" "Unknown" "" "no clinical phenotype associated" "" "" "" "" "" "" "" "" "" ""
"0000257170" "01177" "00361776" "03256" "Unknown" "" "no clinical phenotype associated" "" "" "" "" "" "" "" "" "" ""
"0000257171" "01177" "00361777" "03256" "Unknown" "" "no clinical phenotype associated" "" "" "" "" "" "" "" "" "" ""
"0000257197" "01177" "00361803" "03256" "Familial" "" "Proband presenting with a HAE with C1-INH deficiency" "" "" "" "" "" "" "" "" "" ""
"0000257285" "01177" "00361892" "03256" "Unknown" "" "no HAE clinical phenotype" "" "" "" "" "" "" "" "" "" ""
"0000257306" "01177" "00361910" "03256" "Unknown" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000257307" "01177" "00361911" "03256" "Unknown" "" "Proband likely presenting with a HAE phenotype" "" "" "" "" "" "" "" "" "" ""
"0000257308" "01177" "00361912" "03256" "Familial" "" "Proband(s) presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000257445" "01177" "00362032" "03256" "Familial" "" "Proband presenting with a HAE phenotype, no biological typing" "" "" "" "" "" "" "" "" "" ""
"0000257446" "01177" "00362033" "03256" "Familial" "" "Variant c.1250-154C>G is observed in 2 patients (trans with the c.-22-155G > T variant) and one healthy member of the studied family." "" "" "" "" "" "" "" "" "" ""
"0000257447" "01177" "00362034" "03256" "Unknown" "" "confused clinical observation" "" "" "" "" "" "" "" "" "" ""
"0000257448" "01177" "00362035" "03256" "Familial" "" "Proband presenting with a HAE phenotype" "" "" "" "" "" "" "" "" "" ""
"0000257449" "01177" "00362036" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000269007" "01177" "00373797" "03256" "Familial" "" "Proband reported as presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000271345" "01177" "00376134" "03256" "Familial" "" "" "" "" "" "" "" "" "" "" "" ""
"0000271347" "01177" "00376136" "03256" "Familial" "" "" "" "" "" "" "" "" "" "" "" ""
"0000273532" "01177" "00379688" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000273535" "01177" "00379691" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000273536" "01177" "00379692" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000273537" "01177" "00379693" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000273539" "01177" "00379694" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000273540" "01177" "00379695" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000273541" "01177" "00379696" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000273542" "01177" "00379697" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000273543" "01177" "00379698" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000273574" "01177" "00379722" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000273577" "01177" "00379723" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000273578" "01177" "00379724" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000273579" "01177" "00379725" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000273580" "01177" "00379726" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000273581" "01177" "00379727" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000273582" "01177" "00379728" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000273584" "01177" "00379730" "03256" "Familial" "" "Both probands are presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000273585" "01177" "00379731" "03256" "Familial" "" "Probands are presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000273586" "01177" "00379732" "03256" "Familial" "" "Probands are presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000273587" "01177" "00379733" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000273588" "01177" "00379734" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000273589" "01177" "00379735" "03256" "Familial" "" "Proband presenting with a HAE phenotype" "" "" "" "" "" "" "" "" "" ""
"0000273590" "01177" "00379736" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000273591" "01177" "00379737" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000273592" "01177" "00379738" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000273593" "01177" "00379739" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000273594" "01177" "00379740" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000273595" "01177" "00379741" "03256" "Familial, autosomal recessive" "" "Homozygous proband and her two homozygous sisters are presenting with a HAE type I phenotype; heterozygous individuals are asymptomatic" "" "" "" "" "" "" "" "" "" ""
"0000273596" "01177" "00379742" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000274024" "01177" "00380169" "03256" "Familial, autosomal dominant" "" "An affected family documented for a juvenile-onset LES associated with HAE: Two children (son and daughter) with juvenile-onset SLE and the father with HAE" "" "" "" "" "" "" "" "" "" ""
"0000276814" "01177" "00382959" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000276831" "01177" "00324294" "03256" "Familial" "" "Proband affected by HAE; not typed on biological data" "" "" "" "" "" "" "" "" "" ""
"0000276832" "01177" "00324295" "03256" "Isolated (sporadic)" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000278338" "00000" "00384555" "03256" "Unknown" "" "no clinical phenotype" "" "" "" "" "" "" "" "" "" ""
"0000278342" "00000" "00384558" "03256" "Unknown" "" "no clinical phenotype" "" "" "" "" "" "" "" "" "" ""
"0000278397" "01177" "00384607" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000278398" "01177" "00384608" "03256" "Familial" "" "no information on a clinical phenotype" "" "" "" "" "" "" "" "" "" ""
"0000278399" "01177" "00384609" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000280922" "00000" "00387358" "03256" "Unknown" "" "No clinical record" "" "" "" "" "" "" "" "" "" ""
"0000280934" "01177" "00387369" "03256" "Familial" "" "No indication of an associated phenotype" "" "" "" "" "" "" "" "" "" ""
"0000280971" "01177" "00387408" "03256" "Familial" "" "No clinical phenotype indicated" "" "" "" "" "" "" "" "" "" ""
"0000280972" "01177" "00387409" "03256" "Familial" "" "No clinical phenotype associated with this variant" "" "" "" "" "" "" "" "" "" ""
"0000284833" "00000" "00391496" "03256" "Familial" "" "no clinical phenotype" "" "" "" "" "" "" "" "" "" ""
"0000286010" "01177" "00392764" "03256" "Familial" "" "Probands presenting with a HAE of intermediate type phenotype" "" "" "" "" "" "" "" "" "" ""
"0000291348" "01177" "00398236" "03256" "Familial" "" "A family with 3 affected female patients and presenting with a HAE-I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000291734" "01177" "00398651" "03256" "Familial" "" "Two female probands presenting a HAE type I phenotype; both parents are asymptomatic non carriers on germinal cells" "" "" "" "" "" "" "" "" "" ""
"0000295608" "01177" "00402847" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000297424" "01177" "00404859" "03256" "Familial" "" "Patient presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000297977" "01177" "00405454" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000297982" "01177" "00405459" "03256" "Familial" "" "proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000297983" "01177" "00405460" "03256" "Familial" "" "Female proband presenting with HAE that could be provisionally characterized as a type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000297984" "01177" "00405461" "03256" "Unknown" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000297985" "01177" "00405462" "03256" "Unknown" "" "Proband presenting with a HAE type I phenotype with a decreased level of antigenic C1-INH and C4 as well as deficient function of C1-INH." "" "" "" "" "" "" "" "" "" ""
"0000298300" "01177" "00405803" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000299131" "01177" "00406680" "03256" "Familial" "" "Proband likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000299181" "01177" "00406730" "03256" "Familial" "" "" "" "" "" "" "" "" "" "" "" ""
"0000299182" "01177" "00406731" "03256" "Unknown" "" "no information on clinical phenotype" "" "" "" "" "" "" "" "" "" ""
"0000299183" "01177" "00406732" "03256" "Unknown" "" "No information on the proband phenotype" "" "" "" "" "" "" "" "" "" ""
"0000299186" "01177" "00406735" "03256" "Unknown" "" "Russian proband presenting with a HAE-I phenotype.\r\nNo information by LabCorp Genetics San Francisco CA on the proband clinical and biological phenotypes" "" "" "" "" "" "" "" "" "" ""
"0000300897" "01177" "00408782" "03256" "Familial" "" "proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000308510" "01177" "00416999" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000308512" "01177" "00417001" "03256" "Familial" "" "Proband presenting with a HAE type 1 variant" "" "" "" "" "" "" "" "" "" ""
"0000308513" "01177" "00417002" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000308516" "01177" "00417004" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000308518" "01177" "00417007" "03256" "Familial" "" "Proband presenting with a HAE-1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000308761" "01177" "00417246" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000308762" "01177" "00417247" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000308763" "01177" "00417248" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000308764" "01177" "00417249" "03256" "Familial" "" "Probands presenting with a HAE-I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000308766" "01177" "00417251" "03256" "Familial" "" "Proband presenting with a HAE-I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000308767" "01177" "00417252" "03256" "Familial" "" "Proband presenting with a HAE-I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000308768" "01177" "00417253" "03256" "Familial" "" "Proband presenting with a HAE-I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000308791" "01177" "00417286" "03256" "Familial" "" "Probands presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000308792" "01177" "00417287" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000308793" "01177" "00417290" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000308794" "01177" "00417291" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000308795" "01177" "00417295" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000308796" "01177" "00417297" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000308817" "01177" "00417329" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000308818" "00000" "00417331" "03256" "Unknown" "" "Healthy individual" "" "" "" "" "" "" "" "" "" ""
"0000308819" "00000" "00417332" "03256" "Unknown" "" "Healthy individual" "" "" "" "" "" "" "" "" "" ""
"0000308820" "00000" "00417333" "03256" "Unknown" "" "Healthy individual" "" "" "" "" "" "" "" "" "" ""
"0000308822" "00000" "00417335" "03256" "Unknown" "" "Healthy individual" "" "" "" "" "" "" "" "" "" ""
"0000308823" "01177" "00417336" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000308824" "00000" "00417337" "03256" "Unknown" "" "Healthy individual" "" "" "" "" "" "" "" "" "" ""
"0000308825" "00000" "00417338" "03256" "Unknown" "" "Healthy individual" "" "" "" "" "" "" "" "" "" ""
"0000308826" "01177" "00417339" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000308827" "01177" "00417340" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000308828" "01177" "00417341" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000308829" "00000" "00417342" "03256" "Unknown" "" "Healthy individual" "" "" "" "" "" "" "" "" "" ""
"0000308830" "01177" "00417343" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000308831" "01177" "00417344" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000308832" "01177" "00417345" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000308833" "00000" "00417346" "03256" "Unknown" "" "Healthy individual" "" "" "" "" "" "" "" "" "" ""
"0000308834" "01177" "00417347" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000308835" "01177" "00417348" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000308836" "01177" "00417349" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000308837" "01177" "00417350" "03256" "Familial" "" "Probands presenting with a HAE-I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000308838" "01177" "00417351" "03256" "Unknown" "" "The proband phenotype is not described" "" "" "" "" "" "" "" "" "" ""
"0000308915" "01177" "00417429" "03256" "Familial" "" "Proband presenting with a HAE-I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000308917" "01177" "00417431" "03256" "Familial" "" "Proband presenting with a HAE-I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000308920" "01177" "00417434" "03256" "Familial" "" "Proband presenting with a HAE-I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000308922" "01177" "00417436" "03256" "Familial" "" "Proband presenting with a HAE-I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000308923" "01177" "00417437" "03256" "Familial" "" "Proband presenting with a HAE-1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000308924" "01177" "00417438" "03256" "Familial" "" "Proband presenting with a HAE-I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000308925" "01177" "00417439" "03256" "Familial" "" "Proband presenting with a HAE-I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000308926" "01177" "00417440" "03256" "Familial" "" "Proband presenting with a HAE-I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000309238" "01177" "00417865" "03256" "Familial" "" "Proband presenting with a HAE-I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000314431" "06944" "00423227" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000314432" "01177" "00423228" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000314433" "01177" "00423229" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000314434" "01177" "00423230" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000314435" "01177" "00423231" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000315984" "01177" "00424788" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000315985" "01177" "00424789" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000316141" "00000" "00424942" "03256" "Unknown" "" "No clinical phenotype reported to be associated with c.551-16G>C variant" "" "" "" "" "" "" "" "" "" ""
"0000316201" "00000" "00425007" "03256" "Unknown" "" "No pathological phenotype likely associated with a SERPING1 gene variant" "" "" "" "" "" "" "" "" "" ""
"0000316202" "00000" "00425008" "03256" "Unknown" "" "No pathological phenotype associated with this variant" "" "" "" "" "" "" "" "" "" ""
"0000316203" "00000" "00425009" "03256" "Unknown" "" "No clinical phenotype associated with this variant" "" "" "" "" "" "" "" "" "" ""
"0000316935" "00000" "00425760" "03256" "Unknown" "" "No clinical phenotype observed as associated with this variant" "" "" "" "" "" "" "" "" "" ""
"0000316945" "00000" "00425770" "03256" "Unknown" "" "No clinical phenotype found associated with c.518G>A variant" "" "" "" "" "" "" "" "" "" ""
"0000316957" "00000" "00425779" "03256" "Unknown" "" "No clinical phenotype found to be associated with c.540G>C variant" "" "" "" "" "" "" "" "" "" ""
"0000316967" "00000" "00425797" "03256" "Unknown" "" "No clinical phenotype found to be associated with a c.641C>G variant" "" "" "" "" "" "" "" "" "" ""
"0000316968" "00000" "00425798" "03256" "Unknown" "" "No clinical phenotype found to be associated with a c.647A>T variant" "" "" "" "" "" "" "" "" "" ""
"0000316969" "00000" "00425799" "03256" "Unknown" "" "No clinical phenotype found to be associated with a c.770C>G variant" "" "" "" "" "" "" "" "" "" ""
"0000317537" "00000" "00426385" "03256" "Unknown" "" "No clinical phenotype found associated with c.1249+12C>A variant" "" "" "" "" "" "" "" "" "" ""
"0000317538" "00000" "00426386" "03256" "Unknown" "" "No clinical phenotype found associated with a c.1249+20G>A variant" "" "" "" "" "" "" "" "" "" ""
"0000317539" "00000" "00426387" "03256" "Unknown" "" "No clinical phenotype associated with a c.1250-11T>G variant" "" "" "" "" "" "" "" "" "" ""
"0000317540" "00000" "00426388" "03256" "Unknown" "" "No clinical phenotype reported as being associated with a c.1253T>A variant" "" "" "" "" "" "" "" "" "" ""
"0000317541" "00000" "00426389" "03256" "Unknown" "" "No clinical phenotype reported as being associated with a c.1259A>G variant" "" "" "" "" "" "" "" "" "" ""
"0000317542" "00000" "00426390" "03256" "Unknown" "" "No clinical phenotype reported as being associated with a c.1273C>T variant" "" "" "" "" "" "" "" "" "" ""
"0000317543" "00000" "00426391" "03256" "Unknown" "" "No clinical phenotype reported as being associated with a c.1360G>T variant" "" "" "" "" "" "" "" "" "" ""
"0000317544" "00000" "00426392" "03256" "Unknown" "" "No clinical phenotype recorded as being associated with a c.1369G>T variant" "" "" "" "" "" "" "" "" "" ""
"0000317545" "00000" "00426393" "03256" "Unknown" "" "No clinical phenotype reported as being associated with a c.1499C>T variant" "" "" "" "" "" "" "" "" "" ""
"0000318681" "01177" "00427666" "03256" "Familial" "" "A 27y female proband presenting with a HAE type I phenotype" "" "27y" "" "" "" "" "" "" "" ""
"0000318801" "00198" "00427833" "03256" "Unknown" "" "No reported clinical phenotype for a c.559G>A" "" "" "" "" "" "" "" "" "" ""
"0000319282" "01177" "00428376" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000319283" "01177" "00428377" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000319309" "01177" "00428403" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "07y" "" "" "" "" "" "" "14y" "" ""
"0000319310" "01177" "00428404" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "08y" "11y" "" "" "" "" "" "" "" ""
"0000319311" "01177" "00428405" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000319312" "01177" "00428406" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000319317" "01177" "00428411" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000321072" "01177" "00430264" "03256" "Familial" "" "Proband presenting with a HAE clinical phenotype" "" "" "" "" "" "" "" "" "" ""
"0000321770" "01177" "00431161" "03256" "Familial" "" "Proband presenting with a HAE type i phenotype" "" "" "" "" "" "" "" "" "" ""
"0000324470" "01177" "00434103" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000324894" "06944" "00434644" "03256" "Unknown" "" "" "" "" "" "" "" "" "" "" "" ""
"0000324895" "06944" "00434645" "03256" "Unknown" "" "" "" "" "" "" "" "" "" "" "" ""
"0000324896" "00000" "00434646" "03256" "Unknown" "" "" "" "" "" "" "" "" "" "" "" ""
"0000324899" "00000" "00434650" "03256" "Unknown" "" "" "" "" "" "" "" "" "" "" "" ""
"0000324901" "01177" "00434652" "03256" "Familial" "27y" "Proband presenting with a HAE type I phenotype" "00y18m" "" "" "" "" "" "" "" "" ""
"0000324902" "01177" "00434653" "03256" "Familial" "25y" "Male proband presenting with a HAE type I phenotype" "" "13y" "" "" "" "" "" "" "" ""
"0000324903" "01177" "00434654" "03256" "Familial" "" "Male proband presenting with a HAE type I phenotype" "19y" "" "" "" "" "" "" "26y" "" ""
"0000325246" "01177" "00435005" "03256" "Familial" "32y" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000325366" "00000" "00435159" "03256" "Unknown" "" "Asymptomatic carrier" "" "" "" "" "" "" "" "" "" ""
"0000325425" "01177" "00265600" "03256" "Unknown" "" "Probands presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000325513" "01177" "00435317" "03256" "Familial" "" "Proband presenting with a hae type I phenotype" "" "07y" "" "" "" "" "" "" "" ""
"0000326581" "01177" "00436402" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000326582" "01177" "00436403" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000326583" "01177" "00436404" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000326586" "01177" "00436405" "03256" "Familial" "" "Male proband presenting with HAE type 1 phenotype; there is a disparity of severity between affected individuals of the family" "" "10y" "" "" "" "" "" "" "" ""
"0000326587" "01177" "00436406" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000326588" "01177" "00436407" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000326589" "01177" "00436408" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000326590" "01177" "00436409" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000326594" "01177" "00436413" "03256" "Familial" "" "Proband presenting with a HAE-C1-INH type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000326595" "01177" "00436415" "03256" "Familial" "" "Probands presenting with a HAE-C1-INH phenotype" "" "" "" "" "" "" "" "" "" ""
"0000326660" "01177" "00436482" "03256" "Familial" "" "Proband presenting with a HAE-C1-INH type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000326770" "01177" "00436635" "03256" "Familial" "" "De novo proband presenting with a HAE-C1-INH type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000331959" "01177" "00442612" "03256" "Familial" "" "Homozygous female carriers of the variant c.964G>A are presenting with symptoms of HAE-C1-INH" "" "" "" "" "" "" "" "" "" ""
"0000332979" "01177" "00443696" "03256" "Familial" "24y" "Proband presenting with a HAE-C1-INH type I phenotype" "14y" "" "" "" "" "" "" "" "" ""
"0000333336" "01177" "00444078" "03256" "Familial" "39y" "A male patient presenting with cerebral\r\nangioedema" "" "" "" "" "" "" "" "" "" ""
"0000334283" "01177" "00445030" "03256" "Familial" "" "Female proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000337561" "01177" "00448367" "03256" "Familial" "" "Homozygous proband presenting with a HAE type 1 phenotype" "14y" "" "" "" "" "" "" "37y" "" ""
"0000337588" "01177" "00448400" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype.\r\nOnset of symptoms in early adulthood - from 17 to\r\n20 years of age - and severe course of disease - 20 to 30 attacks per year - with abdominal, orofacial, and laryngeal attacks." "" "" "" "" "" "" "" "" "" ""
"0000337589" "01177" "00448401" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000337590" "01177" "00448402" "03256" "Isolated (sporadic)" "" "Proband presenting with a HAE type 1 phenotype" "" "32y" "" "" "" "" "" "" "" ""
"0000337591" "01177" "00448403" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000337610" "01177" "00448422" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype.\r\nPatients in this family had early onset of symptoms (from 2 to 8 years of age), severe course of disease (10–25 attacks per year) with angioedemas of extremities, face, larynx, and abdominal symptoms." "" "" "" "" "" "" "" "" "" ""
"0000337611" "01177" "00448423" "03256" "Familial" "" "Female proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000337612" "01177" "00448424" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000337669" "01177" "00448481" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000337670" "01177" "00448482" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000337671" "01177" "00448483" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000337672" "01177" "00448484" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000337673" "01177" "00448485" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype.\r\nPatients had an onset of symptoms between 2 to 26 years of age; male patient had only 1 attack per year, female patients from 20 to 51 attacks per year (the highest number in the Slovakian cohort).\r\nPartial segregation of HAE phenotype in the Chinese family." "" "" "" "" "" "" "" "" "" ""
"0000337674" "01177" "00448486" "03256" "Familial" "" "A single individual presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000337676" "01177" "00448487" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype.\r\nWhole gene deletion was associated with a severe course of disease. The patients had early onset of symptoms (from 1 to 5 years of age), developed from 8 to 27 attacks per year with laryngeal phenotype." "" "" "" "" "" "" "" "" "" ""
"0000338742" "01177" "00449568" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000340671" "01177" "00452067" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000340672" "01177" "00452068" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000340690" "01177" "00452086" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000340691" "01177" "00452087" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000340703" "01177" "00452100" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000340705" "01177" "00452102" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "30y" "" "" "" "" "" "" "" ""
"0000340706" "01177" "00452103" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "20y" "" "" "" "" "" "" "" ""
"0000340707" "01177" "00452104" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000340708" "01177" "00452105" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000340711" "01177" "00452108" "03256" "Familial" "" "Proband likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000340712" "01177" "00452109" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "10y" "" "" "" "" "" "" "" ""
"0000340713" "01177" "00452110" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000340714" "01177" "00452111" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000340715" "01177" "00452112" "03256" "Familial" "" "Proband probably presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000340716" "01177" "00452113" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000340717" "01177" "00452114" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000340718" "01177" "00452115" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000340719" "01177" "00452116" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "30y" "" "" "" "" "" "" "" ""
"0000340720" "01177" "00452117" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "31y" "" "" "" "" "" "" "" ""
"0000340721" "01177" "00452118" "03256" "Familial" "" "" "" "" "" "" "" "" "" "" "" ""
"0000340722" "01177" "00452119" "03256" "Familial" "" "Proband possibly presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000340870" "01177" "00452268" "03256" "Unknown" "" "no clinical phenotype provided" "" "" "" "" "" "" "" "" "" ""
"0000340872" "01177" "00452269" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "26y" "" "" "" "" "" "" "" ""
"0000340873" "01177" "00452270" "03256" "Unknown" "" "no information on a clinical phenotype" "" "" "" "" "" "" "" "" "" ""
"0000340874" "01177" "00452271" "03256" "Familial" "" "no information on a clinical phenotype" "" "" "" "" "" "" "" "" "" ""
"0000340875" "01177" "00452272" "03256" "Unknown" "" "no information on clinical phenotype" "" "" "" "" "" "" "" "" "" ""
"0000340876" "01177" "00452273" "03256" "Unknown" "" "no information on clinical phenotype" "" "" "" "" "" "" "" "" "" ""
"0000340877" "01177" "00452274" "03256" "Unknown" "" "no information on a clinical phenotype" "" "" "" "" "" "" "" "" "" ""
"0000340878" "01177" "00452275" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "30y" "" "" "" "" "" "" "" ""
"0000340879" "01177" "00324298" "03256" "Unknown" "" "no information on a clinical phenotype" "" "" "" "" "" "" "" "" "" ""
"0000340926" "01177" "00452322" "03256" "Unknown" "" "no information on a clinical phenotype" "" "" "" "" "" "" "" "" "" ""
"0000340927" "01177" "00452323" "03256" "Unknown" "" "no information of a clinical phenotype" "" "" "" "" "" "" "" "" "" ""
"0000340928" "01177" "00452324" "03256" "Unknown" "" "no information on a clinical phenotype" "" "" "" "" "" "" "" "" "" ""
"0000340929" "01177" "00452325" "03256" "Unknown" "" "no information on a clinical phenotype" "" "" "" "" "" "" "" "" "" ""
"0000340930" "01177" "00452326" "03256" "Unknown" "" "no information on a clinical phenotype" "" "" "" "" "" "" "" "" "" ""
"0000340931" "01177" "00452327" "03256" "Unknown" "" "no information on a clinical phenotype" "" "" "" "" "" "" "" "" "" ""
"0000340932" "01177" "00452328" "03256" "Unknown" "" "No information on a clinical phenotype from the US family.\r\nFor the Romanian family, HAE type 1 symptoms began during childhood (≤ 5 years)" "" "" "" "" "" "" "" "" "" ""
"0000343320" "01177" "00454688" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000343321" "01177" "00454689" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000343322" "01177" "00454690" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "70y" "" "" "" "" "" "" "" ""
"0000343323" "06944" "00454693" "03256" "Familial, autosomal dominant" "" "Female proband presenting with a HAE phenotype, without confirmation of a C1-INH function decrease in plasma" "" "" "" "" "" "" "" "" "" ""
"0000346432" "01177" "00457983" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "50y" "" "" "" "" "" "" "" ""
"0000346437" "01177" "00457987" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "10y" "19y" "" "" "" "" "" "" "" ""
"0000346441" "01177" "00457991" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "30y" "" "" "" "" "" "" "" ""
"0000346445" "01177" "00457995" "03256" "Isolated (sporadic)" "" "Proband presenting with a HAE type I phenotype; unknown family HAE history." "" "30y" "" "" "" "" "" "" "" ""
"0000346446" "01177" "00457996" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "10y" "" "" "" "" "" "" "" ""
"0000346447" "01177" "00457997" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "12y" "" "" "" "" "" "" "" ""
"0000346448" "01177" "00457998" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "50y" "" "" "" "" "" "" "" ""
"0000346449" "01177" "00457999" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "04y" "" "" "" "" "" "" "" ""
"0000346450" "01177" "00458000" "03256" "Isolated (sporadic)" "" "Proband presenting with a HAE type I phenotype, without a family HAE story" "" "20y" "" "" "" "" "" "" "" ""
"0000346451" "01177" "00458001" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000346452" "01177" "00458002" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000346453" "01177" "00458003" "03256" "Familial" "" "Information on proband not provided" "" "" "" "" "" "" "" "" "" ""
"0000346454" "01177" "00458004" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "20y" "" "" "" "" "" "" "" ""
"0000346455" "01177" "00458005" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "30y" "" "" "" "" "" "" "" ""
"0000346477" "01177" "00458028" "03256" "Isolated (sporadic)" "" "Proband presenting with a HAE type I phenotype" "" "10y" "" "" "" "" "" "" "" ""
"0000346478" "01177" "00458029" "03256" "Isolated (sporadic)" "" "Proband presenting with a HAE type I phenotype" "" "20y" "" "" "" "" "" "" "" ""
"0000346486" "06944" "00458037" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "36y" "" "" "" "" "" "" "" ""
"0000346493" "01177" "00458044" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "50y" "" "" "" "" "" "" "" ""
"0000346494" "01177" "00458045" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000346496" "01177" "00458048" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "20y" "" "" "" "" "" "" "" ""
"0000346497" "01177" "00458049" "03256" "Isolated (sporadic)" "" "Proband presenting with a HAE type I phenotype, with an unknown family HAE history" "" "" "" "" "" "" "" "" "" ""
"0000346498" "01177" "00458050" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "40y" "" "" "" "" "" "" "" ""
"0000346499" "01177" "00458051" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "13y" "" "" "" "" "" "" "" ""
"0000346500" "01177" "00458052" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype with a family HAE history" "" "30y" "" "" "" "" "" "" "" ""
"0000346501" "01177" "00458053" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000346502" "01177" "00458054" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "12y" "" "" "" "" "" "" "" ""
"0000346503" "01177" "00458055" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000346505" "01177" "00458057" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000346506" "01177" "00458058" "03256" "Familial" "" "Proband presenting with a HAE type II phenotype" "" "" "" "" "" "" "" "" "" ""
"0000346507" "01177" "00458059" "03256" "Isolated (sporadic)" "" "Proband presenting with a HAE type I phenotype" "" "50y" "" "" "" "" "" "" "" ""
"0000346508" "01177" "00458060" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "32y" "" "" "" "" "" "" "" ""
"0000346509" "01177" "00458061" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "12y" "" "" "" "" "" "" "" ""
"0000346511" "01177" "00458063" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "47y" "" "" "" "" "" "" "" ""
"0000346512" "01177" "00458064" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000346513" "01177" "00458065" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "21y" "" "" "" "" "" "" "" ""
"0000346514" "01177" "00458066" "03256" "Familial" "" "Proband with a HAE type I phenotype" "" "30y" "" "" "" "" "" "" "" ""
"0000346515" "01177" "00458067" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "20y" "" "" "" "" "" "" "" ""
"0000346516" "01177" "00458068" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000346517" "01177" "00458069" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "20y" "" "" "" "" "" "" "" ""
"0000346518" "01177" "00458070" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "40y" "" "" "" "" "" "" "" ""
"0000346519" "01177" "00458071" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "60y" "" "" "" "" "" "" "" ""
"0000346520" "01177" "00458072" "03256" "Familial" "" "Proband presenting with a sporadic HAE type I phenotye" "" "" "" "" "" "" "" "" "" ""
"0000346521" "01177" "00458073" "03256" "Familial" "" "Proband presening with a HAE type I phenotype" "" "40y" "" "" "" "" "" "" "" ""
"0000346522" "01177" "00458074" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "10y" "" "" "" "" "" "" "" ""
"0000346523" "01177" "00458075" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "50y" "" "" "" "" "" "" "" ""
"0000346524" "01177" "00458076" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "10y" "" "" "" "" "" "" "" ""
"0000346525" "01177" "00458077" "03256" "Familial" "" "Compound heterozygous proband with a severe HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000346526" "06944" "00458078" "03256" "Familial" "" "Compound heterozygous proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000346529" "01177" "00458081" "03256" "Isolated (sporadic)" "" "Proband presenting with a HAE type I phenotype with an unknown family history" "" "10y" "" "" "" "" "" "" "" ""
"0000346530" "01177" "00458083" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "16y" "" "" "" "" "" "" "" ""
"0000346531" "01177" "00458084" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "04y" "" "" "" "" "" "" "" ""
"0000346532" "06944" "00458085" "03256" "Isolated (sporadic)" "" "Proband presenting with a HAE type I phenotype with an unknown family HAE history" "" "30y" "" "" "" "" "" "" "" ""
"0000346533" "01177" "00458086" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000346534" "01177" "00458087" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000346535" "01177" "00458088" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "30y" "" "" "" "" "" "" "" ""
"0000346537" "01177" "00458090" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "20y" "" "" "" "" "" "" "" ""
"0000346538" "01177" "00458091" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype with a family HAE history" "" "80y" "" "" "" "" "" "" "" ""
"0000346539" "01177" "00458092" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "34y" "" "" "" "" "" "" "" ""
"0000346540" "01177" "00458093" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "13y" "" "" "" "" "" "" "" ""
"0000346541" "01177" "00458094" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "10y" "" "" "" "" "" "" "" ""
"0000346545" "01177" "00458098" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "42y" "" "" "" "" "" "" "" ""
"0000346551" "06944" "00458106" "03256" "Unknown" "" "Proband with currently insufficient available evidence to determine the role of this variant in the symptoms" "" "" "" "" "" "" "" "" "" ""
"0000346609" "06944" "00458173" "03256" "Unknown" "" "no available information on proband" "" "" "" "" "" "" "" "" "" ""
"0000346682" "01177" "00458246" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "30y" "" "" "" "" "" "" "" ""
"0000347600" "01177" "00459523" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype with recurrent sweling of the extremities and gastro-intestinal symptoms, without oropharyngeal involvement.\r\nProband undergoing a trajectory of IVF/ICSI-PGT,58\r\nresulting in a full-term pregnancy and uncomplicated delivery of an unaffected child, without prior reproductive history." "" "17y" "" "" "" "" "" "" "" ""
"0000347699" "01177" "00459792" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000348295" "01177" "00460571" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "35y" "" "" "" "" "" "" "" ""
"0000348310" "01177" "00460587" "03256" "Isolated (sporadic)" "" "Female proband presenting with a HAE type I phenotype" "" "17y" "" "" "" "" "" "" "" ""
"0000349728" "01177" "00462228" "03256" "Familial" "" "Proband presenting with HAE olfactory dysfunction" "" "57y" "" "" "" "" "" "" "" ""
"0000349730" "01177" "00462230" "03256" "Familial" "" "A family with 2 individuals presenting with HAE. A male individual is presenting with functional anosmia." "" "" "" "" "" "" "" "" "" ""
"0000349732" "01177" "00462232" "03256" "Familial" "" "A female proband presenting with type I HAE and hyposmia" "" "50y" "" "" "" "" "" "" "" ""
"0000349733" "01177" "00462233" "03256" "Familial" "" "Proband preseting with a type I HAE phenotype" "03y" "13y" "" "" "" "" "" "" "" ""
"0000349789" "01177" "00462290" "03256" "Familial" "" "no phenotype introduced by submitter" "" "" "" "" "" "" "" "" "" ""
"0000350447" "01177" "00464426" "03256" "Familial" "" "No phenotype displayed for the proband" "" "" "" "" "" "" "" "" "" ""
"0000350448" "01177" "00464427" "03256" "Familial" "" "No phenotype displayed for the proband" "" "" "" "" "" "" "" "" "" ""
"0000350449" "01177" "00464428" "03256" "Familial" "" "No phenotype displayed for the proband" "" "" "" "" "" "" "" "" "" ""
"0000350450" "01177" "00464429" "03256" "Familial" "" "No phenotype displayed for the proband" "" "" "" "" "" "" "" "" "" ""
"0000350451" "01177" "00464429" "03256" "Familial" "" "No phenotype displayed for the proband" "" "" "" "" "" "" "" "" "" ""
"0000350452" "06943" "00448053" "03256" "Familial" "" "No phenotype displayed for the proband" "" "" "" "" "" "" "" "" "" ""
"0000350453" "01177" "00464430" "03256" "Unknown" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000350454" "01177" "00436647" "03256" "Familial" "" "No phenotype displayed for the proband" "" "" "" "" "" "" "" "" "" ""
"0000350455" "01177" "00462231" "03256" "Familial" "" "No phenotype displayed for the proband" "" "" "" "" "" "" "" "" "" ""
"0000350519" "01177" "00464519" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000350561" "01177" "00464575" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000350562" "01177" "00464576" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype: Facial edema, in the tongue, larynx and skin. Most frequent site in the hands and least frequent in the genital region. Number of crises per year 36, has required orotracheal intubation." "07y" "21y" "" "" "" "" "" "" "" ""
"0000350615" "01177" "00464624" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000350867" "01177" "00465314" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "26y" "34y" "" "" "" "" "" "" "" ""
"0000351446" "01177" "00466060" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype and a decreased antigenic C4.\r\nSymptomatic 7-y son." "" "37y" "" "" "" "" "" "" "" ""
"0000351735" "01177" "00466371" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000351736" "01177" "00466372" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000351737" "01177" "00466373" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000351738" "01177" "00466374" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000351739" "01177" "00466375" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000351740" "01177" "00466376" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000351951" "01177" "00466587" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000351952" "01177" "00466588" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000351953" "01177" "00466589" "03256" "Familial" "" "Proband likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000351954" "01177" "00466590" "03256" "Familial" "" "Proband likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000351978" "01177" "00466614" "03256" "Familial" "" "No information on clinical phenotype" "" "" "" "" "" "" "" "" "" ""
"0000351979" "01177" "00466615" "03256" "Familial" "" "No information on the clinical phenotype" "" "" "" "" "" "" "" "" "" ""
"0000352238" "01177" "00466875" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000352239" "01177" "00466876" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000352240" "01177" "00466877" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000352241" "01177" "00466878" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000352355" "01177" "00467148" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "16y" "22y" "" "" "" "" "" "" "" ""
"0000353171" "01177" "00468019" "03256" "Familial" "" "Proband presenting with a HAE-C1INH type 1 phenotype" "04y" "55y" "" "" "" "" "" "" "" ""
"0000353593" "06980" "00468441" "03256" "Familial" "" "Prolonged course of severe episodic fatigue, abdominal, extremity, facial, and laryngeal swelling with associated dyspnea; susceptibility of a prophylaxis with lanadelumab-flyo." "" "" "" "" "" "" "" "" "" ""
"0000354685" "01177" "00469532" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype." "39y" "43y" "" "" "" "" "" "" "" ""
"0000354694" "05292" "00469541" "03256" "Complex" "" "PID with recurrent upper respiratory tract infections and neutropenia" "" "" "" "" "" "" "" "3y" "" ""
"0000355284" "01177" "00470139" "03256" "Familial" "" "Probands presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000355285" "01177" "00470140" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000355520" "01177" "00470371" "03256" "Familial" "" "Proband presenting with a HAE phenotype" "" "" "" "" "" "" "" "" "" ""
"0000355521" "01177" "00470372" "03256" "Familial" "" "Proband presenting with a HAE clinical phenotype" "" "" "" "" "" "" "" "" "" ""
"0000356307" "01177" "00471500" "03256" "Unknown" "" "No information on the clinical phenotype of the proband" "" "" "" "" "" "" "" "" "" ""
"0000356788" "01177" "00471979" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype, including recurrent cutaneous edema and abdominal pain." "20y" "36y" "" "" "" "" "" "" "" ""
"0000356789" "01177" "00471980" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000356992" "01177" "00472183" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype associated with a C1-INH deficiency" "" "" "" "" "" "" "" "" "" ""
"0000357240" "01177" "00472430" "03256" "Familial" "" "Proband presenting with HAE type I phenotype" "06y" "16y" "" "" "" "" "" "27y" "" ""
"0000359143" "01177" "00474344" "03256" "Familial" "" "Proband presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000359145" "01177" "00474347" "03256" "Familial" "" "Proband likely presenting with a HAE type I phenotype" "" "" "" "" "" "" "" "" "" ""
"0000359659" "01177" "00474866" "03256" "Isolated (sporadic)" "" "Female proband presenting with HAE type I phenotype and CSU. Treatment with omalizumab improves CSU, but there were still unpredictable\r\nrecurrent episodes of edema." "" "26y" "" "" "" "" "" "" "" ""
"0000361749" "01177" "00477139" "03256" "Familial" "" "Proband likely presenting a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000361819" "01177" "00477212" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000361820" "01177" "00477213" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000361821" "01177" "00477214" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000361823" "01177" "00477216" "03256" "Familial" "" "Proband likely presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000361824" "01177" "00477217" "03256" "Familial" "" "Proband likely presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000361825" "01177" "00361891" "03256" "Familial" "" "Proband likely presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000361826" "01177" "00265215" "03256" "Familial" "" "Proband likely presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000361827" "01177" "00266232" "03256" "Familial" "" "Proband likely presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000363027" "06944" "00478512" "03256" "Unknown" "" "Angioedema attack after intravenous thrombolysis with recombinant tissue-type plasminogen activator, with self-limiting episodes and resolution occurring between 2 and 96 h" "" "" "" "" "" "" "" "" "" ""
"0000364502" "00000" "00480000" "03256" "Unknown" "" "No information pertaining to a clinical phenotype" "" "" "" "" "" "" "" "" "" ""
"0000364506" "01177" "00480003" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype based on reduced antigenic C1-INH and C4, and C1-INH function." "21y" "31y" "" "" "" "" "" "" "" ""
"0000364507" "01177" "00480004" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype including a very low C1-INH function, and low antigenic C1-INH and C4." "16y" "16y" "" "" "" "" "" "" "" ""
"0000364568" "01177" "00480063" "03256" "Unknown" "" "No information on the clinical phenotype of the proband, no information on the family history" "" "" "" "" "" "" "" "" "" ""
"0000365399" "01177" "00481118" "03256" "Familial" "" "Proband presenting with a clinical diagnosis of C1-INH-HAE, characterized by low antigenic C1-INH and 10% C1-INH function." "04y" "55y" "" "" "" "" "" "" "" ""
"0000366297" "01177" "00482023" "03256" "Familial" "" "Proband presenting with HAE type 1 phenotype, including edema of the hands, abdominal pain and distension, decreased circulating C1 Inhibitor, and decreased circulating C4" "" "" "" "" "" "" "" "" "" ""
"0000366298" "01177" "00482024" "03256" "Unknown" "" "Proband presenting with a HAE phenotype" "" "" "" "" "" "" "" "" "" ""
"0000366299" "01177" "00482025" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype with edema, low antigenic C4, Low antigenic C1 inhibitor and reduced C1 inhibitor function." "" "40y" "" "" "" "" "" "" "" ""
"0000366926" "01177" "00484149" "03256" "Familial" "" "Male proband presenting with a HAE type 1 phenotype, incl oedema attacks on face, larynx, limbs, abdomen." "19y" "43y" "" "" "" "" "" "" "" ""
"0000367600" "01177" "00484818" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000367601" "01177" "00484819" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000367602" "01177" "00484820" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000367603" "01177" "00484821" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
"0000367604" "01177" "00484822" "03256" "Familial" "" "Proband presenting with a HAE type 1 phenotype" "" "" "" "" "" "" "" "" "" ""
## Screenings ## Do not remove or alter this header ##
## Count = 1233
"{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}"
"0000230893" "00229800" "1" "03256" "03256" "2019-04-11 09:49:13" "" "" "SEQ" "DNA" "" ""
"0000230894" "00229801" "1" "03256" "03256" "2019-04-11 09:52:32" "" "" "SEQ" "DNA" "" ""
"0000230895" "00229802" "1" "03256" "03256" "2019-04-11 09:55:20" "" "" "SEQ" "DNA" "" ""
"0000230898" "00229804" "1" "03256" "03256" "2019-04-11 10:10:36" "" "" "SEQ" "DNA" "" ""
"0000230899" "00229806" "1" "03256" "03256" "2019-04-11 10:15:39" "" "" "SEQ" "DNA" "" ""
"0000230900" "00229807" "1" "03256" "03256" "2019-04-11 10:19:13" "" "" "SEQ" "DNA" "" ""
"0000230901" "00229808" "1" "03256" "03256" "2019-04-11 10:27:30" "" "" "SEQ" "DNA" "" ""
"0000230902" "00229809" "1" "03256" "03256" "2019-04-11 10:31:07" "" "" "SEQ" "DNA" "" ""
"0000230903" "00229810" "1" "03256" "03256" "2019-04-11 10:33:47" "" "" "SEQ" "DNA" "" ""
"0000230904" "00229811" "1" "03256" "03256" "2019-04-11 10:37:53" "" "" "SEQ" "DNA" "" ""
"0000230905" "00229812" "1" "03256" "03256" "2019-04-11 10:40:07" "" "" "SEQ" "DNA" "" ""
"0000230906" "00229813" "1" "03256" "03256" "2019-04-11 10:43:19" "" "" "SEQ" "DNA" "" ""
"0000230907" "00229814" "1" "03256" "03256" "2019-04-11 10:45:59" "" "" "?" "DNA" "" ""
"0000230908" "00229815" "1" "03256" "03256" "2019-04-11 10:48:54" "" "" "?" "DNA" "" ""
"0000230909" "00229816" "1" "03256" "03256" "2019-04-11 10:51:08" "" "" "?" "DNA" "" ""
"0000230910" "00229817" "1" "03256" "03256" "2019-04-11 10:53:21" "" "" "?" "DNA" "" ""
"0000230911" "00229818" "1" "03256" "03256" "2019-04-11 10:55:28" "" "" "?" "DNA" "" ""
"0000230912" "00229819" "1" "03256" "03256" "2019-04-11 10:59:47" "" "" "?" "DNA" "" ""
"0000230913" "00229820" "1" "03256" "03256" "2019-04-11 11:01:51" "" "" "?" "DNA" "" ""
"0000230914" "00229821" "1" "03256" "03256" "2019-04-11 11:04:34" "" "" "?" "DNA" "" ""
"0000230915" "00229822" "1" "03256" "03256" "2019-04-11 11:07:04" "" "" "?" "DNA" "" ""
"0000230916" "00229823" "1" "03256" "03256" "2019-04-11 11:09:57" "" "" "?" "DNA" "" ""
"0000230917" "00229825" "1" "03256" "03256" "2019-04-11 11:12:00" "" "" "?" "DNA" "" ""
"0000230918" "00229826" "1" "03256" "03256" "2019-04-11 11:14:13" "" "" "?" "DNA" "" ""
"0000230919" "00229827" "1" "03256" "03256" "2019-04-11 11:16:26" "" "" "?" "DNA" "" ""
"0000230920" "00229828" "1" "03256" "03256" "2019-04-11 11:18:32" "" "" "?" "DNA" "" ""
"0000230922" "00229829" "1" "03256" "03256" "2019-04-11 11:20:38" "" "" "?" "DNA" "" ""
"0000230923" "00229830" "1" "03256" "03256" "2019-04-11 11:23:54" "" "" "?" "DNA" "" ""
"0000230924" "00229831" "1" "03256" "03256" "2019-04-11 11:26:39" "" "" "?" "DNA" "" ""
"0000230925" "00229833" "1" "03256" "03256" "2019-04-11 11:30:45" "" "" "?" "DNA" "" ""
"0000230927" "00229834" "1" "03256" "03256" "2019-04-11 11:33:17" "" "" "?" "DNA" "" ""
"0000230928" "00229835" "1" "03256" "03256" "2019-04-11 11:35:18" "" "" "?" "DNA" "" ""
"0000230929" "00229836" "1" "03256" "03256" "2019-04-11 11:37:33" "" "" "?" "DNA" "" ""
"0000230930" "00229837" "1" "03256" "03256" "2019-04-11 11:39:46" "" "" "?" "DNA" "" ""
"0000230931" "00229838" "1" "03256" "03256" "2019-04-11 11:42:11" "" "" "?" "DNA" "" ""
"0000230932" "00229839" "1" "03256" "03256" "2019-04-11 11:52:13" "" "" "?" "DNA" "" ""
"0000230933" "00229840" "1" "03256" "03256" "2019-04-11 11:54:24" "" "" "?" "DNA" "" ""
"0000230934" "00229841" "1" "03256" "03256" "2019-04-11 11:56:30" "" "" "?" "DNA" "" ""
"0000230935" "00229842" "1" "03256" "03256" "2019-04-11 11:58:32" "" "" "?" "DNA" "" ""
"0000230936" "00229843" "1" "03256" "03256" "2019-04-11 12:00:41" "" "" "?" "DNA" "" ""
"0000230937" "00229844" "1" "03256" "03256" "2019-04-11 12:03:47" "" "" "?" "DNA" "" ""
"0000230938" "00229845" "1" "03256" "03256" "2019-04-11 12:05:57" "" "" "?" "DNA" "" ""
"0000230939" "00229846" "1" "03256" "03256" "2019-04-11 12:08:22" "" "" "?" "DNA" "" ""
"0000230941" "00229848" "1" "03256" "03256" "2019-04-11 14:15:05" "" "" "?" "DNA" "" ""
"0000230942" "00229849" "1" "03256" "03256" "2019-04-11 14:17:18" "" "" "?" "DNA" "" ""
"0000230943" "00229850" "1" "03256" "03256" "2019-04-11 14:19:49" "" "" "?" "DNA" "" ""
"0000230944" "00229851" "1" "03256" "03256" "2019-04-11 14:22:02" "" "" "?" "DNA" "" ""
"0000230945" "00229852" "1" "03256" "03256" "2019-04-11 14:24:24" "" "" "?" "DNA" "" ""
"0000230946" "00229853" "1" "03256" "03256" "2019-04-11 14:26:13" "" "" "?" "DNA" "" ""
"0000230947" "00229854" "1" "03256" "03256" "2019-04-11 14:29:03" "" "" "?" "DNA" "" ""
"0000230948" "00229855" "1" "03256" "03256" "2019-04-11 14:31:07" "" "" "?" "DNA" "" ""
"0000230949" "00229856" "1" "03256" "03256" "2019-04-11 14:33:08" "" "" "?" "DNA" "" ""
"0000230950" "00229857" "1" "03256" "03256" "2019-04-11 14:35:14" "" "" "?" "DNA" "" ""
"0000230951" "00229858" "1" "03256" "03256" "2019-04-11 14:37:21" "" "" "?" "DNA" "" ""
"0000230952" "00229859" "1" "03256" "03256" "2019-04-11 14:39:57" "" "" "?" "DNA" "" ""
"0000230953" "00229860" "1" "03256" "03256" "2019-04-11 14:41:52" "" "" "?" "DNA" "" ""
"0000230954" "00229861" "1" "03256" "03256" "2019-04-11 14:43:58" "" "" "?" "DNA" "" ""
"0000230955" "00229862" "1" "03256" "03256" "2019-04-11 14:46:03" "" "" "?" "DNA" "" ""
"0000230956" "00229863" "1" "03256" "03256" "2019-04-11 14:47:50" "" "" "?" "DNA" "" ""
"0000230957" "00229864" "1" "03256" "03256" "2019-04-11 14:49:39" "" "" "?" "DNA" "" ""
"0000230958" "00229865" "1" "03256" "03256" "2019-04-11 14:51:33" "" "" "?" "DNA" "" ""
"0000230960" "00229867" "1" "03256" "03256" "2019-04-11 14:57:02" "" "" "?" "DNA" "" ""
"0000230961" "00229868" "1" "03256" "03256" "2019-04-11 14:59:01" "" "" "?" "DNA" "" ""
"0000230963" "00229870" "1" "03256" "03256" "2019-04-11 15:04:23" "" "" "?" "DNA" "" ""
"0000230964" "00229871" "1" "03256" "03256" "2019-04-11 15:06:28" "" "" "?" "DNA" "" ""
"0000230965" "00229872" "1" "03256" "03256" "2019-04-11 15:08:53" "" "" "?" "DNA" "" ""
"0000230966" "00229873" "1" "03256" "03256" "2019-04-11 15:11:35" "" "" "?" "DNA" "" ""
"0000230967" "00229875" "1" "03256" "03256" "2019-04-11 15:14:45" "" "" "?" "DNA" "" ""
"0000230968" "00229876" "1" "03256" "03256" "2019-04-11 15:16:59" "" "" "?" "DNA" "" ""
"0000230970" "00229877" "1" "03256" "03256" "2019-04-11 15:19:39" "" "" "?" "DNA" "" ""
"0000230971" "00229878" "1" "03256" "03256" "2019-04-11 15:21:39" "" "" "?" "DNA" "" ""
"0000230972" "00229879" "1" "03256" "03256" "2019-04-11 15:23:28" "" "" "?" "DNA" "" ""
"0000230973" "00229880" "1" "03256" "03256" "2019-04-11 15:25:36" "" "" "?" "DNA" "" ""
"0000230974" "00229881" "1" "03256" "03256" "2019-04-11 15:27:30" "" "" "?" "DNA" "" ""
"0000230975" "00229882" "1" "03256" "03256" "2019-04-11 15:29:25" "" "" "?" "DNA" "" ""
"0000230977" "00229884" "1" "03256" "03256" "2019-04-11 15:33:17" "" "" "?" "DNA" "" ""
"0000230978" "00229885" "1" "03256" "03256" "2019-04-11 15:35:14" "" "" "?" "DNA" "" ""
"0000230979" "00229886" "1" "03256" "03256" "2019-04-11 15:37:09" "" "" "?" "DNA" "" ""
"0000230980" "00229887" "1" "03256" "03256" "2019-04-11 15:38:55" "" "" "?" "DNA" "" ""
"0000230981" "00229888" "1" "03256" "03256" "2019-04-11 15:42:36" "" "" "?" "DNA" "" ""
"0000230982" "00229889" "1" "03256" "03256" "2019-04-11 15:44:27" "" "" "?" "DNA" "" ""
"0000230983" "00229890" "1" "03256" "03256" "2019-04-11 15:50:42" "" "" "?" "DNA" "" ""
"0000230984" "00229891" "1" "03256" "03256" "2019-04-11 15:52:37" "" "" "?" "DNA" "" ""
"0000230985" "00229892" "1" "03256" "03256" "2019-04-11 15:54:23" "" "" "?" "DNA" "" ""
"0000230986" "00229893" "1" "03256" "03256" "2019-04-11 15:56:19" "" "" "?" "DNA" "" ""
"0000230987" "00229894" "1" "03256" "03256" "2019-04-11 15:58:04" "" "" "?" "DNA" "" ""
"0000230988" "00229895" "1" "03256" "03256" "2019-04-11 15:59:50" "" "" "?" "DNA" "" ""
"0000230989" "00229896" "1" "03256" "03256" "2019-04-11 16:01:35" "" "" "?" "DNA" "" ""
"0000230990" "00229897" "1" "03256" "03256" "2019-04-11 16:03:26" "" "" "?" "DNA" "" ""
"0000230992" "00229899" "1" "03256" "03256" "2019-04-11 16:07:05" "" "" "?" "DNA" "" ""
"0000230993" "00229900" "1" "03256" "03256" "2019-04-11 16:08:57" "" "" "?" "DNA" "" ""
"0000230994" "00229901" "1" "03256" "03256" "2019-04-11 16:10:40" "" "" "?" "DNA" "" ""
"0000230995" "00229902" "1" "03256" "03256" "2019-04-11 16:12:25" "" "" "?" "DNA" "" ""
"0000230996" "00229903" "1" "03256" "03256" "2019-04-11 16:14:09" "" "" "?" "DNA" "" ""
"0000230997" "00229904" "1" "03256" "03256" "2019-04-11 16:57:16" "" "" "?" "DNA" "" ""
"0000230998" "00229905" "1" "03256" "03256" "2019-04-11 16:59:36" "" "" "?" "DNA" "" ""
"0000230999" "00229906" "1" "03256" "03256" "2019-04-11 17:23:44" "" "" "?" "DNA" "" ""
"0000231000" "00229907" "1" "03256" "03256" "2019-04-11 17:26:09" "" "" "?" "DNA" "" ""
"0000231001" "00229908" "1" "03256" "03256" "2019-04-11 17:28:17" "" "" "?" "DNA" "" ""
"0000231002" "00229909" "1" "03256" "03256" "2019-04-11 17:30:49" "" "" "?" "DNA" "" ""
"0000231004" "00229911" "1" "03256" "03256" "2019-04-11 17:52:07" "" "" "?" "DNA" "" ""
"0000231005" "00229912" "1" "03256" "03256" "2019-04-11 17:54:15" "" "" "?" "DNA" "" ""
"0000231006" "00229913" "1" "03256" "03256" "2019-04-11 17:56:57" "" "" "?" "DNA" "" ""
"0000231007" "00229914" "1" "03256" "03256" "2019-04-11 17:59:28" "" "" "?" "DNA" "" ""
"0000231008" "00229915" "1" "03256" "03256" "2019-04-11 18:01:18" "" "" "?" "DNA" "" ""
"0000231009" "00229916" "1" "03256" "03256" "2019-04-11 18:05:40" "" "" "?" "DNA" "" ""
"0000231010" "00229917" "1" "03256" "03256" "2019-04-11 18:07:47" "" "" "?" "DNA" "" ""
"0000231011" "00229918" "1" "03256" "03256" "2019-04-11 18:10:13" "" "" "?" "DNA" "" ""
"0000231012" "00229919" "1" "03256" "03256" "2019-04-11 18:12:16" "" "" "?" "DNA" "" ""
"0000231013" "00229920" "1" "03256" "03256" "2019-04-11 18:14:28" "" "" "?" "DNA" "" ""
"0000231015" "00229922" "1" "03256" "03256" "2019-04-11 18:18:23" "" "" "?" "DNA" "" ""
"0000231016" "00229923" "1" "03256" "03256" "2019-04-11 18:50:47" "" "" "?" "DNA" "" ""
"0000231017" "00229924" "1" "03256" "03256" "2019-04-11 18:53:41" "03256" "2022-03-18 11:36:13" "MAQ" "DNA" "blood" ""
"0000231018" "00229925" "1" "03256" "03256" "2019-04-11 18:55:16" "" "" "?" "DNA" "" ""
"0000231019" "00229926" "1" "03256" "03256" "2019-04-11 18:57:06" "" "" "?" "DNA" "" ""
"0000231020" "00229927" "1" "03256" "03256" "2019-04-11 19:00:58" "" "" "?" "DNA" "" ""
"0000241515" "00240405" "1" "03256" "03256" "2019-06-19 18:33:42" "" "" "SEQ" "DNA" "" ""
"0000241582" "00240473" "1" "00006" "00006" "2019-06-21 09:31:30" "" "" "SEQ" "DNA" "" ""
"0000245532" "00244421" "1" "03256" "03256" "2019-06-22 14:01:40" "" "" "SEQ" "DNA" "blood" ""
"0000245559" "00244447" "1" "03256" "03256" "2019-06-25 09:40:25" "" "" "SEQ" "DNA" "blood, cultured monocytes" ""
"0000245583" "00244472" "1" "03256" "03256" "2019-06-26 16:49:42" "" "" "SEQ" "DNA" "blood" ""
"0000245598" "00244486" "1" "03256" "03256" "2019-06-27 11:38:17" "" "" "SEQ" "DNA" "blood" ""
"0000245601" "00244489" "1" "03256" "03256" "2019-06-27 12:04:36" "00006" "2020-09-25 08:52:33" "QMPSF" "DNA" "" "Quantitative Multiplex PCR of Short Fluorescent fragments"
"0000245606" "00244494" "1" "03256" "03256" "2019-06-27 13:59:02" "" "" "SEQ" "DNA" "blood" ""
"0000245607" "00244495" "1" "03256" "03256" "2019-06-27 15:18:52" "" "" "SEQ" "DNA" "bloods" ""
"0000245609" "00244497" "1" "03256" "03256" "2019-06-27 15:43:38" "" "" "SEQ" "DNA" "blood" ""
"0000245611" "00244500" "1" "03256" "03256" "2019-06-27 15:56:02" "" "" "SEQ" "DNA" "blood" ""
"0000245614" "00244502" "1" "03256" "03256" "2019-06-27 18:21:01" "" "" "SEQ" "DNA" "blood" ""
"0000245984" "00244872" "1" "03256" "03256" "2019-06-28 18:52:51" "" "" "SEQ" "DNA" "blood" ""
"0000245985" "00244873" "1" "03256" "03256" "2019-06-28 23:32:34" "" "" "SEQ" "DNA" "blood" ""
"0000245986" "00244874" "1" "03256" "03256" "2019-06-29 11:13:53" "" "" "SEQ" "DNA" "blood" ""
"0000245987" "00244875" "1" "03256" "03256" "2019-06-29 12:26:01" "" "" "SEQ" "DNA" "blood" ""
"0000245988" "00244876" "1" "03256" "03256" "2019-06-29 13:47:44" "" "" "SEQ" "DNA" "blood" ""
"0000246174" "00245062" "1" "03256" "03256" "2019-06-29 14:35:46" "" "" "SEQ" "DNA" "blood" ""
"0000246175" "00245063" "1" "03256" "03256" "2019-06-29 15:11:00" "" "" "SEQ" "DNA" "blood" ""
"0000246176" "00245064" "1" "03256" "03256" "2019-06-29 17:26:24" "" "" "SEQ" "DNA" "blood" ""
"0000246177" "00245065" "1" "03256" "03256" "2019-06-29 17:37:58" "" "" "SEQ" "DNA" "blood" ""
"0000246178" "00245066" "1" "03256" "03256" "2019-06-30 15:49:48" "" "" "SEQ" "DNA" "blood" ""
"0000246182" "00245070" "1" "03256" "03256" "2019-07-01 18:22:32" "" "" "SEQ" "DNA" "blood" ""
"0000246183" "00245071" "1" "03256" "03256" "2019-07-01 19:40:45" "" "" "SEQ" "RNA" "blood, peripheral leukocytes" ""
"0000246311" "00245199" "1" "03256" "03256" "2019-07-02 09:44:07" "" "" "MLPA" "DNA" "blood" ""
"0000246312" "00245200" "1" "03256" "03256" "2019-07-02 10:06:32" "" "" "SEQ" "DNA" "blood" ""
"0000246315" "00245203" "1" "03256" "03256" "2019-07-02 10:38:10" "" "" "SEQ" "DNA" "blood" "Loules et al, 2018, have screened using NGS"
"0000246316" "00245204" "1" "03256" "03256" "2019-07-02 11:50:22" "" "" "SEQ" "DNA" "blood" ""
"0000246317" "00245205" "1" "03256" "03256" "2019-07-02 12:06:48" "" "" "SEQ" "DNA" "blood, peripheral leukocytes" ""
"0000246319" "00245207" "1" "03256" "03256" "2019-07-02 15:25:10" "" "" "SEQ" "DNA" "blood" ""
"0000246322" "00245210" "1" "03256" "03256" "2019-07-02 17:12:43" "" "" "SEQ" "DNA" "blood, cultured monocytes" "investigated by FAMA"
"0000246328" "00245216" "1" "03256" "03256" "2019-07-02 18:17:47" "" "" "SEQ" "DNA" "blood" "Screening by FAMA"
"0000246340" "00245228" "1" "03256" "03256" "2019-07-02 19:02:14" "" "" "SEQ" "DNA" "blood" ""
"0000246341" "00245229" "1" "03256" "03256" "2019-07-02 19:14:10" "" "" "SEQ" "DNA" "blood" ""
"0000246456" "00245344" "1" "03256" "03256" "2019-07-03 10:48:34" "" "" "SEQ" "DNA" "blood" ""
"0000246461" "00245349" "1" "03256" "03256" "2019-07-03 11:55:27" "" "" "SEQ" "DNA" "blood" ""
"0000246510" "00245397" "1" "03256" "03256" "2019-07-03 12:26:37" "" "" "SEQ" "DNA" "blood, buccal cells, hair roots and urinary cells" ""
"0000246531" "00245419" "1" "03256" "03256" "2019-07-03 15:59:31" "03256" "2023-09-26 09:59:00" "SEQ" "DNA" "blood and buccal cells" ""
"0000246532" "00245420" "1" "03256" "03256" "2019-07-03 16:44:48" "" "" "SEQ" "DNA" "blood" ""
"0000246533" "00245421" "1" "03256" "03256" "2019-07-03 17:01:09" "" "" "SEQ" "DNA" "blood" ""
"0000246534" "00245422" "1" "03256" "03256" "2019-07-03 17:28:49" "" "" "SEQ" "DNA" "blood" ""
"0000246535" "00245423" "1" "03256" "03256" "2019-07-03 17:46:19" "" "" "SEQ" "DNA" "blood" ""
"0000246536" "00245424" "1" "03256" "03256" "2019-07-03 18:01:03" "" "" "SEQ" "DNA" "blood" ""
"0000246538" "00245426" "1" "03256" "03256" "2019-07-03 18:33:33" "" "" "SEQ" "DNA" "blood" "Loules et al, 2018, have screened using NGS"
"0000246539" "00245427" "1" "03256" "03256" "2019-07-03 19:16:26" "" "" "SEQ" "DNA" "blood" ""
"0000246541" "00245429" "1" "03256" "03256" "2019-07-04 09:20:45" "" "" "SEQ" "DNA" "blood" ""
"0000246543" "00245431" "1" "03256" "03256" "2019-07-04 16:25:46" "" "" "SEQ" "DNA" "blood" ""
"0000246544" "00245432" "1" "03256" "03256" "2019-07-04 18:48:01" "" "" "SEQ" "DNA" "blood" ""
"0000246545" "00245433" "1" "03256" "03256" "2019-07-05 08:46:55" "" "" "SEQ" "DNA" "blood" ""
"0000246829" "00245717" "1" "03256" "03256" "2019-07-05 21:45:16" "" "" "SEQ" "DNA" "blood" ""
"0000246830" "00245718" "1" "03256" "03256" "2019-07-05 22:26:06" "" "" "SEQ" "DNA" "blood" ""
"0000246857" "00245745" "1" "03256" "03256" "2019-07-06 10:22:25" "" "" "SEQ" "DNA" "blood" ""
"0000246858" "00245746" "1" "03256" "03256" "2019-07-06 16:58:42" "00006" "2020-09-25 08:52:33" "QMPSF" "DNA" "blood" "Quantitative Multiplex PCR of Short Fluorescent fragments"
"0000246859" "00245747" "1" "03256" "03256" "2019-07-06 22:19:00" "" "" "SEQ" "DNA" "blood" ""
"0000246860" "00245748" "1" "03256" "03256" "2019-07-07 16:27:45" "" "" "SEQ" "DNA" "blood" ""
"0000246861" "00245749" "1" "03256" "03256" "2019-07-07 17:31:58" "00006" "2020-09-25 08:52:33" "QMPSF" "DNA" "blood" "Quantitative Multiplex PCR of Short Fluorescent fragments"
"0000246862" "00245750" "1" "03256" "03256" "2019-07-07 20:50:25" "" "" "SEQ" "DNA" "blood" ""
"0000246864" "00245752" "1" "03256" "03256" "2019-07-07 21:46:11" "" "" "SEQ" "DNA" "blood" ""
"0000246865" "00245753" "1" "03256" "03256" "2019-07-07 21:52:55" "" "" "SEQ-NG" "DNA" "blood" ""
"0000246867" "00245755" "1" "03256" "03256" "2019-07-07 22:05:07" "" "" "SEQ" "DNA" "blood" ""
"0000246869" "00245758" "1" "03256" "03256" "2019-07-08 10:00:21" "" "" "SEQ-NG" "DNA" "blood" ""
"0000246872" "00245759" "1" "03256" "03256" "2019-07-08 10:19:51" "" "" "SEQ" "DNA" "blood" ""
"0000246874" "00245762" "1" "03256" "03256" "2019-07-08 10:31:58" "" "" "SEQ" "DNA" "blood" ""
"0000246875" "00245763" "1" "03256" "03256" "2019-07-08 10:42:39" "" "" "SEQ-NG" "DNA" "blood" ""
"0000246876" "00245764" "1" "03256" "03256" "2019-07-08 11:07:00" "" "" "SEQ-NG" "DNA" "blood" ""
"0000246877" "00245765" "1" "03256" "03256" "2019-07-08 11:28:23" "" "" "SEQ" "DNA" "blood" ""
"0000246879" "00245767" "1" "03256" "03256" "2019-07-08 14:41:25" "" "" "SEQ" "DNA" "blood" ""
"0000246909" "00245797" "1" "03256" "03256" "2019-07-08 18:05:25" "" "" "SEQ" "DNA" "blood" ""
"0000246912" "00245800" "1" "03256" "03256" "2019-07-08 18:20:08" "" "" "SEQ" "DNA" "blood" ""
"0000246914" "00245802" "1" "03256" "03256" "2019-07-08 18:31:42" "" "" "SEQ-NG" "DNA" "blood" ""
"0000246918" "00245806" "1" "03256" "03256" "2019-07-08 19:07:57" "" "" "SEQ" "DNA" "blood" ""
"0000246919" "00245807" "1" "03256" "03256" "2019-07-08 19:14:09" "" "" "SEQ-NG" "DNA" "blood" ""
"0000246920" "00245808" "1" "03256" "03256" "2019-07-08 21:27:32" "" "" "SEQ-NG" "DNA" "blood" ""
"0000246921" "00245809" "1" "03256" "03256" "2019-07-09 08:49:26" "" "" "SEQ" "DNA" "blood" ""
"0000246922" "00245810" "1" "03256" "03256" "2019-07-09 08:56:53" "" "" "SEQ" "DNA" "blood" ""
"0000246961" "00245849" "1" "03256" "03256" "2019-07-09 14:51:41" "" "" "SEQ" "DNA" "blood" ""
"0000246962" "00245850" "1" "03256" "03256" "2019-07-09 15:01:36" "" "" "SEQ" "DNA" "blood" ""
"0000246963" "00245851" "1" "03256" "03256" "2019-07-09 15:06:57" "" "" "SEQ" "DNA" "blood" ""
"0000246964" "00245852" "1" "03256" "03256" "2019-07-09 15:12:48" "" "" "SEQ" "DNA" "blood" ""
"0000246966" "00245854" "1" "03256" "03256" "2019-07-09 15:46:13" "" "" "SEQ" "DNA" "blood" ""
"0000246967" "00245855" "1" "03256" "03256" "2019-07-09 15:56:45" "" "" "SEQ" "DNA" "blood" ""
"0000246968" "00245856" "1" "03256" "03256" "2019-07-09 16:05:24" "" "" "SEQ" "DNA" "blood" ""
"0000246969" "00245857" "1" "03256" "03256" "2019-07-09 16:12:39" "" "" "?" "DNA" "" ""
"0000246970" "00245858" "1" "03256" "03256" "2019-07-09 16:19:31" "" "" "SEQ" "DNA" "blood" ""
"0000246971" "00245859" "1" "03256" "03256" "2019-07-09 16:23:41" "" "" "SEQ" "DNA" "blood" ""
"0000246972" "00245860" "1" "03256" "03256" "2019-07-09 16:35:23" "" "" "?" "DNA" "blood" ""
"0000246973" "00245861" "1" "03256" "03256" "2019-07-09 17:16:57" "" "" "SEQ" "DNA" "blood" ""
"0000246974" "00245862" "1" "03256" "03256" "2019-07-09 17:25:05" "" "" "?" "DNA" "" "Variant introduced in HGMD"
"0000246975" "00245863" "1" "03256" "03256" "2019-07-09 17:33:46" "" "" "SEQ-NG" "DNA" "blood" ""
"0000246977" "00245865" "1" "03256" "03256" "2019-07-09 17:48:43" "" "" "SEQ" "DNA" "blood" ""
"0000246978" "00245866" "1" "03256" "03256" "2019-07-09 17:55:08" "" "" "SEQ-NG" "DNA" "blood" ""
"0000246979" "00245867" "1" "03256" "03256" "2019-07-09 18:03:24" "" "" "SEQ" "DNA" "blood" ""
"0000246980" "00245868" "1" "03256" "03256" "2019-07-09 18:13:20" "" "" "SEQ" "DNA" "blood" ""
"0000246981" "00245869" "1" "03256" "03256" "2019-07-09 18:19:21" "" "" "SEQ" "DNA" "blood" ""
"0000246982" "00245870" "1" "03256" "03256" "2019-07-09 18:32:09" "" "" "SEQ" "DNA" "blood" ""
"0000246983" "00245871" "1" "03256" "03256" "2019-07-09 18:37:10" "" "" "SEQ" "DNA" "blood" ""
"0000246984" "00245872" "1" "03256" "03256" "2019-07-10 09:07:43" "" "" "SEQ" "DNA" "blood" "Investigated using NGS by Loules G et al 2018"
"0000246985" "00245873" "1" "03256" "03256" "2019-07-10 09:19:14" "" "" "SEQ" "DNA" "blood" ""
"0000246986" "00245874" "1" "03256" "03256" "2019-07-10 09:26:33" "" "" "SEQ" "DNA" "blood" "variant identified using NGS by Loules 2018"
"0000246987" "00245875" "1" "03256" "03256" "2019-07-10 09:35:02" "" "" "SEQ" "DNA" "blood" "variant identified using NGS by Loules 2018"
"0000246988" "00245876" "1" "03256" "03256" "2019-07-10 09:42:44" "" "" "SEQ" "DNA" "blood" ""
"0000246989" "00245877" "1" "03256" "03256" "2019-07-10 09:55:21" "" "" "SEQ" "DNA" "blood" ""
"0000246990" "00245878" "1" "03256" "03256" "2019-07-10 10:02:29" "" "" "SEQ" "DNA" "" ""
"0000246991" "00245879" "1" "03256" "03256" "2019-07-10 10:09:24" "" "" "SEQ" "DNA" "blood" "variant identified using NGS by Loules 2018"
"0000246992" "00245880" "1" "03256" "03256" "2019-07-10 10:14:44" "" "" "SEQ" "DNA" "blood" ""
"0000246993" "00245881" "1" "03256" "03256" "2019-07-10 10:20:29" "" "" "SEQ" "DNA" "blood" ""
"0000247015" "00245903" "1" "03256" "03256" "2019-07-11 11:14:06" "" "" "SEQ" "DNA" "blood" ""
"0000247016" "00245904" "1" "03256" "03256" "2019-07-11 11:29:44" "03256" "2019-09-27 11:33:02" "SEQ-NG-IT" "DNA" "blood" "variant identified using a SERPING1-NGS platform by Loules 2018"
"0000247017" "00245905" "1" "03256" "03256" "2019-07-11 11:39:28" "" "" "SEQ" "DNA" "blood" ""
"0000247018" "00245906" "1" "03256" "03256" "2019-07-11 11:57:54" "" "" "SEQ" "DNA" "blood" "variant identified using NGS by Loules 2018"
"0000247019" "00245907" "1" "03256" "03256" "2019-07-11 15:08:28" "" "" "SEQ" "DNA" "blood" ""
"0000247020" "00245908" "1" "03256" "03256" "2019-07-11 15:14:48" "" "" "SEQ" "DNA" "" ""
"0000247021" "00245909" "1" "03256" "03256" "2019-07-11 15:29:32" "" "" "SEQ" "DNA" "blood" ""
"0000247688" "00246576" "1" "03256" "03256" "2019-07-12 19:53:48" "" "" "SEQ" "DNA" "blood" ""
"0000247691" "00246579" "1" "03256" "03256" "2019-07-13 17:42:55" "" "" "SEQ-NG" "DNA" "blood" ""
"0000247692" "00246580" "1" "03256" "03256" "2019-07-13 18:27:00" "" "" "SEQ" "DNA" "blood" ""
"0000247693" "00246581" "1" "03256" "03256" "2019-07-13 22:29:33" "" "" "SEQ" "DNA" "blood" ""
"0000247694" "00246582" "1" "03256" "03256" "2019-07-14 09:51:40" "" "" "SEQ-NG" "DNA" "blood" ""
"0000247696" "00246584" "1" "03256" "03256" "2019-07-14 10:13:46" "" "" "?" "DNA" "" ""
"0000247697" "00246585" "1" "03256" "03256" "2019-07-14 10:25:25" "" "" "SEQ" "DNA" "blood" ""
"0000247698" "00246586" "1" "03256" "03256" "2019-07-14 10:35:44" "" "" "SEQ" "DNA" "blood" ""
"0000247724" "00246613" "1" "03256" "03256" "2019-07-15 12:17:19" "" "" "SEQ-NG" "DNA" "blood" ""
"0000247725" "00246614" "1" "03256" "03256" "2019-07-15 12:23:38" "03256" "2019-11-12 17:49:32" "SEQ-NG" "DNA" "blood" "confirmation by Sanger"
"0000247728" "00246616" "1" "03256" "03256" "2019-07-15 12:44:00" "" "" "?" "DNA" "" ""
"0000247729" "00246617" "1" "03256" "03256" "2019-07-15 12:54:40" "" "" "?" "DNA" "blood" ""
"0000247730" "00246619" "1" "03256" "03256" "2019-07-15 14:49:39" "" "" "SEQ" "DNA" "blood" ""
"0000247731" "00246620" "1" "03256" "03256" "2019-07-15 15:23:14" "" "" "SEQ" "DNA" "blood" ""
"0000247732" "00246621" "1" "03256" "03256" "2019-07-15 15:30:24" "" "" "?" "DNA" "" ""
"0000247733" "00246622" "1" "03256" "03256" "2019-07-15 15:43:10" "" "" "SEQ" "DNA" "blood" "Variant investigated in the forward validation of the SERPING1-NGS platform (Loules 2018)."
"0000247734" "00246623" "1" "03256" "03256" "2019-07-15 15:49:46" "" "" "SEQ" "DNA" "blood" ""
"0000247735" "00246624" "1" "03256" "03256" "2019-07-15 15:56:32" "" "" "SEQ" "DNA" "blood" ""
"0000247736" "00246625" "1" "03256" "03256" "2019-07-15 16:13:45" "" "" "?" "DNA" "" ""
"0000247986" "00246876" "1" "03256" "03256" "2019-07-16 20:07:30" "" "" "SEQ" "DNA" "blood" ""
"0000248002" "00246892" "1" "03256" "03256" "2019-07-16 20:55:37" "" "" "SEQ" "DNA" "blood" ""
"0000248622" "00247517" "1" "03256" "03256" "2019-07-17 18:27:49" "" "" "SEQ" "DNA" "blood" ""
"0000248623" "00247518" "1" "03256" "03256" "2019-07-17 18:41:18" "" "" "SEQ" "DNA" "blood" ""
"0000262450" "00261345" "1" "03256" "03256" "2019-08-14 13:11:41" "" "" "SEQ" "DNA" "blood" ""
"0000262451" "00261346" "1" "03256" "03256" "2019-08-14 15:02:28" "" "" "SEQ" "DNA" "blood" ""
"0000262452" "00261347" "1" "03256" "03256" "2019-08-14 15:12:32" "" "" "SEQ" "DNA" "blood" ""
"0000262453" "00261348" "1" "03256" "03256" "2019-08-14 15:27:30" "" "" "SEQ-NG" "DNA" "blood" ""
"0000262454" "00261349" "1" "03256" "03256" "2019-08-14 15:55:23" "" "" "SEQ" "DNA" "blood" ""
"0000262455" "00261350" "1" "03256" "03256" "2019-08-14 16:34:43" "" "" "SEQ" "DNA" "blood" ""
"0000262456" "00261351" "1" "03256" "03256" "2019-08-14 18:43:54" "" "" "SEQ" "DNA" "blood" ""
"0000262457" "00261352" "1" "03256" "03256" "2019-08-14 19:05:30" "" "" "SEQ" "DNA" "blood" ""
"0000262458" "00261353" "1" "03256" "03256" "2019-08-14 19:46:07" "" "" "SEQ" "DNA" "blood" ""
"0000262461" "00261356" "1" "03256" "03256" "2019-08-15 09:09:20" "" "" "SEQ" "DNA" "blood" ""
"0000262462" "00261357" "1" "03256" "03256" "2019-08-15 14:47:23" "" "" "SEQ" "DNA" "blood" ""
"0000262463" "00261358" "1" "03256" "03256" "2019-08-15 15:56:50" "" "" "SEQ" "DNA" "blood" ""
"0000262464" "00261359" "1" "03256" "03256" "2019-08-15 16:09:41" "" "" "SEQ" "DNA" "blood" ""
"0000263190" "00262084" "1" "03256" "03256" "2019-08-17 14:32:07" "" "" "SEQ" "DNA" "blood" ""
"0000263192" "00262086" "1" "03256" "03256" "2019-08-17 15:01:33" "" "" "SEQ" "DNA" "blood" ""
"0000263193" "00262087" "1" "03256" "03256" "2019-08-17 15:16:19" "" "" "SEQ" "DNA" "blood" ""
"0000263194" "00262089" "1" "03256" "03256" "2019-08-17 15:27:17" "" "" "SEQ" "DNA" "blood" ""
"0000263195" "00262090" "1" "03256" "03256" "2019-08-17 15:38:06" "" "" "SEQ" "DNA" "blood" ""
"0000263196" "00262091" "1" "03256" "03256" "2019-08-17 15:59:38" "" "" "SEQ" "DNA" "blood" ""
"0000263197" "00262092" "1" "03256" "03256" "2019-08-17 16:09:40" "" "" "SEQ" "DNA" "blood" ""
"0000263198" "00262093" "1" "03256" "03256" "2019-08-17 18:35:14" "" "" "SEQ" "DNA" "blood" ""
"0000263202" "00262096" "1" "03256" "03256" "2019-08-18 08:26:30" "" "" "SEQ" "DNA" "blood" ""
"0000263203" "00262097" "1" "03256" "03256" "2019-08-18 09:29:52" "" "" "SEQ" "DNA" "blood" ""
"0000263204" "00262098" "1" "03256" "03256" "2019-08-18 09:38:42" "" "" "SEQ" "DNA" "blood" ""
"0000263205" "00262099" "1" "03256" "03256" "2019-08-18 09:46:59" "" "" "SEQ" "DNA" "blood" ""
"0000263206" "00262100" "1" "03256" "03256" "2019-08-18 12:50:57" "" "" "SEQ" "DNA" "blood" ""
"0000263207" "00262101" "1" "03256" "03256" "2019-08-18 13:05:58" "" "" "SEQ" "DNA" "blood" ""
"0000263209" "00262103" "1" "03256" "03256" "2019-08-18 16:03:15" "" "" "SEQ" "DNA" "blood" ""
"0000263210" "00262104" "1" "03256" "03256" "2019-08-18 21:16:21" "" "" "SEQ" "DNA" "blood" ""
"0000263211" "00262105" "1" "03256" "03256" "2019-08-18 22:00:45" "" "" "SEQ" "DNA" "blood" ""
"0000263212" "00262106" "1" "03256" "03256" "2019-08-18 22:13:49" "" "" "SEQ" "DNA" "" ""
"0000263213" "00262107" "1" "03256" "03256" "2019-08-18 22:30:27" "" "" "SEQ" "DNA" "blood" ""
"0000263214" "00262108" "1" "03256" "03256" "2019-08-18 22:40:46" "" "" "SEQ" "DNA" "blood" ""
"0000263215" "00262109" "1" "03256" "03256" "2019-08-18 22:59:37" "" "" "SEQ" "DNA" "blood" ""
"0000263227" "00262121" "1" "03256" "03256" "2019-08-19 09:57:52" "" "" "SEQ" "DNA" "blood" ""
"0000263228" "00262122" "1" "03256" "03256" "2019-08-19 10:40:26" "" "" "SEQ" "DNA" "blood" ""
"0000263229" "00262123" "1" "03256" "03256" "2019-08-19 11:20:34" "" "" "SEQ" "DNA" "blood" ""
"0000263230" "00262124" "1" "03256" "03256" "2019-08-19 13:08:59" "" "" "SEQ" "DNA" "blood" ""
"0000263231" "00262125" "1" "03256" "03256" "2019-08-19 15:19:34" "" "" "SEQ" "DNA" "blood" ""
"0000263232" "00262126" "1" "03256" "03256" "2019-08-19 15:37:57" "" "" "SEQ" "DNA" "blood" ""
"0000263233" "00262127" "1" "03256" "03256" "2019-08-19 15:58:18" "" "" "SEQ" "DNA" "blood" ""
"0000263234" "00262128" "1" "03256" "03256" "2019-08-19 16:12:52" "" "" "SEQ" "DNA" "blood" ""
"0000263235" "00262129" "1" "03256" "03256" "2019-08-19 16:21:41" "" "" "SEQ" "DNA" "" ""
"0000263237" "00262131" "1" "03256" "03256" "2019-08-19 18:07:05" "" "" "SEQ" "DNA" "blood" ""
"0000263238" "00262132" "1" "03256" "03256" "2019-08-19 18:19:32" "" "" "SEQ" "DNA" "" "Loules 2018 investigated using next-generation sequencing"
"0000264158" "00263052" "1" "03256" "03256" "2019-08-20 17:36:48" "" "" "SEQ" "DNA" "blood" ""
"0000264225" "00263119" "1" "03256" "03256" "2019-08-22 23:37:31" "" "" "SEQ" "DNA" "blood" ""
"0000265119" "00264007" "1" "03256" "03256" "2019-09-05 16:06:34" "" "" "SEQ" "DNA" "blood" ""
"0000265124" "00264013" "1" "03256" "03256" "2019-09-05 16:35:45" "03256" "2021-09-02 15:40:54" "SEQ" "DNA" "blood" ""
"0000265127" "00264016" "1" "03256" "03256" "2019-09-05 17:00:24" "" "" "SEQ" "DNA" "blood" ""
"0000265157" "00264035" "1" "03256" "03256" "2019-09-06 10:48:23" "" "" "SEQ" "DNA" "blood" ""
"0000265158" "00264036" "1" "03256" "03256" "2019-09-06 15:31:20" "" "" "SEQ" "DNA" "blood" ""
"0000265186" "00264064" "1" "03256" "03256" "2019-09-09 16:36:28" "" "" "SEQ" "DNA" "" ""
"0000265210" "00264088" "1" "03256" "03256" "2019-09-10 18:12:36" "" "" "SEQ" "DNA" "blood" ""
"0000265249" "00264129" "1" "03256" "03256" "2019-09-12 09:38:25" "" "" "SEQ" "DNA" "blood" ""
"0000265251" "00264131" "1" "03256" "03256" "2019-09-12 10:19:34" "" "" "SEQ" "DNA" "" ""
"0000265268" "00264148" "1" "03256" "03256" "2019-09-12 11:36:48" "" "" "?" "DNA" "" ""
"0000265269" "00264150" "1" "03256" "03256" "2019-09-12 15:10:31" "" "" "?" "DNA" "" ""
"0000265275" "00264155" "1" "03256" "03256" "2019-09-13 09:14:35" "" "" "SEQ" "DNA" "" ""
"0000265276" "00264156" "1" "03256" "03256" "2019-09-13 09:26:23" "" "" "SEQ" "DNA" "" ""
"0000265277" "00264157" "1" "03256" "03256" "2019-09-13 09:39:41" "" "" "?" "DNA" "" ""
"0000265278" "00264158" "1" "03256" "03256" "2019-09-13 09:51:09" "" "" "SEQ" "DNA" "blood" ""
"0000266333" "00265212" "1" "03256" "03256" "2019-09-14 18:23:18" "" "" "SEQ" "DNA" "blood" ""
"0000266334" "00265213" "1" "03256" "03256" "2019-09-14 18:41:05" "" "" "SEQ" "DNA" "blood" ""
"0000266335" "00265214" "1" "03256" "03256" "2019-09-14 18:51:47" "" "" "SEQ" "DNA" "b" ""
"0000266337" "00265216" "1" "03256" "03256" "2019-09-14 19:05:32" "" "" "SEQ" "DNA" "blood" ""
"0000266339" "00265218" "1" "03256" "03256" "2019-09-14 19:28:42" "" "" "SEQ" "DNA" "blood" ""
"0000266341" "00265220" "1" "03256" "03256" "2019-09-15 18:38:06" "" "" "SEQ" "DNA" "blood" ""
"0000266342" "00265221" "1" "03256" "03256" "2019-09-15 19:00:17" "" "" "SEQ" "DNA" "blood" ""
"0000266343" "00265222" "1" "03256" "03256" "2019-09-16 09:04:18" "" "" "SEQ" "DNA" "blood" ""
"0000266344" "00265223" "1" "03256" "03256" "2019-09-16 09:16:35" "" "" "SEQ" "DNA" "blood" ""
"0000266345" "00265224" "1" "03256" "03256" "2019-09-16 09:37:50" "" "" "SEQ" "DNA" "blood" ""
"0000266346" "00265225" "1" "03256" "03256" "2019-09-16 09:46:50" "" "" "SEQ" "DNA" "blood" ""
"0000266347" "00265226" "1" "03256" "03256" "2019-09-16 09:58:43" "" "" "SEQ" "DNA" "blood" ""
"0000266348" "00265227" "1" "03256" "03256" "2019-09-16 10:11:13" "" "" "SEQ" "DNA" "blood" ""
"0000266349" "00265228" "1" "03256" "03256" "2019-09-16 10:22:47" "" "" "SEQ" "DNA" "blood" ""
"0000266350" "00265229" "1" "03256" "03256" "2019-09-16 10:55:46" "" "" "SEQ" "DNA" "blood" ""
"0000266351" "00265231" "1" "03256" "03256" "2019-09-16 11:19:23" "" "" "SEQ" "DNA" "blood" ""
"0000266357" "00265235" "1" "03256" "03256" "2019-09-16 22:33:14" "" "" "?" "DNA" "" ""
"0000266358" "00265236" "1" "03256" "03256" "2019-09-17 07:46:54" "" "" "SEQ" "DNA" "blood" ""
"0000266379" "00265260" "1" "03256" "03256" "2019-09-18 14:55:59" "" "" "SEQ" "DNA" "blood" ""
"0000266380" "00265261" "1" "03256" "03256" "2019-09-18 15:05:32" "" "" "SEQ" "DNA" "blood" ""
"0000266381" "00265262" "1" "03256" "03256" "2019-09-18 15:22:05" "" "" "SEQ" "DNA" "blood" ""
"0000266406" "00265286" "1" "03256" "03256" "2019-09-19 09:33:22" "" "" "SEQ" "DNA" "blood" ""
"0000266425" "00265306" "1" "03256" "03256" "2019-09-19 19:57:45" "" "" "SEQ" "DNA" "" ""
"0000266426" "00265307" "1" "03256" "03256" "2019-09-19 20:03:03" "" "" "SEQ" "DNA" "blood" ""
"0000266427" "00265308" "1" "03256" "03256" "2019-09-19 20:11:21" "" "" "SEQ" "DNA" "blood" ""
"0000266430" "00265310" "1" "03256" "03256" "2019-09-19 20:28:22" "03256" "2019-10-03 10:00:53" "SEQ" "DNA" "blood" "Identification of c.600dupC: forward validation of NGS platform, Loules 2018"
"0000266431" "00265311" "1" "03256" "03256" "2019-09-19 20:43:38" "" "" "SEQ" "DNA" "blood" ""
"0000266435" "00265316" "1" "03256" "03256" "2019-09-20 09:07:37" "" "" "SEQ" "DNA" "blood" ""
"0000266436" "00265317" "1" "03256" "03256" "2019-09-20 10:18:07" "" "" "SEQ" "DNA" "blood" ""
"0000266437" "00265318" "1" "03256" "03256" "2019-09-20 10:37:51" "" "" "SEQ" "DNA" "blood" ""
"0000266438" "00265319" "1" "03256" "03256" "2019-09-20 10:49:22" "" "" "SEQ" "DNA" "blood" ""
"0000266439" "00265320" "1" "03256" "03256" "2019-09-20 11:02:05" "" "" "SEQ" "DNA" "blood" ""
"0000266440" "00265321" "1" "03256" "03256" "2019-09-20 11:22:28" "" "" "SEQ" "DNA" "" ""
"0000266441" "00265322" "1" "03256" "03256" "2019-09-20 11:38:09" "" "" "SEQ" "DNA" "blood" ""
"0000266442" "00265323" "1" "03256" "03256" "2019-09-20 11:51:36" "" "" "SEQ" "DNA" "blood" ""
"0000266443" "00265324" "1" "03256" "03256" "2019-09-20 12:13:59" "" "" "SEQ" "DNA" "" ""
"0000266444" "00265325" "1" "03256" "03256" "2019-09-20 12:21:23" "" "" "SEQ" "DNA" "" ""
"0000266445" "00265326" "1" "03256" "03256" "2019-09-20 12:27:16" "" "" "SEQ" "DNA" "blood" ""
"0000266446" "00265328" "1" "03256" "03256" "2019-09-20 15:24:03" "" "" "SEQ" "DNA" "blood" ""
"0000266447" "00265329" "1" "03256" "03256" "2019-09-20 15:41:53" "" "" "SEQ" "DNA" "blood" ""
"0000266448" "00265330" "1" "03256" "03256" "2019-09-20 15:57:13" "" "" "SEQ" "DNA" "blood" ""
"0000266449" "00265331" "1" "03256" "03256" "2019-09-20 16:15:31" "" "" "SEQ" "DNA" "blood" ""
"0000266450" "00265332" "1" "03256" "03256" "2019-09-20 16:45:46" "" "" "SEQ" "DNA" "blood" ""
"0000266451" "00265333" "1" "03256" "03256" "2019-09-20 17:01:04" "" "" "SEQ" "DNA" "blood" ""
"0000266452" "00265334" "1" "03256" "03256" "2019-09-20 17:14:51" "" "" "SEQ" "DNA" "blood" ""
"0000266454" "00265335" "1" "03256" "03256" "2019-09-20 18:35:35" "" "" "SEQ" "DNA" "blood" ""
"0000266455" "00265336" "1" "03256" "03256" "2019-09-20 18:46:45" "" "" "SEQ" "DNA" "blood" ""
"0000266456" "00265337" "1" "03256" "03256" "2019-09-20 18:54:00" "" "" "?" "DNA" "" ""
"0000266465" "00265346" "1" "03256" "03256" "2019-09-21 10:22:33" "" "" "SEQ" "DNA" "blood" ""
"0000266466" "00265347" "1" "03256" "03256" "2019-09-21 11:34:19" "" "" "SEQ" "DNA" "blood" ""
"0000266467" "00265348" "1" "03256" "03256" "2019-09-21 11:45:15" "" "" "SEQ" "DNA" "blood" ""
"0000266468" "00265349" "1" "03256" "03256" "2019-09-21 12:00:42" "" "" "SEQ" "DNA" "blood" ""
"0000266469" "00265350" "1" "03256" "03256" "2019-09-21 12:15:01" "" "" "SEQ" "DNA" "blood" ""
"0000266470" "00265351" "1" "03256" "03256" "2019-09-21 12:28:25" "" "" "SEQ" "DNA" "blood" ""
"0000266476" "00265357" "1" "03256" "03256" "2019-09-21 18:32:44" "" "" "SEQ" "DNA" "blood" ""
"0000266477" "00265358" "1" "03256" "03256" "2019-09-21 19:18:03" "" "" "SEQ" "DNA" "blood" ""
"0000266478" "00265359" "1" "03256" "03256" "2019-09-21 19:27:02" "" "" "SEQ" "DNA" "blood" ""
"0000266479" "00265360" "1" "03256" "03256" "2019-09-21 19:35:54" "" "" "SEQ" "DNA" "blood" ""
"0000266488" "00265366" "1" "03256" "03256" "2019-09-22 21:20:25" "" "" "SEQ" "DNA" "blood" ""
"0000266490" "00265368" "1" "03256" "03256" "2019-09-22 21:59:33" "" "" "SEQ" "DNA" "blood" ""
"0000266491" "00265369" "1" "03256" "03256" "2019-09-22 22:12:54" "" "" "SEQ" "DNA" "blood" ""
"0000266495" "00265373" "1" "03256" "03256" "2019-09-23 09:30:11" "" "" "SEQ" "DNA" "blood" ""
"0000266496" "00265374" "1" "03256" "03256" "2019-09-23 09:41:29" "" "" "SEQ" "DNA" "blood" ""
"0000266497" "00265375" "1" "03256" "03256" "2019-09-23 09:55:40" "" "" "SEQ" "DNA" "blood" ""
"0000266498" "00265376" "1" "03256" "03256" "2019-09-23 13:32:54" "" "" "SEQ" "DNA" "blood" ""
"0000266508" "00265385" "1" "03256" "03256" "2019-09-24 09:47:42" "" "" "SEQ" "DNA" "blood" ""
"0000266511" "00265388" "1" "03256" "03256" "2019-09-24 10:13:44" "" "" "SEQ" "DNA" "" ""
"0000266512" "00265389" "1" "03256" "03256" "2019-09-24 10:20:12" "" "" "SEQ" "DNA" "blood" ""
"0000266522" "00265398" "1" "03256" "03256" "2019-09-24 17:10:35" "" "" "SEQ" "DNA" "blood" ""
"0000266524" "00265400" "1" "03256" "03256" "2019-09-24 17:30:18" "" "" "SEQ" "DNA" "blood" ""
"0000266552" "00265426" "1" "03256" "03256" "2019-09-25 10:15:12" "" "" "SEQ" "DNA" "blood" ""
"0000266553" "00265427" "1" "03256" "03256" "2019-09-25 11:11:09" "" "" "SEQ" "DNA" "blood" ""
"0000266554" "00265428" "1" "03256" "03256" "2019-09-25 11:19:32" "" "" "SEQ" "DNA" "blood" ""
"0000266555" "00265429" "1" "03256" "03256" "2019-09-25 11:47:51" "" "" "SEQ" "DNA" "blood" ""
"0000266556" "00265430" "1" "03256" "03256" "2019-09-25 11:56:32" "" "" "SEQ" "DNA" "blood" ""
"0000266557" "00265431" "1" "03256" "03256" "2019-09-25 12:16:28" "00006" "2020-09-25 08:52:33" "QMPSF" "DNA" "blood" "Quantitative Multiplex PCR of Short Fluorescent fragments"
"0000266558" "00265432" "1" "03256" "03256" "2019-09-25 12:26:36" "" "" "SEQ" "DNA" "blood" ""
"0000266560" "00265434" "1" "03256" "03256" "2019-09-25 12:53:03" "" "" "SEQ-NG-IT" "DNA" "blood" ""
"0000266566" "00265443" "1" "03256" "03256" "2019-09-26 10:04:36" "" "" "SEQ" "DNA" "blood" ""
"0000266568" "00265445" "1" "03256" "03256" "2019-09-26 10:22:46" "" "" "SEQ" "DNA" "blood" ""
"0000266569" "00265446" "1" "03256" "03256" "2019-09-26 10:46:26" "" "" "SEQ" "DNA" "blood" ""
"0000266570" "00265447" "1" "03256" "03256" "2019-09-26 10:54:00" "" "" "SEQ" "DNA" "blood" ""
"0000266571" "00265448" "1" "03256" "03256" "2019-09-26 11:01:20" "" "" "SEQ" "DNA" "blood" ""
"0000266606" "00265483" "1" "03256" "03256" "2019-09-26 11:13:07" "" "" "SEQ" "DNA" "blood" ""
"0000266612" "00265489" "1" "03256" "03256" "2019-09-26 11:56:11" "" "" "SEQ" "DNA" "blood" ""
"0000266631" "00265508" "1" "03256" "03256" "2019-09-26 12:05:01" "" "" "SEQ" "DNA" "blood" ""
"0000266634" "00265511" "1" "03256" "03256" "2019-09-26 12:25:17" "" "" "SEQ" "DNA" "blood" ""
"0000266648" "00265525" "1" "03256" "03256" "2019-09-26 15:02:05" "" "" "SEQ" "DNA" "blood" ""
"0000266649" "00265526" "1" "03256" "03256" "2019-09-26 15:16:28" "" "" "SEQ" "DNA" "" ""
"0000266650" "00265527" "1" "03256" "03256" "2019-09-26 15:38:34" "" "" "SEQ" "DNA" "blood" ""
"0000266651" "00265528" "1" "03256" "03256" "2019-09-26 15:47:13" "" "" "SEQ" "DNA" "blood" ""
"0000266652" "00265529" "1" "03256" "03256" "2019-09-26 15:56:54" "" "" "SEQ" "DNA" "" ""
"0000266653" "00265530" "1" "03256" "03256" "2019-09-26 16:02:46" "" "" "SEQ" "DNA" "blood" ""
"0000266654" "00265531" "1" "03256" "03256" "2019-09-26 16:08:49" "" "" "SEQ" "DNA" "" ""
"0000266655" "00265532" "1" "03256" "03256" "2019-09-26 16:15:32" "" "" "SEQ" "DNA" "blood" ""
"0000266656" "00265533" "1" "03256" "03256" "2019-09-26 16:20:40" "" "" "SEQ" "DNA" "blood" ""
"0000266657" "00265535" "1" "03256" "03256" "2019-09-26 16:28:52" "" "" "SEQ" "DNA" "blood" ""
"0000266698" "00265576" "1" "03256" "03256" "2019-09-26 16:36:11" "" "" "SEQ" "DNA" "blood" ""
"0000266699" "00265577" "1" "03256" "03256" "2019-09-26 16:42:36" "" "" "SEQ" "DNA" "blood" ""
"0000266700" "00265578" "1" "03256" "03256" "2019-09-26 17:01:44" "" "" "SEQ" "DNA" "blood" ""
"0000266701" "00265579" "1" "03256" "03256" "2019-09-26 17:06:44" "" "" "SEQ" "DNA" "blood" ""
"0000266702" "00265580" "1" "03256" "03256" "2019-09-26 17:13:48" "" "" "SEQ" "DNA" "blood" ""
"0000266703" "00265581" "1" "03256" "03256" "2019-09-26 17:34:09" "" "" "SEQ" "DNA;RNA" "blood" ""
"0000266706" "00265583" "1" "03256" "03256" "2019-09-26 18:32:26" "" "" "SEQ" "DNA" "blood" ""
"0000266707" "00265584" "1" "03256" "03256" "2019-09-26 18:47:38" "" "" "SEQ-NG-IT" "DNA" "" ""
"0000266716" "00265593" "1" "03256" "03256" "2019-09-26 19:01:44" "" "" "SEQ" "DNA" "blood" ""
"0000266717" "00265594" "1" "03256" "03256" "2019-09-26 19:34:51" "" "" "SEQ" "DNA" "blood" ""
"0000266718" "00265595" "1" "03256" "03256" "2019-09-26 19:45:36" "" "" "SEQ" "DNA" "blood" ""
"0000266719" "00265596" "1" "03256" "03256" "2019-09-26 19:58:41" "" "" "SEQ" "DNA" "blood" ""
"0000266723" "00265600" "1" "03256" "03256" "2019-09-27 10:16:10" "03256" "2025-02-11 17:16:31" "?" "DNA" "" ""
"0000266725" "00265602" "1" "03256" "03256" "2019-09-27 11:44:51" "" "" "SEQ" "DNA" "blood" ""
"0000266726" "00265603" "1" "03256" "03256" "2019-09-27 12:00:23" "" "" "SEQ" "DNA" "blood" ""
"0000266727" "00265604" "1" "03256" "03256" "2019-09-27 12:35:12" "" "" "SEQ" "DNA" "blood" ""
"0000266728" "00265605" "1" "03256" "03256" "2019-09-27 12:44:08" "" "" "SEQ" "DNA" "blood" ""
"0000266729" "00265606" "1" "03256" "03256" "2019-09-27 12:56:39" "" "" "SEQ" "DNA" "blood" ""
"0000266730" "00265607" "1" "03256" "03256" "2019-09-27 21:45:27" "" "" "SEQ" "DNA" "blood" ""
"0000266731" "00265608" "1" "03256" "03256" "2019-09-27 22:09:21" "03256" "2019-09-27 22:23:22" "SEQ" "DNA" "blood" "Detection by FAMA"
"0000266732" "00265609" "1" "03256" "03256" "2019-09-27 22:25:18" "" "" "SEQ" "DNA" "blood" ""
"0000266733" "00265610" "1" "03256" "03256" "2019-09-28 09:01:09" "" "" "SEQ" "DNA" "blood" ""
"0000266734" "00265611" "1" "03256" "03256" "2019-09-28 09:14:26" "" "" "SEQ" "DNA" "blood" ""
"0000266735" "00265612" "1" "03256" "03256" "2019-09-28 09:35:00" "" "" "SEQ" "DNA" "blood" ""
"0000266736" "00265613" "1" "03256" "03256" "2019-09-28 09:41:41" "" "" "SEQ-NG-IT" "DNA" "blood" ""
"0000266737" "00265614" "1" "03256" "03256" "2019-09-28 09:48:12" "" "" "SEQ" "DNA" "blood" ""
"0000266738" "00265615" "1" "03256" "03256" "2019-09-28 10:02:29" "" "" "SEQ" "DNA" "blood" ""
"0000266739" "00265616" "1" "03256" "03256" "2019-09-28 15:04:31" "" "" "SEQ-NG-IT" "DNA" "" ""
"0000266740" "00265617" "1" "03256" "03256" "2019-09-28 15:33:03" "" "" "SEQ" "DNA" "blood" ""
"0000266742" "00265619" "1" "03256" "03256" "2019-09-28 17:25:09" "" "" "SEQ" "DNA" "blood" ""
"0000266743" "00265620" "1" "03256" "03256" "2019-09-28 17:33:14" "" "" "SEQ-NG-IT" "DNA" "" ""
"0000266744" "00265621" "1" "03256" "03256" "2019-09-28 17:44:18" "" "" "?" "DNA" "" ""
"0000266745" "00265622" "1" "03256" "03256" "2019-09-28 18:54:29" "" "" "SEQ" "DNA" "blood" ""
"0000266746" "00265623" "1" "03256" "03256" "2019-09-28 19:16:06" "" "" "SEQ" "DNA" "blood" ""
"0000266747" "00265624" "1" "03256" "03256" "2019-09-28 19:30:44" "" "" "?" "DNA" "" ""
"0000266748" "00265625" "1" "03256" "03256" "2019-09-28 20:44:59" "" "" "SEQ-NG-IT" "DNA" "blood" ""
"0000266749" "00265626" "1" "03256" "03256" "2019-09-28 21:25:09" "" "" "SEQ" "DNA" "blood" ""
"0000266750" "00265627" "1" "03256" "03256" "2019-09-28 21:36:00" "" "" "SEQ" "DNA" "blood" ""
"0000266751" "00265628" "1" "03256" "03256" "2019-09-28 21:42:25" "" "" "SEQ" "DNA" "blood" ""
"0000266752" "00265629" "1" "03256" "03256" "2019-09-28 21:53:35" "" "" "SEQ" "DNA" "blood" ""
"0000266753" "00265630" "1" "03256" "03256" "2019-09-29 09:53:53" "" "" "SEQ" "DNA" "blood" ""
"0000266754" "00265631" "1" "03256" "03256" "2019-09-29 10:00:06" "" "" "SEQ" "DNA" "blood" ""
"0000266757" "00265634" "1" "03256" "03256" "2019-09-29 18:17:01" "" "" "SEQ" "DNA" "blood" ""
"0000266758" "00265635" "1" "03256" "03256" "2019-09-29 18:25:17" "" "" "SEQ-NG-IT" "DNA" "blood" ""
"0000266759" "00265636" "1" "03256" "03256" "2019-09-29 18:36:59" "" "" "SEQ" "DNA" "blood" ""
"0000266760" "00265637" "1" "03256" "03256" "2019-09-29 18:52:58" "" "" "SEQ" "DNA" "blood" ""
"0000266761" "00265638" "1" "03256" "03256" "2019-09-29 19:06:49" "" "" "SEQ-NG-IT" "DNA" "blood" ""
"0000266762" "00265639" "1" "03256" "03256" "2019-09-29 19:19:28" "" "" "SEQ-NG-IT" "DNA" "blood" ""
"0000266764" "00265641" "1" "03256" "03256" "2019-09-30 08:43:45" "" "" "SEQ" "DNA" "blood" ""
"0000266765" "00265642" "1" "03256" "03256" "2019-09-30 08:55:06" "" "" "SEQ" "DNA" "blood" ""
"0000266766" "00265643" "1" "03256" "03256" "2019-09-30 09:05:35" "" "" "SEQ" "DNA" "blood" ""
"0000266767" "00265644" "1" "03256" "03256" "2019-09-30 09:14:27" "" "" "SEQ" "DNA" "blood" ""
"0000266821" "00265699" "1" "03256" "03256" "2019-09-30 19:00:21" "" "" "SEQ" "DNA" "blood" ""
"0000266824" "00265702" "1" "03256" "03256" "2019-10-01 10:09:17" "" "" "SEQ" "DNA" "blood" ""
"0000266825" "00265703" "1" "03256" "03256" "2019-10-01 10:20:28" "" "" "SEQ" "DNA" "blood" ""
"0000266827" "00265704" "1" "03256" "03256" "2019-10-01 10:38:41" "" "" "SEQ" "DNA" "blood" "variant identification validated using NGS by Loules 2018"
"0000266828" "00265705" "1" "03256" "03256" "2019-10-01 10:58:28" "" "" "SEQ" "DNA" "blood" "Variant identification validated using NGS by Loules 2018"
"0000266830" "00265706" "1" "03256" "03256" "2019-10-01 11:13:12" "" "" "SEQ" "DNA" "blood" ""
"0000266831" "00265708" "1" "03256" "03256" "2019-10-01 11:27:16" "" "" "SEQ" "DNA" "blood" ""
"0000266832" "00265709" "1" "03256" "03256" "2019-10-01 11:47:51" "" "" "SEQ-NG-IT" "DNA" "" ""
"0000266833" "00265710" "1" "03256" "03256" "2019-10-01 11:59:55" "" "" "SEQ" "DNA" "blood" ""
"0000266834" "00265711" "1" "03256" "03256" "2019-10-01 15:50:39" "" "" "SEQ" "DNA" "blood" ""
"0000266835" "00265712" "1" "03256" "03256" "2019-10-01 16:06:55" "" "" "SEQ" "DNA" "blood" ""
"0000266836" "00265713" "1" "03256" "03256" "2019-10-01 16:14:09" "" "" "SEQ" "DNA" "blood" ""
"0000266837" "00265714" "1" "03256" "03256" "2019-10-01 16:20:27" "" "" "SEQ" "DNA" "blood" ""
"0000266839" "00265716" "1" "03256" "03256" "2019-10-01 17:17:00" "" "" "SEQ" "DNA" "blood" ""
"0000266840" "00265717" "1" "03256" "03256" "2019-10-01 17:45:34" "" "" "SEQ" "DNA" "blood" ""
"0000266842" "00265719" "1" "03256" "03256" "2019-10-02 08:45:05" "" "" "SEQ" "DNA" "blood" ""
"0000266843" "00265720" "1" "03256" "03256" "2019-10-02 08:56:51" "" "" "SEQ" "DNA" "" ""
"0000266844" "00265721" "1" "03256" "03256" "2019-10-02 09:03:08" "" "" "SEQ" "DNA" "blood" ""
"0000266845" "00265722" "1" "03256" "03256" "2019-10-02 09:37:42" "" "" "SEQ" "DNA" "blood" ""
"0000266865" "00265742" "1" "03256" "03256" "2019-10-02 15:20:24" "03256" "2021-04-15 12:04:04" "DHPLC" "DNA" "blood, buccal, urinary, hair roots, fibroblasts" ""
"0000266866" "00265743" "1" "03256" "03256" "2019-10-02 15:58:36" "" "" "SEQ" "DNA" "blood" ""
"0000266867" "00265744" "1" "03256" "03256" "2019-10-03 09:22:18" "" "" "SEQ" "DNA" "blood" ""
"0000266868" "00265745" "1" "03256" "03256" "2019-10-03 09:31:31" "" "" "SEQ" "DNA" "blood" ""
"0000266869" "00265746" "1" "03256" "03256" "2019-10-03 09:41:09" "" "" "?" "DNA" "" ""
"0000266871" "00265748" "1" "03256" "03256" "2019-10-03 10:03:49" "" "" "SEQ" "DNA" "blood" ""
"0000266872" "00265749" "1" "03256" "03256" "2019-10-03 10:13:03" "" "" "SEQ" "DNA" "blood" ""
"0000266873" "00265750" "1" "03256" "03256" "2019-10-03 10:55:25" "" "" "SEQ" "DNA" "blood" ""
"0000266874" "00265751" "1" "03256" "03256" "2019-10-03 11:12:33" "" "" "SEQ" "DNA" "blood" ""
"0000266875" "00265752" "1" "03256" "03256" "2019-10-03 11:23:23" "" "" "SEQ" "DNA" "blood" ""
"0000266876" "00265753" "1" "03256" "03256" "2019-10-03 15:46:06" "" "" "SEQ" "DNA" "" ""
"0000266877" "00265754" "1" "03256" "03256" "2019-10-03 16:03:36" "" "" "SEQ" "DNA" "blood" ""
"0000266878" "00265755" "1" "03256" "03256" "2019-10-03 16:10:22" "" "" "SEQ" "DNA" "blood" ""
"0000266879" "00265756" "1" "03256" "03256" "2019-10-04 08:55:06" "" "" "SEQ" "DNA" "blood" ""
"0000266880" "00265757" "1" "03256" "03256" "2019-10-04 09:32:29" "" "" "SEQ" "DNA" "blood" ""
"0000266881" "00265758" "1" "03256" "03256" "2019-10-04 09:38:32" "" "" "SEQ" "DNA" "blood" ""
"0000266882" "00265759" "1" "03256" "03256" "2019-10-04 09:47:12" "" "" "SEQ" "DNA" "blood" ""
"0000266883" "00265760" "1" "03256" "03256" "2019-10-04 10:01:58" "" "" "SEQ" "DNA" "blood" ""
"0000266884" "00265761" "1" "03256" "03256" "2019-10-04 10:15:28" "" "" "SEQ" "DNA" "blood" ""
"0000266885" "00265762" "1" "03256" "03256" "2019-10-04 10:50:21" "" "" "SEQ" "DNA" "blood" ""
"0000266886" "00265763" "1" "03256" "03256" "2019-10-04 11:03:07" "" "" "SEQ" "DNA" "blood" ""
"0000266957" "00265834" "1" "03256" "03256" "2019-10-07 09:17:18" "" "" "SEQ" "DNA" "blood" ""
"0000266960" "00265837" "1" "03256" "03256" "2019-10-07 10:57:01" "" "" "SEQ" "DNA" "blood" ""
"0000266961" "00265838" "1" "03256" "03256" "2019-10-07 11:30:27" "" "" "SEQ" "DNA" "blood" ""
"0000266962" "00265839" "1" "03256" "03256" "2019-10-07 11:50:38" "" "" "SEQ" "DNA" "blood" ""
"0000266965" "00265842" "1" "03256" "03256" "2019-10-07 16:32:37" "" "" "SEQ" "DNA" "blood" ""
"0000266966" "00265843" "1" "03256" "03256" "2019-10-07 16:48:23" "" "" "SEQ" "DNA" "blood" ""
"0000266967" "00265844" "1" "03256" "03256" "2019-10-07 17:03:50" "" "" "SEQ-NG-IT" "DNA" "" ""
"0000266968" "00265845" "1" "03256" "03256" "2019-10-07 18:05:15" "" "" "SEQ" "DNA" "blood" ""
"0000266969" "00265846" "1" "03256" "03256" "2019-10-07 18:13:52" "" "" "SEQ" "DNA" "blood" ""
"0000266972" "00265849" "1" "03256" "03256" "2019-10-08 09:00:23" "" "" "SEQ" "DNA" "blood" ""
"0000266973" "00265850" "1" "03256" "03256" "2019-10-08 09:39:33" "" "" "SEQ" "DNA" "" ""
"0000266974" "00265851" "1" "03256" "03256" "2019-10-08 09:48:38" "" "" "SEQ" "DNA" "blood" ""
"0000266975" "00265852" "1" "03256" "03256" "2019-10-08 09:53:50" "" "" "SEQ" "DNA" "blood" ""
"0000266976" "00265853" "1" "03256" "03256" "2019-10-08 10:00:59" "" "" "SEQ" "DNA" "blood" ""
"0000266977" "00265854" "1" "03256" "03256" "2019-10-08 10:33:09" "" "" "SEQ" "DNA" "blood" ""
"0000266978" "00265855" "1" "03256" "03256" "2019-10-08 10:38:02" "" "" "SEQ" "DNA" "blood" ""
"0000266979" "00265856" "1" "03256" "03256" "2019-10-08 11:04:25" "" "" "SEQ" "DNA" "blood" ""
"0000266980" "00265857" "1" "03256" "03256" "2019-10-08 11:10:29" "" "" "SEQ" "DNA" "blood" ""
"0000266981" "00265858" "1" "03256" "03256" "2019-10-08 11:20:34" "" "" "SEQ" "DNA" "blood" ""
"0000266982" "00265859" "1" "03256" "03256" "2019-10-08 12:02:56" "" "" "SEQ" "DNA" "blood" ""
"0000266984" "00265861" "1" "03256" "03256" "2019-10-08 18:17:44" "" "" "SEQ" "DNA" "blood" ""
"0000266985" "00265862" "1" "03256" "03256" "2019-10-08 18:46:27" "" "" "SEQ" "DNA" "blood" ""
"0000266986" "00265863" "1" "03256" "03256" "2019-10-08 18:56:41" "" "" "SEQ" "DNA" "blood" ""
"0000266992" "00265871" "1" "03256" "03256" "2019-10-09 10:18:15" "" "" "SEQ" "DNA" "blood" ""
"0000266993" "00265873" "1" "03256" "03256" "2019-10-09 11:11:35" "" "" "SEQ" "DNA" "blood" ""
"0000266994" "00265874" "1" "03256" "03256" "2019-10-09 11:18:23" "" "" "SEQ" "DNA" "blood" ""
"0000266995" "00265875" "1" "03256" "03256" "2019-10-09 11:30:06" "" "" "SEQ" "DNA" "blood" ""
"0000266996" "00265876" "1" "03256" "03256" "2019-10-09 11:37:50" "" "" "SEQ" "DNA" "blood" ""
"0000266997" "00265877" "1" "03256" "03256" "2019-10-09 11:55:33" "" "" "SEQ" "DNA" "blood" ""
"0000267001" "00265881" "1" "03256" "03256" "2019-10-09 18:09:10" "" "" "SEQ" "DNA" "blood" ""
"0000267005" "00265885" "1" "03256" "03256" "2019-10-10 12:05:09" "" "" "SEQ" "DNA" "blood" ""
"0000267006" "00265886" "1" "03256" "03256" "2019-10-10 12:19:36" "" "" "SEQ" "DNA" "blood" ""
"0000267007" "00265887" "1" "03256" "03256" "2019-10-10 12:29:44" "" "" "SEQ" "DNA" "blood" ""
"0000267008" "00265888" "1" "03256" "03256" "2019-10-10 12:37:35" "" "" "SEQ" "DNA" "blood" ""
"0000267009" "00265889" "1" "03256" "03256" "2019-10-10 12:45:13" "" "" "SEQ" "DNA" "blood" ""
"0000267010" "00265890" "1" "03256" "03256" "2019-10-10 15:22:19" "" "" "SEQ" "DNA" "blood" ""
"0000267011" "00265891" "1" "03256" "03256" "2019-10-10 15:43:19" "" "" "SEQ" "DNA" "blood" ""
"0000267012" "00265892" "1" "03256" "03256" "2019-10-10 15:55:22" "" "" "SEQ" "DNA" "blood" ""
"0000267013" "00265893" "1" "03256" "03256" "2019-10-10 16:09:44" "" "" "?" "DNA" "" ""
"0000267014" "00265894" "1" "03256" "03256" "2019-10-10 16:15:32" "" "" "SEQ" "DNA" "blood" ""
"0000267015" "00265895" "1" "03256" "03256" "2019-10-11 09:41:04" "" "" "SEQ" "DNA" "blood" ""
"0000267016" "00265896" "1" "03256" "03256" "2019-10-11 10:06:21" "" "" "SEQ" "DNA" "blood" ""
"0000267018" "00265898" "1" "03256" "03256" "2019-10-11 10:46:44" "" "" "SEQ" "DNA" "blood" ""
"0000267020" "00265900" "1" "03256" "03256" "2019-10-11 10:56:26" "" "" "SEQ" "DNA" "blood" ""
"0000267022" "00265902" "1" "03256" "03256" "2019-10-11 12:08:34" "" "" "SEQ" "DNA" "blood" ""
"0000267036" "00265916" "1" "03256" "03256" "2019-10-11 18:33:19" "" "" "SEQ" "DNA" "blood" ""
"0000267106" "00265982" "1" "03256" "03256" "2019-10-12 08:31:25" "" "" "SEQ" "DNA" "blood" ""
"0000267107" "00265983" "1" "03256" "03256" "2019-10-12 08:37:57" "" "" "SEQ" "DNA" "blood" ""
"0000267108" "00265984" "1" "03256" "03256" "2019-10-12 09:14:54" "" "" "SEQ" "DNA" "blood" ""
"0000267109" "00265985" "1" "03256" "03256" "2019-10-12 09:50:24" "" "" "SEQ" "DNA" "blood" ""
"0000267110" "00265986" "1" "03256" "03256" "2019-10-12 11:11:58" "" "" "SEQ" "DNA" "blood" ""
"0000267224" "00266100" "1" "03256" "03256" "2019-10-12 16:51:51" "" "" "SEQ" "DNA" "blood" ""
"0000267225" "00266101" "1" "03256" "03256" "2019-10-12 17:02:28" "" "" "SEQ" "DNA" "blood" ""
"0000267229" "00266106" "1" "03256" "03256" "2019-10-12 17:15:02" "" "" "SEQ" "DNA" "blood" ""
"0000267230" "00266107" "1" "03256" "03256" "2019-10-12 17:34:43" "" "" "SEQ" "DNA" "blood" ""
"0000267231" "00266108" "1" "03256" "03256" "2019-10-12 17:45:14" "" "" "SEQ" "DNA" "blood" ""
"0000267232" "00266109" "1" "03256" "03256" "2019-10-12 17:53:40" "" "" "SEQ" "DNA" "blood" ""
"0000267233" "00266110" "1" "03256" "03256" "2019-10-13 08:57:16" "" "" "?" "DNA" "" ""
"0000267234" "00266111" "1" "03256" "03256" "2019-10-13 09:05:07" "" "" "SEQ" "DNA" "blood" ""
"0000267235" "00266112" "1" "03256" "03256" "2019-10-13 12:55:35" "" "" "SEQ" "DNA" "blood" ""
"0000267236" "00266113" "1" "03256" "03256" "2019-10-13 22:21:32" "" "" "SEQ" "DNA" "blood" ""
"0000267243" "00266120" "1" "03256" "03256" "2019-10-14 08:16:30" "" "" "SEQ" "DNA" "blood" ""
"0000267250" "00266127" "1" "03256" "03256" "2019-10-14 10:57:25" "" "" "SEQ" "DNA" "blood" ""
"0000267251" "00266128" "1" "03256" "03256" "2019-10-14 11:04:22" "" "" "SEQ" "DNA" "blood" ""
"0000267252" "00266129" "1" "03256" "03256" "2019-10-14 11:18:56" "" "" "SEQ" "DNA" "blood" ""
"0000267253" "00266130" "1" "03256" "03256" "2019-10-14 12:00:00" "" "" "SEQ" "DNA" "blood" ""
"0000267254" "00266131" "1" "03256" "03256" "2019-10-14 13:24:52" "" "" "SEQ" "DNA" "blood" ""
"0000267255" "00266132" "1" "03256" "03256" "2019-10-14 13:34:55" "" "" "SEQ" "DNA" "blood" ""
"0000267256" "00266133" "1" "03256" "03256" "2019-10-14 13:54:24" "" "" "SEQ" "DNA" "blood" ""
"0000267257" "00266134" "1" "03256" "03256" "2019-10-14 14:04:28" "" "" "SEQ" "DNA" "blood" ""
"0000267258" "00266135" "1" "03256" "03256" "2019-10-14 14:15:04" "" "" "SEQ" "DNA" "blood" ""
"0000267259" "00266136" "1" "03256" "03256" "2019-10-14 15:09:12" "" "" "SEQ" "DNA" "blood" ""
"0000267260" "00266137" "1" "03256" "03256" "2019-10-14 15:28:00" "" "" "SEQ" "DNA" "blood" ""
"0000267261" "00266139" "1" "03256" "03256" "2019-10-14 15:41:16" "" "" "SEQ" "DNA" "blood" ""
"0000267262" "00266140" "1" "03256" "03256" "2019-10-14 15:50:03" "" "" "SEQ" "DNA" "blood" ""
"0000267264" "00266141" "1" "03256" "03256" "2019-10-14 16:00:09" "" "" "SEQ" "DNA" "blood" ""
"0000267265" "00266142" "1" "03256" "03256" "2019-10-14 17:11:02" "" "" "SEQ" "DNA" "blood" ""
"0000267266" "00266143" "1" "03256" "03256" "2019-10-14 17:31:13" "" "" "SEQ" "DNA" "blood" ""
"0000267269" "00266147" "1" "03256" "03256" "2019-10-14 18:17:01" "" "" "SEQ-NG-IT" "DNA" "blood" ""
"0000267270" "00266148" "1" "03256" "03256" "2019-10-14 18:54:51" "" "" "SEQ" "DNA" "blood" ""
"0000267285" "00266163" "1" "03256" "03256" "2019-10-15 08:56:11" "" "" "SEQ" "DNA" "blood" ""
"0000267287" "00266166" "1" "03256" "03256" "2019-10-15 09:20:17" "" "" "SEQ" "DNA" "blood" ""
"0000267288" "00266167" "1" "03256" "03256" "2019-10-15 10:28:37" "" "" "SEQ" "DNA" "blood" ""
"0000267289" "00266168" "1" "03256" "03256" "2019-10-15 10:40:00" "" "" "SEQ" "DNA" "blood" ""
"0000267290" "00266169" "1" "03256" "03256" "2019-10-15 11:02:46" "" "" "SEQ" "DNA" "blood" ""
"0000267299" "00266178" "1" "03256" "03256" "2019-10-15 12:14:47" "" "" "SEQ" "DNA" "blood" ""
"0000267300" "00266179" "1" "03256" "03256" "2019-10-15 12:25:48" "" "" "SEQ" "DNA" "blood" ""
"0000267301" "00266180" "1" "03256" "03256" "2019-10-15 12:32:18" "" "" "SEQ" "DNA" "blood" ""
"0000267302" "00266181" "1" "03256" "03256" "2019-10-15 12:39:12" "" "" "SEQ" "DNA" "blood" ""
"0000267324" "00266203" "1" "03256" "03256" "2019-10-16 12:21:13" "" "" "SEQ" "DNA" "blood" ""
"0000267326" "00266205" "1" "03256" "03256" "2019-10-16 12:34:24" "" "" "SEQ" "DNA" "blood" ""
"0000267327" "00266206" "1" "03256" "03256" "2019-10-16 12:42:34" "" "" "SEQ" "DNA" "blood" ""
"0000267328" "00266207" "1" "03256" "03256" "2019-10-16 13:11:18" "" "" "SEQ" "DNA" "blood" ""
"0000267337" "00266216" "1" "03256" "03256" "2019-10-16 15:55:04" "" "" "SEQ" "DNA" "blood" ""
"0000267338" "00266217" "1" "03256" "03256" "2019-10-16 16:24:02" "" "" "SEQ" "DNA" "blood" ""
"0000267339" "00266218" "1" "03256" "03256" "2019-10-16 16:45:37" "" "" "SEQ" "DNA" "blood" ""
"0000267340" "00266219" "1" "03256" "03256" "2019-10-16 17:17:35" "" "" "SEQ" "DNA" "blood" ""
"0000267341" "00266220" "1" "03256" "03256" "2019-10-16 17:36:19" "" "" "SEQ" "DNA" "blood" ""
"0000267342" "00266221" "1" "03256" "03256" "2019-10-16 17:50:04" "" "" "SEQ" "DNA" "blood" ""
"0000267343" "00266222" "1" "03256" "03256" "2019-10-16 18:26:31" "" "" "SEQ" "DNA" "" ""
"0000267344" "00266223" "1" "03256" "03256" "2019-10-16 18:36:07" "" "" "SEQ" "DNA" "blood" ""
"0000267345" "00266224" "1" "03256" "03256" "2019-10-16 18:48:29" "" "" "SEQ" "DNA" "blood" ""
"0000267346" "00266225" "1" "03256" "03256" "2019-10-16 18:53:12" "" "" "SEQ" "DNA" "blood" ""
"0000267347" "00266226" "1" "03256" "03256" "2019-10-16 19:03:01" "" "" "SEQ" "DNA" "blood" ""
"0000267348" "00266227" "1" "03256" "03256" "2019-10-16 19:13:04" "" "" "SEQ" "DNA" "blood" ""
"0000267349" "00266228" "1" "03256" "03256" "2019-10-16 19:22:37" "" "" "SEQ" "DNA" "blood" ""
"0000267350" "00266229" "1" "03256" "03256" "2019-10-16 19:50:46" "" "" "SEQ" "DNA" "blood" ""
"0000267351" "00266230" "1" "03256" "03256" "2019-10-16 20:26:24" "" "" "SEQ" "DNA" "blood" ""
"0000267352" "00266231" "1" "03256" "03256" "2019-10-17 09:11:21" "" "" "SEQ" "DNA" "blood" ""
"0000267354" "00266233" "1" "03256" "03256" "2019-10-17 09:44:43" "" "" "SEQ" "DNA" "blood" ""
"0000267355" "00266234" "1" "03256" "03256" "2019-10-17 09:55:16" "" "" "SEQ" "DNA" "blood" ""
"0000267356" "00266235" "1" "03256" "03256" "2019-10-17 10:22:30" "" "" "SEQ" "DNA" "blood" ""
"0000267357" "00266236" "1" "03256" "03256" "2019-10-17 12:01:06" "" "" "SEQ" "DNA" "blood" ""
"0000267359" "00266238" "1" "03256" "03256" "2019-10-17 12:46:54" "" "" "SEQ" "DNA" "blood" ""
"0000267363" "00266242" "1" "03256" "03256" "2019-10-17 16:56:04" "" "" "SEQ" "DNA" "blood" ""
"0000267364" "00266243" "1" "03256" "03256" "2019-10-17 17:14:17" "" "" "SEQ" "DNA" "blood" ""
"0000267365" "00266244" "1" "03256" "03256" "2019-10-17 17:26:36" "" "" "SEQ" "DNA" "blood" ""
"0000267366" "00266245" "1" "03256" "03256" "2019-10-17 18:15:57" "" "" "SEQ" "DNA" "blood" ""
"0000267367" "00266246" "1" "03256" "03256" "2019-10-17 18:52:04" "" "" "SEQ" "DNA" "blood" ""
"0000267368" "00266248" "1" "03256" "03256" "2019-10-17 19:08:41" "" "" "SEQ" "DNA" "blood" ""
"0000267369" "00266249" "1" "03256" "03256" "2019-10-17 19:26:55" "" "" "SEQ" "DNA" "blood" ""
"0000267370" "00266250" "1" "03256" "03256" "2019-10-17 19:36:32" "" "" "SEQ" "DNA" "blood" ""
"0000267372" "00266252" "1" "03256" "03256" "2019-10-18 08:01:53" "" "" "SEQ" "DNA" "blood" ""
"0000267373" "00266253" "1" "03256" "03256" "2019-10-18 10:14:49" "" "" "SEQ" "DNA" "blood" ""
"0000267393" "00266271" "1" "03256" "03256" "2019-10-19 15:06:20" "" "" "SEQ" "DNA" "blood" ""
"0000267394" "00266272" "1" "03256" "03256" "2019-10-19 15:39:22" "" "" "SEQ" "DNA" "blood" ""
"0000267395" "00266273" "1" "03256" "03256" "2019-10-19 16:04:02" "" "" "SEQ" "DNA" "blood" ""
"0000267396" "00266274" "1" "03256" "03256" "2019-10-19 16:50:24" "" "" "SEQ" "DNA" "blood" ""
"0000267397" "00266275" "1" "03256" "03256" "2019-10-19 17:13:06" "" "" "SEQ" "DNA" "blood" ""
"0000267399" "00266276" "1" "03256" "03256" "2019-10-20 19:14:41" "" "" "SEQ" "DNA" "blood" ""
"0000267401" "00266278" "1" "03256" "03256" "2019-10-21 08:40:33" "" "" "SEQ" "DNA" "blood" ""
"0000267402" "00266279" "1" "03256" "03256" "2019-10-21 08:47:37" "" "" "SEQ" "DNA" "blood" ""
"0000267403" "00266280" "1" "03256" "03256" "2019-10-21 09:01:33" "" "" "SEQ" "DNA" "blood" ""
"0000267404" "00266281" "1" "03256" "03256" "2019-10-21 09:22:18" "" "" "SEQ" "DNA" "blood" ""
"0000267405" "00266282" "1" "03256" "03256" "2019-10-21 09:37:39" "" "" "SEQ" "DNA" "blood" "variant detected during a reverse validation of SERPING1-NGS platform"
"0000267406" "00266283" "1" "03256" "03256" "2019-10-21 09:47:15" "" "" "SEQ" "DNA" "blood" ""
"0000267407" "00266284" "1" "03256" "03256" "2019-10-21 09:54:24" "" "" "SEQ" "DNA" "blood" ""
"0000267408" "00266285" "1" "03256" "03256" "2019-10-21 10:01:52" "" "" "SEQ" "DNA" "blood" ""
"0000267409" "00266286" "1" "03256" "03256" "2019-10-21 10:29:56" "" "" "SEQ" "DNA" "blood" ""
"0000267410" "00266287" "1" "03256" "03256" "2019-10-21 10:39:42" "" "" "SEQ" "DNA" "blood" ""
"0000267411" "00266288" "1" "03256" "03256" "2019-10-21 10:49:53" "" "" "SEQ" "DNA" "blood" ""
"0000267418" "00266295" "1" "03256" "03256" "2019-10-21 11:00:54" "" "" "SEQ" "DNA" "blood" ""
"0000267419" "00266296" "1" "03256" "03256" "2019-10-21 12:06:50" "" "" "SEQ" "DNA" "blood" ""
"0000267420" "00266297" "1" "03256" "03256" "2019-10-21 12:21:25" "" "" "SEQ" "DNA" "blood" ""
"0000267421" "00266298" "1" "03256" "03256" "2019-10-21 12:27:09" "" "" "SEQ" "DNA" "blood" ""
"0000267422" "00266299" "1" "03256" "03256" "2019-10-21 13:20:49" "" "" "SEQ" "DNA" "blood" ""
"0000267423" "00266300" "1" "03256" "03256" "2019-10-21 13:45:45" "" "" "SEQ" "DNA" "blood" ""
"0000267424" "00266301" "1" "03256" "03256" "2019-10-21 14:14:00" "" "" "SEQ" "DNA" "blood" ""
"0000267425" "00266302" "1" "03256" "03256" "2019-10-21 14:18:39" "" "" "SEQ" "DNA" "blood" ""
"0000267428" "00266305" "1" "03256" "03256" "2019-10-21 17:11:34" "" "" "SEQ" "DNA" "blood" ""
"0000267429" "00266306" "1" "03256" "03256" "2019-10-21 17:42:06" "" "" "SEQ" "DNA" "blood" ""
"0000267430" "00266307" "1" "03256" "03256" "2019-10-21 17:51:21" "" "" "SEQ" "DNA" "blood" ""
"0000267431" "00266308" "1" "03256" "03256" "2019-10-21 18:00:34" "" "" "SEQ" "DNA" "blood" ""
"0000267433" "00266309" "1" "03256" "03256" "2019-10-22 09:28:58" "" "" "SEQ" "DNA" "blood" ""
"0000267434" "00266310" "1" "03256" "03256" "2019-10-22 09:35:07" "" "" "SEQ" "DNA" "blood" ""
"0000267435" "00266311" "1" "03256" "03256" "2019-10-22 12:19:08" "" "" "SEQ" "DNA" "blood" ""
"0000267437" "00266313" "1" "03256" "03256" "2019-10-22 15:01:42" "" "" "SEQ" "DNA" "blood" ""
"0000267438" "00266314" "1" "03256" "03256" "2019-10-22 15:21:11" "" "" "SEQ" "DNA" "blood" ""
"0000267439" "00266315" "1" "03256" "03256" "2019-10-22 15:48:49" "" "" "SEQ" "DNA" "blood" ""
"0000267440" "00266317" "1" "03256" "03256" "2019-10-22 16:09:03" "" "" "SEQ" "DNA" "blood" ""
"0000267442" "00266319" "1" "03256" "03256" "2019-10-22 16:32:18" "" "" "SEQ" "DNA" "blood" ""
"0000267443" "00266320" "1" "03256" "03256" "2019-10-22 16:51:08" "" "" "SEQ" "DNA" "blood" ""
"0000267444" "00266321" "1" "03256" "03256" "2019-10-22 17:04:11" "" "" "SEQ" "DNA" "blood" ""
"0000267445" "00266322" "1" "03256" "03256" "2019-10-22 17:12:43" "" "" "SEQ" "DNA" "blood" ""
"0000267446" "00266323" "1" "03256" "03256" "2019-10-22 17:32:02" "" "" "SEQ" "DNA" "blood" ""
"0000267447" "00266324" "1" "03256" "03256" "2019-10-22 17:51:15" "" "" "SEQ" "DNA" "blood" ""
"0000267448" "00266325" "1" "03256" "03256" "2019-10-22 18:03:31" "" "" "SEQ" "DNA" "blood" ""
"0000267451" "00266328" "1" "03256" "03256" "2019-10-23 09:27:22" "" "" "SEQ" "DNA" "blood" ""
"0000267452" "00266329" "1" "03256" "03256" "2019-10-23 09:52:17" "" "" "SEQ" "DNA" "blood" ""
"0000267454" "00266331" "1" "03256" "03256" "2019-10-23 10:10:44" "" "" "SEQ" "DNA" "blood" ""
"0000267455" "00266332" "1" "03256" "03256" "2019-10-23 10:20:54" "" "" "SEQ" "DNA" "blood" ""
"0000267456" "00266333" "1" "03256" "03256" "2019-10-23 10:27:36" "" "" "SEQ" "DNA" "blood" ""
"0000267458" "00266335" "1" "03256" "03256" "2019-10-23 10:43:15" "" "" "SEQ" "DNA" "blood" ""
"0000267459" "00266336" "1" "03256" "03256" "2019-10-23 10:52:30" "" "" "SEQ" "DNA" "blood" ""
"0000267460" "00266337" "1" "03256" "03256" "2019-10-23 11:25:20" "" "" "SEQ" "DNA" "blood" ""
"0000267461" "00266338" "1" "03256" "03256" "2019-10-23 11:38:20" "" "" "SEQ" "DNA" "blood" ""
"0000267462" "00266339" "1" "03256" "03256" "2019-10-23 11:51:56" "" "" "SEQ" "DNA" "blood" ""
"0000267463" "00266340" "1" "03256" "03256" "2019-10-23 12:01:09" "" "" "SEQ" "DNA" "blood" ""
"0000267464" "00266341" "1" "03256" "03256" "2019-10-23 12:25:54" "" "" "SEQ" "DNA" "blood" ""
"0000267465" "00266342" "1" "03256" "03256" "2019-10-23 12:33:22" "" "" "SEQ" "DNA" "blood" ""
"0000267466" "00266343" "1" "03256" "03256" "2019-10-23 12:42:06" "" "" "SEQ" "DNA" "blood" ""
"0000267467" "00266344" "1" "03256" "03256" "2019-10-23 12:56:05" "" "" "SEQ" "DNA" "blood" ""
"0000267468" "00266345" "1" "03256" "03256" "2019-10-23 13:11:11" "" "" "SEQ" "DNA" "blood" ""
"0000267469" "00266346" "1" "03256" "03256" "2019-10-23 17:38:19" "" "" "SEQ" "DNA" "blood" ""
"0000267472" "00266348" "1" "03256" "03256" "2019-10-24 11:13:43" "" "" "SEQ" "DNA" "blood" ""
"0000267482" "00266359" "1" "03256" "03256" "2019-10-24 15:30:58" "" "" "SEQ-NG-IT" "DNA" "blood" ""
"0000267484" "00266360" "1" "03256" "03256" "2019-10-24 15:51:08" "" "" "SEQ-NG-IT" "DNA" "blood" ""
"0000267486" "00266362" "1" "03256" "03256" "2019-10-24 16:36:02" "" "" "SEQ-NG-IT" "DNA" "blood" ""
"0000267487" "00266363" "1" "03256" "03256" "2019-10-24 16:41:58" "" "" "SEQ-NG-IT" "DNA" "blood" ""
"0000267488" "00266364" "1" "03256" "03256" "2019-10-24 17:01:44" "" "" "SEQ-NG-IT" "DNA" "blood" ""
"0000267489" "00266365" "1" "03256" "03256" "2019-10-24 17:20:09" "" "" "SEQ-NG-IT" "DNA" "blood" ""
"0000267490" "00266366" "1" "03256" "03256" "2019-10-24 17:27:28" "" "" "SEQ-NG-IT" "DNA" "blood" ""
"0000267491" "00266367" "1" "03256" "03256" "2019-10-24 17:40:38" "" "" "SEQ-NG-IT" "DNA" "blood" ""
"0000267492" "00266368" "1" "03256" "03256" "2019-10-24 17:50:00" "" "" "SEQ-NG-IT" "DNA" "blood" ""
"0000267493" "00266369" "1" "03256" "03256" "2019-10-24 18:00:51" "" "" "SEQ-NG-IT" "DNA" "blood" ""
"0000267494" "00266370" "1" "03256" "03256" "2019-10-24 18:18:14" "" "" "SEQ-NG-IT" "DNA" "blood" ""
"0000267495" "00266371" "1" "03256" "03256" "2019-10-24 18:26:31" "" "" "SEQ-NG-IT" "DNA" "blood" ""
"0000267496" "00266372" "1" "03256" "03256" "2019-10-24 18:33:13" "" "" "SEQ-NG-IT" "DNA" "blood" ""
"0000267497" "00266373" "1" "03256" "03256" "2019-10-24 18:43:46" "" "" "SEQ-NG-IT" "DNA" "blood" ""
"0000267498" "00266374" "1" "03256" "03256" "2019-10-24 19:05:34" "" "" "SEQ-NG-IT" "DNA" "blood" ""
"0000267499" "00266375" "1" "03256" "03256" "2019-10-24 19:17:23" "" "" "SEQ-NG-IT" "DNA" "blood" ""
"0000267500" "00266376" "1" "03256" "03256" "2019-10-24 19:25:15" "" "" "SEQ-NG-IT" "DNA" "blood" ""
"0000267501" "00266377" "1" "03256" "03256" "2019-10-24 19:46:34" "" "" "SEQ-NG-IT" "DNA" "blood" ""
"0000267504" "00266379" "1" "03256" "03256" "2019-10-25 09:30:40" "" "" "?" "DNA" "" ""
"0000267506" "00266380" "1" "03256" "03256" "2019-10-25 10:00:19" "" "" "?" "DNA" "" ""
"0000267588" "00266460" "1" "03256" "03256" "2019-10-25 22:33:16" "" "" "MAQ" "DNA" "blood" "some diagnostics have been carried out using FAMA"
"0000267612" "00266473" "1" "03256" "03256" "2019-10-26 12:31:09" "" "" "RFLP" "DNA" "blood" ""
"0000267755" "00266628" "1" "03256" "03256" "2019-10-26 22:32:50" "" "" "MAQ" "DNA" "blood" ""
"0000267786" "00266659" "1" "03256" "03256" "2019-10-29 10:21:47" "" "" "MAQ" "DNA" "blood" ""
"0000267787" "00266660" "1" "03256" "03256" "2019-10-29 10:34:00" "" "" "MAQ" "DNA" "" ""
"0000267789" "00266662" "1" "03256" "03256" "2019-10-29 11:01:52" "" "" "RFLP" "DNA" "blood" ""
"0000267790" "00266663" "1" "03256" "03256" "2019-10-29 11:12:00" "" "" "MAQ" "DNA" "blood" ""
"0000267791" "00266664" "1" "03256" "03256" "2019-10-29 11:26:09" "" "" "MAQ" "RNA" "blood" ""
"0000267792" "00266665" "1" "03256" "03256" "2019-10-29 11:33:14" "" "" "MAQ" "DNA" "blood" ""
"0000267793" "00266666" "1" "03256" "03256" "2019-10-29 11:39:12" "" "" "MAQ" "DNA" "blood" ""
"0000267794" "00266667" "1" "03256" "03256" "2019-10-29 12:00:15" "03256" "2023-09-18 11:35:49" "MLPA" "DNA" "blood" ""
"0000267795" "00266668" "1" "03256" "03256" "2019-10-29 12:16:49" "" "" "MAQ" "DNA" "blood" ""
"0000267797" "00266670" "1" "03256" "03256" "2019-10-29 12:41:27" "" "" "RFLP" "DNA" "blood" ""
"0000267798" "00266671" "1" "03256" "03256" "2019-10-29 14:02:34" "" "" "MAQ" "DNA" "blood" ""
"0000267799" "00266672" "1" "03256" "03256" "2019-10-29 14:28:52" "" "" "MAQ" "DNA" "blood" ""
"0000267800" "00266673" "1" "03256" "03256" "2019-10-29 14:38:34" "" "" "MAQ" "DNA" "blood" ""
"0000268143" "00267016" "1" "03256" "03256" "2019-10-29 15:17:09" "" "" "RFLP" "DNA" "blood" ""
"0000268144" "00267017" "1" "03256" "03256" "2019-10-29 15:26:57" "" "" "RFLP" "DNA" "blood" ""
"0000268145" "00267018" "1" "03256" "03256" "2019-10-29 15:36:25" "" "" "RFLP" "DNA" "blood" ""
"0000268146" "00267019" "1" "03256" "03256" "2019-10-29 16:00:42" "" "" "RFLP" "DNA" "blood" ""
"0000268147" "00267020" "1" "03256" "03256" "2019-10-29 16:23:16" "" "" "RFLP" "DNA" "blood" ""
"0000268148" "00267021" "1" "03256" "03256" "2019-10-29 16:32:11" "" "" "MAQ" "DNA" "blood" ""
"0000268149" "00267022" "1" "03256" "03256" "2019-10-29 16:36:41" "" "" "MAQ" "DNA" "blood" ""
"0000268150" "00267023" "1" "03256" "03256" "2019-10-29 16:43:58" "" "" "MAQ" "DNA" "blood" ""
"0000268151" "00267024" "1" "03256" "03256" "2019-10-29 17:15:35" "" "" "SEQ" "DNA" "blood" ""
"0000268154" "00267026" "1" "03256" "03256" "2019-10-29 18:07:22" "" "" "MAQ" "DNA" "blood" ""
"0000268168" "00267040" "1" "03256" "03256" "2019-10-31 21:39:32" "" "" "MAQ" "DNA" "blood" ""
"0000268169" "00267041" "1" "03256" "03256" "2019-10-31 21:48:08" "" "" "MAQ" "DNA" "blood" ""
"0000268170" "00267042" "1" "03256" "03256" "2019-10-31 21:59:34" "" "" "MAQ" "DNA" "blood" ""
"0000268171" "00267043" "1" "03256" "03256" "2019-10-31 22:05:12" "" "" "RFLP" "DNA" "blood" ""
"0000268172" "00267044" "1" "03256" "03256" "2019-10-31 22:15:29" "" "" "MAQ" "DNA" "blood" ""
"0000268173" "00267045" "1" "03256" "03256" "2019-10-31 22:20:35" "" "" "RFLP" "DNA" "blood" ""
"0000268369" "00267240" "1" "03256" "03256" "2019-11-03 19:27:12" "03256" "2019-11-03 20:11:22" "RFLP" "DNA" "" "Sequencing of 5\' and 3\' boundaries"
"0000268370" "00267241" "1" "03256" "03256" "2019-11-03 20:34:17" "" "" "RFLP" "DNA" "" "Sequencing of 5\' and 3\' boundaries"
"0000268371" "00267242" "1" "03256" "03256" "2019-11-03 20:54:40" "" "" "RFLP" "DNA" "blood" ""
"0000268372" "00267243" "1" "03256" "03256" "2019-11-03 21:15:59" "" "" "RFLP" "DNA" "" ""
"0000268379" "00267250" "1" "03256" "03256" "2019-11-04 09:35:48" "" "" "MAQ" "DNA" "blood" "Sequencing of 5\' and 3\' boundaries"
"0000268380" "00267251" "1" "03256" "03256" "2019-11-04 10:01:20" "" "" "MAQ" "DNA" "blood" ""
"0000268381" "00267252" "1" "03256" "03256" "2019-11-04 10:11:18" "" "" "MAQ" "DNA" "blood" ""
"0000268382" "00267253" "1" "03256" "03256" "2019-11-04 11:01:07" "03256" "2026-01-05 21:34:57" "SEQ-NG-IT" "DNA" "blood" "Sequencing of 5\' and 3\' boundaries"
"0000270235" "00269106" "1" "03256" "03256" "2019-11-04 17:58:44" "" "" "SEQ" "DNA" "blood" ""
"0000270236" "00269107" "1" "03256" "03256" "2019-11-04 18:26:59" "" "" "SEQ" "DNA" "blood" ""
"0000270240" "00269110" "1" "03256" "03256" "2019-11-05 09:32:42" "" "" "?" "DNA" "" ""
"0000270241" "00269111" "1" "03256" "03256" "2019-11-05 09:50:20" "" "" "?" "DNA" "" ""
"0000270243" "00269113" "1" "03256" "03256" "2019-11-05 10:53:39" "" "" "RFLP" "DNA" "blood" ""
"0000270434" "00269303" "1" "03256" "03256" "2019-11-12 17:59:24" "03256" "2025-03-21 16:57:26" "FISH" "DNA" "" ""
"0000270435" "00269304" "1" "03256" "03256" "2019-11-12 18:11:14" "" "" "?" "DNA" "" ""
"0000270436" "00269305" "1" "03256" "03256" "2019-11-12 18:17:15" "" "" "?" "DNA" "" ""
"0000270437" "00269306" "1" "03256" "03256" "2019-11-12 18:31:20" "" "" "?" "DNA" "" ""
"0000270455" "00269323" "1" "03256" "03256" "2019-11-19 10:35:38" "" "" "arraySNP" "DNA" "blood" ""
"0000276849" "00275695" "1" "03256" "03256" "2020-01-18 12:59:07" "" "" "SEQ" "DNA" "blood" ""
"0000276850" "00275696" "1" "03256" "03256" "2020-01-18 13:22:12" "" "" "SEQ" "DNA" "blood" ""
"0000276851" "00275697" "1" "03256" "03256" "2020-01-18 13:35:00" "" "" "SEQ" "DNA" "blood" ""
"0000277094" "00275941" "1" "03256" "03256" "2020-01-21 14:44:28" "" "" "SEQ-NG-IT" "DNA" "blood" ""
"0000277150" "00276003" "1" "03256" "03256" "2020-01-23 10:55:01" "" "" "SEQ" "DNA" "blood" ""
"0000277257" "00276112" "1" "03256" "03256" "2020-01-27 15:34:50" "" "" "SEQ" "DNA" "blood" ""
"0000291622" "00290454" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0"
"0000304292" "00303167" "1" "03256" "03256" "2020-06-08 09:04:46" "" "" "SEQ" "DNA" "blood" ""
"0000311758" "00310605" "1" "03256" "03256" "2020-09-11 11:16:26" "" "" "SNPlex" "DNA" "" "Unusual pericentromeric rearrangement of chromosome 11 including the SERPING1 gene"
"0000312246" "00311095" "1" "03256" "03256" "2020-09-17 15:47:59" "" "" "SEQ" "DNA" "blood" ""
"0000312247" "00311096" "1" "03256" "03256" "2020-09-17 16:31:42" "" "" "SEQ" "DNA" "blood" ""
"0000312349" "00311191" "1" "03256" "03256" "2020-09-21 17:56:44" "" "" "SEQ" "DNA" "blood" ""
"0000312544" "00311379" "1" "03256" "03256" "2020-09-23 13:14:00" "" "" "SEQ" "DNA" "blood" ""
"0000315116" "00313943" "1" "03256" "03256" "2020-10-07 16:40:30" "" "" "?" "DNA" "" ""
"0000315821" "00314648" "1" "03256" "03256" "2020-10-13 16:52:57" "" "" "SEQ" "DNA" "blood" ""
"0000321555" "00320369" "1" "03256" "03256" "2020-11-28 22:04:14" "" "" "SEQ" "DNA" "blood" ""
"0000321556" "00320370" "1" "03256" "03256" "2020-11-28 22:13:58" "" "" "SEQ" "DNA" "" ""
"0000321558" "00320372" "1" "03256" "03256" "2020-11-28 22:31:00" "" "" "SEQ" "DNA" "blood" ""
"0000321559" "00320373" "1" "03256" "03256" "2020-11-28 22:43:48" "" "" "SEQ-NG" "DNA" "blood" ""
"0000321560" "00320374" "1" "03256" "03256" "2020-11-28 22:53:06" "" "" "SEQ" "DNA" "blood" ""
"0000321616" "00320429" "1" "03256" "03256" "2020-11-29 19:08:16" "" "" "SEQ" "DNA" "blood" ""
"0000321617" "00320430" "1" "03256" "03256" "2020-11-29 19:19:30" "" "" "SEQ" "DNA" "blood" ""
"0000321618" "00320431" "1" "03256" "03256" "2020-11-29 22:37:10" "" "" "?" "DNA" "" ""
"0000321633" "00320446" "1" "03256" "03256" "2020-11-30 13:45:40" "" "" "?" "DNA" "" ""
"0000325328" "00324138" "1" "03256" "03256" "2020-12-02 16:48:57" "" "" "SEQ" "DNA" "blood" ""
"0000325329" "00324139" "1" "03256" "03256" "2020-12-02 17:05:05" "" "" "SEQ" "DNA" "blood" ""
"0000325331" "00324141" "1" "03256" "03256" "2020-12-02 17:52:28" "" "" "SEQ" "DNA" "blood" ""
"0000325333" "00324143" "1" "03256" "03256" "2020-12-02 18:46:47" "" "" "SEQ" "DNA" "blood" ""
"0000325334" "00324144" "1" "03256" "03256" "2020-12-02 18:53:01" "" "" "SEQ" "DNA" "blood" ""
"0000325484" "00324294" "1" "03256" "03256" "2020-12-05 12:32:57" "" "" "SEQ" "DNA" "blood" ""
"0000325485" "00324295" "1" "03256" "03256" "2020-12-05 12:50:24" "" "" "SEQ" "DNA" "blood" ""
"0000325486" "00324296" "1" "03256" "03256" "2020-12-05 16:04:03" "" "" "SEQ" "DNA" "blood" ""
"0000325487" "00324297" "1" "03256" "03256" "2020-12-05 19:03:42" "" "" "SEQ" "DNA" "blood" ""
"0000325488" "00324298" "1" "03256" "03256" "2020-12-05 19:11:09" "" "" "SEQ" "DNA" "blood" ""
"0000325489" "00324299" "1" "03256" "03256" "2020-12-05 19:23:08" "" "" "SEQ" "DNA" "blood" ""
"0000325576" "00324386" "1" "03256" "03256" "2020-12-10 19:32:18" "" "" "?" "DNA" "" ""
"0000325585" "00324395" "1" "03256" "03256" "2020-12-11 11:29:12" "" "" "?" "DNA" "" ""
"0000328698" "00327484" "1" "03256" "03256" "2021-01-22 10:23:21" "" "" "SEQ" "DNA" "blood" ""
"0000328700" "00327486" "1" "03256" "03256" "2021-01-22 10:41:32" "" "" "SEQ" "DNA" "blood" ""
"0000328701" "00327487" "1" "03256" "03256" "2021-01-22 10:48:49" "" "" "SEQ" "DNA" "blood" ""
"0000329762" "00328547" "1" "03256" "03256" "2021-01-28 18:10:39" "" "" "SEQ" "DNA" "blood" ""
"0000329763" "00328548" "1" "03256" "03256" "2021-01-28 18:18:46" "" "" "SEQ" "DNA" "blood" ""
"0000330227" "00329010" "1" "03256" "03256" "2021-02-02 17:56:58" "" "" "SEQ" "DNA" "blood" ""
"0000330228" "00329011" "1" "03256" "03256" "2021-02-03 12:09:14" "" "" "SEQ" "DNA" "blood" ""
"0000330353" "00329133" "1" "03256" "03256" "2021-02-05 10:26:51" "" "" "SEQ" "DNA" "blood" ""
"0000330354" "00329134" "1" "03256" "03256" "2021-02-05 10:36:50" "" "" "SEQ" "DNA" "blood" ""
"0000330382" "00329169" "1" "03256" "03256" "2021-02-06 19:46:32" "" "" "SEQ" "DNA" "bl" ""
"0000332456" "00331237" "1" "03256" "03256" "2021-02-10 17:16:25" "" "" "MLPA" "DNA" "" ""
"0000332457" "00331238" "1" "03256" "03256" "2021-02-10 17:43:11" "" "" "MLPA" "DNA" "blood" ""
"0000332821" "00331602" "1" "03256" "03256" "2021-02-11 18:07:06" "" "" "SEQ" "DNA" "blood" ""
"0000333650" "00332426" "1" "03256" "03256" "2021-02-19 10:59:39" "" "" "SEQ" "DNA" "blood" ""
"0000333774" "00332550" "1" "03256" "03256" "2021-02-20 22:13:05" "" "" "SEQ" "DNA" "blood" ""
"0000333775" "00332551" "1" "03256" "03256" "2021-02-21 22:02:31" "" "" "SEQ" "DNA" "" ""
"0000360848" "00359618" "1" "03256" "03256" "2021-04-02 10:26:50" "" "" "SEQ-NG-IT" "DNA" "blood" ""
"0000362958" "00361729" "1" "03256" "03256" "2021-04-08 12:25:22" "" "" "SEQ" "DNA" "" ""
"0000362959" "00361731" "1" "03256" "03256" "2021-04-08 12:38:55" "" "" "SEQ" "DNA" "" ""
"0000362960" "00361732" "1" "03256" "03256" "2021-04-08 12:55:00" "03256" "2021-04-09 22:08:48" "MLPA" "DNA" "blood" ""
"0000362961" "00361733" "1" "03256" "03256" "2021-04-08 13:02:24" "" "" "SEQ" "DNA" "" ""
"0000362962" "00361734" "1" "03256" "03256" "2021-04-08 13:09:22" "" "" "SEQ" "DNA" "" ""
"0000362974" "00361746" "1" "03256" "03256" "2021-04-08 16:11:44" "" "" "SEQ" "DNA" "blood" ""
"0000362975" "00361747" "1" "03256" "03256" "2021-04-08 16:38:07" "" "" "SEQ" "DNA" "blood" ""
"0000362990" "00361762" "1" "03256" "03256" "2021-04-09 09:59:40" "" "" "?" "DNA" "" ""
"0000362991" "00361763" "1" "03256" "03256" "2021-04-09 10:07:51" "" "" "?" "DNA" "" ""
"0000362995" "00361767" "1" "03256" "03256" "2021-04-10 10:05:43" "" "" "SEQ-NG-IT" "DNA" "" ""
"0000362996" "00361768" "1" "03256" "03256" "2021-04-10 10:22:26" "" "" "SEQ-NG-IT" "DNA" "" ""
"0000362997" "00361769" "1" "03256" "03256" "2021-04-10 10:28:34" "" "" "SEQ-NG-IT" "DNA" "" ""
"0000362999" "00361771" "1" "03256" "03256" "2021-04-10 10:32:46" "" "" "SEQ-NG-IT" "DNA" "" ""
"0000363000" "00361772" "1" "03256" "03256" "2021-04-10 10:37:09" "" "" "SEQ-NG-IT" "DNA" "" ""
"0000363001" "00361773" "1" "03256" "03256" "2021-04-10 10:41:00" "" "" "SEQ-NG-IT" "DNA" "" ""
"0000363002" "00361774" "1" "03256" "03256" "2021-04-10 10:45:24" "" "" "SEQ-NG-IT" "DNA" "" ""
"0000363004" "00361776" "1" "03256" "03256" "2021-04-10 10:49:24" "" "" "SEQ-NG-IT" "DNA" "" ""
"0000363005" "00361777" "1" "03256" "03256" "2021-04-10 10:53:32" "" "" "SEQ-NG-IT" "DNA" "" ""
"0000363031" "00361803" "1" "03256" "03256" "2021-04-11 09:49:55" "" "" "SEQ" "DNA" "blood" ""
"0000363120" "00361892" "1" "03256" "03256" "2021-04-11 22:08:58" "" "" "?" "DNA" "" ""
"0000363137" "00361910" "1" "03256" "03256" "2021-04-12 09:15:09" "" "" "?" "DNA" "" ""
"0000363138" "00361911" "1" "03256" "03256" "2021-04-12 09:21:57" "" "" "?" "DNA" "" ""
"0000363139" "00361912" "1" "03256" "03256" "2021-04-12 09:27:14" "" "" "?" "DNA" "" ""
"0000363260" "00362032" "1" "03256" "03256" "2021-04-14 16:45:25" "" "" "SEQ" "DNA" "" ""
"0000363261" "00362033" "1" "03256" "03256" "2021-04-14 17:01:11" "" "" "SEQ-NG-IT" "DNA" "blood" ""
"0000363262" "00362034" "1" "03256" "03256" "2021-04-14 17:27:26" "" "" "?" "DNA" "" ""
"0000363263" "00362035" "1" "03256" "03256" "2021-04-14 17:35:53" "" "" "SEQ" "DNA" "" ""
"0000363264" "00362036" "1" "03256" "03256" "2021-04-14 17:42:32" "" "" "SEQ" "DNA" "" ""
"0000364712" "00363484" "1" "03256" "03256" "2021-04-27 15:36:56" "" "" "-" "DNA" "" ""
"0000364713" "00363485" "1" "03256" "03256" "2021-04-27 15:49:15" "" "" "arraySNP" "DNA" "" ""
"0000364714" "00363486" "1" "03256" "03256" "2021-04-27 15:54:59" "" "" "arraySNP" "DNA" "" ""
"0000364715" "00363487" "1" "03256" "03256" "2021-04-27 16:04:08" "" "" "arraySNP" "DNA" "" ""
"0000364721" "00363493" "1" "03256" "03256" "2021-04-28 09:32:27" "" "" "arraySNP" "DNA" "" ""
"0000364722" "00363494" "1" "03256" "03256" "2021-04-28 09:44:04" "" "" "arraySNP" "DNA" "" ""
"0000364723" "00363495" "1" "03256" "03256" "2021-04-28 09:52:31" "" "" "arraySNP" "DNA" "" ""
"0000364724" "00363496" "1" "03256" "03256" "2021-04-28 10:00:31" "" "" "arraySNP" "DNA" "" ""
"0000364725" "00363497" "1" "03256" "03256" "2021-04-28 10:18:27" "" "" "arraySNP" "DNA" "" ""
"0000364726" "00363498" "1" "03256" "03256" "2021-04-28 10:24:32" "" "" "arraySNP" "DNA" "" ""
"0000364990" "00363762" "1" "03256" "03256" "2021-04-29 17:29:31" "" "" "arraySNP" "DNA" "" ""
"0000364991" "00363763" "1" "03256" "03256" "2021-04-29 17:39:53" "" "" "arraySNP" "DNA" "" ""
"0000375029" "00373797" "1" "03256" "03256" "2021-05-20 18:03:25" "" "" "?" "DNA" "" ""
"0000377330" "00376134" "1" "03256" "03256" "2021-06-16 16:44:03" "" "" "SEQ" "DNA" "" ""
"0000377332" "00376136" "1" "03256" "03256" "2021-06-16 17:07:52" "" "" "SEQ" "DNA" "" ""
"0000380890" "00379688" "1" "03256" "03256" "2021-08-06 10:32:06" "" "" "SEQ" "DNA" "" ""
"0000380893" "00379691" "1" "03256" "03256" "2021-08-06 10:53:11" "" "" "SEQ" "DNA" "" ""
"0000380894" "00379692" "1" "03256" "03256" "2021-08-06 11:32:11" "" "" "SEQ" "DNA" "blood" ""
"0000380895" "00379693" "1" "03256" "03256" "2021-08-06 11:49:02" "" "" "SEQ" "DNA" "blood" ""
"0000380896" "00379694" "1" "03256" "03256" "2021-08-06 12:08:15" "" "" "SEQ" "DNA" "blood" ""
"0000380897" "00379695" "1" "03256" "03256" "2021-08-06 12:24:10" "" "" "SEQ" "DNA" "blood" ""
"0000380898" "00379696" "1" "03256" "03256" "2021-08-06 12:44:52" "" "" "SEQ" "DNA" "blood" ""
"0000380899" "00379697" "1" "03256" "03256" "2021-08-06 13:03:37" "" "" "SEQ" "DNA" "blood" ""
"0000380900" "00379698" "1" "03256" "03256" "2021-08-06 16:07:49" "" "" "SEQ" "DNA" "blood" ""
"0000380924" "00379722" "1" "03256" "03256" "2021-08-06 18:31:08" "" "" "SEQ" "DNA" "blood" ""
"0000380925" "00379723" "1" "03256" "03256" "2021-08-06 19:33:51" "" "" "SEQ" "DNA" "blood" ""
"0000380926" "00379724" "1" "03256" "03256" "2021-08-06 19:41:53" "" "" "SEQ" "DNA" "blood" ""
"0000380927" "00379725" "1" "03256" "03256" "2021-08-06 21:21:00" "" "" "SEQ" "DNA" "blood" ""
"0000380928" "00379726" "1" "03256" "03256" "2021-08-06 22:03:46" "" "" "SEQ" "DNA" "blood" ""
"0000380929" "00379727" "1" "03256" "03256" "2021-08-06 22:19:37" "" "" "SEQ" "DNA" "blood" ""
"0000380930" "00379728" "1" "03256" "03256" "2021-08-06 22:48:07" "" "" "SEQ" "DNA" "blood" ""
"0000380932" "00379730" "1" "03256" "03256" "2021-08-07 13:00:18" "" "" "SEQ" "DNA" "blood" ""
"0000380933" "00379731" "1" "03256" "03256" "2021-08-07 13:07:09" "" "" "SEQ" "DNA" "blood" ""
"0000380934" "00379732" "1" "03256" "03256" "2021-08-07 13:16:16" "" "" "SEQ" "DNA" "blood" ""
"0000380935" "00379733" "1" "03256" "03256" "2021-08-07 16:02:11" "" "" "SEQ" "DNA" "blood" ""
"0000380936" "00379734" "1" "03256" "03256" "2021-08-07 16:12:48" "" "" "SEQ" "DNA" "blood" ""
"0000380937" "00379735" "1" "03256" "03256" "2021-08-07 16:25:38" "" "" "SEQ" "DNA" "blood" ""
"0000380938" "00379736" "1" "03256" "03256" "2021-08-07 16:45:40" "" "" "SEQ" "DNA" "blood" ""
"0000380939" "00379737" "1" "03256" "03256" "2021-08-07 18:08:14" "" "" "?" "DNA" "blood" ""
"0000380940" "00379738" "1" "03256" "03256" "2021-08-07 18:41:39" "" "" "?" "DNA" "blood" ""
"0000380941" "00379739" "1" "03256" "03256" "2021-08-07 18:53:46" "" "" "?" "DNA" "blood" ""
"0000380942" "00379740" "1" "03256" "03256" "2021-08-07 19:13:35" "" "" "SEQ" "DNA" "blood" ""
"0000380943" "00379741" "1" "03256" "03256" "2021-08-08 21:17:47" "" "" "SEQ" "DNA" "" ""
"0000380944" "00379742" "1" "03256" "03256" "2021-08-08 21:50:10" "" "" "SEQ" "DNA" "blood" ""
"0000381371" "00380169" "1" "03256" "03256" "2021-08-11 08:54:05" "" "" "SEQ" "DNA" "blood" ""
"0000384181" "00382959" "1" "03256" "03256" "2021-09-17 09:12:27" "" "" "SEQ" "DNA" "blood" ""
"0000385780" "00384555" "1" "03256" "03256" "2021-09-29 18:00:49" "" "" "SEQ-NG" "DNA" "" ""
"0000385783" "00384558" "1" "03256" "03256" "2021-09-29 18:23:34" "" "" "SEQ-NG" "DNA" "" ""
"0000385834" "00384607" "1" "03256" "03256" "2021-10-02 22:09:02" "" "" "SEQ" "DNA" "blood" ""
"0000385835" "00384608" "1" "03256" "03256" "2021-10-02 22:12:41" "" "" "SEQ" "DNA" "blood" ""
"0000385836" "00384609" "1" "03256" "03256" "2021-10-02 22:17:28" "" "" "SEQ" "DNA" "blood" ""
"0000388585" "00387358" "1" "03256" "03256" "2021-10-28 18:21:07" "" "" "?" "DNA" "" ""
"0000388596" "00387369" "1" "03256" "03256" "2021-10-28 20:11:07" "" "" "SEQ-NG-IT" "DNA" "blood" ""
"0000388634" "00387408" "1" "03256" "03256" "2021-10-29 10:32:21" "" "" "?" "DNA" "" ""
"0000388635" "00387409" "1" "03256" "03256" "2021-10-29 10:38:43" "" "" "SEQ-NG-IT" "DNA" "" ""
"0000392738" "00391496" "1" "03256" "03256" "2021-11-16 10:30:08" "" "" "?" "DNA" "" ""
"0000394011" "00392764" "1" "03256" "03256" "2021-11-24 11:36:18" "" "" "SEQ" "DNA" "blood" ""
"0000399481" "00398236" "1" "03256" "03256" "2022-01-02 10:35:20" "" "" "SEQ" "DNA" "blood" ""
"0000399892" "00398651" "1" "03256" "03256" "2022-01-08 19:22:29" "" "" "SEQ" "DNA" "lymphocytes, sperm" ""
"0000404088" "00402847" "1" "03256" "03256" "2022-02-11 22:18:23" "" "" "SEQ" "DNA" "blood" ""
"0000406100" "00404859" "1" "03256" "03256" "2022-03-09 18:06:06" "" "" "SEQ" "DNA" "blood" ""
"0000406696" "00405454" "1" "03256" "03256" "2022-03-18 09:58:02" "" "" "MAQ" "DNA" "blood" ""
"0000406699" "00405459" "1" "03256" "03256" "2022-03-18 10:14:57" "" "" "SEQ" "DNA" "blood" ""
"0000406700" "00405460" "1" "03256" "03256" "2022-03-18 11:00:11" "" "" "SEQ" "DNA" "blood" ""
"0000406701" "00405461" "1" "03256" "03256" "2022-03-18 11:05:55" "" "" "SEQ" "DNA" "blood" ""
"0000406702" "00405462" "1" "03256" "03256" "2022-03-18 11:19:08" "" "" "SEQ" "DNA" "blood" ""
"0000407044" "00405803" "1" "03256" "03256" "2022-03-22 15:42:39" "" "" "SEQ" "DNA" "blood" ""
"0000407927" "00406680" "1" "03256" "03256" "2022-04-04 13:02:51" "" "" "SEQ" "DNA" "blood" ""
"0000407977" "00406730" "1" "03256" "03256" "2022-04-04 16:43:17" "" "" "?" "DNA" "" ""
"0000407978" "00406731" "1" "03256" "03256" "2022-04-04 17:09:41" "" "" "SEQ" "DNA" "" ""
"0000407979" "00406732" "1" "03256" "03256" "2022-04-04 17:17:02" "" "" "?" "DNA" "" ""
"0000407982" "00406735" "1" "03256" "03256" "2022-04-04 17:24:39" "" "" "?" "DNA" "" ""
"0000410046" "00408782" "1" "03256" "03256" "2022-04-27 18:22:13" "" "" "SEQ" "DNA" "blood" ""
"0000418282" "00416999" "1" "03256" "03256" "2022-09-12 17:29:13" "" "" "SEQ" "DNA" "blood" ""
"0000418284" "00417001" "1" "03256" "03256" "2022-09-12 17:39:43" "" "" "SEQ" "DNA" "blood" ""
"0000418285" "00417002" "1" "03256" "03256" "2022-09-12 17:48:02" "" "" "SEQ" "DNA" "blood" ""
"0000418287" "00417004" "1" "03256" "03256" "2022-09-12 17:58:10" "" "" "SEQ" "DNA" "blood" ""
"0000418289" "00417007" "1" "03256" "03256" "2022-09-12 18:06:03" "" "" "SEQ" "DNA" "blood" ""
"0000418538" "00417246" "1" "03256" "03256" "2022-09-14 16:47:56" "" "" "SEQ" "DNA" "blood" ""
"0000418539" "00417247" "1" "03256" "03256" "2022-09-14 17:01:52" "" "" "SEQ" "DNA" "blood" ""
"0000418540" "00417248" "1" "03256" "03256" "2022-09-14 17:49:54" "" "" "SEQ" "DNA" "blood" ""
"0000418541" "00417249" "1" "03256" "03256" "2022-09-14 18:25:34" "" "" "SEQ" "DNA" "blood" ""
"0000418543" "00417251" "1" "03256" "03256" "2022-09-14 18:45:42" "" "" "SEQ" "DNA" "blood" ""
"0000418544" "00417252" "1" "03256" "03256" "2022-09-14 18:54:07" "" "" "SEQ" "DNA" "blood" ""
"0000418545" "00417253" "1" "03256" "03256" "2022-09-14 19:09:28" "" "" "SEQ" "DNA" "blood" ""
"0000418578" "00417286" "1" "03256" "03256" "2022-09-15 10:33:58" "" "" "SEQ" "DNA" "blood" ""
"0000418579" "00417287" "1" "03256" "03256" "2022-09-15 10:41:34" "" "" "SEQ" "DNA" "blood" ""
"0000418580" "00417288" "1" "03256" "03256" "2022-09-15 10:49:39" "" "" "?" "DNA" "blood" ""
"0000418581" "00417289" "1" "03256" "03256" "2022-09-15 10:57:15" "" "" "?" "DNA" "" ""
"0000418582" "00417290" "1" "03256" "03256" "2022-09-15 11:08:01" "" "" "SEQ" "DNA" "blood" ""
"0000418583" "00417291" "1" "03256" "03256" "2022-09-15 11:12:43" "" "" "SEQ" "DNA" "blood" ""
"0000418584" "00417292" "1" "03256" "03256" "2022-09-15 11:18:58" "" "" "?" "DNA" "" ""
"0000418585" "00417293" "1" "03256" "03256" "2022-09-15 11:30:09" "" "" "?" "DNA" "" ""
"0000418586" "00417294" "1" "03256" "03256" "2022-09-15 11:33:51" "" "" "?" "DNA" "" ""
"0000418587" "00417295" "1" "03256" "03256" "2022-09-15 11:45:49" "" "" "SEQ" "DNA" "blood" ""
"0000418588" "00417296" "1" "03256" "03256" "2022-09-15 11:51:19" "" "" "?" "DNA" "" ""
"0000418589" "00417297" "1" "03256" "03256" "2022-09-15 12:02:49" "" "" "SEQ" "DNA" "blood" ""
"0000418621" "00417329" "1" "03256" "03256" "2022-09-15 16:01:25" "" "" "SEQ" "DNA" "blood" ""
"0000418622" "00417330" "1" "03256" "03256" "2022-09-15 16:09:19" "" "" "?" "DNA" "" ""
"0000418623" "00417331" "1" "03256" "03256" "2022-09-15 16:12:29" "" "" "?" "DNA" "" ""
"0000418624" "00417332" "1" "03256" "03256" "2022-09-15 16:22:08" "" "" "?" "DNA" "" ""
"0000418625" "00417333" "1" "03256" "03256" "2022-09-15 16:25:26" "" "" "?" "DNA" "" ""
"0000418627" "00417335" "1" "03256" "03256" "2022-09-15 16:48:03" "" "" "?" "DNA" "" ""
"0000418628" "00417336" "1" "03256" "03256" "2022-09-15 17:19:03" "" "" "SEQ" "DNA" "blood" ""
"0000418629" "00417337" "1" "03256" "03256" "2022-09-15 17:23:49" "" "" "?" "DNA" "" ""
"0000418630" "00417338" "1" "03256" "03256" "2022-09-15 17:27:21" "" "" "?" "DNA" "" ""
"0000418631" "00417339" "1" "03256" "03256" "2022-09-15 17:32:26" "" "" "SEQ" "DNA" "blood" ""
"0000418632" "00417340" "1" "03256" "03256" "2022-09-15 17:38:54" "" "" "SEQ" "DNA" "blood" ""
"0000418633" "00417341" "1" "03256" "03256" "2022-09-15 17:53:57" "" "" "SEQ" "DNA" "blood" ""
"0000418634" "00417342" "1" "03256" "03256" "2022-09-15 18:00:49" "" "" "?" "DNA" "" ""
"0000418635" "00417343" "1" "03256" "03256" "2022-09-15 18:05:15" "" "" "SEQ" "DNA" "blood" ""
"0000418636" "00417344" "1" "03256" "03256" "2022-09-15 18:10:56" "" "" "SEQ" "DNA" "blood" ""
"0000418637" "00417345" "1" "03256" "03256" "2022-09-15 18:17:57" "" "" "SEQ" "DNA" "blood" ""
"0000418638" "00417346" "1" "03256" "03256" "2022-09-15 18:41:30" "" "" "?" "DNA" "" ""
"0000418639" "00417347" "1" "03256" "03256" "2022-09-15 18:48:48" "" "" "SEQ" "DNA" "blood" ""
"0000418640" "00417348" "1" "03256" "03256" "2022-09-15 18:56:07" "" "" "SEQ" "DNA" "blood" ""
"0000418641" "00417349" "1" "03256" "03256" "2022-09-15 19:04:18" "" "" "SEQ" "DNA" "blood" ""
"0000418642" "00417350" "1" "03256" "03256" "2022-09-15 19:21:34" "" "" "SEQ" "DNA" "blood" ""
"0000418643" "00417351" "1" "03256" "03256" "2022-09-15 19:28:34" "" "" "?" "DNA" "" ""
"0000418722" "00417429" "1" "03256" "03256" "2022-09-16 12:34:32" "" "" "SEQ" "DNA" "blood" ""
"0000418724" "00417431" "1" "03256" "03256" "2022-09-16 13:09:19" "" "" "SEQ" "DNA" "blood" ""
"0000418726" "00417434" "1" "03256" "03256" "2022-09-16 13:35:49" "" "" "SEQ" "DNA" "blood" ""
"0000418729" "00417436" "1" "03256" "03256" "2022-09-16 13:57:48" "" "" "SEQ" "DNA" "blood" ""
"0000418730" "00417437" "1" "03256" "03256" "2022-09-16 14:06:00" "" "" "SEQ" "DNA" "blood" ""
"0000418731" "00417438" "1" "03256" "03256" "2022-09-16 14:12:02" "" "" "SEQ" "DNA" "blood" ""
"0000418732" "00417439" "1" "03256" "03256" "2022-09-16 14:38:48" "" "" "MAPH" "DNA" "blood" ""
"0000418733" "00417440" "1" "03256" "03256" "2022-09-16 15:17:37" "" "" "MAPH" "DNA" "blood" ""
"0000419160" "00417865" "1" "03256" "03256" "2022-09-27 12:01:57" "" "" "SEQ" "DNA" "blood" ""
"0000424537" "00423227" "1" "03256" "03256" "2022-11-12 11:38:02" "03256" "2022-11-12 12:00:28" "MLPA" "DNA" "blood" ""
"0000424538" "00423228" "1" "03256" "03256" "2022-11-12 12:39:33" "" "" "SEQ" "DNA" "blood" ""
"0000424539" "00423229" "1" "03256" "03256" "2022-11-12 12:58:42" "" "" "SEQ" "DNA" "blood" ""
"0000424540" "00423230" "1" "03256" "03256" "2022-11-12 15:23:52" "" "" "SEQ" "DNA" "" ""
"0000424541" "00423231" "1" "03256" "03256" "2022-11-12 15:35:20" "" "" "SEQ" "DNA" "blood" ""
"0000426101" "00424788" "1" "03256" "03256" "2022-11-21 15:32:33" "" "" "SEQ" "DNA" "blood" ""
"0000426102" "00424789" "1" "03256" "03256" "2022-11-21 17:10:53" "" "" "SEQ" "DNA" "blood" ""
"0000426260" "00424942" "1" "03256" "03256" "2022-11-23 17:14:51" "" "" "?" "DNA" "" ""
"0000426327" "00425007" "1" "03256" "03256" "2022-11-24 18:33:00" "" "" "SEQ-NG" "DNA" "" ""
"0000426328" "00425008" "1" "03256" "03256" "2022-11-24 18:39:58" "" "" "SEQ-NG" "DNA" "" ""
"0000426329" "00425009" "1" "03256" "03256" "2022-11-24 18:49:36" "" "" "SEQ-NG" "DNA" "" ""
"0000427080" "00425760" "1" "03256" "03256" "2022-11-25 15:12:58" "" "" "SEQ-NG" "DNA" "" ""
"0000427090" "00425770" "1" "03256" "03256" "2022-11-25 15:24:57" "" "" "SEQ-NG" "DNA" "" ""
"0000427102" "00425779" "1" "03256" "03256" "2022-11-25 15:35:50" "" "" "SEQ-NG" "DNA" "" ""
"0000427117" "00425797" "1" "03256" "03256" "2022-11-25 16:38:48" "" "" "SEQ-NG" "DNA" "" ""
"0000427118" "00425798" "1" "03256" "03256" "2022-11-25 16:45:57" "" "" "SEQ-NG" "DNA" "" ""
"0000427119" "00425799" "1" "03256" "03256" "2022-11-25 17:13:38" "" "" "SEQ-NG" "DNA" "" ""
"0000427705" "00426385" "1" "03256" "03256" "2022-11-29 17:30:25" "" "" "SEQ-NG" "DNA" "" ""
"0000427706" "00426386" "1" "03256" "03256" "2022-11-29 17:34:49" "" "" "SEQ-NG" "DNA" "" ""
"0000427707" "00426387" "1" "03256" "03256" "2022-11-29 17:41:24" "" "" "SEQ-NG" "DNA" "" ""
"0000427708" "00426388" "1" "03256" "03256" "2022-11-29 17:47:31" "" "" "SEQ-NG" "DNA" "" ""
"0000427709" "00426389" "1" "03256" "03256" "2022-11-29 17:52:26" "" "" "SEQ-NG" "DNA" "" ""
"0000427710" "00426390" "1" "03256" "03256" "2022-11-29 18:00:56" "" "" "SEQ-NG" "DNA" "" ""
"0000427711" "00426391" "1" "03256" "03256" "2022-11-29 18:20:36" "" "" "SEQ-NG" "DNA" "" ""
"0000427712" "00426392" "1" "03256" "03256" "2022-11-29 18:26:39" "" "" "SEQ-NG" "DNA" "" ""
"0000427713" "00426393" "1" "03256" "03256" "2022-11-29 18:59:11" "" "" "SEQ-NG" "DNA" "" ""
"0000428987" "00427666" "1" "03256" "03256" "2022-12-09 16:05:23" "" "" "SEQ" "DNA" "blood" ""
"0000429155" "00427833" "1" "03256" "03256" "2022-12-15 16:48:50" "" "" "?" "DNA" "" ""
"0000429788" "00428376" "1" "03256" "03256" "2023-01-02 11:43:25" "" "" "SEQ" "DNA" "blood" ""
"0000429789" "00428377" "1" "03256" "03256" "2023-01-02 12:18:14" "" "" "SEQ" "DNA" "blood" ""
"0000429815" "00428403" "1" "03256" "03256" "2023-01-02 16:38:00" "" "" "SEQ" "DNA" "blood" ""
"0000429816" "00428404" "1" "03256" "03256" "2023-01-02 16:55:41" "" "" "SEQ" "DNA" "blood" ""
"0000429817" "00428405" "1" "03256" "03256" "2023-01-02 17:19:33" "" "" "SEQ-NG" "DNA" "blood" ""
"0000429818" "00428406" "1" "03256" "03256" "2023-01-02 17:29:17" "" "" "SEQ-NG" "DNA" "blood" ""
"0000429824" "00428411" "1" "03256" "03256" "2023-01-02 20:10:03" "" "" "SEQ-NG" "DNA" "blood" ""
"0000431678" "00430264" "1" "03256" "03256" "2023-01-16 12:47:26" "" "" "?" "DNA" "" ""
"0000432572" "00431161" "1" "03256" "03256" "2023-01-31 15:33:42" "" "" "?" "DNA" "" ""
"0000435570" "00434103" "1" "03256" "03256" "2023-03-19 18:56:58" "" "" "SEQ" "DNA" "blood" ""
"0000436115" "00434644" "1" "03256" "03256" "2023-04-05 15:40:03" "" "" "?" "DNA" "" ""
"0000436116" "00434645" "1" "03256" "03256" "2023-04-05 15:48:34" "" "" "?" "DNA" "" ""
"0000436118" "00434646" "1" "03256" "03256" "2023-04-06 09:17:03" "" "" "?" "DNA" "" ""
"0000436122" "00434650" "1" "03256" "03256" "2023-04-06 12:22:04" "" "" "?" "DNA" "" ""
"0000436124" "00434652" "1" "03256" "03256" "2023-04-06 17:47:55" "" "" "SEQ-NG-I" "DNA" "blood" ""
"0000436125" "00434653" "1" "03256" "03256" "2023-04-06 18:08:19" "" "" "SEQ-NG-I" "DNA" "blood" ""
"0000436126" "00434654" "1" "03256" "03256" "2023-04-06 18:20:45" "" "" "SEQ-NG-I" "DNA" "blood" ""
"0000436478" "00435005" "1" "03256" "03256" "2023-04-19 12:23:22" "" "" "SEQ-NG" "DNA" "blood" ""
"0000436633" "00435159" "1" "03256" "03256" "2023-05-31 19:42:46" "" "" "?" "DNA" "" ""
"0000436796" "00435317" "1" "03256" "03256" "2023-06-29 16:06:01" "" "" "SEQ" "DNA" "blood" ""
"0000437884" "00436402" "1" "03256" "03256" "2023-09-12 17:26:58" "" "" "SEQ" "DNA" "blood" ""
"0000437885" "00436403" "1" "03256" "03256" "2023-09-12 18:33:07" "" "" "SEQ" "DNA" "blood" ""
"0000437886" "00436404" "1" "03256" "03256" "2023-09-12 19:15:12" "" "" "SEQ" "DNA" "blood" ""
"0000437887" "00436405" "1" "03256" "03256" "2023-09-13 10:01:47" "" "" "SEQ" "DNA" "blood" ""
"0000437888" "00436406" "1" "03256" "03256" "2023-09-13 10:15:31" "" "" "SEQ" "DNA" "blood" ""
"0000437889" "00436407" "1" "03256" "03256" "2023-09-13 10:29:37" "" "" "SEQ" "DNA" "blood" ""
"0000437890" "00436408" "1" "03256" "03256" "2023-09-13 10:48:07" "" "" "SEQ" "DNA" "blood" ""
"0000437891" "00436409" "1" "03256" "03256" "2023-09-13 10:54:33" "" "" "SEQ" "DNA" "blood" ""
"0000437897" "00436413" "1" "03256" "03256" "2023-09-14 15:49:16" "" "" "SEQ" "DNA" "blood" ""
"0000437898" "00436415" "1" "03256" "03256" "2023-09-14 16:30:35" "" "" "SEQ" "DNA" "blood" ""
"0000437966" "00436482" "1" "03256" "03256" "2023-09-18 11:06:03" "03256" "2023-09-18 11:33:24" "MLPA" "DNA" "blood" ""
"0000438118" "00436635" "1" "03256" "03256" "2023-09-26 09:10:24" "" "" "SEQ" "DNA" "blood" ""
"0000444096" "00442612" "1" "03256" "03256" "2023-11-22 17:13:44" "" "" "SEQ" "DNA" "blood" ""
"0000445189" "00443696" "1" "03256" "03256" "2023-11-30 18:41:15" "" "" "SEQ" "DNA" "blood" ""
"0000445575" "00444078" "1" "03256" "03256" "2023-12-15 16:34:04" "" "" "?" "DNA" "blood" ""
"0000446600" "00445030" "1" "03256" "03256" "2023-12-31 18:30:25" "" "" "SEQ" "DNA" "blood" ""
"0000449945" "00448367" "1" "03256" "03256" "2024-03-02 22:38:29" "" "" "SEQ" "DNA" "blood" ""
"0000449976" "00448400" "1" "03256" "03256" "2024-03-07 18:52:08" "" "" "SEQ" "DNA" "blood" ""
"0000449977" "00448401" "1" "03256" "03256" "2024-03-07 19:05:24" "" "" "SEQ" "DNA" "blood" ""
"0000449978" "00448402" "1" "03256" "03256" "2024-03-07 19:18:00" "" "" "SEQ" "DNA" "blood" ""
"0000449979" "00448403" "1" "03256" "03256" "2024-03-07 19:27:08" "" "" "SEQ" "DNA" "blood" ""
"0000449998" "00448422" "1" "03256" "03256" "2024-03-10 19:17:12" "" "" "MLPA" "DNA" "blood" ""
"0000449999" "00448423" "1" "03256" "03256" "2024-03-10 19:23:05" "" "" "SEQ" "DNA" "blood" ""
"0000450000" "00448424" "1" "03256" "03256" "2024-03-11 09:26:03" "" "" "SEQ" "DNA" "blood" ""
"0000450060" "00448481" "1" "03256" "03256" "2024-03-12 10:46:41" "" "" "SEQ" "DNA" "blood" ""
"0000450061" "00448482" "1" "03256" "03256" "2024-03-12 10:53:42" "" "" "SEQ" "DNA" "blood" ""
"0000450062" "00448483" "1" "03256" "03256" "2024-03-12 10:59:36" "" "" "SEQ" "DNA" "blood" ""
"0000450063" "00448484" "1" "03256" "03256" "2024-03-12 11:14:14" "" "" "SEQ" "DNA" "blood" ""
"0000450064" "00448485" "1" "03256" "03256" "2024-03-12 11:52:10" "" "" "SEQ" "DNA" "blood" ""
"0000450065" "00448486" "1" "03256" "03256" "2024-03-13 10:10:06" "" "" "SEQ" "DNA" "blood" ""
"0000450066" "00448487" "1" "03256" "03256" "2024-03-13 17:01:50" "" "" "MAPH" "DNA" "blood" ""
"0000451159" "00449568" "1" "03256" "03256" "2024-04-28 16:06:02" "" "" "SEQ" "DNA" "blood" ""
"0000453669" "00452067" "1" "03256" "03256" "2024-07-09 15:12:57" "" "" "?" "DNA" "blood" ""
"0000453670" "00452068" "1" "03256" "03256" "2024-07-09 15:52:11" "" "" "?" "DNA" "blood" ""
"0000453688" "00452086" "1" "03256" "03256" "2024-07-09 16:42:19" "" "" "?" "DNA" "blood" ""
"0000453689" "00452087" "1" "03256" "03256" "2024-07-09 16:49:45" "" "" "SEQ" "DNA" "blood" ""
"0000453702" "00452100" "1" "03256" "03256" "2024-07-09 17:15:24" "" "" "?" "DNA" "blood" ""
"0000453704" "00452102" "1" "03256" "03256" "2024-07-10 08:46:28" "" "" "?" "DNA" "blood" ""
"0000453705" "00452103" "1" "03256" "03256" "2024-07-10 09:17:56" "" "" "?" "DNA" "blood" ""
"0000453706" "00452104" "1" "03256" "03256" "2024-07-10 10:07:04" "" "" "?" "DNA" "blood" ""
"0000453707" "00452105" "1" "03256" "03256" "2024-07-10 10:12:01" "" "" "?" "DNA" "blood" ""
"0000453710" "00452108" "1" "03256" "03256" "2024-07-10 14:18:32" "" "" "?" "DNA" "" ""
"0000453711" "00452109" "1" "03256" "03256" "2024-07-10 14:26:20" "" "" "?" "DNA" "" ""
"0000453712" "00452110" "1" "03256" "03256" "2024-07-10 15:25:50" "" "" "?" "DNA" "" ""
"0000453713" "00452111" "1" "03256" "03256" "2024-07-10 15:45:03" "" "" "?" "DNA" "" ""
"0000453714" "00452112" "1" "03256" "03256" "2024-07-10 15:51:45" "" "" "?" "DNA" "" ""
"0000453715" "00452113" "1" "03256" "03256" "2024-07-10 16:04:17" "" "" "?" "DNA" "" ""
"0000453716" "00452114" "1" "03256" "03256" "2024-07-10 16:11:35" "" "" "?" "DNA" "" ""
"0000453717" "00452115" "1" "03256" "03256" "2024-07-10 16:25:39" "" "" "?" "DNA" "" ""
"0000453718" "00452116" "1" "03256" "03256" "2024-07-11 21:22:03" "" "" "?" "DNA" "blood" ""
"0000453719" "00452117" "1" "03256" "03256" "2024-07-11 21:46:22" "" "" "?" "DNA" "" ""
"0000453720" "00452118" "1" "03256" "03256" "2024-07-11 22:22:38" "" "" "?" "DNA" "blood" ""
"0000453721" "00452119" "1" "03256" "03256" "2024-07-11 22:40:12" "" "" "?" "DNA" "" ""
"0000453869" "00452268" "1" "03256" "03256" "2024-07-12 15:35:51" "" "" "?" "DNA" "blood" ""
"0000453871" "00452269" "1" "03256" "03256" "2024-07-12 15:59:46" "" "" "?" "DNA" "" ""
"0000453872" "00452270" "1" "03256" "03256" "2024-07-12 16:08:10" "" "" "?" "DNA" "" ""
"0000453873" "00452271" "1" "03256" "03256" "2024-07-12 16:23:57" "" "" "?" "DNA" "" ""
"0000453874" "00452272" "1" "03256" "03256" "2024-07-12 21:00:49" "" "" "?" "DNA" "" ""
"0000453875" "00452273" "1" "03256" "03256" "2024-07-12 21:18:13" "" "" "?" "DNA" "" ""
"0000453876" "00452274" "1" "03256" "03256" "2024-07-12 22:16:07" "" "" "?" "DNA" "" ""
"0000453877" "00452275" "1" "03256" "03256" "2024-07-12 22:23:13" "" "" "?" "DNA" "" ""
"0000453924" "00452322" "1" "03256" "03256" "2024-07-16 17:25:45" "" "" "?" "DNA" "" ""
"0000453925" "00452323" "1" "03256" "03256" "2024-07-16 17:52:42" "" "" "?" "DNA" "" ""
"0000453926" "00452324" "1" "03256" "03256" "2024-07-16 18:06:31" "" "" "?" "DNA" "" ""
"0000453927" "00452325" "1" "03256" "03256" "2024-07-16 18:12:36" "" "" "?" "DNA" "" ""
"0000453928" "00452326" "1" "03256" "03256" "2024-07-16 18:19:42" "" "" "?" "DNA" "" ""
"0000453929" "00452327" "1" "03256" "03256" "2024-07-16 18:23:43" "" "" "?" "DNA" "" ""
"0000453930" "00452328" "1" "03256" "03256" "2024-07-16 18:28:43" "" "" "?" "DNA" "" ""
"0000456301" "00454688" "1" "03256" "03256" "2024-09-25 10:48:20" "" "" "?" "DNA" "" ""
"0000456302" "00454689" "1" "03256" "03256" "2024-09-25 10:56:07" "" "" "?" "DNA" "" ""
"0000456303" "00454690" "1" "03256" "03256" "2024-09-25 11:04:31" "" "" "?" "DNA" "" ""
"0000456306" "00454693" "1" "03256" "03256" "2024-09-25 11:23:56" "" "" "?" "DNA" "" ""
"0000459602" "00457983" "1" "03256" "03256" "2024-11-24 10:26:48" "" "" "?" "DNA" "blood" ""
"0000459607" "00457987" "1" "03256" "03256" "2024-11-24 14:44:37" "" "" "?" "DNA" "blood" ""
"0000459611" "00457991" "1" "03256" "03256" "2024-11-24 15:20:48" "" "" "?" "DNA" "blood" ""
"0000459615" "00457995" "1" "03256" "03256" "2024-11-24 18:38:33" "" "" "?" "DNA" "blood" ""
"0000459616" "00457996" "1" "03256" "03256" "2024-11-24 18:46:54" "" "" "?" "DNA" "blood" ""
"0000459617" "00457997" "1" "03256" "03256" "2024-11-24 18:54:36" "" "" "?" "DNA" "blood" ""
"0000459618" "00457998" "1" "03256" "03256" "2024-11-24 19:03:08" "" "" "?" "DNA" "blood" ""
"0000459619" "00457999" "1" "03256" "03256" "2024-11-24 19:07:54" "" "" "?" "DNA" "blood" ""
"0000459620" "00458000" "1" "03256" "03256" "2024-11-24 19:19:11" "" "" "?" "DNA" "blood" ""
"0000459621" "00458001" "1" "03256" "03256" "2024-11-24 19:37:12" "" "" "?" "DNA" "blood" ""
"0000459622" "00458002" "1" "03256" "03256" "2024-11-24 19:43:19" "" "" "?" "DNA" "blood" ""
"0000459623" "00458003" "1" "03256" "03256" "2024-11-24 21:40:37" "" "" "?" "DNA" "blood" ""
"0000459624" "00458004" "1" "03256" "03256" "2024-11-24 21:48:08" "" "" "?" "DNA" "blood" ""
"0000459625" "00458005" "1" "03256" "03256" "2024-11-25 08:48:23" "" "" "?" "DNA" "blood" ""
"0000459645" "00458028" "1" "03256" "03256" "2024-11-25 22:07:09" "" "" "?" "DNA" "blood" ""
"0000459646" "00458029" "1" "03256" "03256" "2024-11-25 22:14:54" "" "" "?" "DNA" "blood" ""
"0000459654" "00458037" "1" "03256" "03256" "2024-11-25 22:23:10" "" "" "?" "DNA" "blood" ""
"0000459662" "00458044" "1" "03256" "03256" "2024-11-26 11:31:22" "" "" "?" "DNA" "blood" ""
"0000459663" "00458045" "1" "03256" "03256" "2024-11-26 11:53:11" "" "" "?" "DNA" "blood" ""
"0000459666" "00458048" "1" "03256" "03256" "2024-11-26 15:36:22" "" "" "?" "DNA" "blood" ""
"0000459667" "00458049" "1" "03256" "03256" "2024-11-26 15:43:30" "" "" "?" "DNA" "blood" ""
"0000459668" "00458050" "1" "03256" "03256" "2024-11-26 15:49:53" "" "" "?" "DNA" "blood" ""
"0000459669" "00458051" "1" "03256" "03256" "2024-11-26 15:55:29" "" "" "?" "DNA" "blood" ""
"0000459670" "00458052" "1" "03256" "03256" "2024-11-26 16:10:47" "" "" "?" "DNA" "blood" ""
"0000459671" "00458053" "1" "03256" "03256" "2024-11-26 21:32:01" "" "" "?" "DNA" "blood" ""
"0000459672" "00458054" "1" "03256" "03256" "2024-11-26 22:24:01" "" "" "?" "DNA" "blood" ""
"0000459673" "00458055" "1" "03256" "03256" "2024-11-26 22:30:45" "" "" "?" "DNA" "" ""
"0000459675" "00458057" "1" "03256" "03256" "2024-11-27 09:25:00" "" "" "?" "DNA" "" ""
"0000459676" "00458058" "1" "03256" "03256" "2024-11-27 09:36:52" "" "" "?" "DNA" "blood" ""
"0000459677" "00458059" "1" "03256" "03256" "2024-11-27 09:53:36" "" "" "?" "DNA" "blood" ""
"0000459678" "00458060" "1" "03256" "03256" "2024-11-27 10:58:12" "" "" "?" "DNA" "blood" ""
"0000459679" "00458061" "1" "03256" "03256" "2024-11-27 12:29:52" "" "" "?" "DNA" "blood" ""
"0000459681" "00458063" "1" "03256" "03256" "2024-11-27 18:25:25" "" "" "?" "DNA" "blood" ""
"0000459682" "00458064" "1" "03256" "03256" "2024-11-27 18:36:00" "" "" "?" "DNA" "blood" ""
"0000459683" "00458065" "1" "03256" "03256" "2024-11-27 19:24:06" "" "" "?" "DNA" "blood" ""
"0000459684" "00458066" "1" "03256" "03256" "2024-11-27 19:29:44" "" "" "?" "DNA" "blood" ""
"0000459685" "00458067" "1" "03256" "03256" "2024-11-27 19:35:06" "" "" "?" "DNA" "blood" ""
"0000459686" "00458068" "1" "03256" "03256" "2024-11-27 19:39:22" "" "" "?" "DNA" "" ""
"0000459687" "00458069" "1" "03256" "03256" "2024-11-27 19:43:02" "" "" "?" "DNA" "" ""
"0000459688" "00458070" "1" "03256" "03256" "2024-11-27 19:47:36" "" "" "?" "DNA" "" ""
"0000459689" "00458071" "1" "03256" "03256" "2024-11-27 21:02:45" "" "" "?" "DNA" "" ""
"0000459690" "00458072" "1" "03256" "03256" "2024-11-27 21:07:43" "" "" "?" "DNA" "" ""
"0000459691" "00458073" "1" "03256" "03256" "2024-11-27 21:23:32" "" "" "?" "DNA" "blood" ""
"0000459692" "00458074" "1" "03256" "03256" "2024-11-27 21:27:13" "" "" "?" "DNA" "" ""
"0000459693" "00458075" "1" "03256" "03256" "2024-11-27 21:33:14" "" "" "?" "DNA" "" ""
"0000459694" "00458076" "1" "03256" "03256" "2024-11-27 21:40:23" "" "" "?" "DNA" "" ""
"0000459695" "00458077" "1" "03256" "03256" "2024-11-28 10:24:14" "" "" "SEQ" "DNA" "blood" ""
"0000459696" "00458078" "1" "03256" "03256" "2024-11-28 11:10:09" "" "" "SEQ" "DNA" "" ""
"0000459699" "00458081" "1" "03256" "03256" "2024-11-28 14:48:11" "" "" "?" "DNA" "" ""
"0000459700" "00458082" "1" "03256" "03256" "2024-11-28 14:54:40" "" "" "?" "DNA" "" ""
"0000459701" "00458083" "1" "03256" "03256" "2024-11-28 15:02:58" "" "" "?" "DNA" "" ""
"0000459702" "00458084" "1" "03256" "03256" "2024-11-28 15:07:25" "" "" "?" "DNA" "" ""
"0000459703" "00458085" "1" "03256" "03256" "2024-11-28 18:21:38" "" "" "?" "DNA" "" ""
"0000459704" "00458086" "1" "03256" "03256" "2024-11-28 18:33:14" "" "" "?" "DNA" "" ""
"0000459705" "00458087" "1" "03256" "03256" "2024-11-28 18:37:16" "" "" "?" "DNA" "" ""
"0000459706" "00458088" "1" "03256" "03256" "2024-11-28 18:42:47" "" "" "?" "DNA" "" ""
"0000459708" "00458090" "1" "03256" "03256" "2024-11-28 19:04:19" "" "" "?" "DNA" "" ""
"0000459709" "00458091" "1" "03256" "03256" "2024-11-28 19:21:57" "" "" "?" "DNA" "" ""
"0000459710" "00458092" "1" "03256" "03256" "2024-11-28 19:26:42" "" "" "?" "DNA" "" ""
"0000459711" "00458093" "1" "03256" "03256" "2024-11-29 09:03:48" "" "" "?" "DNA" "" ""
"0000459712" "00458094" "1" "03256" "03256" "2024-11-29 09:07:43" "" "" "?" "DNA" "" ""
"0000459716" "00458098" "1" "03256" "03256" "2024-11-29 11:31:19" "" "" "?" "DNA" "" ""
"0000459724" "00458106" "1" "03256" "03256" "2024-11-30 20:29:08" "" "" "?" "DNA" "" ""
"0000459794" "00458173" "1" "03256" "03256" "2024-12-06 11:04:35" "" "" "?" "DNA" "" ""
"0000459867" "00458246" "1" "03256" "03256" "2024-12-09 15:17:14" "" "" "?" "DNA" "" ""
"0000461149" "00459523" "1" "03256" "03256" "2025-01-06 18:26:08" "" "" "SEQ" "DNA" "blood" ""
"0000461422" "00459792" "1" "03256" "03256" "2025-01-13 19:38:22" "" "" "MLPA" "DNA" "blood" ""
"0000462204" "00460571" "1" "03256" "03256" "2025-01-25 21:26:13" "" "" "SEQ" "DNA" "blood" ""
"0000462220" "00460587" "1" "03256" "03256" "2025-01-27 10:54:15" "" "" "SEQ" "DNA" "blood" ""
"0000463860" "00462228" "1" "03256" "03256" "2025-02-03 11:54:06" "" "" "SEQ" "DNA" "" ""
"0000463862" "00462230" "1" "03256" "03256" "2025-02-03 12:16:19" "" "" "SEQ" "DNA" "" ""
"0000463864" "00462232" "1" "03256" "03256" "2025-02-03 14:33:59" "" "" "SEQ" "DNA" "blood" ""
"0000463865" "00462233" "1" "03256" "03256" "2025-02-03 14:57:51" "" "" "SEQ" "DNA" "blood" ""
"0000463922" "00462290" "1" "03256" "03256" "2025-02-08 16:50:19" "" "" "?" "DNA" "blood" ""
"0000466060" "00464426" "1" "03256" "03256" "2025-03-13 14:46:55" "" "" "?" "DNA" "" ""
"0000466061" "00464427" "1" "03256" "03256" "2025-03-13 14:54:16" "" "" "?" "DNA" "" ""
"0000466062" "00464428" "1" "03256" "03256" "2025-03-13 15:02:57" "" "" "?" "DNA" "" ""
"0000466064" "00464429" "1" "03256" "03256" "2025-03-13 17:21:41" "" "" "?" "DNA" "" ""
"0000466065" "00448053" "1" "03256" "03256" "2025-03-13 17:29:54" "" "" "?" "DNA" "" ""
"0000466066" "00464430" "1" "03256" "03256" "2025-03-13 17:40:04" "" "" "?" "DNA" "" ""
"0000466067" "00436647" "1" "03256" "03256" "2025-03-13 17:50:54" "" "" "?" "DNA" "" ""
"0000466068" "00462231" "1" "03256" "03256" "2025-03-13 17:58:04" "" "" "?" "DNA" "" ""
"0000466157" "00464519" "1" "03256" "03256" "2025-03-20 15:00:41" "" "" "?" "DNA" "" ""
"0000466215" "00464575" "1" "03256" "03256" "2025-03-30 19:26:43" "" "" "?" "DNA" "" ""
"0000466216" "00464576" "1" "03256" "03256" "2025-03-30 21:09:19" "" "" "SEQ" "DNA" "" ""
"0000466270" "00464624" "1" "03256" "03256" "2025-04-03 18:48:15" "" "" "MLPA" "DNA" "" ""
"0000466962" "00465314" "1" "03256" "03256" "2025-05-11 08:25:31" "" "" "SEQ" "DNA" "" ""
"0000467715" "00466060" "1" "03256" "03256" "2025-07-21 12:18:24" "" "" "SEQ" "DNA" "" ""
"0000468032" "00466371" "1" "03256" "03256" "2025-08-25 13:26:21" "" "" "SEQ" "DNA" "blood" ""
"0000468033" "00466372" "1" "03256" "03256" "2025-08-25 13:32:25" "" "" "SEQ" "DNA" "blood" ""
"0000468035" "00466373" "1" "03256" "03256" "2025-08-25 13:40:09" "" "" "SEQ" "DNA" "blood" ""
"0000468036" "00466374" "1" "03256" "03256" "2025-08-25 16:05:07" "" "" "MLPA" "DNA" "" ""
"0000468037" "00466375" "1" "03256" "03256" "2025-08-25 16:21:19" "" "" "SEQ" "DNA" "blood" ""
"0000468038" "00466376" "1" "03256" "03256" "2025-08-25 16:56:41" "" "" "SEQ" "DNA" "blood" ""
"0000468251" "00466587" "1" "03256" "03256" "2025-09-17 15:26:53" "" "" "SEQ" "DNA" "" ""
"0000468252" "00466588" "1" "03256" "03256" "2025-09-17 15:42:40" "" "" "SEQ" "DNA" "" ""
"0000468253" "00466589" "1" "03256" "03256" "2025-09-17 16:11:23" "" "" "?" "DNA" "" ""
"0000468254" "00466590" "1" "03256" "03256" "2025-09-17 16:39:07" "" "" "SEQ" "DNA" "" ""
"0000468278" "00466614" "1" "03256" "03256" "2025-09-18 10:09:23" "" "" "?" "DNA" "" ""
"0000468279" "00466615" "1" "03256" "03256" "2025-09-18 10:14:27" "" "" "?" "DNA" "" ""
"0000468540" "00466875" "1" "03256" "03256" "2025-09-29 10:19:12" "" "" "SEQ" "DNA" "" ""
"0000468541" "00466876" "1" "03256" "03256" "2025-09-29 10:48:30" "" "" "SEQ" "DNA" "" ""
"0000468542" "00466877" "1" "03256" "03256" "2025-09-29 10:57:05" "" "" "SEQ" "DNA" "" ""
"0000468543" "00466878" "1" "03256" "03256" "2025-09-29 11:06:35" "" "" "SEQ" "DNA" "" ""
"0000468810" "00467148" "1" "03256" "03256" "2025-10-08 14:51:36" "03256" "2025-11-17 15:58:41" "SEQ-NG" "DNA" "blood" ""
"0000469685" "00468019" "1" "03256" "03256" "2025-11-06 14:03:02" "" "" "MLPA" "DNA" "blood" ""
"0000470108" "00468441" "1" "03256" "03256" "2025-11-09 18:22:18" "" "" "?" "DNA" "" ""
"0000471200" "00469532" "1" "03256" "03256" "2025-11-13 14:44:42" "" "" "SEQ" "DNA" "blood" ""
"0000471209" "00469541" "1" "03256" "03256" "2025-11-17 16:15:58" "" "" "SEQ-NG" "DNA" "" ""
"0000471807" "00470139" "1" "03256" "03256" "2025-11-27 12:43:19" "" "" "SEQ-NG-IT" "DNA" "" ""
"0000471808" "00470140" "1" "03256" "03256" "2025-11-27 12:57:57" "" "" "SEQ-NG-IT" "DNA" "" ""
"0000472038" "00470371" "1" "03256" "03256" "2025-12-03 15:11:55" "" "" "SEQ" "DNA" "" ""
"0000472039" "00470372" "1" "03256" "03256" "2025-12-03 18:17:14" "" "" "SEQ" "DNA" "" ""
"0000473170" "00471500" "1" "03256" "03256" "2025-12-25 18:57:08" "" "" "?" "DNA" "" ""
"0000473649" "00471979" "1" "03256" "03256" "2026-01-03 22:02:31" "" "" "SEQ" "DNA" "" ""
"0000473650" "00471980" "1" "03256" "03256" "2026-01-03 22:13:54" "" "" "SEQ" "DNA" "" ""
"0000473853" "00472183" "1" "03256" "03256" "2026-01-14 09:55:39" "" "" "SEQ" "DNA" "" ""
"0000474099" "00472430" "1" "03256" "03256" "2026-02-12 11:51:13" "" "" "SEQ" "DNA" "blood" ""
"0000476026" "00474344" "1" "03256" "03256" "2026-03-16 09:13:15" "" "" "SEQ" "DNA" "" ""
"0000476028" "00474347" "1" "03256" "03256" "2026-03-16 09:27:42" "" "" "SEQ" "DNA" "" ""
"0000476548" "00474866" "1" "03256" "03256" "2026-03-26 15:56:30" "" "" "SEQ-NG" "DNA" "" ""
"0000478783" "00477139" "1" "03256" "03256" "2026-04-22 15:25:42" "" "" "?" "DNA" "" ""
"0000478856" "00477212" "1" "03256" "03256" "2026-04-23 13:36:28" "" "" "?" "DNA" "" ""
"0000478857" "00477213" "1" "03256" "03256" "2026-04-23 14:38:10" "" "" "?" "DNA" "" ""
"0000478858" "00477214" "1" "03256" "03256" "2026-04-23 14:46:47" "" "" "?" "DNA" "" ""
"0000478860" "00477216" "1" "03256" "03256" "2026-04-24 10:23:30" "" "" "?" "DNA" "" ""
"0000478861" "00477217" "1" "03256" "03256" "2026-04-24 15:21:21" "" "" "?" "DNA" "" ""
"0000478862" "00361891" "1" "03256" "03256" "2026-04-24 15:27:36" "" "" "?" "DNA" "" ""
"0000478863" "00265215" "1" "03256" "03256" "2026-04-24 15:48:37" "" "" "?" "DNA" "" ""
"0000478864" "00266232" "1" "03256" "03256" "2026-04-24 16:10:04" "" "" "?" "DNA" "" ""
"0000480159" "00478512" "1" "03256" "03256" "2026-05-11 11:22:12" "" "" "SEQ-NG-I" "DNA" "" ""
"0000481645" "00480000" "1" "03256" "03256" "2026-06-01 15:47:27" "" "" "?" "DNA" "" ""
"0000481648" "00480003" "1" "03256" "03256" "2026-06-03 14:59:50" "" "" "SEQ" "DNA" "" ""
"0000481649" "00480004" "1" "03256" "03256" "2026-06-03 15:44:45" "" "" "SEQ" "DNA" "" ""
"0000481710" "00480063" "1" "03256" "03256" "2026-06-16 17:14:41" "" "" "?" "DNA" "" ""
"0000482766" "00481118" "1" "03256" "03256" "2026-07-10 17:49:24" "" "" "MLPA" "DNA" "" ""
"0000483671" "00482023" "1" "03256" "03256" "2026-07-31 15:47:21" "" "" "?" "DNA" "" ""
"0000483672" "00482024" "1" "03256" "03256" "2026-07-31 16:08:52" "" "" "SEQ" "DNA" "" ""
"0000483673" "00482025" "1" "03256" "03256" "2026-07-31 16:24:25" "" "" "SEQ" "DNA" "" ""
"0000485798" "00484149" "1" "03256" "03256" "2026-08-25 22:34:16" "" "" "SEQ" "DNA" "" ""
"0000486472" "00484818" "1" "03256" "03256" "2026-09-14 16:22:36" "" "" "SEQ-NG" "DNA" "" ""
"0000486473" "00484819" "1" "03256" "03256" "2026-09-14 16:30:01" "" "" "SEQ-NG" "DNA" "" ""
"0000486474" "00484820" "1" "03256" "03256" "2026-09-14 16:44:11" "" "" "SEQ-NG" "DNA" "" ""
"0000486475" "00484821" "1" "03256" "03256" "2026-09-14 16:52:05" "" "" "SEQ-NG" "DNA" "" ""
"0000486476" "00484822" "1" "03256" "03256" "2026-09-14 17:01:54" "" "" "SEQ-NG" "DNA" "" ""
## Screenings_To_Genes ## Do not remove or alter this header ##
## Count = 1233
"{{screeningid}}" "{{geneid}}"
"0000230893" "SERPING1"
"0000230894" "SERPING1"
"0000230895" "SERPING1"
"0000230898" "SERPING1"
"0000230899" "SERPING1"
"0000230900" "SERPING1"
"0000230901" "SERPING1"
"0000230902" "SERPING1"
"0000230903" "SERPING1"
"0000230904" "SERPING1"
"0000230905" "SERPING1"
"0000230906" "SERPING1"
"0000230907" "SERPING1"
"0000230908" "SERPING1"
"0000230909" "SERPING1"
"0000230910" "SERPING1"
"0000230911" "SERPING1"
"0000230912" "SERPING1"
"0000230913" "SERPING1"
"0000230914" "SERPING1"
"0000230915" "SERPING1"
"0000230916" "SERPING1"
"0000230917" "SERPING1"
"0000230918" "SERPING1"
"0000230919" "SERPING1"
"0000230920" "SERPING1"
"0000230922" "SERPING1"
"0000230923" "SERPING1"
"0000230924" "SERPING1"
"0000230925" "SERPING1"
"0000230927" "SERPING1"
"0000230928" "SERPING1"
"0000230929" "SERPING1"
"0000230930" "SERPING1"
"0000230931" "SERPING1"
"0000230932" "SERPING1"
"0000230933" "SERPING1"
"0000230934" "SERPING1"
"0000230935" "SERPING1"
"0000230936" "SERPING1"
"0000230937" "SERPING1"
"0000230938" "SERPING1"
"0000230939" "SERPING1"
"0000230941" "SERPING1"
"0000230942" "SERPING1"
"0000230943" "SERPING1"
"0000230944" "SERPING1"
"0000230945" "SERPING1"
"0000230946" "SERPING1"
"0000230947" "SERPING1"
"0000230948" "SERPING1"
"0000230949" "SERPING1"
"0000230950" "SERPING1"
"0000230951" "SERPING1"
"0000230952" "SERPING1"
"0000230953" "SERPING1"
"0000230954" "SERPING1"
"0000230955" "SERPING1"
"0000230956" "SERPING1"
"0000230957" "SERPING1"
"0000230958" "SERPING1"
"0000230960" "SERPING1"
"0000230961" "SERPING1"
"0000230963" "SERPING1"
"0000230964" "SERPING1"
"0000230965" "SERPING1"
"0000230966" "SERPING1"
"0000230967" "SERPING1"
"0000230968" "SERPING1"
"0000230970" "SERPING1"
"0000230971" "SERPING1"
"0000230972" "SERPING1"
"0000230973" "SERPING1"
"0000230974" "SERPING1"
"0000230975" "SERPING1"
"0000230977" "SERPING1"
"0000230978" "SERPING1"
"0000230979" "SERPING1"
"0000230980" "SERPING1"
"0000230981" "SERPING1"
"0000230982" "SERPING1"
"0000230983" "SERPING1"
"0000230984" "SERPING1"
"0000230985" "SERPING1"
"0000230986" "SERPING1"
"0000230987" "SERPING1"
"0000230988" "SERPING1"
"0000230989" "SERPING1"
"0000230990" "SERPING1"
"0000230992" "SERPING1"
"0000230993" "SERPING1"
"0000230994" "SERPING1"
"0000230995" "SERPING1"
"0000230996" "SERPING1"
"0000230997" "SERPING1"
"0000230998" "SERPING1"
"0000230999" "SERPING1"
"0000231000" "SERPING1"
"0000231001" "SERPING1"
"0000231002" "SERPING1"
"0000231004" "SERPING1"
"0000231005" "SERPING1"
"0000231006" "SERPING1"
"0000231007" "SERPING1"
"0000231008" "SERPING1"
"0000231009" "SERPING1"
"0000231010" "SERPING1"
"0000231011" "SERPING1"
"0000231012" "SERPING1"
"0000231013" "SERPING1"
"0000231015" "SERPING1"
"0000231016" "SERPING1"
"0000231017" "SERPING1"
"0000231018" "SERPING1"
"0000231019" "SERPING1"
"0000231020" "SERPING1"
"0000241515" "SERPING1"
"0000241582" "F12"
"0000241582" "SERPING1"
"0000245532" "SERPING1"
"0000245559" "SERPING1"
"0000245583" "SERPING1"
"0000245598" "SERPING1"
"0000245601" "SERPING1"
"0000245606" "SERPING1"
"0000245607" "SERPING1"
"0000245609" "SERPING1"
"0000245611" "SERPING1"
"0000245614" "SERPING1"
"0000245984" "SERPING1"
"0000245985" "SERPING1"
"0000245986" "SERPING1"
"0000245987" "SERPING1"
"0000245988" "SERPING1"
"0000246174" "SERPING1"
"0000246175" "SERPING1"
"0000246176" "SERPING1"
"0000246177" "SERPING1"
"0000246178" "SERPING1"
"0000246182" "SERPING1"
"0000246183" "SERPING1"
"0000246311" "SERPING1"
"0000246312" "SERPING1"
"0000246315" "SERPING1"
"0000246316" "SERPING1"
"0000246317" "SERPING1"
"0000246319" "SERPING1"
"0000246322" "SERPING1"
"0000246328" "SERPING1"
"0000246340" "SERPING1"
"0000246341" "SERPING1"
"0000246456" "SERPING1"
"0000246461" "SERPING1"
"0000246510" "SERPING1"
"0000246531" "SERPING1"
"0000246532" "SERPING1"
"0000246533" "SERPING1"
"0000246534" "SERPING1"
"0000246535" "SERPING1"
"0000246536" "SERPING1"
"0000246538" "SERPING1"
"0000246539" "SERPING1"
"0000246541" "SERPING1"
"0000246543" "SERPING1"
"0000246544" "SERPING1"
"0000246545" "SERPING1"
"0000246829" "SERPING1"
"0000246830" "SERPING1"
"0000246857" "SERPING1"
"0000246858" "SERPING1"
"0000246859" "SERPING1"
"0000246860" "SERPING1"
"0000246861" "SERPING1"
"0000246862" "SERPING1"
"0000246864" "SERPING1"
"0000246865" "SERPING1"
"0000246867" "SERPING1"
"0000246869" "SERPING1"
"0000246872" "SERPING1"
"0000246874" "SERPING1"
"0000246875" "SERPING1"
"0000246876" "SERPING1"
"0000246877" "SERPING1"
"0000246879" "SERPING1"
"0000246909" "SERPING1"
"0000246912" "SERPING1"
"0000246914" "SERPING1"
"0000246918" "SERPING1"
"0000246919" "SERPING1"
"0000246920" "SERPING1"
"0000246921" "SERPING1"
"0000246922" "SERPING1"
"0000246961" "SERPING1"
"0000246962" "SERPING1"
"0000246963" "SERPING1"
"0000246964" "SERPING1"
"0000246966" "SERPING1"
"0000246967" "SERPING1"
"0000246968" "SERPING1"
"0000246969" "SERPING1"
"0000246970" "SERPING1"
"0000246971" "SERPING1"
"0000246972" "SERPING1"
"0000246973" "SERPING1"
"0000246974" "SERPING1"
"0000246975" "SERPING1"
"0000246977" "SERPING1"
"0000246978" "SERPING1"
"0000246979" "SERPING1"
"0000246980" "SERPING1"
"0000246981" "SERPING1"
"0000246982" "SERPING1"
"0000246983" "SERPING1"
"0000246984" "SERPING1"
"0000246985" "SERPING1"
"0000246986" "SERPING1"
"0000246987" "SERPING1"
"0000246988" "SERPING1"
"0000246989" "SERPING1"
"0000246990" "SERPING1"
"0000246991" "SERPING1"
"0000246992" "SERPING1"
"0000246993" "SERPING1"
"0000247015" "SERPING1"
"0000247016" "SERPING1"
"0000247017" "SERPING1"
"0000247018" "SERPING1"
"0000247019" "SERPING1"
"0000247020" "SERPING1"
"0000247021" "SERPING1"
"0000247688" "SERPING1"
"0000247691" "SERPING1"
"0000247692" "SERPING1"
"0000247693" "SERPING1"
"0000247694" "SERPING1"
"0000247696" "SERPING1"
"0000247697" "SERPING1"
"0000247698" "SERPING1"
"0000247724" "SERPING1"
"0000247725" "SERPING1"
"0000247728" "SERPING1"
"0000247729" "SERPING1"
"0000247730" "SERPING1"
"0000247731" "SERPING1"
"0000247732" "SERPING1"
"0000247733" "SERPING1"
"0000247734" "SERPING1"
"0000247735" "SERPING1"
"0000247736" "SERPING1"
"0000247986" "SERPING1"
"0000248002" "SERPING1"
"0000248622" "SERPING1"
"0000248623" "SERPING1"
"0000262450" "SERPING1"
"0000262451" "SERPING1"
"0000262452" "SERPING1"
"0000262453" "SERPING1"
"0000262454" "SERPING1"
"0000262455" "SERPING1"
"0000262456" "SERPING1"
"0000262457" "SERPING1"
"0000262458" "SERPING1"
"0000262461" "SERPING1"
"0000262462" "SERPING1"
"0000262463" "SERPING1"
"0000262464" "SERPING1"
"0000263190" "SERPING1"
"0000263192" "SERPING1"
"0000263193" "SERPING1"
"0000263194" "SERPING1"
"0000263195" "SERPING1"
"0000263196" "SERPING1"
"0000263197" "SERPING1"
"0000263198" "SERPING1"
"0000263202" "SERPING1"
"0000263203" "SERPING1"
"0000263204" "SERPING1"
"0000263205" "SERPING1"
"0000263206" "SERPING1"
"0000263207" "SERPING1"
"0000263209" "SERPING1"
"0000263210" "SERPING1"
"0000263211" "SERPING1"
"0000263212" "SERPING1"
"0000263213" "SERPING1"
"0000263214" "SERPING1"
"0000263215" "SERPING1"
"0000263227" "SERPING1"
"0000263228" "SERPING1"
"0000263229" "SERPING1"
"0000263230" "SERPING1"
"0000263231" "SERPING1"
"0000263232" "SERPING1"
"0000263233" "SERPING1"
"0000263234" "SERPING1"
"0000263235" "SERPING1"
"0000263237" "SERPING1"
"0000263238" "SERPING1"
"0000264158" "SERPING1"
"0000264225" "SERPING1"
"0000265119" "SERPING1"
"0000265124" "SERPING1"
"0000265127" "SERPING1"
"0000265157" "SERPING1"
"0000265158" "SERPING1"
"0000265186" "SERPING1"
"0000265210" "SERPING1"
"0000265249" "SERPING1"
"0000265251" "SERPING1"
"0000265268" "SERPING1"
"0000265269" "SERPING1"
"0000265275" "SERPING1"
"0000265276" "SERPING1"
"0000265277" "SERPING1"
"0000265278" "SERPING1"
"0000266333" "SERPING1"
"0000266334" "SERPING1"
"0000266335" "SERPING1"
"0000266337" "SERPING1"
"0000266339" "SERPING1"
"0000266341" "SERPING1"
"0000266342" "SERPING1"
"0000266343" "SERPING1"
"0000266344" "SERPING1"
"0000266345" "SERPING1"
"0000266346" "SERPING1"
"0000266347" "SERPING1"
"0000266348" "SERPING1"
"0000266349" "SERPING1"
"0000266350" "SERPING1"
"0000266351" "SERPING1"
"0000266357" "SERPING1"
"0000266358" "SERPING1"
"0000266379" "SERPING1"
"0000266380" "SERPING1"
"0000266381" "SERPING1"
"0000266406" "SERPING1"
"0000266425" "SERPING1"
"0000266426" "SERPING1"
"0000266427" "SERPING1"
"0000266430" "SERPING1"
"0000266431" "SERPING1"
"0000266435" "SERPING1"
"0000266436" "SERPING1"
"0000266437" "SERPING1"
"0000266438" "SERPING1"
"0000266439" "SERPING1"
"0000266440" "SERPING1"
"0000266441" "SERPING1"
"0000266442" "SERPING1"
"0000266443" "SERPING1"
"0000266444" "SERPING1"
"0000266445" "SERPING1"
"0000266446" "SERPING1"
"0000266447" "SERPING1"
"0000266448" "SERPING1"
"0000266449" "SERPING1"
"0000266450" "SERPING1"
"0000266451" "SERPING1"
"0000266452" "SERPING1"
"0000266454" "SERPING1"
"0000266455" "SERPING1"
"0000266456" "SERPING1"
"0000266465" "SERPING1"
"0000266466" "SERPING1"
"0000266467" "SERPING1"
"0000266468" "SERPING1"
"0000266469" "SERPING1"
"0000266470" "SERPING1"
"0000266476" "SERPING1"
"0000266477" "SERPING1"
"0000266478" "SERPING1"
"0000266479" "SERPING1"
"0000266488" "SERPING1"
"0000266490" "SERPING1"
"0000266491" "SERPING1"
"0000266495" "SERPING1"
"0000266496" "SERPING1"
"0000266497" "SERPING1"
"0000266498" "SERPING1"
"0000266508" "SERPING1"
"0000266511" "SERPING1"
"0000266512" "SERPING1"
"0000266522" "SERPING1"
"0000266524" "SERPING1"
"0000266552" "SERPING1"
"0000266553" "SERPING1"
"0000266554" "SERPING1"
"0000266555" "SERPING1"
"0000266556" "SERPING1"
"0000266557" "SERPING1"
"0000266558" "SERPING1"
"0000266560" "SERPING1"
"0000266566" "SERPING1"
"0000266568" "SERPING1"
"0000266569" "SERPING1"
"0000266570" "SERPING1"
"0000266571" "SERPING1"
"0000266606" "SERPING1"
"0000266612" "SERPING1"
"0000266631" "SERPING1"
"0000266634" "SERPING1"
"0000266648" "SERPING1"
"0000266649" "SERPING1"
"0000266650" "SERPING1"
"0000266651" "SERPING1"
"0000266652" "SERPING1"
"0000266653" "SERPING1"
"0000266654" "SERPING1"
"0000266655" "SERPING1"
"0000266656" "SERPING1"
"0000266657" "SERPING1"
"0000266698" "SERPING1"
"0000266699" "SERPING1"
"0000266700" "SERPING1"
"0000266701" "SERPING1"
"0000266702" "SERPING1"
"0000266703" "SERPING1"
"0000266706" "SERPING1"
"0000266707" "SERPING1"
"0000266716" "SERPING1"
"0000266717" "SERPING1"
"0000266718" "SERPING1"
"0000266719" "SERPING1"
"0000266723" "SERPING1"
"0000266725" "SERPING1"
"0000266726" "SERPING1"
"0000266727" "SERPING1"
"0000266728" "SERPING1"
"0000266729" "SERPING1"
"0000266730" "SERPING1"
"0000266731" "SERPING1"
"0000266732" "SERPING1"
"0000266733" "SERPING1"
"0000266734" "SERPING1"
"0000266735" "SERPING1"
"0000266736" "SERPING1"
"0000266737" "SERPING1"
"0000266738" "SERPING1"
"0000266739" "SERPING1"
"0000266740" "SERPING1"
"0000266742" "SERPING1"
"0000266743" "SERPING1"
"0000266744" "SERPING1"
"0000266745" "SERPING1"
"0000266746" "SERPING1"
"0000266747" "SERPING1"
"0000266748" "SERPING1"
"0000266749" "SERPING1"
"0000266750" "SERPING1"
"0000266751" "SERPING1"
"0000266752" "SERPING1"
"0000266753" "SERPING1"
"0000266754" "SERPING1"
"0000266757" "SERPING1"
"0000266758" "SERPING1"
"0000266759" "SERPING1"
"0000266760" "SERPING1"
"0000266761" "SERPING1"
"0000266762" "SERPING1"
"0000266764" "SERPING1"
"0000266765" "SERPING1"
"0000266766" "SERPING1"
"0000266767" "SERPING1"
"0000266821" "SERPING1"
"0000266824" "SERPING1"
"0000266825" "SERPING1"
"0000266827" "SERPING1"
"0000266828" "SERPING1"
"0000266830" "SERPING1"
"0000266831" "SERPING1"
"0000266832" "SERPING1"
"0000266833" "SERPING1"
"0000266834" "SERPING1"
"0000266835" "SERPING1"
"0000266836" "SERPING1"
"0000266837" "SERPING1"
"0000266839" "SERPING1"
"0000266840" "SERPING1"
"0000266842" "SERPING1"
"0000266843" "SERPING1"
"0000266844" "SERPING1"
"0000266845" "SERPING1"
"0000266865" "SERPING1"
"0000266866" "SERPING1"
"0000266867" "SERPING1"
"0000266868" "SERPING1"
"0000266869" "SERPING1"
"0000266871" "SERPING1"
"0000266872" "SERPING1"
"0000266873" "SERPING1"
"0000266874" "SERPING1"
"0000266875" "SERPING1"
"0000266876" "SERPING1"
"0000266877" "SERPING1"
"0000266878" "SERPING1"
"0000266879" "SERPING1"
"0000266880" "SERPING1"
"0000266881" "SERPING1"
"0000266882" "SERPING1"
"0000266883" "SERPING1"
"0000266884" "SERPING1"
"0000266885" "SERPING1"
"0000266886" "SERPING1"
"0000266957" "SERPING1"
"0000266960" "SERPING1"
"0000266961" "SERPING1"
"0000266962" "SERPING1"
"0000266965" "SERPING1"
"0000266966" "SERPING1"
"0000266967" "SERPING1"
"0000266968" "SERPING1"
"0000266969" "SERPING1"
"0000266972" "SERPING1"
"0000266973" "SERPING1"
"0000266974" "SERPING1"
"0000266975" "SERPING1"
"0000266976" "SERPING1"
"0000266977" "SERPING1"
"0000266978" "SERPING1"
"0000266979" "SERPING1"
"0000266980" "SERPING1"
"0000266981" "SERPING1"
"0000266982" "SERPING1"
"0000266984" "SERPING1"
"0000266985" "SERPING1"
"0000266986" "SERPING1"
"0000266992" "SERPING1"
"0000266993" "SERPING1"
"0000266994" "SERPING1"
"0000266995" "SERPING1"
"0000266996" "SERPING1"
"0000266997" "SERPING1"
"0000267001" "SERPING1"
"0000267005" "SERPING1"
"0000267006" "SERPING1"
"0000267007" "SERPING1"
"0000267008" "SERPING1"
"0000267009" "SERPING1"
"0000267010" "SERPING1"
"0000267011" "SERPING1"
"0000267012" "SERPING1"
"0000267013" "SERPING1"
"0000267014" "SERPING1"
"0000267015" "SERPING1"
"0000267016" "SERPING1"
"0000267018" "SERPING1"
"0000267020" "SERPING1"
"0000267022" "SERPING1"
"0000267036" "SERPING1"
"0000267106" "SERPING1"
"0000267107" "SERPING1"
"0000267108" "SERPING1"
"0000267109" "SERPING1"
"0000267110" "SERPING1"
"0000267224" "SERPING1"
"0000267225" "SERPING1"
"0000267229" "SERPING1"
"0000267230" "SERPING1"
"0000267231" "SERPING1"
"0000267232" "SERPING1"
"0000267233" "SERPING1"
"0000267234" "SERPING1"
"0000267235" "SERPING1"
"0000267236" "SERPING1"
"0000267243" "SERPING1"
"0000267250" "SERPING1"
"0000267251" "SERPING1"
"0000267252" "SERPING1"
"0000267253" "SERPING1"
"0000267254" "SERPING1"
"0000267255" "SERPING1"
"0000267256" "SERPING1"
"0000267257" "SERPING1"
"0000267258" "SERPING1"
"0000267259" "SERPING1"
"0000267260" "SERPING1"
"0000267261" "SERPING1"
"0000267262" "SERPING1"
"0000267264" "SERPING1"
"0000267265" "SERPING1"
"0000267266" "SERPING1"
"0000267269" "SERPING1"
"0000267270" "SERPING1"
"0000267285" "SERPING1"
"0000267287" "SERPING1"
"0000267288" "SERPING1"
"0000267289" "SERPING1"
"0000267290" "SERPING1"
"0000267299" "SERPING1"
"0000267300" "SERPING1"
"0000267301" "SERPING1"
"0000267302" "SERPING1"
"0000267324" "SERPING1"
"0000267326" "SERPING1"
"0000267327" "SERPING1"
"0000267328" "SERPING1"
"0000267337" "SERPING1"
"0000267338" "SERPING1"
"0000267339" "SERPING1"
"0000267340" "SERPING1"
"0000267341" "SERPING1"
"0000267342" "SERPING1"
"0000267343" "SERPING1"
"0000267344" "SERPING1"
"0000267345" "SERPING1"
"0000267346" "SERPING1"
"0000267347" "SERPING1"
"0000267348" "SERPING1"
"0000267349" "SERPING1"
"0000267350" "SERPING1"
"0000267351" "SERPING1"
"0000267352" "SERPING1"
"0000267354" "SERPING1"
"0000267355" "SERPING1"
"0000267356" "SERPING1"
"0000267357" "SERPING1"
"0000267359" "SERPING1"
"0000267363" "SERPING1"
"0000267364" "SERPING1"
"0000267365" "SERPING1"
"0000267366" "SERPING1"
"0000267367" "SERPING1"
"0000267368" "SERPING1"
"0000267369" "SERPING1"
"0000267370" "SERPING1"
"0000267372" "SERPING1"
"0000267373" "SERPING1"
"0000267393" "SERPING1"
"0000267394" "SERPING1"
"0000267395" "SERPING1"
"0000267396" "SERPING1"
"0000267397" "SERPING1"
"0000267399" "SERPING1"
"0000267401" "SERPING1"
"0000267402" "SERPING1"
"0000267403" "SERPING1"
"0000267404" "SERPING1"
"0000267405" "SERPING1"
"0000267406" "SERPING1"
"0000267407" "SERPING1"
"0000267408" "SERPING1"
"0000267409" "SERPING1"
"0000267410" "SERPING1"
"0000267411" "SERPING1"
"0000267418" "SERPING1"
"0000267419" "SERPING1"
"0000267420" "SERPING1"
"0000267421" "SERPING1"
"0000267422" "SERPING1"
"0000267423" "SERPING1"
"0000267424" "SERPING1"
"0000267425" "SERPING1"
"0000267428" "SERPING1"
"0000267429" "SERPING1"
"0000267430" "SERPING1"
"0000267431" "SERPING1"
"0000267433" "SERPING1"
"0000267434" "SERPING1"
"0000267435" "SERPING1"
"0000267437" "SERPING1"
"0000267438" "SERPING1"
"0000267439" "SERPING1"
"0000267440" "SERPING1"
"0000267442" "SERPING1"
"0000267443" "SERPING1"
"0000267444" "SERPING1"
"0000267445" "SERPING1"
"0000267446" "SERPING1"
"0000267447" "SERPING1"
"0000267448" "SERPING1"
"0000267451" "SERPING1"
"0000267452" "SERPING1"
"0000267454" "SERPING1"
"0000267455" "SERPING1"
"0000267456" "SERPING1"
"0000267458" "SERPING1"
"0000267459" "SERPING1"
"0000267460" "SERPING1"
"0000267461" "SERPING1"
"0000267462" "SERPING1"
"0000267463" "SERPING1"
"0000267464" "SERPING1"
"0000267465" "SERPING1"
"0000267466" "SERPING1"
"0000267467" "SERPING1"
"0000267468" "SERPING1"
"0000267469" "SERPING1"
"0000267472" "SERPING1"
"0000267482" "SERPING1"
"0000267484" "SERPING1"
"0000267486" "SERPING1"
"0000267487" "SERPING1"
"0000267488" "SERPING1"
"0000267489" "SERPING1"
"0000267490" "SERPING1"
"0000267491" "SERPING1"
"0000267492" "SERPING1"
"0000267493" "SERPING1"
"0000267494" "SERPING1"
"0000267495" "SERPING1"
"0000267496" "SERPING1"
"0000267497" "SERPING1"
"0000267498" "SERPING1"
"0000267499" "SERPING1"
"0000267500" "SERPING1"
"0000267501" "SERPING1"
"0000267504" "SERPING1"
"0000267506" "SERPING1"
"0000267588" "SERPING1"
"0000267612" "SERPING1"
"0000267755" "SERPING1"
"0000267786" "SERPING1"
"0000267787" "SERPING1"
"0000267789" "SERPING1"
"0000267790" "SERPING1"
"0000267791" "SERPING1"
"0000267792" "SERPING1"
"0000267793" "SERPING1"
"0000267794" "SERPING1"
"0000267795" "SERPING1"
"0000267797" "SERPING1"
"0000267798" "SERPING1"
"0000267799" "SERPING1"
"0000267800" "SERPING1"
"0000268143" "SERPING1"
"0000268144" "SERPING1"
"0000268145" "SERPING1"
"0000268146" "SERPING1"
"0000268147" "SERPING1"
"0000268148" "SERPING1"
"0000268149" "SERPING1"
"0000268150" "SERPING1"
"0000268151" "SERPING1"
"0000268154" "SERPING1"
"0000268168" "SERPING1"
"0000268169" "SERPING1"
"0000268170" "SERPING1"
"0000268171" "SERPING1"
"0000268172" "SERPING1"
"0000268173" "SERPING1"
"0000268369" "SERPING1"
"0000268370" "SERPING1"
"0000268371" "SERPING1"
"0000268372" "SERPING1"
"0000268379" "SERPING1"
"0000268380" "SERPING1"
"0000268381" "SERPING1"
"0000268382" "SERPING1"
"0000270235" "SERPING1"
"0000270236" "SERPING1"
"0000270240" "SERPING1"
"0000270241" "SERPING1"
"0000270243" "SERPING1"
"0000270434" "SERPING1"
"0000270435" "SERPING1"
"0000270436" "SERPING1"
"0000270437" "SERPING1"
"0000270455" "SERPING1"
"0000276849" "SERPING1"
"0000276850" "SERPING1"
"0000276851" "SERPING1"
"0000277094" "SERPING1"
"0000277150" "SERPING1"
"0000277257" "SERPING1"
"0000304292" "SERPING1"
"0000311758" "SERPING1"
"0000312246" "SERPING1"
"0000312247" "SERPING1"
"0000312349" "SERPING1"
"0000312544" "SERPING1"
"0000315116" "SERPING1"
"0000315821" "SERPING1"
"0000321555" "SERPING1"
"0000321556" "SERPING1"
"0000321558" "SERPING1"
"0000321559" "SERPING1"
"0000321560" "SERPING1"
"0000321616" "SERPING1"
"0000321617" "SERPING1"
"0000321618" "SERPING1"
"0000321633" "SERPING1"
"0000325328" "SERPING1"
"0000325329" "SERPING1"
"0000325331" "SERPING1"
"0000325333" "SERPING1"
"0000325334" "SERPING1"
"0000325484" "SERPING1"
"0000325485" "SERPING1"
"0000325486" "SERPING1"
"0000325487" "SERPING1"
"0000325488" "SERPING1"
"0000325489" "SERPING1"
"0000325576" "SERPING1"
"0000325585" "SERPING1"
"0000328698" "SERPING1"
"0000328700" "SERPING1"
"0000328701" "SERPING1"
"0000329762" "SERPING1"
"0000329763" "SERPING1"
"0000330227" "SERPING1"
"0000330228" "SERPING1"
"0000330353" "SERPING1"
"0000330354" "SERPING1"
"0000330382" "SERPING1"
"0000332456" "SERPING1"
"0000332457" "SERPING1"
"0000332821" "SERPING1"
"0000333650" "SERPING1"
"0000333774" "SERPING1"
"0000333775" "SERPING1"
"0000360848" "SERPING1"
"0000362958" "SERPING1"
"0000362959" "SERPING1"
"0000362960" "SERPING1"
"0000362961" "SERPING1"
"0000362962" "SERPING1"
"0000362974" "SERPING1"
"0000362975" "SERPING1"
"0000362990" "SERPING1"
"0000362991" "SERPING1"
"0000362995" "SERPING1"
"0000362996" "SERPING1"
"0000362997" "SERPING1"
"0000362999" "SERPING1"
"0000363000" "SERPING1"
"0000363001" "SERPING1"
"0000363002" "SERPING1"
"0000363004" "SERPING1"
"0000363005" "SERPING1"
"0000363031" "PLG"
"0000363120" "SERPING1"
"0000363137" "SERPING1"
"0000363138" "SERPING1"
"0000363139" "SERPING1"
"0000363260" "SERPING1"
"0000363261" "SERPING1"
"0000363262" "SERPING1"
"0000363263" "SERPING1"
"0000363264" "SERPING1"
"0000364712" "SERPING1"
"0000364713" "SERPING1"
"0000364714" "SERPING1"
"0000364715" "SERPING1"
"0000364721" "SERPING1"
"0000364722" "SERPING1"
"0000364723" "SERPING1"
"0000364724" "SERPING1"
"0000364725" "SERPING1"
"0000364726" "SERPING1"
"0000364990" "SERPING1"
"0000364991" "SERPING1"
"0000375029" "SERPING1"
"0000377330" "SERPING1"
"0000377332" "SERPING1"
"0000380890" "SERPING1"
"0000380893" "SERPING1"
"0000380894" "SERPING1"
"0000380895" "SERPING1"
"0000380896" "SERPING1"
"0000380897" "SERPING1"
"0000380898" "SERPING1"
"0000380899" "SERPING1"
"0000380900" "SERPING1"
"0000380924" "SERPING1"
"0000380925" "SERPING1"
"0000380926" "SERPING1"
"0000380927" "SERPING1"
"0000380928" "SERPING1"
"0000380929" "SERPING1"
"0000380930" "SERPING1"
"0000380932" "SERPING1"
"0000380933" "SERPING1"
"0000380934" "SERPING1"
"0000380935" "SERPING1"
"0000380936" "SERPING1"
"0000380937" "SERPING1"
"0000380938" "SERPING1"
"0000380939" "SERPING1"
"0000380940" "SERPING1"
"0000380941" "SERPING1"
"0000380942" "SERPING1"
"0000380943" "SERPING1"
"0000380944" "SERPING1"
"0000381371" "SERPING1"
"0000384181" "SERPING1"
"0000385780" "SERPING1"
"0000385783" "SERPING1"
"0000385834" "SERPING1"
"0000385835" "SERPING1"
"0000385836" "SERPING1"
"0000388585" "SERPING1"
"0000388596" "SERPING1"
"0000388634" "SERPING1"
"0000388635" "SERPING1"
"0000392738" "SERPING1"
"0000394011" "SERPING1"
"0000399481" "SERPING1"
"0000399892" "SERPING1"
"0000404088" "SERPING1"
"0000406100" "SERPING1"
"0000406696" "SERPING1"
"0000406699" "SERPING1"
"0000406700" "SERPING1"
"0000406701" "SERPING1"
"0000406702" "SERPING1"
"0000407044" "SERPING1"
"0000407927" "SERPING1"
"0000407977" "SERPING1"
"0000407978" "SERPING1"
"0000407979" "SERPING1"
"0000407982" "SERPING1"
"0000410046" "SERPING1"
"0000418282" "SERPING1"
"0000418284" "SERPING1"
"0000418285" "SERPING1"
"0000418287" "SERPING1"
"0000418289" "SERPING1"
"0000418538" "SERPING1"
"0000418539" "SERPING1"
"0000418540" "SERPING1"
"0000418541" "SERPING1"
"0000418543" "SERPING1"
"0000418544" "SERPING1"
"0000418545" "SERPING1"
"0000418578" "SERPING1"
"0000418579" "SERPING1"
"0000418580" "SERPING1"
"0000418581" "SERPING1"
"0000418582" "SERPING1"
"0000418583" "SERPING1"
"0000418584" "SERPING1"
"0000418585" "SERPING1"
"0000418586" "SERPING1"
"0000418587" "SERPING1"
"0000418588" "SERPING1"
"0000418589" "SERPING1"
"0000418621" "SERPING1"
"0000418622" "SERPING1"
"0000418623" "SERPING1"
"0000418624" "SERPING1"
"0000418625" "SERPING1"
"0000418627" "SERPING1"
"0000418628" "SERPING1"
"0000418629" "SERPING1"
"0000418630" "SERPING1"
"0000418631" "SERPING1"
"0000418632" "SERPING1"
"0000418633" "SERPING1"
"0000418634" "SERPING1"
"0000418635" "SERPING1"
"0000418636" "SERPING1"
"0000418637" "SERPING1"
"0000418638" "SERPING1"
"0000418639" "SERPING1"
"0000418640" "SERPING1"
"0000418641" "SERPING1"
"0000418642" "SERPING1"
"0000418643" "SERPING1"
"0000418722" "SERPING1"
"0000418724" "SERPING1"
"0000418726" "SERPING1"
"0000418729" "SERPING1"
"0000418730" "SERPING1"
"0000418731" "SERPING1"
"0000418732" "SERPING1"
"0000418733" "SERPING1"
"0000419160" "SERPING1"
"0000424537" "SERPING1"
"0000424538" "SERPING1"
"0000424539" "SERPING1"
"0000424540" "SERPING1"
"0000424541" "SERPING1"
"0000426101" "SERPING1"
"0000426102" "SERPING1"
"0000426260" "SERPING1"
"0000426327" "SERPING1"
"0000426328" "SERPING1"
"0000426329" "SERPING1"
"0000427080" "SERPING1"
"0000427090" "SERPING1"
"0000427102" "SERPING1"
"0000427117" "SERPING1"
"0000427118" "SERPING1"
"0000427119" "SERPING1"
"0000427705" "SERPING1"
"0000427706" "SERPING1"
"0000427707" "SERPING1"
"0000427708" "SERPING1"
"0000427709" "SERPING1"
"0000427710" "SERPING1"
"0000427711" "SERPING1"
"0000427712" "SERPING1"
"0000427713" "SERPING1"
"0000428987" "SERPING1"
"0000429155" "SERPING1"
"0000429788" "SERPING1"
"0000429789" "SERPING1"
"0000429815" "SERPING1"
"0000429816" "SERPING1"
"0000429817" "SERPING1"
"0000429818" "SERPING1"
"0000429824" "SERPING1"
"0000431678" "SERPING1"
"0000432572" "SERPING1"
"0000435570" "SERPING1"
"0000436115" "SERPING1"
"0000436116" "SERPING1"
"0000436118" "SERPING1"
"0000436122" "SERPING1"
"0000436124" "SERPING1"
"0000436125" "SERPING1"
"0000436126" "SERPING1"
"0000436478" "SERPING1"
"0000436633" "SERPING1"
"0000436796" "SERPING1"
"0000437884" "SERPING1"
"0000437885" "SERPING1"
"0000437886" "SERPING1"
"0000437887" "SERPING1"
"0000437888" "SERPING1"
"0000437889" "SERPING1"
"0000437890" "SERPING1"
"0000437891" "SERPING1"
"0000437897" "SERPING1"
"0000437898" "SERPING1"
"0000437966" "SERPING1"
"0000438118" "SERPING1"
"0000444096" "SERPING1"
"0000445189" "SERPING1"
"0000445575" "SERPING1"
"0000446600" "SERPING1"
"0000449945" "SERPING1"
"0000449976" "SERPING1"
"0000449977" "SERPING1"
"0000449978" "SERPING1"
"0000449979" "SERPING1"
"0000449998" "SERPING1"
"0000449999" "SERPING1"
"0000450000" "SERPING1"
"0000450060" "SERPING1"
"0000450061" "SERPING1"
"0000450062" "SERPING1"
"0000450063" "SERPING1"
"0000450064" "SERPING1"
"0000450065" "SERPING1"
"0000450066" "SERPING1"
"0000451159" "SERPING1"
"0000453669" "SERPING1"
"0000453670" "SERPING1"
"0000453688" "SERPING1"
"0000453689" "SERPING1"
"0000453702" "SERPING1"
"0000453704" "SERPING1"
"0000453705" "SERPING1"
"0000453706" "SERPING1"
"0000453707" "SERPING1"
"0000453710" "SERPING1"
"0000453711" "SERPING1"
"0000453712" "SERPING1"
"0000453713" "SERPING1"
"0000453714" "SERPING1"
"0000453715" "SERPING1"
"0000453716" "SERPING1"
"0000453717" "SERPING1"
"0000453718" "SERPING1"
"0000453719" "SERPING1"
"0000453720" "SERPING1"
"0000453721" "SERPING1"
"0000453869" "SERPING1"
"0000453871" "SERPING1"
"0000453872" "SERPING1"
"0000453873" "SERPING1"
"0000453874" "SERPING1"
"0000453875" "SERPING1"
"0000453876" "SERPING1"
"0000453877" "SERPING1"
"0000453924" "SERPING1"
"0000453925" "SERPING1"
"0000453926" "SERPING1"
"0000453927" "SERPING1"
"0000453928" "SERPING1"
"0000453929" "SERPING1"
"0000453930" "SERPING1"
"0000456301" "SERPING1"
"0000456302" "SERPING1"
"0000456303" "SERPING1"
"0000456306" "SERPING1"
"0000459602" "SERPING1"
"0000459607" "SERPING1"
"0000459611" "SERPING1"
"0000459615" "SERPING1"
"0000459616" "SERPING1"
"0000459617" "SERPING1"
"0000459618" "SERPING1"
"0000459619" "SERPING1"
"0000459620" "SERPING1"
"0000459621" "SERPING1"
"0000459622" "SERPING1"
"0000459623" "SERPING1"
"0000459624" "SERPING1"
"0000459625" "SERPING1"
"0000459645" "SERPING1"
"0000459646" "SERPING1"
"0000459654" "SERPING1"
"0000459662" "SERPING1"
"0000459663" "SERPING1"
"0000459666" "SERPING1"
"0000459667" "SERPING1"
"0000459668" "SERPING1"
"0000459669" "SERPING1"
"0000459670" "SERPING1"
"0000459671" "SERPING1"
"0000459672" "SERPING1"
"0000459673" "SERPING1"
"0000459675" "SERPING1"
"0000459676" "SERPING1"
"0000459677" "SERPING1"
"0000459678" "SERPING1"
"0000459679" "SERPING1"
"0000459681" "SERPING1"
"0000459682" "SERPING1"
"0000459683" "SERPING1"
"0000459684" "SERPING1"
"0000459685" "SERPING1"
"0000459686" "SERPING1"
"0000459687" "SERPING1"
"0000459688" "SERPING1"
"0000459689" "SERPING1"
"0000459690" "SERPING1"
"0000459691" "SERPING1"
"0000459692" "SERPING1"
"0000459693" "SERPING1"
"0000459694" "SERPING1"
"0000459695" "SERPING1"
"0000459696" "SERPING1"
"0000459699" "SERPING1"
"0000459700" "SERPING1"
"0000459701" "SERPING1"
"0000459702" "SERPING1"
"0000459703" "SERPING1"
"0000459704" "SERPING1"
"0000459705" "SERPING1"
"0000459706" "SERPING1"
"0000459708" "SERPING1"
"0000459709" "SERPING1"
"0000459710" "SERPING1"
"0000459711" "SERPING1"
"0000459712" "SERPING1"
"0000459716" "SERPING1"
"0000459724" "SERPING1"
"0000459794" "SERPING1"
"0000459867" "SERPING1"
"0000461149" "SERPING1"
"0000461422" "SERPING1"
"0000462204" "SERPING1"
"0000462220" "SERPING1"
"0000463860" "SERPING1"
"0000463862" "SERPING1"
"0000463864" "SERPING1"
"0000463865" "SERPING1"
"0000463922" "SERPING1"
"0000466060" "SERPING1"
"0000466061" "SERPING1"
"0000466062" "SERPING1"
"0000466064" "SERPING1"
"0000466065" "SERPING1"
"0000466066" "SERPING1"
"0000466067" "SERPING1"
"0000466068" "SERPING1"
"0000466157" "SERPING1"
"0000466215" "SERPING1"
"0000466216" "SERPING1"
"0000466270" "SERPING1"
"0000466962" "SERPING1"
"0000467715" "SERPING1"
"0000468032" "SERPING1"
"0000468033" "SERPING1"
"0000468035" "SERPING1"
"0000468036" "SERPING1"
"0000468037" "SERPING1"
"0000468038" "SERPING1"
"0000468251" "SERPING1"
"0000468252" "SERPING1"
"0000468253" "SERPING1"
"0000468254" "SERPING1"
"0000468278" "SERPING1"
"0000468279" "SERPING1"
"0000468540" "SERPING1"
"0000468541" "SERPING1"
"0000468542" "SERPING1"
"0000468543" "SERPING1"
"0000468810" "SERPING1"
"0000469685" "SERPING1"
"0000470108" "PLG"
"0000471200" "SERPING1"
"0000471209" "SERPING1"
"0000471807" "SERPING1"
"0000471808" "SERPING1"
"0000472038" "SERPING1"
"0000472039" "SERPING1"
"0000473170" "SERPING1"
"0000473649" "SERPING1"
"0000473650" "SERPING1"
"0000473853" "SERPING1"
"0000474099" "SERPING1"
"0000476026" "SERPING1"
"0000476028" "SERPING1"
"0000476548" "SERPING1"
"0000478783" "SERPING1"
"0000478856" "SERPING1"
"0000478857" "SERPING1"
"0000478858" "SERPING1"
"0000478860" "SERPING1"
"0000478861" "SERPING1"
"0000478862" "SERPING1"
"0000478863" "SERPING1"
"0000478864" "SERPING1"
"0000480159" "SERPING1"
"0000481645" "SERPING1"
"0000481648" "SERPING1"
"0000481649" "SERPING1"
"0000481710" "SERPING1"
"0000482766" "SERPING1"
"0000483671" "SERPING1"
"0000483672" "SERPING1"
"0000483673" "SERPING1"
"0000485798" "SERPING1"
"0000486472" "SERPING1"
"0000486473" "SERPING1"
"0000486474" "SERPING1"
"0000486475" "SERPING1"
"0000486476" "SERPING1"
## Variants_On_Genome ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Count = 1309
"{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}"
"0000248233" "0" "10" "11" "57379170" "57379170" "subst" "0.582149" "02325" "SERPING1_000005" "g.57379170A>G" "0.6056 (gnomAD v3)" "" "" "SERPING1(NM_000062.2):c.1030-20A>G, SERPING1(NM_000062.3):c.1030-20A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "rs2511988" "0" "" "" "g.57611697A>G" "" "benign" ""
"0000250936" "0" "10" "11" "57379170" "57379170" "subst" "0.582149" "02326" "SERPING1_000005" "g.57379170A>G" "" "" "" "SERPING1(NM_000062.2):c.1030-20A>G, SERPING1(NM_000062.3):c.1030-20A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.57611697A>G" "" "benign" "ACMG"
"0000295754" "0" "90" "11" "57365748" "57365748" "subst" "0.00128084" "02330" "SERPING1_000002" "g.57365748C>T" "0.0009841 (gnomAD v3)" "" "" "SERPING1(NM_000062.2):c.5C>T (p.A2V), SERPING1(NM_000062.3):c.5C>T (p.A2V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "rs185342631" "0" "" "" "g.57598275C>T" "{CV:000305016}" "pathogenic" ""
"0000298124" "0" "10" "11" "57381989" "57381989" "subst" "0.223181" "02325" "SERPING1_000007" "g.57381989G>A" "" "" "" "SERPING1(NM_000062.2):c.1438G>A (p.V480M), SERPING1(NM_000062.3):c.1438G>A (p.V480M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.57614516G>A" "" "benign" ""
"0000302048" "0" "33" "11" "57365723" "57365723" "subst" "0.0289261" "02326" "SERPING1_000001" "g.57365723T>C" "0.029081 (GnomAD_exome); 0.030270 (TOPMed)" "{DOI:Duponchel 2006:10.1002/humu.9414} {DOI:Ponard 2019:10.1002/humu.23917}" "" "SERPING1(NM_000062.2):c.-21T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "no" "rs28362944" "0" "" "" "g.57598250T>C" "{CV-SCV:000372547.3}" "likely benign" "ACMG"
"0000302049" "0" "70" "11" "57379193" "57379193" "subst" "0" "02326" "SERPING1_000006" "g.57379193G>T" "" "" "" "SERPING1(NM_000062.2):c.1033G>T (p.G345W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.57611720G>T" "" "likely pathogenic" ""
"0000302050" "0" "10" "11" "57381989" "57381989" "subst" "0.223181" "02326" "SERPING1_000007" "g.57381989G>A" "" "" "" "SERPING1(NM_000062.2):c.1438G>A (p.V480M), SERPING1(NM_000062.3):c.1438G>A (p.V480M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "rs4926" "0" "" "" "g.57614516G>A" "{CV:000254786}" "benign" ""
"0000302051" "0" "99" "11" "57382031" "57382031" "subst" "0" "02326" "SERPING1_000008" "g.57382031C>T" "" "" "" "SERPING1(NM_000062.2):c.1480C>T (p.R494*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.57614558C>T" "" "pathogenic" ""
"0000302052" "0" "30" "11" "57373548" "57373548" "subst" "0.00551838" "02326" "SERPING1_000004" "g.57373548C>T" "" "" "" "SERPING1(NM_000062.2):c.751C>T (p.L251=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.57606075C>T" "" "likely benign" ""
"0000307916" "0" "35" "11" "57367347" "57367347" "subst" "0" "01943" "SERPING1_000003" "g.57367347C>T" "0.000024 (TOPMED)" "" "" "SERPING1(NM_000062.2):c.52-5C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "rs1026657804" "0" "" "" "g.57599874C>T" "{CV-SCV:003001332.2} {CV-SCV:005088169.1}" "likely benign" ""
"0000338430" "0" "13" "11" "57365723" "57365723" "subst" "0.0289261" "02327" "SERPING1_000001" "g.57365723T>C" "0.02908" "" "" "SERPING1(NM_000062.2):c.-21T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "rs28362944" "0" "" "" "g.57598250T>C" "" "benign" "ACMG"
"0000350562" "0" "11" "11" "57381989" "57381989" "subst" "0.223181" "02327" "SERPING1_000007" "g.57381989G>A" "0.22195 (gnomAD, exomes)" "{DOI:Bock 1986:10.1021/bi00363a018} {DOI:Cumming 2003:10.1136/jmg.40.10.e114} {DOI:Elngar 2022:10.3389/fped.2022.779511}" "" "SERPING1(NM_000062.2):c.1438G>A (p.V480M), SERPING1(NM_000062.3):c.1438G>A (p.V480M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "rs4926" "0" "" "" "g.57614516G>A" "{CV:000254786}" "benign" "ACMG"
"0000351291" "0" "10" "11" "57379170" "57379170" "subst" "0.582149" "02327" "SERPING1_000005" "g.57379170A>G" "" "" "" "SERPING1(NM_000062.2):c.1030-20A>G, SERPING1(NM_000062.3):c.1030-20A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.57611697A>G" "" "benign" ""
"0000472588" "0" "99" "11" "57367534" "57367535" "ins" "0" "03256" "SERPING1_000033" "g.57367534_57367535insCCACTATACC" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "234_235insCCACTATACC" "insCCACTATACC has been introduced between two flanking nucleotides" "Germline" "yes" "" "0" "" "" "g.57600061_57600062insCCACTATACC" "" "pathogenic" "ACMG"
"0000472589" "0" "99" "11" "57367570" "57367570" "del" "0" "03256" "SERPING1_000034" "g.57367570del" "" "{DOI:Roche 2005: 10.1002/humu.20197} {DOI:Ponard 2019:10.1002/humu.23917}" "" "270delT" "Variant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "" "0" "" "" "g.57600097del" "" "pathogenic" "ACMG"
"0000472590" "0" "99" "11" "57367591" "57367595" "del" "0" "03256" "SERPING1_000035" "g.57367591_57367595del" "" "{DOI:Roche 2005:10.1002/humu.20197} {DOI:Ponard 2019:10.1002/humu.23917}" "" "291_295delACCCA" "variant found in a de novo condition\r\nVariant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "De novo" "" "" "0" "" "" "g.57600118_57600122del" "" "pathogenic" "ACMG"
"0000472592" "0" "99" "11" "57367601" "57367601" "del" "0" "03256" "SERPING1_000036" "g.57367601del" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "300delC" "" "Germline" "yes" "" "0" "" "" "g.57600128del" "" "pathogenic" "ACMG"
"0000472593" "0" "99" "11" "57367612" "57367612" "dup" "0" "03256" "SERPING1_000037" "g.57367612dup" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "312dupA" "According to the published information, the c.312dupA variant in SERPING1 meets ACMG/ClinGen SVI criteria to be classified as pathogenic: PVS1, PP4_Str, PS4_Mod, PM2_Sup" "Germline" "yes" "rs2495426038" "0" "" "" "g.57600139dup" "{CV-SCV:005061391.1}" "pathogenic" "ACMG"
"0000472594" "0" "99" "11" "57367666" "57367667" "dup" "0" "03256" "SERPING1_000038" "g.57367666_57367667dup" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "366_367dupCT" "Erroneously identified as c.367_368insCT" "Germline" "yes" "" "0" "" "" "g.57600193_57600194dup" "" "pathogenic" "ACMG"
"0000472595" "0" "99" "11" "57367690" "57367690" "subst" "0" "03256" "SERPING1_000039" "g.57367690C>G" "<0.0001" "{DOI:Ponard 2019:10.1002/humu.23917} {DOI:Loli‐Ausejo 2021:10.1007/s12016-021-08834-9} {DOI:Ren 2023:10.1016/j.jaci.2022.11.027}" "" "" "Cys130 position is located out of the serpin structure, but destroys the disulfide with Cys183 suggesting an unstable serpin, then classifying p.(Cys130Trp) within class III.\r\nRecombinant investigation shows a defective C1-INH expression (Ren et al 2023).\r\nIntroduced in ClinVar as a VUS by LabCorp, San Francisco CA." "Germline" "yes" "rs2495426358" "0" "" "" "g.57600217C>G" "{CV-SCV:004261771.1}" "likely pathogenic" ""
"0000472596" "0" "99" "11" "57367703" "57367704" "del" "0" "03256" "SERPING1_000040" "g.57367703_57367704del" "" "{DOI:Ponard 2019:10.1002/humu.23917} {DOI:Hashimura 2021:10.1111/all.15034} {DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "403_404delAG" "Erroneously identified as c.401_402del.\r\nThe c.403_404del variant in SERPING1 meets ACMG/ClinGen criteria to be classified as pathogenic: PVS1, PP4_Str, PS4_Mod, PM2_Sup, PP1." "Germline" "yes" "" "0" "" "" "g.57600230_57600231del" "{CV-SCV:005093813.1}" "pathogenic" "ACMG"
"0000472597" "0" "99" "11" "57367730" "57367730" "del" "0" "03256" "SERPING1_000041" "g.57367730del" "" "{DOI:Roche 2005:10.1002/humu.20197} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Mendoza-Alvarez 2026:10.21203/rs.3.rs-10662999/v1}" "" "430delG" "The c.430delG variant in SERPING1 meets ACMG/ClinGen criteria to be classified as pathogenic: PVS1, PP4_Str, PS4_Mod, PM2_Sup, PP1.\r\nVariant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "rs1565169693" "0" "" "" "g.57600257del" "{CV-SCV:005186228.1}" "pathogenic" "ACMG"
"0000472598" "0" "99" "11" "57367743" "57367744" "del" "0" "03256" "SERPING1_000042" "g.57367743_57367744del" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "443_444delAT" "" "Germline" "yes" "" "0" "" "" "g.57600270_57600271del" "" "pathogenic" "ACMG"
"0000472599" "0" "97" "11" "57367752" "57367752" "subst" "0" "03256" "SERPING1_000043" "g.57367752T>G" "" "{DOI:Ghannam 2015:10.1111/all.12657} {DOI:Ponard 2019:10.1002/humu.23917}" "" "" "p.(Leu151Arg) C1-INH product: Unexpected normal control of the Kallikrein-Kinin System with a loss of control of C1s protease (Ghannam 2015): non-inhibitory C1INH variant with altered exposure of the active site" "Germline" "" "" "0" "" "" "g.57600279T>G" "" "pathogenic" ""
"0000472600" "0" "99" "11" "57367758" "57367758" "subst" "0" "03256" "SERPING1_000044" "g.57367758T>C" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "" "Variant meets ACMG a likely pathogenic criterion according to PM1, PM2, PP3_Str, PP5" "Germline" "yes" "" "0" "" "" "g.57600285T>C" "" "likely pathogenic" "ACMG"
"0000472601" "0" "99" "11" "57367762" "57367762" "subst" "0" "03256" "SERPING1_000045" "g.57367762C>G" "" "{DOI:Roche 2005:10.1002/humu.20197} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Loli-Ausejo 2021:10.1007/s12016-021-08834-9}" "" "" "Variant expected to result in an absent or disrupted protein product; therefore loss-of-function variants in SERPING1 are known to be pathogenic.\r\nVariant submitted to ClinVar as pathogenic by InVitae, San Francisco CA.\r\nVariant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "" "rs371834047" "0" "" "" "g.57600289C>G" "{CV-SCV:004294831.1}" "pathogenic" "ACMG"
"0000472602" "0" "99" "11" "57367797" "57367797" "subst" "0" "03256" "SERPING1_000046" "g.57367797A>T" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "" "Variant at a highly conserved position among serpins (Asn144: β-sheet B, s1B; shutter/gate).\r\nAsn144 makes extensive bonding and subsequent network with C-terminus residues 474 to 478" "Germline" "yes" "" "0" "" "" "g.57600324A>T" "" "pathogenic" "ACMG"
"0000472603" "0" "99" "11" "57367801" "57367825" "dup" "0" "03256" "SERPING1_000047" "g.57367801_57367825dup" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "501_525dupGGCCTTTTCCCCATTCAGCATCGCC" "" "Germline" "yes" "" "0" "" "" "g.57600328_57600352dup" "" "pathogenic" "ACMG"
"0000472604" "0" "99" "11" "57367802" "57367802" "subst" "0" "03256" "SERPING1_000048" "g.57367802G>A" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "" "Variant c.502G>A is associated with p.(Ala168Thr) with an indication of a polymorphism by MutationTaster (0.861)" "Germline" "yes" "" "0" "" "" "g.57600329G>A" "" "likely pathogenic" ""
"0000472605" "0" "99" "11" "57367816" "57367817" "ins" "0" "03256" "SERPING1_000049" "g.57367816_57367817insT" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57600343_57600344insT" "" "pathogenic" "ACMG"
"0000472606" "0" "99" "11" "57367823" "57367823" "subst" "0" "03256" "SERPING1_000050" "g.57367823G>C" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "" "variant found in a de novo situation with non-carrying parents" "De novo" "" "" "0" "" "" "g.57600350G>C" "" "pathogenic" "ACMG"
"0000472607" "0" "99" "11" "57367850" "57367850" "subst" "0" "03256" "SERPING1_000051" "g.57367850G>T" "" "{DOI:Grodecká 2017:10.1016/j.clim.2017.03.010} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Wang 2022:10.1186/s41065-022-00242-z} {DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "" "c.550G>T" "Gly162, located at the end of helix B, shutter domain, is a conserved residue among serpins (80%), forms tight turn and packs against conserved position Phe214\r\nProtein change with p.Asp18Glyfs*26 or p.Gly184Cysfs*72 (NMD?).\r\nc.550G>T affects the last nt of exon 3, with subsequent splicing defect and 95% skipping of exon 3, experimental demonstration by Grodecká 2017.\r\nVariant submitted to ClinVar as likely pathogenic by InVitae, San Francisco CA" "Germline" "yes" "" "0" "" "" "g.57600377G>T" "{CV-SCV:003439798.2}" "pathogenic" "ACMG"
"0000472608" "0" "99" "11" "57369546" "57369546" "subst" "0" "03256" "SERPING1_000052" "g.57369546C>G" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "" "Leu175 residue is a highly conserved position within serpins (75%); located at the C-terminus of helix C, in the shutter region.\r\nThe 3D-stucture shows that Leu175 is within a buried hydrophobic and packs against the conserved Phe 214.\r\nIn silico analysis predicts this variant is probably damaging to the protein structure/function.\r\nIntroduced in ClinVar by Labcorp Genetics, San Francisco CA, as a VUS." "Germline" "yes" "rs1064793266" "0" "" "" "g.57602073C>G" "{CV:000418485}" "likely pathogenic" "ACMG"
"0000472609" "0" "99" "11" "57369547" "57369547" "subst" "0" "03256" "SERPING1_000053" "g.57369547T>C" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "" "Leu175 residue in the mature protein sequence is the C-terminus of helix C, shutter functional domain. It likely packs against conserved Leu156 residue of helix B.\r\nThis position is highly conserved (75%) in the serpins." "Germline" "yes" "" "0" "" "" "g.57602074T>C" "" "pathogenic" ""
"0000472610" "0" "99" "11" "57369554" "57369554" "subst" "0" "03256" "SERPING1_000054" "g.57369554C>A" "" "{DOI:Ponard 2019:10.1002/humu.23917} {DOI:Loli‐Ausejo 2021:10.1007/s12016-021-08834-9}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57602081C>A" "" "pathogenic" "ACMG"
"0000472611" "0" "99" "11" "57369570" "57369570" "subst" "0" "03256" "SERPING1_000055" "g.57369570T>C" "" "{DOI:Ponard 2019:10.1002/humu.23917} {DOI:Mendoza-Alvarez 2022:10.3389/fimmu.2022.997148} {DOI:Mendoza-Alvarez 2026:10.21203/rs.3.rs-10662999/v1}" "" "" "The p.(Cys205Arg) variant presents with a disrupted Cys130–Cys205 disulfide bond.\r\nThe c.613T>C variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PS4_Mod, PM5, PP3_Mod, PP4_Mod, PM2_Sup, PP2." "Germline" "yes" "rs2495431072" "0" "" "" "g.57602097T>C" "{CV-SCV:005088176.1}" "likely pathogenic" "ACMG"
"0000472612" "0" "77" "11" "57369598" "57369598" "subst" "4.87341E-5" "03256" "SERPING1_000056" "g.57369598C>T" "0.00001" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "" "c.641C>T variant is found in less than 1 in 134576 (ALFA relase version #20201027095038). \r\nAdditional evidences must be provided to attributed a pathogenicity for this variant." "Germline" "" "rs61754492" "0" "" "" "g.57602125C>T" "{CV-SCV:004735100.2}" "VUS" "ACMG"
"0000472613" "0" "99" "11" "57369616" "57369616" "subst" "0" "03256" "SERPING1_000057" "g.57369616C>A" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57602143C>A" "" "pathogenic" "ACMG"
"0000472614" "0" "99" "11" "57369621" "57369621" "subst" "0" "03256" "SERPING1_000058" "g.57369621T>C" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "" "" "De novo" "yes" "" "0" "" "" "g.57602148T>C" "" "pathogenic" "ACMG"
"0000472615" "3" "97" "11" "57369625" "57369625" "subst" "0" "03256" "SERPING1_000059" "g.57369625A>C" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "[668A>C];[668A>C]" "Homozygous situation of the symptomatic proband; asymptomatic relatives." "Germline" "" "" "0" "" "" "g.57602152A>C" "" "pathogenic (recessive)" "ACMG"
"0000472617" "0" "99" "11" "57369633" "57369633" "subst" "0" "03256" "SERPING1_000060" "g.57369633C>G" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57602160C>G" "" "pathogenic" ""
"0000472618" "0" "99" "11" "57369647" "57369647" "subst" "0" "03256" "SERPING1_000061" "g.57369647G>A" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "" "Donor splicing site loss" "Germline" "yes" "" "0" "" "" "g.57602174G>A" "" "pathogenic" "ACMG"
"0000472619" "0" "99" "11" "57369647" "57369647" "subst" "0" "03256" "SERPING1_000062" "g.57369647G>T" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "" "Donor splice site loss" "Germline" "yes" "" "0" "" "" "g.57602174G>T" "" "pathogenic" "ACMG"
"0000472620" "0" "99" "11" "57373476" "57373476" "subst" "0" "03256" "SERPING1_000063" "g.57373476C>G" "" "{DOI:Ponard 2019:10.1002/humu.23917} {DOI:Grombirikova 2023:10.1007/s10875-023-01565-w} {DOI:Kron 2023:10.1136/bcr-2023-257212}" "" "" "Potential acceptor splice site loss and predicted alternate acceptor splice site gain (in silico SpliceAI).\r\nEstablished impairment of C1-INH expression: a 6-bp longer transcript using a de novo created acceptor splice site, with aberrant and normal transcripts, which corresponds to complete impairment caused by the c.686-7C>G variant. The variant preserves a reading frame and leads to incorporation of additional two amino acids Pro-Ala into the polypeptide chain.\r\nThe variant meets ACMG criteria to be considered likely pathogenic: PM2, PP3_Str" "Germline" "yes" "rs1360867871" "0" "" "" "g.57606003C>G" "{CV-SCV:003236477.3}" "likely pathogenic" "ACMG"
"0000472622" "0" "99" "11" "57373498" "57373502" "del" "0" "03256" "SERPING1_000011" "g.57373498_57373502del" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "701_705delACACC" "variant c.701_705delACACC carried by a single individual" "Germline" "yes" "" "0" "" "" "g.57606025_57606029del" "" "pathogenic" "ACMG"
"0000472623" "0" "99" "11" "57373559" "57373559" "del" "0" "03256" "SERPING1_000064" "g.57373559del" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "762delC" "" "Germline" "yes" "" "0" "" "" "g.57606086del" "" "pathogenic" "ACMG"
"0000472624" "0" "99" "11" "57373573" "57373573" "subst" "0" "03256" "SERPING1_000065" "g.57373573T>A" "" "{DOI:Ponard 2019:10.1002/humu.23917} {DOI:Sheikh 2023:10.1007/s10875-022-01399-y}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57606100T>A" "" "pathogenic" ""
"0000472625" "0" "99" "11" "57373582" "57373582" "subst" "0" "03256" "SERPING1_000066" "g.57373582T>C" "" "{PMID:Ponard 2019:31517426} {DOI:Ponard 2019:10.1002/humu.23917}" "" "" "Variant expressed in the plasma, with a low antigenic C1Inh and an identification as a HAE of the intermediate type (anti-C1inh immunoblot)\r\nProbably incomplete penetrance of the variant within families.\r\nCharacterization as likely pathogenic according to the following ACMG criteria PS3, PM1, PM2, PP3 (InterVar interpretation of genetic variants)" "Germline" "yes" "" "0" "" "" "g.57606109T>C" "" "likely pathogenic" "ACMG"
"0000472626" "0" "99" "11" "57373603" "57373603" "dup" "0" "03256" "SERPING1_000067" "g.57373603dup" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "806dupA" "" "Germline" "yes" "" "0" "" "" "g.57606130dup" "" "pathogenic" "ACMG"
"0000472627" "0" "99" "11" "57373604" "57373604" "dup" "0" "03256" "SERPING1_000068" "g.57373604dup" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "807dupC" "" "Germline" "yes" "" "0" "" "" "g.57606131dup" "" "pathogenic" "ACMG"
"0000472628" "0" "99" "11" "57373613" "57373615" "dup" "0" "03256" "SERPING1_000069" "g.57373613_57373615dup" "" "{DOI:Ponard 2019:10.1002/humu.23917} {DOI:Ren 2025:10.1172/jci.insight.185548}" "" "c.814_816dupAAC" "Proband presenting with an intermediate-type HAE : low antigenic C1-INH with co-expression of variant and wt alleles in circulation.\r\nPosition Asn250 is highly conserved among serpins; exposed in a loop after helix F. Homologous to position 167 of A1AT.\r\nIt has been demonstrated that an additional Asn-linked sugar generated at Asn272 impairs C1-INH function." "Germline" "yes" "" "0" "" "" "g.57606140_57606142dup" "" "pathogenic" "ACMG"
"0000472629" "0" "99" "11" "57373613" "57373613" "dup" "0" "03256" "SERPING1_000070" "g.57373613dup" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "816dupC" "" "Germline" "yes" "" "0" "" "" "g.57606140dup" "" "pathogenic" "ACMG"
"0000472630" "0" "99" "11" "57373657" "57373657" "subst" "0" "03256" "SERPING1_000071" "g.57373657T>A" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57606184T>A" "" "likely pathogenic" ""
"0000472631" "0" "99" "11" "57373672" "57373673" "del" "0" "03256" "SERPING1_000072" "g.57373672_57373673del" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "c.875_876delCT" "" "Germline" "yes" "" "0" "" "" "g.57606199_57606200del" "" "pathogenic" "ACMG"
"0000472632" "0" "99" "11" "57373687" "57373687" "del" "0" "03256" "SERPING1_000073" "g.57373687del" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "889+1delG" "c.889+1delG variant is likely to affect the canonical donor splice site, with subsequent possible exon 5 skipping." "Germline" "yes" "" "0" "" "" "g.57606214del" "" "pathogenic" "ACMG"
"0000472633" "0" "90" "11" "57373873" "57373873" "subst" "0" "03256" "SERPING1_000074" "g.57373873C>G" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "" "c.890-8C>G could be considered as a deep intronic alteration that may affect pre-mRNA splicing: Potential acceptor splice site loss and alternate acceptor splice site gain, possibly contributing to C1-INH-HAE phenotype. Its responsibility in acceptor splicing must be investigated for mRNA species using patient cells." "Germline" "" "" "0" "" "" "g.57606400C>G" "" "VUS" "ACMG"
"0000472635" "0" "99" "11" "57373889" "57373889" "subst" "0" "03256" "SERPING1_000075" "g.57373889A>T" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57606416A>T" "" "pathogenic" "ACMG"
"0000472636" "0" "99" "11" "57373907" "57373908" "ins" "0" "03256" "SERPING1_000076" "g.57373907_57373908insN[37]" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "916_917ins(37)" "" "Germline" "yes" "" "0" "" "" "g.57606434_57606435insN[37]" "" "pathogenic" "ACMG"
"0000472637" "0" "99" "11" "57373915" "57373915" "del" "0" "03256" "SERPING1_000077" "g.57373915del" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "c.924delC" "" "Germline" "yes" "" "0" "" "" "g.57606442del" "" "pathogenic" "ACMG"
"0000472638" "0" "99" "11" "57373929" "57373929" "subst" "0" "03256" "SERPING1_000078" "g.57373929T>C" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "" "Phe291 is a highly conserved residue among serpins (98%).\r\nLocated in the gate functional region and at a buried hydrophobic position; it packs against conserved positions in s3C (Val300), and distal hinge region (Pro454, Phe455 and Pro476 in native C1-INH; Val451-Gln452 in latent structure)" "De novo" "yes" "" "0" "" "" "g.57606456T>C" "" "pathogenic" "ACMG"
"0000472639" "0" "99" "11" "57373932" "57373932" "dup" "0" "03256" "SERPING1_000079" "g.57373932dup" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "941dupA" "" "Germline" "yes" "" "0" "" "" "g.57606459dup" "" "pathogenic" "ACMG"
"0000472640" "0" "99" "11" "57373935" "57373935" "del" "0" "03256" "SERPING1_000080" "g.57373935del" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "944delT" "" "Germline" "yes" "" "0" "" "" "g.57606462del" "" "pathogenic" "ACMG"
"0000472641" "0" "99" "11" "57373941" "57373941" "del" "0" "03256" "SERPING1_000081" "g.57373941del" "" "{DOI:Gösswein 2008:10.1159/000138883} {DOI:Ponard 2019:10.1002/humu.23917}" "" "950delA" "The c.950delA variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PVS1, PS4_Mod, PP4_Mod, PM2_Sup" "Germline" "yes" "" "0" "" "" "g.57606468del" "{CV-SCV:005196585.1}" "pathogenic" "ACMG"
"0000472642" "0" "99" "11" "57373943" "57373943" "subst" "0" "03256" "SERPING1_000082" "g.57373943T>C" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "" "A family with 4 individuals presenting with HAE of low to severe grade" "Germline" "yes" "" "0" "" "" "g.57606470T>C" "" "pathogenic" "ACMG"
"0000472643" "0" "99" "11" "57373952" "57373952" "subst" "0" "03256" "SERPING1_000083" "g.57373952A>T" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "" "" "De novo" "yes" "" "0" "" "" "g.57606479A>T" "" "pathogenic" "ACMG"
"0000472644" "0" "99" "11" "57373956" "57373956" "subst" "0" "03256" "SERPING1_000084" "g.57373956T>A" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "" "Characterized as likely pathogenic variation according to ACMG criteria as follows PS2_Str, PM1, PM2, PM5, PP3_Str, PP4.\r\nVal300 is a highly conserved position among serpins (80%), in a buried hydrophobic environment in sheet-3C with involvement in the gate functional domain; it packs against conserved positions of gate at s4C (Phe291), s3C (Met302), s2C (Pro377) and distal hinge (Pro476) in native C1-INH.\r\nVal to Glu transition suggests a modified hydrophobicity with disruption of the insertion capacity of the cleaved RCL into the A-sheet and a reduced C1-INH function" "De novo" "yes" "" "0" "" "" "g.57606483T>A" "" "likely pathogenic" "ACMG"
"0000472645" "0" "99" "11" "57373956" "57373958" "del" "0" "03256" "SERPING1_000085" "g.57373956_57373958del" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "c.965_967delTGC" "" "Germline" "yes" "" "0" "" "" "g.57606483_57606485del" "" "pathogenic" "ACMG"
"0000472646" "0" "99" "11" "57373964" "57373964" "subst" "0" "03256" "SERPING1_000086" "g.57373964A>G" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "" "p.(Met325Val): intolerant by SIFT, pathogenic by PolyPhen, polymorphic by MutationTaster\r\nMet303 residue is highly conserved among serpins (86%); location in breach/gate, buried hydrophobic; Met303 packs against conserved positions in loop s3A/s4C (Phe281), s2C (Pro377, Arg378) and s5A (Glu429)" "Germline" "yes" "" "0" "" "" "g.57606491A>G" "" "likely pathogenic" "ACMG"
"0000472647" "0" "99" "11" "57373965" "57373967" "del" "0" "03256" "SERPING1_000087" "g.57373965_57373967del" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "974_976delTGA" "In-frame deletion in agreement with an intermediate biological typing, with 50% antigenic C1-INH in serum.\r\nDeclared by ghardy as ACMG Class 4, likely pathogenic\r\nc.974_976del variant meets ACMG criteria PS3, PM2_Sup, PP4, PM4, and interpreted as likely pathogenic." "Germline" "" "" "0" "" "" "g.57606492_57606494del" "" "likely pathogenic" "ACMG"
"0000472648" "0" "99" "11" "57373981" "57373981" "subst" "0" "03256" "SERPING1_000088" "g.57373981C>A" "" "{DOI:Ponard 2019:10.1002/humu.23917} {DOI:Yuan 2026:10.3389/fmed.2026.1936529}" "" "" "A de novo situation has been recorded in a 28-year-old female with an over 6-year history of recurrent, self-limiting abdominal pain.\r\nThe variant meets the ACMG criteria PVS1 and PS2, with its classification as pathogenic." "De novo" "yes" "" "0" "" "" "g.57606508C>A" "" "pathogenic" "ACMG"
"0000472649" "0" "99" "11" "57373982" "57373982" "subst" "0" "03256" "SERPING1_000089" "g.57373982C>T" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "" "Additional information on c.991C>T variant carriers is expected to establish a classification of the variant" "Germline" "yes" "" "0" "" "" "g.57606509C>T" "" "VUS (!)" ""
"0000472650" "0" "99" "11" "57373986" "57373986" "del" "0" "03256" "SERPING1_000090" "g.57373986del" "" "{DOI:Moreno 2015:10.1016/j.jaci.2014.12.1576} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Maia 2019:10.1111/all.13699} {DOI:Veronez 2021:10.1016/j.jaip.2020.11.039} {DOI:Ferriani 2025:10.1016/j.jaip.2025.08.026}" "" "995delT" "" "Germline" "yes" "" "0" "" "" "g.57606513del" "" "pathogenic" "ACMG"
"0000472651" "0" "99" "11" "57373991" "57373991" "subst" "0" "03256" "SERPING1_000091" "g.57373991C>G" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "" "" "Germline" "" "" "0" "" "" "g.57606518C>G" "" "pathogenic" ""
"0000472652" "0" "99" "11" "57374022" "57374022" "subst" "0" "03256" "SERPING1_000092" "g.57374022T>G" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "" "Donor splice site loss: c.1029+2T>G variant is likely to affect the canonical donor splice site, with subsequent exon(s) skipping" "Germline" "yes" "" "0" "" "" "g.57606549T>G" "" "pathogenic" "ACMG"
"0000472654" "0" "99" "11" "57379189" "57379189" "subst" "0" "03256" "SERPING1_000094" "g.57379189G>T" "6.197e-7" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "" "The c.1030-1G>T variant is likely to affect the canonical acceptor splice site, with a subsequent probable exon 7 skipping.\r\nThe c.1030-1G>T variant in SERPING1 meets ACMG/ClinGen criteria to be classified as pathogenic: PVS1_Str, PS4_Mod, PM6, PM2_Sup, PP4.\r\nIt has been submitted to ClinVar as pathogenic by Research Centre For Medical Genetics, Moscow Russia" "Germline" "yes" "" "0" "" "" "g.57611716G>T" "{CV-SCV:007375051.1}" "pathogenic" "ACMG"
"0000472655" "0" "99" "11" "57379194" "57379194" "subst" "0" "03256" "SERPING1_000095" "g.57379194G>A" "" "{DOI:Pedrosa 2016:10.1007/s10875-015-0222-9} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Hashimura 2021:10.1111/all.15034} {DOI:Du 2025: 10.3389/falgy.2025.1696666} {DOI:Guo 2026:10.1186/s13023-026-04421-3} {DOI:Du 2026:10.3389/falgy.2026.1899305}" "" "" "Recurrent variant\r\nFamily 1, France, de novo proband\r\nGly323 belongs to sheet 2B. This variant disrupts the Gly323 amino acid residue in C1-INH that has been recognized as critical for its biophysical properties, with subsequent disruption of the breach functional domain of C1-INH.\r\nConsidered pathogenic according to the ACMG criteria: PS2_Sup, PS4_Sup, PM2_Sup, PP3_Mod, PM1_Sup, PP4_Sup." "De novo" "yes" "rs2495452103" "0" "" "" "g.57611721G>A" "{CV-SCV:003440383.1}" "pathogenic" "ACMG"
"0000472656" "0" "99" "11" "57379196" "57379196" "del" "0" "03256" "SERPING1_000096" "g.57379196del" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "1036delC" "" "Germline" "yes" "" "0" "" "" "g.57611723del" "" "pathogenic" "ACMG"
"0000472657" "0" "99" "11" "57379197" "57379197" "del" "0" "03256" "SERPING1_000097" "g.57379197del" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "1037delA" "" "Germline" "yes" "" "0" "" "" "g.57611724del" "" "pathogenic" "ACMG"
"0000472658" "0" "99" "11" "57379213" "57379214" "dup" "0" "03256" "SERPING1_000098" "g.57379213_57379214dup" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "1053_c.1054dupCA" "" "Germline" "yes" "" "0" "" "" "g.57611740_57611741dup" "" "pathogenic" "ACMG"
"0000472659" "0" "99" "11" "57379224" "57379224" "subst" "0" "03256" "SERPING1_000099" "g.57379224T>C" "" "{DOI:Ponard 2019:10.1002/humu.23917} {DOI:Jindal 2021:10.1111/PAI.13420}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57611751T>C" "" "pathogenic" ""
"0000472660" "0" "99" "11" "57379230" "57379230" "subst" "0" "03256" "SERPING1_000100" "g.57379230T>G" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57611757T>G" "" "VUS" ""
"0000472661" "0" "99" "11" "57379235" "57379236" "ins" "0" "03256" "SERPING1_000013" "g.57379235_57379236insA" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "1076delGinsAG (Val359Glufs*10)" "" "Germline" "yes" "" "0" "" "" "g.57611762_57611763insA" "" "pathogenic" "ACMG"
"0000472662" "0" "99" "11" "57379239" "57379239" "subst" "0" "03256" "SERPING1_000101" "g.57379239C>A" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "" "Pro338 residue is highly conserved among serpins (93%)\r\nLocated within distal hinge (s3B), gate, in buried hydrophobic area.\r\nPro338 packs against Leu345 and Met348 and conserved position in distal hinge (Pro454)." "Germline" "yes" "" "0" "" "" "g.57611766C>A" "" "likely pathogenic" "ACMG"
"0000472663" "0" "99" "11" "57379245" "57379245" "del" "0" "03256" "SERPING1_000102" "g.57379245del" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "1085delA" "" "De novo" "yes" "" "0" "" "" "g.57611772del" "" "pathogenic" "ACMG"
"0000472664" "0" "99" "11" "57379260" "57379260" "subst" "0" "03256" "SERPING1_000103" "g.57379260T>C" "" "{DOI:Ponard 2019:10.1002/humu.23917} {DOI:Mendoza-Alvarez 2022:10.3389/fimmu.2022.997148} {DOI:Mendoza-Alvarez 2026:10.21203/rs.3.rs-10662999/v1}" "" "" "c.1100T>C variant affected as likely pathogenic based on the classification criteria PM1 (moderate), PM2 (moderate), PM5 (moderate), PP2 (supporting), and PP3 (supporting)" "Germline" "yes" "" "0" "" "" "g.57611787T>C" "" "likely pathogenic" "ACMG"
"0000472666" "0" "99" "11" "57379268" "57379268" "dup" "0" "03256" "SERPING1_000104" "g.57379268dup" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "1108dupA" "" "Germline" "yes" "" "0" "" "" "g.57611795dup" "" "pathogenic" "ACMG"
"0000472667" "0" "99" "11" "57379274" "57379274" "del" "0" "03256" "SERPING1_000105" "g.57379274del" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "1114delC" "" "Germline" "yes" "" "0" "" "" "g.57611801del" "" "pathogenic" "ACMG"
"0000472668" "0" "99" "11" "57379282" "57379283" "dup" "0" "03256" "SERPING1_000106" "g.57379282_57379283dup" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "c.1122_1123dupCA" "" "Germline" "yes" "" "0" "" "" "g.57611809_57611810dup" "" "pathogenic" "ACMG"
"0000472671" "0" "99" "11" "57379355" "57379355" "subst" "0" "03256" "SERPING1_000108" "g.57379355C>G" "" "{PMID:Bissler 1997:9069585} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Ren 2023:10.1016/j.jaci.2022.11.027}" "" "" "Pro377 is a highly conserved position among serpins (97%) located at the C-terminus of β-sheet 2C; gate and hinge functional domains; located in a buried hydrophobic area and packs against conserved positions for native C1Inh in s4C (Phe291), s3C (Val300, Met302) and distal hinge (Phe455).\r\np.(Pro399Ala) characterized as Intolerant (0.00) by SIFT Damaging (1.00) by PolyPhen and Disease causing (0.998) by MutationTaster.\r\nIntroduced in ClinVar as likely pathogenic by InVitae." "De novo" "yes" "rs2135324767" "0" "" "" "g.57611882C>G" "{CV-SCV:002254160.2}" "likely pathogenic" "ACMG"
"0000472672" "0" "99" "11" "57379362" "57379362" "subst" "0" "03256" "SERPING1_000109" "g.57379362T>G" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "" "Two independent pedigrees with single affected individuals carrying variant c.1202T>G.\r\nVariant meets a likely pathogenic criterion with ACMG scores as following PM2, PM5, PP3_Mod, PP5" "Germline" "yes" "" "0" "" "" "g.57611889T>G" "" "likely pathogenic" "ACMG"
"0000472673" "0" "99" "11" "57379366" "57379366" "del" "0" "03256" "SERPING1_000110" "g.57379366del" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "1206delA" "Variant c.1206delA is carried by a single individual" "Germline" "-" "" "0" "" "" "g.57611893del" "" "pathogenic" "ACMG"
"0000472674" "0" "99" "11" "57379367" "57379367" "del" "0" "03256" "SERPING1_000111" "g.57379367del" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "1207delG" "Variant c.1207del is carried by a single individual" "Germline" "-" "" "0" "" "" "g.57611894del" "" "pathogenic" "ACMG"
"0000472675" "0" "99" "11" "57379379" "57379379" "dup" "0" "03256" "SERPING1_000112" "g.57379379dup" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "1219dupC" "The c.1219dup variation meets ACMG criteria PS3, PM2, PM4, PP1 and specified pathogenic by using InterVar on-line interpretation" "Germline" "yes" "" "0" "" "" "g.57611906dup" "" "pathogenic" "ACMG"
"0000472676" "0" "99" "11" "57379409" "57379409" "subst" "0" "03256" "SERPING1_000113" "g.57379409G>T" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "" "Submitted to ClinVar as pathogenic by InVitae, San Francisco CA, and likely pathogenic by Center for Human Genetics Tuebingen, Tübingen Germany." "Germline" "yes" "rs755108467" "0" "" "" "g.57611936G>T" "{CV-SCV:001502068.10}" "pathogenic" "ACMG"
"0000472677" "0" "99" "11" "57379410" "57379410" "subst" "0" "03256" "SERPING1_000114" "g.57379410G>T" "" "{DOI:Ponard 2019:10.1002/humu.23917} {DOI:Markocsy 2024:10.1016/j.waojou.2024.100885}" "" "c.1249+1G>T" "c.1249+1G>T variant likely to affect the canonical donor splice site, with a subsequent probable exon 7 skipping" "Germline" "yes" "rs112565881" "0" "" "" "g.57611937G>T" "{CV:000003951}" "pathogenic" "ACMG"
"0000472678" "0" "99" "11" "57381807" "57381807" "del" "0" "03256" "SERPING1_000115" "g.57381807del" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "1256delT" "" "Germline" "yes" "" "0" "" "" "g.57614334del" "" "pathogenic" "ACMG"
"0000472679" "0" "99" "11" "57381816" "57381817" "del" "0" "03256" "SERPING1_000116" "g.57381816_57381817del" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "1265_1266delCT" "" "Germline" "" "" "0" "" "" "g.57614343_57614344del" "" "pathogenic" "ACMG"
"0000472680" "0" "99" "11" "57381863" "57381863" "del" "0" "03256" "SERPING1_000118" "g.57381863del" "" "{DOI:Ponard 2019:10.1002/humu.23917} {DOI:Wang 2022:10.1186/s41065-022-00242-z} {DOI:Kanepa 2023:10.1186/s13223-023-00783-6} {DOI:Rozevska 2024:10.1186/s13223-024-00889-5}" "" "1312delG" "Variant c.1312del is carried by four (likely) independent families.\r\nSubmitted to ClinVar as pathogenic by InVitae, San Francisco CA" "Germline" "yes" "" "0" "" "" "g.57614390del" "{CV-SCV:004424737.1}" "pathogenic" "ACMG"
"0000472681" "0" "99" "11" "57381870" "57381870" "subst" "8.12638E-6" "03256" "SERPING1_000117" "g.57381870C>T" "0.000008674 (gnomAD v4)" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "" "p.(Ala440Val) scores: deleterious by SIFT, possibly damaging by PolyPhen, polymorphic by MutationTaster.\r\nVariant found in a severely affected individual and characterized as likely pathogenic with an allele frequency below 0.000012.\r\nc.1319C>T variant has been introduced as likely benign in ClinVar by InVitae Corp San Francisco CA.\r\nInterpreted as likely pathogenic according to ACMG criteria PS3 PP1 PP3 PP4" "Germline" "" "rs867177349" "0" "" "" "g.57614397C>T" "{CV-SCV:002203737.2}" "likely pathogenic" ""
"0000472682" "0" "99" "11" "57381885" "57381885" "subst" "0" "03256" "SERPING1_000119" "g.57381885C>G" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "" "The c.1334C>G variant is carried by 2 affected individuals presenting with a HAE type II phenotype" "Germline" "yes" "" "0" "" "" "g.57614412C>G" "" "likely pathogenic" "ACMG"
"0000472683" "0" "99" "11" "57381897" "57381897" "dup" "0" "03256" "SERPING1_000120" "g.57381897dup" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "1346dupT" "" "Germline" "" "" "0" "" "" "g.57614424dup" "" "pathogenic" "ACMG"
"0000472684" "0" "99" "11" "57381901" "57381906" "del" "0" "03256" "SERPING1_000121" "g.57381901_57381906del" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "1350_1355delAGAGAC" "In-frame deletion of 2 aminoacid residues.\r\nc.1350_1355delAGAGAC variant carried by two pedigrees" "Germline" "yes" "" "0" "" "" "g.57614428_57614433del" "" "pathogenic" "ACMG"
"0000472686" "0" "99" "11" "57381930" "57381930" "subst" "0" "03256" "SERPING1_000123" "g.57381930C>A" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "" "P7 residue of the RCL sequence.\r\nThe identity of residues P8-P7 in the RCL appears to determine whether the serpin is a functional protease inhibitor or not. \r\np.(Ser460Tyr) bioinformatic scores: intolerant by SIFT, pathogenic by PolyPhen, polymorphic by MutationTaster.\r\nThe c.1379C>A variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as likely pathogenic: PS4_Mod, PP4_Mod, PM2_Sup, PP2." "Germline" "yes" "" "0" "" "" "g.57614457C>A" "{CV-SCV:005088616.1}" "likely pathogenic" "ACMG"
"0000472687" "0" "99" "11" "57381975" "57381975" "dup" "0" "03256" "SERPING1_000124" "g.57381975dup" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "1424dupA" "" "Germline" "" "" "0" "" "" "g.57614502dup" "" "pathogenic" "ACMG"
"0000472688" "0" "99" "11" "57381990" "57381990" "del" "0" "03256" "SERPING1_000125" "g.57381990del" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "1439delT" "c.1439del variation meets ACMG criteria PS3, PM2, PM4, PP1, with specification as pathogenic by using InterVar on line interpretation of variation" "Germline" "yes" "" "0" "" "" "g.57614517del" "" "pathogenic" "ACMG"
"0000472689" "0" "99" "11" "57382004" "57382004" "subst" "0" "03256" "SERPING1_000126" "g.57382004C>T" "6.196e-7" "{DOI:Ponard 2019:10.1002/humu.23917} {DOI:Rodriguez Espada 2025:10.1182/bloodadvances.2025017220}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57614531C>T" "" "pathogenic" "ACMG"
"0000472690" "0" "99" "11" "57382006" "57382008" "dup" "0" "03256" "SERPING1_000127" "g.57382006_57382008dup" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "1453_1455dupCAG" "A sequence CAG at position c.1453_1455 has been recorded, however the HGVS notation prescribes that on the forward strand it should be GCA at c.1455_1457.\r\nThis alternative has been retained for this variant, with a c.1455_1457dupGCA, with in-frame protein change" "Germline" "yes" "" "0" "" "" "g.57614533_57614535dup" "" "likely pathogenic" "ACMG"
"0000472691" "0" "90" "11" "57365200" "57365200" "del" "0" "03256" "SERPING1_000012" "g.57365200del" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "-23+5delG" "" "Germline" "yes" "" "0" "" "" "g.57597727del" "" "VUS" ""
"0000472692" "0" "95" "11" "57365200" "57365200" "subst" "0" "03256" "SERPING1_000016" "g.57365200G>A" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57597727G>A" "" "VUS" ""
"0000472693" "0" "97" "11" "57365697" "57365713" "del" "0" "03256" "SERPING1_000017" "g.57365697_57365713del" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "-22-25_-9del" "" "Germline" "yes" "" "0" "" "" "g.57598224_57598240del" "" "VUS" ""
"0000472694" "0" "99" "11" "57365703" "57365718" "del" "0" "03256" "SERPING1_000018" "g.57365703_57365718del" "" "{DOI:Ponard 2019:10.1002/humu.23917} {DOI:Obtulowicz 2020:10.5114/ceji.2020.101252} {DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "" "" "Mutation near splice site in SERPING1 transcript 1." "De novo" "yes" "" "0" "" "" "g.57598230_57598245del" "" "likely pathogenic" "ACMG"
"0000472695" "0" "99" "11" "57365712" "57365715" "del" "0" "03256" "SERPING1_000019" "g.57365712_57365715del" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "c.-22-10_-7delGGCT" "Transcript expression failed.\r\nFamily presenting with a compound heterozygous situation c.[(-21)T>C](;)[-22-10_-22-7del] in a trans configuration (n=2) and in both cis and trans configurations (n=1), with clinical phenotype affected;\r\n-patient 1, female, c.[(-21)T>C];[-22-10_-22-7del];[(-21)T>C], severe;\r\n-patient 2, female, c.[(-21)T>C];[-22-10_-22-7del], moderate;\r\n-patient 3, male, c.[(-21)T>C];[-22-10_-22-7del], mild" "Germline" "yes" "" "0" "" "" "g.57598239_57598242del" "" "likely pathogenic" ""
"0000472696" "0" "97" "11" "57365715" "57365719" "del" "0" "03256" "SERPING1_000020" "g.57365715_57365719del" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "-22-7_-3delTCCGC" "c.-22-7_-22-3delTCCGC variant might affect the acceptor splice site of intron 1. Additional investigations on transcripts are expected." "Germline" "" "" "0" "" "" "g.57598242_57598246del" "" "VUS" ""
"0000472698" "0" "99" "11" "57365720" "57365720" "subst" "0" "03256" "SERPING1_000021" "g.57365720A>T" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "" "" "Germline" "" "" "0" "" "" "g.57598247A>T" "" "pathogenic" "ACMG"
"0000472699" "0" "99" "11" "57365772" "57365772" "subst" "0" "03256" "SERPING1_000022" "g.57365772T>G" "" "{DOI:Ponard 2019:10.1002/humu.23917} {DOI:Ren 2025:10.1016/j.jaci.2024.12.1044}" "" "" "Variant Leu10Arg is not expressed after transient transfection of minigene into 293T cells.\r\nAltering the hydrophobic core by substitution by positively charged amino acids can disrupt signal peptide transportation and impair protein secretion." "De novo" "yes" "" "0" "" "" "g.57598299T>G" "" "likely pathogenic" "ACMG"
"0000472700" "0" "99" "11" "57365792" "57365807" "del" "0" "03256" "SERPING1_000023" "g.57365792_57365807del" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "49_51+13delGGGGTATGTGGTCCCT" "Variant c.49_51+13del hits one or more splice sites in transcripts\r\nSPiP prediction: Variant c.49_51+13del introduces a 98.4% risk to alter splicing.\r\nRecognized as pathogenic according to ACMG criteria as follows: PVS1, PS3, PM2, PP3, PP4" "Germline" "" "" "0" "" "" "g.57598319_57598334del" "" "pathogenic" "ACMG"
"0000472701" "0" "99" "11" "57365796" "57365796" "subst" "0" "03256" "SERPING1_000024" "g.57365796T>A" "" "{DOI:Ponard 2019:10.1002/humu.23917} {DOI:Miguel Berenguel 2024:10.3389/fimmu.2024.1499415}" "" "" "c.51+2T>A affects the donor canonical splice site." "Germline" "yes" "" "0" "" "" "g.57598323T>A" "" "pathogenic" "ACMG"
"0000472702" "0" "99" "11" "57365797" "57365797" "subst" "0" "03256" "SERPING1_000025" "g.57365797A>C" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57598324A>C" "" "pathogenic" ""
"0000472703" "0" "99" "11" "57365797" "57365800" "del" "0" "03256" "SERPING1_000026" "g.57365797_57365800del" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "51+3_+6delATGT" "" "Germline" "" "" "0" "" "" "g.57598324_57598327del" "" "likely pathogenic" ""
"0000472704" "0" "99" "11" "57367358" "57367358" "del" "0" "03256" "SERPING1_000027" "g.57367358del" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "58delG" "" "Germline" "" "" "0" "" "" "g.57599885del" "" "pathogenic" "ACMG"
"0000472705" "0" "99" "11" "57367412" "57367412" "subst" "0" "03256" "SERPING1_000028" "g.57367412C>T" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57599939C>T" "" "pathogenic" "ACMG"
"0000472706" "0" "99" "11" "57367457" "57367457" "del" "0" "03256" "SERPING1_000029" "g.57367457del" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "157delA" "" "Germline" "yes" "" "0" "" "" "g.57599984del" "" "pathogenic" "ACMG"
"0000472707" "0" "99" "11" "57367459" "57367459" "del" "0" "03256" "SERPING1_000030" "g.57367459del" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "159delG" "" "Germline" "yes" "" "0" "" "" "g.57599986del" "" "pathogenic" "ACMG"
"0000472709" "0" "99" "11" "57367508" "57367511" "del" "0" "03256" "SERPING1_000032" "g.57367508_57367511del" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "208_211delTCAA" "" "Germline" "yes" "" "0" "" "" "g.57600035_57600038del" "" "pathogenic" "ACMG"
"0000472710" "0" "99" "11" "57365721" "57367851" "del" "0" "03256" "SERPING1_000131" "g.(57365196_57365721)_(57367851_57369507)del" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "deletion of exons 2_3" "" "Germline" "" "" "0" "" "" "g.(57597723_57598248)_(57600378_57602034)del" "" "pathogenic" "ACMG"
"0000472711" "0" "99" "11" "57365721" "57373687" "del" "0" "03256" "SERPING1_000132" "g.(57365196_57365721)_(57373687_57373880)del" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "deletion exons 2_5" "variant identified by FAMA" "Germline" "" "" "0" "" "" "g.(57597723_57598248)_(57606214_57606407)del" "" "pathogenic" "ACMG"
"0000472712" "0" "99" "11" "57373482" "57379410" "del" "0" "03256" "SERPING1_000133" "g.(57369643_57373482)_(57379410_57381800)del" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "deletion exons 5_7" "variant identified by FAMA" "Germline" "yes" "" "0" "" "" "g.(57602170_57606009)_(57611937_57614327)del" "" "pathogenic" "ACMG"
"0000472713" "0" "99" "11" "57369507" "57369643" "dup" "0" "03256" "SERPING1_000014" "g.(57367851_57369507)_(57369643_57373482)dup" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "duplication exon 4" "variant identified by FAMA.\r\nIn-frame duplication of the genomic region encompassing exon 4, with subsequent failed C1-INH expression, a HAE type 1 clinical phenotype and a loss of C1-INH function." "Germline" "yes" "" "0" "" "" "g.(57600378_57602034)_(57602170_57606009)dup" "" "pathogenic" "ACMG"
"0000472714" "0" "99" "11" "57373482" "57382326" "dup" "0" "03256" "SERPING1_000015" "g.(57369643_57373482)_(57382326_?)dup" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "duplication exons 5_8" "variant identified by FAMA.\r\nOut-of-frame duplication" "Germline" "yes" "" "0" "" "" "g.(57602170_57606009)_(57614853_?)dup" "" "pathogenic" "ACMG"
"0000487592" "21" "99" "11" "57365797" "57365797" "subst" "0" "03256" "SERPING1_000025" "g.57365797A>C" "" "{PMID:Charignon 2018:29885370}, {DOI:Charignon 2018:10.1016/j.anai.2018.05.031}" "" "" "Variant resulting in marked exon 2 skipping.\r\nThe c.51+3A>C variant in SERPING1 meets ACMG/ClinGen criteria to be classified as pathogenic: PP4_Str, PS4_Mod, PS1_Mod, PM2_Sup, PP3" "Germline" "yes" "" "0" "" "" "g.57598324A>C" "" "pathogenic (dominant)" "ACMG"
"0000497705" "0" "99" "11" "57373675" "57373678" "del" "0" "03256" "SERPING1_000136" "g.57373675_57373678del" "" "{DOI:Monnier 2006:10.1016/j.molimm.2006.01.006}" "" "878_881delTCTA" "Variant introduced in the Lund SERPING1 database https://structure.bmc.lu.se/idbase/SERPING1base/" "De novo" "yes" "" "0" "" "" "g.57606202_57606205del" "" "pathogenic" "ACMG"
"0000497739" "0" "99" "11" "57365720" "57365720" "subst" "0" "03256" "SERPING1_000134" "g.57365720A>G" "" "{DOI:Bygum 2011:10.1111/j.1398-9995.2010.02456.x} {DOI:Veronez 2019:10.3389/fmed.2019.00028} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Hashimura 2021:10.1111/all.15010}" "" "c.-22-2A>G" "Recurrent variant\r\nc.-22-2A>G variant is likely to affect the acceptor splice site of intron 1.\r\nVariant with responsibility for decreased C1 Inhibitor function and HAE" "Germline" "yes" "" "0" "" "" "g.57598247A>G" "" "pathogenic" "ACMG"
"0000497763" "0" "99" "11" "57365720" "57365720" "subst" "0" "03256" "SERPING1_000135" "g.57365720A>C" "" "{DOI:Aabom 2017:10.1186/s13023-017-0604-6}" "" "c.-22-2A>C" "" "Germline/De novo (untested)" "yes" "" "0" "" "" "g.57598247A>C" "" "pathogenic" "ACMG"
"0000497767" "0" "99" "11" "57365749" "57365756" "dup" "0" "03256" "SERPING1_000138" "g.57365749_57365756dup" "" "{PMID:Verpy 1996:8755917} {DOI:Ponard 2019:10.1002/humu.23917}" "" "" "A c.3_10dup was erroneously introduced in SERPING1base, ID @R4X8, accession S0049 on 30 July 2004; structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "" "0" "" "" "g.57598276_57598283dup" "" "pathogenic" "ACMG"
"0000497773" "3" "99" "11" "57379358" "57379358" "subst" "0" "03256" "SERPING1_000546" "g.57379358C>T" "0.000013 (gnomAD)" "{DOI:Lopez-Lera 2010:10.1016/j.jaci.2010.07.037} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Bas 2026:10.3390/medicina62091635}" "" "c.[1198C>T];[1198C>T]" "Affected homozygous patients present with an intermediate biological typing. (i) The Spanish family presenting with an absence of HAE-C1INH-related symptomatology in the heterozygous subjects. (ii) The Turkish family presents with 3 symptomatic homozygous individuals and 4 heterozygous individuals.\r\nVariant product is susceptible to oligomerization.\r\nArg378 residue at a highly conserved position among serpins;located in a loop s2C/s6A; gate. Exposed position, makes salt bridge to conserved position in s3C (Pro301, Met303) and s5A (Glu429), participates in the polyanion binding site; position corresponding to Glu342 in A1AT with variant p.(Glu342Lys), the Z allele promoting pathogenic multimers." "Germline" "yes" "rs201363394" "0" "" "" "g.57611885C>T" "{CV-SCV:000678295.2}" "pathogenic" "ACMG"
"0000497774" "0" "99" "11" "57365766" "57365766" "dup" "0" "03256" "SERPING1_000140" "g.57365766dup" "" "{DOI:Bygum 2011:10.1111/j.1398-9995.2010.02456.x} {DOI:Veronez 2019:10.3389/fmed.2019.00028}" "" "c.23insT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.57598293dup" "" "pathogenic" "ACMG"
"0000497777" "0" "99" "11" "57365758" "57365759" "dup" "0" "03256" "SERPING1_000141" "g.57365758_57365759dup" "" "{DOI:Zuraw 2000:10.1067/mai.2000.104780} {DOI:Chan 2024:10.22541/au.170664625.53951073/v1}" "" "c.15_16dupGA" "Variant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "" "0" "" "" "g.57598285_57598286dup" "" "pathogenic" "ACMG"
"0000497782" "0" "99" "11" "57365762" "57365762" "dup" "0" "03256" "SERPING1_000142" "g.57365762dup" "" "{DOI:Johnsrud 2015:10.1371/journal.pone.0131637.t001}" "" "c.19dupC" "" "Germline" "" "" "0" "" "" "g.57598289dup" "" "likely pathogenic" "ACMG"
"0000497784" "0" "99" "11" "57365797" "57365803" "del" "0" "03256" "SERPING1_000143" "g.57365797_57365803del" "" "{DOI:Lopez-Lera 2011:10.1016/j.molimm.2011.07.010}" "" "c.50_51+6del" "Exon 2 completely skipped" "Germline" "yes" "" "0" "" "" "g.57598324_57598330del" "" "pathogenic" "ACMG"
"0000498192" "0" "99" "11" "57379193" "57379193" "subst" "0" "03256" "SERPING1_000144" "g.57379193G>A" "" "{DOI:Roche 2005:10.1002/humu.20197} {DOI:Kang 2006:10.1111/j.1398-9995.2006.01010.x} {DOI:Gösswein 2008:10.1159/000138883} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Loli‐Ausejo 2021:10.1007/s12016-021-08834-9} {DOI:Hashimura 2021:10.1111/all.15034} {DOI:Ryø 2023:10.1016/j.jaci.2023.04.023}" "" "c.1033G>A" "Recurrent variant\r\nCo-expression of variant and wild-type allele products, in agreement with a HAE-C1-INH intermediate type.\r\np.(Gly345Arg) is a dominant-negative variant; p.(Gly345Arg) variant product accumulates into cell, affecting transport and secretion of normal C1-INH (Ryø et al 2023), then classifying p.(Gly345Arg) within class III.\r\nGly323 residue is localized within sheet 2B; a Gly to Arg transition might affect the breach functional region, ie. a mobile region where sheet swings open to accept RCL during loop insertion, with an increased susceptibility to oligomerization.\r\np.(Gly323Arg) has been found not to interact with target protease. Other variants that disrupt Gly323 have been determined to be pathogenic.\r\nVariant submitted to ClinVar as pathogenic by InVitae, San Francisco CA. Introduced in the Lund SERPING1 database https://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "rs2135324441" "0" "" "" "g.57611720G>A" "{CV-SCV:004294840.2}" "pathogenic (dominant)" "ACMG"
"0000498193" "0" "99" "11" "57367806" "57367806" "subst" "0" "03256" "SERPING1_000145" "g.57367806T>C" "" "{DOI:Roche 2005: 10.1002/humu.20197} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Grombikirova 2023:10.1007/s10875-023-01565-w}" "" "c.506T>C" "Variant product with high susceptibility to oligomerization.\r\nPhe147 is a highly conserved position among serpins (84%): location β-sheet B, s6B, in the shutter domain, contributing to maintain the normal closed state of the overlying sheet A.\r\nPhe147Ser variant product is likely to destabilise the closure of a five-stranded central β-sheet, which in turn favors oligomerisation; apparent correspondence to p.(Phe52del) Mmalton in A1AT.\r\nVariant c.506T>C expressed with an intermediate biological phenotype: low antigenic C1-INH is associated with a co-expression of both variant and wt alleles.\r\nVerpy 1996 reported the c.[-626C>G;509T>C] compound heterozygosity in a cis configuration.\r\nThe c.506T>C variant in SERPING1 meets ACMG/ClinGen criteria to be classified as pathogenic: PP3_Str, PM6, PS4_Mod, PM2_Sup, PP2, PP4.\r\nVariant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "rs2495426721" "0" "" "" "g.57600333T>C" "{CV-SCV:005088174.1}" "pathogenic" "ACMG"
"0000498194" "1" "55" "11" "57373653" "57373653" "subst" "1.21826E-5" "03256" "SERPING1_000130" "g.57373653C>T" "0.000006815 (gnomAD v4)" "{DOI:Faiyaz-Ul-Haque 2010:10.1159/000236005}" "" "c.[856C>T(;)1361T>A]" "Compound heterozygous proband with c.[856C>T(;)1361T>A]; heterozygous individuals with c.856C>T variant are asymptomatic" "Germline" "" "rs1392305191" "0" "" "" "g.57606180C>T" "{CV-SCV:005778448.2}" "benign" ""
"0000498195" "2" "99" "11" "57381912" "57381912" "subst" "0" "03256" "SERPING1_000146" "g.57381912T>A" "" "{DOI:Faiyaz-Ul-Haque 2010:10.1159/000236005}" "" "c.[856C>T(;)1361T>A]" "Proband carrying the variant c.1361T>A variant with c.856C>T in a compound heterozygosity.\r\nRecurrent variant." "Germline/De novo (untested)" "" "rs121907949" "0" "" "" "g.57614439T>A" "{CV:000003953}" "likely pathogenic" ""
"0000498196" "0" "99" "11" "57381912" "57381912" "subst" "0" "03256" "SERPING1_000146" "g.57381912T>A" "" "{DOI:Davis 1992:10.1038/ng0892-354} {DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Pedrosa 2016:10.1007/s10875-015-0222-9} {DOI:Loli‐Ausejo 2021:10.1007/s12016-021-08834-9}" "" "c.1361T>A" "Recurrent pathogenic variant\r\nVal432 belongs to a position P14, hinge region, that is critical for serpin mousetrap function; variant product results in dysfunction, converting the inhibitor to a substrate of kallikrein or C1s protease (class I of the HAE type 2)\r\nIntroduced in ClinVar as pathogenic (submitter OMIM)." "Germline" "yes" "rs121907949" "0" "" "" "g.57614439T>A" "{CV:000003953}" "pathogenic" "ACMG"
"0000498197" "0" "99" "11" "57365744" "57365744" "subst" "0" "03256" "SERPING1_000147" "g.57365744A>G" "" "{DOI:Gösswein 2008:10.1159/000138883}{PMID:Papadopoulou-Alataki 2008:18535392} {DOI:Papadopoulou-Alataki 2008: 10.1159/000137286}{DOI:Speletas 2009:10.1016/j.humimm.2009.08.010}{DOI:López-Lera 2011:10.1016/j.molimm.2011.07.010}{DOI:Bors 2013:10.1016/j.jaci.2012.11.015}{DOI:Ponard 2019:10.1002/humu.23917}{DOI:Szabó 2022:10.3389/falgy.2022.836465} {DOI:Wang 2022:10.1186/ s41065-022-00242-z}" "" "c.1A>G" "c.1A>G variant affects the initiation codon of the transcript of SERPING1 gene.\r\nRecurrent variant found in multiple pedigrees, Germany, Turkey, Greece, Spain, France, Hungary, China.\r\nOne pedigree is presenting with a de novo mutation. According to ACMG Guidelines, with criteria PVS1, PS1, PS2, PS4, PM2, PP1, PP4, the variant is considered pathogenic." "De novo" "yes" "rs1565168898" "0" "" "" "g.57598271A>G" "{CV:VCV000626352.1}" "pathogenic" "ACMG"
"0000498491" "0" "99" "11" "57381947" "57381947" "subst" "0" "03256" "SERPING1_000148" "g.57381947C>A" "" "{DOI:Aulak 1990:10.1016/0014-5793(90)81494-9} {PMID:McPhaden 1991:1674681} {PMID:Eldering 1992:1551909} {PMID:Verpy 1996:8755917} {DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Xu 2012:10.1111/all.12024} {DOI:Liu 2019:10.1684/ejd.2018.3487} {DOI:Ponard 2019:10.1002/humu.23917} {PMID:Obtulowicz 2020:33437182} {DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "c.1396C>A" "Recurrent variant\r\nArg444 residue at the critical P1 position within the RCL\r\nMissense variants at the same residue (Arg466Gly/Cys/His/Pro/Leu) also disrupt the Arg P1 position of the RCL, with deleterious consequences on the control of Ser-protease targets" "Germline" "yes" "rs28940870" "0" "" "" "g.57614474C>A" "{CV-RCV:000059083.1}" "pathogenic" "ACMG"
"0000498492" "0" "99" "11" "57379358" "57379358" "subst" "4.87337E-5" "03256" "SERPING1_000139" "g.57379358C>T" "0.00002230 (gnomAD v4) 0.00002 (TOPMed)" "{DOI:Roche 2005:10.1002/humu.20197} {DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Gösswein 2008:10.1159/000138883} {DOI:López-Lera 2010:10.1016/j.jaci.2010.07.037} {DOI:Caccia 2018:10.1038/s41598-017-16667-w} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Tesolin 2022:10.3390/jpm12101618}" "" "c.1198C>T" "Recurrent variant in families with HAE-C1INH. Incomplete penetrance in some families.\r\nVariant product susceptible to oligomerization.\r\nArg378 residue is a highly conserved position among serpins; located at a loop s2C/s6A in the gate functional domain. Arg378 makes salt bridge to conserved position in s3C (Pro301, Met303) and s5A (Glu429) and participates in the polyanion binding site; position corresponding to Glu342 in A1AT with variant p.(Glu342Lys), the Z allele promoting pathogenic multimers.\r\nHomozygous proband c.[1198C>T];[1198C>T] described by López-Lera et al 2010. \r\nConflicting classifications of pathogenicity; considered pathogenic and VUS depending on submitters.\r\nc.1198C>T variant reported in patients affected by multi-drug resistant rheumatoid or psoriatic arthritis (Tessolin P et al 2022)\r\nIntroduced in ClinVar as pathogenic by OMIM and as VUS by InVitae, San Franscisco CA." "Germline" "yes" "rs201363394" "0" "" "" "g.57611885C>T" "{CV-SCV:000678295}" "VUS" "ACMG"
"0000498530" "0" "99" "11" "57367365" "57367365" "subst" "0" "03256" "SERPING1_000149" "g.57367365C>G" "" "{DOI:Roche 2005:10.1002/humu.20197} {DOI:Gösswein 2008:10.1159/000138883} {DOI:Bors 2013:10.1016/j.jaci.2012.11.015} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Szabó 2022:10.3389/falgy.2022.836465} {DOI:Troldborg 2024:10.1016/j.jaci.2024.03.028}" "" "c.65C>G" "Recurrent pathogenic variant.\r\nVariant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "" "0" "" "" "g.57599892C>G" "" "pathogenic" "ACMG"
"0000498531" "0" "99" "11" "57367394" "57367394" "subst" "0" "03256" "SERPING1_000150" "g.57367394C>T" "" "{DOI:Kalmár 2003:10.1002/humu.9202} {DOI:Roche 2005:10.1002/humu.20197} {DOI:Bors 2013:10.1016/j.jaci.2012.11.015} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Szabó 2022:10.3389/falgy.2022.836465} {DOI:Troldborg 2024:10.1016/j.jaci.2024.03.028}" "" "c.94C>T" "Recurrent variant" "Germline" "yes" "" "0" "" "" "g.57599921C>T" "" "pathogenic" "ACMG"
"0000498532" "0" "99" "11" "57381968" "57381968" "subst" "0" "03256" "SERPING1_000151" "g.57381968G>A" "" "{DOI:Verpy 1995:10.1172/JCI117663} {DOI:Bygum 2011:10.1111/j.1398-9995.2010.02456.x} {DOI:Bors 2013:10.1016/j.jaci.2012.11.015} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Haslund 2019:10.1172/JCI98869} {DOI:Veronez 2019:10.3389/fmed.2019.00028} {DOI:Arias-Flórez 2024:10.1371/journal.pone.0311316.t001}" "" "c.1417G>A" "Variant at a conserved position among serpins: Val451, loop s1C/s4B; gate; needed for the RCL insertion.\r\nRecurrent dominant-negative variant, associated with a HAE of the intemediate type: peripheral expression of variant product, with low antigenic C1 Inhibitor.\r\nVariant product with high susceptibility to oligomerization.\r\nWell-established in vitro or in vivo functional studies supportive of a damaging effect on the gene or gene product.\r\nVariant c.1417>A is identified as pathogenic and fulfills ACMG criteria PS4, PM2, PM1, PM5, PP3, and PP5. Variant introduced in a ClinVar list of pathogenic variants by University of Thessaly and submitted to ClinVar as pathogenic by InVitae, San Francisco CA.\r\nIntroduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "rs956390201" "0" "" "" "g.57614495G>A" "{CV:000690355}" "pathogenic" "ACMG"
"0000498541" "0" "59" "11" "57381945" "57381945" "subst" "0" "03256" "SERPING1_000152" "g.57381945C>T" "0.000001239" "{DOI:Zahedi 1995:10.1172/JCI117780} {PMID:Zahedi 1997:9218620} {DOI:Zahedi 2001:10.4049/jimmunol.167.3.1500}" "" "16786C>T" "Ala443 residue at the P2 position within the RCL.\r\nDiminished control of C1s by variant p.(Ala465Val) permits unregulated C1s-mediated activation of C4 and C2: While the family is noted to have C4 deficiency, it should be considered an indirect biochemical result of uncontrolled complement activation.\r\nNormal control of kallikrein-kinin system proteases.\r\nThe variant product also forms a complex with trypsin, a serine protease that normally cleaves, and is not inhibited by, C1-INH. The p.(Ala465Val) product therefore converts C1-INH from a substrate to an inhibitor of trypsin." "Germline" "yes" "rs121907950" "0" "" "" "g.57614472C>T" "{CV:000003955}" "VUS" "ACMG"
"0000498543" "0" "99" "11" "57379189" "57379410" "del" "0" "03256" "SERPING1_000153" "g.(57374021_57379189)_(57379410_57381800)del" "" "{DOI:Cicardi 1987:10.1172/JCI114095} {DOI:Ariga 1989:10.1172/JCI114095} {DOI:Szabó 2022:10.3389/falgy.2022.836465}" "" "exon 7 deletion" "Initial Southern blot analysis followed by direct sequencing of the cDNA prepared from proband monocytes. A pulse-chase experiment with the patient\'s monocytes revealed no difference in the kinetics of synthesis or secretion of C1-INH as compared with other type 1 patients or with normal individuals.\r\nIt is likely that exon 7 skipping creates a frameshift that resulted in NMD of the abnormal transcript.\r\n0.2-kb deletion variant encompassing exon 7.\r\nHungarian family presenting with an exon 7 deletion of unknown length.\r\nErroneously introduced as c.1030_1249del in the Lund SERPING1 database https://structure.bmc.lu.se/idbase/SERPING1base/" "Germline/De novo (untested)" "yes" "" "0" "" "" "g.(57606548_57611716)_(57611937_5761432)del" "{CV:000003944}" "pathogenic" "ACMG"
"0000498898" "0" "99" "11" "57365799" "57365799" "subst" "0" "03256" "SERPING1_000154" "g.57365799G>A" "" "{PMID:Verpy 1996:8755917} {DOI:Duponchel 2006:10.1002/humu.9414} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Gábos 2019:10.2478/rrlm-2019-0029} {DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "" "c.51+5G>A" "Recurrent variant\r\nExon 2 partially skipped. RNA has been prepared from HepG2 cells transfected with minigene.\r\nIntroduced in ClinVar as likely pathogenic by GeneDX, Gaithersburg MA." "Germline" "yes" "rs1554994665" "0" "" "" "g.57598326G>A" "{CV:000450500}" "pathogenic" "ACMG"
"0000498899" "0" "99" "11" "57367351" "57367351" "subst" "0" "03256" "SERPING1_000155" "g.57367351G>A" "0.00001396 (gnomAD v3)" "{DOI:Gösswein 2008:10.1159/000138883} {DOI:Hashimura 2021:10.1111/all.15034} {DOI:Förster 2021:10.1186/s13023-021-02021-x}" "" "c.52-1G>A" "Variant likely to affect splice acceptor site.\r\nThe variant meets the ACMG criteria to considered pathogenic: PVS1, PM2, PP5_Very_Strong\r\nIntroduced in ClinVar as a pathogenic variant by GeneDx, Gaithersburg MD" "Germline" "yes" "rs886041353" "0" "" "" "g.57599878G>A" "{CV:000280064}" "pathogenic" "ACMG"
"0000498902" "0" "99" "11" "57365800" "57365800" "subst" "0" "03256" "SERPING1_000158" "g.57365800T>G" "" "{DOI:Lopez-Lera 2011:10.1016/j.molimm.2011.07.010} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "c.51+6T>G" "Total RNA analysis: The gel displays a low transcription of the full length isoform.\r\nThe change c.51+6T>G probably induces an aberrant transcript processing in a dominant manner, leading to the degradation of most of the full length transcript." "Germline" "" "" "0" "" "" "g.57598327T>G" "" "pathogenic" "ACMG"
"0000498903" "0" "99" "11" "57365797" "57365797" "subst" "0" "03256" "SERPING1_000159" "g.57365797A>T" "" "{DOI:Mete Gökmen 2018:10.1159/000492583}" "" "IVS2+3A>T" "Note: Exon 2, exon 3 and exons 2 + 3 skipping have been reported for the variant c.51+3A>G by {DOI:Duponchel 2006:10.1002/humu.9414}\r\nAlgorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site.\r\nIntroduced in ClinVar as likely pathogenic by Labcorp Genetics, San Francisco CA." "Germline" "yes" "rs2495421197" "0" "" "" "g.57598324A>T" "{CV-SCV:004631963.1}" "likely pathogenic" "ACMG"
"0000498904" "0" "99" "11" "57365797" "57365797" "subst" "0" "03256" "SERPING1_000160" "g.57365797A>G" "<0.00000001" "{DOI:Roche 2005:10.1002/humu.20197} {DOI:Duponchel 2006:10.1002/humu.9414} {DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Bafunno 2014:10.1111/ahg.12052} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Guryanova 2019:10.29235/1814-6023-2019-16-3-349-356} {DOI:Förster 2021:0.1186/s13023-021-02021-x} {DOI:Markocsy 2024:10.1016/j.waojou.2024.100885}" "" "640A>G (traditional)" "Highly recurrent variant, found associated with a HAE type I phenotype.\r\nPatient total RNA analysis: Variant associated with exon 3 and exons 2 + 3 skipping.\r\nHAE family from Belarus presenting with a de novo proband\r\nAccording to ACMG Guidelines, with criteria PVS1, PS2_Str, PS3, PS4, PM2, PP1, PP4, the variant is considered pathogenic.\r\nIntroduced in ClinVar as a pathogenic variant by InVitae, San Francisco CA" "De novo" "yes" "rs2495421197" "0" "" "" "g.57598324A>G" "{CV-SCV:003440401.1}" "pathogenic" "ACMG"
"0000498907" "0" "99" "11" "57373613" "57373615" "del" "0" "03256" "SERPING1_000161" "g.57373613_57373615del" "" "{PMID:Bissler 1994:7937817} {DOI:Roche 2005:10.1002/humu.20197} {DOI:Gösswein 2008:10.1159/000138883} {DOI:Lopez-Lera 2011:10.1016/j.molimm.2011.07.010} {DOI:Xu 2012:10.1111/all.12024} {DOI:Pedrosa 2016:10.1007/s10875-015-0222-9} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Liu 2019:10.1684/ejd.2018.3487} {DOI:Ren 2023:10.1016/j.jaci.2022.11.027} {DOI:Grover 2023:10.1182/blood.2022018849} {DOI:Ren 2025:10.1172/jci.insight.185548} {DOI:Kurjane 2026:10.3389/fimmu.2026.1696479} {DOI:Guo 2026:10.1186/s13023-026-04421-3} {DOI:Du 2026:10.3389/falgy.2026.1899305} {DOI:Mendoza-Alvarez 2026:10.21203/rs.3.rs-10662999/v1}" "" "8455_8457delCAA" "Nomenclature: Variant is also known as c.813_815delCAA. The HGVS notation prescibed that on the forward strand it should be CAA at position c.816_818.\r\nRecurrent variant.\r\nIn frame deletion; p.(Asn272del) affects a N-glycosylation site; the protein sequence for the Asn272 glycosylation site is NN(272)KIS. Asn272 deletion disrupts the recognition site, thereby altering protein folding and function; thus Asn272del is deleterious as demonstrated by cultured cells by Ren et al (2025).\r\nAsn250 is located at the end of helix F, close to Sheet 3A, with H-bonding with Ala245. Asn250 is a highly exposed residue within the shutter region. \r\np.(Asn272del) is poorly biosynthesized in recombinant expression studies (Ren et al 2023), then classifying p.(Asn272del) within class II/III (ie., disturbed insertion of the RCL, conformational transition with spontaneous self or mutual insertion of the RCL). The c.816_818del variant in SERPING1 meets ACMG/ClinGen criteria to be classified as likely pathogenic: PP4_Str, PM4, PS4_Mod, PM2_Sup.\r\nVariant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/\r\nConflicting classifications of pathogenicity. Variant introduced in ClinVar as VUS by InVitae, San Francisco CA and as likely pathogenic by Research Centre For Medical Genetics, Moscow Russia" "Germline" "yes" "rs2495440974" "0" "" "" "g.57606140_57606142del" "{CV-SCV:003439867}" "likely pathogenic" "ACMG"
"0000498910" "1" "90" "11" "57381971" "57381971" "subst" "0" "03256" "SERPING1_000162" "g.57381971C>G" "" "{DOI:Verpy 1995:10.1172/JCI117663} {PMID:Verpy 1996:8755917}" "" "[Q452E;L459P]" "Both c.1420C>G and c.1442T>G variants are in a cis configuration.\r\np.(Gln452Glu) has little or no effect on C1 inhibitor protein structure or function (benign variant), whereas in vitro secretion of p.(Leu459Pro) is abolished." "De novo" "" "" "0" "" "" "g.57614498C>G" "" "pathogenic" ""
"0000498916" "0" "99" "11" "57367406" "57367407" "del" "0" "03256" "SERPING1_000163" "g.57367406_57367407del" "" "{PMID:Verpy 1996:8755917} {DOI:Kesim 2011:10.1159/000323915} {DOI:Rodriguez 2018:10.1007/s10875-018-0491-1} {DOI:Nabilou 2020:10.1080/08820139.2020.1817068} {DOI:Loli‐Ausejo 2021:10.1007/s12016-021-08834-9} {DOI:Hashimura 2021:10.1111/all.15034} {DOI:Szabo 2022:10.3389/falgy.2022.836465} {DOI:Mendoza-Alvarez 2026:10.21203/rs.3.rs-10662999/v1}" "" "106_107delAG" "Highly recurrent variant\r\nConsidered pathogenic according to ACMG guidelines, with following criteria PVS1, PM2, PP4 (University of Thessaly Greece).\r\nConsidered pathogenic in ClinVar (2 submitters).\r\nVariant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "rs1590822296" "0" "" "" "g.57599933_57599934del" "{CV:000626349}" "pathogenic" "ACMG"
"0000499065" "0" "99" "11" "57367809" "57367809" "subst" "0" "03256" "SERPING1_000164" "g.57367809C>T" "" "{DOI:Faiyaz-Ul-Haque 2010:10.1159/000236005} {DOI:Xu 2012:10.1111/all.12024} {DOI:Liu 2019:10.1684/ejd.2018.3487} {DOI:Wang 2022:10.1186/s41065-022-00242-z} {DOI:Sheikh 2023:10.1007/s10875-022-01399-y}" "" "c.509C>T" "Ser148, located at a conserved position among serpins (93%), is a position within the shutter domain and forms H-bond of backbone of conserved positions Ser151, Asn269 and Val468" "Germline" "yes" "rs281875169" "0" "" "" "g.57600336C>T" "{CV:000068252}" "likely pathogenic" "ACMG"
"0000499066" "0" "99" "11" "57367812" "57367812" "subst" "0" "03256" "SERPING1_000165" "g.57367812C>T" "" "{PMID:Verpy 1996:8755917} {DOI:Roche 2005:10.1002/humu.20197}" "" "2656C>T" "Variant c.512C>T affects Pro149, a highly conserved position among serpins (90%), location N-terminus of helix B; shutter.\r\nIn C1Inh structure, Pro149 residue forms tight turn, with variants at this position disturbing β-sheet A subsequently resulting in the formation of loop-sheet polymers.\r\nHomologous to Pro54 position of A1AT.\r\nRelated to SERPINC1 variant c.(Pro112Thr), Pro80 position.\r\nc.512C>T variant has been considered as a likely pathogenic variant by ClinVar submitter, GeneDx Gaithersburg MA\r\nVariant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "" "rs1064793350" "0" "" "" "g.57600339C>T" "{CV:000418660}" "likely pathogenic" "ACMG"
"0000499181" "0" "99" "11" "57367850" "57367850" "subst" "0" "03256" "SERPING1_000166" "g.57367850G>A" "0/10680" "{PMID:Verpy 1996:8755917} {DOI:Zhang 1998:10.1093/hmg/7.5.919} {PMID:Pappalardo 2000:11112899} {PMID:Zuraw 2000:10719305} {PMID:Roche 2005:15971231} {PMID:Bygum 2011:20804470} {DOI:de la Cruz 2012:10.1016/j.imlet.2011.07.011} {PMID:Xu 2012:22994404}{DOI:Martinho 2013:10.1016/j.molimm.2012.09.003} {DOI:Madsen 2014: 10.1371/journal.pone.0112051}{DOI:Johnsrud 2015:10.1371/journal.pone.0131637} {DOI:Andrejević 2015:10.1371/journal.pone.0142174} {PMID:Grodecká 2017:28359783} {DOI:Gábos 2019:10.2478/rrlm-2019-0029} {DOI:Liu 2019:10.1684/ejd.2018.3487} {DOI:Veronez 2019:10.3389/fmed.2019.00028 } {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Maia 2019:10.1111/all.13699} {DOI:Hashimura 2021:10.1111/all.15034} {DOI:Veronez 2021:10.1016/j.jaip.2020.11.039} {DOI:Förster 2021:10.1186/s13023-021-02021-x} {DOI:Wang 2022:10.1186/s41065-022-00242-z} {DOI:Kanepa 2023:10.1186/s13223-023-00783-6} {DOI:Grombirikova 2023:10.1007/s10875-023-01565-w} {DOI:Jiang 2024:10.1186/s13023-024-03306} {DOI:Mak 2025:10.1111/cea.70001} {DOI:Ferriani 2025:10.1016/j.jaip.2025.08.026} {DOI:Jiang 2025:10.22541/au.176675056.63979689/v1} {DOI:Mendoza-Alvarez 2026:10.21203/rs.3.rs-10662999/v1}" "" "c.550G>A" "Highly recurrent variant with more than 25 pedigrees carrying the variant.\r\nOne Italian proband with a de novo mutation.\r\nProtein change with p.Asp18Glyfs*26 or p.Gly184Serfs*72 (NMD?).\r\nVariant affecting the last nt of exon 3, 1 nt from donor site, with impact on splicing and subsequent 95% skipping of exon 3, as demonstrated by Grodecká 2017, doi:10.1016/j.clim.2017.03.010.\r\nAccording to Splicing Pipeline Prediction SPiP, the risk for the variant to alter splicing is 98.41 % [91.47% - 99.96%].\r\nGly162, located at the end of helix B, shutter domain, is a conserved residue among serpins (80%), forms tight turn and packs against conserved position Phe214 that is possibly disrupted by the Gly to Glu transition. In vitro transfection investigation suggests that c.550G>A variant may result in the aggregation of C1-INH in the endoplasmic reticulum, with subsequent impaired secretion.\r\nConsidered pathogenic with the ACMG criteria: PS1, PS2_Str, PS3, PS4_Str, PM2, PP1, PP2, PP4.\r\nVariant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "De novo" "yes" "rs281875170" "0" "" "" "g.57600377G>A" "{CV:000068253}" "pathogenic" "ACMG"
"0000499186" "0" "99" "11" "57369544" "57369544" "subst" "0" "03256" "SERPING1_000167" "g.57369544T>A" "" "{DOI:Steiner 2017:10.1111/cei.12941} {DOI:Ponard 2019:10.1002/humu.23917}" "" "g.9518T>A" "Recurrent variant.\r\nThe c.587T>A variant in SERPING1 meets ACMG/ClinGen criteria to be classified as likely pathogenic: PS4_Sup, PP1_Mod, PP4_Mod, PP2, PM2_Sup, BP4.\r\nIntroduced in ClinVar as VUS by Central Haematology Laboratory, Luzerner Kantonsspital, Lucerne Switzerland and as likely pathogenic by DNA-diagnostics Laboratory, Research Centre For Medical Genetics, Moscow Russia." "Germline" "yes" "rs1554995255" "0" "" "" "g.57602071T>A" "{CV:000252940}" "likely pathogenic" "ACMG"
"0000499235" "21" "99" "11" "57369554" "57369554" "subst" "0" "03256" "SERPING1_000168" "g.57369554C>G" "0/78700" "{DOI:Guarino 2006:10.1111/j.1399-0004.2006.00643.x}" "" "c.597C>G" "Gonadal mosaicism in a family in which only both sons but not the parents show clinical and laboratory findings typical of HAE. Parental mosaicism investigated using DHPLC.\r\nHaplotype analysis : microsatellite markers carried by affected brothers fit with maternal haplotype.\r\nVariant c.597C>G not detected in DNA derived from buccal cells, urinary cells, hair roots and cultured fibroblasts from the mother." "Uniparental disomy, maternal allele" "yes" "rs121907951" "0" "" "" "g.57602081C>G" "{CV:000003957}" "pathogenic" "ACMG"
"0000499256" "3" "99" "11" "57369603" "57369603" "delins" "0" "03256" "SERPING1_000169" "g.57369603delinsTCAGTGTCGTG" "" "{PMID:Bafunno 2013:23688413}, {DOI:Bafunno 2013:10.1016/j.jaci.2013.04.006}" "" "c.[646delinsTCAGTGTCGTG];[646delinsTCAGTGTCGTG]" "Both parents do not carry the variant - a deletion on one allele was excluded - demonstrating a de novo situation.\r\nThe patient displays normal level of C1q." "De novo" "-" "rs1554995271" "0" "" "" "g.57602130delinsTCAGTGTCGTG" "{CV:000487526}" "pathogenic" "ACMG"
"0000499257" "0" "99" "11" "57373486" "57373486" "subst" "0" "03256" "SERPING1_000170" "g.57373486T>C" "" "{DOI:Lopez-Lera 2011:10.1016/j.molimm.2011.07.010} {DOI:Xu 2012:10.1111/all.12024} {DOI:Maia 2019:10.1111/all.13699} {DOI:Liu 2019:10.1684/ejd.2018.3487} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Veronez 2021:10.1016/j.jaip.2020.11.039} {DOI:Ferriani 2025:10.1016/j.jaip.2025.08.026}" "" "c.689T>C" "One Spanish pedigree is presenting with a de novo proband.\r\nBrazilian family is presenting with a de novo proband.\r\nThe variation introduces a Pro residue at Leu230 position in a turn between sheet 2A and helix E.\r\nThe c.689T>C variant meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PP4_Str, PM6, PS2_Str, PS4_Mod, PP3_Mod, PM2_Sup, PP1" "De novo" "yes" "rs281875171" "0" "" "" "g.57606013T>C" "{CV:000068254}" "pathogenic" "ACMG"
"0000499258" "0" "99" "11" "57373549" "57373549" "subst" "0" "03256" "SERPING1_000171" "g.57373549T>C" "" "{DOI:Cagini 2016:10.1515/hsz-2015-0222} {DOI:Veronez 2019:10.3389/fmed.2019.00028} {DOI:Veronez 2021:10.1016/j.jaip.2020.11.039} {DOI:Ryø 2023:10.1016/j.jaci.2023.04.023} {DOI:Ferriani 2025:10.1016/j.jaip.2025.08.026}" "" "c.752T>C" "Single proband with asymptomatic parents suggesting a de novo mutation.\r\np.(Leu251Pro) is a dominant-negative variant; p.(Leu251Pro) variant product accumulates into cell, affecting transport and secretion of normal C1-INH.\r\nLeu229 residue is localized at the junction between sheet 1A and helix E; a Leu to Pro transition might affect the shutter functional region, with an increased susceptibility to oligomerization, as demonstrated by Ryø 2023." "Germline/De novo (untested)" "yes" "rs1554995774" "0" "" "" "g.57606076T>C" "{CV:000432141}" "pathogenic (dominant)" "ACMG"
"0000499259" "0" "99" "11" "57373668" "57373668" "subst" "0" "03256" "SERPING1_000172" "g.57373668A>C" "" "{DOI:Gösswein 2008:10.1159/000138883} {DOI:Haslund 2019:10.1172/JCI98869} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "c.871A>C" "One pedigree with a proband presenting with a de novo mutation.\r\nVariant at a highly conserved position (85%) among serpins; Asn269 located in β-sheet 3A; shutter functional domain.\r\nVariant product with high susceptibility to oligomerization, with p.(Asn291His) developing cell aggregates with wild-type C1-INH: functional studies demonstrate a damaging effect.\r\nc.871A>C variant meets ACMG pathogenicity criteria PS2, PS3, PM2, PM6, PP2, PP4, PP5, and characterized pathogenic by InterVar; it has been considered likely pathogenic by University of Thessaly and pathogenic by GeneDx Gaithersburg MA." "De novo" "yes" "rs1057520366" "0" "" "" "g.57606195A>C" "{CV:000378573}" "pathogenic" "ACMG"
"0000499260" "0" "99" "11" "57373886" "57373886" "subst" "0" "03256" "SERPING1_000173" "g.57373886T>C" "" "{DOI:Xu 2012:10.1111/all.12024} {DOI:Liu 2019:10.1684/ejd.2018.3487} {DOI:Ponard 2019:10.1002/humu.23917}" "" "c.895T>C" "Variant p.(Trp299Arg) at a highly conserved position among serpins (94%); Trp277 location in β-sheet A, s3A; gate.\r\nTrp277 location in buried hydrophobic, it packs against conserved positions in a turn (Phe281) and s2B (Leu327)" "Germline" "yes" "rs281875173" "0" "" "" "g.57606413T>C" "{CV:000068256}" "likely pathogenic" ""
"0000499261" "0" "99" "11" "57373886" "57373886" "subst" "0" "03256" "SERPING1_000174" "g.57373886T>G" "" "{DOI:Yamamoto 2012:10.1097/MAJ.0b013e31822bdb65} {DOI:Hashimura 2021:10.1111/all.15034}" "" "c.895T>G" "Trp277 at a highly conserved position among serpins (94%); Trp277 location in β-sheet A, s3A; gate.\r\nTrp277 is located in buried hydrophobic, it packs against conserved positions in a turn (Phe281) and s2B (Leu327)" "Germline" "yes" "" "0" "" "" "g.57606413T>G" "" "likely pathogenic" "ACMG"
"0000499263" "0" "99" "11" "57379266" "57379266" "del" "0" "03256" "SERPING1_000176" "g.57379266del" "" "{DOI:Kalmar 2003:10.1002/humu.9202} {DOI:Lopez-Lera 2011:10.1016/j.molimm.2011.07.010} {DOI:Bors 2013:10.1016/j.jaci.2012.11.015} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Guryanova 2019:10.29235/1814-6023-2019-16-3-349-356} {DOI:Guryanova 2021:10.1186/s12948-021-00141-0} {DOI:Szabo 2022:10.3389/falgy.2022.836465} {DOI:Troldborg 2024:10.1016/j.jaci.2024.03.028}" "" "14107delA (traditional)" "Highly recurrent variant.\r\nVariant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "De novo" "yes" "rs1565173309" "0" "" "" "g.57611793del" "{CV:000626355}" "pathogenic" "ACMG"
"0000499264" "0" "99" "11" "57381873" "57381873" "subst" "0" "03256" "SERPING1_000177" "g.57381873T>C" "" "{DOI:Gösswein 2008:10.1159/000138883} {DOI:Xu 2012:10.1111/all.12024} {DOI:Haslund 2019:10.1172/JCI98869} {DOI:Obtulowicz 2020:10.5114/ceji.2020.101252}" "" "c.1322T>C" "Variant product p.(Met441Thr) likely to oligomerize, with attribution of c.1322T>C variant to class III (ie., conformational transition with spontaneous self or mutual insertion of the RCL)." "Germline" "yes" "rs281875175" "0" "" "" "g.57614400T>C" "{CV:000068245}" "likely pathogenic" "ACMG"
"0000499266" "10" "99" "11" "57381908" "57381909" "ins" "0" "03256" "SERPING1_000178" "g.57381908_57381909insTGT" "" "{PMID:Siddique 1993:8396558}" "" "16749_16750insTGT" "C1 Inhibitor protein expression in the normal range; serpin function below 5% of normal.\r\nVariant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "rs606231141" "0" "" "" "g.57614435_57614436insTGT" "{CV:000003954}" "pathogenic" "ACMG"
"0000499268" "0" "99" "11" "57381923" "57381923" "subst" "0" "03256" "SERPING1_000179" "g.57381923G>A" "" "{PMID:Levy 1990:2296585} {PMID:Davis 1992:1363816}{PMID:Aulak 1993:8349686} {DOI:Pappalardo 2008:0.1016/j.molimm.2008.05.00} {DOI:Suffritti 2014:10.1111/cea.12293} {DOI:Bafunno 2014:10.1111/ahg.12052} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Förster 2021:0.1186/s13023-021-02021-x}" "" "16764G>A (traditional)" "Recurrent variant.\r\nItalian patient samples exhibit a high level of circulating cleaved HK species, with 31.6% to 48.41% of total HK, consistent with an involvement of kallikrein-kinin system.\r\nA real HAE-II variant. Aligned to P9 in A1AT. Ala436 is a RCL position of the hinge region whose side chain becomes buried upon RCL incorporation. p.(Ala458Thr), unlike similar variants of other serpins, is not cleavable by target proteases. By increasing the interaction with Lys307 or Lys306, the RCL of p.(Ala458Thr) packs even better in the loop-inserted latent structure than in that of the wild-type residue. Subsequently it favours overinsertion up to P9 with release of s1C from the β-sheet C likely to prevent RCL cleavage; this process prones p.(Ala458Thr) to oligomerize.\r\nSimilar with the p.(Gly373Arg) of SERPINA1, a functionally inactive variant of AAT : Laffranchi et al. 2019; PLoS ONE 14(1): e0206955.\r\nIntroduced in ClinVar as pathogenic by OMIM.\r\nIntroduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "rs121907947" "0" "" "" "g.57614450G>A" "{CV-SCV:000024317.3}" "pathogenic" "ACMG"
"0000499269" "0" "99" "11" "57381969" "57381969" "subst" "0" "03256" "SERPING1_000180" "g.57381969T>G" "" "{DOI:Blanch 2002:10.1002/humu.9073} {DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Suffritti 2014:10.1111/cea.12293} {DOI:Xu 2012:10.1111/all.12024} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Gábos 2019:10.2478/rrlm-2019-0029} {DOI:Liu 2019:10.1684/ejd.2018.3487} {DOI:Loli-Ausejo 2021:10.1007/s12016-021-08834-9}{DOI:[1]:[2]}" "" "16810T>G (traditional)" "Recurrent variant at a conserved position among serpins; Val451 residue located within the loop s1C/s4B and belongs to the gate functional domain. As it is displaced during RCL insertion, losing a Val451 that serves to make the gate mobile is expected with important consequence for establishing the serpin-protease complex, then classifying p.(Val451Gly) within class II.\r\nThe Italian patient samples exhibit a high level of circulating cleaved HK species, with 33.0% to 38.0% of total HK, in line with an activation of kallikrein-kinin system.\r\nConsidered pathogenic according to ACMG criteria PS3, PS4, PM1, PP1, PP3, PP4.\r\nIntroduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "rs281875177" "0" "" "" "g.57614496T>G" "{CV:000068248}" "pathogenic" "ACMG"
"0000499270" "0" "99" "11" "57382041" "57382041" "subst" "0" "03256" "SERPING1_000181" "g.57382041A>G" "" "{DOI:Xu 2012:10.1111/all.12024} {DOI:Liu 2019:10.1684/ejd.2018.3487}" "" "c.1490A>G" "Low antigenic C1 Inhibitor. No C1 Inhibitor function provided.\r\nThe c.1490A>G variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as likely pathogenic: PP4_Str, PS4_Mod, PM2_Sup, PP2, PP3.\r\nSubmitted to ClinVar as likely pathogenic by Research Centre For Medical Genetics, Moscow Russia." "Germline" "" "rs281875178" "0" "" "" "g.57614568A>G" "{CV:000068249}" "likely pathogenic" "ACMG"
"0000499467" "1" "50" "11" "57365118" "57365118" "subst" "0" "03256" "SERPING1_000182" "g.57365118C>G" "0.0002 (1000Genomes)" "{PMID:Verpy 1996:8755917} {DOI:Ponard 2019:10.1002/humu.23917}" "" "c.-40C>T" "Pathogenic variant when in a cis configuration with variant c.506T>C. \r\nVariant c.-100C>G affecting a pyrimidine-rich region (c.-108 to c.-77) of potential H-DNA structure." "Germline" "yes" "rs578018379" "0" "" "" "g.57597645C>G" "{CV:000877957}" "VUS" "ACMG"
"0000499468" "1" "99" "11" "57381993" "57381993" "subst" "0" "03256" "SERPING1_000183" "g.57381993T>C" "" "{DOI:Verpy 1995:10.1172/JCI117663} {PMID:Verpy 1996:8755917} {DOI:Nabilou 2020:10.1080/08820139.2020.1817068}" "" "[Q452E;L459P]" "French pedigree (Verpy 1996), with 2 variants in a cis configuration.\r\np.(Gln474Glu) exhibits little or no effect on C1 inhibitor protein structure or function (benign variant), whereas in vitro secretion of p.(Leu481Pro) is abolished (pathogenic variant).\r\nThe c.1442T>C variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PP4_Str, PS4_Mod, PP3_Mod, PS3_Sup, PM2_Sup, PP1, PP2, PP4_Mod." "De novo" "yes" "" "0" "" "" "g.57614520T>C" "{CV-SCV:005088639.1}" "pathogenic" "ACMG"
"0000499619" "0" "33" "11" "57367467" "57367467" "subst" "0.00376416" "03256" "SERPING1_000184" "g.57367467T>C" "0.001681 (gnomAD v4); 0.004070 (ExAC); 0.004324 (TOPMed)" "{DOI:Khang 2006:10.1111/j.1398-9995.2006.01010.x} {PMID:Lu 2010:20062564} {DOI:Xu 2012:10.1111/all.12024}" "" "c.167T>C" "The variant meets the ACMG criterion BA1" "Germline" "" "rs11546660" "0" "" "" "g.57599994T>C" "{CV-SCV:004746979.2}" "likely benign" "ACMG"
"0000499620" "0" "99" "11" "57382031" "57382031" "subst" "0" "03256" "SERPING1_000008" "g.57382031C>T" "6.196e-7" "{PMID:Verpy 1996:8755917} {PMID:Bissler 1997:9069585} {PMID:Zuraw 2000:10719305} {PMID:Kalmár 2003:14635117} {PMID:Bygum 2011:20804470} {PMID:Martinho 2013:23123409} {DOI:Andrejević 2015:10.1371/journal.pone.0142174} {PMID:Cagini 2016:26812872} {DOI:Suffritti 2014:10.1111/cea.12293} {PMID:Maia 2019:30556912} {DOI:Serpa 2019:10.1016/j.anai.2018.11.026} {DOI:Veronez 2019:10.3389/fmed.2019.00028} {DOI:Liu 2019:10.1684/ejd.2018.3487} {PMID:Ponard 2019:31517426} {PMID:Nabilou 2020:32896191}{DOI:Hashimura 2021:10.1111/all.15034} {DOI:Veronez 2021:10.1016/j.jaip.2020.11.039} {DOI:Loli-Ausejo 2021:10.1007/s12016-021-08834-9} {DOI:Förster 2021:0.1186/s13023-021-02021-x} {DOI:Wang 2022:10.1186/s41065-022-00242-z}{DOI:Seikh 2022:10.1007/s10875-022-01399-y} {DOI:Szabo 2022:10.3389/falgy.2022.836465} {DOI:Sheikh 2023:10.1007/s10875-022-01399-y} {DOI:Roosens 2024:10.1016/j.jaip.2024.12.023} {DOI:Troldborg 2024:10.1016/j.jaci.2024.03.028} {DOI:Pinhal 2024:10.3389/falgy.2025.1604440} {DOI:Ferriani 2025:10.1016/j.jaip.2025.08.026} {DOI:Rodriguez Espada 2025:10.1182/bloodadvances.2025017220} {DOI:Ren 2026:10.3389/fimmu.2026.1828352} {DOI:Mendoza-Alvarez 2026:10.21203/rs.3.rs-10662999/v1}" "" "16872C>T (traditional)" "Highly recurrent variant.\r\nVariant observed in 3 probands with a de novo condition. More than 20 probands have been recognized as presenting with HAE-C1INH.\r\nVariant product p.(Arg494*) demonstrated to be expressed in circulation, with subsequent identification of an intermediate type: low antigenic C1-INH, no oligomers, no serpin-protease associations - non functional variant protein - detected in circulation (anti-C1-INH immunoblot), then classifying p.(Arg494*) within class II.\r\nOne French family is presenting with a compound heterozygous situation [c.(-21)T>C];[c.1480C>T]\r\nACMG classification as Class 5, pathogenic\r\nc.1480C>T variation meets ACMG criteria PVS1, PS2_Str, PS3_Supp, PS4_Very Str, PM2, PP1, PP4_Mod; established as pathogenic by using Intervar on-line system.\r\nClinVar: recognized as pathogenic by multiple submitters." "De novo" "yes" "rs922149386" "0" "" "" "g.57614558C>T" "{CV:000626347}" "pathogenic" "ACMG"
"0000499665" "3" "77" "11" "57365723" "57365723" "subst" "0.0289261" "03256" "SERPING1_000658" "g.57365723T>C" "0.04177 (gnomAD v4) 0.014577 (1000Genomes)" "{DOI:Duponchel 2006:10.1002/humu.9414} {DOI:Rijavec 2013:10.1371/journal.pone.0056712}" "" "c.-21T>C" "exon 2 skipped (minigene transfected in Hep3B cells); variant likely pathogenic when homozygous\r\n\r\nAverage frequency (large NGS studies) 0.02415 \r\nFreq EA 264/8028\r\nFreq AA 27/4024\r\n(omner Ivo F.A.C. Fokkema)" "Germline" "no" "rs28362944" "0" "" "" "g.57598250T>C" "{CV-SCV:001926743.1}" "likely pathogenic (recessive)" "ACMG"
"0000499666" "3" "77" "11" "57365055" "57365055" "subst" "0" "03256" "SERPING1_000185" "g.57365055C>T" "0.000007 (gnomAD)" "{PMID:Verpy 1996:8755917}" "" "c.[-103C>T];[-103C>T]" "c.-163C>T variant is the sole idiomorphic nucleotide change in the kindred, found homozygous in the proband, at variance with the dominant mode of transmission observed for structural mutations.\r\nPathogenic when homozygous, with severe HAE. and low C1-INH levels; homozygosity because of consanguinity.\r\nVariant altering the first nucleotide of a putative CAAT box, the first promoter variant reported in the SERPING1 gene.\r\nIn contrast, heterozygous individuals display C1-INH levels within the normal range, although often at its lower level, and were free of angioedema attacks." "Germline" "no" "rs1387768389" "0" "" "" "g.57597582C>T" "{CV:000003956}" "pathogenic (recessive)" "ACMG"
"0000499667" "3" "77" "11" "57365057" "57365057" "subst" "0" "03256" "SERPING1_000186" "g.57365057A>G" "0.0000319 (gnomAD)" "{DOI:Büyüköztürk 2009:10.1016/j.jaci.2008.12.022} {DOI:Kesim 2011:10.1159/000323915}" "" "c.-101A>G" "Putatively disrupts CAAT box.\r\nOne homozygous proband presenting with a HAE-I phenotype; two homozygous affected siblings.\r\nHeterozygous carriers have been recorded as unaffected indicating a recessive c.-(161)A>G variant.\r\nIntroduced in ClinVar by Research Centre for Medical Genetics, Moscow Russia that indicated variant -161A>G meets ACMG /ClinGen criteria to be classified as pathogenic: PS3, PP1_Str, PS4_Mod, PM2_Sup.\r\nErroneously published as c.-101A>G" "Germline" "no" "rs766344850" "0" "" "" "g.57597584A>G" "{CV-SCV:005061388.1}" "pathogenic (recessive)" "ACMG"
"0000499668" "0" "99" "11" "57367419" "57367441" "dup" "0" "03256" "SERPING1_000187" "g.57367419_57367441dup" "" "{DOI:Bygum 2011:10.1111/j.1398-9995.2010.02456.x}" "" "c.119_141dup; c.[-(21)T>C];[119_141dup]" "Danish family presenting with a compound heterozygous combination c.[-(21)T>C];[119_141dup]" "Germline" "yes" "" "0" "" "" "g.57599946_57599968dup" "" "pathogenic" "ACMG"
"0000499669" "0" "99" "11" "57367443" "57367444" "del" "0" "03256" "SERPING1_000188" "g.57367443_57367444del" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Bygum 2011:10.1111/j.1398-9995.2010.02456.x} {DOI:Xu 2012:10.1111/all.12024} {DOI:Veronez 2019:10.3389/fmed.2019.00028} {DOI:Liu 2019:10.1684/ejd.2018.3487} {DOI:Mendoza-Alvarez 2022:10.3389/fimmu.2022.997148} {DOI:Markocsy 2024:10.1016/j.waojou.2024.100885} {DOI:Mendoza-Alvarez 2026:10.21203/rs.3.rs-10662999/v1}" "" "c.143_144delCA" "Recurrent variant" "Germline" "yes" "" "0" "" "" "g.57599970_57599971del" "" "pathogenic" "ACMG"
"0000499670" "0" "99" "11" "57367737" "57367737" "del" "0" "03256" "SERPING1_000189" "g.57367737del" "" "{DOI:Bygum 2011:10.1111/j.1398-9995.2010.02456.x}" "" "c.437del" "The c.437delT variant in SERPING1 meets ACMG/ClinGen criteria to be classified as pathogenic: PVS1, PP4_Str, PS4_Mod, PM2_Sup" "Germline" "yes" "" "0" "" "" "g.57600264del" "{CV-SCV:005186229.1}" "pathogenic" "ACMG"
"0000499672" "0" "99" "11" "57365783" "57365792" "del" "0" "03256" "SERPING1_000191" "g.57365783_57365792del" "" "{DOI:Gösswein 2008:10.1159/000138883}" "" "c.40_49del" "" "Germline" "" "" "0" "" "" "g.57598310_57598319del" "" "likely pathogenic" "ACMG"
"0000499673" "0" "99" "11" "57367394" "57367394" "del" "0" "03256" "SERPING1_000192" "g.57367394del" "" "{DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "c.94del" "" "Germline" "" "" "0" "" "" "g.57599921del" "" "pathogenic" ""
"0000499675" "0" "99" "11" "57367497" "57367497" "del" "0" "03256" "SERPING1_000194" "g.57367497del" "" "{DOI:Gösswein 2008:10.1159/000138883}" "" "c.196delC" "This variant has been erroneously identified by Gösswein 2008 as c.196delC - g.2340delC (traditional numbering)" "Germline" "yes" "" "0" "" "" "g.57600024del" "" "likely pathogenic" "ACMG"
"0000499676" "0" "99" "11" "57367518" "57367518" "del" "0" "03256" "SERPING1_000195" "g.57367518del" "" "{DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "c.218del" "Variant submitted in ClinVar as pathogenic by InVitae, San Francisco CA" "Germline" "yes" "rs2495425553" "0" "" "" "g.57600045del" "{CV-SCV:004540567.1}" "pathogenic" "ACMG"
"0000499679" "0" "99" "11" "57367552" "57367716" "del" "0" "03256" "SERPING1_000196" "g.57367552_57367716del" "" "{DOI:Bos 2003:10.1074/jbc.M302977200}" "" "c.250_414del" "In-frame deletion of 55 residues with consequences on the serpin domain of C1-INH" "Germline" "yes" "" "0" "" "" "g.57600079_57600243del" "" "pathogenic" "ACMG"
"0000499680" "0" "99" "11" "57367575" "57367575" "del" "0" "03256" "SERPING1_000197" "g.57367575del" "" "{DOI:Gösswein 2008:10.1159/000138883}" "" "c.275del" "" "Germline" "yes" "" "0" "" "" "g.57600102del" "" "pathogenic" "ACMG"
"0000499684" "0" "99" "11" "57367629" "57367641" "del" "0" "03256" "SERPING1_000198" "g.57367629_57367641del" "" "{DOI:Gösswein 2008:10.1159/000138883} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Förster 2021:0.1186/s13023-021-02021-x}" "" "c.325_337del" "This variant has been initially identified using Sanger sequencing and published by Gösswein et al 2008 as c.325_337del13bp; 2 families, 6 affected individuals. It has been next investigated using NGS by Loules, 2018.\r\nFor this variant, the HGVS notation prescribes that on the forward strand it should be \"CAACAGATTCTCC\" at position c.329_341.\r\nSubsequently a c.329_341del variant has been introduced, in line with the HGVS nomenclature." "Germline" "yes" "" "0" "" "" "g.57600156_57600168del" "{CV-SCV:006580263.1}" "pathogenic" "ACMG"
"0000499690" "0" "99" "11" "57367658" "57367677" "dup" "0" "03256" "SERPING1_000199" "g.57367658_57367677dup" "" "{DOI:Gösswein 2008:10.1159/000138883} {DOI:Förster 2021:10.1186/s13023-021-02021-x}" "" "c.359_378dup" "c.358_377dup variant is probably homologous with c.359_378dup identified by {DOI:Speletas 2015:10.1016/j.jaci.2014.08.007} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "Germline" "yes" "" "0" "" "" "g.57600185_57600204dup" "" "pathogenic" "ACMG"
"0000499697" "0" "99" "11" "57367651" "57367663" "del" "0" "03256" "SERPING1_000200" "g.57367651_57367663del" "" "{DOI:Speletas 2015:10.1016/j.jaci.2014.08.007}" "" "c.350_362del" "" "Germline" "yes" "" "0" "" "" "g.57600178_57600190del" "" "pathogenic" "ACMG"
"0000499704" "0" "99" "11" "57367759" "57367759" "del" "0" "03256" "SERPING1_000201" "g.57367759del" "" "{DOI:Gösswein 2008:10.1159/000138883}" "" "c.459del" "" "Germline" "yes" "" "0" "" "" "g.57600286del" "" "pathogenic" "ACMG"
"0000499739" "0" "99" "11" "57367692" "57367693" "del" "0" "03256" "SERPING1_000203" "g.57367692_57367693del" "" "{DOI:Kalmár 2003:10.1002/humu.9202} {DOI:Speletas 2015:10.1016/j.jaci.2014.08.007} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Szabo 2022:10.3389/falgy.2022.836465} {DOI:Troldborg 2024:10.1016/j.jaci.2024.03.028}" "" "2534_2535delCT (traditional)" "Initially identified as c.390_391del; the HGVS notation prescribes that on the forward strand it should be \'CT\' at c.392_393del.\r\nVariant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "" "0" "" "" "g.57600219_57600220del" "" "pathogenic" "ACMG"
"0000499742" "0" "99" "11" "57367744" "57367754" "del" "0" "03256" "SERPING1_000204" "g.57367744_57367754del" "" "{DOI:Gösswein 2008:10.1159/000138883}" "" "c.444_454del" "" "Germline" "yes" "" "0" "" "" "g.57600271_57600281del" "" "pathogenic" "ACMG"
"0000499748" "0" "99" "11" "57367808" "57367808" "del" "0" "03256" "SERPING1_000190" "g.57367808del" "" "{DOI:Speletas 2015:10.1016/j.jaci.2014.08.007} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "c.508del" "Variant initially identified by Sanger has been validated using NGS by Loules 2018.\r\nMeets ACMG criteria PVS1, PS1, PM2, PP4." "Germline" "yes" "rs1590822739" "0" "" "" "g.57600335del" "{CV:000690354}" "pathogenic" "ACMG"
"0000499749" "0" "99" "11" "57369531" "57369543" "del" "0" "03256" "SERPING1_000205" "g.57369531_57369543del" "" "{DOI:Gösswein 2008:10.1159/000138883}" "" "c.573_585del" "Duplication of sequence AAACCTGGAGAGC has been introduced at position g.5738585 by Gösswein 2008; however the HGVS notation prescribes that on the forward strand it should be AACCTGGAGAGCA at position c.574_586." "Germline" "yes" "" "0" "" "" "g.57602058_57602070del" "" "pathogenic" "ACMG"
"0000499750" "0" "99" "11" "57369543" "57369546" "del" "0" "03256" "SERPING1_000206" "g.57369543_57369546del" "" "{DOI:Speletas 2015:10.1016/j.jaci.2014.08.007} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "c.586_589del" "The variant is considered pathogenic according to ACMG Guidelines and meets criteria PVS1, PM2, PP1, PP4" "Germline" "yes" "rs1565170287" "0" "" "" "g.57602070_57602073del" "{CV:000626356}" "pathogenic" "ACMG"
"0000499751" "0" "99" "11" "57369609" "57369610" "del" "0" "03256" "SERPING1_000207" "g.57369609_57369610del" "" "{DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Gábos 2019:10.2478/rrlm-2019-0029}" "" "c.650_651delGT" "Loules 2019 recorded a c.650_651delGT variant, with p.(Val218Hisfs*38).\r\nHGVS prescribes that on the forward strand it should be GT at position c.652_653; this guideline has been retained for the current introduction in the database." "Germline" "yes" "" "0" "" "" "g.57602136_57602137del" "" "pathogenic" "ACMG"
"0000499752" "0" "99" "11" "57369623" "57369624" "del" "0" "03256" "SERPING1_000208" "g.57369623_57369624del" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Hashimura 2021:10.1111/all.15034} {DOI:Wang 2022:10.1186/s41065-022-00242-z} {DOI:Salih 2023:/10.1016/j.jaip.2022.11.045} {DOI:Mendoza-Alvarez 2026:10.21203/rs.3.rs-10662999/v1}" "" "c.662del" "The c.666_667del is a pathogenic variant in agreement with the ACMG guidelines: PVS1, PP4_Str, PS4_Mod, PM2_Sup" "Germline" "yes" "" "0" "" "" "g.57602150_57602151del" "{CV-SCV:005186254.1}" "pathogenic" "ACMG"
"0000499753" "0" "99" "11" "57373487" "57373487" "delins" "0" "03256" "SERPING1_000209" "g.57373487delinsTCCCTTAT" "" "{DOI:Gösswein 2008:10.1159/000138883}" "" "c.690delGCCATAAinsTCCCTTAT" "Variant to be probably replaced by c.690_696delinsTCCCTTAT" "Germline" "yes" "" "0" "" "" "g.57606014delinsTCCCTTAT" "" "pathogenic" "ACMG"
"0000499801" "0" "99" "11" "57373502" "57373502" "del" "0" "03256" "SERPING1_000210" "g.57373502del" "" "{DOI:Speletas 2015:10.1016/j.jaci.2014.08.007} {DOI:Szabo 2022:10.3389/falgy.2022.836465}" "" "c.705del" "" "Germline" "yes" "" "0" "" "" "g.57606029del" "" "pathogenic" "ACMG"
"0000499802" "0" "99" "11" "57373524" "57373524" "del" "0" "03256" "SERPING1_000211" "g.57373524del" "" "{DOI:Tarzi 2007:10.1111/j.1365-2249.2007.03438.x} {DOI:Nabilou 2020:10.1080/08820139.2020.1817068}" "" "c.727del" "" "Germline" "yes" "" "0" "" "" "g.57606051del" "" "pathogenic" "ACMG"
"0000499803" "0" "99" "11" "57373601" "57373601" "del" "0" "03256" "SERPING1_000212" "g.57373601del" "" "{DOI:Tarzi 2007:10.1111/j.1365-2249.2007.03438.x}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57606128del" "" "pathogenic" "ACMG"
"0000499804" "0" "99" "11" "57373588" "57373611" "del" "0" "03256" "SERPING1_000213" "g.57373588_57373611del" "" "{DOI:Gösswein 2008:10.1159/000138883}" "" "c.790_813del" "In-frame deletion of 8 residues, with a deletion of the C-terminal third of peptide sequence of helix F" "Germline" "yes" "" "0" "" "" "g.57606115_57606138del" "" "pathogenic" "ACMG"
"0000499806" "0" "99" "11" "57373661" "57373681" "del" "0" "03256" "SERPING1_000215" "g.57373661_57373681delinsG" "" "{DOI:Gösswein 2008:10.1159/000138883}" "" "c.864_884delinsG" "" "Germline" "yes" "" "0" "" "" "g.57606188_57606208delinsG" "" "pathogenic" "ACMG"
"0000499807" "0" "99" "11" "57373912" "57373919" "del" "0" "03256" "SERPING1_000216" "g.57373912_57373919del" "" "{DOI:Lopez-Lera 2011:10.1016/j.molimm.2011.07.010} {DOI:Ponard 2019:10.1002/humu.23917}" "" "c.918_925del" "" "Germline" "yes" "" "0" "" "" "g.57606439_57606446del" "" "pathogenic" "ACMG"
"0000499808" "0" "99" "11" "57373954" "57373955" "del" "0" "03256" "SERPING1_000217" "g.57373954_57373955delinsT" "" "{DOI:Gösswein 2008:10.1159/000138883}" "" "c.963_964delinsT" "" "Germline" "yes" "" "0" "" "" "g.57606481_57606482delinsT" "" "pathogenic" "ACMG"
"0000499809" "0" "79" "11" "57373927" "57373927" "del" "0" "03256" "SERPING1_000218" "g.57373927del" "" "" "" "c.936del" "Submitted to ClinVar as pathogenic by GeneDx, Gaithersburg MD" "CLASSIFICATION record" "" "rs1085307611" "0" "" "" "g.57606454del" "{CV:000426410}" "pathogenic" "ACMG"
"0000499810" "0" "99" "11" "57373955" "57373955" "del" "0" "03256" "SERPING1_000219" "g.57373955del" "" "{DOI:Gösswein 2008:10.1159/000138883}" "" "c.964del" "Criteria applied: PVS1, PS4_Mod, PM2" "Germline" "yes" "" "0" "" "" "g.57606482del" "{CV-SCV:007105817.2}" "pathogenic" "ACMG"
"0000499811" "0" "99" "11" "57373969" "57373970" "dup" "0" "03256" "SERPING1_000220" "g.57373969_57373970dup" "" "{DOI:Roche 2005:10.1002/humu.20197}" "" "c.978_979dup" "Variant introduced in the Lund SERPING1 database https://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "" "" "0" "" "" "g.57606496_57606497dup" "" "pathogenic" "ACMG"
"0000499812" "0" "99" "11" "57374017" "57374017" "dup" "0" "03256" "SERPING1_000221" "g.57374017dup" "" "{DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "c.1027insC" "" "Germline" "" "" "0" "" "" "g.57606544dup" "" "pathogenic" "ACMG"
"0000499813" "0" "99" "11" "57379238" "57379244" "del" "0" "03256" "SERPING1_000222" "g.57379238_57379244del" "" "{DOI:Gösswein 2008:10.1159/000138883}" "" "c.1078_1084del" "" "Germline" "yes" "" "0" "" "" "g.57611765_57611771del" "" "pathogenic" "ACMG"
"0000499814" "0" "79" "11" "57379257" "57379257" "del" "0" "03256" "SERPING1_000223" "g.57379257del" "" "{DOI:Gösswein 2008:10.1159/000138883}" "" "c.1097del (HGMD)" "" "Germline" "yes" "" "0" "" "" "g.57611784del" "" "pathogenic" "ACMG"
"0000499815" "0" "99" "11" "57379287" "57379287" "dup" "0" "03256" "SERPING1_000224" "g.57379287dup" "" "{DOI:Bors 2013:10.1016/j.jaci.2012.11.015} {DOI:Speletas 2015:10.1016/j.jaci.2014.08.007} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Szabo 2022:10.3389/falgy.2022.836465}" "" "c.1127_1128insC" "predicted to lead to degradation by nonsense mediated mRNA decay (NMD) leaving no transcripts for protein production." "Germline" "" "" "0" "" "" "g.57611814dup" "" "pathogenic" "ACMG"
"0000499817" "0" "99" "11" "57379307" "57379307" "dup" "0" "03256" "SERPING1_000226" "g.57379307dup" "" "{DOI:Speletas 2015:10.1016/j.jaci.2014.08.007} {DOI:Szabo 2022:10.3389/falgy.2022.836465}" "" "c.1147_1148insA" "" "Germline" "" "" "0" "" "" "g.57611834dup" "" "pathogenic" "ACMG"
"0000499818" "0" "79" "11" "57379340" "57379340" "del" "0" "03256" "SERPING1_000227" "g.57379340del" "" "{DOI:Speletas 2015:10.1016/j.jaci.2014.08.007} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "c.1180delA" "" "Germline" "" "rs1590829763" "0" "" "" "g.57611867del" "{CV:000690356}" "pathogenic" "ACMG"
"0000499819" "0" "99" "11" "57379344" "57379344" "del" "0" "03256" "SERPING1_000228" "g.57379344del" "" "{DOI:Gösswein 2008:10.1159/000138883}" "" "c.1184delT" "" "Germline" "" "" "0" "" "" "g.57611871del" "" "pathogenic" "ACMG"
"0000499820" "0" "99" "11" "57379344" "57379345" "ins" "0" "03256" "SERPING1_000229" "g.57379344_57379345insTA" "" "{DOI:Andrejević 2015:10.1371/journal.pone.0142174}" "" "c.1184_1185insTA" "" "Germline" "yes" "" "0" "" "" "g.57611871_57611872insTA" "" "pathogenic" "ACMG"
"0000499821" "0" "99" "11" "57379349" "57379349" "dup" "0" "03256" "SERPING1_000230" "g.57379349dup" "" "{DOI:Gösswein 2008:10.1159/000138883}" "" "c.1189_90insA" "" "Germline" "" "" "0" "" "" "g.57611876dup" "" "pathogenic" "ACMG"
"0000499822" "0" "99" "11" "57379372" "57379375" "del" "0" "03256" "SERPING1_000231" "g.57379372_57379375del" "" "{DOI:Gösswein 2008:10.1159/000138883}" "" "c.1212_1215delGACC" "" "Germline" "yes" "" "0" "" "" "g.57611899_57611902del" "" "pathogenic" "ACMG"
"0000499823" "0" "99" "11" "57379376" "57379376" "del" "0" "03256" "SERPING1_000232" "g.57379376del" "" "{DOI:Gösswein 2008:10.1159/000138883}" "" "c.1216delA" "the c.1216delA variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PVS1_Str, PS4_Mod, PP4_Mod, PM2_Sup, PP1" "Germline" "yes" "" "0" "" "" "g.57611903del" "{CV-SCV:005088589.1}" "pathogenic" "ACMG"
"0000499824" "0" "99" "11" "57381904" "57381905" "del" "0" "03256" "SERPING1_000233" "g.57381904_57381905del" "variant not detected in the ExAC database" "{DOI:Yakushiji 2007:10.1001/archneur.64.5.731}{DOI:Gösswein 2008:10.1159/000138883} {DOI:Cagini 2016:10.1515/hsz-2015-0222} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Veronez 2019:10.3389/fmed.2019.00028} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Veronez 2021:10.1016/j.jaip.2020.11.039} {DOI:Ferriani 2025:10.1016/j.jaip.2025.08.026}" "" "erroneously identified as c.1351_1352del by Yakushiji 2007" "Highly recurrent pathogenic variant.\r\nc.1353_1354delGA variant is carried by pedigrees in Japan, Germany, Italy, Brazil (n=4), Greece, France.\r\nSubmitted to ClinVar as pathogenic by Department of Immunology and Histocompatibility, University of Thessaly, Greece and by InVitae, San Francisco CA and as likely pathogenic by GeneDX, Gaithersburg MD.\r\nThe variant is considered pathogenic according to ACMG Guidelines with criteria PVS1, PM2, PM4, PM6, PP4, PP5.\r\nErroneously introduced as c.1351_1352del in Lund SERPING1 database (http://structure.bmc.lu.se/idbase/SERPING1base/)." "Germline" "yes" "rs1554996833" "0" "" "" "g.57614431_57614432del" "{CV:000503707}" "pathogenic" "ACMG"
"0000499825" "0" "99" "11" "57379380" "57379380" "del" "0" "03256" "SERPING1_000432" "g.57379380del" "" "{DOI:Gösswein 2008:10.1159/000138883} {DOI:Markocsy 2024:10.1016/j.waojou.2024.100885}" "" "c.1220del" "" "Germline" "yes" "" "0" "" "" "g.57611907del" "" "pathogenic" "ACMG"
"0000499826" "0" "99" "11" "57379405" "57379405" "del" "0" "03256" "SERPING1_000235" "g.57379405del" "" "{DOI:Gösswein 2008:10.1159/000138883} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "c.1243del" "Published as c.1243del: The HGVS notation prescribes that on the forward strand it should be a ‘A’ at position c.1245, with subsequent identification of the variant as c.1245delA with unmodified protein product as p.(Lys415Asnfs*16)" "Germline" "" "" "0" "" "" "g.57611932del" "" "pathogenic" "ACMG"
"0000499827" "0" "99" "11" "57381893" "57381900" "dup" "0" "03256" "SERPING1_000236" "g.57381893_57381900dup" "" "{DOI:Speletas 2015:10.1111/all.12714} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "c.1341_1342insGAACTGAC_dupl" "The c.1342_1349dup variant is considered pathogenic according to ACMG Guidelines Criteria: PVS1, PM2, PM4, PP4.\r\nSubmitted to ClinVar as pathogenic by Department of Immunology and Histocompatibility, University of Thessaly Greece" "Germline" "" "rs1590831385" "0" "" "" "g.57614420_57614427dup" "{CV:000690349}" "pathogenic" "ACMG"
"0000499828" "0" "99" "11" "57381903" "57381903" "dup" "0" "03256" "SERPING1_000237" "g.57381903dup" "" "{DOI:Speletas 2015:10.1111/all.12714} {DOI:Steiner 2017:10.1111/cei.12941}" "" "c.1352dup" "" "Germline" "yes" "" "0" "" "" "g.57614430dup" "" "pathogenic" "ACMG"
"0000499829" "0" "79" "11" "57381917" "57381920" "del" "0" "03256" "SERPING1_000238" "g.57381917_57381920delinsA" "" "{DOI:Gösswein 2008:10.1159/000138883}" "" "c.1366_1369delGCGGInsA" "" "Germline" "" "" "0" "" "" "g.57614444_57614447delinsA" "" "pathogenic" "ACMG"
"0000499830" "0" "99" "11" "57381958" "57381978" "del" "0" "03256" "SERPING1_000239" "g.57381958_57381978del" "" "{DOI:Gösswein 2008:10.1159/000138883}" "" "c.1407_1427del21bp" "" "Germline" "yes" "" "0" "" "" "g.57614485_57614505del" "" "pathogenic" ""
"0000499831" "0" "99" "11" "57381959" "57381959" "dup" "0" "03256" "SERPING1_000240" "g.57381959dup" "" "{PMID:Verpy 1996:8755917} {DOI:Speletas 2015:10.1111/all.12714} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Förster 2021:0.1186/s13023-021-02021-x}" "" "c.1409_1410insG" "" "Germline" "yes" "" "0" "" "" "g.57614486dup" "" "likely pathogenic" "ACMG"
"0000499832" "0" "99" "11" "57381961" "57381961" "del" "0" "03256" "SERPING1_000241" "g.57381961del" "" "{DOI:Lopez-Lera 2011:10.1016/j.molimm.2011.07.010}" "" "c.1410del" "Proband carrying the variant c.1410del in a de novo situation\r\nVariant c.1410del interpreted as pathogenic according to ACMG criteria PS2_Str, PS3, PM2, PP4" "De novo" "yes" "" "0" "" "" "g.57614488del" "" "pathogenic" "ACMG"
"0000499833" "0" "99" "11" "57381971" "57381971" "dup" "0" "03256" "SERPING1_000242" "g.57381971dup" "" "{DOI:Gösswein 2008:10.1159/000138883}" "" "c.1420_1421insC" "" "Germline" "" "" "0" "" "" "g.57614498dup" "" "pathogenic" "ACMG"
"0000499860" "0" "99" "11" "57381983" "57381983" "del" "0" "03256" "SERPING1_000243" "g.57381983del" "" "{PMID:El-Meguid 2008:20306692} {DOI:Gösswein 2008:10.1159/000138}" "" "c.1432delC" "" "Germline" "yes" "" "0" "" "" "g.57614510del" "" "pathogenic" "ACMG"
"0000499861" "0" "99" "11" "57382017" "57382017" "del" "0" "03256" "SERPING1_000244" "g.57382017del" "" "{DOI:Bors 2013:10.1016/j.jaci.2012.11.015} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Szabo 2022:10.3389/falgy.2022.836465}" "" "c.1466del" "" "Germline" "yes" "" "0" "" "" "g.57614544del" "" "pathogenic" "ACMG"
"0000499862" "0" "99" "11" "57382017" "57382017" "dup" "0" "03256" "SERPING1_000245" "g.57382017dup" "" "{DOI:Lopez-Lera 2011:10.1016/j.molimm.2011.07.010} {DOI:Pedrosa 2016:10.1007/s10875-015-0222-9} {DOI:Loli‐Ausejo 2021:10.1007/s12016-021-08834-9}" "" "c.1466 1467insC" "The p.(Val468Cysfs*8) might mimic the 1 p.(Arg472*), classified as a class II variant, because unable to properly develop serpin-protease associations." "De novo" "yes" "" "0" "" "" "g.57614544dup" "" "pathogenic" "ACMG"
"0000499863" "0" "99" "11" "57382054" "57382060" "del" "0" "03256" "SERPING1_000246" "g.57382054_57382060del" "" "{DOI:Speletas 2015:10.1111/all.12714} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "c.1503_1503+6delAGACCTG" "Identification of c.1503_1503+6delAGACCTG variant has been used to validate the SERPING1-NGS platform by Loules 2018, and identified as c.1499_1505delCCTGAGA." "Germline" "" "" "0" "" "" "g.57614581_57614587del" "" "pathogenic" "ACMG"
"0000499864" "0" "99" "11" "57382039" "57382039" "dup" "0" "03256" "SERPING1_000247" "g.57382039dup" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007}" "" "c.1489insT" "" "Germline" "" "" "0" "" "" "g.57614566dup" "" "pathogenic" "ACMG"
"0000499865" "0" "99" "11" "57382052" "57382052" "subst" "0" "03256" "SERPING1_000248" "g.57382052T>C" "" "{DOI:Steiner 2017:10.1111/cei.12941}" "" "g.22026T>C" "" "Germline" "yes" "" "0" "" "" "g.57614579T>C" "" "pathogenic" ""
"0000499866" "0" "99" "11" "57382052" "57382052" "subst" "0" "03256" "SERPING1_000249" "g.57382052T>A" "" "{DOI:Blanch 2002:10.1002/humu.9073} {DOI:Lopez-Lera 2011:10.1016/j.molimm.2011.07.010}" "" "g.16893T>A" "" "Germline" "yes" "" "0" "" "" "g.57614579T>A" "" "pathogenic" ""
"0000500555" "0" "99" "11" "57379410" "57379410" "subst" "0" "03256" "SERPING1_000251" "g.57379410G>C" "" "{DOI:Lopez-Lera 2011:10.1016/j.molimm.2011.07.010}" "" "c.1249+1G>C" "c.1249+1G>A variant affects the canonical donor splice site.\r\nTotal RNA analysis: Exon 7 skipping." "Germline" "yes" "" "0" "" "" "g.57611937G>C" "" "pathogenic" "ACMG"
"0000500558" "0" "99" "11" "57367678" "57367679" "ins" "0" "03256" "SERPING1_000253" "g.57367678_57367679insN[20]" "" "{DOI:Speletas 2015:10.1016/j.jaci.2014.08.007} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "c.378_379ins(20)" "c.378_379ins(20) variant similar to c.359_378dup(20) described by Speletas 2015 and Loules 2018; no indication of the deleted sequence" "Germline" "" "" "0" "" "" "g.57600205_57600206insN[20]" "" "pathogenic" "ACMG"
"0000500559" "0" "99" "11" "57373487" "57373493" "del" "0" "03256" "SERPING1_000254" "g.57373487_57373493delinsTCCCTTAT" "" "{DOI:Gösswein 2008:10.1159/000138883}" "" "c.690delGCCATAAinsTCCCTTAT" "" "Germline" "" "" "0" "" "" "g.57606014_57606020delinsTCCCTTAT" "" "pathogenic" "ACMG"
"0000500560" "0" "99" "11" "57367647" "57367647" "del" "0" "03256" "SERPING1_000255" "g.57367647del" "" "{DOI:Speletas 2015:10.1016/j.jaci.2014.08.007} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "c.347del" "The c.347del variant has not been detected using NGS and VariantCaller v.5.2 by Loules, 2018.\r\nc.347del variant has been considered pathogenic according to ACMG criteria PVS1, PS1, PM2, PP4." "Germline" "yes" "rs1590822588" "0" "" "" "g.57600174del" "{CV:000690353}" "pathogenic" "ACMG"
"0000500561" "0" "99" "11" "57367786" "57367799" "del" "0" "03256" "SERPING1_000256" "g.57367786_57367799del" "" "{DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "c.485_498del" "For the present variant sequence at position c.485_498, the HGVS notation prescribes that on the forward strand it should be GGTGGAGACCAACA at position c.486_499." "SUMMARY record" "" "" "0" "" "" "g.57600313_57600326del" "" "pathogenic" "ACMG"
"0000500563" "0" "79" "11" "57379358" "57379358" "dup" "0" "03256" "SERPING1_000257" "g.57379358dup" "" "" "" "unpublished" "" "SUMMARY record" "" "" "0" "" "" "g.57611885dup" "" "likely pathogenic" "ACMG"
"0000500564" "0" "99" "11" "57379343" "57379343" "del" "0" "03256" "SERPING1_000258" "g.57379343del" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007}" "" "c.1183delC" "" "Germline" "" "" "0" "" "" "g.57611870del" "" "likely pathogenic" "ACMG"
"0000500565" "0" "99" "11" "57379332" "57379332" "del" "0" "03256" "SERPING1_000107" "g.57379332del" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "" "New variant found in a single individual and introduced by Ponard D et al Human Mutation 2019" "Germline" "yes" "" "0" "" "" "g.57611859del" "" "pathogenic" "ACMG"
"0000500594" "0" "79" "11" "57367723" "57367724" "dup" "0" "03256" "SERPING1_000260" "g.57367723_57367724dup" "" "{DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Gábos 2019:10.2478/rrlm-2019-0029}" "" "c.424_425insGT" "First identification c.424_425insGT by Loules 2018;\r\nThe HGVS notation prescribes that on the forward strand it should be \'GT\' at c.423_424, with subsequent identification as c.423_424dupGT" "Germline" "" "" "0" "" "" "g.57600250_57600251dup" "" "pathogenic" "ACMG"
"0000500595" "0" "77" "11" "57369572" "57369572" "dup" "0" "03256" "SERPING1_000261" "g.57369572dup" "" "{DOI:Calvo-Ferrer 2019:10.1016/j.anai.2019.09.021}" "" "c.615dup" "variant c.615dupT detected with clinical diagnosis of angioedema.\r\nsubmitted to ClnVar as pathogenic by HUSP Clinical Genetics Laboratory, Logroño La Rioja Spain" "Germline" "yes" "rs1554995260" "0" "" "" "g.57602099dup" "{CV:000559595}" "likely pathogenic" "ACMG"
"0000500597" "0" "77" "11" "57367466" "57367466" "del" "0" "03256" "SERPING1_000262" "g.57367466del" "" "" "" "" "c.164delT variant has been interpreted as a pathogenic variant (GeneDx, Gaithersburg MA)" "Germline/De novo (untested)" "" "rs1554994909" "0" "" "" "g.57599993del" "{CV:000503648}" "pathogenic" "ACMG"
"0000500598" "0" "79" "11" "57367700" "57367700" "del" "0" "03256" "SERPING1_000263" "g.57367700del" "" "" "" "" "Observation in Sevilla, unpublished" "Germline/De novo (untested)" "" "" "0" "" "" "g.57600227del" "" "pathogenic" "ACMG"
"0000500599" "0" "99" "11" "57373493" "57373501" "del" "0" "03256" "SERPING1_000264" "g.57373493_57373501delinsTTATGGCC" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007}" "" "c.706 714insTTATGGCC" "" "Germline" "yes" "" "0" "" "" "g.57606020_57606028delinsTTATGGCC" "" "pathogenic" "ACMG"
"0000500600" "0" "99" "11" "57373665" "57373667" "del" "0" "03256" "SERPING1_000265" "g.57373665_57373667del" "" "{DOI:Gösswein 2008:10.1159/000138883} {DOI:Ponard 2019:10.1002/humu.23917}" "" "c.865[1]CTC" "In-frame deletion of a single residue in the middle of sheet 3A.\r\nThe c.868_870del variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PP4_Str, PS4_Mod, PM4, PM2_Sup, PP1" "Germline" "yes" "" "0" "" "" "g.57606192_57606194del" "{CV-SCV:005196582.1}" "pathogenic" "ACMG"
"0000500601" "0" "79" "11" "57382009" "57382016" "del" "0" "03256" "SERPING1_000266" "g.57382009_57382016delinsA" "" "" "" "" "The c.1458_1465delCAAGTTCCinsA variant in the SERPING1 gene has been introduced in the ClinVar database as a likely pathogenic variant by GeneDx, Gaithersburg MA; however it has not been published." "Germline/De novo (untested)" "" "rs1554996859" "0" "" "" "g.57614536_57614543delinsA" "{CV:000451253}" "likely pathogenic" "ACMG"
"0000500602" "0" "79" "11" "57381942" "57381943" "del" "0" "03256" "SERPING1_000267" "g.57381942_57381943del" "" "{DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "c.1389_1390delTG" "HGVS notation prescribes that on the forward strand it should be \'TG\' at position c.1391_1392, as reported by Bors 2013" "Germline" "yes" "" "0" "" "" "g.57614469_57614470del" "" "pathogenic" "ACMG"
"0000500603" "0" "99" "11" "57381908" "57381934" "dup" "0" "03256" "SERPING1_000268" "g.57381908_57381934dup" "" "{DOI:Kalmár 2003:10.1002/humu.9202} {DOI:Troldborg 2024:10.1016/j.jaci.2024.03.028}" "" "16749_16775dup(27) (traditional)" "In-frame duplication of 9 residues within the RCL incl. peptide sequence until P6." "Germline" "yes" "" "0" "" "" "g.57614435_57614461dup" "" "pathogenic" "ACMG"
"0000500604" "0" "99" "11" "57381847" "57381855" "del" "0" "03256" "SERPING1_000269" "g.57381847_57381855del" "" "{DOI:Kesim 2011:10.1159/000323915} {DOI:Mete Gökmen 2019:10.1159/000492583}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57614374_57614382del" "" "pathogenic" "ACMG"
"0000500605" "0" "77" "11" "57379329" "57379335" "del" "0" "03256" "SERPING1_000429" "g.57379329_57379335del" "" "" "" "c.1169_1175delAGTTCCA" "Introduced in ClinVar as a pathogenic variant by GeneDx" "CLASSIFICATION record" "" "rs1064793917" "0" "" "" "g.57611856_57611862del" "{CV:000419503}" "pathogenic" "ACMG"
"0000500871" "0" "99" "11" "57369557" "57369557" "del" "0" "03256" "SERPING1_000270" "g.57369557del" "" "{DOI:Andrejević 2015:10.1371/journal.pone.0142174}" "" "c.610delC" "Variant c.610delC described by Andrejević 2015 does not exist; there is a \'A\' at this position.\r\nIn agreement to g.4400delC, it has been introduced as an additional c.600delC variant." "Germline" "" "" "0" "" "" "g.57602084del" "" "pathogenic" "ACMG"
"0000500889" "0" "99" "11" "57367374" "57367375" "del" "0" "03256" "SERPING1_000271" "g.57367374_57367375del" "" "{DOI:Andrejević 2015:10.1371/journal.pone.0142174} {DOI:Karadza-Lapic 2016:10.1080/07853890.2016.1185144}" "" "c.74_75delAT" "" "Germline" "" "" "0" "" "" "g.57599901_57599902del" "" "pathogenic" "ACMG"
"0000501551" "0" "99" "11" "57367420" "57367420" "del" "0" "03256" "SERPING1_000272" "g.57367420del" "" "{DOI:Roche 2005:10.1002/humu.20197}" "" "c.120delA" "Variant introduced in the Lung SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "" "" "0" "" "" "g.57599947del" "" "pathogenic" "ACMG"
"0000501552" "0" "99" "11" "57367420" "57367421" "del" "0" "03256" "SERPING1_000273" "g.57367420_57367421del" "" "{DOI:Freiberger 2002:10.1002/humu.9029} {DOI:Roche 2005:10.1002/humu.20197} {DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Suffritti 2014:10.1111/cea.12293}{DOI:Grodecká 2017:10.1016/j.clim.2017.03. 010} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Wang 2022:10.1186/s41065-022-00242-z} {DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "" "2262_2263delAG" "Recurrent variant.\r\nVariant erroneously described as c.119_120delAG (Pappalardo 2008; Suffriti 2014).\r\nc.120_121delAG variant displays an increased exon 3 skipping, with subsequent p.(Asp18Glyfs*26) expression or possible NMD; however the decreased expression of mutated allele could not be unambiguously assigned to the splicing defect (Grodecká 2017; minigene construct).\r\nOn patient blood cells, c.120_121delAG variant displays a decreased expression of full-length mutant allele compared to wt allele.\r\nA de novo proband has been reported by Ponard 2019.\r\nConsidered pathogenic according to ACMG criteria PVS1, PP4_Str, PM6, PS3, PS4_Mod, PM2_Sup. Research Centre for Medical Genetics, Moscow Russia, considers c.346C>T variant as pathogenic without the PVS1 criterion that relates to a de novo situation.\r\nVariant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "De novo" "yes" "" "0" "" "" "g.57599947_57599948del" "{CV-SCV:005068175.1}" "pathogenic" "ACMG"
"0000544627" "0" "30" "11" "57367429" "57367429" "subst" "0.000239576" "02325" "SERPING1_000274" "g.57367429G>A" "" "" "" "SERPING1(NM_000062.3):c.129G>A (p.G43=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.57599956G>A" "" "likely benign" ""
"0000544628" "0" "10" "11" "57367579" "57367579" "dup" "0" "01943" "SERPING1_000275" "g.57367579dup" "0.00002797 (gnomAD v3)" "" "" "SERPING1(NM_000062.2):c.279dup (p.(Pro94AlafsTer39)), SERPING1(NM_000062.2):c.279dupG (p.P94Afs*39)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.57600106dup" "" "benign" ""
"0000544629" "0" "33" "11" "57367579" "57367579" "dup" "0" "01804" "SERPING1_000275" "g.57367579dup" "0.000029 (gnomAD)" "" "" "SERPING1(NM_000062.2):c.279dup (p.(Pro94AlafsTer39)), SERPING1(NM_000062.2):c.279dupG (p.P94Afs*39)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "rs1945330983" "0" "" "" "g.57600106dup" "{CV-SCV:001800750.1}" "likely benign" ""
"0000544630" "0" "30" "11" "57367583" "57367583" "subst" "0" "01943" "SERPING1_000276" "g.57367583A>C" "" "" "" "SERPING1(NM_000062.2):c.283A>C (p.T95P, p.(Thr95Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.57600110A>C" "" "likely benign" ""
"0000544631" "0" "30" "11" "57367768" "57367768" "subst" "0.00103975" "02326" "SERPING1_000277" "g.57367768C>T" "0.00101 (gnomAD) 0.00101 (ExAC)" "{DOI:Veronez 2016:10.1515/hsz-2015-0212} {DOI:Khodan 2025:10.21802/artm.2025.2.34.119}" "" "SERPING1(NM_000062.2):c.468C>T (p.A156=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "rs150601964" "0" "" "" "g.57600295C>T" "{CV:000305024}" "likely benign" "ACMG"
"0000544632" "0" "30" "11" "57373478" "57373478" "subst" "7.7153E-5" "02327" "SERPING1_000278" "g.57373478C>G" "0.00007" "" "" "SERPING1(NM_000062.2):c.686-5C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "rs28362952" "0" "" "" "g.57606005C>G" "{CV:VCV000305025.9}" "likely benign" ""
"0000544633" "0" "31" "11" "57373548" "57373548" "subst" "0.00551838" "01943" "SERPING1_000004" "g.57373548C>T" "0.00542 (gnomAD)" "{DOI:Roche 2005:10.1002/humu.20197} {DOI:Mendoza-Alvarez 2022:10.3389/fimmu.2022.997148} {DOI:Mendoza-Alvarez 2026:10.21203/rs.3.rs-10662999/v1}" "" "SERPING1(NM_000062.2):c.751C>T (p.L251=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "yes" "rs35788383" "0" "" "" "g.57606075C>T" "{CV:000305026}" "likely benign" "ACMG"
"0000592743" "0" "99" "11" "57367424" "57367424" "subst" "0" "03256" "SERPING1_000279" "g.57367424G>T" "0.000012" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Bafunno 2014:10.1111/ahg.12052} {DOI:Speletas 2015:10.1016/j.jaci.2014.08.007} {DOI:Loules:10.1016/j.gene.2018.05.029} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Gábos 2019:10.2478/rrlm-2019-0029}" "" "2268G>T (traditional)" "Recurrent pathogenic variant.\r\nA de novo condition has been recorded in one pedigree\r\nAs per ACMG guidelines the variant has been classified as pathogenic, with criteria as follows PVS2, PS2, PS3, PM1, PM6 (CSIR - Centre for Cellular and Molecular Biology, Hyderabad, Telangana, India)" "De novo" "yes" "rs778625408" "0" "" "" "g.57599951G>T" "{CV:000694737}" "pathogenic" "ACMG"
"0000592744" "0" "99" "11" "57367464" "57367464" "del" "0" "03256" "SERPING1_000280" "g.57367464del" "" "{DOI:Roche 2005:10.1002/humu.20197} {DOI:Ponard 2019:10.1002/humu.23917}" "" "c.164delT" "c.164del variant has been interpreted as a pathogenic variant (GeneDx, Gaithersburg Maryland)\r\nc.164del variant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "rs1590822371" "0" "" "" "g.57599991del" "{CV:000817621}" "pathogenic" "ACMG"
"0000592745" "0" "99" "11" "57367535" "57367535" "del" "0" "03256" "SERPING1_000281" "g.57367535del" "" "{DOI:Speletas 2015:10.1016/j.jaci.2014.08.007} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "c.235delA" "" "Germline" "yes" "" "0" "" "" "g.57600062del" "" "pathogenic" "ACMG"
"0000592746" "0" "99" "11" "57367422" "57367422" "del" "0" "03256" "SERPING1_000193" "g.57367422del" "" "{DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Gábos 2019:10.2478/rrlm-2019-0029}" "" "c.121delG" "Initially identified as c.121delG by Loules 2018; the HGVS notation prescribes that on the forward strand it should be ‘G’ at c.122, with subsequent identification as c.122delG, as reported by Gábos 2019" "Germline" "yes" "" "0" "" "" "g.57599949del" "" "pathogenic" "ACMG"
"0000592747" "0" "99" "11" "57367565" "57367565" "subst" "0" "03256" "SERPING1_000282" "g.57367565C>T" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Rijavec 2013:10.1371/journal.pone.0056712} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Iwanami 2019:10.2169/internalmedicine.1559-18} {DOI:Sheikh 2023:10.1007/s10875-022-01399-y}" "" "c.265C>T" "Recurrent variant.\r\nItalian proband sample exhibits a high level of cleaved circulating HK species, with 46.3% of total HK." "Germline" "yes" "" "0" "" "" "g.57600092C>T" "" "pathogenic" "ACMG"
"0000592748" "0" "99" "11" "57367749" "57367749" "subst" "0" "03256" "SERPING1_000283" "g.57367749C>T" "" "{DOI:Rijavec 2013:10.1371/journal.pone.0056712} {DOI:Yasuno 2021:10.1111/1346-8138.15930} {DOI:Hashimura 2021:10.1111/all.15034} {DOI:Aydoğdu 2024:10.1620/tjem.2023.J083} {DOI:Bas 2026:10.3390/medicina62091635}" "" "c.449C>T" "Recurrent variant.\r\np.(Ser150Phe) is a dominant-negative variant: The variant c.449C>T product accumulates within the cell, compromising a production of C1-INH normal allele with a markedly reduction of its secretion in a dominant-negative manner.\r\np.(Ser150Phe) product has been demonstrated to be prone to oligomerize.\r\nc.449C>T variant interpreted as likely pathogenic by Turkish authors according to the ACMG criteria PP3, PM1, PM5, PM2.\r\nAs an additional evaluation from Research Centre for Medical Genetics, Moscow Russia, the c.449C>T variant in SERPING1 meets ACMG/ClinGen criteria to be classified as pathogenic with the following scores PP4_Str, PS4_Mod, PP3_Mod, PS3_Sup, PM2_Sup, PP1, PP2." "Germline" "yes" "" "0" "" "" "g.57600276C>T" "{CV-SCV:005186230.1}" "pathogenic" "ACMG"
"0000592751" "0" "99" "11" "57367766" "57367766" "subst" "0" "03256" "SERPING1_000284" "g.57367766G>C" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Yasuno 2021:10.1111/1346-8138.15930} {DOI:Ryø 2023:10.1016/j.jaci.2023.04.023}" "" "c.466G>C" "Variant emerging in a CpG sequence.\r\nRecurrent variant characterized as pathogenic according to ACMG following criteria PS3, PS4, PM1, PM2, PM5, PP3_Mod, PP5.\r\np.(Ala156Pro) is a dominant-negative variant; p.(Ala156Pro) variant product accumulates into cell, affecting transport and secretion of normal C1-INH.\r\nAla134 residue is localized in helix A; a Ala to Pro transition might affect the shutter functional region, with an increased susceptibility to oligomerization" "Germline" "yes" "" "0" "" "" "g.57600293G>C" "" "pathogenic (dominant)" "ACMG"
"0000592752" "0" "99" "11" "57367767" "57367767" "subst" "0" "03256" "SERPING1_000285" "g.57367767C>A" "" "{DOI:Gösswein 2008:10.1159/000138883} {DOI:Yamamoto 2012:10.1097/MAJ.0b013e31822bdb65} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Obtulowicz 2020:10.5114/ceji.2020.101252} {DOI:Yasuno 2021:10.1111/1346-8138.15930} {DOI:Hashimura 2021:10.1111/all.15034}{DOI:Föster 2021:0.1186/s13023-021-02021-x}" "" "c.467C>A" "Highly recurrent variant. \r\nIt is not shown whether the Japanese records are related to independent pedigrees." "De novo" "yes" "" "0" "" "" "g.57600294C>A" "" "pathogenic" "ACMG"
"0000592753" "0" "99" "11" "57367835" "57367835" "dup" "0" "03256" "SERPING1_000286" "g.57367835dup" "" "{DOI:Lopez-Lera 2011:10.1016/j.molimm.2011.07.010} {DOI:Pedrosa 2016:10.1007/s10875-015-0222-9} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Loli‐Ausejo 2021:10.1007/s12016-021-08834-9}" "" "c.535_536insA" "Recurrent variant" "De novo" "yes" "" "0" "" "" "g.57600362dup" "" "pathogenic" "ACMG"
"0000592756" "0" "99" "11" "57367850" "57367850" "subst" "0" "03256" "SERPING1_000287" "g.57367850G>C" "" "{DOI:Roche 2005:10.1002/humu.20197} {DOI:Bygum 2011:10.1111/j.1398-9995.2010.02456.x} {DOI:Kesim 2011:10.1159/000323915} {DOI:de la Cruz 2011:10.1016/j.imlet.2011.07.011} {DOI:Cagini 2016:10.1515/hsz-2015-0222} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Veronez 2019:10.3389/fmed.2019.00028} {DOI:Veronez 2021:10.1016/j.jaip.2020.11.039}" "" "" "Recurrent variant, with at least seven pedigrees recorded in Spain, Denmark, France, Brazil, Turkey, Romania\r\nVariant affects the last nt of exon 3, with subsequent possible splicing defect and skipping of exon 3; this makes possible protein change with p.Asp18Glyfs*26 (NMD?)\r\nGly162, located at the end of helix B, shutter domain, is a conserved residue among serpins (80%), forms tight turn and packs against conserved position Phe214" "Germline" "yes" "" "0" "" "" "g.57600377G>C" "" "pathogenic" "ACMG"
"0000592757" "0" "99" "11" "57369523" "57369523" "subst" "0" "03256" "SERPING1_000288" "g.57369523C>A" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Suffritti 2014:10.1111/cea.12293} {DOI:Madsen 2014:10.1371/journal.pone.0112051} {DOI:Haslund 2019:10.1172/JCI98869} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Hashimura 2021:10.1111/all.15034} {DOI:Jiang 2024:10.1186/s13023-024-03306-7}" "" "4366C>A (traditional)" "Highly recurrent variant.\r\nVariant expressed with an intermediate biological phenotype: low antigenic C1-INH is associated with a co-expression of both variant and wt alleles.\r\nThr167 is a highly conserved residue among serpins (87%), making H-bonds to Asp398 and Asn404, stabilizing the long connection between helix I and s5A.\r\nThr167Asn product is prone to oligomerize with accumulation of aggregates, correlating with the low levels of C1INH secretion and increased intracellular accumulation. In vitro transfection investigations suggest that c.566C>A variant may result in the aggregation of C1-INH in the endoplasmic reticulum, with subsequent impaired secretion.\r\nClinical Interpretation by InterVar as pathogenic specified by ACMG criteria PS3, PS4, PP1, PP3, PP4 \r\nIntroduced in ClinVar by InVitae San Francisco CA as likely pathogenic (single submitter)" "Germline" "yes" "rs2495430901" "0" "" "" "g.57602050C>A" "{CV-SCV:003440381.1}" "pathogenic" "ACMG"
"0000592758" "0" "99" "11" "57369525" "57369525" "subst" "0" "03256" "SERPING1_000289" "g.57369525A>G" "" "{DOI:Martinho 2013:10.1016/j.molimm.2012.09.003} {DOI:Ponard 2019:10.1002/humu.23917}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57602052A>G" "" "pathogenic" ""
"0000592759" "0" "99" "11" "57369557" "57369557" "del" "0" "03256" "SERPING1_000290" "g.57369557del" "" "{PMID:Verpy 1996:8755917} {DOI:Ponard 2019:10.1002/humu.23917}" "" "c.600delC" "A single individual is carrying a c.600delC variant in the family.\r\nVariant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "-" "" "0" "" "" "g.57602084del" "" "pathogenic" "ACMG"
"0000592761" "0" "99" "11" "57373519" "57373519" "subst" "0" "03256" "SERPING1_000291" "g.57373519G>C" "" "{DOI:Suffritti 2014:10.1111/cea.12293} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Grombikirova 2023:10.1007/s10875-023-01565-w}" "" "8361G>C (traditional)" "Predicted acceptor gain by in silico models.\r\nItalian proband sample exhibits a high level of ciculating cleaved HK, with 45.7% of total HK, in line with an activation of kallikrein-kinin system.\r\nThe c.722G>C variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as likely pathogenic: PS4_Mod, PP4_Mod, PM2_Sup, PP2, PP3.\r\nIntroduced in ClinVar as likely pathogenic by Research Centre For Medical Genetics, Moscow Russia" "Germline" "yes" "" "0" "" "" "g.57606046G>C" "{CV-SCV:005187249.2}" "likely pathogenic" "ACMG"
"0000592762" "0" "99" "11" "57373525" "57373525" "subst" "0" "03256" "SERPING1_000292" "g.57373525T>C" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Speletas 2015:10.1016/j.jaci.2014.08.007}{DOI:Pedrosa 2016:10.1007/s10875-015-0222-9}{DOI:Maia 2019:10.1111/all.13699} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Veronez 2021:10.1016/j.jaip.2020.11.039} {DOI:Szabo 2022:10.3389/falgy.2022.836465} {DOI:Ryø 2023:10.1016/j.jaci.2023.04.023}" "" "" "Highly recurrent variant\r\nOne proband is presenting with a de novo situation\r\np.(Leu243Pro) is a dominant-negative variant; p.(Leu243Pro) variant product accumulates into cell, affecting transport and secretion of normal C1-INH.\r\nLeu221 residue is localized in helix E that plays a crucial role in facilitating the conformation change during the insertion of RCL between s3A and s5A; a Leu to Pro transition might affect the shutter functional region, with an increased susceptibility to oligomerization.\r\nThe c.728T>C variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PP3_Str, PP4_Str, PM6, PS4_Mod, PP1, PP2, PM2_Sup." "De novo" "yes" "rs2495440530" "0" "" "" "g.57606052T>C" "{CV-SCV:005088179.1}" "pathogenic (dominant)" "ACMG"
"0000593670" "0" "99" "11" "57373675" "57373675" "subst" "0" "03256" "SERPING1_000293" "g.57373675T>C" "" "{DOI:Pappalardo 2000:10.1067/mai.2000.110471} {DOI:Bygum 2011:10.1111/j.1398-9995.2010.02456.x}{DOI:Madsen 2014:10.1371/journal.pone.0112051}{DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Speletas 2015:10.1111/all.12714} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Veronez 2019:10.3389/fmed.2019.00028} {DOI:Ryø 2023:10.1016/j.jaci.2023.04.023}" "" "" "Recurrent variant.\r\nIntermediate type of HAE: Ile271Thr product is co-expressed with the wt allele product.\r\np.(Ile293Thr) is a dominant-negative variant; p.(Ile293Thr) variant product accumulates into cell, affecting transport and secretion of normal C1-INH.\r\nIle271 residue is localized in sheet 3A; a Ile to Thr transition might affect the shutter/breach functional region, ie. insertion into Aβ-sheet, with an increased susceptibility to oligomerization.\r\nNote: All affected patients from Danish family are carrying the c.878T>C variant combined with the c.(-21)T>C in a cis configuration, as already described by Verpy 1996\r\nVariant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "De novo" "yes" "rs1590826571" "0" "" "" "g.57606202T>C" "{CV:000690346}" "pathogenic (dominant)" "ACMG"
"0000593672" "0" "99" "11" "57373887" "57373887" "subst" "0" "03256" "SERPING1_000294" "g.57373887G>A" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Suffritti 2014:10.1111/cea.12293} {DOI:Xu 2012:10.1111/all.12024} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Liu 2019:10.1684/ejd.2018.3487} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Förster 2021:10.1186/s13023-021-02021-x} {DOI:Gurianova 2022:10.34883/PI.2022.8.3.009}" "" "8729G>A (traditional)" "Recurrent variant.\r\nItalian proband sample exhibits a high level of cleaved circulating HK species, with 36.8% of total circulating HK.\r\nRecognized as pathogenic with the ACMG criteria: PVS1, PS4_Mod, PP3, PP4_Str, PM2_Sup" "De novo" "yes" "" "0" "" "" "g.57606414G>A" "{CV-SCV:005196583.1}" "pathogenic" "ACMG"
"0000593673" "0" "99" "11" "57373899" "57373899" "subst" "0" "03256" "SERPING1_000295" "g.57373899T>C" "" "{DOI:Gösswein 2008:10.1159/000138883} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Rodriguez Espada 2025:10.1182/bloodadvances.2025017220}" "" "" "Recurrent variant on a highly conserved position among serpins (98%).\r\nPhe291 residue located in a loop s3A/s4C, gate, in a buried hydrophobic area; it packs against conserved positions in s3A (Trp277) and s3C (Met303), contributing to the gate functional region. \r\nThe variant is considered pathogenic according to ACMG Guidelines; criteria PS1, PS4_Mod, PM2_Sup, PM5, PP1, PP2, PP3_Str, PP4_Mod, PP5." "Germline" "yes" "rs1590826703" "0" "" "" "g.57606426T>C" "{CV:000690347}" "pathogenic" "ACMG"
"0000593674" "0" "99" "11" "57373899" "57373899" "subst" "0" "03256" "SERPING1_000296" "g.57373899T>G" "" "{PMID:Verpy 1996:8755917} {DOI:Ponard 2019:10.1002/humu.23917}" "" "" "Phe281 residue is a highly conserved position among serpins (98%).\r\nPhe291 amino acid located in a loop S3A/S4C, contributing to the gate functional region, in a buried hydrophobic area; it packs against conserved positions in s3A (Trp277) and s3C (Met303).\r\nVariant introduced in the Lund SERPING1 database https://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "" "0" "" "" "g.57606426T>G" "" "pathogenic" "ACMG"
"0000593675" "0" "99" "11" "57373928" "57373928" "subst" "0" "03256" "SERPING1_000297" "g.57373928T>C" "" "{DOI:Siddique 1995:10.1159/000154267} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Hashimura 2021:10.1111/all.15034} {DOI:Imam 2021:10.1016/j.anai.2021.08.264} {DOI:Mendoza-Alvarez 2026:10.21203/rs.3.rs-10662999/v1}" "" "" "Phe291 is a highly conserved residue among serpins (98%)\r\nPhe291 residue is located within beta-sheet C (s4C), contributing with s3C to the gate functional region, in a buried hydrophobic area, packing against conserved positions in s3C (Val300), and distal hinge region (Pro454, Phe455 and Pro476 in native C1-INH; Val451-Gln452 in latent structure).\r\nThe c.937T>C variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PP4_Str, PS4_Mod, PP3_Mod, PM2_Sup, PP1." "De novo" "yes" "" "0" "" "" "g.57606455T>C" "{CV-SCV:005196584.1}" "pathogenic" "ACMG"
"0000593676" "0" "99" "11" "57373930" "57373930" "subst" "0" "03256" "SERPING1_000298" "g.57373930T>G" "" "{DOI:Maia 2019:10.1111/all.13699} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Veronez 2021:10.1016/j.jaip.2020.11.039} {DOI:Ferriani 2025:10.1016/j.jaip.2025.08.026}" "" "" "Phe291 is a highly conserved residue among serpins (98%)\r\nPhe291 residue is located within beta-sheet C (s4C), gate, buried hydrophobic area, packing against conserved positions in s3C (Val300), and distal hinge region (Pro454, Phe455 and Pro476 in native C1Inh; Val451-Gln452 in latent structure)" "De novo" "yes" "" "0" "" "" "g.57606457T>G" "" "pathogenic" "ACMG"
"0000593677" "0" "99" "11" "57374003" "57374003" "subst" "0" "03256" "SERPING1_000175" "g.57374003C>T" "" "{DOI:Iwamoto 2012:10.1016/j.jdermsci.2012.07.009} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Loli‐Ausejo 2021:10.1007/s12016-021-08834-9}" "" "" "Recurrent variant\r\nOne de novo male proband recorded in ClinVar #VCV000626348.1 (University of Thessaly)\r\nThe c.1012C>T variant meets the criteria to be considered pathogenic according to ACMG Guidelines: PVS1, PS2_Str, PM2, PP4." "De novo" "yes" "rs1565171906" "0" "" "" "g.57606530C>T" "{CV:000626348}" "pathogenic" "ACMG"
"0000593678" "0" "99" "11" "57379196" "57379196" "subst" "0" "03256" "SERPING1_000299" "g.57379196C>T" "" "{PMID:Verpy 1996:8755917} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "" "" "c.1036C>T variant meets ACMG criteria PVS1, PM2, PP4, PP5, and it is considered pathogenic by University of Thessaly.\r\nVariant introduced in the Lund SERPING1 database https://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "rs1590829609" "0" "" "" "g.57611723C>T" "{CV:000690348}" "pathogenic" "ACMG"
"0000593682" "0" "99" "11" "57379274" "57379274" "subst" "0" "03256" "SERPING1_000300" "g.57379274C>T" "" "{DOI:Roche 2005:10.1002/humu.20197} {DOI:Andrejević 2015:10.1371/journal.pone.0142174} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Loli‐Ausejo 2021:10.1007/s12016-021-08834-9}" "" "" "Recurrent variant.\r\nVariant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "" "0" "" "" "g.57611801C>T" "" "pathogenic" "ACMG"
"0000593683" "0" "99" "11" "57379340" "57379340" "subst" "0" "03256" "SERPING1_000301" "g.57379340A>C" "" "{PMID:Verpy 1996:8755917 } {DOI:Kalmar 2003:10.1002/humu.9202} {DOI:Bors 2013:10.1016/j.jaci.2012.11.015} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Szabó 2022:10.3389/falgy.2022.836465} {DOI:Guryanova 2024:10.1016/j.clim.2024.109990}" "" "14181A>C" "Variant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "" "0" "" "" "g.57611867A>C" "" "pathogenic" ""
"0000593684" "0" "99" "11" "57379347" "57379347" "subst" "0" "03256" "SERPING1_000302" "g.57379347T>C" "" "{DOI:Gösswein 2008:10.1159/000138883} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Gábos 2019:10.2478/rrlm-2019-0029}" "" "" "Recurrent variant" "Germline" "yes" "rs1945480228" "0" "" "" "g.57611874T>C" "{CV-SCV:001486118.3}" "likely pathogenic" "ACMG"
"0000593685" "0" "99" "11" "57379353" "57379353" "subst" "0" "03256" "SERPING1_000303" "g.57379353T>C" "" "{DOI:Gösswein 2008:10.1159/000138883} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Gábos 2019:10.2478/rrlm-2019-0029}" "" "" "Recurrent variant.\r\nIntroduced in ClinVar as likely pathogenic by Research Centre For Medical Genetics, Moscow Russia.\r\nThe c.1193T>C variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as likely pathogenic: PS4_Mod, PP3_Mod, PP4_Mod, PM2_Sup." "Germline" "yes" "rs1945480328" "0" "" "" "g.57611880T>C" "{CV:000976258}" "likely pathogenic" "ACMG"
"0000593686" "0" "99" "11" "57379355" "57379355" "subst" "0" "03256" "SERPING1_000304" "g.57379355C>T" "" "{PMID:Bissler 1997:9069585} {DOI:Andrejević 2015:10.1371/journal.pone.0142174} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Hashimura 2021:10.1111/all.15034} {DOI:Kanepa 2023:10.1186/s13223-023-00783-6} {DOI:Grombirikova 2023:10.1007/s10875-023-01565-w} {DOI:Rozevska 2024:10.1186/s13223-024-00889-5}" "" "" "Highly recurrent variant recognized pathogenic; note that in a family from Latvia a relative carrier of HAE-I patient has been found asymptomatic.\r\nEleven independent pedigrees, with French probands presenting a HAE of the intermediate type with a p.(Pro377Ser), a phenotype that has not been found with p.(Pro377Ala) and p.(Pro377Leu) variants\r\nPro377 is a highly conserved position among serpins (97%) located at the C-terminus of β-sheet C (s2C; gate, hinge), buried hydrophobic, packs against conserved positions in s4C (native Phe291), s3C (Val300, Met302) and distal hinge (Phe455).\r\nThe c.1195C>T variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PP3_Str, PP4_Str, PS4_Mod, PM2_Sup, PP2.\r\nIntroduced in ClinVar as pathogenic by DNA-diagnostics Laboratory, Research Centre For Medical Genetics, Moscow Russia" "Germline" "yes" "rs2135324767" "0" "" "" "g.57611882C>T" "{CV-SCV:003255493.1}" "pathogenic" "ACMG"
"0000593687" "0" "99" "11" "57379386" "57379386" "subst" "0" "03256" "SERPING1_000305" "g.57379386T>C" "" "{DOI:Roche 2005:10.1002/humu.20197} {DOI:Pedrosa 2016:10.1007/s10875-015-0222-9} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Loli‐Ausejo 2021:10.1007/s12016-021-08834-9} {DOI:Mendoza-Alvarez 2026:10.21203/rs.3.rs-10662999/v1}" "" "" "Recurrent variant.\r\nMet387 lies at the start of β-sheet 6A, known as strategic for stabilizing the serpin-protease complex, then classifying p.(Met409Thr) within class II.\r\nThe c.1226T>C variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PP4_Str, PS4_Mod, PP3_Mod, PM2_Sup, PP2.\r\nVariant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "" "0" "" "" "g.57611913T>C" "{CV-SCV:005088590.1}" "pathogenic" "ACMG"
"0000593689" "0" "99" "11" "57379392" "57379392" "subst" "0" "03256" "SERPING1_000306" "g.57379392C>G" "" "{DOI:Johnsrud 2015:10.1371/journal. pone.0131637} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Jindal 2021:10.1111/PAI.13420} {PMID:Gao 2025:40848077}, {DOI:Gao 2025:10.1007/s10875-025-01912-z}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57611919C>G" "" "pathogenic" "ACMG"
"0000593690" "0" "99" "11" "57381891" "57381891" "subst" "0" "03256" "SERPING1_000307" "g.57381891T>C" "" "{PMID:Tang & Zhang 2009:20120775} {DOI:de la Cruz:10.1016/j.imlet.2011.07.011} {DOI:Xu 2012:10.1111/all.12024} {DOI:Liu 2019:10.1684/ejd.2018.3487} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Hashimura 2021:10.1111/all.15034} {DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "" "Highly recurrent variant.\r\nLocated at the C-terminus moiety of the RCL, where Leu>Pro transition affects Michaelis complex formation with the target protease." "Germline" "yes" "rs281875176" "0" "" "" "g.57614418T>C" "{CV:000068246}" "pathogenic" "ACMG"
"0000593691" "0" "99" "11" "57381901" "57381901" "dup" "0" "03256" "SERPING1_000308" "g.57381901dup" "" "{DOI:Blanch 2002:10.1002/humu.9073} {DOI:Roche 2005:10.1002/humu.20197} {DOI:Steiner 2017:10.1111/cei.12941} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Mak 2025:10.1111/cea.70001}" "" "c.1350dupA" "Recurrent variant\r\nVariant c.1350dupA carried by five pedigrees in France (de novo proband), Spain, Switzerland, Saudi Arabia and China.\r\nIntroduced in ClinVar as pathogenic by King Faisal Specialist Hospital and Research Center, Riyadh Saudi Arabia\r\nVariant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "De novo" "yes" "" "0" "" "" "g.57614428dup" "{CV-SCV:005438514.1}" "pathogenic" "ACMG"
"0000593692" "0" "99" "11" "57381907" "57381908" "del" "0" "03256" "SERPING1_000309" "g.57381907_57381908del" "" "{DOI:Bors 2013:10.1016/j.jaci.2012.11.015} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Nabilou 2020:10.1080/08820139.2020.1817068} {DOI:Wang 2022:10.1186/s41065-022-00242-z} {DOI:Szabo 2022:10.3389/falgy.2022.836465} {DOI:Troldborg 2024:10.1016/j.jaci.2024.03.028}" "" "16748_16749delTG (traditional)" "" "Germline" "yes" "" "0" "" "" "g.57614434_57614435del" "" "pathogenic" "ACMG"
"0000593693" "0" "99" "11" "57381911" "57381911" "dup" "0" "03256" "SERPING1_000310" "g.57381911dup" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "c.1361dupG" "Variant introduced in ClinVar database as payhogenic by LabCorp Genetics, San Francisco CA" "Germline" "yes" "" "0" "" "" "g.57614438dup" "{CV-SCV:007375135.1}" "pathogenic" "ACMG"
"0000593694" "0" "99" "11" "57381924" "57381924" "subst" "0" "03256" "SERPING1_000311" "g.57381924C>T" "" "{DOI:Siddique 1992:10.1159/000154086} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "" "Recurrent variant.\r\np.(Ala458Val) scores: intolerant by SIFT, pathogenic by PolyPhen, polymorphic by MutationTaster\r\nSimilar with the p.(Gly373Arg) functionally inactive variant of AAT : Laffranchi et al. 2019; PLoS ONE 14(1): e0206955.\r\nThe c.1373C>T has been characterized as pathogenic according ACMG criteria as follows PM1, PM2, PP3, PP5.\r\nSubmitted to ClinVar as pathogenic by Department of Immunology and Histocompatibility, University of Thessaly, Greece" "Germline" "yes" "rs1590831432" "0" "" "" "g.57614451C>T" "{CV:000690357}" "pathogenic" "ACMG"
"0000593695" "0" "99" "11" "57381947" "57381947" "subst" "0" "03256" "SERPING1_000312" "g.57381947C>G" "" "{DOI:Gösswein 2008:10.1159/000138883} {DOI:Loules 2018:2}{DOI:Veronez 2019:10.3389/fmed.2019.00028} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Loli‐Ausejo 2021:10.1007/s12016-021-08834-9}{DOI:Förster 2021:0.1186/s13023-021-02021-x} {DOI:Xia 2024:10.3760/cma.j.cn112140-20240227-00125 }" "" "" "Highly recurrent variant.\r\nAs other missense variants at the same Arg444 residue (Arg466Cys/Ser/His/Pro/Leu), p.(Arg466Gly) disrupts the Arg P1 residue that targets the Ser-protease; subsequently the variant product is no more able to control any target Ser-protease, then classifying p.(Arg466Gly) within class I.\r\nThe c.1396C>G variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PP4_Str, PM1, PM5, PS4_Str, PM2_Sup, PP1, PP2, PP3." "Germline" "yes" "" "0" "" "" "g.57614474C>G" "{CV-SCV:005088627.1}" "pathogenic" "ACMG"
"0000593709" "0" "99" "11" "57381947" "57381947" "subst" "0" "03256" "SERPING1_000313" "g.57381947C>T" "" "{PMID:Skriver 1989:2563376}{PMID:Bissler 1997:9069585}{PMID:Pappalardo 2000:18586324}{DOI:Williams 2006:10.1007/s10620-006-9294-y}{PMID:Gösswein 2008:18758157}{DOI:Xu 2012:10.1111/all.12024} {DOI:Martinho 2013:10.1016/j.molimm.2012.09.003} {DOI:Chen 2016:10.1016/j.jfma.2015.12.006}{DOI:Sim 2017:10.4168/aair.2017.9.1.96}{DOI:Loules 2018:10.1016/j.gene.2018.05.029}{DOI:Maia 2019:10.1111/all.13699}{DOI:Ponard 2019:10.1002/humu.23917}{PMID:Nabilou 2020:32896191}{PMID:Guryanova 2021:33827715}{DOI:Hashimura 2021:10.1111/all.15034}{DOI:Veronez 2021:10.1016/j.jaip.2020.11.039} {DOI:Wang 2022:10.1186/s41065-022-00242-z}{DOI:Mendoza-Alvarez 2022:10.3389/fimmu.2022.997148}{DOI:Szabó 2022:10.3389/falgy.2022.836465}{DOI:Kanepa 2023:10.1186/s13223-023-00783-6}{DOI:Topyıldız 2023:0.24953/turkjped.2022.637}{DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}{DOI:Mak 2025:10.1111/cea.70001} {DOI:Fails 2025:10.17161/kjm.vol18.22749} {DOI:Gao 2025:10.1007/s10875-025-01912-z} {DOI:Ferriani 2025:10.1016/j.jaip.2025.08.026} {DOI:Du 2025: 10.3389/falgy.2025.1696666} {DOI:Guo 2026:10.1186/s13023-026-04421-3} {DOI:Bara 2026:10.2478/rrlm-2026-0026} {DOI:Bas 2026:10.3390/medicina62091635} {DOI:Mendoza-Alvarez 2026:10.21203/rs.3.rs-10662999/v1}" "" "c.1396C>T" "Highly recurrent variant\r\nFour probands in independent pedigrees are presenting with a de novo condition. More than 20 probands are reported as carrying a c.1396C>T variant.\r\nMissense variants at the same residue (Arg466Gly/Ser/His/Pro/Leu) also disrupt the Arg P1 position of the RCL, with deleterious consequences on the control of Ser-protease targets.\r\nc.1396C>T variation characterized as pathogenic according to ACMG criteria as follows PS3, PS4_Str, PS2_Str, PM1, PM2, PM6, PP1, PP3, PP4, PP5.\r\nVariant c.1396C>T has been found associated with incomplete penetrance C1-INH-HAE ; HAE symptomatic individuals carry additional variants possibly involved in HAE clinical phenotype: NM_001159747.2:c.190A>G;p.(Asn64Asp), NM_001017403.1:c.2323G>A;p.(Val775Met), NM_006226.4:c.1103A>G;p.(Gln368Arg), NM_013956.5:c.881T>C;p.(Met294Thr)" "De novo" "yes" "rs28940870" "0" "" "" "g.57614474C>T" "{CV-SCV:002246714.4}" "pathogenic" "ACMG"
"0000593710" "0" "99" "11" "57381948" "57381948" "subst" "0" "03256" "SERPING1_000314" "g.57381948G>A" "6.196e-7" "{PMID:Skriver 1989:2563376} {PMID:Eldering 1992:1551909} {PMID:Aulak 1993:8495195} {PMID:Bissler 1997:9069585} {DOI:Zuraw 2000:10.1067/mai.2000.104780} {DOI:Bygum 2011:10.1111/j.1398-9995.2010.02456.x} {DOI:Suffritti 2014:10.1111/cea.12293} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Maia 2019:10.1111/all.13699} {DOI:Liu 2019:10.1684/ejd.2018.3487} {DOI:Veronez 2019:10.3389/fmed.2019.00028} {DOI:Guryanova 2021:10.1186/s12948-021-00141-0}{DOI:Veronez 2021:10.1016/j.jaip.2020.11.039}{DOI:Förster 2021:0.1186/s13023-021-02021-x} {DOI:Sheikh 2022:10.1007/s10875-022-01399-y} {DOI:Ren 2023:10.1016/j.jaci.2022.11.027} {DOI:Grombirikova 2023:10.1007/s10875-023-01565-w} {DOI:Markocsy 2024:10.1016/j.waojou.2024.100885} {DOI:Aydoğdu 2024:10.1620/tjem.2023.J083} {DOI:Lu 2024:10.1016/j.cgh.2024.05.020} {DOI:Bocquet 2024:10.21203/rs.3.rs-4847919/v1} {DOI:Ferriani 2025:10.1016/j.jaip.2025.08.026} {DOI:Guan 2026:10.1097/MD.0000000000047283} {DOI:Bas 2026:10.3390/medicina62091635}" "" "16789G>A (traditional)" "Highly recurrent variant\r\nFour probands have been found with a de novo condition\r\nMissense variants of the same residue (p.Arg466Cys/Ser/Pro/Leu/Gly) disrupt the Arg P1 position of the RCL and subsequently the control of Ser-protease targets\r\nc.1397G>A variant.\r\nThe Italian proband sample exhibits a high level of ciculating cleaved HK species, with 44.7% of total HK, in line with an activation of kallikrein-kinin system.\r\nMultiple submitters on ClinVar; considered pathogenic based on ACMG variant classification criteria PS1, PS3, PS4_Str, PS2_Str, PM1, PM2, PM5, PP1, PP2, PP3, PP4, PP5." "De novo" "yes" "rs121907948" "0" "" "" "g.57614475G>A" "{CV:000003946}" "pathogenic" "ACMG"
"0000593711" "0" "99" "11" "57381953" "57381953" "del" "0" "03256" "SERPING1_000315" "g.57381953del" "" "{DOI:Gösswein 2008:10.1159/000138883}" "" "" "" "Germline" "" "" "0" "" "" "g.57614480del" "" "likely pathogenic" "ACMG"
"0000593712" "0" "99" "11" "57381978" "57381978" "subst" "0" "03256" "SERPING1_000316" "g.57381978C>T" "" "{DOI:Gösswein 2008:10.1159/000138883} {DOI:Bygum 2011:10.1111/j.1398-9995.2010.02456.x} {DOI:Haslund 2019:10.1172/JCI98869} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Shin 2020:0.3345/kjp.2019.00241} {DOI:Loli-Ausejo 2021:10.1007/s12016-021-08834-9} {PMID:Gao 2025:40848077}, {DOI:Gao 2025:10.1007/s10875-025-01912-z}" "" "" "Recurrent variant.\r\nPro454 is a highly conserved residue among serpins (98%); lies within the non-structurally organized C-terminus - loop s1C/s4B; i.e., distal hinge region, and functioning as part of the gate. It forms tight turn and the RCL flips for its insertion around this residue; In the native structure, Pro454 residue packs against conserved position in s4C (Phe291), in s3C (Val300) and in s2C (Pro377), likely disrupted by the Pro to Leu transition. \r\nApparent correspondence to p.(Pro391His) in SERPINA1 (A1AT) with oligomers.\r\nVariant likely to oligomerize (Haslund 2019)\r\nIntroduced in ClinVar database as pathogenic by LabCorp Genetics, San Francisco CA" "Germline" "yes" "" "0" "" "" "g.57614505C>T" "{CV-SCV:007374317.1}" "pathogenic" "ACMG"
"0000593713" "0" "99" "11" "57382001" "57382001" "subst" "0" "03256" "SERPING1_000317" "g.57382001C>T" "" "{DOI:Siddique 1993:10.1159/000154171} {DOI:Blanch 2002:10.1002/humu.9073} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Soyak Aytekin 2021:10.23822/EurAnnACI.1764-1489.146}" "" "" "Recurrent variant.\r\nThe c.1450C>T variant meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PVS1_Mod, PP4_Mod, PS4_Mod, PM2_Sup.\r\nSubmitted to ClinVar as pathogenic by Center for Genomics, Ann and Robert H. Lurie Children\'s Hospital of Chicago, IL; by Research Centre For Medical Genetics, Moscow Russia" "Germline" "yes" "rs2135328243" "0" "" "" "g.57614528C>T" "{CV-SCV:002495952.1}" "pathogenic" "ACMG"
"0000593714" "0" "99" "11" "57382017" "57382017" "subst" "0" "03256" "SERPING1_000318" "g.57382017C>G" "" "{DOI:Verpy 1995:10.1172/JCI117663} {PMID:Verpy 1996:8755917} {DOI:Pedrosa 2016:10.1007/s10875-015-0222-9} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:loli-Ausejo 2021:10.1007/s12016-021-08834-9}" "" "" "Recurrent variant.\r\nHomologous to mouse and rat sequences.\r\nThe p.(Pro467Arg) lies within the beta-sheet 5B. Losing a Pro467 that serves to structure the gate should very probably have consequences with a conformation with gate open and a subsequent high susceptibility to oligomerize, then classifying\r\np.(Pro467Arg) within class III. In line with some other variants affecting the structure of the gate.\r\nThe c.1466C>G variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PP3_Str, PP4_Str, PS4_Mod, PS3_Sup, PM2_Sup, PP2" "Germline" "yes" "" "0" "" "" "g.57614544C>G" "{CV-SCV:005088208.1}" "pathogenic" "ACMG"
"0000593715" "0" "99" "11" "57382032" "57382032" "subst" "0" "03256" "SERPING1_000319" "g.57382032G>A" "0.00001396 (gnomAD v3)" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Suffritti 2014:10.1111/cea.12293} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Berra 2019:10.1186/s13223-019-0355-0} {DOI:Hauk 2022:10.1016/j.anai.2022.08.919} {DOI:Rodriguez Espada 2025:10.1182/bloodadvances.2025017220}" "" "16873G>A (traditional)" "Recurrent variant.\r\nFamily 1. The Italian patient samples exhibit a high level of circulating cleaved HK species, with 19.8% and 34.4% of total HK, in line with an activation of kallikrein-kinin system.\r\nFamilies 4 to 7. Probands in each of the 4 Italian families were identified due to urticaria symptoms. In none of the 4 families there was evidence for HAE without wheals while inherited C1-INH and C4 deficiency were clearly present. C1-INH function tested with C1s, kallikrein and FXIIa was below 50% of reference. Repeated measurements of complement parameters in carriers showed a degree of variability, which is never detected in typical HAE-C1INH. Transfected in a murine hepatoma cell line, the mutant protein secretion failed, but was abundant in the insoluble fraction of cell lysate, with a hypothesis of intracellular accumulation is due to polymer formation.\r\nOther variant(s) that disrupt Arg494 have been observed in individuals with SERPING1-related conditions, which suggests that Arg494 may be a clinically significant amino acid residue of sheet 5B, with possible consequence of its substitution on the shutter functional domain.\r\nIntroduced in ClinVar as a likely pathogenic variant by InVitae, San Francisco CA." "Germline" "yes" "rs1363997186" "0" "" "" "g.57614559G>A" "{CV-SCV:002259703.2}" "likely pathogenic" "ACMG"
"0000593716" "0" "99" "11" "57382032" "57382032" "subst" "0" "03256" "SERPING1_000320" "g.57382032G>T" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Suffritti 2014:10.1111/cea.12293} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "16873G>T (traditional)" "The Italian patient samples exhibit a high level of circulating cleaved HK species, with 39.3% to 49.4% of total HK, in line with an activation of kallikrein-kinin system.\r\nc.1481G>T variant meets ACMG criteria to be characterized as pathogenic PS3, PS4, PM1, PM2, PP1, PP3." "Germline" "yes" "" "0" "" "" "g.57614559G>T" "" "pathogenic" "ACMG"
"0000593717" "0" "99" "11" "57382044" "57382044" "subst" "0" "03256" "SERPING1_000321" "g.57382044C>A" "" "{PMID:Yamamoto 2012:21934598} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Hashimura 2021:10.1111/all.15034}" "" "" "Pro476 is a highly conserved residue among serpins (95%) in the distal hinge C-terminus and participates in the gate structure, located in a buried hydrophobic area\r\nIn native structure packs against conserved positions in s4C (Phe291), s3C (Val300) and s2C (Pro377); follows the hinge C-terminus at Arg472." "Germline" "yes" "" "0" "" "" "g.57614571C>A" "" "pathogenic" "ACMG"
"0000593719" "0" "99" "11" "57382044" "57382044" "subst" "0" "03256" "SERPING1_000323" "g.57382044C>T" "" "{DOI:Gösswein 2008:10.1159/000138883} {DOI:Martinho 2013:10.1016/j.molimm.2012.09.003} {DOI:Guryanova 2019:10.29235/1814-6023-2019-16-3-349-356} {DOI:Guryanova 2021:10.1186/s12948-021-00141-0} {DOI:Loli-Ausejo 2021:10.1007/s12016-021-08834-9} {DOI:Hashimura 2021:10.1111/all.15034}" "" "" "Highly recurrent variant\r\nPro476 is a highly conserved residue among serpins (95%) in the distal hinge C-terminus and participates in the gate structure, located in a buried hydrophobic area, then classifying Pro476Leu variation within class III.\r\nIn native structure Pro476 packs against conserved positions in s4C (Phe291), s3C (Val300) and s2C (Pro377); follows the hinge C-terminus at Arg472.\r\nHAE family from Belarus presenting with a de novo proband.\r\nSubmitted to ClinVar as likely pathogenic by Ambry Genetics, Aliso Viejo CA" "De novo" "yes" "rs2495458739" "0" "" "" "g.57614571C>T" "{CV-SCV:002700085.2}" "pathogenic" "ACMG"
"0000593720" "0" "99" "11" "57382044" "57382044" "subst" "0" "03256" "SERPING1_000324" "g.57382044C>G" "" "{DOI:Kalmar 2003:10.1002/humu.9202} {DOI:Bors 2013:10.1016/j.jaci.2012.11.015} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Szabo 2022:10.3389/falgy.2022.836465}" "" "" "Pro476 is a highly conserved residue among serpins (95%) in the distal hinge C-terminus and participating in the gate structure, located in a buried hydrophobic area.\r\nIn native structure packs against conserved positions in s4C (Phe291), s3C (Val300) and s2C (Pro377).\r\nThe c.1493C>G variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PP3_Str, PS4_Mod, PM5, PM2_Sup, PP2, PP4" "Germline" "yes" "" "0" "" "" "g.57614571C>G" "{CV-SCV:005073700.1}" "pathogenic" "ACMG"
"0000593744" "0" "99" "11" "57373652" "57373653" "del" "0" "03256" "SERPING1_000325" "g.57373652_57373653del" "" "{DOI:Freiberger 2002:10.1002/humu.9029} {DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "" "" "Considered pathogenic in agreement with ACMG criteria PVS1, PS3, PS4.\r\nErroneously introduced as c.854_855del in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "" "0" "" "" "g.57606179_57606180del" "" "pathogenic" "ACMG"
"0000594724" "0" "99" "11" "57381816" "57381816" "del" "0" "03256" "SERPING1_000326" "g.57381816del" "" "{PMID:Zhi 2003:14714307} {DOI:Xu 2012:10.1111/all.12024}" "" "17839delC" "The c.1265delC variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PVS1_Str, PS4_Mod, PP4_Mod, PM2_Sup" "Germline" "yes" "" "0" "" "" "g.57614343del" "{CV-SCV:005088596.1}" "pathogenic" "ACMG"
"0000595702" "0" "99" "11" "57382155" "57382308" "del" "0" "03256" "SERPING1_000327" "g.57382155_57382308del" "" "{DOI:Laimer 2006:10.1097/01.gim.0000214302.90076.fa} {PMID:Laimer 2006:16617246}" "" "" "Demonstrated low expression of a 155-bp deleted transcript with a substantial reduction of transcription and C1 Inhibitor protein expression" "Germline" "yes" "" "0" "" "" "g.57614682_57614835del" "" "pathogenic" "ACMG"
"0000595706" "0" "55" "11" "57383314" "57383314" "del" "0" "03256" "SERPING1_000328" "g.57383314del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.57615841del" "" "likely pathogenic" ""
"0000595734" "0" "30" "11" "57382139" "57382139" "dup" "0" "03256" "SERPING1_000329" "g.57382139dup" "" "{DOI:Kang 2006:10.1111/j.1398-9995.2006.01010.x}" "" "" "" "Germline" "no" "" "0" "" "" "g.57614666dup" "" "likely benign" ""
"0000595735" "0" "33" "11" "57365152" "57365153" "del" "0" "03256" "SERPING1_000330" "g.57365152_57365153del" "0.000056 (TOPMed)" "{DOI:Roche 2005:10.1002/humu.20197}" "" "" "" "Germline" "" "rs917061427" "0" "" "" "g.57597679_57597680del" "" "likely benign" ""
"0000595767" "0" "73" "11" "57357305" "57357305" "subst" "0" "03256" "SERPING1_000331" "g.57357305G>A" "0.186690" "{DOI:Gibson 2012:10.1016/j.imbio.2011.07.015}" "" "" "Significant difference in higher C1-INH antigenic levels in AMD cases versus controls." "Germline" "" "rs2649663" "0" "" "" "g.57589832G>A" "" "likely benign" ""
"0000595793" "0" "99" "11" "57373591" "57373591" "subst" "0" "03256" "SERPING1_000332" "g.57373591G>A" "" "{DOI:Roche 2005:10.1002/humu.20197} {DOI:Bygum 2011:10.1111/j.1398-9995.2010.02456.x} {DOI:Kesim 2011:10.1159/000323915} {DOI:Veronez 2019:10.3389/fmed.2019.00028} {DOI:Liu 2019:10.1684/ejd.2018.3487} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Xu 2020:0.1186/s13601-020-00360-9} {DOI:Loli‐Ausejo 2021:10.1007/s12016-021-08834-9} {DOI:Ferriani 2025:10.1016/j.jaip.2025.08.026}" "" "c.795G>A" "Recurrent variant.\r\nThe c.794G>A variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PVS1, PS4_Mod, PP4_Str, PM2_Sup.\r\nErroneously introduced as c.795G>A in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "" "0" "" "" "g.57606118G>A" "{CV-SCV:005187342.1}" "pathogenic" "ACMG"
"0000595854" "0" "33" "11" "57365160" "57365160" "subst" "0" "03256" "SERPING1_000333" "g.57365160T>C" "" "{DOI:Roche 2005:10.1002/humu.20197}" "" "c.-584T>C" "Variant found in one control" "Germline" "" "" "0" "" "" "g.57597687T>C" "" "benign" ""
"0000595856" "0" "33" "11" "57365162" "57365162" "subst" "0" "03256" "SERPING1_000335" "g.57365162T>G" "" "" "" "" "Introduced in ClinVar as VUS by Illumina Laboratory Services, San Diego CA" "Germline" "" "rs886048398" "0" "" "" "g.57597689T>G" "{CV-SCV:000372544.3}" "VUS" "ACMG"
"0000595878" "0" "30" "11" "57365194" "57365194" "subst" "0" "03256" "SERPING1_000336" "g.57365194G>C" "0.00026 (gnomAD); 0.000725 (TOPMed)" "" "" "" "" "Germline" "" "rs112290300" "0" "" "" "g.57597721G>C" "{CV-RCV:000312741.2}" "likely benign" "ACMG"
"0000595880" "0" "30" "11" "57365785" "57365785" "dup" "0" "03256" "SERPING1_000337" "g.57365785dup" "0.0043" "" "" "" "" "CLASSIFICATION record" "" "rs1019516520" "0" "" "" "g.57598312dup" "" "VUS" ""
"0000595887" "0" "10" "11" "57365895" "57365895" "subst" "0" "03256" "SERPING1_000338" "g.57365895G>A" "0.126564 (GnomAD) 0.085064 (1000Genomes)" "{DB:CLININ[1]}{DOI:Xu 2012:10.1111/all.12024}" "" "g.738G>A" "Polymorphism with possible NMD" "Germline" "" "rs28362945" "0" "" "" "g.57598422G>A" "{CV:000983229}" "benign" "ACMG"
"0000595888" "0" "31" "11" "57367222" "57367222" "subst" "0" "03256" "SERPING1_000339" "g.57367222C>T" "0.3850 (GnomAD) 0.410264 (TOPMED)" "{DOI:Xu 2012:10.1111/all.12024}" "" "IVS2-130C>T" "C to T transition creates an ISE" "Germline" "" "rs1005510" "0" "" "" "g.57599749C>T" "{CV:000983239}" "benign" "ACMG"
"0000595889" "0" "33" "11" "57367417" "57367417" "subst" "0" "03256" "SERPING1_000340" "g.57367417C>G" "0.000006195 (GnomAD v4) 0.000008 (TOPMED" "" "" "" "" "Germline/De novo (untested)" "" "rs11229062" "0" "" "" "g.57599944C>G" "{CV:000305018}" "VUS" "ACMG"
"0000595890" "0" "97" "11" "57367429" "57367429" "subst" "0" "03256" "SERPING1_000341" "g.57367429G>T" "0.00025 (GnomAD)" "{DOI:Suffritti 2014:10.1111/cea.12293}" "" "2273G>T (traditional)" "With a synonymous variant, G to T transition creates an ESS and disrupts an ESE.\r\nProband sample exhibits a high level of circulating cleaved HK species, with 57.0% of total HK, consistent with an activation of kallikrein-kinin system.\r\nVariant introduced in ClinVar as likely benign by independent submitters." "Germline" "" "rs149573972" "0" "" "" "g.57599956G>T" "{CV-SCV:004781493.2}" "VUS" ""
"0000596994" "0" "99" "11" "57365775" "57365775" "dup" "0" "03256" "SERPING1_000342" "g.57365775dup" "" "{DOI:Mete Gökmen 2019:10.1159/000492583}" "" "" "" "Germline/De novo (untested)" "yes" "" "0" "" "" "g.57598302dup" "" "pathogenic" "ACMG"
"0000596995" "0" "99" "11" "57365776" "57365776" "dup" "0" "03256" "SERPING1_000343" "g.57365776dup" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007}" "" "" "" "Germline" "" "" "0" "" "" "g.57598303dup" "" "pathogenic" "ACMG"
"0000596996" "0" "99" "11" "57365779" "57365779" "dup" "0" "03256" "SERPING1_000344" "g.57365779dup" "" "{DOI:Bafunno 2014:10.1111/ahg.12052}" "" "" "" "Germline" "" "" "0" "" "" "g.57598306dup" "" "pathogenic" "ACMG"
"0000596997" "0" "99" "11" "57365792" "57365792" "delins" "0" "03256" "SERPING1_000345" "g.57365792delinsTT" "" "{DOI:Rijavec 2013:10.1371/journal.pone.0056712.t002}" "" "" "" "Germline" "" "" "0" "" "" "g.57598319delinsTT" "" "pathogenic" "ACMG"
"0000596999" "0" "79" "11" "57367397" "57367415" "del" "0" "03256" "SERPING1_000346" "g.57367397_57367415del" "" "{DOI:Cagini 2016:10.1515/hsz-2015-0222} {DOI:Veronez 2019:10.3389/fmed.2019.00028} {DOI:Veronez 2021:10.1016/j.jaip.2020.11.039} {DOI:Ferriani 2025:10.1016/j.jaip.2025.08.026}" "" "" "" "Germline" "?" "" "0" "" "" "g.57599924_57599942del" "" "pathogenic" "ACMG"
"0000597002" "0" "99" "11" "57367418" "57367418" "dup" "0" "03256" "SERPING1_000348" "g.57367418dup" "" "{DOI:Iwamoto 2018:10.1016/j.jdermsci.2012.06.012}" "" "c.119insA" "" "Germline" "" "" "0" "" "" "g.57599945dup" "" "likely pathogenic" "ACMG"
"0000597003" "0" "99" "11" "57367438" "57367507" "del" "0" "03256" "SERPING1_000349" "g.57367438_57367507del" "" "{DOI:Iwamoto 2018:10.1016/j.jdermsci.2012.06.012} {DOI:Hashimura 2021:10.1111/all.15034}" "" "c.138_207del(70)" "Independency of both Japanese pedigrees not indicated" "Germline" "yes" "" "0" "" "" "g.57599965_57600034del" "" "likely pathogenic" "ACMG"
"0000597006" "0" "99" "11" "57367457" "57367457" "dup" "0" "03256" "SERPING1_000350" "g.57367457dup" "" "{DOI:Lopez-Lera 2011:10.1016/j.molimm.2011.07.010} {DOI:Ponard 2019:10.1002/humu.23917}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57599984dup" "" "pathogenic" "ACMG"
"0000597007" "0" "99" "11" "57367460" "57367460" "del" "0" "03256" "SERPING1_000351" "g.57367460del" "" "{DOI:Freiberger 2002:10.1002/humu.9029} {DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "" "2304delC" "Variant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "" "0" "" "" "g.57599987del" "" "pathogenic" "ACMG"
"0000597008" "0" "99" "11" "57367487" "57367494" "del" "0" "03256" "SERPING1_000352" "g.57367487_57367494del" "" "{DOI:Bafunno 2014]:10.1111/ahg.12052}" "" "c.187_194 delTCCAGCTT" "" "Germline" "yes" "" "0" "" "" "g.57600014_57600021del" "" "pathogenic" ""
"0000597009" "0" "99" "11" "57367487" "57367487" "del" "0" "03256" "SERPING1_000353" "g.57367487del" "" "{DOI:Roche 2005:10.1002/humu.20197} {DOI:Ponard 2019:10.1002/humu.23917}" "" "c.187delT" "Variant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "" "" "0" "" "" "g.57600014del" "" "pathogenic" "ACMG"
"0000597010" "0" "79" "11" "57367506" "57367506" "del" "0" "03256" "SERPING1_000354" "g.57367506del" "" "{DOI:Xu 2012:10.1111/all.12024} {DOI:Liu 2019:10.1684/ejd.2018.3487}" "" "c.206delA" "" "Germline" "yes" "" "0" "" "" "g.57600033del" "" "pathogenic" "ACMG"
"0000597011" "0" "99" "11" "57367549" "57367549" "del" "0" "03256" "SERPING1_000355" "g.57367549del" "" "{DOI:Maia 2019:10.1111/all.13699} {DOI:Guryanova 2021:10.1186/s12948-021-00141-0} {DOI:Veronez 2021:10.1016/j.jaip.2020.11.039} {DOI:Szabo 2022:10.3389/falgy.2022.836465}" "" "c.249delT" "" "Germline" "yes" "" "0" "" "" "g.57600076del" "" "pathogenic" "ACMG"
"0000597012" "0" "99" "11" "57367567" "57367567" "del" "0" "03256" "SERPING1_000356" "g.57367567del" "" "{DOI:Lopez-Lera 2011:10.1016/j.molimm.2011.07.010} {DOI:de la Cruz 2011:10.1016/j.imlet.2011.07.011}" "" "c.267delA" "" "Germline" "" "" "0" "" "" "g.57600094del" "" "pathogenic" "ACMG"
"0000597013" "0" "99" "11" "57367567" "57367567" "dup" "0" "03256" "SERPING1_000357" "g.57367567dup" "" "{DOI:Lopez-Lera 2011:10.1016/j.molimm.2011.07.010}" "" "c.267dupA" "" "Germline" "yes" "" "0" "" "" "g.57600094dup" "" "pathogenic" "ACMG"
"0000597014" "0" "99" "11" "57367591" "57367591" "dup" "0" "03256" "SERPING1_000358" "g.57367591dup" "" "{DOI:Mete Gökmen 2019:10.1159/000492583}" "" "c.291-292insA" "" "Germline" "yes" "" "0" "" "" "g.57600118dup" "" "pathogenic" "ACMG"
"0000597019" "0" "79" "11" "57367642" "57367645" "del" "0" "03256" "SERPING1_000359" "g.57367642_57367645del" "" "" "" "" "c.342_345del variant has been considered as pathogenic in agreement with ACMG criteria as follows PVS1, PM2, PP4 (University of Thessaly Greece)" "Germline" "yes" "rs1565169621" "0" "" "" "g.57600169_57600172del" "{CV:000626351}" "pathogenic" "ACMG"
"0000597020" "0" "99" "11" "57367660" "57367679" "dup" "0" "03256" "SERPING1_000360" "g.57367660_57367679dup" "" "{DOI:Speletas 2015:10.1016/j.jaci.2014.08.007} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "c.357_358insGGGTCCTTCTGCCCAGGACC" "The HGVS notation prescribes that on the forward strand it should be the 20-nt sequence at position c.360_379." "Germline" "yes" "" "0" "" "" "g.57600187_57600206dup" "" "pathogenic" "ACMG"
"0000597044" "0" "99" "11" "57367660" "57367660" "del" "0" "03256" "SERPING1_000361" "g.57367660del" "" "{DOI:Johnsrud 2015:10.1371/journal.pone.0131637.t001}" "" "c.360delG" "" "Germline" "yes" "" "0" "" "" "g.57600187del" "" "pathogenic" "ACMG"
"0000597045" "0" "99" "11" "57367687" "57367688" "del" "0" "03256" "SERPING1_000362" "g.57367687_57367688del" "" "{DOI:Gösswein 2008:10.1159/000138883} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Guryanova 2021:10.1186/s12948-021-00141-0}" "" "NM_000062.2:c.383_384delCT" "HAE family from Belarus is presenting with a de novo proband" "De novo" "yes" "" "0" "" "" "g.57600214_57600215del" "" "pathogenic" "ACMG"
"0000597046" "0" "99" "11" "57367731" "57367731" "del" "0" "03256" "SERPING1_000363" "g.57367731del" "" "{DOI:Mete Gökmen 2019:10.1159/000492583}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57600258del" "" "pathogenic" "ACMG"
"0000597072" "0" "99" "11" "57367833" "57367834" "dup" "0" "03256" "SERPING1_000364" "g.57367833_57367834dup" "" "{PMID:Verpy 1996:8755917} {DOI:Gösswein 2008:10.1159/000138883} {DOI:Steiner 2017:10.1111/cei.12941}" "" "2679insTT" "Variant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "" "0" "" "" "g.57600360_57600361dup" "" "pathogenic" "ACMG"
"0000597089" "0" "99" "11" "57369510" "57369510" "del" "0" "03256" "SERPING1_000365" "g.57369510del" "" "{DOI:Cagini 2016:10.1515/hsz-2015-0222} {DOI:Hashimura 2021:10.1111/all.15034} {DOI:Veronez 2021:10.1016/j.jaip.2020.11.039} {DOI:Ferriani 2025:10.1016/j.jaip.2025.08.026}" "" "c.553delG" "" "Germline" "yes" "" "0" "" "" "g.57602037del" "" "pathogenic" "ACMG"
"0000597090" "0" "99" "11" "57369528" "57369528" "del" "0" "03256" "SERPING1_000366" "g.57369528del" "" "{DOI:Zuraw 2000:10.1067/mai.2000.104780}" "" "" "Variant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "" "" "0" "" "" "g.57602055del" "" "pathogenic" "ACMG"
"0000597091" "0" "99" "11" "57369528" "57369528" "dup" "0" "03256" "SERPING1_000367" "g.57369528dup" "" "{PMID:Verpy 1996:8755917}" "" "4372insA" "Variant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "" "" "0" "" "" "g.57602055dup" "" "pathogenic" "ACMG"
"0000597093" "0" "99" "11" "57369557" "57369557" "dup" "0" "03256" "SERPING1_000368" "g.57369557dup" "" "{DOI:Speletas 2015:10.1016/j.jaci.2014.08.007} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Ren 2023:10.1016/j.jaci.2022.11.027} {DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "" "c.601insC" "Four pedigrees have been described\r\nFamily 1 Greece, 3 affected individuals\r\nFamily 2 France, 2 affected individuals\r\nFamily 3 United States, 1 female is affected\r\nFamily 4, Czech republic (n=2)\r\nFrameshift p.(Lys201Glnfs*56) affects the loop after helix C\r\nCharacterized as pathogenic according to ACMG criteria PVS1, PP5, PM2, PP1, PP4.\r\nLast introduction in ClinVar as a pathogenic variant by Centogene AG, Rostock Germany" "De novo" "yes" "rs1590823884" "0" "" "" "g.57602084dup" "{CV:000690350}" "pathogenic" "ACMG"
"0000597094" "0" "99" "11" "57369532" "57369543" "del" "0" "03256" "SERPING1_000369" "g.57369532_57369543del" "" "{DOI:Martinho 2013:10.1016/j.molimm.2012.09.003} {DOI:Ryø 2023:10.1016/j.jaci.2023.04.023}" "" "" "p.(Asn192_Ser195del) is a dominant-negative variant; p.(Asn192_Ser195del) variant product accumulates into cell, affecting transport and secretion of normal C1-INH.\r\nAsn170-Ser173 residues are localized in helix C; a Asn170 to Ser173 deletion affects the shutter functional region, with an increased susceptibility to oligomerization." "Germline" "" "" "0" "" "" "g.57602059_57602070del" "" "pathogenic (dominant)" "ACMG"
"0000597099" "21" "33" "11" "57365748" "57365748" "subst" "0.00128084" "03256" "SERPING1_000370" "g.57365748C>T" "0.0009841 (c.5C>T; gnomAD v3)" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "[5C>T];[1045C>T]" "Likely benign/benign with the following criteria BS1, BS2, BP2, BP4.\r\nCompound heterozygous proband c.[5C>T];[1045C>T] presenting with a HAE of the intermediate type.\r\nTwo variants are in trans, c.5C>T maternal allele/c.1045C>T paternal allele, both parents are asymptomatic, proband\'s sister is not a carrier" "Germline" "no" "rs185342631" "0" "" "" "g.57598275C>T" "{CV:000305016}" "benign" "ACMG"
"0000597100" "0" "99" "11" "57367830" "57367830" "subst" "0" "03256" "SERPING1_000371" "g.57367830T>C" "" "{PMID:Bissler 1997:9069585} {DOI:Haslund 2019:10.1172/JCI98869.}" "" "" "Leu155 is located within the shutter domain, contributing to maintain the normal closed state of the overlying sheet A.\r\np.(Leu177Pro) is a dominant-negative variant: The variant product p.(Leu177Pro) develops oligomers with wt C1-INH, with subsequent insoluble protein fraction within cells and a strongly reduced C1-INH secretion, making conditions for a haploinsufficiency." "Germline" "yes" "" "0" "" "" "g.57600357T>C" "" "pathogenic" "ACMG"
"0000597101" "0" "99" "11" "57369544" "57369553" "del" "0" "03256" "SERPING1_000372" "g.57369544_57369553del" "" "{DOI:Martinho 2013:10.1016/j.molimm.2012.09.003}" "" "c.587delTCCTCTCTTA" "The variant product presented as p.(Ile196_Tyr177del) by Martinho 2013 is not in agreement with a c.587_596delTCCTCTCTTA variant." "Germline" "yes" "" "0" "" "" "g.57602071_57602080del" "" "pathogenic" "ACMG"
"0000597102" "0" "99" "11" "57369549" "57369576" "del" "0" "03256" "SERPING1_000373" "g.57369549_57369576del" "" "{DOI:Martinho 2013:10.1016/j.molimm.2012.09.003}" "" "c.592delTCTTACCCCAAGGACTTCACCTGTGTCC" "The variant C1-INH product presented as p.(Ser198_His207del) by Martinho 2013 is not in agreement with a c.592_619delTCTTACCCCAAGGACTTCACCTGTGTCC variant and a 28-nt deletion" "Germline" "yes" "" "0" "" "" "g.57602076_57602103del" "" "pathogenic" "ACMG"
"0000597103" "0" "99" "11" "57369562" "57369577" "del" "0" "03256" "SERPING1_000374" "g.57369562_57369577del" "" "{DOI:Martinho 2013:10.1016/j.molimm.2012.09.003}" "" "c.605delACTTCACCTGTGTCCA" "The deletion variant with delACTTCACCTGTGTCCA presented by Martinho 2013 is not an in-frame deletion; it has been considered as c.605_620delACTTCACCTGTGTCCA, with subsequent p.(Asp202Alafs*4)." "Germline" "yes" "" "0" "" "" "g.57602089_57602104del" "" "pathogenic" "ACMG"
"0000597104" "0" "99" "11" "57373577" "57373601" "del" "0" "03256" "SERPING1_000375" "g.57373577_57373601del" "" "{DOI:Martinho 2013:10.1016/j.molimm.2012.09.003}" "" "c.780delGCTCATCAACACCTGGGTGGCCAAG" "The variant C1-INH product presented as p.(Glu260_Lys246del) by Martinho 2013 is not in agreement with a c.780_804delGCTCATCAACACCTGGGTGGCCAAG variant and a 25-nt deletion; it has been modified as p.(Leu261Thrfs*10)" "Germline" "yes" "" "0" "" "" "g.57606104_57606128del" "" "pathogenic" "ACMG"
"0000597105" "0" "99" "11" "57373619" "57373634" "del" "0" "03256" "SERPING1_000376" "g.57373619_57373634del" "" "{DOI:Martinho 2013:10.1016/j.molimm.2012.09.003}" "" "c.822delCAGCCGGCTGCTAGAC" "The variant C1-INH product presented as p.(Ile274_Asp279del) by Martinho 2013 is not in agreement with a c.822_837delCAGCCGGCTGCTAGAC variant and a 16-nt deletion; it has been modified as p.(Ser275Valfs*16)" "Germline" "yes" "" "0" "" "" "g.57606146_57606161del" "" "pathogenic" "ACMG"
"0000597106" "0" "99" "11" "57373632" "57373637" "del" "0" "03256" "SERPING1_000377" "g.57373632_57373637del" "" "{DOI:Martinho 2013:10.1016/j.molimm.2012.09.003} {DOI:Ryø 2023:10.1016/j.jaci.2023.04.023}" "" "" "p.(Asp279_Ser280del) is a dominant-negative variant; p.(Asp279_Ser280del) variant product accumulates into HeLa cells in recombinant expression studies, affecting transport and secretion of normal C1-INH (Ryø et al 2023).\r\nAsp257-Ser258 residues are localized between helixF and sheet3A; a deletion might affect the shutter functional region, with an increased susceptibility to oligomerization" "Germline" "" "" "0" "" "" "g.57606159_57606164del" "" "pathogenic (dominant)" "ACMG"
"0000597107" "0" "99" "11" "57369550" "57369551" "del" "0" "03256" "SERPING1_000378" "g.57369550_57369551del" "" "{DOI:Rijavec 2013:10.1371/journal.pone.0056712}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57602077_57602078del" "" "pathogenic" "ACMG"
"0000597108" "0" "99" "11" "57369552" "57369552" "del" "0" "03256" "SERPING1_000379" "g.57369552del" "" "{PMID:Bissler 1997:9069585}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57602079del" "" "pathogenic" "ACMG"
"0000597109" "0" "99" "11" "57369557" "57369557" "dup" "0" "03256" "SERPING1_000380" "g.57369557dup" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007}" "" "" "The HGVS notation prescribes that on the forward strand the duplication should be at position c.600. Subsequently this variant should be c.600dupC, also identified by Speletas 2015, Loules 2018 and in a French series by Ponard 2019.\r\nSame predicted protein change, with p.(Lys201Glnfs*56) for both alleles." "Germline" "yes" "" "0" "" "" "g.57602084dup" "" "pathogenic" "ACMG"
"0000597110" "0" "99" "11" "57369579" "57369579" "del" "0" "03256" "SERPING1_000381" "g.57369579del" "" "{DOI:Roche 2005:10.1002/humu.20197} {DOI:Loli‐Ausejo 2021:10.1007/s12016-021-08834-9}" "" "" "Variant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "" "0" "" "" "g.57602106del" "" "pathogenic" "ACMG"
"0000597111" "0" "99" "11" "57369585" "57369585" "del" "0" "03256" "SERPING1_000382" "g.57369585del" "" "{DOI:Zuraw 2000:10.1067/mai.2000.104780} {PMID:Lei 2011:22299312}" "" "" "Variant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "" "0" "" "" "g.57602112del" "" "pathogenic" "ACMG"
"0000597112" "0" "99" "11" "57369586" "57369602" "del" "0" "03256" "SERPING1_000383" "g.57369586_57369602del" "" "{DOI:Xu 2012:10.1111/all.12024} {DOI:Liu 2019:10.1684/ejd.2018.3487}" "" "c.629_645delTGAAGGGCTTCACGACC" "" "Germline" "yes" "" "0" "" "" "g.57602113_57602129del" "" "pathogenic" "ACMG"
"0000597113" "0" "99" "11" "57369617" "57369617" "dup" "0" "03256" "SERPING1_000384" "g.57369617dup" "" "{DOI:Zuraw 2000:10.1067/mai.2000.104780} {DOI:Lin 2021:10.1016/j.jfma.2021.02.006}" "" "" "Variant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "" "0" "" "" "g.57602144dup" "" "pathogenic" "ACMG"
"0000597114" "0" "99" "11" "57369625" "57369625" "del" "0" "03256" "SERPING1_000385" "g.57369625del" "" "{DOI:Bygum 2011:10.1111/j.1398-9995.2010.02456.x} {DOI:Veronez 2019:10.3389/fmed.2019.00028}" "" "" "de novo proband of the Danish predigree evaluated by C1-INH function." "De novo" "yes" "" "0" "" "" "g.57602152del" "" "pathogenic" "ACMG"
"0000597115" "0" "99" "11" "57369626" "57369627" "del" "0" "03256" "SERPING1_000386" "g.57369626_57369627del" "" "{DOI:dela Cruz 2011:10.1016/j.imlet.2011.07.011} {DOI:Lopez-Lera 2011:10.1016/j.molimm.2011.07.010} {DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57602153_57602154del" "" "pathogenic" "ACMG"
"0000597116" "0" "99" "11" "57369631" "57369632" "delins" "0" "03256" "SERPING1_000387" "g.57369631_57369632delinsAA" "" "{DOI:Speletas 2009:10.1016/j.humimm.2009.08.010} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Hashimura 2021:10.1111/all.15034}" "" "c.675–676TC>AA" "Recurrent variant.\r\nErroneously identified by Speletas 2009" "Germline" "yes" "rs1565170364" "0" "" "" "g.57602158_57602159delinsAA" "{CV:000626350}" "pathogenic" "ACMG"
"0000597117" "0" "99" "11" "57369628" "57369628" "subst" "0" "03256" "SERPING1_000388" "g.57369628T>G" "<0.0001" "{DOI:Roche 2005:10.1002/humu.20197} {DOI:López-Lera 2011:10.1016/j.molimm.2011.07.010} {DOI:Andrejević 2015:10.1371/journal.pone.0142174} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Ren 2023:10.1016/j.jaci.2022.11.027} {DOI:Ryø 2023:10.1016/j.jaci.2023.04.023}" "" "" "Four pedigrees have been recorded as carrying a c.671T>G variant\r\nFamily 1. Spain (Roche et al 2005)\r\nFamily 2. Spain (López-Lera et al 2011); incl pedigree with compound variant c.[52-130C>T];[671T>G].\r\nFamily 3. Serbia (Andrejević et al 2015)\r\nFamily 4. United States of America (Ren et al 2023)\r\nIle202 position is located within Sheet 2A, partipating in the shutter function, thus facilitating the RCL insertion, with the hydrophobic Ile bearing a long side chain enhancing the stability of the hydrophobic core of Sheet A; the Ile to Ser transition could disrupt the stability of Sheet A, with a significant degree of oligomerization and demonstrated dominant-negative effect, making the p.(Ile224Ser) variant as provisionally introduced in class III of HAE type II.\r\nCharacterized as pathogenic according to ACMG recommendations PS1, PS3, PS4, PP4, PM1, PM2, PM5, PP3.\r\nVariant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "" "0" "" "" "g.57602155T>G" "" "pathogenic (dominant)" "ACMG"
"0000597118" "0" "99" "11" "57369631" "57369631" "subst" "0" "03256" "SERPING1_000389" "g.57369631T>C" "" "{DOI:Gösswein 2008:10.1159/000138883}" "" "g.4474 T>C" "Two families have been recorded, with one affected individual each\r\nErroneously identified as c.675T>C by Gösswein 2008.\r\nThe c.674T>C variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PP4_Str, PP3_Str, PS4_Mod, PM2_Sup, PP2." "Germline" "yes" "" "0" "" "" "g.57602158T>C" "" "pathogenic" "ACMG"
"0000597119" "0" "99" "11" "57369642" "57369642" "subst" "0" "03256" "SERPING1_000390" "g.57369642G>T" "" "{DOI:Ponard 1019:10.1002/humu.23917}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57602169G>T" "" "pathogenic" "ACMG"
"0000597127" "0" "99" "11" "57373491" "57373491" "del" "0" "03256" "SERPING1_000391" "g.57373491del" "" "{PMID:Wen 2007:18035804}" "" "c.628delA" "" "Germline" "yes" "" "0" "" "" "g.57606018del" "" "pathogenic" "ACMG"
"0000597128" "0" "99" "11" "57373500" "57373502" "del" "0" "03256" "SERPING1_000392" "g.57373500_57373502del" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007}" "" "c.713_715delACC" "In-frame deletion" "Germline" "yes" "" "0" "" "" "g.57606027_57606029del" "" "likely pathogenic" ""
"0000597129" "0" "79" "11" "57373524" "57373525" "del" "0" "03256" "SERPING1_000393" "g.57373524_57373525del" "" "{DOI:Xu 2012:10.1111/all.12024} {DOI:Liu 2019:10.1684/ejd.2018.3487}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57606051_57606052del" "" "pathogenic" "ACMG"
"0000597130" "0" "99" "11" "57373528" "57373529" "delins" "0" "03256" "SERPING1_000394" "g.57373528_57373529delinsT" "" "{DOI:Pappalardo 2000:10.1067/mai.2000.110471}" "" "" "c731_732delinsT variant can be considered pathogenic in agreement with ACMG criteria PVS1, PS2_Str, PS3, PS4, PM2, PP4.\r\nVariant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "De novo" "yes" "" "0" "" "" "g.57606055_57606056delinsT" "" "pathogenic" "ACMG"
"0000597131" "0" "99" "11" "57373541" "57373541" "del" "0" "03256" "SERPING1_000395" "g.57373541del" "" "{PMID:Verpy 1996:8755917}" "" "" "Variant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "" "" "0" "" "" "g.57606068del" "" "pathogenic" "ACMG"
"0000597132" "0" "99" "11" "57373548" "57373548" "del" "0" "03256" "SERPING1_000396" "g.57373548del" "" "{PMID:Verpy 1996:8755917}" "" "" "The c.751delC variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PVS1, PS4_Mod, PP4_Mod, PM2_Sup.\r\nVariant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "rs2495440645" "0" "" "" "g.57606075del" "{CV-SCV:005088183.1}" "pathogenic" "ACMG"
"0000597138" "0" "99" "11" "57373559" "57373560" "del" "0" "03256" "SERPING1_000397" "g.57373559_57373560del" "" "{DOI:Bygum 2011:10.1111/j.1398-9995.2010.02456.x} {DOI:Aabom 2017:10.1186/s13023-017-0604-6} {DOI:Veronez 2019:10.3389/fmed.2019.00028}" "" "c.762_763delCA" "" "Germline" "yes" "" "0" "" "" "g.57606086_57606087del" "" "pathogenic" "ACMG"
"0000597139" "0" "99" "11" "57373563" "57373563" "del" "0" "03256" "SERPING1_000398" "g.57373563del" "" "{DOI:Iwamoto 2012:10.1016/j.jdermsci.2012.06.012} {DOI:Shibuya 2014:10.2332/allergolint.13-LE-0655}" "" "c.766delG and g.9587delG" "" "Germline" "yes" "" "0" "" "" "g.57606090del" "" "pathogenic" "ACMG"
"0000597140" "0" "99" "11" "57373573" "57373579" "del" "0" "03256" "SERPING1_000399" "g.57373573_57373579del" "" "{DOI:Cagini 2016:10.1515/hsz-2015-0222} {DOI:Veronez 2021:10.1016/j.jaip.2020.11.039} {DOI:Ferriani 2025:10.1016/j.jaip.2025.08.026}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57606100_57606106del" "" "pathogenic" "ACMG"
"0000597141" "0" "99" "11" "57373582" "57373584" "del" "0" "03256" "SERPING1_000400" "g.57373582_57373584del" "" "{DOI:Lopez-Lera 2011:g.57606109_57606111del} {DOI:Ponard 2019:10.1002/humu.23917}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57606109_57606111del" "" "pathogenic" "ACMG"
"0000597149" "0" "99" "11" "57373615" "57373617" "del" "0" "03256" "SERPING1_000401" "g.57373615_57373617del" "" "{DOI:Parad 1990:10.1073/pnas.87.17.6786} {DOI:Zahedi 1996:10.1074/jbc.271.39.24307} {DOI:Zuraw 2000:10.1067/mai.2000.104780} {DOI:Ren 2023:10.1016/j.jaci.2022.11.027} {DOI:Ren 2025:10.1172/jci.insight.185548}" "" "" "The HGVS notation prescribes that on the forward strand it should be \'AGA\' at position c.818_820.\r\nIn frame deletion, with deletion of Lys251 residue located within the loop after helix-F, with a full expression of the variant allele and functional evidence by expressing variant in COS cells.\r\np.(Lys273del) results in acquisition of an additional N-glycan at the Asn272IS site.\r\nVariant p.(Lys273del) is prone to decrease the flexibility of the helix F/Sheet-3A loop, which is critical for the RCL insertion during the transition from an active to a latent state. Accordingly, the variant has been shown to generate spontaneous loop-sheet polymerization (Zahedi 1996); C1-INH function is subsequently decreased, with a decreased binding affinity to C1s protease target, however it displays a normal antigenic C1-INH. Thus p.(Lys273del) is considered pathogenic by Ren (2025).\r\nErroneously introduced as c.817_819del in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "" "0" "" "" "g.57606142_57606144del" "" "pathogenic" "ACMG"
"0000597151" "0" "99" "11" "57373610" "57373615" "del" "0" "03256" "SERPING1_000403" "g.57373610_57373615del" "" "{DOI:Grivčeva-Panovska 2018:10.1080/07853890.2018.1449959} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Ryø 2023:/10.1016/j.jaci.2023.04.023} {DOI:Ren 2025:10.1172/jci.insight.185548}" "" "" "Two independent pedigrees have been recorded to carry a c.813_818delCAACAA, Macedonia (n=2) and Bulgaria.\r\nIn frame deletion where Asn250del affects a N-glycosylation site; both Asn249 and Asn250 are located at the C-terminus of helix F, close to Sheet 3A within the shutter region.\r\nBoth Asn deletions likely disrupt the recognition site, thereby altering protein folding and serpin function.\r\np.(Asn271_Asn272del) biosynthesized in recombinant expression studies using HeLa cells mainly in the soluble secretory compartment (Ryø et al 2023). The Asn271_272del variant has been demonstrated as deleterious for protein expression and considered likely pathogenic by Ren (2025)." "Germline" "yes" "" "0" "" "" "g.57606137_57606142del" "" "likely pathogenic (dominant)" "ACMG"
"0000597152" "0" "99" "11" "57373607" "57373607" "dup" "0" "03256" "SERPING1_000404" "g.57373607dup" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57606134dup" "" "pathogenic" "ACMG"
"0000597156" "0" "99" "11" "57373602" "57373606" "dup" "0" "03256" "SERPING1_000405" "g.57373602_57373606dup" "" "{DOI:Bissler 1994:10.1073/pnas.91.20.9622}" "" "" "c.805_809dup variant introduces a premature translational stop signal in the SERPING1 gene, expected to result in an absent or disrupted protein product.\r\nSubmitted to ClinVar as pathogenic by InVitae San Francisco CA\r\nVariant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "" "rs2495440926" "0" "" "" "g.57606129_57606133dup" "{CV-SCV:004436685.1}" "pathogenic" "ACMG"
"0000597157" "0" "99" "11" "57373615" "57373617" "del" "0" "03256" "SERPING1_000406" "g.57373615_57373617del" "" "{DOI:Bissler 1994:10.1073/pnas.91.20.9622}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57606142_57606144del" "" "pathogenic" ""
"0000597158" "0" "99" "11" "57373635" "57373643" "del" "0" "03256" "SERPING1_000407" "g.57373635_57373643del" "" "{DOI:Bygum 2011:10.1111/j.1398-9995.2010.02456.x} {DOI:Haslund 2019:10.1172/JCI98869} {DOI:Veronez 2019:10.3389/fmed.2019.00028}" "" "" "Variant product p.(Leu281_Ser283del) with an in-frame deletion presenting with high intracellular protein accumulation (Haslund 2019).\r\nDe novo proband in the Danish pedigree observed by C1-INH function." "De novo" "yes" "" "0" "" "" "g.57606162_57606170del" "" "pathogenic" "ACMG"
"0000597159" "0" "99" "11" "57373653" "57373653" "del" "0" "03256" "SERPING1_000408" "g.57373653del" "" "{DOI:Mete Gökmen 2019:10.1159/000492583} {DOI:Bas 2026:10.3390/medicina62091635}" "" "c.854delC" "Erroneously published as c.854delC. The HGVS notation prescribes that on the forward strand it should be \'C\' at position c.856, with a record of a c.856del.\r\nVariant submitted to ClinVar as pathogenic by GeneDx, Gaithersburg MD." "Germline" "yes" "rs1064793792" "0" "" "" "g.57606180del" "{CV:000419322}" "pathogenic" "ACMG"
"0000597190" "0" "99" "11" "57373660" "57373661" "delins" "0" "03256" "SERPING1_000409" "g.57373660_57373661delinsAA" "" "{DOI:Roche 2005:10.1002/humu.20197} {DOI:Haslund 2019:10.1172/JCI98869}" "" "c.863_864TC>CAA" "Variant presenting with reduced secretion of wild type allele and dominant-negative intracellular retention of normal C1INH as well as the capacity to induce aggregates.\r\nVariant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "" "0" "" "" "g.57606187_57606188delinsAA" "" "pathogenic" "ACMG"
"0000597201" "0" "99" "11" "57373665" "57373667" "dup" "0" "03256" "SERPING1_000410" "g.57373665_57373667dup" "" "{DOI:Lopez-Lera 2011:10.1016/j.molimm.2011.07.010}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57606192_57606194dup" "" "pathogenic" "ACMG"
"0000597202" "0" "99" "11" "57373666" "57373666" "dup" "0" "03256" "SERPING1_000411" "g.57373666dup" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Suffritti 2014:10.1111/cea.12293}" "" "c.868insT" "" "Germline" "yes" "" "0" "" "" "g.57606193dup" "" "pathogenic" "ACMG"
"0000597213" "0" "99" "11" "57373941" "57373941" "dup" "0" "03256" "SERPING1_000413" "g.57373941dup" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Suffritti 2014:10.1111/cea.12293}" "" "c.946insA" "The c.963delA variant in SERPING1 meets ACMG/ClinGen criteria to be classified as pathogenic: PVS1, PP4_Str, PS4_Mod, PM2_Sup.\r\nSubmitted to ClinVar as pathogenic by RCMG Research Centre For Medical Genetics, Moscow Russia\r\nVariant c.950dup replaces variant c.946dupA in a stretch of 5A in line with the HGVS nomenclature.\r\nNote the HGVS notation prescribes that on the forward strand it should be \'A\' at position c.950." "Germline" "yes" "" "0" "" "" "g.57606468dup" "{CV-SCV:005061751.1}" "pathogenic" "ACMG"
"0000597215" "0" "99" "11" "57373927" "57373927" "dup" "0" "03256" "SERPING1_000414" "g.57373927dup" "" "{DOI:Mete Gökmen 2019:10.1159/000492583}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57606454dup" "" "pathogenic" "ACMG"
"0000597251" "0" "99" "11" "57365379" "57365570" "del" "0" "03256" "SERPING1_000415" "g.57365379_57365570del" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "" "A 191-nt deletion within intron 1" "Germline" "yes" "" "0" "" "" "g.57597906_57598097del" "" "likely pathogenic" "ACMG"
"0000597252" "0" "99" "11" "57373895" "57373895" "del" "0" "03256" "SERPING1_000416" "g.57373895del" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.00}" "" "8737delA (traditional)" "" "Germline" "yes" "" "0" "" "" "g.57606422del" "" "pathogenic" "ACMG"
"0000597253" "0" "99" "11" "57373895" "57373897" "del" "0" "03256" "SERPING1_000417" "g.57373895_57373897del" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Bafunno 2014:10.1111/ahg.12052} {DOI:Ryø 2023:10.1016/j.jaci.2023.04.023}" "" "c.904_906delACA" "p.(Thr302del) is a dominant-negative variant; p.(Thr302del) variant product accumulates into cell, affecting transport and secretion of normal C1-INH (Ryø et al 2023).\r\nThr280 residue is localized in a stretch of 7 aminoacids between sheet 3A and sheet 4C; a Thr deletion at this position might affect the breach functional region, ie. a mobile region where sheet swings open to accept RCL during loop insertion, with an increased susceptibility to oligomerization.\r\nIn one individual, the c.904_906del variant has been observed to be de novo.\r\nVariant introduced in the Lund SERPING1 database https://structure.bmc.lu.se/idbase/SERPING1base/" "De novo" "yes" "" "0" "" "" "g.57606422_57606424del" "{CV-SCV:007374407.1}" "pathogenic (dominant)" "ACMG"
"0000597254" "0" "99" "11" "57373936" "57373936" "del" "0" "03256" "SERPING1_000418" "g.57373936del" "" "{DOI:Suffritti 2014:10.1111/cea.12293}" "" "8778delC (traditional)" "Patients exhibit different levels of cleaved HK, from 39.8% to 69.4% of total circulating HK." "Germline" "yes" "" "0" "" "" "g.57606463del" "" "pathogenic" "ACMG"
"0000597255" "0" "99" "11" "57373937" "57373942" "del" "0" "03256" "SERPING1_000419" "g.57373937_57373942del" "" "{PMID:Bissler 1997:9069585}" "" "" "" "Germline" "" "" "0" "" "" "g.57606464_57606469del" "" "pathogenic" "ACMG"
"0000597256" "0" "99" "11" "57373972" "57373973" "del" "0" "03256" "SERPING1_000420" "g.57373972_57373973del" "" "{PMID:Verpy 1996:8755917}" "" "" "Variant introduced in the Lund SERPING1 database https://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "" "" "0" "" "" "g.57606499_57606500del" "" "pathogenic" "ACMG"
"0000597257" "0" "99" "11" "57373980" "57373992" "del" "0" "03256" "SERPING1_000421" "g.57373980_57373992del" "" "{DOI:Mete Gökmen 2018:10.1159/000492583}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57606507_57606519del" "" "pathogenic" "ACMG"
"0000597258" "0" "99" "11" "57379198" "57379212" "del" "0" "03256" "SERPING1_000422" "g.57379198_57379212del" "" "{DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "" "In-frame deletion.\r\nThe variant is considered likely pathogenic according to ACMG/ClinGen guidelines criteria PM2, PM4, PP1, PP4.\r\nIntroduced in ClinVar as likely pathogenic by University of Thessaly, Larissa Greece." "Germline" "yes" "rs1590829616" "0" "" "" "g.57611725_57611739del" "{CV:000690358}" "likely pathogenic" "ACMG"
"0000597270" "0" "99" "11" "57379253" "57379253" "del" "0" "03256" "SERPING1_000423" "g.57379253del" "0.000006977 (gomAD v3)" "{DOI:Bygum 2011:10.1111/j.1398-9995.2010.02456.x}" "" "" "" "Germline" "yes" "rs1322367122" "0" "" "" "g.57611780del" "" "pathogenic" "ACMG"
"0000597271" "0" "99" "11" "57379271" "57379271" "del" "0" "03256" "SERPING1_000424" "g.57379271del" "" "{DOI:Xu 2012:10.1111/all.12024} {DOI:Liu 2019:10.1684/ejd.2018.3487}" "" "" "" "Germline" "" "" "0" "" "" "g.57611798del" "" "pathogenic" "ACMG"
"0000597273" "0" "99" "11" "57379282" "57379282" "del" "0" "03256" "SERPING1_000425" "g.57379282del" "" "{DOI:Mete Gökmen 2019:10.1159/000492583}" "" "" "" "Germline" "" "" "0" "" "" "g.57611809del" "" "pathogenic" "ACMG"
"0000597274" "0" "99" "11" "57379289" "57379290" "ins" "0" "03256" "SERPING1_000426" "g.57379289_57379290insA" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57611816_57611817insA" "" "pathogenic" "ACMG"
"0000597275" "0" "99" "11" "57379303" "57379303" "del" "0" "03256" "SERPING1_000427" "g.57379303del" "" "{DOI:Faiyaz-Ul-Haque 2010:10.1159/000236005} {DOI:Sheikh 2023:10.1007/s10875-022-01399-y}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57611830del" "" "pathogenic" "ACMG"
"0000597313" "0" "99" "11" "57379315" "57379315" "del" "0" "03256" "SERPING1_000428" "g.57379315del" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007}" "" "" "" "Germline" "" "" "0" "" "" "g.57611842del" "" "pathogenic" "ACMG"
"0000597338" "0" "99" "11" "57379360" "57379361" "ins" "0" "03256" "SERPING1_000430" "g.57379360_57379361insCC" "" "{DOI:Xu 2012:10.1111/all.12024} {DOI:Liu 2019:10.1684/ejd.2018.3487}" "" "" "" "Germline" "" "" "0" "" "" "g.57611887_57611888insCC" "" "pathogenic" "ACMG"
"0000597341" "0" "99" "11" "57379363" "57379363" "dup" "0" "03256" "SERPING1_000431" "g.57379363dup" "" "{DOI:Roche 2005:10.1002/humu.20197}" "" "" "Variant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "" "" "0" "" "" "g.57611890dup" "" "pathogenic" "ACMG"
"0000597345" "0" "99" "11" "57379387" "57379387" "del" "0" "03256" "SERPING1_000433" "g.57379387del" "" "{DOI:Roche 2005:10.1002/humu.20197}" "" "" "Variant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "" "" "0" "" "" "g.57611914del" "" "pathogenic" "ACMG"
"0000597366" "0" "99" "11" "57381815" "57381815" "dup" "0" "03256" "SERPING1_000434" "g.57381815dup" "" "{DOI:Mete Gökmen 2018:10.1159/000492583}" "" "" "The c.1264dupT variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PVS1_Str, PS4_Mod, PP4_Mod, PM2_Sup" "Germline" "yes" "" "0" "" "" "g.57614342dup" "{CV-SCV:005088595.1}" "pathogenic" "ACMG"
"0000597367" "0" "99" "11" "57381815" "57381815" "del" "0" "03256" "SERPING1_000435" "g.57381815del" "" "{DOI:Frangi 1991:10.1172/JCI115373} {DOI:Nabilou 2020:10.1080/08820139.2020.1817068}" "" "" "Characterized as pathogenic by ClinVar.\r\nVariant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "rs1554996817" "0" "" "" "g.57614342del" "{CV:000003950}" "pathogenic" "ACMG"
"0000597368" "0" "99" "11" "57381819" "57381819" "dup" "0" "03256" "SERPING1_000436" "g.57381819dup" "" "{DOI:Frangi 1991:10.1172/JCI115373} {DOI:Suffritti 2014:10.1111/cea.12293}" "" "16661insA" "Samples from 2 patients have been assayed for HK cleavage, with 48.3% and 51.2% cleavage of total HK.\r\nVariant considered pathogenic in ClinVar by OMIM submitter.\r\nVariant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "rs1554996819" "0" "" "" "g.57614346dup" "{CV:000003949}" "pathogenic" "ACMG"
"0000597369" "0" "99" "11" "57381830" "57381830" "del" "0" "03256" "SERPING1_000437" "g.57381830del" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Bygum 2011:10.1111/j.1398-9995.2010.02456.x} {DOI:Xu 2012:10.1111/all.12024} {DOI:Suffritti 2014:10.1111/cea.12293} {DOI:Liu 2019:10.1684/ejd.2018.3487} {DOI:Xu 2020:/10.1186/s13601-020-00360-9}" "" "16671delC (traditional)" "Recurrent pathogenic variant.\r\nPatient samples exhibit high levels of cleaved HK species, from 37.7% to 52.2% of total circulating HK." "Germline" "yes" "" "0" "" "" "g.57614357del" "" "pathogenic" "ACMG"
"0000597370" "0" "99" "11" "57381832" "57381832" "del" "0" "03256" "SERPING1_000438" "g.57381832del" "" "{DOI:Suffritti 2014:10.1111/cea.12293}" "" "16673delG" "Proband sample investigated for high MW kininogen cleavage during attacks, with 47.3 % cleavage of total HK" "Germline" "yes" "" "0" "" "" "g.57614359del" "" "pathogenic" "ACMG"
"0000597371" "0" "99" "11" "57381835" "57381836" "del" "0" "03256" "SERPING1_000439" "g.57381835_57381836del" "" "{DOI:Freiberger 2002:10.1002/humu.9029} {DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "" "" "Considered pathogenic in agreement with ACMG criteria PVS1, PS3, PS4.\r\nVariant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "" "0" "" "" "g.57614362_57614363del" "" "pathogenic" "ACMG"
"0000597372" "0" "99" "11" "57381847" "57381855" "del" "0" "03256" "SERPING1_000440" "g.57381847_57381855del" "" "{DOI:Kesim 2011:10.1159/000323915}" "" "" "In-frame deletion of 3 residues within the functional gate domain" "Germline" "yes" "" "0" "" "" "g.57614374_57614382del" "" "pathogenic" "ACMG"
"0000597373" "0" "99" "11" "57381848" "57381848" "del" "0" "03256" "SERPING1_000441" "g.57381848del" "" "{DOI:Johnsrud 2015:10.1371/journal.pone.0131637}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57614375del" "" "pathogenic" "ACMG"
"0000597374" "0" "99" "11" "57381856" "57381856" "del" "0" "03256" "SERPING1_000442" "g.57381856del" "" "{DOI:Siddique 1992:10.1159/000154075} {DOI:Seikh 2023:10.1007/s10875-022-01399-y}" "" "c.1306del" "Erroneously introduced as c.1306del in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "" "0" "" "" "g.57614383del" "{CV:VCV000003952.2}" "pathogenic" "ACMG"
"0000597437" "0" "99" "11" "57381861" "57381866" "delins" "0" "03256" "SERPING1_000443" "g.57381861_57381866delinsTG" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007}" "" "16702 16707delAGGTTTinsTG" "" "Germline" "yes" "" "0" "" "" "g.57614388_57614393delinsTG" "" "pathogenic" "ACMG"
"0000597438" "0" "99" "11" "57381866" "57381866" "del" "0" "03256" "SERPING1_000444" "g.57381866del" "" "{DOI:Blanch 2002:10.1002/humu.9073}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57614393del" "" "pathogenic" "ACMG"
"0000597439" "0" "99" "11" "57381867" "57381867" "del" "0" "03256" "SERPING1_000445" "g.57381867del" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Bafunno 2014:10.1111/ahg.12052}" "" "" "Variant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "" "0" "" "" "g.57614394del" "" "pathogenic" "ACMG"
"0000597440" "0" "99" "11" "57381886" "57381886" "dup" "0" "03256" "SERPING1_000446" "g.57381886dup" "" "{DOI:Maia 2019:10.1111/all.13699} {DOI:Veronez 2021:10.1016/j.jaip.2020.11.039} {DOI:Ferriani 2025:10.1016/j.jaip.2025.08.026}" "" "c.1334_1335insA" "" "Germline" "yes" "" "0" "" "" "g.57614413dup" "" "pathogenic" "ACMG"
"0000597441" "0" "99" "11" "57381887" "57381887" "del" "0" "03256" "SERPING1_000447" "g.57381887del" "" "{DOI:Bafunno 2014:10.1111/ahg.12052}" "" "" "" "Germline" "" "" "0" "" "" "g.57614414del" "" "pathogenic" "ACMG"
"0000597505" "0" "99" "11" "57381893" "57381901" "dup" "0" "03256" "SERPING1_000448" "g.57381893_57381901dup" "" "{DOI:Speletas 2015:10.1016/j.jaci.2014.08.007}" "" "c.1350ins9bp" "Variant c.1350ins9bp;p.(Glu448_Thr450dup) probably erroneously introduced by Speletas (2015); might be c.1342_1349dup as published by Loules (2018) as c.1341_1342insGAACTGAC_dup" "Germline" "yes" "" "0" "" "" "g.57614420_57614428dup" "" "VUS" ""
"0000597506" "0" "99" "11" "57381894" "57381896" "delins" "0" "03256" "SERPING1_000449" "g.57381894_57381896delinsT" "" "{DOI:Pappalardo 2000:10.1067/mai.2000.110471}" "" "16735delAACinsT (traditional)" "Variant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "De novo" "yes" "" "0" "" "" "g.57614421_57614423delinsT" "" "pathogenic" "ACMG"
"0000597510" "0" "99" "11" "57381901" "57381901" "del" "0" "03256" "SERPING1_000450" "g.57381901del" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Suffritti 2014:10.1111/cea.12293}" "" "16742delA" "Probands sample investigated for HK cleavage during attacks (Suffriti 2014), with 33.1% and 38.1% of total circulating HK.\r\nErroneously identified with p.(Thr428fsX553) by Suffriti (2004)." "Germline" "yes" "" "0" "" "" "g.57614428del" "" "pathogenic" "ACMG"
"0000597513" "0" "99" "11" "57381908" "57381933" "dup" "0" "03256" "SERPING1_000451" "g.57381908_57381933dup" "" "{DOI:Kalmar 2003:0.1002/humu.9202} {DOI:Bors 2013:10.1016/j.jaci.2012.11.015} {DOI:Speletas 2015:10.1016/j.jaci.2014.08.007} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Szabo 2022:10.3389/falgy.2022.836465}" "" "" "Introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "" "0" "" "" "g.57614435_57614460dup" "" "pathogenic" "ACMG"
"0000597526" "0" "99" "11" "57381911" "57381944" "del" "0" "03256" "SERPING1_000452" "g.57381911_57381944del" "" "{DOI:Bissler 1994:10.1007/bf00212020}" "" "" "Submitted to ClinVar as pathogenic by Ambry Genetics, Aliso Viejo CA.\r\nIntroduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "" "rs2495458177" "0" "" "" "g.57614438_57614471del" "{CV-SCV:002697560.2}" "pathogenic" "ACMG"
"0000597530" "0" "99" "11" "57381930" "57381949" "dup" "0" "03256" "SERPING1_000453" "g.57381930_57381949dup" "" "{DOI:Bissler 1994:10.1007/bf00212020} {PMID:Ernst 1996:8683145}" "" "" "Demonstration of a complete lack of secretion of the c.1379_1398dup variant product, with a decreased\r\nextracellular production of the wt allele, a model where production of the functional protein may be affected by the product of the variant." "Germline" "yes" "" "0" "" "" "g.57614457_57614476dup" "" "likely pathogenic" "ACMG"
"0000597531" "0" "99" "11" "57381934" "57381934" "dup" "0" "03256" "SERPING1_000454" "g.57381934dup" "" "{DOI:Blanch 2002:10.1002/humu.9073}" "" "" "Introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "" "0" "" "" "g.57614461dup" "" "pathogenic" "ACMG"
"0000597532" "0" "79" "11" "57381942" "57381996" "del" "0" "03256" "SERPING1_000455" "g.57381942_57381996del" "" "{DOI:Qu 2012:10.1111/j.1600-0625.2012.01563.x} {DOI:Liu 2019:10.1684/ejd.2018.3487}" "" "" "A large pedigree with 37 individuals (5 generations) and 11 presenting with a HAE clinical phenotype" "Germline" "yes" "" "0" "" "" "g.57614469_57614523del" "" "pathogenic" "ACMG"
"0000597538" "0" "99" "11" "57382030" "57382030" "del" "0" "03256" "SERPING1_000457" "g.57382030del" "" "{DOI:Xu 2012:10.1111/all.12024} {DOI:Liu 2019:10.1684/ejd.2018.3487}" "" "" "The c.1479delG variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as likely pathogenic: PVS1_Mod, PS4_Mod, PP4_Mod, PM2_Sup" "Germline" "yes" "" "0" "" "" "g.57614557del" "{CV-SCV:005093796.1}" "likely pathogenic" "ACMG"
"0000597539" "0" "79" "11" "57382034" "57382038" "del" "0" "03256" "SERPING1_000458" "g.57382034_57382038del" "" "{DOI:Speletas 2015:10.1016/j.jaci.2014.08.007} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "" "This variant identification has been used to validate the SERPING1-NGS platform by Loules 2018" "Germline" "yes" "" "0" "" "" "g.57614561_57614565del" "" "pathogenic" "ACMG"
"0000597540" "0" "99" "11" "57381997" "57381997" "subst" "0" "03256" "SERPING1_000459" "g.57381997G>A" "" "{DOI:Blanch 2002:10.1002/humu.9073} {DOI:Speletas 2009:10.1016/j.humimm.2009.08.010} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Förster 2021:10.1186/s13023-021-02021-x}" "" "" "Another variant, c.1445G>A, recognized pathogenic, is presenting with the same nonsense change at codon 482.\r\nIdentification of c.1446G>A variant has been used to validate the SERPING1-NGS platform by Loules 2018.\r\nThe variant c.1446G>A is considered pathogenic according to ACMG criteria: PVS1, PS1, PM2, PM4, PP1, PP4, PP5\r\nSubmitted to ClinVar as pathogenic by Department of Immunology and Histocompatibility, University of Thessaly, Greece." "Germline" "yes" "rs1590831545" "0" "" "" "g.57614524G>A" "{CV:000690351}" "pathogenic" "ACMG"
"0000597541" "0" "99" "11" "57381993" "57381993" "subst" "0" "03256" "SERPING1_000460" "g.57381993T>G" "" "{DOI:Verpy 1995:10.1172/JCI117663}" "" "c.[1420C>G];[1442T>G]" "p.(Leu481Arg) exhibits a defective transport of the protein in cultured transfected Cos-7 cells.\r\nCompound heterozygous carrier with a benign variant p.Gln474Glu.\r\nClassified as a Variant of Uncertain Significance by LabCorp Genetics, San Francisco CA." "Germline" "yes" "" "0" "" "" "g.57614520T>G" "" "pathogenic" "ACMG"
"0000597542" "0" "77" "11" "57381990" "57381990" "subst" "0" "03256" "SERPING1_000461" "g.57381990T>G" "" "{DOI:Gösswein 2008:10.1159/000138883}" "" "" "p.(Val480Gly) bioinformatic scores: intolerant by SIFT, benign by PolyPhen, disease causing by MutationTaster" "Germline" "yes" "" "0" "" "" "g.57614517T>G" "" "pathogenic" ""
"0000597543" "0" "77" "11" "57367539" "57367539" "subst" "0" "03256" "SERPING1_000462" "g.57367539C>G" "6.196e-7 (gnomAD v4)" "{DOI:Speletas 2015:10.1016/j.jaci.2014.08.007} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "" "The variant c.239C>G has been validated by the SERPING1-NGS platform by Loules 2018.\r\nThe variant c.239C>G is considered VUS (Variant of Uncertain Significance) and meets ACMG criteria: PM2, PP1, PP2, PP4." "Germline" "" "rs774944411" "0" "" "" "g.57600066C>G" "{CV-SCV:000993535.2}" "VUS" "ACMG"
"0000597544" "1" "99" "11" "57367806" "57367806" "subst" "0" "03256" "SERPING1_000145" "g.57367806T>C" "" "{PMID:Verpy 1996:8755917}" "" "c.[-21T>C;506T>C]" "Pathogenic compound heterozygozity in a cis combination c.[(-21)T>C;506T>C]" "Germline" "" "" "0" "" "" "g.57600333T>C" "" "pathogenic" "ACMG"
"0000597545" "1" "33" "11" "57365723" "57365723" "subst" "0.0289261" "03256" "SERPING1_000659" "g.57365723T>C" "0.0314 (gnomADv3)" "{PMID:Verpy 1996:8755917}" "" "c.[-566T>C;2650T>C]" "Pathogenic compound heterozygosity in a cis combination c.[-21T>C;506T>C]." "Germline" "" "rs28362944" "0" "" "" "g.57598250T>C" "{CV-SCV:000372547.3}" "likely benign" "ACMG"
"0000597546" "0" "99" "11" "57365744" "57365744" "subst" "0" "03256" "SERPING1_000463" "g.57365744A>T" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Kesim 2011:10.1159/000323915}" "" "" "c.1A>T variant affects the initiation codon required for SERPING1 gene expression" "Germline" "yes" "" "0" "" "" "g.57598271A>T" "" "likely pathogenic" "ACMG"
"0000597550" "0" "99" "11" "57365744" "57365744" "subst" "0" "03256" "SERPING1_000464" "g.57365744A>C" "" "{DOI:Speletas 2015:10.1111/all.12714} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "" "c.1A>C variant affecting the initiation codon of the transcript of SERPING1 gene.\r\nIntroduced in ClinVar as pathogenic variant by Department of Immunology and Histocompatibility, University of Thessaly.\r\nVariant validated by the SERPING1-NGS platform using NGS-Ion Torrent by Loules 2018" "Germline" "" "rs1565168898" "0" "" "" "g.57598271A>C" "{CV-SCV:000900062.1}" "pathogenic" "ACMG"
"0000597551" "0" "99" "11" "57365745" "57365745" "subst" "0" "03256" "SERPING1_000465" "g.57365745T>A" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007}" "" "" "c.2T>A variant affects the initiation codon of the transcript of SERPING1 gene." "Germline" "yes" "" "0" "" "" "g.57598272T>A" "" "pathogenic" "ACMG"
"0000597552" "0" "99" "11" "57365745" "57365745" "subst" "0" "03256" "SERPING1_000466" "g.57365745T>C" "" "{DOI:Bafunno 2014:10.1111/ahg.12052}" "" "" "c.2T>C variant affects the initiation codon of the transcript of SERPING1 gene. Disruption of the initiator codon has been observed in individuals with hereditary angioedema carrying other missense variants affecting the first codon." "Germline" "yes" "" "0" "" "" "g.57598272T>C" "{CV-SCV:007374610.1}" "pathogenic" "ACMG"
"0000597553" "0" "77" "11" "57365745" "57365745" "subst" "0" "03256" "SERPING1_000467" "g.57365745T>G" "" "{DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "" "c.2T>G variant affect the initiation codon required for SERPING1 gene expression.\r\nIntroduced in ClinVar as pathogenic by Labcorp Genetics, San Francisco CA" "Germline" "yes" "rs2495420943" "0" "" "" "g.57598272T>G" "{CV-RCV:003734626.1} {CV-SCV:004538883.1}" "pathogenic" "ACMG"
"0000597554" "0" "99" "11" "57365746" "57365746" "subst" "0" "03256" "SERPING1_000468" "g.57365746G>A" "" "{DOI:Gösswein 2008:10.1159/000138883} {DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Suffritti 2014:10.1111/cea.12293} {DOI:Hashimura 2021:10.1111/all.15010}" "" "589G>A (traditional)" "p.(Met1Ile) disrupts the initiation codon of SERPING1 gene expression.\r\nItalian paient samples exhibit a high level of circulating cleaved HK species, with 27.7% to 45.8% of total HK, consistent with an involvement of kallikrein-kinin system." "Germline" "yes" "" "0" "" "" "g.57598273G>A" "" "pathogenic" "ACMG"
"0000597555" "0" "99" "11" "57365778" "57365778" "subst" "0" "03256" "SERPING1_000469" "g.57365778T>G" "" "{DOI:Bafunno 2014:10.1111/ahg.12052} {DOI:Ren 2025:10.1016/j.jaci.2024.12.1044}" "" "" "Simulation by SignalP excludes the possibility that substitutions Leu to Arg has an important role in the proteolytic cleavage after the uptake of the protein into the endoplasmic reticulum.\r\nThe variant p.(Leu12Arg) is not expressed when minigene is transfected into 293T cells. Altering the hydrophobic core by substitution with positively charged amino acids can disrupt signal peptide transportation and impair protein secretion.\r\nThe c.35T>G variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as likely pathogenic: PP4_Mod, PS3, PS4_Mod, PM2_Sup, PP2, PP3" "Germline" "yes" "rs2495421098" "0" "" "" "g.57598305T>G" "{CV-SCV:005088165.1}" "likely pathogenic" "ACMG"
"0000597556" "0" "99" "11" "57367355" "57367355" "subst" "0" "03256" "SERPING1_000470" "g.57367355A>T" "" "{DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "" "Variant introduced in ClinVar as pathogenic by Department of Immunology and Histocompatibility, University of Thessaly" "De novo" "yes" "rs1565169419" "0" "" "" "g.57599882A>T" "{CV:000619175}" "pathogenic" "ACMG"
"0000597557" "0" "55" "11" "57367652" "57367652" "subst" "0.000211217" "03256" "SERPING1_000471" "g.57367652A>G" "0.000227 (gnomAD_exome); 0.000198 (ExAC); 0.000191 (TOPMed)" "{DOI:Xu 2012:10.1111/all.12024} {DOI:Liu 2019:10.1684/ejd.2018.3487}" "" "" "Thr96 is a putative O-glycosylation site.\r\nThe variant c.352A>G meets the BA1 criterion of ACMG, with a benign character" "Germline" "" "rs200534715" "0" "" "" "g.57600179A>G" "{CV:000068250}" "benign" "ACMG"
"0000597558" "0" "99" "11" "57367430" "57367430" "subst" "0" "03256" "SERPING1_000472" "g.57367430A>T" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Bafunno 2014:10.1111/ahg.12052}" "" "2274A>T (traditional)" "" "Germline" "yes" "" "0" "" "" "g.57599957A>T" "" "pathogenic" "ACMG"
"0000597559" "0" "79" "11" "57367452" "57367452" "subst" "4.06075E-6" "03256" "SERPING1_000473" "g.57367452C>T" "6.195e-7 (GnomAD v4) 0.000008/1 (ExAC)" "{DOI:Loules 2018:/10.1016/j.jaci.2014.08.007} {DOI:Obtułowicz 2020:10.5114/ceji.2020.101252}" "" "" "" "Germline" "" "rs773505671" "0" "" "" "g.57599979C>T" "" "likely pathogenic" "ACMG"
"0000597560" "0" "50" "11" "57367435" "57367435" "subst" "0" "03256" "SERPING1_000474" "g.57367435C>T" "0.000006815 (gnomAD v4)" "" "" "" "Creates an ESE" "Germline/De novo (untested)" "" "rs886048399" "0" "" "" "g.57599962C>T" "{CV-SCV:000372551.3}" "VUS" "ACMG"
"0000597561" "0" "99" "11" "57367461" "57367461" "subst" "0" "03256" "SERPING1_000475" "g.57367461T>A" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Ryø 2023:10.1016/j.jaci.2023.04.023}" "" "" "p.(Leu54Gln) variant does not affect secretion and functionality of the resulting C1-INH protein. For patients carrying the c.161T>A variant, a specific combination of the c.161T>A variant and unknown confounding factors may potentially support development of C1-INH deficiency." "Germline" "" "" "0" "" "" "g.57599988T>A" "" "pathogenic (dominant)" ""
"0000597562" "0" "99" "11" "57367509" "57367509" "subst" "0" "03256" "SERPING1_000476" "g.57367509C>G" "" "{DOI:Freiberger 2002:10.1002/humu.9029} {DOI:Grobirikova 2023:10.1007/s10875-023-01565-w}" "" "" "Variant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "" "" "0" "" "" "g.57600036C>G" "" "pathogenic" "ACMG"
"0000597563" "0" "55" "11" "57367527" "57367527" "subst" "1.62739E-5" "03256" "SERPING1_000477" "g.57367527C>T" "0.00007744 (gnomAD v4)" "" "" "" "Thr54 is a O-glycosylation site that is disrupted by the c.227C>T variant.\r\nIntroduced in ClinVar by InVitae Corp San Francisco CA as a benign variant and by Department of Pathology and Laboratory Medicine, Toronto ON as a VUS.\r\nMeets the ACMG criterion BP4_Sup" "Germline/De novo (untested)" "" "rs182779591" "0" "" "" "g.57600054C>T" "{CV-SCV:005914898.1}" "benign" "ACMG"
"0000597564" "1" "99" "11" "57367553" "57367553" "subst" "0" "03256" "SERPING1_000478" "g.57367553G>T" "" "{DOI:Speletas 2015:10.1016/j.jaci.2014.08.007}" "" "c.[253G>T(;)1097G>A]" "Proband carrying a compound heterozygosity c.[253G>T(;)1097G>A];p.[(Glu85*)(;)(Arg344His)].\r\nc.253G>T should represent the causative alteration." "Germline" "yes" "" "0" "" "" "g.57600080G>T" "" "likely pathogenic" "ACMG"
"0000597565" "2" "33" "11" "57379257" "57379257" "subst" "8.93423E-5" "03256" "SERPING1_000479" "g.57379257G>A" "2.052e-06" "{DOI:Speletas 2015:10.1016/j.jaci.2014.08.007}" "" "" "Associated with a c.253G>T variant in a compound heterozygosity c.[253G>T(;)1097G>A];p.[(Glu85*)(;)(Arg344His)], where the c.253G>T variant is causative.\r\nVariant p.(Arg366His) might be tolerant or benign, according to SIFT or PolyPhen-2, respectively; this is consolidated by MutationTaster®, with a polymorphism (P).\r\nIntroduced in ClinVar as likely benign by In Vitae Corp San Francisco CA.\r\nVariant matches the ACMG criteria PM1_Mod, PM2_Mod, PP3_Str, BA1, BP4." "Germline" "" "rs139000758" "0" "" "" "g.57611784G>A" "{CV-SCV:003448328.1}" "likely benign" "ACMG"
"0000597566" "0" "99" "11" "57367589" "57367589" "subst" "0" "03256" "SERPING1_000480" "g.57367589C>T" "" "{DOI:Xu 2012:10.1111/all.12024} {DOI:Andrejević 2015:10.1371/journal.pone.0142174.t001} {DOI:Guryanova 2019:10.29235/1814-6023-2019-16-3-349-356} {DOI:Liu 2019:10.1684/ejd.2018.3487} {DOI:Xu 2020:0.1186/s13601-020-00360-9}" "" "" "HAE family from Belarus is presenting with a de novo situation\r\nIn the HAE family from Serbia, the c.289C>T variant has been found associated with C1-INH-HAE with incomplete penetrance; HAE symptomatic individuals carry additional variants possibly involved in HAE clinical phenotype: NM_001159747.2:c.190A>G;p.(Asn64Asp), NM_001017403.1:c.2323G>A;p.(Val775Met), NM_006226.4:c.1103A>G;p.(Gln368Arg), NM_013956.5:c.881T>C;p.(Met294Thr)" "De novo" "yes" "" "0" "" "" "g.57600116C>T" "" "pathogenic" "ACMG"
"0000597567" "0" "99" "11" "57367601" "57367601" "subst" "0" "03256" "SERPING1_000481" "g.57367601C>T" "" "{DOI:Andrejević 2015:10.1371/journal.pone.0142174} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Guryanova 2019:10.29235/1814-6023-2019-16-3-349-356} {DOI:Peters 2024:10.1056/NEJMoa2400403}" "" "c.300C>T" "Erroneously published as c.300C>T.\r\nThe c.301C>T variant in SERPING1 meets ACMG/ClinGen criteria to be classified as pathogenic: PVS1, PP4_Str, PS4_Mod, PM2_Sup, PP1." "Germline" "yes" "" "0" "" "" "g.57600128C>T" "{CV-SCV:005093805.1}" "pathogenic" "ACMG"
"0000597568" "0" "99" "11" "57367610" "57367610" "subst" "0" "03256" "SERPING1_000482" "g.57367610C>T" "" "{DOI:Gösswein 2008:10.1159/000138883} {DOI:Johnsrud 2015:10.1371/journal.pone.0131637} {DOI:Guryanova 2021:10.1186/s12948-021-00141-0}" "" "" "The c.310C>T variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PVS1, PS4_Mod, PP4_Mod, PM2_Sup" "Germline" "yes" "" "0" "" "" "g.57600137C>T" "{CV-SCV:005093806.1}" "pathogenic" "ACMG"
"0000597569" "0" "79" "11" "57367622" "57367622" "subst" "0" "03256" "SERPING1_000483" "g.57367622C>T" "" "{DOI:Gösswein 2008:10.1159/000138883} {DOI:Xu 2012:10.1111/all.12024} {DOI:Liu 2019:10.1684/ejd.2018.3487} {DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "" "This variant creates a premature translational stop signal in the SERPING1 gene and is expected to result in an absent or disrupted protein product. Loss-of-function variants in SERPING1 are known to be pathogenic.\r\nVariant introduced to ClinVar as pathogenic by InVitae, San Francisco CA" "Germline" "yes" "rs780799832" "0" "" "" "g.57600149C>T" "{CV-SCV:004294829.1}" "pathogenic" "ACMG"
"0000597570" "0" "99" "11" "57367646" "57367646" "subst" "0" "03256" "SERPING1_000484" "g.57367646C>T" "" "{DOI:Pappalardo 2000:10.1067/mai.2000.110471} {DOI:Andrejević 2015:10.1371/journal.pone.0142174} {DOI:Hashimura 2021:10.1111/all.15034} {DOI:Ferriani 2025:10.1016/j.jaip.2025.08.026}" "" "c.345C>T" "Recurrent variant\r\nThe Italian pedigree is presenting with a de novo proband\r\nACMG classification criteria (Laboratorio de Genetica e Diagnostico Molecular, Sao Paolo Brazil): PVS1 very strong, PS4 supporting, PM2 moderate, PP1 supporting. Research Centre for Medical Genetics, Moscow Russia, considers c.346C>T variant as pathogenic without the PVS1 criterion.\r\nVariant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "De novo" "yes" "rs2135308550" "0" "" "" "g.57600173C>T" "{CV-SCV:002512341.1}" "pathogenic" "ACMG"
"0000597571" "0" "99" "11" "57367689" "57367689" "subst" "0" "03256" "SERPING1_000485" "g.57367689G>A" "" "{DOI:Kalmár 2003:10.1002/humu.9202} {DOI:Bors 2013:10.1016/j.jaci.2012.11.015} {DOI:Szabó 2022:10.3389/falgy.2022.836465} {DOI:Troldborg 2024:10.1016/j.jaci.2024.03.028}" "" "" "Variant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "" "0" "" "" "g.57600216G>A" "" "pathogenic" "ACMG"
"0000597575" "0" "99" "11" "57367700" "57367700" "subst" "0" "03256" "SERPING1_000486" "g.57367700G>T" "" "{DOI:Gösswein 2008:10.1159/000138883} {DOI:Bafunno 2014:10.1111/ahg.12052 }" "" "" "c.400G>T is a loss of function variant that has been considered pathogenic by InVitae San Francisco California" "Germline" "yes" "rs2135308651" "0" "" "" "g.57600227G>T" "{CV:VCV001460244.1}" "pathogenic" "ACMG"
"0000597576" "0" "99" "11" "57367725" "57367725" "subst" "0" "03256" "SERPING1_000487" "g.57367725T>C" "" "{DOI:Loules 2019:10.1016/j.gene.2018.05.029} {DOI:Szabó 2022:10.3389/falgy.2022.836465} {DOI:Troldborg 2024:10.1016/j.jaci.2024.03.028}" "" "" "A single Hungarian family with 3 affected individuals" "Germline" "yes" "" "0" "" "" "g.57600252T>C" "" "pathogenic" ""
"0000597577" "0" "99" "11" "57367734" "57367734" "subst" "0" "03256" "SERPING1_000488" "g.57367734C>A" "" "{DOI:Lopez-Lera 2011:10.1016/j.molimm.2011.07.010} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Yasuno 2021:10.1111/1346-8138.15930}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57600261C>A" "" "likely pathogenic" "ACMG"
"0000597578" "0" "77" "11" "57367737" "57367737" "subst" "0" "03256" "SERPING1_000489" "g.57367737T>C" "" "{DOI:Gösswein 2008:10.1159/000138883} {DOI:Yasuno 2021:10.1111/1346-8138.15930}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57600264T>C" "" "likely pathogenic" "ACMG"
"0000597579" "0" "77" "11" "57367745" "57367745" "subst" "0" "03256" "SERPING1_000490" "g.57367745T>G" "" "{PMID:Bissler 1997:9069585} {DOI:Rodriguez Espada 2025:10.1182/bloodadvances.2025017220}" "" "2589T>G" "p.(Phe149Val) disrupts Phe127, a conserved residue among serpins (79%) and located in the middle of helix A in the shutter region.\r\nPhe127 packs against conserved position Ser148" "Germline" "yes" "" "0" "" "" "g.57600272T>G" "" "pathogenic" ""
"0000597580" "0" "79" "11" "57367748" "57367748" "subst" "0" "03256" "SERPING1_000491" "g.57367748T>C" "" "{DOI:Speletas 2015:10.1016/j.jaci.2014.08.007} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "" "A related variant p.(Ser150Phe) has been established as pathogenic by Yasuno 2021: the p.(Ser150Phe) variant C1-INH has been shown stably expressed within the cultured cells, while it was not secreted into the medium at all. Interestingly it significantly prevents secretion of wild-type C1-INH, suggesting that the wild-type protein is not only retained but also degraded within the cytoplasm through interacting with the mutant protein.\r\nIn silico analysis supports that c.448T>C variant has a deleterious effect on protein structure/function" "Germline" "" "rs2135308725" "0" "" "" "g.57600275T>C" "{CV-SCV:001986148.2}" "likely pathogenic" ""
"0000597581" "0" "99" "11" "57367752" "57367752" "subst" "0" "03256" "SERPING1_000492" "g.57367752T>C" "" "{DOI:Mete Gökmen 2018:10.1159/000492583} {DOI:Ryø 2023:/10.1016/j.jaci.2023.04.023}" "" "" "p.(Leu151Pro) is a dominant-negative variant; p.(Leu151Pro) variant product accumulates into cell, affecting transport and secretion of normal C1-INH.\r\nLeu129 residue is localized in helix A; a Leu to Pro transition could affect the shutter functional region, with an increased susceptibility to oligomerization.\r\nThe c.452T>C variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as likely pathogenic: PP3_Mod, PP4_Mod, PM2_Sup, PP" "Germline" "yes" "" "0" "" "" "g.57600279T>C" "{CV-SCV:005186234.2}" "pathogenic (dominant)" "ACMG"
"0000597582" "0" "99" "11" "57367761" "57367761" "subst" "0" "03256" "SERPING1_000493" "g.57367761A>C" "" "{DOI:Martinho 2013:10.1016/j.molimm.2012.09.003} {DOI:Yasuno 2021:10.1111/1346-8138.15930}" "" "" "Variant submitted to ClinVar as likely pathogenic by InVitae, San Francisco CA.\r\nThis variant disrupts the p.Tyr154 residue in SERPING1. Other variant(s) that disrupt this Tyr residue have been observed in individuals with C1-INH failure, which suggests that this may be a clinically significant amino acid residue." "Germline" "yes" "rs281875168" "0" "" "" "g.57600288A>C" "{CV-SCV:004294830.1}" "likely pathogenic" "ACMG"
"0000597583" "0" "79" "11" "57367761" "57367761" "subst" "0" "03256" "SERPING1_000494" "g.57367761A>G" "" "{DOI:Xu 2012:10.1111/all.12024} {DOI:Liu 2019:10.1684/ejd.2018.3487} {DOI:Yasuno 2021:10.1111/1346-8138.15930}" "" "" "The c.461A>G variant in SERPING1 meets ACMG/ClinGen criteria to be classified as pathogenic: PP3_Mod, PS4_Mod, PP4_Mod, PM2_Sup, PP2" "Germline" "yes" "rs281875168" "0" "" "" "g.57600288A>G" "{CV:000068251}{CV-SCV:005073721.2}" "pathogenic" "ACMG"
"0000597584" "0" "99" "11" "57367764" "57367764" "subst" "0" "03256" "SERPING1_000495" "g.57367764A>G" "" "{PMID:Bissler 1997:9069585}" "" "" "Phe133 position is located near the C-terminus of helix A" "De novo" "yes" "" "0" "" "" "g.57600291A>G" "" "pathogenic" "ACMG"
"0000597641" "0" "99" "11" "57367773" "57367773" "subst" "0" "03256" "SERPING1_000496" "g.57367773C>G" "" "{DOI:Lopez-Lera 2011:10.1016/j.molimm.2011.07.010} {DOI:de la Cruz 2011:10.1016/j.imlet.2011.07.011} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Staikuniene-Kozonis 2024:10.3389/fped.2024.1408110}" "" "" "c.473C>G variant identification as been validated by new-generation sequencing, Loules 2018.\r\nThe c.473C>G variant in SERPING1 meets ACMG/ClinGen criteria to be classified as pathogenic: PVS1, PP4_Str, PS4_Mod, PM2_Sup." "De novo" "yes" "" "0" "" "" "g.57600300C>G" "" "pathogenic" "ACMG"
"0000597652" "0" "99" "11" "57367781" "57367781" "subst" "0" "03256" "SERPING1_000497" "g.57367781A>T" "" "{DOI:Martinho 2013:10.1016/j.molimm.2012.09.003} {DOI:Grivčeva-Panovska 2018:10.1080/07853890.2018.1449959}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57600308A>T" "" "pathogenic" "ACMG"
"0000597653" "0" "99" "11" "57367790" "57367790" "subst" "0" "03256" "SERPING1_000498" "g.57367790G>T" "" "{DOI:Mete Gökmen 2018:10.1159/000492583}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57600317G>T" "" "pathogenic" "ACMG"
"0000597654" "0" "99" "11" "57367798" "57367798" "subst" "0" "03256" "SERPING1_000499" "g.57367798C>A" "" "{DOI:Speletas 2015:10.1016/j.jaci.2014.08.007} {DOI:Cagini 2016:10.1515/hsz-2015-0222} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Gábos 2019:10.2478/rrlm-2019-0029} {DOI:Veronez 2021:10.1016/j.jaip.2020.11.039} {DOI:Grombikirova 2023:10.1007/s10875-023-01565-w} {DOI:Ferriani 2025:10.1016/j.jaip.2025.08.026} {DOI:Urdea 2026:10.1016/j.waojou.2026.101407}" "" "" "Asn144 residue is highly conserved among serpins (87%)\r\nAsn144 position in a β-sheet B (s6B), shutter/gate, \r\nAsn144 residue makes extensive H-bond network with C1INH C-terminus residues 474 to 478.\r\nConflicting interpretation; introduced in ClinVar as a VUS by LabCorp, San Francisco CA because the available evidence is currently insufficient to determine the role of this variant in HAE." "Germline" "yes" "rs2495426698" "0" "" "" "g.57600325C>A" "{CV-SCV:004294832.1}" "pathogenic" "ACMG"
"0000597655" "0" "77" "11" "57367800" "57367800" "subst" "0" "03256" "SERPING1_000500" "g.57367800T>A" "" "{DOI:Speletas 2015:10.1016/j.jaci.2014.08.007} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "" "" "Germline" "" "" "0" "" "" "g.57600327T>A" "" "pathogenic" ""
"0000597657" "0" "57" "11" "57367802" "57367802" "subst" "0" "03256" "SERPING1_000502" "g.57367802G>C" "" "{DOI:Gösswein 2008:10.1159/000138883}" "" "" "" "Germline" "" "" "0" "" "" "g.57600329G>C" "" "VUS" ""
"0000597658" "0" "99" "11" "57367803" "57367803" "subst" "0" "03256" "SERPING1_000503" "g.57367803C>A" "" "{DOI:Suffritti 2014:10.1111/cea.12293} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Gábos 2019:10.2478/rrlm-2019-0029} {DOI:Szabó 2022:3389/falgy.2022.836465} {DOI:Grombikirova 2023:10.1007/s10875-023-01565-w} {DOI:Markocsy 2024:10.1016/j.waojou.2024.100885}" "" "2647C>A" "p.(Ala168Asp) bioinformatic scores: deleterious by SIFT, pathogenic by PolyPhen, but polymorphic by MutationTaster (0.540). Sample investigated from Italian proband exhibits a kininogenase activity with consistent HK cleavage, 39.8% of total circulating HK." "Germline" "yes" "" "0" "" "" "g.57600330C>A" "" "likely pathogenic" "ACMG"
"0000597659" "0" "77" "11" "57367808" "57367808" "subst" "0" "03256" "SERPING1_000504" "g.57367808T>A" "" "{DOI:Loules 2008:10.1016/j.gene.2018.05.029}" "" "" "" "Germline" "" "" "0" "" "" "g.57600335T>A" "" "pathogenic" ""
"0000597660" "0" "99" "11" "57367808" "57367808" "subst" "0" "03256" "SERPING1_000505" "g.57367808T>C" "" "{DOI:Pappalardo 2000:10.1067/mai.2000.110471} {DOI:Haslund 2019:10.1172/JCI98869} {DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "" "Variant c.508T>C is carried by a proband with a de novo situation, Pappalardo 2000.\r\nSer148, located at a conserved position among serpins (93%), within the shutter domain and forms H-bond of backbone of conserved positions Ser151, Asn269 and Val468; disrupted after substitution of Ser by Pro.\r\nVariant product p.(Ser170Pro) is likely to oligomerize, Haslund 2019\r\nVariant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "De novo" "yes" "" "0" "" "" "g.57600335T>C" "" "pathogenic" "ACMG"
"0000597661" "0" "99" "11" "57367812" "57367812" "subst" "0" "03256" "SERPING1_000506" "g.57367812C>A" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Ryø 2023:10.1016/j.jaci.2023.04.023}" "" "" "p.(Pro171Gln) is a dominant-negative variant.\r\nVariant c.512C>A affects Pro149, a highly conserved position among serpins (90%), location N-terminus of helix B in the shutter functional region.\r\nIn C1-INH structure, Pro149 residue forms tight turn, with variants at this position disturbing β-sheet A, subsequently resulting in the formation of loop-sheet polymers; p.(Pro171Gln) variant product has been demonstrated to accumulate into cell, affecting transport and secretion of normal C1-INH.\r\nVariant characterized as pathogenic according to ACMG following criteria PS3, PS4, PM1, PM2, PP3\r\nHomologous to Pro54 position of A1AT.\r\nRelated to antithrombin III variant c.(Pro112Thr), Pro80 position." "Germline" "" "" "0" "" "" "g.57600339C>A" "" "pathogenic (dominant)" "ACMG"
"0000597662" "0" "99" "11" "57367833" "57367833" "subst" "0" "03256" "SERPING1_000507" "g.57367833T>C" "" "{DOI:Gösswein 2008:10.1159/000138883}" "" "" "Leu156 is located within helix B, shutter domain, contributing to maintain the normal closed state of the overlying sheet A, and represents a highly conserved residue (75%) within serpins." "Germline" "yes" "" "0" "" "" "g.57600360T>C" "" "pathogenic" "ACMG"
"0000597663" "0" "99" "11" "57367836" "57367836" "subst" "0" "03256" "SERPING1_000508" "g.57367836C>T" "" "{DOI:Lopez-Lera 2011:10.1016/j.molimm.2011.07.010} {DOI:Kurjane 2026:10.3389/fimmu.2026.1696479}" "" "" "Thr179 is located in helix B, shutter functional domain. With Gly162, Phe214, Leu161, Ala163, Thr167, Thr 157 has been recognized of functional importance in this region of C1-INH.\r\nVariant recognized as likely pathogenic according to the ACMG criteria PM1, PM2, PP3_Str, PP5" "Germline" "yes" "" "0" "" "" "g.57600363C>T" "" "likely pathogenic" "ACMG"
"0000597664" "0" "99" "11" "57367848" "57367848" "subst" "0" "03256" "SERPING1_000509" "g.57367848T>C" "" "{DOI:López-Lera 2011:10.1016/j.molimm.2011.07.010} {DOI:Grodecká 2017:10.1016/j.clim.2017.03.010} {DOI:Hashimura 2021:10.1111/all.15034} {DOI:Grombikirova 2023:10.1007/s10875-023-01565-w}" "" "" "Biallelic expression was detected in patient\'s blood-derived RNA (Grodecká et al 2017).\r\nRecurrent variant.\r\nc.548T>C variant bioinformatic scores: intolerant by SIFT, pathogenic by PolyPhen, Disease causing by MutationTaster.\r\nWith Gly162, Phe214, Ala163, Thr167, Thr 157, Leu161 position has been recognized of functional importance in this region of C1 Inhibitor" "Germline" "yes" "" "0" "" "" "g.57600375T>C" "" "pathogenic" "ACMG"
"0000597666" "0" "99" "11" "57369508" "57369508" "subst" "0" "03256" "SERPING1_000510" "g.57369508G>A" "" "{DOI:Zuraw 2000:10.1067/mai.2000.104780} {DOI:Gösswein 2008:10.1159/000138883} {DOI:Andrejević 2015:10.1371/journal.pone.0142174}" "" "erroneously c.552G>A by Andrejević 2015" "Recurrent variant.\r\nGly162, located at the end of helix B, shutter domain, is a conserved residue among serpins (80%), forms tight turn and packs against conserved position Phe214 that is possibly disrupted by the Gly to Glu transition.\r\nVariant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "" "0" "" "" "g.57602035G>A" "" "pathogenic" "ACMG"
"0000597668" "0" "99" "11" "57369510" "57369510" "subst" "0" "03256" "SERPING1_000511" "g.57369510G>C" "" "{DOI:Speletas 2015:10.1016/j.jaci.2014.08.007} {DOI:Szabó 2022:10.3389/falgy.2022.836465} {DOI:Troldborg 2024:10.1016/j.jaci.2024.03.028}" "" "" "The variant c.553G>C introduces a Pro residue at position Ala185 in a turn between helix B and helix C. With Gly162, Phe214, Leu161, Thr167, Thr 157, the Ala163 position has been recognized of functional importance in this region of C1-INH.\r\nThe c.553G>C variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PP4_Str, PS4_Mod, PP3_Mod, PM2_Sup, PP2, PP1.\r\nConflicting classification of pathogenicity; Research Centre for Medical Genetics, Moscow Russia, classifies the c.553G>C variant as pathogenic; Labcorp Genetics, San Francisco CA, and 3billion, Seoul Korea, classify the c.553G>C variant as VUS." "Germline" "yes" "rs1335168882" "0" "" "" "g.57602037G>C" "{CV-SCV:005186248.1}" "pathogenic" "ACMG"
"0000597671" "0" "99" "11" "57369525" "57369525" "subst" "0" "03256" "SERPING1_000512" "g.57369525A>T" "" "{DOI:Gösswein 2008:10.1159/000138883}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57602052A>T" "" "pathogenic" "ACMG"
"0000597672" "0" "79" "11" "57369528" "57369528" "subst" "0" "03256" "SERPING1_000513" "g.57369528A>C" "" "{PMID:Bissler 1997:9069585 }" "" "" "Thr169 location in the middle of helix C, a site at which serpins contains a polar or charged residue. No other serpin contains a Pro at this location. A Pro disrupts the helix, with subsequent abnormal folding of the protein. Gln to Lys transition at this site in Antithrombin III, SERPINC1, results in deficiency." "Germline" "" "" "0" "" "" "g.57602055A>C" "" "likely pathogenic" ""
"0000597673" "0" "99" "11" "57369535" "57369535" "subst" "0" "03256" "SERPING1_000514" "g.57369535T>C" "" "{DOI:Roche 2005:10.1002/humu.20197} {DOI:Veronez 2021:10.1016/j.jaip.2020.11.039} {DOI:Ryø 2023:10.1016/j.jaci.2023.04.023}" "" "" "p.(Leu193Pro) is a dominant-negative variant; p.(Leu193Pro) variant product accumulates into cell, affecting transport and secretion of normal C1-INH.\r\nLeu171 residue is localized in helix C; a Leu to Pro transition might affect the shutter functional region, with an increased susceptibility to oligomerization.\r\nVariant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/\r\nThe c.578T>C variant in SERPING1 meets ACMG/ClinGen criteria to be classified as pathogenic: PP3_Str, PS4_Mod, PP4_Mod, PM2_Sup, PP2." "Germline" "yes" "rs2495430954" "0" "" "" "g.57602062T>C" "{CV-SCV:005088175.1}" "pathogenic (dominant)" "ACMG"
"0000597674" "0" "99" "11" "57369552" "57369552" "subst" "0" "03256" "SERPING1_000515" "g.57369552T>A" "" "{DOI:Roche 2005:10.1002/humu.20197} {DOI:Ryø 2023:10.1016/j.jaci.2023.04.023}" "" "" "p.(Tyr199Asn) is a dominant-negative variant; p.(Tyr199Asn) variant product accumulates into cell, affecting transport and secretion of normal C1-INH, as shown by expression of recombinant protein using HeLa cells (Ryø et al 2023).\r\nTyr177 residue is localized at the junction between helices C and D; a Tyr to Asn transition might affect the shutter functional region, with an increased susceptibility to oligomerization.\r\nVariant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "" "0" "" "" "g.57602079T>A" "" "pathogenic (dominant)" "ACMG"
"0000597693" "0" "99" "11" "0" "0" "" "0" "03256" "SERPING1_000516" "g.[57369554C=/>G]" "0.00000 (0/78700)" "{DOI:Guarino 2006:10.1111/j.1399-0004.2006.00643.x}" "" "" "Gonadal mosaicism in a family in which only both sons, but not the parents, show clinical and laboratory findings typical of HAE, with allele segregation demonstrated using DHPLC.\r\nc.597C>G variant not not detected in DNA derived from buccal cells, urinary cells, hair roots and cultured fibroblasts from the mother, whereas occurred on the maternal transmitted chromosome." "Uniparental disomy, maternal allele" "yes" "rs121907951" "0" "" "" "g.[57602081C=/>G]" "{CV:VCV000003957.1}" "pathogenic" "ACMG"
"0000597694" "0" "79" "11" "57369558" "57369558" "subst" "0" "03256" "SERPING1_000517" "g.57369558A>T" "" "{DOI:Gösswein 2008:10.1159/000138883} {DOI:Ozkars 2019:10.12932/AP-060218-0257}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57602085A>T" "" "pathogenic" "ACMG"
"0000597696" "0" "99" "11" "57369571" "57369571" "subst" "0" "03256" "SERPING1_000518" "g.57369571G>A" "" "{DOI:Zuraw 2000:10.1067/mai.2000.104780} {DOI:López-Lera 2011:10.1016/j.molimm.2011.07.01} {DOI:Haslund 2019:10.1172/JCI98869} {DOI:Grombikirova 2023:10.1007/s10875-023-01565-w}" "" "" "Four independent pedigrees have been recorded to carry a c.614G>A variant\r\nFamily 1, United States (n=3)\r\nFamily 2, Spain, with a de novo proband\r\nFamily 3, Denmark\r\nFamily 4, Czech republic (n=3)\r\nVariant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "De novo" "yes" "rs2135311313" "0" "" "" "g.57602098G>A" "{CV-SCV:002240718.2}" "pathogenic" "ACMG"
"0000597697" "0" "99" "11" "57369571" "57369571" "subst" "0" "03256" "SERPING1_000519" "g.57369571G>C" "" "{DOI:López-Lera 2011:10.1016/j.molimm.2011.07.010} {DOI:de la Cruz 2011:10.1016/j.imlet.2011.07.011} {DOI:Ponard 2019:10.1002/humu.23917}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57602098G>C" "" "pathogenic" ""
"0000597698" "0" "50" "11" "57369576" "57369576" "subst" "0" "03256" "SERPING1_000520" "g.57369576C>T" "6.195e-7" "unpublished observation" "" "" "" "CLASSIFICATION record" "" "" "0" "" "" "g.57602103C>T" "" "VUS" ""
"0000597700" "0" "99" "11" "57369580" "57369580" "subst" "0" "03256" "SERPING1_000522" "g.57369580A>T" "" "{DOI:Martinho 2013:10.1016/j.molimm.2012.09.003}" "" "" "" "Germline" "" "" "0" "" "" "g.57602107A>T" "" "pathogenic" ""
"0000597701" "0" "99" "11" "57369586" "57369586" "subst" "0" "03256" "SERPING1_000523" "g.57369586T>C" "" "{DOI:Yakushiji 2016:10.2169/internalmedicine.55.6951} {DOI:Grodecká 2017:10.1016/j.clim.2017.03.010} {DOI:Hashimura 2021:10.1111/all.15034} {DOI:Grombikirova 2023:10.1007/s10875-023-01565-w}" "" "" "Biallelic expression of variant c.629T>C and wt was detected in patient\'s blood-derived RNA." "Germline" "?" "" "0" "" "" "g.57602113T>C" "" "pathogenic" "ACMG"
"0000597702" "0" "99" "11" "57369610" "57369610" "subst" "0" "03256" "SERPING1_000524" "g.57369610T>A" "" "{DOI:Zuraw 2000:10.1067/mai.2000.104780} {DOI:Ando 2019:10.2169/internalmedicine.2015-18} {DOI:Hashimura 2021:10.1111/all.15034}" "" "" "Variant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "" "0" "" "" "g.57602137T>A" "" "likely pathogenic" ""
"0000597703" "0" "99" "11" "57369624" "57369624" "subst" "0" "03256" "SERPING1_000525" "g.57369624C>T" "" "{DOI:Kalmár 2003:10.1002/humu.9202} {DOI:Bors 2013:10.1016/j.jaci.2012.11.015} {DOI:Obtulowicz 2020:10.5114/ceji.2020.101252} {DOI:Szabo 2022:10.3389/falgy.2022.836465}" "" "" "The c.666_667del variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PVS1, PS4_Mod, PP4_Mod, PM2_Sup.\r\nVariant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "" "0" "" "" "g.57602151C>T" "" "pathogenic" "ACMG"
"0000597704" "0" "99" "11" "57369628" "57369628" "subst" "0" "03256" "SERPING1_000526" "g.57369628T>A" "" "{DOI:Gösswein 2008:10.1159/000138883}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57602155T>A" "" "pathogenic" "ACMG"
"0000597705" "0" "11" "11" "57378325" "57378325" "subst" "0" "03256" "SERPING1_000527" "g.57378325C>T" "0.38381 (12014/31302, GnomAD); 0.381682 (47927/125568, TOPMED)" "{DOI:Ennis 2008:10.1016/S0140- 6736(08)61348-3} {PMID:Park 2009:19169411} {PMID:Li 2010:20161815} {PMID:Ma 2014:25352749}" "" "" "rs2511989 is a common polymorphism; considered benign according to the ACMG criteria BA1, BS1, BS2, BP4, BP5, BP6\r\nc.1030-865C>T has been reported to increase the risk of AMD by Ennis 2009\r\nControversial with Park 2009 and Li 2010\r\nA meta-analysis showed that the SERPING1 rs2511989 may have a positive effect on the risk of AMD, especially among Caucasians, see Ma 2014" "Germline" "" "rs2511989" "0" "" "" "g.57610852C>T" "{CV-SCV:001441215.2}" "benign" ""
"0000597706" "0" "79" "11" "57373492" "57373492" "subst" "0" "03256" "SERPING1_000528" "g.57373492T>A" "" "{DOI:Xu 2012:10.1111/all.12024} {DOI:Liu 2019:10.1684/ejd.2018.3487} {DOI:Hashimura 2021:10.1111/all.15034}" "" "" "Introduced as VUS in ClinVar by Ambry Genetics, Aliso Viejo CA and by multiple submitters" "Germline" "yes" "rs281875172" "0" "" "" "g.57606019T>A" "{CV:000068255}" "likely pathogenic" ""
"0000597707" "0" "99" "11" "57373492" "57373492" "subst" "0" "03256" "SERPING1_000529" "g.57373492T>G" "" "{DOI:Johnsrud 2015:10.1371/journal.pone.0131637}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57606019T>G" "" "pathogenic" ""
"0000597717" "0" "99" "11" "57373504" "57373504" "subst" "0" "03256" "SERPING1_000530" "g.57373504T>C" "6.195e-7" "{PMID:Verpy 1996:8755917} {DOI:Haslund 2019:10.1172/JCI98869} {DOI:Loli-Ausejo 2021:10.1007/s12016-021-08834-9} {DOI:Salih 2023:/10.1016/j.jaip.2022.11.045}" "" "" "Recurrent variant\r\np.(Phe214Ser) product likely to oligomerize with wt protein, with a subsequent highly reduced secretion by fibroblast and retention within cell, as investigated by Haslund 2019.\r\nPhe214 is a highly conserved residue among serpins (75%), located in helix E that plays a crucial role in facilitating the conformation change during the insertion of RCL between s3A and s5A; Phe214 packs against Leu408 and the conserved Gly162 at the C-terminus of helix B, then classifying p.(Phe236Ser) within class III.\r\nThe c.707T>C variant in SERPING1 meets ACMG/ClinGen criteria to be classified as pathogenic: PS3_VS, PP4_Str, PS4_Mod, PP3_Mod, PM2_Sup, PP2.\r\nVariant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "" "0" "" "" "g.57606031T>C" "{CV-SCV:005187247.1}" "pathogenic" "ACMG"
"0000597718" "0" "99" "11" "57373527" "57373527" "subst" "0" "03256" "SERPING1_000531" "g.57373527T>G" "" "{DOI:Maia 2019:10.1111/all.13699} {DOI:Veronez 2021:10.1016/j.jaip.2020.11.039}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57606054T>G" "" "likely pathogenic" ""
"0000597719" "0" "99" "11" "57373535" "57373535" "subst" "0" "03256" "SERPING1_000532" "g.57373535C>A" "" "{PMID:Bissler 1997:9069585}" "" "" "The Ser to Arg transition at position 224 is at the junction of helix E and strand 1A; the second of three consecutive serines, in a region relatively conserved among serpins.\r\nNote that helix E plays a crucial role in facilitating the conformation change during the insertion of RCL between s3A and s5A." "Germline" "yes" "" "0" "" "" "g.57606062C>A" "" "pathogenic" "ACMG"
"0000597720" "0" "99" "11" "57373540" "57373540" "subst" "0" "03256" "SERPING1_000533" "g.57373540C>G" "" "{DOI:Roche 2005:10.1002/humu.20197} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Ryø 2023:10.1016/j.jaci.2023.04.023} {DOI:Grombikirova 2023:10.1007/s10875-023-01565-w}" "" "" "p.(Pro248Arg) is a dominant-negative variant; p.(Pro248Arg) variant product accumulates into cell, affecting transport and secretion of normal C1-INH.\r\nBased on the structure of secreted protein, Pro226 residue is localized at the junction between helices E and F; a Pro to Arg transition might affect the shutter functional region, with an increased susceptibility to oligomerization.\r\nThe c.743C>G variant in SERPING1 meets ACMG/ClinGen criteria to be classified as pathogenic: PP4_Str, PP3_Str, PS4_Mod, PP2, PM2_Sup.\r\nVariant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "rs2495440609" "0" "" "" "g.57606067C>G" "{CV-SCV:005061744.2}" "pathogenic (dominant)" "ACMG"
"0000597721" "0" "93" "11" "57373561" "57373561" "subst" "8.12117E-6" "03256" "SERPING1_000534" "g.57373561G>C" "0.00002850 (gnomAD v4)" "{DOI:Gösswein 2008:10.1159/000138883} {DOI:Haslund 2019:10.1172/JCI98869} {DOI:Ren 2025:10.1172/jci.insight.185548}" "" "" "The replacement of Ser with Thr at Ser255 position theoretically should not affect the glycol attachment at the Asn253. As in vitro investigations on p.(Ser255Thr) demonstrate, the variant has preserved expression and function and is likely a benign missense variant.\r\nMeets the ACMG criterion BA1. Conflicting classification as VUS by ClinVar." "Germline" "no" "rs893262278" "0" "" "" "g.57606088G>C" "{CV-SCV:002132592.5}" "likely benign" "ACMG"
"0000597722" "0" "99" "11" "57373549" "57373549" "subst" "0" "03256" "SERPING1_000535" "g.57373549T>G" "" "{DOI:Speletas 2015:10.1016/j.jaci.2014.08.007} {DOI:Szabo 2022:10.3389/falgy.2022.836465} {DOI:Troldborg 2024:10.1016/j.jaci.2024.03.028}" "" "c.751C>T" "c.751C>T has been erroneously recorded by Speletas 2015; the right sequence has been confirmed as c.752T>G by Prof AE Germenis, Dr M Speletas, 13th Feb 2018" "Germline" "yes" "" "0" "" "" "g.57606076T>G" "" "likely pathogenic" ""
"0000597724" "0" "99" "11" "57373570" "57373570" "subst" "0" "03256" "SERPING1_000536" "g.57373570A>T" "6.195e-7" "{DOI:Gösswein:10.1159/000138883} {DOI:Haslund 2019:10.1172/JCI98869}" "" "" "p.(Asn236Ile) protein likely to oligomerize; variant should be identified as intermediate type.\r\nVariant product secretion is affected, with associated intracellular accumulation." "Germline" "yes" "rs1240290746" "0" "" "" "g.57606097A>T" "{CV-SCV:003440382.4}" "likely pathogenic" "ACMG"
"0000597725" "0" "99" "11" "57373575" "57373575" "subst" "0" "03256" "SERPING1_000537" "g.57373575G>T" "" "{DOI:Roche 2005:10.1002/humu.20197} {DOI:Bas 2026:10.3390/medicina62091635}" "" "" "Variant submitted to ClinVar as pathogenic by PreventionGenetics, part of Exact Sciences, Marshfield WI\r\nVariant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "rs2495440825" "0" "" "" "g.57606102G>T" "{CV-SCV:004714005.1}" "pathogenic" "ACMG"
"0000597800" "0" "99" "11" "57373590" "57373590" "subst" "0" "03256" "SERPING1_000538" "g.57373590T>C" "" "{DOI:Bafunno 2014:10.1111/ahg.12052} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Ryø 2023:10.1016/j.jaci.2023.04.023}" "" "" "p.(Trp265Arg) is a dominant-negative variant; p.(Trp265Arg) variant product accumulates into cell, affecting transport and secretion of normal C1-INH.\r\nTrp243 residue is localized in helix F; a Trp to Arg transition might affect the shutter functional region, with an increased susceptibility to oligomerization.\r\nthe c.793T>C variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PP4_Str, PS4_Mod, PP3_Mod, PM2_Sup, PP2." "Germline" "yes" "" "0" "" "" "g.57606117T>C" "{CV-SCV:005187340.1}" "pathogenic (dominant)" "ACMG"
"0000597802" "0" "33" "11" "57373597" "57373597" "subst" "0" "03256" "SERPING1_000540" "g.57373597C>T" "" "{DOI:Jaradat 2016:10.1016/j.molimm.2016.02.001}" "" "" "Coumpound heterozygous individuals carrying c.[c.203C>T(;)800C>T] exhibit more severe and frequent symptoms than subjects without c.800C>T variant.\r\nc.800C>T variant carriers exhibit circulating C1-INH levels slightly below the reference.\r\nThese observations may suggest a recessive modifier role for the c.800T allele.\r\nSuggested ACMG criteria PM1 PM2 PM3 PP3 with a VUS" "Germline" "no" "" "0" "" "" "g.57606124C>T" "" "VUS" "ACMG"
"0000597803" "0" "99" "11" "57367503" "57367503" "subst" "0" "03256" "SERPING1_000541" "g.57367503C>T" "" "{DOI:Jaradat 2016:10.1016/j.molimm.2016.02.001}" "" "" "c.203C>T allele segregates with low antigenic C1-INH and function.\r\nThr46 is adjacent to an Asn47 that is known to be N-glycosylated. For p.(Thr68Ile), the calculated potential score for N-glycosylation prediction is decreased to 4 (out of 9), suggesting that the Thr to Ile transition can impair Asn47 glycosylation, with subsequent deleterious consequence for protein expression.\r\nVariant c.203C>T introduced in ClinVar as pathogenic by Labcorp, San Francisco CA." "Germline" "yes" "" "0" "" "" "g.57600030C>T" "{CV-SCV:007374403.1}" "likely pathogenic" ""
"0000597804" "21" "99" "11" "57367503" "57367503" "subst" "0" "03256" "SERPING1_000542" "g.57367503C>T" "" "{PMID:Jaradat 2016:26895475}, {DOI:Jaradat 2016:10.1016/j.molimm.2016.02.001}" "" "c.[203C>T];[800C>T]" "c.[203C>T];[800C>T] compound heterozygous affected siblings (n=3) presenting with the highest severity scores. \r\nIndividuals known to only have the c.800C>T variant are asymptomatic, with circulating C1-INH values at the lower limit of the normal range.\r\nSuggested ACMG criteria PM1 PM2 PP2 BP4 with a VUS" "Germline" "yes" "" "0" "" "" "g.57600030C>T" "" "VUS" "ACMG"
"0000597807" "2" "97" "11" "57373653" "57373653" "subst" "1.21826E-5" "03256" "SERPING1_000543" "g.57373653C>T" "0.000006815" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "c.[820A>G];[856C>T]" "The compound heterozygous c.[820A>G];[856C>T] carrier is symptomatic and presenting with a low C1-INH function.\r\np.(Arg286Cys) is intolerant by SIFT, but benign by PolyPhen and polymorphic by MutationTaster. \r\nc.856C>T variant might behave with a recessive modifier role for the c.820A>G allele.\r\nVariant c.856C>T also reported in a compound heterozygous individual by Faiyaz-Ul-Haque et al 2010." "Germline" "" "rs1392305191" "0" "" "" "g.57606180C>T" "{CV-SCV:001259299.1}" "VUS" "ACMG"
"0000597808" "0" "90" "11" "57373653" "57373653" "" "0" "03256" "SERPING1_000544" "g.[57373653C>T(;)57381912T>A]" "" "{DOI:Faiyaz-Ul-Haque 2010:10.1159/000236005}" "" "" "p.(Arg286Cys) is intolerant by SIFT, but benign by PolyPhen and polymorphic by MutationTaster.\r\nc.856C>T variant might behave with a recessive modifier role for the c.1361A allele." "Germline/De novo (untested)" "" "" "0" "" "" "g.[57606180C>T(;)57614439T>A]" "" "pathogenic" ""
"0000597809" "0" "99" "11" "57373657" "57373657" "subst" "0" "03256" "SERPING1_000545" "g.57373657T>C" "" "{DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Gábos 2019:10.2478/rrlm-2019-0029}" "" "" "In silico algorithms support a deleterious effect of the c.860T>C variant with Moderate evidence of pathogenicity, when choosing at least two identical assessments and using the threshold ranges from ClinGen recommendations.\r\nThe c.860T>C variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PP4_Str, PP3_Mod, PS4_Sup, PM2_Sup, PP1, PP2" "Germline" "yes" "" "0" "" "" "g.57606184T>C" "{CV-SCV:005196580.1}" "pathogenic" "ACMG"
"0000597810" "0" "99" "11" "57373668" "57373668" "subst" "0" "03256" "SERPING1_000547" "g.57373668A>T" "" "{DOI:Maia 2019:10.1111/all.13699} {DOI:Veronez 2021:10.1016/j.jaip.2020.11.039}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57606195A>T" "" "pathogenic" "ACMG"
"0000597811" "0" "97" "11" "57373677" "57373677" "subst" "0" "03256" "SERPING1_000548" "g.57373677T>A" "6.195e-7" "{DOI:Martinho 2013:10.1016/j.molimm.2012.09.003}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57606204T>A" "" "likely pathogenic" ""
"0000597817" "0" "79" "11" "57373679" "57373679" "subst" "0" "03256" "SERPING1_000549" "g.57373679C>A" "" "{DOI:Xu 2012:10.1111/all.12024} {DOI:Liu 2019:10.1684/ejd.2018.3487}" "" "" "" "Germline" "" "" "0" "" "" "g.57606206C>A" "" "likely pathogenic" "ACMG"
"0000597818" "0" "99" "11" "57373679" "57373679" "subst" "0" "03256" "SERPING1_000550" "g.57373679C>G" "" "{DOI:Roche 2005:10.1002/humu.20197} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Xia 2024:10.3760/cma.j.cn112140-20240227-00125 }" "" "" "c.882C>G variant has been demonstrated to affect the acceptor splice site, with a subsequent skipped exon 5 (Roche 2005): Patient cell mRNA exhibits wt transcript and an aberrantly spliced transcript skipping exon 5, pertaining to a defect in ESE motif in this portion of exon 5 (c.881_886, ACCTGA), with subsequent aberrant splicing.\r\nIntroduced in ClinVar as pathogenic by Research Centre for Medical Genetics, Moscow Russia" "Germline" "yes" "" "0" "" "" "g.57606206C>G" "{CV-SCV:005088627}" "pathogenic" "ACMG"
"0000597819" "0" "99" "11" "57373681" "57373681" "subst" "0" "03256" "SERPING1_000551" "g.57373681T>G" "" "{DOI:Roche 2005:10.1002/humu.20197}" "" "" "This exonic mutation may affect splicing.\r\nc.884T>G variant has been demonstrated to affect the acceptor splice site (defect in ESE motif), with a subsequent partially skipped exon 5 (Roche 2005): Patient cell mRNA exhibits wt transcript and an aberrantly spliced transcript skipping exon 5 with a remnant synthesis of some C1Inh mRNA coding for p.(Leu295Arg).\r\nVariant introduced in the Lund SERPING1 database https://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "" "" "0" "" "" "g.57606208T>G" "" "pathogenic" "ACMG"
"0000597820" "0" "99" "11" "57373686" "57373686" "subst" "0" "03256" "SERPING1_000552" "g.57373686G>A" "" "{DOI:Martinho 2013:10.1016/j.molimm.2012.09.003} {DOI:Cagini 2016:10.1515/hsz-2015-0222} {DOI:Moreno 2015:10.1016/j.jaci.2014.12.1576} {DOI:Veronez 2019:10.3389/fmed.2019.00028} {DOI:Veronez 2021:10.1016/j.jaip.2020.11.039} {DOI:Ryø 2023:10.1016/j.jaci.2023.04.023} {DOI:Pinhal 2024:10.3389/falgy.2025.1604440} {DOI:Ferriani 2025:10.1016/j.jaip.2025.08.026}" "" "" "p.(Ala297Thr) is a dominant-negative variant; p.(Ala297Thr) variant product accumulates into cell, affecting transport and secretion of normal C1-INH.\r\nAla275 residue is localized in sheet 3A in a conserved position among serpins (74%); a Ala to Thr transition might affect the breach functional region, ie. ia mobile region where sheet swings open to accept RCL during loop insertion, with an increased susceptibility to oligomerization, as shown by Ryø 2023." "Germline" "yes" "" "0" "" "" "g.57606213G>A" "" "pathogenic (dominant)" "ACMG"
"0000597821" "0" "99" "11" "57373883" "57373883" "subst" "0" "03256" "SERPING1_000553" "g.57373883A>T" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Bafunno 2014:2}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57606410A>T" "" "pathogenic" "ACMG"
"0000597822" "0" "77" "11" "57373893" "57373893" "subst" "0" "03256" "SERPING1_000554" "g.57373893C>A" "" "{PMID:Bissler 1997:9069585}" "" "" "p.(Thr301Lys): Tolerant by SIFT, benign by PolyPhen, polymorphic by MutationTaster\r\nThr279 is located at the junction of strand 3A and helix F1, which connects S4C.\r\nThr279 position is a site of different other pathogenic substitutions." "Germline" "yes" "" "0" "" "" "g.57606420C>A" "" "VUS" ""
"0000597823" "0" "99" "11" "57373893" "57373893" "subst" "0" "03256" "SERPING1_000555" "g.57373893C>T" "0.000001859" "{DOI:Bissler 1997:9069585}" "" "" "p.(Thr301Ile): Tolerant by SIFT, benign by PolyPhen, polymorphic by MutationTaster\r\nThr279 is located at the junction of strand 3A and helix F1, which connects S4C.\r\nThr279 position is a site for different other substitutions." "Germline" "yes" "rs1945410224" "0" "" "" "g.57606420C>T" "" "pathogenic" ""
"0000597824" "0" "77" "11" "57373902" "57373902" "subst" "0" "03256" "SERPING1_000556" "g.57373902A>G" "" "{DOI:Speletas 2015:10.1016/j.jaci.2014.08.007} {DOI:Szabo 2022:10.3389/falgy.2022.836465}" "" "" "p.(Asp304Gly): found polymorphic by MutationTaster" "Germline" "yes" "" "0" "" "" "g.57606429A>G" "" "likely pathogenic" ""
"0000597825" "1" "77" "11" "57373913" "57373913" "subst" "0" "03256" "SERPING1_000557" "g.57373913A>G" "6.195e-7" "{DOI:Cumming 2003:10.1136/jmg.40.10.e114}" "" "c.[922A>G];[1030-20A>G]" "p.(Thr308Ala) variant found polymorphic by MutationTaster\r\nCompound heterozygous carrier with c.1030-20A>G, identified as benign variant." "Germline" "" "rs1803212" "0" "" "" "g.57606440A>G" "" "likely pathogenic" "ACMG"
"0000597826" "0" "77" "11" "57373923" "57373923" "subst" "0" "03256" "SERPING1_000558" "g.57373923A>C" "" "{DOI:Martinho 2013:10.1016/j.molimm.2012.09.003}" "" "" "p.(Glu311Ala): Tolerant by SIFT, benign by PolyPhen, polymorphic by MutationTaster" "Germline" "?" "" "0" "" "" "g.57606450A>C" "" "likely pathogenic" ""
"0000597827" "0" "99" "11" "57373944" "57373944" "subst" "0" "03256" "SERPING1_000559" "g.57373944C>G" "0.000001" "{DOI:Firinu 2013:10.1016/j.clim.2013.03.007} {DOI:Steiner 2017:10.1111/cei.12941}" "" "g.13918C>G (traditional)" "Recurrent variant.\r\nA de novo proband has been identified in the Swiss cohort by Steiner 2017." "De novo" "yes" "rs1554995860" "0" "" "" "g.57606471C>G" "{CV:000252942}" "pathogenic" "ACMG"
"0000597830" "0" "99" "11" "57373962" "57373962" "subst" "0" "03256" "SERPING1_000560" "g.57373962T>G" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Hashimura 2021:10.1111/all.15034} {DOI:Ryø 2023:10.1016/j.jaci.2023.04.023}" "" "" "p.(Met324Arg) is a dominant-negative variant; p.(Met324Arg) variant product accumulates into cell, and consistently shown in the insoluble fraction of transfected Hela cells; p.(Met324Arg) affects transport and secretion of normal C1-INH (Ryø et al 2023).\r\nMet302 residue is localized within sheet 3C in a highly conserved position among serpins (84%); a Met to Arg transition might affect the gate functional region, ie. ia mobile region where sheet swings open to accept RCL during loop insertion, with an increased susceptibility to oligomerization.\r\nThe c.971T>G variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PS4_Mod, PS3_Sup, PP2, PP3_Str, PP4_Str, PM2_Sup." "Germline" "yes" "rs2495442432" "0" "" "" "g.57606489T>G" "{CV-SCV:005088186.2}" "pathogenic (dominant)" "ACMG"
"0000597831" "0" "99" "11" "57373965" "57373965" "subst" "0" "03256" "SERPING1_000561" "g.57373965T>C" "" "{PMID:Verpy 1996:8755917} {DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Kesim 2011:10.1159/000323915} {DOI:Martinho 2013:10.1016/j.molimm.2012.09.003} {DOI:Ryø 2023:10.1016/j.jaci.2023.04.023} {DOI:Galata 2025:10.1016/j.jaip.2025.03.020} {DOI:Bas 2026:10.3390/medicina62091635}" "" "" "Recurrent pathogenic variant.\r\np.(Met325Thr) is a dominant-negative variant; p.(Met325Thr) variant product consistently accumulates into cell, affecting transport and secretion of normal C1-INH (Ryø et al 2023).\r\nMet303 residue is localized within sheet 3C at a highly conserved position among serpins (86%); a Met to Thr transition might affect the breach/gate functional regions, ie. a mobile region where sheet swings open to accept RCL during loop insertion, with an increased susceptibility to oligomerization.\r\nMet303 is located in a buried hydrophobic area; Met303 packs against conserved positions in loop s3A/s4C (Phe281), s2C (Pro377, Arg378) and s5A (Glu429).\r\nVariant introduced in the Lund SERPING1 database https://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "" "0" "" "" "g.57606492T>C" "" "pathogenic (dominant)" "ACMG"
"0000597832" "0" "99" "11" "57373979" "57373979" "subst" "0" "03256" "SERPING1_000562" "g.57373979T>A" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Suffritti 2014:10.1111/cea.12293} {DOI:Ryø 2023:10.1016/j.jaci.2023.04.023}" "" "8821T>A (traditional)" "p.(Tyr330Asn) is a dominant-negative variant; p.(Tyr330Asn) variant product accumulates into cell, affecting transport and secretion of normal C1-INH (Ryø et al 2023).\r\nTyr308 residue is localized within sheet 3C; a Tyr to Asn transition might affect the breach/gate functional regions, ie. a mobile region where sheet swings open to accept RCL during loop insertion, with an increased susceptibility to oligomerization.\r\nItalian patient samples exhibit a high level of circulating cleaved HK species, with 48.1% and 35.8% of total HK, in line with an activation of kallikrein-kinin system." "Germline" "yes" "" "0" "" "" "g.57606506T>A" "" "pathogenic (dominant)" "ACMG"
"0000597840" "0" "99" "11" "57373687" "57373687" "subst" "0" "03256" "SERPING1_000563" "g.57373687G>A" "" "{DOI:Ponard 2019:10.1002/humu.23917} {DOI:Hashimura 2021:10.1111/all.15034} {DOI:Szabó 2022:10.3389/falgy.2022.836465}" "" "" "c.889+1G>A variant is likely to affect the canonical donor splice site, with subsequent probable exon 5 skipping.\r\nRecurrent variant" "Germline" "yes" "" "0" "" "" "g.57606214G>A" "{CV-SCV:005763544.1}" "pathogenic" "ACMG"
"0000597841" "0" "99" "11" "57373989" "57373989" "subst" "0" "03256" "SERPING1_000564" "g.57373989C>G" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007}" "" "" "The variant meets ACMG criteria PP3, PP4, PM2_Sup, PM5_Mod and has been considered as a VUS." "Germline" "yes" "" "0" "" "" "g.57606516C>G" "" "VUS" ""
"0000597842" "0" "97" "11" "57373989" "57373989" "subst" "0" "03256" "SERPING1_000565" "g.57373989C>A" "" "{DOI:Kasamatsu 2011:10.2169/internalmedicine.50.6224} {DOI:Yamamoto 2012:10.1097/MAJ.0b013e31822bdb65} {DOI:Hashimura 2021:10.1111/all.15034}" "" "" "Yamamoto 2012 erroneously identified this variant as c.996C>A (8831C>A, traditional nomenclature).\r\nAla311 position is located at the N-terminus of sheet 1B, with an Ala to Asp transition possibly affecting breach functional domain.\r\nThe variant meets ACMG criteria PM2_Sup, PP2, PP3, PP4_Str, and could be provisionnally characterized as a likely pathogenic variant, as suggested in ClinVar by Research Centre for Medical Genetics, Moscow Russia." "Germline" "yes" "" "0" "" "" "g.57606516C>A" "{CV-SCV:005199874}" "likely pathogenic" "ACMG"
"0000597843" "0" "99" "11" "57373995" "57373995" "subst" "0" "03256" "SERPING1_000566" "g.57373995T>C" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57606522T>C" "" "pathogenic" ""
"0000597844" "0" "99" "11" "57374001" "57374001" "subst" "0" "03256" "SERPING1_000567" "g.57374001A>G" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Maia 2019:10.1111/all.13699} {DOI:Veronez 2021:10.1016/j.jaip.2020.11.039}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57606528A>G" "" "pathogenic" "ACMG"
"0000597845" "0" "77" "11" "57374015" "57374015" "subst" "0" "03256" "SERPING1_000568" "g.57374015G>C" "" "{DOI:Gösswein 2008:10.1159/000138883}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57606542G>C" "" "pathogenic" ""
"0000597849" "0" "99" "11" "57379193" "57379193" "subst" "0" "03256" "SERPING1_000569" "g.57379193G>C" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "" "c.1033G>C variant located in sheet 2B, breach functional region. C1-INH function affected." "Germline" "yes" "" "0" "" "" "g.57611720G>C" "{CV-SCV:007385783.1}" "pathogenic" "ACMG"
"0000597853" "0" "99" "11" "57379202" "57379202" "subst" "0" "03256" "SERPING1_000570" "g.57379202C>T" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Gösswein 2008:10.1159/000138883} {DOI:Xu 2012:10.1111/all.12024} {DOI:Suffritti 2014:10.1111/cea.12293} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Gábos 2019:10.2478/rrlm-2019-0029} {DOI:Liu 2019:10.1684/ejd.2018.3487} {DOI:Veronez 2021:10.1016/j.jaip.2020.11.039} {DOI:Ferriani 2025:10.1016/j.jaip.2025.08.026}" "" "14043C>T (traditional)" "Recurrent variant.\r\nItalian proband sample exhibits a high level of cleaved circulating HK species, with 37.6% of total HK." "Germline" "yes" "" "0" "" "" "g.57611729C>T" "{CV-SCV:005836088.1}" "pathogenic" "ACMG"
"0000597854" "0" "99" "11" "57379208" "57379208" "subst" "0" "03256" "SERPING1_000571" "g.57379208T>C" "" "{DOI:López-Lera 2011:10.1016/j.molimm.2011.07.010} {DOI:de la Cruz 2012:10.1016/j.imlet.2011.07.011} {DOI:Mendoza-Alvarez 2026:10.21203/rs.3.rs-10662999/v1}" "" "" "Introduced in ClinVar as likely pathogenic by Hannover Medical School, Hannover Germany" "Germline" "yes" "" "0" "" "" "g.57611735T>C" "{CV-SCV:005088699.1}" "pathogenic" "ACMG"
"0000597855" "0" "99" "11" "57379215" "57379215" "subst" "0" "03256" "SERPING1_000572" "g.57379215A>T" "" "{DOI:Gösswein 2008:10.1159/000138883} {DOI:Ren 2025:10.1172/jci.insight.185548}" "" "" "Asn352 is located at the end of loop in the β-sheet 2B (S2B) as it transits into S3B (Ren 2025), situated in the center of the breach region, where the RCL inserts into the shutter domain. Isoleucine is a hydrophobic residue, which is challenging to adapt to an α-helical confirmation likely lie within β-sheets. The substitution of Asn to Ile at 352 may change the orientation of the loop, resulting in protein misfolding and thereby a decreased protein expression.\r\np.(Asn352Ile) disrupts the N-glycosylation site at Asn330 position of C1-INH protein. It has been demonstrated that altering Asn352 by substituting Asn to Ala disrupts N-linked sugar attachment but preserves protein expression or function.\r\nThe disruption at Asn352 glycan attachment results in a decreased protein expression and functional defects. Asn352Ile results in expression defects and is likely causing HAE: Reinterpretation as likely pathogenic by Ren et al (2025)." "Germline" "yes" "" "0" "" "" "g.57611742A>T" "" "likely pathogenic" "ACMG"
"0000597856" "0" "99" "11" "57379218" "57379218" "subst" "0" "03256" "SERPING1_000573" "g.57379218T>C" "" "{DOI:Gösswein 2008:10.1159/000138883} {DOI:Guryanova 2019:10.29235/1814-6023-2019-16-3-349-356} {DOI:Guryanova 2021:10.1186/s12948-021-00141-0} {DOI:Ren 2025:10.1172/jci.insight.185548}" "" "" "HAE family from Belarus presenting with a de novo proband.\r\nThe c.1058T>C variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PS2_Str, PS3, PP3_Str, PP4_Mod, PM2_Sup, PP2.\r\nThe disruption at Asn352 glycan attachment results in a decreased protein expression and functional defects. Leu353Pro demonstrates abolished expression, leading to HAE: considered pathogenic by Ren et al (2025).\r\nIntroduced in ClinVar as likely pathogenic by DNA-diagnostics Laboratory, Research Centre For Medical Genetics, Moscow Russia." "De novo" "yes" "rs2495452187" "0" "" "" "g.57611745T>C" "{CV-SCV:005088189.1}" "pathogenic" "ACMG"
"0000597857" "0" "99" "11" "57379230" "57379230" "subst" "0" "03256" "SERPING1_000574" "g.57379230T>A" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Ryø 2023:10.1016/j.jaci.2023.04.023}" "" "" "p.(Ile357Asn) is a dominant-negative variant; p.(Ile357Asn) variant product accumulates into cell, affecting transport and secretion of normal C1-INH (Ryø et al 2023).\r\nIle335 residue is localized within sheet 3B; a Ile to Asn transition might affect the gate functional region, ie. a mobile region where sheet swings open to accept RCL during loop insertion, with an increased susceptibility to oligomerization.\r\nThe c.1070T>A variant in SERPING1 meets ACMG/ClinGen criteria to be classified as pathogenic: PP4_Str, PS3_Mod, PP3_Mod, PS4_Sup, PM2_Sup, PP2." "Germline" "yes" "" "0" "" "" "g.57611757T>A" "{CV-SCV:005061767.3}" "pathogenic (dominant)" "ACMG"
"0000597858" "0" "99" "11" "57379262" "57379262" "subst" "0" "03256" "SERPING1_000575" "g.57379262G>T" "" "{PMID:Bissler 1997:9069585}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57611789G>T" "" "pathogenic" "ACMG"
"0000597859" "0" "99" "11" "57379269" "57379269" "subst" "0" "03256" "SERPING1_000576" "g.57379269T>G" "" "{DOI:Tarzi 2007:10.1111/j.1365-2249.2007.03438.x}" "" "" "Three individuals do not present with a decreased antigenic C4 (Tarzi).\r\nThe variant meets the ACMG criteria PP4_Supp, PP3_Supp, PM2_Mod, PS3_Supp, PS4_Supp" "Germline" "yes" "" "0" "" "" "g.57611796T>G" "{CV-SCV:007600982.1}" "pathogenic" "ACMG"
"0000597860" "0" "99" "11" "57379239" "57379239" "subst" "0" "03256" "SERPING1_000577" "g.57379239C>T" "" "{DOI:Mete Gökmen 2019:10.1159/000492583} {DOI:Ryø 2023:10.1016/j.jaci.2023.04.023}" "" "" "p.(Pro360Leu) is a dominant-negative variant; p.(Pro360Leu) variant product accumulates into cell, affecting transport and secretion of normal C1-INH (Ryø et al 2023).\r\nPro338 residue is localized in the distal hinge, within sheet 3B in a highly conserved position among serpins (93%); a Pro to Leu transition might affect the gate functional region, ie. a mobile region where sheet swings open to accept RCL during loop insertion, with an increased susceptibility to oligomerization.\r\nPro338 is located in a buried hydrophobic area\r\nPro338 packs against Leu345 and Met348 and conserved position in distal hinge (Pro454)." "Germline" "?" "" "0" "" "" "g.57611766C>T" "" "pathogenic (dominant)" "ACMG"
"0000597861" "0" "57" "11" "57379281" "57379281" "subst" "0" "03256" "SERPING1_000578" "g.57379281T>C" "" "{DOI:Wang 2022:10.1186/s41065-022-00242-z} {DOI:Du 2026:10.3389/falgy.2026.1899305}" "" "" "A Leu to Pro substitution at a conserved position across species, which may impact secondary protein structure as these residues differ in some properties.\r\nIn silico analysis predicts this variant is probably damaging to the protein structure/function.\r\nThe c.1121T>C meets the ACMG criteria PM2_Sup, PP3_Sup, PP4_Sup." "Germline/De novo (untested)" "" "rs1085307742" "0" "" "" "g.57611808T>C" "{CV:000426682}" "VUS" "ACMG"
"0000597862" "0" "99" "11" "57379289" "57379289" "subst" "0" "03256" "SERPING1_000579" "g.57379289T>C" "" "{DOI:López-Lera 2011:10.1016/j.molimm.2011.07.010}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57611816T>C" "" "pathogenic" "ACMG"
"0000597863" "0" "99" "11" "57381942" "57381943" "del" "0" "03256" "SERPING1_000580" "g.57381942_57381943del" "" "{DOI:Bors 2013:10.1016/j.jaci.2012.11.015} {DOI:Szabo 2022:10.3389/falgy.2022.836465} {DOI:Troldborg 2024:10.1016/j.jaci.2024.03.028}" "" "16783_16784delTG (traditional)" "A variant c.1389_1390delTG has been erroneously recorded by Loules 2018.\r\nThe c.1391_1392delTG variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as likely pathogenic: PVS1_Str, PS4_Mod, PP4_Mod, PM2_Sup." "Germline" "yes" "" "0" "" "" "g.57614469_57614470del" "" "likely pathogenic" "ACMG"
"0000597864" "0" "99" "11" "57367735" "57367776" "del" "0" "03256" "SERPING1_000581" "g.57367735_57367776del" "" "{DOI:Kalmár 2003:10.1002/humu.9202} {DOI:Bors 2013:10.1016/j.jaci.2012.11.015} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Szabó 2022:10.3389/falgy.2022.836465} {DOI:Troldborg 2024:10.1016/j.jaci.2024.03.028}" "" "2579_2620del42 (traditional)" "Variant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/\r\nIn-frame deletion of 14 residues." "Germline" "yes" "" "0" "" "" "g.57600262_57600303del" "" "pathogenic" "ACMG"
"0000597866" "0" "99" "11" "57379383" "57379383" "subst" "0" "03256" "SERPING1_000583" "g.57379383A>T" "" "{DOI:Kalmár 2003:10.1002/humu.9202} {DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Bors 2013:10.1016/j.jaci.2012.11.015} {DOI:Martinho 2013:10.1016/j.molimm.2012.09.003} {DOI:Suffritti 2014:10.1111/cea.12293} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Szabó 2022:10.3389/falgy.2022.836465}" "" "14224A>T (traditional)" "The Italian proband sample exhibits a high level of circulating HK species, with 38.9% of total HK, in line with an activation of kallikrein-kinin system.\r\ncleaved Variant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "" "0" "" "" "g.57611910A>T" "" "pathogenic" "ACMG"
"0000597868" "0" "99" "11" "57381969" "57381969" "subst" "0" "03256" "SERPING1_000584" "g.57381969T>A" "" "{DOI:Kalmár 2003:10.1002/humu.9202} {DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Bors 2013:10.1016/j.jaci.2012.11.015} {DOI:Suffritti 2014:10.1111/cea.12293} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Szabo 2022:10.3389/falgy.2022.836465}" "" "16810T>A (traditional)" "One de novo proband in the Hungarian pedigree.\r\nRecurrent variant at a conserved position among serpins: Val451, loop s1C/s4B; gate; needed for the RCL insertion.\r\nVariant considered pathogenic according to ACMG guidelines PS2_Str, PS3, PS4, PM1, PM2, PP1, PP4.\r\nThe Italian proband sample exhibits a high level of circulating cleaved HK species, with 44.2% of total HK, in line with an activation of kallikrein-kinin system.\r\nIntroduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "De novo" "yes" "" "0" "" "" "g.57614496T>A" "" "pathogenic" "ACMG"
"0000597871" "0" "99" "11" "57381820" "57381820" "subst" "0" "03256" "SERPING1_000585" "g.57381820T>G" "" "{DOI:Lopez-Lera 2011:10.1016/j.molimm.2011.07.010} {DOI:Yamamoto 2012:10.1097/MAJ.0b013e31822bdb65} {DOI:Hashimura 2021:10.1111/all.15034}" "" "" "Spanish family with a de novo proband" "De novo" "yes" "" "0" "" "" "g.57614347T>G" "" "pathogenic" "ACMG"
"0000597900" "0" "99" "11" "57379296" "57379296" "subst" "0" "03256" "SERPING1_000586" "g.57379296T>C" "" "{DOI:Roche 2005:10.1002/humu.20197} {DOI:Kurjane 2026:10.3389/fimmu.2026.1696479}" "" "" "Phe379 residue is located in the helix H.\r\nVariant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "" "0" "" "" "g.57611823T>C" "" "pathogenic" ""
"0000598041" "0" "99" "11" "57379302" "57379302" "subst" "8.12163E-6" "03256" "SERPING1_000587" "g.57379302C>T" "0.000002478 (GnomAD v4)" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007}" "" "" "" "Germline" "yes" "rs779296414" "0" "" "" "g.57611829C>T" "{CV-SCV:001509959.6}" "VUS" "ACMG"
"0000598042" "0" "99" "11" "57379325" "57379325" "subst" "0" "03256" "SERPING1_000588" "g.57379325T>C" "" "{DOI:Gösswein 2008:10.1159/000138883}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57611852T>C" "" "pathogenic" "ACMG"
"0000598043" "0" "99" "11" "57379334" "57379334" "subst" "0" "03256" "SERPING1_000589" "g.57379334C>T" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {PMID:Uyguner 2008:18846648} {DOI:Kesim 2011:10.1159/000323915}{DOI:Martinho 2013:10.1016/j.molimm.2012.09.003}{DOI:Veronez 2021:10.1016/j.jaip.2020.11.039}" "" "" "Recurrent variant" "De novo" "yes" "rs2135324708" "0" "" "" "g.57611861C>T" "{CV-SCV:002238942.2}" "pathogenic" "ACMG"
"0000598044" "0" "99" "11" "57379353" "57379353" "subst" "0" "03256" "SERPING1_000590" "g.57379353T>A" "" "{DOI:Gösswein 2008:10.1159/000138883}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57611880T>A" "" "likely pathogenic" "ACMG"
"0000598045" "0" "99" "11" "57379356" "57379356" "subst" "0" "03256" "SERPING1_000591" "g.57379356C>T" "" "{DOI:Roche 2005:10.1002/humu.20197} {DOI:Gösswein 2008:10.1159/000138883} {DOI:López-Lera 2011:10.1016/j.molimm.2011.07.010} {DOI:Loli‐Ausejo 2021:10.1007/s12016-021-08834-9}" "" "" "Recurrent variant.\r\nPro377 is a highly conserved position among serpins (97%).\r\nAs described for p.(Pro399Arg), the p.(Pro399Leu) variant product lies at the C-terminus of the sheet 2C, at a very critical position within gate and hinge regions for structural constraints and moreover in a buried hydrophobic context, with at least 3 important interactions in the native C1Inh structure; i.e. conserved positions in s4C (Phe291), s3C (Val300, Met302) and distal hinge (Phe455). Similarly to p.(Pro399Ser), the protein product loses a Pro377 that is suggestive to disturb insertion of the RCL to properly develop serpin-protease association. For these reasons it must be affected as a class II of the intermediate HAE type.\r\nVariant submitted to ClinVar as pathogenic by InVitae, San Francisco CA and introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "De novo" "yes" "rs2135324770" "0" "" "" "g.57611883C>T" "{CV-SCV:001587490.3}" "pathogenic" "ACMG"
"0000598264" "0" "99" "11" "57379356" "57379356" "subst" "0" "03256" "SERPING1_000592" "g.57379356C>G" "" "{DOI:Roche 2005:10.1002/humu.20197} {DOI:Loli-Ausejo 2021:doi.org/10.1007/s12016-021-08834-9} {DOI:Ren 2023:10.1016/j.jaci.2022.11.027} {DOI:Ryø 2023:10.1016/j.jaci.2023.04.023}" "" "" "p.(Pro399Arg) is a dominant-negative variant; p.(Pro399Arg) variant product accumulates into cell, affecting transport and secretion of normal C1-INH.\r\nPro377 residue is localized at the C-terminus of β-sheet C (s2C) in a highly conserved position among serpins (97%); a Pro to Arg transition might affect the gate (and hinge) functional region, ie. a mobile region where sheet swings open to accept RCL during loop insertion, with an increased susceptibility to oligomerization, then classifying p.(Pro399Arg) within class III.\r\nPro377 is located in a buried hydrophobic environment, packs against conserved positions in s4C (Phe291, native C1Inh), s3C (Val300, Met302) and distal hinge (Phe455).\r\nSimilarly to p.(Pro379Ser), the product loses a Pro377 that is suggestive to disturb insertion of the RCL to properly develop serpin-protease association, with a characterization as class 2 biological phenotype.\r\nVariant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/\r\nClinVar pathogenic. Variant characterized pathogenic according to the ACMG criteria PM1, PM2, PM5, PP3_Str, PP5_Mod." "Germline" "yes" "rs2135324770" "0" "" "" "g.57611883C>G" "{CV-SCV:001587490.3}" "pathogenic (dominant)" "ACMG"
"0000598265" "0" "99" "11" "57379365" "57379365" "subst" "0" "03256" "SERPING1_000593" "g.57379365A>T" "" "{PMID:Bissler 1997:9069585}" "" "" "" "Germline" "" "" "0" "" "" "g.57611892A>T" "" "pathogenic" ""
"0000598269" "0" "99" "11" "57379383" "57379383" "subst" "0" "03256" "SERPING1_000594" "g.57379383A>G" "" "{DOI:Martinho 2013:10.1016/j.molimm.2012.09.003} {DOI:Andrejević 2015:10.1371/journal.pone.0142174} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Gábos 2019:10.2478/rrlm-2019-0029} {DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "" "Recurrent variant.\r\nSubmitted to ClinVar as likely pathogenic by InVitae, San Francisco CA, and by Ambry Genetics, Aliso Viejo CA." "Germline" "yes" "rs2495452880" "0" "" "" "g.57611910A>G" "{CV-SCV:002658725.1}" "likely pathogenic" "ACMG"
"0000598270" "0" "99" "11" "57379389" "57379389" "subst" "0" "03256" "SERPING1_000595" "g.57379389T>C" "" "{DOI:Gösswein 2008:10.1159/000138883}" "" "" "The c.1229T>C variant in SERPING1 meets ACMG/ClinGen criteria to be classified as likely pathogenic: PP4_Mod, PS4_Mod, PM2_Sup, PP2, PP3" "Germline" "yes" "rs2495452889" "0" "" "" "g.57611916T>C" "{CV-SCV:005088209}" "likely pathogenic" "ACMG"
"0000598271" "0" "99" "11" "57379392" "57379392" "subst" "0" "03256" "SERPING1_000596" "g.57379392C>A" "" "{DOI:Pappalardo 2000:10.1067/mai.2000.110471}" "" "" "De novo proband.\r\nVariant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "De novo" "" "" "0" "" "" "g.57611919C>A" "" "pathogenic" "ACMG"
"0000598272" "0" "99" "11" "57379407" "57379407" "subst" "0" "03256" "SERPING1_000597" "g.57379407T>A" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "" "" "De novo" "yes" "rs1565173405" "0" "" "" "g.57611934T>A" "{CV:000619176}" "pathogenic" "ACMG"
"0000598273" "0" "50" "11" "57381808" "57381808" "subst" "8.14545E-6" "03256" "SERPING1_000598" "g.57381808C>A" "0.000006980 (gnomAD v3)" "unknown authors" "" "" "SIFT: tolerant; PolyPhen: benign" "CLASSIFICATION record" "" "" "0" "" "" "g.57614335C>A" "" "VUS" ""
"0000598274" "0" "73" "11" "57381816" "57381816" "subst" "2.03427E-5" "03256" "SERPING1_000599" "g.57381816C>T" "0.000004337" "{DOI:Martinho 2013:10.1016/j.molimm.2012.09.003}" "" "" "Variant effect predictor: p.(Ser422Phe) has been found tolrated by SIFT, benign by PolyPhen and polymorphic by MutationTaster" "Germline" "?" "rs763796718" "0" "" "" "g.57614343C>T" "" "likely benign" "ACMG"
"0000598275" "0" "99" "11" "57381828" "57381828" "subst" "0" "03256" "SERPING1_000600" "g.57381828A>T" "" "{DOI:Mete Gökmen 2019:10.1159/000492583} {DOI:Ryø 2023:10.1016/j.jaci.2023.04.023}" "" "" "p.(Asn426Ile) is a dominant-negative variant; p.(Asn426Ile) variant product accumulates into cell, affecting transport and secretion of normal C1-INH (Ryø et al 2023).\r\nAsn404 residue is localized within the loop between sheet 6A and helix I; a Asn to Ile transition might affect the breach/gate functional regions, ie. a mobile region where sheet swings open to accept RCL during loop insertion, with an increased susceptibility to oligomerization." "Germline" "" "" "0" "" "" "g.57614355A>T" "" "pathogenic (dominant)" "ACMG"
"0000598276" "1" "90" "11" "57381833" "57381833" "" "0" "03256" "SERPING1_000601" "g.[57381833T>C;57381893G>C]" "0.00002387 (c.1282T>C); 0.00000397 (c.1342G>C)" "{DOI:Gösswein 2008:10.1159/000138883}" "" "c.[1282T>C;1342G>C]" "Compound heterozygosity, cis configuration c.[1282T>C;1342G>C]" "Germline" "yes" "" "0" "" "" "g.[57614360T>C;57614420G>C]" "" "pathogenic (recessive)" ""
"0000598284" "0" "99" "11" "57381834" "57381834" "subst" "0" "03256" "SERPING1_000602" "g.57381834G>A" "6.196e-7 (gnomAD v4)" "{DOI:López-Lera 2011:10.1016/j.molimm.2011.07.010} {DOI:Loli‐Ausejo 2021:10.1007/s12016-021-08834-9}" "" "" "p.(Cys406Tyr) destroys the disulfide bridge with Cys101, suggesting an unstable serpin, then classifying p.(Cys428Tyr) within class II.\r\nSubmitted to ClinVar as pathogenic by InVitae, San Francisco CA" "Germline" "yes" "rs1945512818" "0" "" "" "g.57614361G>A" "{CV-SCV:002238776.2}" "pathogenic" "ACMG"
"0000598289" "0" "79" "11" "57381836" "57381836" "subst" "0" "03256" "SERPING1_000603" "g.57381836G>A" "6.196e-7" "{PMID:Davis 1993:8172583}" "" "" "Gly407 is located in a loop between helix I and sheet 5A" "Germline" "yes" "" "0" "" "" "g.57614363G>A" "" "likely pathogenic" "ACMG"
"0000598291" "0" "99" "11" "57381840" "57381840" "subst" "0" "03256" "SERPING1_000604" "g.57381840T>C" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "" "The c.1289T>C variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PP4_Str, PM5, PS4_Mod, PM2_Sup, PP2, PP3" "Germline" "yes" "" "0" "" "" "g.57614367T>C" "{CV-SCV:005073704.1}" "pathogenic" "ACMG"
"0000598292" "3" "93" "11" "57381930" "57381930" "subst" "0" "03256" "SERPING1_000605" "g.57381930C>T" "" "{DOI:Mete Gökmen 2020:10.1111/imcb.12362}" "" "g.[57381930C>T];[57381930C>T]" "Two homozygous affected individuals; heterozygous individuals presenting with mild phenotype or non affected" "Germline" "no" "" "0" "" "" "g.57614457C>T" "" "pathogenic (recessive)" ""
"0000598293" "3" "99" "11" "57381930" "57381930" "subst" "0" "03256" "SERPING1_000606" "g.57381930C>T" "" "{DOI:Mete Gökmen 2018:10.1159/000492583}{DOI:Mete Gökmen 2020:10.1111/imcb.12362}" "" "" "Variant at residue P7 of the RCL. The identity of residues P8-P7 in the RCL appears to determine whether the serpin is a functional protease inhibitor or not. \r\np.(Ser460Phe) bioinformatic scores: intolerant by SIFT, pathogenic by PolyPhen, polymorphic by MutationTaster.\r\nSymptomatic homozygous carriers, asymptomatic heterozygous carriers.\r\nPathogenicity results from a nonoptimal presentation of the RCL and/or unproductive turnover of the inhibitor and the release of an RCL-cleaved serpin and an active protease - as reported for p.(Arg400Cys) and p.(Ile462Ser)" "Germline" "no" "" "0" "" "" "g.57614457C>T" "" "likely pathogenic (recessive)" "ACMG"
"0000598294" "0" "77" "11" "57381840" "57381840" "subst" "0" "03256" "SERPING1_000607" "g.57381840T>A" "" "{DOI:Xu 2012:10.1111/all.12024} {DOI:Liu 2019:10.1684/ejd.2018.3487}" "" "" "The c.1289T>A variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PP4_Str, PM5, PS4_Mod, PM2_Sup, PP1, PP2, PP3" "Germline" "" "rs281875174" "0" "" "" "g.57614367T>A" "{CV:000068244}" "likely pathogenic" ""
"0000598295" "0" "99" "11" "57381860" "57381860" "subst" "0" "03256" "SERPING1_000608" "g.57381860C>T" "" "{DOI:Bafunno 2014:10.1111/ahg.12052}" "" "" "Introduced as pathogenic variant in ClinVar by CeGaT Center for Human Genetics Tübingen, with PVS1, PM2; a second introduction by Research Centre for Medical Genetics, Moscow Russia; the c.1309C>T variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PVS1_Str, PP4_Str, PM2_Sup, PP1." "Germline" "yes" "" "0" "" "" "g.57614387C>T" "{CV-SCV:002544568.3}" "pathogenic" "ACMG"
"0000598298" "0" "99" "11" "57381875" "57381875" "subst" "0" "03256" "SERPING1_000609" "g.57381875C>T" "" "{DOI:Gösswein 2008:10.1159/000138883} {DOI:Martinho 2013:10.1016/j.molimm.2012.09.003}" "" "" "The c.1324C>T variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PVS1_Str, PP4_Str, PS4_Mod, PM2_Sup, PP1" "Germline" "yes" "" "0" "" "" "g.57614402C>T" "{CV-SCV:005088603.1}" "pathogenic" "ACMG"
"0000598299" "0" "99" "11" "57381879" "57381879" "subst" "0" "03256" "SERPING1_000610" "g.57381879A>G" "" "{DOI:Zuraw 2000:10.1067/mai.2000.104780} {DOI:Blanch 2002:10.1002/humu.9073}" "" "" "His421 is a conserved position among serpins (78%), located in sheet 5A, shutter functional domain, suggested to develop H-bonding with conserved Asn269 and to pack against conserved position Leu388.\r\nDe novo Spanish proband.\r\nThe c.1328A>G variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PP4_Str, PM6, PS4_Mod, PP3_Mod, PM2_Sup, PP1.\r\nVariant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "De novo" "yes" "" "0" "" "" "g.57614406A>G" "{CV-SCV:005088605.1}" "pathogenic" "ACMG"
"0000598300" "0" "99" "11" "57381881" "57381881" "subst" "0" "03256" "SERPING1_000611" "g.57381881C>T" "" "{PMID:Uyguner 2008:18846646} {DOI:Kesim 2011:10.1159/000323915} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "" "De novo Turkish proband (family 1)" "De novo" "yes" "" "0" "" "" "g.57614408C>T" "" "pathogenic" "ACMG"
"0000598301" "0" "77" "11" "57381884" "57381884" "subst" "0" "03256" "SERPING1_000612" "g.57381884A>C" "" "{DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "" "p.(Thr445Pro) product has been attributed as intolerant by SIFT, benign by PolyPhen and polymorphic by MutationTaster" "Germline" "" "" "0" "" "" "g.57614411A>C" "" "VUS" ""
"0000598302" "0" "99" "11" "57381893" "57381893" "subst" "4.06299E-6" "03256" "SERPING1_000613" "g.57381893G>C" "0.00000397" "{DOI:Gösswein 2008:10.1159/000138883} {DOI:Haslund 2019:10.1172/JCI98869}" "" "" "Residue Glu426 located in sheet 5A, shutter functional domain.\r\np.(Glu426Gln) protein likely to oligomerize (Haslund 2019)\r\nc.1342G>C variant is combined with c.1282T>C in a c.[1282T>C];[1342G>C] cis combination (German family)" "Germline" "" "" "0" "" "" "g.57614420G>C" "" "likely pathogenic" "ACMG"
"0000598303" "0" "79" "11" "57381893" "57381893" "subst" "0" "03256" "SERPING1_000614" "g.57381893G>T" "" "{DOI:Xu 2012:10.1111/all.12024} {DOI:Liu 2019:10.1684/ejd.2018.3487} {DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "" "The c.1342G>T nonsense variant disrupts the last 53 amino acid(s) of the SERPING1 protein that are considered critical for serpin function (RCL, hinge).\r\nVariant introduced as pathogenic in ClinVar by Invitae, San Francisco CA." "Germline" "yes" "rs1168397543" "0" "" "" "g.57614420G>T" "{CV-SCV:003439802.1}" "pathogenic" "ACMG"
"0000598304" "0" "99" "11" "57381897" "57381897" "subst" "0" "03256" "SERPING1_000615" "g.57381897T>C" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Loules 2019:doi.org/10.1016/j.gene.2018.05.029} {DOI:Grombirikova 2023:10.1007/s10875-023-01565-w} {PMID:Gao 2025:40848077}, {DOI:Gao 2025:10.1007/s10875-025-01912-z}" "" "" "p.(Leu449Pro) at P5\' residue is likely to affect the RCL structure" "Germline" "yes" "" "0" "" "" "g.57614424T>C" "" "pathogenic" "ACMG"
"0000598306" "0" "99" "11" "57381897" "57381897" "subst" "0" "03256" "SERPING1_000616" "g.57381897T>G" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Suffritti 2014:10.1111/cea.12293} {DOI:Speletas 2015:10.1016/j.jaci.2014.08.007} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Förster 2021:10.1186/s13023-021-02021-x}" "" "16738T>G (traditional)" "The Italian patient sample exhibits a high level of circulating cleaved HK species, with 49.5% of total HK, in line with an activation of kallikrein-kinin system" "Germline" "yes" "" "0" "" "" "g.57614424T>G" "" "pathogenic" "ACMG"
"0000598307" "0" "99" "11" "57381902" "57381902" "subst" "0" "03256" "SERPING1_000617" "g.57381902G>A" "" "{DOI:Rijavec 2013:10.1371/journal.pone.0056712} {DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "" "Glu429 position is highly conserved among serpins (93%).\r\nGlu429 is located within β-sheet A (s5A), gate/breach, makes H-bonding to conserved Thr286 and salt bridge to conserved and exposed electropositive Arg378, packs against conserved Met303. \r\nGlu429 could be considered as a P17 position in the N-terminus of the RCL; apparent correspondence to p.(Glu342Lys), Z allele in A1AT with highly pathogenic multimers.\r\nVariant associated with incomplete penetrance C1-INH-HAE ; HAE symptomatic individuals carry additional variants possibly involved in HAE clinical phenotype: NM_001159747.2:c.190A>G;p.(Asn64Asp), NM_001017403.1:c.2323G>A;p.(Val775Met), NM_006226.4:c.1103A>G;p.(Gln368Arg), NM_013956.5:c.881T>C;p.(Met294Thr)" "Germline" "yes" "" "0" "" "" "g.57614429G>A" "" "pathogenic" ""
"0000598309" "0" "99" "11" "57381918" "57381918" "subst" "0" "03256" "SERPING1_000618" "g.57381918C>A" "" "{PMID:Skriver 1991:2026621 } {DOI:Blanch 2002:10.1002/humu.9073} {DOI:Speletas 2015:10.1016/j.jaci.2014.08.007} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Mendoza-Alvarez 2026:10.21203/rs.3.rs-10662999/v1}" "" "" "Recurrent variant.\r\nAla434 residue is highly conserved among serpins (79%).\r\nAla434 is the RCL P11 residue (proximal hinge), where Ala>Glu substitution disrupts RCL insertion into the β-sheet A and is likely to develop multimers.\r\nThe c.1367C>A variant in SERPING1 meets ACMG/ClinGen criteria to be classified as pathogenic: PM6, PS4_Mod, PP3_Mod, PP4_Mod, PM2_Sup, PP2.\r\nThe c.1367C>A variant has been found in a de novo Russian proband.\r\nIntroduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "De novo" "yes" "" "0" "" "" "g.57614445C>A" "{CV-SCV:005088610.1}" "pathogenic" "ACMG"
"0000598311" "0" "99" "11" "57381920" "57381920" "subst" "0" "03256" "SERPING1_000619" "g.57381920G>C" "" "{DOI:Veronez 2016:10.1515/hsz-2015-0212} {DOI:Hashimura 2021:10.1111/all.15034} {DOI:Veronez 2021:10.1016/j.jaip.2020.11.039} {DOI:Ferriani 2025:10.1016/j.jaip.2025.08.026}" "" "" "The variation introduces a Pro residue at Ala457 position closely to the RCL functional segment (P10), likely to affect pseudo-substrate and to disrupt serpin function.\r\np.(Ala457Pro) scores: intolerant by SIFT, pathogenic by PolyPhen, but polymorphic by MutationTaster" "Germline" "yes" "" "0" "" "" "g.57614447G>C" "" "likely pathogenic" "ACMG"
"0000598312" "0" "99" "11" "57381926" "57381926" "subst" "0" "03256" "SERPING1_000620" "g.57381926G>C" "" "{DOI:Martinho 2013:10.1016/j.molimm.2012.09.00}" "" "" "Ala437 residue is the P8 position within the RCL.\r\np.(Ala459Pro) scores: deleterious by SIFT, pathogenic by PolyPhen, Polymorphic by MutationTaster.\r\nThe c.1375G>C variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PS4_Mod, PP3_Mod, PP4_Mod, PM2_Sup, PP1, PP2." "Germline" "yes" "" "0" "" "" "g.57614453G>C" "{CV-SCV:005088611.1}" "pathogenic" "ACMG"
"0000598337" "0" "99" "11" "57381927" "57381927" "subst" "0" "03256" "SERPING1_000621" "g.57381927C>A" "" "{DOI:Cagini 2016:10.1515/hsz-2015-0222} {DOI:Veronez 2021:10.1016/j.jaip.2020.11.039} {DOI:Ferriani 2025:10.1016/j.jaip.2025.08.026}" "" "" "The variation introduces a negatively charged Asp residue at Ala459 position (P8 of the RCL). \r\np.(Ala459Asp) bioinformatic scores: deleterious by SIFT, pathogenic by PolyPhen, polymorphic by MutationTaster.\r\nAla437 residue is the P8 position within the RCL.\r\nThe c.1376C>A variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PM5, PS4_Mod, PP4_Mod, PM2_Sup, PP3" "Germline" "yes" "" "0" "" "" "g.57614454C>A" "{CV-SCV:005088613.1}" "likely pathogenic" "ACMG"
"0000598339" "0" "99" "11" "57379235" "57379249" "del" "0" "03256" "SERPING1_000622" "g.57379235_57379249del" "" "{DOI:Cagini 2016:10.1515/hsz-2015-0222} {DOI:Veronez 2021:10.1016/j.jaip.2020.11.039}" "" "" "In-frame deletion within sheet 3B" "Germline" "yes" "" "0" "" "" "g.57611762_57611776del" "" "pathogenic" "ACMG"
"0000598340" "0" "99" "11" "57379314" "57379314" "subst" "0" "03256" "SERPING1_000623" "g.57379314A>G" "" "{DOI:Gábos 2019:10.2478/rrlm-2019-0029}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57611841A>G" "" "likely pathogenic" "ACMG"
"0000598341" "0" "99" "11" "57373690" "57373694" "del" "0" "03256" "SERPING1_000624" "g.57373690_57373694del" "" "{DOI:Speletas 2015:10.1016/j.jaci.2014.08.007} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Gábos 2019:10.2478/rrlm-2019-0029}" "" "" "Donor splice site loss or c.889+4_889+8del considered as a deep intronic variant that might affect donor splice site and that should be recommended for mRNA species investigation." "Germline" "yes" "" "0" "" "" "g.57606217_57606221del" "" "pathogenic" "ACMG"
"0000598342" "0" "99" "11" "57373979" "57373979" "subst" "4.06088E-6" "03256" "SERPING1_000625" "g.57373979T>G" "" "{DOI:Gábos 2019:10.2478/rrlm-2019-0029} {DOI:Szabo 2022:10.3389/falgy.2022.836465}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57606506T>G" "{CV:VCV001424557.3}" "pathogenic" ""
"0000598356" "0" "99" "11" "57381929" "57381929" "subst" "0" "03256" "SERPING1_000626" "g.57381929T>C" "6.195e-7" "{DOI:Blanch 2002:10.1002/humu.9073}" "" "" "Variant at residue P7. The identity of residues P8-P7 in the RCL appears to determine whether the serpin is a functional protease inhibitor or not. \r\np.(Ser460Pro) bioinformatic scores: intolerant by SIFT, pathogenic by PolyPhen, polymorphic by MutationTaster.\r\nIntroduced in ClinVar as likely pathogenic by InVitae, San Francisco CA.\r\nIntroduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "rs2135328049" "0" "" "" "g.57614456T>C" "{CV-SCV:002178465.2}" "likely pathogenic" "ACMG"
"0000598357" "0" "99" "11" "57381932" "57381932" "subst" "0" "03256" "SERPING1_000627" "g.57381932G>C" "" "{DOI:Bygum 2011:10.1111/j.1398-9995.2010.02456.x}" "" "" "Variant at the P6 residue of the RCL.\r\nde novo proband recognized by C1-INH function." "Germline/De novo (untested)" "yes" "" "0" "" "" "g.57614459G>C" "" "likely pathogenic" "ACMG"
"0000598358" "0" "77" "11" "57381933" "57381933" "subst" "0" "03256" "SERPING1_000628" "g.57381933C>T" "" "{PMID:Bissler 1997:9069585} {DOI:Zahedi 2001:10.4049/jimmunol.167.3.1500}" "" "" "Ala439 is located at the P6 position within the RCL; the assumption that Ala439Val is responsible for C1-INH deficiency is supported by the observation of an Ala to Val transition in Antithrombin III, SERPINC1, which also contains an Ala at P6, and that it likewise results in ATIII deficiency with recurrent thrombosis.\r\nRate constants of C1-INHAla439 display only a moderate decrease in control of C1s protease." "Germline" "" "" "0" "" "" "g.57614460C>T" "" "VUS" "ACMG"
"0000598359" "3" "99" "11" "57381936" "57381936" "subst" "0" "03256" "SERPING1_000629" "g.57381936T>G" "0.000020 (5/251312, GnomAD_exome); 0.000025 (3/121282, ExAC)" "{DOI:Blanch 2006:10.1016/j.jaci.2006.07.035}" "" "c.1576T>G" "Variant at residue P5 within RCL functional sequence.\r\nVariant p.(Ile462Ser) affects control of both C1s protease and kallikrein in plasma samples of homozygous and heterozygous carriers.\r\nIle440 is a critical residue for serpin function because of a hydrophobic S5 pocket formed between Val600 of C1s and around the bulky P5 Ile440.\r\np.(Ile462Ser) bioinformatic scores: intolerant by SIFT, benign by PolyPhen, polymorphic by MutationTaster.\r\nIntroduced in ClinVar as pathogenic by OMIM.\r\nIntroduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "rs763451792" "0" "" "" "g.57614463T>G" "{CV:000487524}" "pathogenic (recessive)" "ACMG"
"0000598383" "0" "99" "11" "57381948" "57381948" "subst" "0" "03256" "SERPING1_000630" "g.57381948G>T" "" "{PMID:Frangi 1992:1451784} {PMID:Bissler 1997:9069585}{DOI:Zuraw 2000:10.1067/mai.2000.104780} {DOI:Pappalardo 2000:10.1067/mai.2000.110471} {DOI:Blanch 2002:10.1002/humu.9073} {DOI:Xu 2012:10.1111/all.12024} {DOI:Yamamoto 2012:10.1097/MAJ.0b013e31822bdb65} {DOI:Suffritti 2014:10.1111/cea.12293} {DOI:Liu 2019:10.1684/ejd.2018.3487} {DOI:Hishimura 2021:10.1111/all.15034} {DOI:Shapero 2021:10.1016/j.anai.2021.08.258} {DOI:Wang 2022:10.1186/s41065-022-00242-z} {DOI:Markocsy 2024:10.1016/j.waojou.2024.100885} {DOI:Ferriani 2025:10.1016/j.jaip.2025.08.026}" "" "167789G>T (traditional)" "Highly recurrent variant.\r\nMissense variants of the same Arg444 residue (p.Arg466Cys/Ser/Pro/Leu/Gly) disrupt the Arg P1 position of the RCL and subsequently the control of Ser-protease targets.\r\nThe Italian proband sample exhibits a high level of circulating cleaved HK species, with 53.1% of total HK, in line with an activation of kallikrein-kinin system." "De novo" "yes" "rs121907948" "0" "" "" "g.57614475G>T" "{CV:000068247}" "pathogenic" "ACMG"
"0000598384" "0" "99" "11" "57381948" "57381948" "subst" "0" "03256" "SERPING1_000631" "g.57381948G>C" "0.00000" "{DOI:Blanch 2002:10.1002/humu.9073}" "" "" "Missense variants of the same Arg444 residue (p.Arg466Cys/Ser/Pro/Leu/Gly) disrupt the Arg P1 position of the RCL and subsequently the control of Ser-protease targets." "Germline" "yes" "rs121907948" "0" "" "" "g.57614475G>C" "{CV:000426171}" "pathogenic" "ACMG"
"0000598385" "0" "99" "11" "57381950" "57381950" "subst" "0" "03256" "SERPING1_000632" "g.57381950A>C" "" "{PMID:Ocejo-Vinyals 1995:8529136}" "" "" "First molecular defect at the P1\' position of the serpin\r\nVariant at Thr445 affects the strategic function of target protease recognition in a Michaelis intermediate complex\r\nConsidered pathogenic in line with ACMG criteria PS3, PS4, PM1, PM2, PP1, PP4, PP5" "Germline" "yes" "" "0" "" "" "g.57614477A>C" "" "pathogenic" "ACMG"
"0000598386" "0" "33" "11" "57381971" "57381971" "subst" "0" "03256" "SERPING1_000633" "g.57381971C>G" "" "{PMID:Verpy 1996:8755917} {PMID:Bissler 1997:9069585}" "" "c.[1420C>G;1442T>G]" "Verpy 1996: c.1420C>G variant associated with HAE when found in cis with a pathogenic variant p.(Leu481Arg).\r\nIntroduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "" "" "0" "" "" "g.57614498C>G" "" "likely benign" ""
"0000598397" "0" "99" "11" "57381971" "57381971" "subst" "0" "03256" "SERPING1_000634" "g.57381971C>T" "" "{DOI:Speletas 2015:10.1016/j.jaci.2014.08.007} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Wang 2022:10.1186/s41065-022-00242-z} {DOI:Grombirikova 2023:10.1007/s10875-023-01565-w} {DOI:Arias-Flórez 2024:10.1371/journal.pone.0311316.t001}" "" "" "The molecular variant promotes the insertion of the RCL into the central beta-sheet, mimicking the latent form of the protein, meeting ACMG criteria PVS1, PS4, PM2, and PP5.\r\nClinVar: recognized as Pathogenic by Department of Immunology and Histocompatibility University of Thessaly, with the ACMG criteria: PVS1, PM2, PM4, PP1, PP4, and as pathogenic by InVitae, San Francisco CA." "Germline" "yes" "rs1565174105" "0" "" "" "g.57614498C>T" "{CV:000626354}" "pathogenic" "ACMG"
"0000598398" "0" "99" "11" "57381978" "57381978" "subst" "0" "03256" "SERPING1_000635" "g.57381978C>G" "" "{DOI:Ponard 2019:10.1002/humu.23917} {DOI:Troldborg 2024:10.1016/j.jaci.2024.03.028}" "" "" "Pro454 is a highly conserved residue among serpins (98%); localized in loop s1C/s4B; gate, hinge; it forms tight turn and the RCL flips for its insertion around this residue; packs against conserved position in s4C (Phe291)." "Germline" "yes" "" "0" "" "" "g.57614505C>G" "" "pathogenic" "ACMG"
"0000598399" "0" "99" "11" "57381981" "57381981" "subst" "0" "03256" "SERPING1_000636" "g.57381981T>C" "" "{DOI:Verpy 1995:10.1172/JCI117663} {DOI:Eldering 1995:10.1074/jbc.270.6.2579} {PMID:Verpy 1996:8755917}" "" "" "Phe455 residue is highly conserved among serpins (97%).\r\nPhe455 located in the gate, in a buried hydrophobic area; it packs against conserved positions native Phe291, Ile335, Val337 and Val473; corresponding position with Phe370 in A1AT.\r\np.(Phe455Ser) displays a tendency to form multimers, with both native (predominant) and multimeric forms of similar size as with p.(Phe476Ser).\r\nThe c.1430T>C variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PP3_Str, PP4_Str, PS3_Sup, PM2_Sup, PP2.\r\nIntroduced in the Lung SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "" "0" "" "" "g.57614508T>C" "{CV-SCV:005088205.1}" "pathogenic" "ACMG"
"0000598400" "0" "99" "11" "57381982" "57381982" "subst" "0" "03256" "SERPING1_000637" "g.57381982C>A" "" "{DOI:Cagini 2016:10.1515/hsz-2015-0222} {DOI:Veronez 2019:10.3389/fmed.2019.00028} {DOI:Veronez 2021:10.1016/j.jaip.2020.11.039}" "" "" "Phe455 residue is highly conserved among serpins (97%).\r\nPhe455 located in the sheet 4B, gate functional region, in a buried hydrophobic area; it packs against conserved positions native Phe291, Ile335, Val337 and Val473; corresponding position with Phe370 in A1AT" "De novo" "yes" "" "0" "" "" "g.57614509C>A" "" "pathogenic" "ACMG"
"0000598401" "0" "99" "11" "57381982" "57381982" "subst" "0" "03256" "SERPING1_000638" "g.57381982C>G" "" "{DOI:Maia 2019:10.1111/all.13699} {DOI:Hashimura 2021:10.1111/all.15034} {DOI:Ferriani 2025:10.1016/j.jaip.2025.08.026}" "" "" "Phe455 residue is highly conserved among serpins (97%).\r\nPhe455 located in the gate, in a buried hydrophobic area; it packs against conserved positions native Phe291, Ile335, Val337 and Val473; corresponding position with Phe370 in A1AT.\r\nc.1431C>G variant meets ACMG criteria to be considered likely pathogenic PS1, PM1, PM2, PP3.\r\nIntroduced in ClinVar as likely pathogenic by Al Jalila Childrens Speciality Hospital, Dubai United Arab Emirates" "Germline" "yes" "" "0" "" "" "g.57614509C>G" "{CV-SCV:005420903.1}" "likely pathogenic" "ACMG"
"0000598402" "0" "77" "11" "57381986" "57381986" "subst" "0" "03256" "SERPING1_000639" "g.57381986T>C" "" "{DOI:Bowen 2001:10.1006/clim.2000.4947}" "" "" "Introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "" "" "0" "" "" "g.57614513T>C" "" "pathogenic" ""
"0000598403" "0" "99" "11" "57382010" "57382010" "subst" "0" "03256" "SERPING1_000640" "g.57382010A>T" "" "{DOI:Martinho 2013:10.1016/j.molimm.2012.09.003}" "" "" "Variant introduced in ClinVar Database as pathogenic by LabCorp Genetics, San Francisco CA" "Germline" "yes" "" "0" "" "" "g.57614537A>T" "{CV-SCV:007374465.1}" "pathogenic" ""
"0000598404" "0" "99" "11" "57382020" "57382020" "subst" "0" "03256" "SERPING1_000641" "g.57382020T>A" "" "{DOI:Blanch 2002:10.1002/humu.9073}" "" "" "Val448 residue in a conserved position among serpins (80%).\r\nLocation in the shutter, in a buried hydrophobic area; Val448 forms β-bulge in s5B, packs against conserved position in s6B (Ser148)" "Germline" "yes" "" "0" "" "" "g.57614547T>A" "" "pathogenic" ""
"0000598405" "0" "99" "11" "57382026" "57382026" "subst" "0" "03256" "SERPING1_000642" "g.57382026T>A" "" "{DOI:Bowen 2001:10.1006/clim.2000.4947} {DOI:Suffritti 2014:10.1111/cea.12293} {DOI:Cicardi 2016:10.1016/j.jaci.2016.10.044} {DOI:Hashimura 2021:10.1111/all.15034}" "" "16867T>A (traditional)" "One Italian female proband sample exhibits a high level of circulating cleaved HK species, with 66.0% of total HK, in line with an activation of kallikrein-kinin system." "Germline" "yes" "" "0" "" "" "g.57614553T>A" "" "pathogenic" "ACMG"
"0000598406" "0" "55" "11" "57382026" "57382026" "subst" "4.0659E-6" "03256" "SERPING1_000643" "g.57382026T>C" "0.000003982 (gnomAD) 0.00001 (TOPMed)" "Institut für Humangenetik Universität Würzburg" "" "" "" "Germline" "" "rs978962357" "0" "" "" "g.57614553T>C" "{CV:000427759}" "likely pathogenic" ""
"0000598407" "0" "99" "11" "57382028" "57382028" "subst" "0" "03256" "SERPING1_000644" "g.57382028G>A" "" "{PMID:Sugiyama 2001:11315937} {DOI:Martinho 2013:10.1016/j.molimm.2012.09.003} {DOI:Hashimura 2021:10.1111/all.15034}" "" "" "Gly471 residue located in a highly conserved position among serpins (89%).\r\nLocated within the sheet 5B, shutter domain; a Gly to Arg transition might be expected to disrupt the shutter serpin function.\r\nVariant similar to the c.1477G>C, p.(Gly493Arg) variation, also characterized as a pathogenic variant." "De novo" "yes" "" "0" "" "" "g.57614555G>A" "" "pathogenic" "ACMG"
"0000598408" "0" "99" "11" "57382028" "57382028" "subst" "0" "03256" "SERPING1_000645" "g.57382028G>C" "" "{DOI:Bafunno 2014:10.1111/ahg.12052} {DOI:Nabilou 2020:10.1080/08820139.2020.1817068}" "" "" "Gly471 residue located in a highly conserved position among serpins (89%); homologous to mouse and rat sequences.\r\nShutter domain - beta-strand." "Germline" "yes" "" "0" "" "" "g.57614555G>C" "" "pathogenic" ""
"0000598409" "0" "99" "11" "57382029" "57382029" "subst" "0" "03256" "SERPING1_000646" "g.57382029G>A" "" "{DOI:Blanch 2002:10.1002/humu.9073} {DOI:Kalmár 2003:10.1002/humu.9202} {DOI:Bors 2013:10.1016/j.jaci.2012.11.015} {DOI:Bafunno 2014:10.1111/ahg.12052} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Guryanova 2019:10.29235/1814-6023-2019-16-3-349-356} {PMID:Guryanova 2021:33827715} {DOI:Loli-Ausejo 2021:10.1007/s12016-021-08834-9} {DOI:Hashimura 2021:10.1111/all.15034} {DOI:Mak 2025:10.1111/cea.70001} {DOI:Horváth 2026:10.1515/bmc-2025-0060}" "" "" "Gly471 residue located in a highly conserved position among serpins (89%).\r\nLocalisation in the β-sheet 5B (shutter functional domain); strategic position for shutter function likely disrupted by an introduction of a negatively charged Glu residue. \r\nIt has been classified within class III of the SERPING1 missense variants.\r\nThe c.1478G>A variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PP3_Str, PP4_Str, PS4_Mod, PM2_Sup" "Germline" "yes" "" "0" "" "" "g.57614556G>A" "{CV-SCV:005093795.2}" "pathogenic" "ACMG"
"0000598410" "0" "99" "11" "57382039" "57382039" "subst" "0" "03256" "SERPING1_000647" "g.57382039T>G" "" "{DOI:Grivčeva-Panovska 2018:10.1080/07853890.2018.1449959}" "" "" "Variant absent in unaffected relatives or controls" "Germline" "yes" "" "0" "" "" "g.57614566T>G" "" "pathogenic" ""
"0000598411" "0" "99" "11" "57382043" "57382043" "subst" "0" "03256" "SERPING1_000648" "g.57382043C>T" "" "{DOI:Verpy 1995:10.1172/JCI117663} {DOI:Eldering 1995:10.1074/jbc.270.6.2579} {DOI:Roem 1995:10.1074/jbc.270.6.2579} {PMID:Verpy 1996:8755917} {DOI:Gösswein 2008:10.1159/000138883} {DOI:Liu 2019:10.1684/ejd.2018.3487} {DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "" "Pro476 residue located in a highly conserved position among serpins (96%).\r\nLocation in the distal hinge, in a buried hydrophobic area; in native structure Pro476 packs against conserved positions in s4C (Phe291), s3C (Val300) and s2C (Pro377).\r\nVariant shown with multimerization capacity.\r\nThe c.1492C>T variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PP3_Str, PS4_Mod, PM2_Sup, PS3_Sup, PP4, PP2." "Germline" "yes" "rs1945518132" "0" "" "" "g.57614570C>T" "{CV-SCV:005073699.1}" "pathogenic" "ACMG"
"0000598412" "0" "99" "11" "57379241" "57379241" "subst" "0" "03256" "SERPING1_000649" "g.57379241C>T" "" "{DOI:Ono 1996:10.1007/s004390050238} {DOI:Ishii 1996:10.1111/j.1365-2133.1996.tb06980.x} {DOI:Rodríguez 2018:10.1007/s10875-018-0491-1} {DOI:Loli‐Ausejo 2021:10.1007/s12016-021-08834-9} {DOI:Hashimura 2021:10.1111/all.15034}" "" "" "Recurrent variant.\r\nIntroduced in ClinVar by Genetic Services Laboratory, University of Chicago.\r\nVariant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "rs2495452285" "0" "" "" "g.57611768C>T" "{CV-SCV:003840038.1}" "pathogenic" "ACMG"
"0000598413" "0" "99" "11" "57379317" "57379317" "del" "0" "03256" "SERPING1_000650" "g.57379317del" "" "{DOI:Yamamoto 2012:10.1097/MAJ.0b013e31822bdb65} {DOI:Hashimura 2021:10.1111/all.15034}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57611844del" "" "pathogenic" "ACMG"
"0000598414" "0" "99" "11" "57379216" "57379216" "dup" "0" "03256" "SERPING1_000651" "g.57379216dup" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Yamamoto 2012:10.1097/MAJ.0b013e31822bdb65} {DOI:Hashimura 2021:10.1111/all.15034}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57611743dup" "" "pathogenic" "ACMG"
"0000598415" "11" "99" "11" "57367369" "57367439" "del" "0" "03256" "SERPING1_000652" "g.57367369_57367439del" "" "{DOI:Yu 2007:10.1016/S1081-1206(10)60557-1}" "" "" "Erroneously identified as a c.3_73del;p.(Asn1fs*34) variant by Yu et al 2007.\r\nIdentified as c.67_137del in IDbases\r\nGonadal mosaicism in a family in which both brothers, but not the parents, show clinical and laboratory findings typical of HAE, with allele segregation demonstrated using Sanger sequencing.\r\nc.69_139del variant not detected in DNA derived from lymphocytes from the father and the mother, whereas present on the DNA prepared from the sperm of the father." "Uniparental disomy, paternal allele" "yes" "" "0" "" "" "g.57599896_57599966del" "" "pathogenic" "ACMG"
"0000598416" "0" "99" "11" "57381974" "57381974" "subst" "0" "03256" "SERPING1_000653" "g.57381974C>T" "" "{DOI:Speletas 2015:10.1016/j.jaci.2014.08.007} {DOI:Andrejević 2015:10.1371/journal.pone.0142174} {DOI:Wang 2022:10.1186/s41065-022-00242-z} {DOI:Szabo 2022:10.3389/falgy.2022.836465}" "" "" "The c.1423C>T variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PP4_Str, PVS1_Mod, PS4_Mod, PM2_Sup, PP1.\r\nSubmitted to ClinVar as pathogenic by Research Centre For Medical Genetics, Moscow Russia" "Germline" "yes" "" "0" "" "" "g.57614501C>T" "{CV-SCV:005061823.1}" "pathogenic" "ACMG"
"0000598417" "0" "99" "11" "57382043" "57382043" "subst" "0" "03256" "SERPING1_000654" "g.57382043C>A" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "" "Pro476 is a highly conserved residue among serpins (95%); located in the hinge C-terminus, in the gate structure and in a buried hydrophobic area; in native structure packs against conserved positions in s4C (Phe291), s3C (Val300) and s2C (Pro377)" "Germline" "yes" "" "0" "" "" "g.57614570C>A" "" "pathogenic" "ACMG"
"0000598421" "0" "99" "11" "57379395" "57379395" "subst" "0" "03256" "SERPING1_000655" "g.57379395T>A" "" "{DOI:Yokoyama 2019:10.1016/j.alit.2019.07.005} {DOI:Hashimura 2021:10.1111/all.15034} {DOI:Ohzono 2026:10.1111/1346-8138.70320}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57611922T>A" "" "pathogenic" "ACMG"
"0000598422" "0" "99" "11" "57367623" "57367623" "dup" "0" "03256" "SERPING1_000656" "g.57367623dup" "" "{DOI:Bowen 2001:10.1006/clim.2000.4947}" "" "" "Variant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "" "" "0" "" "" "g.57600150dup" "" "pathogenic" "ACMG"
"0000598423" "0" "99" "11" "57373879" "57373879" "subst" "0" "03256" "SERPING1_000657" "g.57373879A>G" "" "{DOI:Bowen 2001:10.1006/clim.2000.4947} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Guryanova 2019:10.29235/1814-6023-2019-16-3-349-356} {DOI:Guryanova 2021:10.1186/s12948-021-00141-0} {DOI:Jia 2022:10.3760/cma.j.cn115330-20211209-00789}" "" "" "c.890-2A>G variant is likely to affect the canonical acceptor splice site, with subsequent exon(s) skipping" "Germline" "yes" "" "0" "" "" "g.57606406A>G" "" "pathogenic" "ACMG"
"0000598424" "0" "99" "11" "57365721" "57365721" "subst" "0" "03256" "SERPING1_000137" "g.57365721G>A" "" "{PMID:Verpy 1996:8755917} {DOI:Gösswein 2008:10.1159/000138883} {DOI:Rijavec 2013:10.1371/journal.pone.0056712} {DOI:Andrejević 2015:10.1371/journal.pone.0142174} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "" "Recurrent variant\r\nVariant that affects intron 1 acceptor splice site, with subsequent partial to complete exon 2 skipping.\r\nIntroduced in ClinVar as pathogenic by Research Centre for Medical Genetics, Moscow Russia, indicating variant c.-22-1G>A meets ACMG/ClinGen criteria to be classified as pathogenic: PVS1, PP4_Str, PS4_Mod, PM2_Sup." "Germline" "yes" "rs2495420852" "0" "" "" "g.57598248G>A" "{CV-SCV:005077924.1}" "pathogenic" "ACMG"
"0000598425" "0" "99" "11" "57365793" "57365800" "del" "0" "03256" "SERPING1_000660" "g.57365793_57365800del" "" "{DOI:Roche 2005:10.1002/humu.20197} {DOI:López-Lera 2011:10.1016/j.molimm.2011.07.010}" "" "" "Variant c.50_51+6del deletes both exonic and intronic positions, affecting exons 2 (completely) and 3 (partially) skipping.\r\nRecognized as pathogenic according to ACMG criteria as follows: PVS1, PS3, PM2, PP3, PP4" "Germline" "" "" "0" "" "" "g.57598320_57598327del" "" "pathogenic" "ACMG"
"0000598426" "0" "99" "11" "57365795" "57365795" "subst" "0" "03256" "SERPING1_000661" "g.57365795G>A" "6.400e-7" "{DOI:Kalmár 2003:10.1002/humu.9202} {DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Gösswein 2008:10.1159/000138883} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Kasami 2018:10.1111/1346-8138.14103} {DOI:Jindal 2021:10.1111/PAI.13420} {DOI:Szabó 2022:10.3389/falgy.2022.836465} {DOI:Horváth 2026:10.1515/bmc-2025-0060}" "" "638G>A (traditional)" "c.51+1G>A affects the canonical donor splice site; 0.98 spliceAI; -0.800 Pangolin\r\nFunctional evidence: Disruption of this splice site has been demonstrated to result in exon 2 skipping, subsequently causing a loss of initiator Met residue, frameshift and NMD.\r\nMeets the ACMG criteria PS1, PP4_Mod.\r\nRecurrent variant with an association with HAE.\r\nIntroduced in ClinVar as pathogenic by Labcorp Genetics, San Francisco CA." "Germline" "yes" "rs1470120365" "0" "" "" "g.57598322G>A" "{CV-SCV:002154189.2}" "pathogenic" "ACMG"
"0000598427" "0" "99" "11" "57365795" "57365795" "subst" "0" "03256" "SERPING1_000662" "g.57365795G>T" "" "{DOI:Yamamoto 2012:10.1097/MAJ.0b013e31822bdb65} {DOI:Cagini 2016:10.1515/hsz-2015-0222} {DOI:Veronez 2019:10.3389/fmed.2019.00028} {DOI:Hashimura 2021:10.1111/all.15034} {DOI:Veronez 2021:10.1016/j.jaip.2020.11.039}" "" "" "Recurrent variant\r\nc.51+1G>T variant affects donor splice site\r\nMeets ACMG criteria to be considered as pathogenic: PVS1, PP4_Str, PS4_Mod, PS1_Sup, PM2_Sup, PP3." "Germline" "yes" "rs1470120365" "0" "" "" "g.57598322G>T" "{CV-SCV:005068178.1}" "pathogenic" "ACMG"
"0000598428" "0" "99" "11" "57365796" "57365796" "subst" "0" "03256" "SERPING1_000663" "g.57365796T>C" "6.412e-7" "{DOI:Cagini 2016:10.1515/hsz-2015-0222} {DOI:Veronez 2019:10.3389/fmed.2019.00028} {DOI:Nabilou 2020:10.1080/08820139.2020.1817068} {DOI:Veronez 2021:10.1016/j.jaip.2020.11.039} {DOI:Ferriani 2025:10.1016/j.jaip.2025.08.026}" "" "" "Recurrent variant\r\nc.51+2T>C variant affects the canonical donor splice site" "Germline" "yes" "" "0" "" "" "g.57598323T>C" "" "pathogenic" "ACMG"
"0000598431" "0" "99" "11" "57367350" "57367350" "del" "0" "03256" "SERPING1_000664" "g.57367350del" "" "{DOI:Pappalardo 2000:10.1067/mai.2000.110471}" "" "" "Variant c.52-2delA affects the canonical acceptor site" "De novo" "" "" "0" "" "" "g.57599877del" "" "pathogenic" "ACMG"
"0000598432" "0" "99" "11" "57367350" "57367350" "subst" "0" "03256" "SERPING1_000156" "g.57367350A>G" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Miguel Berenguel 2024:10.3389/fimmu.2024.1499415}" "" "2194A>G (traditional)" "c.52-2A>G variant affects the canonical acceptor site.\r\nMeets ACMG/ClinGen criteria to be classified as pathogenic: PVS1, PP4_Str, PS4_Mod, PM2_Sup" "De novo" "yes" "rs2495424954" "0" "" "" "g.57599877A>G" "{CV-SCV:005088168.1}" "pathogenic" "ACMG"
"0000598451" "0" "99" "11" "57367851" "57367851" "subst" "0" "03256" "SERPING1_000665" "g.57367851G>A" "" "{DOI:Kalmár 2003:10.1002/humu.9202} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Szabó 2022:10.3389/falgy.2022.836465} {DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "" "c.550+1G>A affects the canonical donor splice site\r\nRecurrent variant. \r\nThe c.550+1G>A variant meets ACMG/ClinGen criteria to be classified as pathogenic: PVS1, PP4_Str, PS4_Mod, PS1_Sup, PM2_Sup. It has been submitted to ClinVar as pathogenic by RCMG Research Centre For Medical Genetics, Moscow Russia" "Germline" "yes" "rs2135308859" "0" "" "" "g.57600378G>A" "{CV-SCV:005068171.1}" "pathogenic" "ACMG"
"0000598452" "0" "99" "11" "57367852" "57367852" "subst" "0" "03256" "SERPING1_000666" "g.57367852T>C" "" "{DOI:Roche 2005:10.1002/humu.20197} {DOI:Speletas 2015:10.1016/j.jaci.2014.08.007} {DOI:Pedrosa 2016:10.1007/s10875-015-0222-9} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Guryanova 2019:10.29235/1814-6023-2019-16-3-349-356} {DOI:Guryanova 2021:10.1186/s12948-021-00141-0}" "" "" "c.550+2T>C variant affects the canonical donor splice site.\r\nHighly recurrent variant.\r\nHAE familly from Spain presenting with a de novo proband." "De novo" "yes" "rs112666115" "0" "" "" "g.57600379T>C" "{CV-SCV:003439866.1}" "pathogenic" "ACMG"
"0000598453" "0" "99" "11" "57367852" "57367852" "dup" "0" "03256" "SERPING1_000667" "g.57367852dup" "" "{DOI:Kalmár 2003:10.1002/humu.9202} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Szabó 2022:10.3389/falgy.2022.836465} {DOI:Troldborg 2024:10.1016/j.jaci.2024.03.028} {DOI:Horváth 2026:10.1515/bmc-2025-0060}" "" "2696_2697insT" "c.550+2dupT shifts the sequence of the intron 3 splice donor site and destroys the canonical donor splice sequence. The Neural Network Splice Site Prediction program did not predict any splice donor site in the affected region of c.550+2dup with a probability value of 0.1. \r\nc.550+2dup alters the donor splice sequence and predicts a defect in the mRNA maturation." "Germline" "yes" "" "0" "" "" "g.57600379dup" "" "likely pathogenic" "ACMG"
"0000598454" "0" "99" "11" "57367855" "57367855" "subst" "0" "03256" "SERPING1_000668" "g.57367855G>C" "" "{DOI:Roche 2005:10.1002/humu.20197} {DOI:Klausegger 2012:10.1038/bmt.2012.7} {DOI:Pedrosa 2016:10.1007/s10875-015-0222-9} {DOI:Loli‐Ausejo 2021:10.1007/s12016-021-08834-9} {DOI:Miguel Berenguel 2025:10.3389/fimmu.2024.1499415}" "" "" "Loss of relatively conserved G residue (80% conservation) at donor splice site that might affect the canonical donor splice site.\r\nThe variant has been reported in multiple affected individuals. Low C1-INH expression and impaired function support the\r\nmolecular defect; the Alamut software - Interactive BioSoftware, Rouen - indicates that four predictors forecast the loss of the canonical splicing sequence." "Germline" "yes" "" "0" "" "" "g.57600382G>C" "" "pathogenic" "ACMG"
"0000598455" "0" "99" "11" "57367855" "57367855" "subst" "4.11188E-6" "03256" "SERPING1_000669" "g.57367855G>A" "6.203e-7" "{DOI:Roche 2005:10.1002/humu.20197} {DOI:de la Cruz 2011:10.1016/j.imlet.2011.07.011} {DOI:Klausegger 2012:10.1038/ bmt.2012.7;} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Szabó 2022:10.3389/falgy.2022.836465}" "" "" "Loss of relatively conserved G residue (80% conservation) at donor splice site that could affect the canonical donor splice site, with subsequent exon 3 skipping.\r\nThe c.550+5G>A variant in SERPING1 meets ACMG/ClinGen criteria to be classified as pathogenic: PP4_Str, PS1_Mod, PS4_Mod, PM2_Sup, PP3. Research Centre for Medical Genetics, Moscow Russia, considers c.550+5G>A variant as pathogenic without the PVS1 criterion" "Germline" "yes" "rs1314284778" "0" "" "" "g.57600382G>A" "{CV-SCV:005062173.1}" "pathogenic" "ACMG"
"0000598457" "0" "99" "11" "57369500" "57369515" "del" "0" "03256" "SERPING1_000670" "g.57369500_57369515del" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "" "Deletion comprising polypyrimidin truct" "Germline" "yes" "" "0" "" "" "g.57602027_57602042del" "" "pathogenic" "ACMG"
"0000598459" "0" "99" "11" "57369503" "57369503" "subst" "0" "03256" "SERPING1_000672" "g.57369503T>A" "" "{DOI:Gösswein 2008:10.1159/000138883} {DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Drouet 2022:10.3389/falgy.2022.835503}" "" "4346T>A (traditional)" "Noncanonical substitution. Acceptor splicing site loss." "Germline" "yes" "" "0" "" "" "g.57602030T>A" "" "pathogenic" "ACMG"
"0000598460" "0" "99" "11" "57369505" "57369505" "subst" "0" "03256" "SERPING1_000673" "g.57369505C>G" "" "{DOI:Gösswein 2008:10.1159/000138883}" "" "" "c.551-3C>G variant near the canonical acceptor site, with possible splicing defect" "Germline" "yes" "" "0" "" "" "g.57602032C>G" "" "pathogenic" ""
"0000598461" "0" "99" "11" "57369506" "57369506" "subst" "0" "03256" "SERPING1_000674" "g.57369506A>G" "" "{DOI:Gösswein 2008:10.1159/000138883} {DOI:Grodecká 2017:10.1016/j.clim.2017.03.010} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Förster 2021:10.1186/s13023-021-02021-x} {DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "" "" "Recurrent variant.\r\nc.551-2A>G variant has been demonstrated to affect the acceptor splice site, with subsequent skipping of exon 4 (Grodecká 2017) and putative expression of p.Gly184_Pro228del and/or p.Ala185 Leufs*54.\r\nConsidered pathogenic with the ACMG criteria PVS1, PS2_Str, PS4_Mod, PM2." "De novo" "yes" "" "0" "" "" "g.57602033A>G" "{CV-SCV:007299013.1}" "pathogenic" "ACMG"
"0000598462" "0" "99" "11" "57369506" "57369506" "del" "0" "03256" "SERPING1_000675" "g.57369506del" "" "{DOI:Roche 2005:10.1002/humu.20197} {DOI:Bafunno 2014:10.1111/ahg.12052} {DOI:Ponard 2019:10.1002/humu.23917}" "" "" "c.551-2delA variant affects the canonical acceptor splice site. 0.99 spliceAI.\r\nFunctional evidence by total RNA analysis demonstrates exon 4 skipping." "Germline" "yes" "rs2135311220" "0" "" "" "g.57602033del" "{CV-SCV:002279647.2}" "pathogenic" "ACMG"
"0000598463" "0" "99" "11" "57369507" "57369507" "dup" "0" "03256" "SERPING1_000676" "g.57369507dupG" "" "{DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "c.551-2insG" "c.551-1dupG variant is likely to affect the canonical acceptor splice site, with subsequent exon(s) skipping (not investigated)" "Germline" "yes" "" "0" "" "" "g.57602034dup" "" "pathogenic" "ACMG"
"0000598464" "0" "99" "11" "57369507" "57369507" "subst" "0" "03256" "SERPING1_000677" "g.57369507G>A" "" "{DOI:Speletas 2015:10.1016/j.jaci.2014.08.007} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Guryanova 2019:10.29235/1814-6023-2019-16-3-349-356} {DOI:Guryanova 2021:10.1186/s12948-021-00141-0}" "" "" "c.551-1G>A variant affects the canonical acceptor splice site, with subsequent exon(s) skipping\r\nHAE familly from Belarus presenting with a de novo proband" "De novo" "yes" "rs2135311222" "0" "" "" "g.57602034G>A" "{CV-SCV:003806107.1}" "pathogenic" "ACMG"
"0000598465" "0" "79" "11" "57369507" "57369507" "subst" "0" "03256" "SERPING1_000678" "g.57369507G>C" "" "{DOI:Guryanova 2019:10.29235/1814-6023-2019-16-3-349-356} {DOI:Guryanova 2021:10.1186/s12948-021-00141-0} {DOI:Hashimura 2021:10.1111/all.15034}" "" "" "c.551-1G>C variant likely affects the canonical acceptor splice site" "Germline" "yes" "rs2135311222" "0" "" "" "g.57602034G>C" "{CV-SCV:002156802.2}" "pathogenic" "ACMG"
"0000598466" "0" "99" "11" "57369642" "57369642" "del" "0" "03256" "SERPING1_000679" "g.57369642del" "" "{DOI:Grodecká 2017:10.1016/j.clim.2017.03.010}" "" "" "c.685delG variant has been demonstrated to affect the function of donor splice site, with subsequent skipping of exon 4 and exons 4 + 5 and putative expression of p.(Gly184_Pro228del);p.Gly217_Pro228del);p.(Asp229Thrfs*4);p.(Asp229Valfs*48) (Grodecká 2017)." "Germline" "" "" "0" "" "" "g.57602169del" "" "pathogenic" "ACMG"
"0000598467" "0" "99" "11" "57369643" "57369643" "subst" "0" "03256" "SERPING1_000680" "g.57369643G>A" "" "{DOI:Gösswein 2008:10.1159/000138883} {DOI:Xu 2012:10.1111/all.12024} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Liu 2019:10.1684/ejd.2018.3487} {DOI:Loli‐Ausejo 2021:10.1007/s12016-021-08834-9} {DOI:Ferriani 2025:10.1016/j.jaip.2025.08.026}" "" "" "c.685+1G>A variant affects the canonical donor splice site, with a subsequent probable skipping of exons 4 and 5.\r\nIt meets the ACMG criteria as pathogenic as follows PVS1, PS4, PM2. Sumitted to ClinVar as pathogenic by Centre for Human Genetics Tübingen Germany" "Germline" "yes" "rs113263597" "0" "" "" "g.57602170G>A" "{CV:VCV001459234.1}" "pathogenic" "ACMG"
"0000598468" "0" "99" "11" "57369643" "57369643" "subst" "0" "03256" "SERPING1_000681" "g.57369643G>T" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Suffritti 2014:10.1111/cea.12293} {DOI:Liu 2017:10.1016/j.jfma.2017.04.016} {DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "4486G>T (traditional)" "c.685+1G>T variant likely affects the canonical donor splice site, with subsequent probable skipping of exons 4 and 5.\r\nItalian patient samples exhibit a high level of circulating cleaved HK species, with 45.2% and 51.6% of total HK.\r\nIntroduced as pathogenic in ClinVar by InVitae, San Francisco CA" "Germline" "yes" "rs113263597" "0" "" "" "g.57602170G>T" "{CV-SCV:002182636.2}" "pathogenic" "ACMG"
"0000598469" "0" "99" "11" "57369644" "57369644" "subst" "0" "03256" "SERPING1_000682" "g.57369644T>A" "" "{DOI:Colobran 2014:10.1016/j.clim.2013.11.013}" "" "" "c.685+2T>A variant has been demonstrated to partially affect the canonical donor splice site, with subsequent partial (50%) exon 4 skipping.\r\nIntroduced in ClinVar as pathogenic by LabCorp Genetics San Francisco CA." "Germline" "yes" "" "0" "" "" "g.57602171T>A" "{CV-SCV:005836086.1}" "pathogenic" "ACMG"
"0000598476" "0" "99" "11" "57369644" "57369644" "subst" "0" "03256" "SERPING1_000683" "g.57369644T>G" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Bafunno 2014:10.1111/ahg.12052}" "" "" "c.685+2T>G variant affects the canonical donor splice site in intron 4 of the SERPING1 gene , with subsequent expected to disrupt RNA splicing.\r\nOther variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function, and loss-of-function variants in SERPING1 are known to be pathogenic.\r\nSubmitted to ClinVar as pathogenic by InVitae San Francisco CA" "Germline" "yes" "rs111709785" "0" "" "" "g.57602171T>G" "{CV-SCV:002246563.4}" "pathogenic" "ACMG"
"0000598477" "0" "99" "11" "57369644" "57369655" "del" "0" "03256" "SERPING1_000684" "g.57369644_57369655del" "" "{DOI:Grodecká 2017:10.1016/j.clim.2017.03.010} {DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "" "" "c.685+2_685+13del variant affects canonical donor splice site in intron 4, and activation of cryptic intronic sites, with subsequent skipping of exon 4 and exons 4 to 6, as demonstrated by Grodecká 2017.\r\nPredicted donor loss by in silico SpliceAI algorithm." "Germline" "yes" "" "0" "" "" "g.57602171_57602182del" "" "pathogenic" "ACMG"
"0000598478" "0" "71" "11" "57369673" "57369673" "subst" "8.5459E-5" "03256" "SERPING1_000685" "g.57369673G>A" "0.00005143 (gnomAD v4)" "{DOI:Suffritti 2014:10.1111/cea.12293} {DOI:Mormile 2024:0.1007/s12026-024-09501-9}" "" "4516G>A (traditional)" "Potential donor splicing site loss: c.685+31G>A variant must be checked for its responsibility in proband HAE phenotype.\r\nAn Italian proband sample exhibits a level of cleaved HK species, with 61.5% of total HK, consistent with an involvement of kallikrein-kinin system.\r\nAn Italian patient recorded by Mormile 2024 does not show a decreased C1-INH function." "Germline" "" "rs751335805" "0" "" "" "g.57602200G>A" "" "VUS" ""
"0000598479" "0" "99" "11" "57373471" "57373471" "subst" "0" "03256" "SERPING1_000686" "g.57373471A>G" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Andrejević 2015:10.1371/journal.pone.0142174} {DOI:Grodecká 2017:/10.1016/j.clim.2017.03.010} {DOI:Mendoza-Alvarez 2022:10.3389/fimmu.2022.997148} {DOI:Grombirikova 2023:10.1007/s10875-023-01565-w} {DOI:Mendoza-Alvarez 2026:10.21203/rs.3.rs-10662999/v1}" "" "" "c.686-12A>G creates a de novo splice site, with an aberrant transcript, subsequent p.(Asp229Alafs*8) and NMD as demonstrated by Grodecká 2017.\r\nc.686-12A>G variant scored as likely pathogenic according to ACMG criteria: BP4, PS2, PM2, PP1 (supporting), PP3 (supporting), PP4.\r\nPredicted acceptor gain by in silico SpliceAI algorithm.\r\nSubmitted to ClinVar as pathogenic by RCMG Research Centre For Medical Genetics Moscow Russia" "Germline" "yes" "" "0" "" "" "g.57605998A>G" "" "pathogenic" "ACMG"
"0000598480" "0" "99" "11" "57367605" "57367617" "del" "0" "03256" "SERPING1_000687" "g.57367605_57367617del" "" "{DOI:Grodecká 2017:10.1016/j.clim.2017.03.010} {DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "" "" "c.305_317del variant has been demonstrated to affect splice site in a mingene construct, with a decreased exon 3 skipping, with subsequent expression of p.(Asp18Glyfs*26) (NMD?) and an increased down intron retention (Grodecká 2017).\r\nIn patient\'s peripheral blood cells monoallelic expression of the only full-length wt allele.\r\nc.305_317del variant considered as pathogenic in agreement with ACMG criteria PVS1, PS3, PS4, PM2, PP1, PP4.\r\nIdentified as pathogenic by InVitae, San Francisco California" "Germline" "yes" "rs2135308474" "0" "" "" "g.57600132_57600144del" "{CV-SCV:002238547.3}" "pathogenic" "ACMG"
"0000598481" "0" "77" "11" "57369521" "57369526" "dup" "0" "03256" "SERPING1_000688" "g.57369521_57369526dup" "" "{DOI:Grodecká 2017:10.1016/j.clim.2017.03.010}" "" "" "" "Germline" "" "" "0" "" "" "g.57602048_57602053dup" "" "VUS" ""
"0000598482" "0" "99" "11" "57373503" "57373503" "subst" "0" "03256" "SERPING1_000689" "g.57373503T>G" "" "{DOI:Grodecká 2017:10.1016/j.clim.2017.03.010} {DOI:Grombikirova 2023:10.1007/s10875-023-01565-w}" "" "" "Phe214 is a highly conserved position among serpins (75%); it is located at the N-terminus of helix E that plays a crucial role in facilitating the conformation change during the insertion of RCL between S3A and S5A; Phe214 packs against the conserved Gly162.\r\nThe c.706T>G variant in SERPING1 meets ACMG/ClinGen criteria to be classified as pathogenic: PP4_Str, PP3_Str, PM2_Sup, PP2." "Germline" "yes" "rs2495440402" "0" "" "" "g.57606030T>G" "{CV-SCV:005088178.1}" "pathogenic" "ACMG"
"0000598483" "0" "99" "11" "57373888" "57373888" "subst" "0" "03256" "SERPING1_000690" "g.57373888G>A" "" "{DOI:Speletas 2015:10.1016/j.gene.2018.05.029} {DOI:Grodecká 2017:10.1016/j.clim.2017.03.010} {DOI:Veronez 2021:10.1016/j.jaip.2020.11.039} {DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "" "" "c.897G>A bioinformatic score: Disease causing by MutationTaster" "Germline" "yes" "" "0" "" "" "g.57606415G>A" "" "pathogenic" "ACMG"
"0000598488" "0" "77" "11" "57367669" "57367669" "subst" "0" "03256" "SERPING1_000691" "g.57367669C>G" "0.000007" "" "" "" "Recorded in ClinVar from Institute of Human Genetics, University of Würzburg, as VUS.\r\nc.369C>G bioinformatic scores: Disease causing by MutationTaster (0.999), Probably damaging by PolyPhen (0.996) and Intolerant by SIFT" "Germline" "" "rs1465637711" "0" "" "" "g.57600196C>G" "{CV:000689536}" "VUS" ""
"0000598489" "0" "99" "11" "57379362" "57379362" "subst" "0" "03256" "SERPING1_000692" "g.57379362T>A" "" "{DOI:Grodecká 2017:10.1016/j.clim.2017.03.010} {DOI:Sheikh 2023:10.1007/s10875-022-01399-y} {DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "" "" "Biallelic expression of c.1202T>A and wt has been detected in patient\'s blood-derived RNA.\r\np.(Ile401Asn) bioinformatic scores: intolerant (SIFT), pathogenic (PolyPhen), Disease causing (MutationTaster)" "Germline" "yes" "" "0" "" "" "g.57611889T>A" "" "pathogenic" "ACMG"
"0000598490" "0" "59" "11" "57381873" "57381873" "subst" "0" "03256" "SERPING1_000693" "g.57381873T>A" "" "{DOI:Grodecká 2017:10.1016/j.clim.2017.03.010} {DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "" "" "Biallelic expression of c.1322T>A and wt was detected in patient\'s blood-derived RNA.\r\nc.1322T>A bioinformatic scores: Intolerant by SIFT, Pathogenic by PolyPhen, Disease causing by MutationTaster" "Germline" "yes" "" "0" "" "" "g.57614400T>A" "" "likely pathogenic" "ACMG"
"0000598491" "0" "99" "11" "57373480" "57373480" "subst" "0" "03256" "SERPING1_000694" "g.57373480C>G" "" "{DOI:Roche 2005:10.1002/humu.20197} {DOI:Loli-Ausejo 2021:10.1007/s12016-021-08834-9} {DOI:Förster 2021:10.1186/s13023-021-02021-x} {DOI:Szabó 2022:10.3389/falgy.2022.836465}" "" "" "c.686-3C>G variant has been demonstrated to affect acceptor splice site.\r\nTotal RNA analysis: Exon 5 skipping.\r\nSubsequent expression of p.(Asp229_Ser296del), in frame exon 5 deletion" "Germline" "yes" "" "0" "" "" "g.57606007C>G" "" "pathogenic" "ACMG"
"0000598492" "0" "99" "11" "57373687" "57373687" "subst" "0" "03256" "SERPING1_000695" "g.57373687G>T" "" "{DOI:Gösswein 2008:10.1159/000138883}" "" "" "c.889+1G>T variant is likely to affect the canonical donor splice site, with subsequent probable exon 5 skipping" "Germline" "yes" "" "0" "" "" "g.57606214G>T" "" "pathogenic" "ACMG"
"0000598493" "0" "99" "11" "57373688" "57373688" "subst" "0" "03256" "SERPING1_000696" "g.57373688T>C" "" "{DOI:Roche 2005:10.1002/humu.20197} {DOI:Loli-Ausejo 2021:10.1007/s12016-021-08834-9}" "" "" "c.889+2T>C variant has been demonstrated to affect the canonical donor splice site, with a subsequent exon 5 skipping" "Germline" "yes" "" "0" "" "" "g.57606215T>C" "" "pathogenic" "ACMG"
"0000598494" "0" "99" "11" "57373689" "57373689" "" "0" "03256" "SERPING1_000697" "g.[57373689A>G(;)57379413A>G]" "0.00003579(;)- (gnomAD)" "{DOI:Kang 2006:10.1111/j.1398-9995.2006.01010.x}" "" "c.[889+3A>G(;)1249+4A>G]" "Compound heterozygous patients had relatively lower mRNA expression level compared with normal controls. Single heterozygous carriers have not been recorded as affected by a HAE clinical phenotype.\r\nTwo families with heterozygous symptomatic individuals carrying the c.1249+4A>G variant have been recorded by Ponard 2019 and Kanepa 2023.\r\nA heterozygous family carrying a c.889+3A>T has been recorded as presenting with a HAE type I phenotype. c.889+3A>T has been demonstrated to affect the donor splice site with complete exon 5 skipping (Johnsrud 2015)." "Germline" "" "" "0" "" "" "g.[57606216A>G(;)57611940A>G]" "" "likely pathogenic" ""
"0000598496" "0" "99" "11" "57373689" "57373689" "subst" "0" "03256" "SERPING1_000698" "g.57373689A>T" "" "{DOI:Johnsrud 2015:10.1371/journal. pone.0131637}" "" "" "c.889+3A>T variant affects the donor splice site, with subsequent complete skipping of exon 5 maintaining the reading frame with an expected protein expression as p.(Asp229_Ser296)del" "Germline" "yes" "" "0" "" "" "g.57606216A>T" "" "pathogenic" "ACMG"
"0000598497" "0" "99" "11" "57373793" "57373915" "del" "0" "03256" "SERPING1_000699" "g.57373793_57373915del" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007}" "" "" "c.889+107_924del is likely to hit acceptor splice site, with subsequent putative exon 6 skipping" "Germline" "yes" "" "0" "" "" "g.57606320_57606442del" "" "pathogenic" "ACMG"
"0000598498" "0" "99" "11" "57373867" "57373867" "subst" "0" "03256" "SERPING1_000700" "g.57373867C>G" "" "{DOI:Speletas 2015:10.1016/j.jaci.2014.08.007} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "" "c.890-14C>G variant has been used in the forward validation of the SERPING1-NGS platform by Loules 2018.\r\nc.890-14C>G could be considered as a deep intronic alteration that may affect pre-mRNA splicing and possibly contributing to C1-INH-HAE phenotype. Its responsibility in acceptor splicing must be investigated for mRNA species using patient cells.\r\nMeets the ACMG Criteria PM2, PP1, PP2, PP3, PP4 to be considered to be likely pathogenic." "Germline" "yes" "rs2135318127" "0" "" "" "g.57606394C>G" "{CV:VCV001064580.1}" "likely pathogenic" "ACMG"
"0000598499" "0" "99" "11" "57373880" "57373880" "subst" "0" "03256" "SERPING1_000701" "g.57373880G>A" "" "{DOI:Sekijima 2004:10.2169/internalmedicine.43.253} {DOI:Yamamoto 2012:10.1097/MAJ.0b013e31822bdb65}" "" "" "c.890-1G>A variant is likely to affect the canonical acceptor splice site, with subsequent exon 6 skipping and partial intron 5 retention. \r\nSegregation studies of the Spanish family revealed that the asymptomatic mother carried the variant in the form of gonosomal mosaicism." "Germline" "yes" "" "0" "" "" "g.57606407G>A" "{CV-SCV:005439126.1}" "pathogenic" "ACMG"
"0000598501" "0" "99" "11" "57374021" "57374021" "subst" "0" "03256" "SERPING1_000702" "g.57374021G>T" "" "{DOI:Siddique 1991:10.1007/bf00206079}" "" "" "c.1029+1G>T variant is likely to affect the canonical donor splice site, with subsequent exon(s) skipping.\r\nSubmitted to ClinVar as likely pathogenic by InVitae, San Francsico CA" "Germline" "" "rs2495442676" "0" "" "" "g.57606548G>T" "{CV-SCV:004294839.1}" "pathogenic" "ACMG"
"0000598502" "0" "99" "11" "57374021" "57374021" "subst" "0" "03256" "SERPING1_000703" "g.57374021G>A" "" "{DOI:Gösswein 2008:10.1159/000138883} {DOI:Speletas 2015:10.1111/all.12714} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Sheikh 2023:10.1007/s10875-022-01399-y} {DOI:Kurjane 2026:10.3389/fimmu.2026.1696479}" "" "" "Donor splice site loss: c.1029+1G>A variant is likely to affect the canonical donor splice site, with subsequent exon(s) skipping\r\nMeets the ACMG criteria PVS1, PS3, PS4, PM2, PP4" "Germline" "yes" "" "0" "" "" "g.57606548G>A" "" "pathogenic" "ACMG"
"0000598503" "0" "99" "11" "57374024" "57374024" "del" "0" "03256" "SERPING1_000704" "g.57374024del" "" "{DOI:Bygum 2011:10.1111/j.1398-9995.2010.02456.x} {DOI:Veronez 2019:10.3389/fmed.2019.00028}" "" "" "Potential donor splice site loss: c.1029+4delA variant might affect the donor splice site, with putative exon(s) skipping. Human Splicing\r\nFinder (HSF) in silico prediction tool predicts inactivation of\r\nboth splice sites.\r\nThis hypothesis must be confirmed by examination of mRNA species from patient cells." "Germline" "yes" "" "0" "" "" "g.57606551del" "" "likely pathogenic" "ACMG"
"0000598504" "0" "99" "11" "57374023" "57374026" "del" "0" "03256" "SERPING1_000705" "g.57374023_57374026del" "" "{DOI:Gösswein 2008:10.1159/000138883}" "" "" "Donor splice site loss: c.1029+3_1029+6del variant is likely to affect the donor splice site, with subsequent putative exon(s) skipping. This hypothesis must be confirmed by examination of mRNA species from patient cells." "Germline" "yes" "" "0" "" "" "g.57606550_57606553del" "" "pathogenic" "ACMG"
"0000598505" "0" "97" "11" "57374104" "57374104" "subst" "0" "03256" "SERPING1_000706" "g.57374104G>A" "0.0037 (gnomAD)" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Suffritti 2014:10.1111/cea.12293}" "" "8946G>A (traditional)" "c.1029+84G>A variant is a deep intronic variant that has been identified in an Italian symptomatic carrier (Pappalardo 2008) and in a compound heterozygous Colombian proband (Rodríguez & Narváez 2018) as c.[1029+84G>A(;)1396C>G] with a severe phenotype.\r\nAn Italian patient sample exhibits a high level of cleaved circulating HK species, with 55.8% of total HK, consistent with an involvement of kallikrein-kinin system." "Germline" "?" "rs118132731" "0" "" "" "g.57606631G>A" "" "VUS" ""
"0000598506" "0" "99" "11" "57379178" "57379206" "del" "0" "03256" "SERPING1_000707" "g.57379178_57379206del" "" "{PMID:Verpy 1996:8755917}" "" "" "Deletion comprising polypyrimidine truct: c.1030-12_1046del variant affects the acceptor splice site and 16 nt in exon 7, with subsequent putative exon 7 skipping" "Germline" "yes" "" "0" "" "" "g.57611705_57611733del" "" "pathogenic" "ACMG"
"0000598507" "0" "99" "11" "57379188" "57379191" "delins" "0" "03256" "SERPING1_000708" "g.57379188_57379191delinsGCA" "" "{PMID:Verpy 1996:8755917}" "" "" "Deletion comprising polypyrimidine truct: c.1030-2_1031delinsGCA variant is likely to affect the acceptor splice site, with subsequent probable exon 7 skipping" "Germline" "yes" "" "0" "" "" "g.57611715_57611718delinsGCA" "" "pathogenic" "ACMG"
"0000598510" "0" "99" "11" "57379193" "57379193" "subst" "0" "03256" "SERPING1_000006" "g.57379193G>T" "" "{DOI:Ozkars 2019:10.5114/ada.2018.78898} {DOI:Aydoğdu 2024:10.1620/tjem.2023.J083}" "" "" "c.1033G>T variant classified as likely pathogenic according to the ACMG criteria PM1, PM5, PP3, PM2" "Germline" "yes" "" "0" "" "" "g.57611720G>T" "" "likely pathogenic" "ACMG"
"0000598511" "0" "99" "11" "57379180" "57379208" "del" "0" "03256" "SERPING1_000709" "g.57379180_57379208del" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "" "Deletion comprising polypyrimidine truct: c.1030-10_1048del variant affects the acceptor splice site and 18 nt in exon 7, with a subsequent probable exon 7 skipping" "Germline" "yes" "" "0" "" "" "g.57611707_57611735del" "" "pathogenic" "ACMG"
"0000598513" "0" "99" "11" "57379189" "57379189" "subst" "0" "03256" "SERPING1_000710" "g.57379189G>A" "" "{DOI:Cumming 2003:10.1136/jmg.40.10.e114} {DOI:Speletas 2015:10.1016/j.jaci.2014.08.007} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Hashimura 2021:10.1111/all.15034}" "" "" "c.1030-1G>A variant is likely to affect the acceptor splice site, with a subsequent probable exon 7 skipping.\r\nDNA sample used in the forward validation of the SERPING1-NGS platform by Loules 2018.\r\nIntroduced in ClinVar as pathogenic by LabCorp, San Francisco CA." "Germline" "yes" "" "0" "" "" "g.57611716G>A" "{CV-SCV:005835882.1}" "pathogenic" "ACMG"
"0000598514" "0" "99" "11" "57379189" "57379189" "subst" "0" "03256" "SERPING1_000711" "g.57379189G>C" "" "{PMID:Verpy 1996:8755917} {DOI:Gösswein 2008:10.1159/000138883} {DOI:López-Lera 2011:10.1016/j.molimm.2011.07.010} {DOI:Hashimura 2021:10.1111/all.15034} {DOI:Förster 2021:0.1186/s13023-021-02021-x}" "" "" "The change c.1030-1G>C affects the canonical acceptor splice site.\r\nTotal RNA analysis showed skipping of exon 7.\r\nthe c.1030-1G>C variant in SERPING1 meets ACMG/ClinGen criteria to be classified as pathogenic: PVS1_Str, PP4_Str, PS4_Mod, PM2_Sup." "Germline" "yes" "" "0" "" "" "g.57611716G>C" "{CV-SCV:005061763.1}" "pathogenic" "ACMG"
"0000598515" "0" "99" "11" "57379189" "57379189" "del" "0" "03256" "SERPING1_000712" "g.57379189del" "" "{DOI:Xu 2012:10.1111/all.12024} {DOI:Liu 2019:10.1684/ejd.2018.3487}" "" "" "c.1030-1delG variant is likely to affect the canonical acceptor splice site, with a subsequent probable exon 7 skipping.\r\nThe c.1030delG variant in SERPING1 meets ACMG/ClinGen criteria to be classified as pathogenic: PVS1, PS4_Mod, PM2_Sup, PP4." "Germline" "yes" "rs2495452078" "0" "" "" "g.57611716del" "{CV-SCV:005061765.1}" "pathogenic" "ACMG"
"0000598517" "0" "99" "11" "57379385" "57379428" "del" "0" "03256" "SERPING1_000713" "g.57379385_57379428del" "" "{DOI:Grodecká 2017:10.1016/j.clim.2017.03.010} {DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "" "" "Deletion comprising donor splice site: c.1225_1249+19del variant has been demonstrated to affect the donor splice site, with a subsequent exon 7 skipping.\r\nPredicted donor loss by in silico SpliceAI algorithm" "Germline" "yes" "" "0" "" "" "g.57611912_57611955del" "" "pathogenic" "ACMG"
"0000598518" "0" "99" "11" "57379410" "57379410" "subst" "0" "03256" "SERPING1_000714" "g.57379410G>A" "" "{DOI:Gösswein 2008:10.1159/000138883} {DOI:López-Lera 2011:10.1016/j.molimm.2011.07.010} {DOI:Jindal 2021:10.1111/PAI.13420} {DOI:Veronez 2021:10.1016/j.jaip.2020.11.039} {DOI:Grombirikova 2023:10.1007/s10875-023-01565-w} {DOI:Ferriani 2025:10.1016/j.jaip.2025.08.026}" "" "" "Recurrent variant\r\nc.1249+1G>A variant is likely to affect the canonical donor splice site, with a subsequent probable exon 7 skipping.\r\nThe c.1249+1G>A variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PVS1_Str, PP4_Mod, PS4_Sup, PM2_Sup, PP1" "De novo" "yes" "rs112565881" "0" "" "" "g.57611937G>A" "{CV-SCV:005088592.1}" "pathogenic" "ACMG"
"0000598519" "0" "99" "11" "57379411" "57379411" "del" "0" "03256" "SERPING1_000715" "g.57379411del" "" "{DOI:Roche 2005:10.1002/humu.20197} {DOI:Loli‐Ausejo 2021:10.1007/s12016-021-08834-9}" "" "" "c.1249+2del variant affects the canonical donor splice site.\r\nTotal RNA analysis: Exon 7 skipping." "Germline" "yes" "" "0" "" "" "g.57611938del" "" "pathogenic" "ACMG"
"0000598520" "0" "99" "11" "57379411" "57379411" "subst" "0" "03256" "SERPING1_000716" "g.57379411T>A" "" "{DOI:Kawachi 1998:10.1046/j.1523-1747.1998.00170.x} {DOI:Yamamoto 2012:10.1097/MAJ.0b013e31822bdb65}" "" "" "c.1249+2T>A variant has been demonstrated to affect the canonical donor splice site, with a subsequent exon 7 skipping and a decreased amount of C1Inh mRNA." "Germline" "yes" "" "0" "" "" "g.57611938T>A" "" "pathogenic" "ACMG"
"0000598521" "0" "99" "11" "57379413" "57379413" "subst" "0" "03256" "SERPING1_000717" "g.57379413A>G" "" "{DOI:Ponard 2019:10.1002/humu.23917} {DOI:Kanepa 2023:10.1186/s13223-023-00783-6} {DOI:Rozevska 2024:10.1186/s13223-024-00889-5}" "" "" "c.1249+4A>G variant near donor splice site; its responsibility to affect the donor splice site must be investigated using patient cells.\r\nVariant predicted to result in a loss of canonical donor site (-4 bp): SPiP predicts a 98.4% risk to alter splicing, Pangolin in a loss of canonical donor site (-4 bp), with splice loss = 0.71, but spliceAI in a low prediction confidence, with donor loss = 0.16).\r\nKanepa 2023 attributed c.1249+4A>G variation as likely pathogenic; Rozevska 2024 as a pathogenic variant with revealing full intron retention on one allele in mRNA-escaping NMD.\r\nA compound heterozygous proband with c.[889+3A>G(;)1249+4A>G] has been reported by Kang 2006." "Germline" "yes" "" "0" "" "" "g.57611940A>G" "" "pathogenic" "ACMG"
"0000598522" "0" "99" "11" "57379414" "57379414" "subst" "0" "03256" "SERPING1_000718" "g.57379414G>A" "" "{DOI:Colobran 2014:10.1007/s10875-014-0042-3} {DOI:Grodecká 2017:10.1016/j.clim.2017.03.010} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Obtulowicz 2020:10.5114/ceji.2020.101252} {DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "" "" "c.1249+5G>A variant has been demonstrated to affect the donor splice site by Grodecká 2017, with an exon 7 skipping and an aberrant and unstable C1Inh transcript.\r\nSPiP prediction: Alteration of the consensus splice site, with a 98.41% risk for c.1249+5G>A variant to alter splicing\r\nc.1249+5G>A variant meets ACMG criteria to be characterized as pathogenic PS3, PS4, PM2, PM4, PP1, PP3, PP4" "Germline" "yes" "" "0" "" "" "g.57611941G>A" "" "pathogenic" "ACMG"
"0000598523" "0" "77" "11" "57379414" "57379414" "subst" "0" "03256" "SERPING1_000719" "g.57379414G>T" "" "{DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007}" "" "14255G>T (traditional)" "c.1249+5G>T variant might affect donor splice site; must be investigated on patient cells.\r\nNote that c.1249+5G>A variant has been demonstrated to affect the donor splice site (Grodecká 2017) and has been chracterized as pathogenic" "Germline" "yes" "" "0" "" "" "g.57611941G>T" "" "likely pathogenic" "ACMG"
"0000598524" "0" "11" "11" "57379500" "57379501" "del" "0" "03256" "SERPING1_000720" "g.57379500_57379501del" "" "{DOI:Kang 2006:10.1111/j.1398-9995.2006.01010.x}" "" "14337_14338delTT (traditional)" "" "Unknown" "" "" "0" "" "" "g.57612027_57612028del" "" "likely benign" ""
"0000598525" "0" "77" "11" "57381788" "57381788" "subst" "0" "03256" "SERPING1_000721" "g.57381788G>A" "" "{DOI:Zuraw 2000:10.1067/mai.2000.104780} {PMID:Uyguner 2008:18846647}{DOI:Gösswein 2008:10.1159/000138883} {DOI:Kesim 2011:10.1159/000323915}" "" "" "Acceptor splice site loss: An in silico analysis by Kesim 2011 gives the c.1250-13G>A variant as likely to create a new acceptor splice site, with subsequent p.(Glu417fs*2)" "Germline" "yes" "" "0" "" "" "g.57614315G>A" "" "pathogenic" "ACMG"
"0000598526" "0" "99" "11" "57381799" "57381799" "subst" "0" "03256" "SERPING1_000722" "g.57381799A>G" "" "{DOI:Gösswein 2008:10.1159/000138883} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Förster 2021:0.1186/s13023-021-02021-x} {DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "" "c.1250-2A>G variant affects the canonical acceptor splice site, with a subsequent exon(s) skipping" "Germline" "yes" "" "0" "" "" "g.57614326A>G" "" "pathogenic" "ACMG"
"0000598527" "0" "99" "11" "57381800" "57381800" "subst" "0" "03256" "SERPING1_000723" "g.57381800G>A" "" "{DOI:Andersen 2015:10.1155/2015/934247} {DOI:Aabom 2017:10.1016/j.clinbiochem.2017.04.007} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Förster 2021:0.1186/s13023-021-02021-x}" "" "" "Acceptor splice site loss: c.1250-1G>A variant affects the canonical acceptor splice site, with subsequent probable exon(s) skipping.\r\nThe c.1250-1G>A variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PVS1_Str, PP4_Mod, PS4_Mod, PM2_Sup." "Germline" "yes" "" "0" "" "" "g.57614327G>A" "{CV-SCV:005088593.1}" "pathogenic" "ACMG"
"0000598528" "0" "99" "11" "57367651" "57367651" "del" "0" "03256" "SERPING1_000724" "g.57367651del" "" "{DOI:Ferraro 2011:10.1111/j.1398-9995.2011.02658.x} {DOI:Maia 2019:10.1111/all.13699} {DOI:Veronez 2021:10.1016/j.jaip.2020.11.039} {DOI:Ferriani 2025:10.1016/j.jaip.2025.08.026}" "" "c.351delC" "" "Germline" "yes" "" "0" "" "" "g.57600178del" "" "pathogenic" "ACMG"
"0000598531" "3" "99" "11" "57379362" "57379362" "subst" "0" "03256" "SERPING1_000725" "g.57379362T>C" "0.000004" "{DOI:Mete Gökmen 2020:10.1111/imcb.12362}" "" "g.[57379362T>C];[57379362T>C]" "Two homozygous individuals presenting with a more severe clinical phenotype than the single affected heterozygous individual, presenting with a nearly asymptomatic HAE phenotype.\r\nThe Ile to Thr substitution at position 401 might affect the function of the gate" "Germline" "no" "rs1263371770" "0" "" "" "g.57611889T>C" "" "pathogenic (recessive)" "ACMG"
"0000598542" "0" "99" "11" "57368467" "57369931" "del" "0" "03256" "SERPING1_000726" "g.57368467_57369931del" "" "{DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57600994_57602458del" "" "pathogenic" "ACMG"
"0000598544" "0" "99" "11" "57368468" "57371758" "del" "0" "03256" "SERPING1_000727" "g.57368468_57371758del" "" "{DOI:Loules 2019:10.1016/j.gene.2018.05.029}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57600995_57604289del" "" "pathogenic" "ACMG"
"0000598546" "0" "99" "11" "57368904" "57369726" "del" "0" "03256" "SERPING1_000729" "g.57368904_57369726del" "" "{DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "" "A 822-nt deletion encompassing exon 4, with identified bounderies" "Germline" "yes" "" "0" "" "" "g.57601431_57602253del" "" "pathogenic" "ACMG"
"0000598547" "0" "99" "11" "57379590" "57382476" "del" "0" "03256" "SERPING1_000730" "g.57379590_57382476del" "" "{DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "" "a 2,886-nt deletion variant encompassing exon 8 of SERPING1 gene with identified boundaries" "Germline" "yes" "" "0" "" "" "g.57612117_57615003del" "" "pathogenic" "ACMG"
"0000598548" "0" "99" "11" "57364832" "57382477" "del" "0" "03256" "SERPING1_000731" "g.57364832_57382477del" "" "{DOI:Roche 2005:10.1002/humu.20197} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "" "a 17,646-nt deletion variant encompassing exons 1 to 8" "Germline" "yes" "" "0" "" "" "g.57597359_57615004del" "" "pathogenic" "ACMG"
"0000598549" "0" "99" "11" "57364831" "57367229" "del" "0" "03256" "SERPING1_000732" "g.57364831_57367229del" "" "{DOI:Roche 2005:10.1002/humu.20197} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "" "a 2,399-nt deletion variant encompassing exons 1 to 2" "Germline" "yes" "" "0" "" "" "g.57597358_57599756del" "" "pathogenic" "ACMG"
"0000598550" "0" "99" "11" "57366421" "57369726" "del" "0" "03256" "SERPING1_000733" "g.57366421_57369726del" "" "{DOI:Speletas 2015:10.1016/j.jaci.2014.08.007} {DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Förster 2021:10.1186/s13023-021-02021-x}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57598948_57602253del" "" "pathogenic" "ACMG"
"0000598551" "0" "99" "11" "57367937" "57369931" "del" "0" "03256" "SERPING1_000734" "g.57367937_57369931del" "" "{DOI:Speletas 2015:10.1016/j.jaci.2014.08.007} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "" "" "Germline" "" "" "0" "" "" "g.57600464_57602458del" "" "pathogenic" "ACMG"
"0000598552" "0" "99" "11" "57368904" "57369930" "del" "0" "03256" "SERPING1_000735" "g.57368904_57369930del" "" "{DOI:Speletas 2015:10.1016/j.jaci.2014.08.007} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "11q12.1(57368904-57369930)del" "A 1,026-nt deletion encompassing exon 4 with identified boundaries" "Germline" "yes" "" "0" "" "" "g.57601431_57602457del" "" "pathogenic" "ACMG"
"0000598553" "0" "99" "11" "57369000" "57370856" "dup" "0" "03256" "SERPING1_000736" "g.57369000_57370856dup" "" "{DOI:Roche 2005:10.1002/humu.20197} {DOI:Speletas 2015:10.1016/j.jaci.2014.08.007} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "g.(?_57369488)_(57369662_?)dup" "1,856-nt duplication variant.\r\nIntroduced in ClinVar as a pathogenic variant by InVitae, San Diego CA.\r\nDuplication of in-frame exon 4, with subsequent failed C1-INH expression - likely disturbing breach and shutter functional domains - and clinical/biological HAE type 1 phenotype." "Germline" "yes" "" "0" "" "" "g.57601527_57603383dup" "{CV-SCV:002110505.2}" "pathogenic" "ACMG"
"0000598554" "0" "99" "11" "57368466" "57370856" "del" "0" "03256" "SERPING1_000737" "g.57368466_57370856del" "" "{DOI:Roche 2005:10.1002/humu.20197} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "" "A 3,294-nt deletion encompassing exon 4, with identified boundaries" "Germline" "yes" "" "0" "" "" "g.57600993_57603383del" "" "pathogenic" "ACMG"
"0000598555" "0" "99" "11" "57369219" "57370856" "del" "0" "03256" "SERPING1_000738" "g.57369219_57370856del" "" "{DOI:Speletas 2015:10.1016/j.jaci.2014.08.007} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "" "" "Germline" "" "" "0" "" "" "g.57601746_57603383del" "" "pathogenic" "ACMG"
"0000598556" "0" "99" "11" "57371759" "57376643" "del" "0" "03256" "SERPING1_000739" "g.57371759_57376643del" "" "{DOI:Roche 2005:10.1002/humu.20197} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "" "a 4,885-nt deletion variant with exon 5 deletion" "Germline" "yes" "" "0" "" "" "g.57604286_57609170del" "" "pathogenic" "ACMG"
"0000598557" "0" "99" "11" "57373059" "57378387" "dup" "0" "03256" "SERPING1_000740" "g.57373059_57378387dup" "" "{DOI:Roche 2005:10.1002/humu.20197} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "" "Variant with a 5,328-nt duplication encompassing exons 5 to 6" "Germline" "" "" "0" "" "" "g.57605586_57610914dup" "" "pathogenic" "ACMG"
"0000598558" "0" "99" "11" "57375659" "57382476" "del" "0" "03256" "SERPING1_000741" "g.57375659_57382476del" "" "{DOI:Speletas 2015:10.1016/j.jaci.2014.08.007} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "" "a 6,817-nt deletion variant" "Germline" "yes" "" "0" "" "" "g.57608186_57615003del" "" "pathogenic" "ACMG"
"0000598559" "0" "99" "11" "57377605" "57380942" "del" "0" "03256" "SERPING1_000742" "g.57377605_57380942del" "" "{DOI:Roche 2005:10.1002/humu.20197} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "" "a 3,337-nt deletion variant" "Germline" "yes" "" "0" "" "" "g.57610132_57613469del" "" "pathogenic" "ACMG"
"0000598560" "0" "99" "11" "57379395" "57380191" "del" "0" "03256" "SERPING1_000743" "g.57379395_57380191del" "" "{DOI:Speletas 2015:10.1016/j.jaci.2014.08.007} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "" "The c.1235_1249+782del variant is expected to affect the donor splice site, with a probable subsequent exon 7 skipping; not demonstrated" "Germline" "" "" "0" "" "" "g.57611922_57612718del" "" "pathogenic" "ACMG"
"0000598561" "0" "99" "11" "57379785" "57382169" "del" "0" "03256" "SERPING1_000744" "g.57379785_57382169del" "" "{DOI:Roche 2005:10.1002/humu.20197} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "" "a 2,384-nt deletion variant encompassing exon 8" "Germline" "yes" "" "0" "" "" "g.57612312_57614696del" "" "pathogenic" "ACMG"
"0000598565" "0" "51" "11" "57365768" "57365768" "subst" "0.00035551" "03256" "SERPING1_000745" "g.57365768A>C" "0.0003072 (gnomAD v4) 0.000637 (ExAC)" "" "" "" "" "Not applicable" "" "rs201455616" "0" "" "" "g.57598295A>C" "{CV-SCV:001726012.4}" "benign" "ACMG"
"0000598566" "0" "55" "11" "57381932" "57381932" "subst" "2.84613E-5" "03256" "SERPING1_000746" "g.57381932G>A" "0.00002664 (gnomAD v4)" "" "" "" "Silent variant at P6 position of the RCL" "Not applicable" "" "rs774928269" "0" "" "" "g.57614459G>A" "{CV-SCV:004326196.2}" "benign" ""
"0000598579" "0" "99" "11" "57372182" "57374190" "del" "0" "03256" "SERPING1_000747" "g.57372182_57374190del" "" "{DOI:Wong 2019:10.1155/2019/7052062}" "" "g.12156_14164del" "variant with a 2,009-nt deletion and identified boundaries; the 5′ end of the deletion breakpoint is 16 bps from the adjacent Alu element, while the 3′ end is approximately 1 kbp away from the nearest Alu sequence." "Germline" "yes" "" "0" "" "" "g.57604709_57606717del" "" "pathogenic" "ACMG"
"0000598823" "0" "99" "11" "57369507" "57369643" "del" "0" "03256" "SERPING1_000748" "g.(57367851_57369507)_(57369643_57373482)del" "" "{PMID:Stoppa-Lyonnet 1991:1656734}{PMID:McPhaden 1991:1674681}{PMID:Pappalardo 2000:11112899}{PMID:Gösswein 2008:18758157}{PMID:Bygum 2011:20804470}{PMID:Lopez-Lera 2011:21864911}{PMID:Johnsrud 2015:26154504}{DOI:Ponard 2019:10.1002/humu.23917} {DOI:Loli-Ausejo 2021:10.1007/s12016-021-08834-9} {DOI:Hashimura 2021:10.1111/all.15034} {DOI:Wang 2022:10.1186/s41065-022-00242-z} {DOI:Szabo 2022:10.3389/falgy.2022.836465} {DOI:Grombikirova 2023:10.1007/s10875-023-01565-w} {DOI:Troldborg 2024:10.1016/j.jaci.2024.03.028} {DOI:Bas 2026:10.3390/medicina62091635}" "" "exon 4 deletion of unknown length" "Highly recurrent deletion variant, associated with an abundance of Alu repeats in 3\' and 5\' flanking introns, with a subsequent in-frame deletion.\r\nExon-4 deletion affects C1Inh structure. Exon-4 deletion variant is considered as pathogenic due to the profound capacity to induce formation of C1INH aggregates in the presence of normal C1Inh protein (Haslund 2019): Significant structural changes by loss of helix D, helix C and s2A, all playing an important role in stabilizing the shutter region, and deletion of these 2 helices may lead to opening of the sA, thereby allowing the RCL of variant C1Inh proteins to docking to the wt protein with subsequent stable protein-protein interactions. Opening of the shutter domain may explain why aggregates are formed in cells coexpressing both exon-4 deletion variant and wt proteins." "De novo" "yes" "" "0" "" "" "g.(57600378_57602034)_(57602170_57606009)del" "{CV-SCV:002243450.2}" "pathogenic" "ACMG"
"0000599135" "0" "99" "11" "57365721" "57369643" "del" "0" "03256" "SERPING1_000749" "g.(57365027_57365721)_(57369643_57373482)del" "" "{PMID:Stoppa-Lyonnet 1991:1656734}" "" "deletion of exons 1 to 4" "9-kb deletion variant identified by RFLP" "Germline" "yes" "" "0" "" "" "g.(57597554_57598248)_(57602170_57606009)del" "" "pathogenic" "ACMG"
"0000599281" "0" "99" "11" "57379189" "57379410" "del" "0" "03256" "SERPING1_000153" "g.(57374021_57379189)_(57379410_57381800)del" "" "{DOI:McPhaden 1991:10.1111/j.1399-0004.1991.tb03006.x} {DOI:Lopez-Lera 2011:10.1016/j.molimm.2011.07.010} {DOI:Ponard 2019:10.1002/humu.23917}" "" "exon 7 deletion" "Deletion encompassing exon 7 of unknown length.\r\nFirst identification of an exon 7 deletion using RFLP (McPhaden 1991)" "De novo" "yes" "" "0" "" "" "g.(57606548_57611716)_(57611937_5761432)del" "" "pathogenic" "ACMG"
"0000599313" "0" "99" "11" "57368351" "57371239" "del" "0" "03256" "SERPING1_000750" "g.57368351_57371239del" "" "{DOI:Roche 2005:10.1002/humu.20197} {DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "c.551-1158_685+1596del" "Variant described as a 2.9-kb deletion by Roche 2005, as estimated from RT-PCR, within Alu repeats 1 and 7; a 2,888-nt deletion and 5\' and 3\' boundaries have been attributed by Loules 2018." "Germline" "yes" "" "0" "" "" "g.57600878_57603766del" "" "pathogenic" "ACMG"
"0000599314" "0" "99" "11" "57365195" "57365795" "del" "0" "03256" "SERPING1_000751" "g.(57365027_57365195)_(57365795_57367351)del" "" "{DOI:Lopez-Lera 2011:10.1016/j.molimm.2011.07.010} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "exons 1_2 deletion of unknown length" "c.(-191_-23)_(51+1_52-1)del variant carried by a de novo proband\r\nConsidered as pathogenic in agreement with ACMG criteria PVS1, PS2_Str, PS3, PS4, PP4" "De novo" "yes" "" "0" "" "" "g.(57597554_57597722)_(57598322_57599878)del" "" "pathogenic" "ACMG"
"0000599316" "0" "99" "11" "57365195" "57369643" "del" "0" "03256" "SERPING1_000752" "g.(57365027_57365195)_(57369643_57373482)del" "" "{PMID:Stoppa-Lyonnet 1991:1656734}" "" "exons 1_4 deletion with a 9-kb deletion" "" "Germline" "yes" "" "0" "" "" "g.(57597554_57597722)_(57602170_57606009)del" "" "pathogenic" "ACMG"
"0000599317" "0" "99" "11" "57365195" "57369643" "del" "0" "03256" "SERPING1_000752" "g.(57365027_57365195)_(57369643_57373482)del" "" "{PMID:Duponchel 2001:11139243} {DOI:Johnsrud 2015:10.1371/journal. pone.0131637} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Loli-Ausejo 2021:10.1007/s12016-021-08834-9} {DOI:Hashimura 2021:10.1111/all.15034} {DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "exons 1_4 deletion with unknown length" "" "Germline" "yes" "" "0" "" "" "g.(57597554_57597722)_(57602170_57606009)del" "{CV-SCV:002243450.2}" "pathogenic" "ACMG"
"0000599318" "0" "99" "11" "57365195" "57374021" "del" "0" "03256" "SERPING1_000753" "g.(57365027_57365195)_(57374021_57379189)del" "" "{PMID:Stoppa-Lyonnet 1991:1656734} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Förster 2021:10.1186/s13023-021-02021-x}" "" "large deletion (17-kb long) of exons 1 to 6" "" "Germline" "yes" "" "0" "" "" "g.(57597554_57597722)_(57606548_57611716)del" "{CV-SCV:003790197.1}" "pathogenic" "ACMG"
"0000599319" "0" "99" "11" "57365195" "57374021" "del" "0" "03256" "SERPING1_000753" "g.(57365027_57365195)_(57374021_57379189)del" "" "{DOI:Aradhya 2012:10.1038/gim.2011.65}" "" "exons 1_6 deletion with a 9.3-kb deletion" "" "Germline" "" "" "0" "" "" "g.(57597554_57597722)_(57606548_57611716)del" "" "pathogenic" "ACMG"
"0000599320" "0" "99" "11" "57365195" "57379410" "del" "0" "03256" "SERPING1_000754" "g.(57365027_57365195)_(57379410_57381800)del" "" "{DOI:Pedrosa 2016:10.1007/s10875-015-0222-9}" "" "large deletion encompassing exons 1 to 7" "" "Germline" "" "" "0" "" "" "g.(57597554_57597722)_(57611937_57614327)del" "" "pathogenic" "ACMG"
"0000599321" "0" "99" "11" "57365195" "57382326" "del" "0" "03256" "SERPING1_000755" "g.(57365027_57365195)_(57382326_?)del" "" "{PMID:Duponchel 2001:11139243} {DOI:Roche 2005:10.1002/humu.20197} {DOI:Iwamoto 2012:10.1016/j.jdermsci.2012.06.012} {DOI:Johnsrud 2015:10.1371/journal. pone.0131637} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Loli-Ausejo 2021:10.1007/s12016-021-08834-9} {DOI:Hashimura 2021:10.1111/all.15034} {DOI:Szabó 2022:10.3389/falgy.2022.836465} {DOI:Grombikirova 2023:10.1007/ s10875-023-01565-w} {DOI:Troldborg 2024:10.1016/j.jaci.2024.03.028}" "" "exons 1_8 deletion of unknown length" "Recurrent gross deletion\r\nIntroduced in ClinVar as a pathogenic variant by InVitae, San Francisco CA" "De novo" "yes" "" "0" "" "" "g.(57597554_57597722)_(57614853_?)del" "{CV-SCV:001591839.3}" "pathogenic" "ACMG"
"0000599322" "0" "99" "11" "57365721" "57365795" "del" "0" "03256" "SERPING1_000756" "g.(57365196_57365721)_(57365795_57367351)del" "" "{DOI:Lopez-Lera 2011:10.1016/j.molimm.2011.07.010}" "" "" "exon 2 deletion, probably encompassing introns 1 and 2" "Germline" "yes" "" "0" "" "" "g.(57597723_57598248)_(57598322_57599878)del" "" "pathogenic" "ACMG"
"0000599324" "0" "99" "11" "57367351" "57374021" "del" "0" "03256" "SERPING1_000758" "g.(57365795_57367351)_(57374021_57379189)del" "" "{DOI:Stoppa-Lyonnet 1990:10.1073/pnas.87.4.1551}" "" "" "4.6-kb deletion variant encompassing exons 3 to 6" "Germline" "yes" "" "0" "" "" "g.(57598322_57599878)_(57606548_57611716)del" "" "pathogenic" "ACMG"
"0000599325" "0" "99" "11" "57369507" "57369643" "del" "0" "03256" "SERPING1_000748" "g.(57367851_57369507)_(57369643_57373482)del" "" "{DOI:Ariga 1990:10.1016/0888-7543(90)90246-q} {DOI:Cumming 2003:10.1136/jmg.40.10.e114} {DOI:Haslund 2019:10.1172/JCI98869}" "" "1.4-kb deletion variant encompassing exon 4" "Exon-4 deletion affects C1Inh structure. Exon-4 deletion variant is considered as pathogenic due to the profound capacity to induce formation of C1INH aggregates in the presence of normal C1Inh protein.\r\nSignificant structural changes occurs in C1Inh, as exon 4 encodes helix D, helix C and s2A. Both hD and hC play an important role in stabilizing the shutter region, and deletion of these 2 helices may lead to opening of the sA, thereby allowing the RCL of variant C1Inh proteins to dockin to the wt protein with subsequent stable protein-protein interactions. Opening of the shutter domain may explain why aggregates are formed in cells coexpressing both exon-4 deletion variant and wt proteins." "Germline" "yes" "" "0" "" "" "g.(57600378_57602034)_(57602170_57606009)del" "" "pathogenic" "ACMG"
"0000599326" "0" "99" "11" "57369507" "57369643" "del" "0" "03256" "SERPING1_000748" "g.(57367851_57369507)_(57369643_57373482)del" "" "{DOI:Kalmár 2003:10.1002/humu.9202}" "" "exon-4 deletion with a 2.9-kb deletion" "Exon-4 deletion variant identified with a 2.9-kb deletion.\r\nExon-4 deletion affects C1Inh structure. Exon-4 deletion variant is considered as pathogenic due to the profound capacity to induce formation of C1INH aggregates in the presence of normal C1Inh protein. Significant structural changes occurs in C1Inh, as exon 4 encodes helix D, helix C and s2A. Both hD and hC play an important role in stabilizing the shutter region, and deletion of these 2 helices may lead to opening of the sA, thereby allowing the RCL of variant C1Inh proteins to dockin to the wt protein with subsequent stable protein-protein interactions. Opening of the shutter domain may explain why aggregates develop in cells coexpressing both exon-4 deletion variant and wt proteins." "Germline" "" "" "0" "" "" "g.(57600378_57602034)_(57602170_57606009)del" "" "pathogenic" "ACMG"
"0000599327" "0" "99" "11" "57369507" "57369643" "del" "0" "03256" "SERPING1_000748" "g.(57367851_57369507)_(57369643_57373482)del" "" "{DOI:Roche 2005:10.1002/humu.20197}" "" "exon-4 deletion with 1.2-kb deletion" "Exon-4 deletion variant with 1.2-kb deletion.\r\nExon-4 deletion affects C1Inh structure. Exon-4 deletion variant is considered as pathogenic due to the profound capacity to induce formation of C1INH aggregates in the presence of normal C1Inh protein. Significant structural changes occurs in C1Inh, as exon 4 encodes helix D, helix C and s2A. Both hD and hC play an important role in stabilizing the shutter region, and deletion of these 2 helices may lead to opening of the sA, thereby allowing the RCL of variant C1Inh proteins to dockin to the wt protein with subsequent stable protein-protein interactions. Opening of the shutter domain may explain why aggregates are formed in cells coexpressing both exon-4 deletion variant and wt proteins." "Germline" "yes" "" "0" "" "" "g.(57600378_57602034)_(57602170_57606009)del" "" "pathogenic" "ACMG"
"0000600818" "0" "99" "11" "57369507" "57369643" "del" "0" "03256" "SERPING1_000748" "g.(57367851_57369507)_(57369643_57373482)del" "" "{PMID:Stoppa-Lyonnet 1991:1656734} {DOI:Roche 2005:10.1002/humu.20197}" "" "exon-4 deletion with 3.2-kb deletion" "Exon-4 deletion with 3.2-kb deletion (estimation by RT-PCR), within the left monomers of Alu repeats 1 and 8.\r\nExon-4 deletion affects C1Inh structure. Exon-4 deletion variant is considered as pathogenic due to the profound capacity to induce formation of C1INH aggregates in the presence of normal C1Inh protein. Significant structural changes occurs in C1Inh, as exon 4 encodes helix D, helix C and s2A. Both hD and hC play an important role in stabilizing the shutter region, and deletion of these 2 helices may lead to opening of the sA, thereby allowing the RCL of variant C1Inh proteins to dockin to the wt protein with subsequent stable protein-protein interactions. Opening of the shutter domain may explain why aggregates are formed in cells coexpressing both exon-4 deletion variant and wt proteins." "Germline" "yes" "" "0" "" "" "g.(57600378_57602034)_(57602170_57606009)del" "" "pathogenic" "ACMG"
"0000600819" "0" "99" "11" "57369507" "57369643" "del" "0" "03256" "SERPING1_000748" "g.(57367851_57369507)_(57369643_57373482)del" "" "{PMID:Stoppa-Lyonnet 1991:1656734} {DOI:Kalmár 2003:10.1002/humu.9202}" "" "exon-4 deletion with a 2.75-kb deletion" "Exon-4 deletion variant is considered as pathogenic due to the profound capacity to induce formation of C1INH aggregates in the presence of normal C1Inh protein. Significant structural changes occurs in C1Inh, as exon 4 encodes helix D, helix C and s2A. Both hD and hC play an important role in stabilizing the shutter region, and deletion of these 2 helices may lead to opening of the sA, thereby allowing the RCL of variant C1Inh proteins to dockin to the wt protein with subsequent stable protein-protein interactions. Opening of the shutter domain may explain why aggregates are formed in cells coexpressing both exon-4 deletion variant and wt proteins." "Germline" "yes" "" "0" "" "" "g.(57600378_57602034)_(57602170_57606009)del" "" "pathogenic" "ACMG"
"0000600820" "0" "99" "11" "57369507" "57369643" "del" "0" "03256" "SERPING1_000748" "g.(57367851_57369507)_(57369643_57373482)del" "" "{DOI:Kalmár 2003:10.1002/humu.9202}" "" "exon-4 deletion with 9-kb deletion" "Exon-4 deletion variant with a 9-kb deletion.\r\nExon-4 deletion variant is considered as pathogenic due to the profound capacity to induce formation of C1INH aggregates in the presence of normal C1IINH protein. Significant structural changes occurs in C1INH, as exon 4 encodes helix D, helix C and s2A. Both hD and hC play an important role in stabilizing the shutter region, and deletion of these 2 helices may lead to opening of the sA, thereby allowing the RCL of variant C1Inh proteins to dockin to the wt protein with subsequent stable protein-protein interactions. Opening of the shutter domain may explain why aggregates are formed in cells coexpressing both exon-4 deletion variant and wt proteins." "Germline" "yes" "" "0" "" "" "g.(57600378_57602034)_(57602170_57606009)del" "" "pathogenic" "ACMG"
"0000600821" "0" "99" "11" "57369507" "57369643" "del" "0" "03256" "SERPING1_000748" "g.(57367851_57369507)_(57369643_57373482)del" "" "{PMID:Stoppa-Lyonnet 1991:2154751}" "" "exon-4 deletion with 2.6-kb deletion" "Exon-4 deletion variant with 2.6-kb deletion.\r\nExon-4 deletion affects C1INH structure. Exon-4 deletion variant is considered as pathogenic due to the profound capacity to induce formation of C1INH aggregates in the presence of normal C1INH protein. Significant structural changes occurs in C1INH, as exon 4 encodes helix D, helix C and s2A. Both hD and hC play an important role in stabilizing the shutter region, and deletion of these 2 helices may lead to opening of the sA, thereby allowing the RCL of variant C1INH proteins to dockin to the wt protein with subsequent stable protein-protein interactions. Opening of the shutter domain may explain why aggregates are formed in cells coexpressing both exon-4 deletion variant and wt proteins." "Germline" "yes" "" "0" "" "" "g.(57600378_57602034)_(57602170_57606009)del" "" "pathogenic" "ACMG"
"0000600822" "0" "99" "11" "57369507" "57374021" "del" "0" "03256" "SERPING1_000759" "g.(57367851_57369507)_(57374021_57379189)del" "" "{DOI:Ariga 1990:10.1016/0888-7543(90)90246-q}" "" "exons 4_6 deletion" "8.5-kb deletion variant encompassing exons 4 to 6" "Germline" "yes" "" "0" "" "" "g.(57600378_57602034)_(57606548_57611716)del" "" "pathogenic" "ACMG"
"0000600823" "0" "99" "11" "57373482" "57373687" "dup" "0" "03256" "SERPING1_000760" "g.(57369643_57373482)_(57373687_57373880)dup" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "exon 5 duplication" "" "Germline" "yes" "" "0" "" "" "g.(57602170_57606009)_(57606214_57606407)dup" "" "pathogenic" "ACMG"
"0000600824" "0" "99" "11" "57373482" "57374021" "del" "0" "03256" "SERPING1_000761" "g.(57369643_57373482)_(57374021_57379189)del" "" "{DOI:Roche 2005:10.1002/humu.20197}" "" "exons 5 to 6 deletion" "exons 5_6 deletion variant with a 2.0-kb deletion size" "Germline" "" "" "0" "" "" "g.(57602170_57606009)_(57606548_57611716)del" "" "pathogenic" "ACMG"
"0000600825" "0" "99" "11" "57373482" "57374021" "del" "0" "03256" "SERPING1_000761" "g.(57369643_57373482)_(57374021_57379189)del" "" "{PMID:Duponchel 2001:11139243} {DOI:Pappalardo 2000:10.1067/mai.2000.110471} {DOI:Gösswein 2008:10.1159/000138883} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Hashimura 2021:10.1111/all.15034} {DOI:Förster 2021:10.1186/s13023-021-02021-x} {DOI:Banerji 2022:10.1056/NEJMcpc2027087} {DOI:Bas 2026:10.3390/medicina62091635}" "" "exons 5_6 deletion of unknown length" "Recurrent large deletion encompassing exons 5 and 6, where boudaries have not been identified" "De novo" "yes" "" "0" "" "" "g.(57602170_57606009)_(57606548_57611716)del" "{CV-SCV:002243450.2}" "pathogenic" "ACMG"
"0000600826" "1" "97" "11" "57365792" "57365792" "subst" "0" "03256" "SERPING1_000762" "g.57365792G>A" "0.000004479" "{DOI:Xu 2018:10.4168/aair.2018.10.3.285}" "" "c.[49G>A(;)953C>G]" "Variant c.49G>A is contributing to a more severe phenotype in a compound heterozygous c.[49G>A(;)953C>G] with variant c.953C>G. \r\nAs expressed in the HepG2 cell line, the cis configuration c.[49G>A;953C>G] significantly displays lower function of recombinant C1-INH than c.953CA" "" "VUS" ""
"0000600828" "0" "99" "11" "57373482" "57382326" "del" "0" "03256" "SERPING1_000763" "g.(57369643_57373482)_(57382326_?)del" "" "{DOI:Gösswein 2008:10.1159/000138883} {DOI:Otani 2019:10.1111/ped.13729} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Hashimura 2021:10.1111/all.15034}" "" "deletion of exons 5 to 8, unknown length" "deletion variant encompassing exons 5 to 8, unknown length" "Germline" "yes" "" "0" "" "" "g.(57602170_57606009)_(57614853_?)del" "{CV-SCV:003790198.1}" "pathogenic" "ACMG"
"0000600846" "0" "99" "11" "57379189" "57382326" "del" "0" "03256" "SERPING1_000764" "g.(57374021_57379189)_(57382326_?)del" "" "{DOI:Roche 2005:10.1002/humu.20197}" "" "" "a 3.3-kb deletion variant" "Germline" "yes" "" "0" "" "" "g.(57606548_57611716)_(57614853_?)del" "" "pathogenic" "ACMG"
"0000600847" "0" "99" "11" "57379189" "57382326" "del" "0" "03256" "SERPING1_000764" "g.(57374021_57379189)_(57382326_?)del" "" "{DOI:Cumming 2003:10.1136/jmg.40.10.e114} {DOI:Gösswein 2008:10.1159/000138883} {DOI:Bygum 2011:10.1111/j.1398-9995.2010.02456} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Szabó 2022:10.3389/falgy.2022.836465}" "" "" "a deletion variant of unknown size\r\na de novo proband in the Danish pedigree" "De novo" "yes" "" "0" "" "" "g.(57606548_57611716)_(57614853_?)del" "" "pathogenic" "ACMG"
"0000600848" "0" "99" "11" "57381800" "57382326" "del" "0" "03256" "SERPING1_000765" "g.(57379410_57381800)_(57382326_?)del" "" "{DOI:Gösswein 2008:10.1159/000138883} {DOI:Ponard 2019:10.1002/humu.2391} {DOI:Obtulowicz 2020:10.5114/ceji.2020.101252} {DOI:Förster 2021:10.1186/s13023-021-02021-x}" "" "" "exon-8 deletion variant(s) of unknown length" "Germline" "yes" "" "0" "" "" "g.(57611937_5761432)_(57614853_?)del" "" "pathogenic" "ACMG"
"0000600849" "0" "99" "11" "57381800" "57382326" "del" "0" "03256" "SERPING1_000765" "g.(57379410_57381800)_(57382326_?)del" "" "{DOI:Stoppa-Lyonnet 1990:10.1073/pnas.87.4.1551}" "" "" "a 3.5-kb deletion variant affecting exon 8" "Germline" "yes" "" "0" "" "" "g.(57611937_5761432)__(57614853_?)del" "" "pathogenic" "ACMG"
"0000600850" "0" "99" "11" "57373880" "57374021" "del" "0" "03256" "SERPING1_000766" "g.(57373687_57373880)_(57374021_57379189)del" "" "{DOI:Gösswein 2008:10.1159/000138883}" "" "" "an exon-6 deletion variant of unknown length" "Germline" "" "" "0" "" "" "g.(57606214_57606407)_(57606548_57611716)del" "" "pathogenic" "ACMG"
"0000600851" "0" "99" "11" "57373482" "57382326" "del" "0" "03256" "SERPING1_000763" "g.(57369643_57373482)_(57382326_?)del" "" "{DOI:Ariga 1993:10.1006/clin.1993.1156} {DOI:Yamamoto 2012:10.1097/MAJ.0b013e31822bdb65}" "" "" "a 17-kb long deletion variant encompassing exons 5 to 8" "De novo" "yes" "" "0" "" "" "g.(57602170_57606009)_(57614853_?)del" "" "pathogenic" "ACMG"
"0000601059" "0" "99" "11" "57368227" "57371445" "del" "0" "03256" "SERPING1_000767" "g.57368227_57371445del" "" "{DOI:Stoppa-Lyonnet 1990:10.1073/pnas.87.4.1551}" "" "3.2-kb deletion" "Exon-4 deletion variant with attributed 5\' and 3\' boundaries.\r\nExon-4 deletion affects C1Inh structure. Exon-4 deletion variant is considered as pathogenic due to the profound capacity to induce formation of C1INH aggregates in the presence of normal C1Inh protein. Significant structural changes occurs in C1Inh, as exon 4 encodes helix D, helix C and s2A. Both hD and hC play an important role in stabilizing the shutter region, and deletion of these 2 helices may lead to opening of the sA, thereby allowing the RCL of variant C1Inh proteins to dockin to the wt protein with subsequent stable protein-protein interactions. Opening of the shutter domain may explain why aggregates are formed in cells coexpressing both exon-4 deletion variant and wt proteins." "Germline" "yes" "" "0" "" "" "g.57600754_57603972del" "" "pathogenic" "ACMG"
"0000601060" "1" "99" "11" "57368304" "57370918" "del" "0" "03256" "SERPING1_000768" "g.57368304_57370918del" "" "{DOI:Stoppa-Lyonnet 1990:10.1073/pnas.87.4.1551}" "" "2.5-kb deletion" "Compound heterozygous carrier for 2.5-kb deletion and 0.3-kb duplication variants in a cis configuration. Exon-4 deletion affects C1INH structure. Exon-4 deletion variant is considered as pathogenic due to the profound capacity to induce formation of C1INH aggregates in the presence of normal C1INH protein. Significant structural changes occurs in C1INH, as exon 4 encodes helix D, helix C and s2A. Both hD and hC play an important role in stabilizing the shutter region, and deletion of these 2 helices may lead to opening of the sA, thereby allowing the RCL of variant C1INH proteins to dockin to the wt protein with subsequent stable protein-protein interactions. Opening of the shutter domain may explain why aggregates are formed in cells coexpressing both exon-4 deletion variant and wt proteins." "Germline" "yes" "" "0" "" "" "g.57600831_57603445del" "" "pathogenic" "ACMG"
"0000601061" "1" "99" "11" "57369507" "57369643" "dup" "0" "03256" "SERPING1_000014" "g.(57367851_57369507)_(57369643_57373482)dup" "" "{DOI:Stoppa-Lyonnet 1990:10.1073/pnas.87.4.1551}" "" "0.3-kb duplication" "Compound heterozygous 2.5-kb deletion and 0.3-kb duplication variants in a cis configuration.\r\nBoth Alu–mediated transposition and Alu-mediated deletion, with subsequent the 2.5-kb deletion and 0.3-kb insertion of exon 4, are carried by the same allele." "Germline" "yes" "" "0" "" "" "g.(57600378_57602034)_(57602170_57606009)dup" "" "pathogenic" "ACMG"
"0000601062" "0" "99" "11" "57365195" "57367851" "del" "0" "03256" "SERPING1_000769" "g.(57365027_57365195)_(57367851_57369507)del" "" "{PMID:Stoppa-Lyonnet 1991:1656734} {DOI:Ponard 2019:10.1002/humu.23917}" "" "4-kb deletion encompassing exons 1 to 3" "A >4 kb deletion of the genomic region encompassing exons 1-3 of the SERPING1 gene.\r\nIntroduced in ClinVar as pathogenic variant by InVitae" "Germline" "yes" "" "0" "" "" "g.(57597554_57597722)_(57600378_57602034)del" "{CV-SCV:002243450.2}" "pathogenic" "ACMG"
"0000601069" "0" "99" "11" "57368278" "57370081" "del" "0" "03256" "SERPING1_000770" "g.57368278_57370081del" "" "{DOI:Nicolicht 2019:10.1016/j.gene.2018.10.084}" "" "c.550+428del1804" "Exon-4 deletion affects C1INH structure. Exon-4 deletion variant is considered as pathogenic due to the profound capacity to induce formation of C1INH aggregates in the presence of normal C1INH protein. Significant structural changes occurs in C1INH, as exon 4 encodes helix D, helix C and s2A. Both hD and hC play an important role in stabilizing the shutter region, and deletion of these 2 helices may lead to opening of the sA, thereby allowing the RCL of variant C1INH proteins to dockin to the wt protein with subsequent stable protein-protein interactions. Opening of the shutter domain may explain why aggregates are formed in cells coexpressing both exon-4 deletion variant and wt proteins." "Germline" "yes" "" "0" "" "" "g.57600805_57602608del" "" "pathogenic" "ACMG"
"0000601070" "0" "99" "11" "57369507" "57374021" "del" "0" "03256" "SERPING1_000759" "g.(57367851_57369507)_(57374021_57379189)del" "" "{DOI:Roche 2005:10.1002/humu.20197}" "" "3.2-kb deletion variant" "a 3.2-kb deletion variant encompassing exons 4 to 6" "Germline" "" "" "0" "" "" "g.(57600378_57602034)_(57606548_57611716)del" "" "pathogenic" "ACMG"
"0000601071" "0" "99" "11" "57369507" "57374021" "del" "0" "03256" "SERPING1_000759" "g.(57367851_57369507)_(57374021_57379189)del" "" "{DOI:Roche 2005:10.1002/humu.20197}" "" "2.5-kb deletion variant" "a 2.5-kb deletion variant encompassing exons 4 to 6" "Germline" "yes" "" "0" "" "" "g.(57600378_57602034)_(57606548_57611716)del" "" "pathogenic" "ACMG"
"0000601072" "0" "99" "11" "57368595" "57369950" "del" "0" "03256" "SERPING1_000771" "g.57368595_57369950del" "" "{DOI:Steiner 2017:10.1111/cei.12941} {DOI:Nicolicht 2019:10.1016/j.gene.2018.10.084}" "" "" "c.550+695_685+308del variant introduces a 1,356-nt deletion encompassing part of intron 3, exon 4 and part of intron 4. Additional exon skipping not demonstrated.\r\nThis variant meets ACMG criteria PVS1_Strong, PP4_Moderate, PP1 to be considered as likely pathogenic." "Germline" "yes" "" "0" "" "" "g.57601122_57602477del" "{CV-SCV:000297730.1}" "pathogenic" "ACMG"
"0000602972" "0" "99" "11" "57379264" "57379264" "del" "0" "03256" "SERPING1_000772" "g.57379264del" "" "{DOI:Da Silva 2015:10.1186/1939-4551-8-S1-A116} {DOI:Veronez 2019:10.3389/fmed.2019.00028} {DOI:Veronez 2021:10.1016/j.jaip.2020.11.039} {DOI:Gehlen 2024:10.1159/000538518} {DOI:Ferriani 2025:10.1016/j.jaip.2025.08.026}" "" "" "" "Germline" "yes" "rs1590829685" "0" "" "" "g.57611791del" "{CV:000692101}" "likely pathogenic" "ACMG"
"0000602973" "0" "99" "11" "57369554" "57369554" "subst" "0" "03256" "SERPING1_000168" "g.57369554C>G" "" "{DOI:Bafunno 2014:10.1111/ahg.12052} {DOI:Veronez 2019:10.3389/fmed.2019.00028}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57602081C>G" "" "pathogenic" "ACMG"
"0000602977" "0" "99" "11" "57365795" "57365795" "del" "0" "03256" "SERPING1_000774" "g.57365795del" "" "" "" "" "Record from Institute of Human Genetics, University of Wuerzburg" "Germline" "" "rs1590821401" "0" "" "" "g.57598322del" "{CV:000689535}" "likely pathogenic" "ACMG"
"0000602978" "0" "99" "11" "57365799" "57365799" "subst" "0" "03256" "SERPING1_000775" "g.57365799G>T" "" "{DOI:Brix 2020:10.1136/bcr-2019-231906}" "" "" "Non-canonical substitution. \r\nIntroduced in ClinVar as likely pathogenic by GeneDx, Gaitherburg MA\r\nLikely affecting splicing of intron 2 in a non-canonical position: Predicted donor site loss by in silico SpliceAI algorithm." "Germline" "yes" "rs1554994665" "0" "" "" "g.57598326G>T" "{CV:000450500}" "likely pathogenic" "ACMG"
"0000602979" "0" "99" "11" "57369507" "57369643" "del" "0" "03256" "SERPING1_000748" "g.(57367851_57369507)_(57369643_57373482)del" "" "{DOI:Stoppa-Lyonnet 1990:10.1073/pnas.87.4.1551}" "" "0.9-kb deletion encompassing exon 4" "Exon-4 deletion affects C1INH structure. Exon-4 deletion variant is considered as pathogenic due to the profound capacity to induce formation of C1INH aggregates in the presence of normal C1INH protein. Significant structural changes occurs in C1INH, as exon 4 encodes helix D, helix C and s2A. Both hD and hC play an important role in stabilizing the shutter region, and deletion of these 2 helices may lead to opening of the sA, thereby allowing the RCL of variant C1INH proteins to dockin to the wt protein with subsequent stable protein-protein interactions. Opening of the shutter domain may explain why aggregates are formed in cells coexpressing both exon-4 deletion variant and wt proteins." "Germline" "yes" "" "0" "" "" "g.(57600378_57602034)_(57602170_57606009)del" "" "pathogenic" "ACMG"
"0000604194" "0" "55" "11" "55033164" "57518726" "dup" "0" "03256" "SERPING1_000776" "g.55033164_57518726dup" "" "" "" "" "Long duplicated sequence encompassing the entire SERPING1 gene.\r\nIntroduced as VUS in ClinVar by GenomeConnect Lewisburg PA; no assertion provided" "De novo" "" "" "0" "" "" "g.55265691_57751253dup" "{CV:000684481}" "VUS" "ACMG"
"0000604195" "0" "53" "11" "57306011" "57669349" "dup" "0" "03256" "SERPING1_000777" "g.57306011_57669349dup" "" "" "" "" "" "CLASSIFICATION record" "" "" "0" "" "" "g.57538538_57901876dup" "{CV:000613421}" "benign" ""
"0000604196" "0" "53" "11" "57147016" "57667222" "dup" "0" "03256" "SERPING1_000778" "g.57147016_57667222dup" "" "" "" "" "Long duplicated sequence encompassing the whole SERPING1 gene.\r\nIntroduced as benign variant in Clinvar by Cincinnati Children\'s Hospital Medical Center Genetics and Genomics Diagnostic Laboratory, Cincinnati OH; no assertion provided" "Germline" "" "" "0" "" "" "g.57379543_57899749dup" "{CV:000613420}" "benign" ""
"0000604197" "0" "55" "11" "57139699" "57703639" "dup" "0" "03256" "SERPING1_000865" "g.(?_57139699)_(57703639_?)dup" "" "" "" "" "Duplication of SERPING1 locus" "CLASSIFICATION record" "" "" "0" "" "" "g.(?_57372226)_(57936167_?)dup" "{CV:000058162}" "VUS" ""
"0000604224" "0" "50" "11" "57379205" "57379205" "subst" "6.49942E-5" "03256" "SERPING1_000128" "g.57379205C>T" "0.000049 (ExAC)" "{DOI:Maaser 2018:10.1371/journal.pone.0205895}" "" "" "Variants have been identified in 17 selected genes and were shared by all investigated BD cases in the respective pedigrees. The most promising variant was located in the gene SERPING1 (c.1045C>T), which has been reported previously as a genome-wide significant risk gene for schizophrenia, and now suggested as novel candidate gene for Bipolar Disorder susceptibility." "Germline" "yes" "rs141075266" "0" "" "" "g.57611732C>T" "{CV:VCV001425516.1}" "VUS" ""
"0000613452" "0" "30" "11" "57367580" "57367580" "subst" "0" "01943" "SERPING1_000779" "g.57367580C>G" "" "" "" "SERPING1(NM_000062.2):c.280C>G (p.P94A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.57600107C>G" "" "likely benign" ""
"0000613453" "0" "33" "11" "57367583" "57367583" "subst" "0" "01804" "SERPING1_000276" "g.57367583A>C" "" "" "" "SERPING1(NM_000062.2):c.283A>C (p.T95P, p.(Thr95Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.57600110A>C" "" "likely benign" ""
"0000613454" "0" "30" "11" "57367586" "57367586" "subst" "0" "01804" "SERPING1_000780" "g.57367586A>C" "" "" "" "SERPING1(NM_000062.2):c.286A>C (p.(Thr96Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.57600113A>C" "" "likely benign" ""
"0000613455" "0" "30" "11" "57367765" "57367765" "subst" "0.00032491" "01943" "SERPING1_000781" "g.57367765C>T" "0.00013 (gnomAD) 0.00054 (TOPMed)" "" "" "SERPING1(NM_000062.2):c.465C>T (p.H155=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "rs201627388" "0" "" "" "g.57600292C>T" "{CV:000305023}" "likely benign" "ACMG"
"0000613456" "0" "33" "11" "57379324" "57379324" "subst" "0.000113706" "01943" "SERPING1_000782" "g.57379324G>A" "0.0002237" "" "" "SERPING1(NM_000062.2):c.1164G>A (p.M388I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "rs141529833" "0" "" "" "g.57611851G>A" "{CV-SCV:001696391.6}" "likely benign" "ACMG"
"0000613457" "0" "97" "11" "57381897" "57381897" "subst" "0" "02325" "SERPING1_000616" "g.57381897T>G" "" "" "" "SERPING1(NM_000062.3):c.1346T>G (p.L449R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.57614424T>G" "" "pathogenic" ""
"0000630999" "0" "79" "11" "57367791" "57367802" "del" "0" "03256" "SERPING1_000783" "g.57367791_57367802del" "" "" "" "" "In-frame deletion variant.\r\nc.491_502del variant has been considered as likely pathogenic (ATS GeneTech Pvt Ltd, Hyderabad India)." "Germline/De novo (untested)" "yes" "rs1590822719" "0" "" "" "g.57600318_57600329del" "{CV:000633776}" "likely pathogenic" "ACMG"
"0000631000" "0" "70" "11" "57379343" "57379343" "subst" "0" "03256" "SERPING1_000784" "g.57379343C>G" "" "" "" "" "" "CLASSIFICATION record" "" "rs368990869" "0" "" "" "g.57611870C>G" "{CV:000450648}" "VUS" "ACMG"
"0000631001" "0" "77" "11" "57381798" "57381798" "subst" "0" "03256" "SERPING1_000785" "g.57381798T>G" "" "" "" "" "In-silico splice prediction models predict that c.1250-3 T>G damages the natural acceptor site and leads to abnormal gene splicing. In the absence of RNA/cellular biology studies, the actual effect of this sequence change in this individual is unknown." "Germline" "" "rs1554996812" "0" "" "" "g.57614325T>G" "{CV:000451758}" "VUS" "ACMG"
"0000631826" "0" "99" "11" "57365567" "57365567" "subst" "0" "03256" "SERPING1_000786" "g.57365567G>T" "" "{DOI:Vatsiou 2020:10.1016/j.alit.2019.12.009}" "" "" "The c.-22-155G>T variant introduces in the genome a new donor site stronger than the wild type leading to a larger exon 1 in the RNA level.\r\nThe c.-22-155G>T variant disrupts an ISS recognized by a number of transcriptional factors and subsequently stops the suppression of the intronic cryptic donor site.\r\nTranscriptional analysis indicated that the mutant mRNA is susceptible to degradation.\r\nThe c.-22-155G > T variant co-segregated with C1-INH-HAE in all of the 4 analyzed patients, while it was absent from 3 healthy family members.\r\nThe c.-22-155G > T variant meets ACMG criteria to be considered pathogenic: PS3, PS4, PM2, PP1_Str, PP3, PP4" "Germline" "yes" "rs1945307391" "0" "" "" "g.57598094G>T" "{CV:000870444}" "pathogenic" "ACMG"
"0000631880" "0" "99" "11" "57367614" "57367617" "dup" "0" "03256" "SERPING1_000787" "g.57367614_57367617dup" "" "{DOI:Maia 2019:10.1111/all.13699} {DOI:Veronez 2021:10.1016/j.jaip.2020.11.039} {DOI:Ferriani 2025:10.1016/j.jaip.2025.08.026}" "" "" "Loss of function variant with low functional C1-INH in plasma of patients with hereditary angioedema symptoms." "Germline" "yes" "rs1945331796" "0" "" "" "g.57600141_57600144dup" "{CV:000979214}" "pathogenic" "ACMG"
"0000632024" "0" "99" "11" "57374404" "57374404" "subst" "0" "03256" "SERPING1_000788" "g.57374404A>G" "" "{DOI:Hujová 2020:10.1007/s10875-020-00753-2} {DOI:Germenis 2020:10.1007/s10875-020-00887-3} {DOI:Szabó 2022:10.3389/falgy.2022.836465} {DOI:Hida 2023:10.1111/1346-8138.16817} {DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "" "" "A deep-intronic variant resulting in creation of a new donor splice site, with a subsequent pseudoexon inclusion (6C\') by detection of a +89 bp prolonged alternative exon 6, with subsequent frameshift and PTC, and the transcript degraded by NMD. Transcripts observed in minigene assay are absent in RT-PCR on patient PBMCs, indicating NMD. \r\nThe proximal part of intron 6 is a region potentially prone to pseudoexon-activating mutations, since natural alternative exons and additional cryptic sites occur therein.\r\nThe c.1029+384A>G variant is considered pathogenic according to ACMG criteria PS3, PS4, PM2, PP1, PP3, PP4, PP5" "Germline" "yes" "rs1945416520" "0" "" "" "g.57606931A>G" "{CV:000870445}" "pathogenic" "ACMG"
"0000648311" "1" "53" "11" "57365748" "57365748" "subst" "0.00128084" "03575" "SERPING1_000002" "g.57365748C>T" "0.001315 (GnomAD v4)" "{PMID:Narang 2020:32906206} {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 14 heterozygous, no homozygous; {DB:CLININrs185342631}" "Germline" "" "rs185342631" "0" "" "" "g.57598275C>T" "{CV-SCV:000898969.3}" "VUS" ""
"0000656817" "0" "30" "11" "57367433" "57367433" "subst" "6.90305E-5" "02326" "SERPING1_000789" "g.57367433G>T" "0.00005266" "" "" "SERPING1(NM_000062.2):c.133G>T (p.V45F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "rs143231506" "0" "" "" "g.57599960G>T" "{CV-SCV:001620045.5}" "likely benign" ""
"0000656818" "0" "30" "11" "57373565" "57373565" "subst" "0.00011776" "01943" "SERPING1_000790" "g.57373565C>T" "" "" "" "SERPING1(NM_000062.2):c.768C>T (p.D256=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.57606092C>T" "" "likely benign" ""
"0000667723" "0" "99" "11" "57379362" "57379362" "subst" "0" "03256" "SERPING1_000791" "g.57379362T>C" "0.000004 (TOPMED)" "{DOI:Guryanova 2019:10.29235/1814-6023-2019-16-3-349-356} {DOI:Guryanova 2021:10.1186/s12948-021-00141-0} {DOI:Ryø 2023:10.1016/j.jaci.2023.04.023}" "" "" "Four families are carrying c.1202T>C variant from Belarus, with a de novo situation of a 4y heterozygous boy presenting with mild clinical phenotype, France (non published), Turkey (two homozygous female patients) and from Russia (compound heterozygous situation c.[1202T>C;1477G>C]).\r\np.(Ile401Thr) has been ascribed as a dominant-negative variant, because p.(Ile401Thr) variant product accumulates into cell, affecting transport and secretion of normal C1-INH.\r\nIle379 residue is localized at the N-terminus of sheet 6A; a Ile to Thr transition might affect the gate functional region, ie. a mobile region where sheet swings open to accept RCL during loop insertion, with an increased susceptibility to oligomerization.\r\nc.1202T>C variant meets the ACMG criteria PS2_Str, PS4, PM2, PM5, PP1, PP2, PP3, PP4_Mod, PP5_Mod with a consideration as pathogenic according to hg38 InterVar; however its incomplete penetrance in the Turkish family with two homozygous carriers - an incomplete penetrance shown by heterozygous individuals - is in line with a BS2 criterion.\r\nIntroduced in ClinVar as likely pathogenic variant by Research Centre For Medical Genetics, Moscow Russia." "De novo" "no" "rs1263371770" "0" "" "" "g.57611889T>C" "{CV-SCV:005367817.1}" "pathogenic" "ACMG"
"0000674989" "11" "33" "11" "57379205" "57379205" "subst" "6.49942E-5" "00006" "SERPING1_000128" "g.57379205C>T" "0.00008736 (gnomAD v4)" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "c.[5C>T];[1045C>T]" "Compound heterozygous proband presenting with a HAE of the intermediate type.\r\nBoth variants are in trans, c.5C>T maternal allele/c.1045C>T paternal allele, both parents are asymptomatic, suggesting that p.(Leu349Phe) does not impair C1-INH expression and function.\r\nLeu327 is a conserved position among serpins (76%); Leu327 is located at the C-terminus of sheet s2B, within the breach functional domain. Leu327 packs against conserved positions in s3A (Tyr272, Trp277), and possibly makes H-bonding with P14 in serpin-protease associated structure.\r\nLeu to Phe transition introduces an aromatic side chain that likely generates clashes between Leu327 and Trp277 that could disturb the conformation of S3A and thereby disrupt the RCL insertion into the shutter region.\r\np.Leu349Phe intolerant by SIFT, probably damaging by PolyPhen, disease causing by MutationTaster. \r\nProposed ACMG criteria PS3, PP3, PM3.\r\nSubmitted to ClinVar as likely benign by InVitae, San Francisco CA, without any reference to bioinformatic support, and as VUS by PreventionGenetics Marshfield WI." "Germline" "no" "rs141075266" "0" "" "" "g.57611732C>T" "{CV-SCV:004712162.2}" "VUS" ""
"0000674990" "2" "99" "11" "57373944" "57373944" "subst" "0" "00006" "SERPING1_000559" "g.57373944C>G" "" "{DOI:Xu 2018:10.4168/aair.2018.10.3.285}" "" "c.[49G>A(;)953C>G]" "Variant c.953C>G is pathogenic, with more severe phenotype in a compound heterozygous c.[49G>A(;)953C>G] with variant c.49G>A.\r\nAs expressed in the HepG2 cell line, the cis configuration c.[49G>A;953C>G] significantly displays lower function of recombinant C1-INH than the single c.953CG" "{CV:000252942}" "pathogenic (dominant)" "ACMG"
"0000679226" "0" "30" "11" "57373654" "57373654" "subst" "1.21821E-5" "01943" "SERPING1_000792" "g.57373654G>A" "0.00001239" "" "" "SERPING1(NM_000062.2):c.857G>A (p.R286H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "rs762750068" "0" "" "" "g.57606181G>A" "" "likely benign" ""
"0000687265" "0" "99" "11" "57364832" "57364832" "" "0" "03256" "SERPING1_000731" "g.(57364832?)_(57382477?)del" "" "{DOI:Ebo 2019:10.1016/j.jaip.2018.10.005}" "" "9.3 Mb interstitial deletion of chromosome 11 including at least a small sequence of the short arm and a larger region of the long arm and encompassing exons 1 to 8" "" "De novo" "yes" "" "0" "" "" "g.(57597359?)_(57615004?)del" "" "pathogenic" "ACMG"
"0000693803" "0" "99" "11" "57367727" "57367727" "subst" "0" "03256" "SERPING1_000793" "g.57367727G>A" "" "{DOI:Nabilou 2020:10.1080/08820139.2020.1817068}" "" "" "" "Germline" "?" "" "0" "" "" "g.57600254G>A" "" "likely pathogenic" ""
"0000693804" "3" "97" "11" "57367740" "57367740" "subst" "0" "03256" "SERPING1_000794" "g.57367740T>A" "" "{DOI:Nabilou 2020:10.1080/08820139.2020.1817068}" "" "c.[440T>A];[440T>A]" "Symptomatic male proband.\r\nAsymptomatic heterozygous parents." "Germline" "?" "" "0" "" "" "g.57600267T>A" "" "likely pathogenic (recessive)" "ACMG"
"0000693939" "0" "99" "11" "57369607" "57369607" "del" "0" "03256" "SERPING1_000795" "g.57369607del" "" "{DOI:Grodecká 2017:10.1016/j.clim.2017.03.010} {DOI:Nabilou 2020:10.1080/08820139.2020.1817068} {DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57602134del" "" "pathogenic" "ACMG"
"0000694133" "0" "77" "11" "57379356" "57379356" "subst" "0" "03256" "SERPING1_000796" "g.57379356C>A" "" "{DOI:Nabilou 2020:10.1080/08820139.2020.1817068}" "" "" "Pro377 is a highly conserved position among serpins (97%) located at the C-terminus of β-sheet C (s2C); gate, hinge functional structures; in a buried hydrophobic environment and in the native C1Inh packs against conserved positions in s4C (Phe291), s3C (Val300, Met302) and distal hinge (Phe455). A Pro to His substitution could likely disrupt C1 Inh structure." "Germline" "" "" "0" "" "" "g.57611883C>A" "" "pathogenic" "ACMG"
"0000697191" "0" "77" "11" "57365752" "57365752" "del" "0" "03256" "SERPING1_000797" "g.57365752del" "" "" "" "" "No functional evidence for this variant.\r\nNo familial identification was provided by the submitter Genatak Kuwait city Kuwait" "CLASSIFICATION record" "" "rs1945310324" "0" "" "" "g.57598279del" "{CV:000830237}" "likely pathogenic" ""
"0000697922" "0" "99" "11" "57365791" "57365791" "subst" "0" "03256" "SERPING1_000798" "g.[57365791T>G;57365797A>G]" "" "{DOI:López-Lera 2011:10.1016/j.molimm.2011.07.010}" "" "" "The variant c.51+3A>G is cis-linked to an unreported synonymous polymorphism c.48T>G, in the 3\' end of exon 2. It partially restores the wild-type splicing pattern, with a subsequent individual processing of exon 3." "Germline" "" "" "0" "" "" "g.[57598318T>G;57598324A>G]" "" "pathogenic" ""
"0000704464" "0" "99" "11" "57367489" "57367490" "ins" "0" "03256" "SERPING1_000799" "g.57367489_57367490insG" "" "{DOI:Jindal 2021:10.1111/PAI.13420}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.57600016_57600017insG" "" "likely pathogenic" "ACMG"
"0000704465" "0" "77" "11" "57373666" "57373666" "subst" "0" "03256" "SERPING1_000800" "g.57373666T>A" "" "{DOI:Jindal 2021:10.1111/PAI.13420}" "" "" "" "Germline" "" "" "0" "" "" "g.57606193T>A" "" "likely pathogenic" ""
"0000704466" "0" "99" "11" "57379260" "57379260" "subst" "0" "03256" "SERPING1_000801" "g.57379260T>A" "" "{DOI:Jindal 2021:[2]}" "" "" "" "Germline/De novo (untested)" "yes" "" "0" "" "" "g.57611787T>A" "" "pathogenic" ""
"0000704467" "0" "99" "11" "57379206" "57379206" "subst" "0" "03256" "SERPING1_000802" "g.57379206T>C" "" "{DOI:Jindal 2021:10.1111/PAI.13420} {DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "" "" "Leu327 residue located in a highly conserved position among serpins (76%).\r\nBreach domain. \r\nLeu327 packs against conserved positions Tyr272 and Trp277. Leu to Phe transition introduces a rigid pyrrolidine ring that constrains the main chain dihedral angle and restricts the conformation that likely generates clashes between Leu327 and Trp277 and thereby disrupts the RCL insertion into the shutter region.\r\np.(Leu349Pro) characterized as Intolerant by SIFT, Damaging by PolyPhen and Disease causing by MutationTaster" "Germline" "yes" "" "0" "" "" "g.57611733T>C" "" "pathogenic" "ACMG"
"0000704468" "0" "99" "11" "57381835" "57381835" "subst" "0" "03256" "SERPING1_000803" "g.57381835T>A" "" "{DOI:Jindal 2021:10.1111/PAI.13420} {DOI:Hashimura 2021:10.1111/all.15034}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57614362T>A" "" "pathogenic" "ACMG"
"0000704527" "0" "99" "11" "57381894" "57381895" "ins" "0" "03256" "SERPING1_000804" "g.57381894_57381895insTGA" "" "{DOI:Jindal 2021:10.1111/pai.13420}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57614421_57614422insTGA" "" "pathogenic" "ACMG"
"0000704528" "0" "77" "11" "57381980" "57381980" "subst" "0" "03256" "SERPING1_000805" "g.57381980T>G" "" "{DOI:Jindal 2021:10.1111/pai.13420}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57614507T>G" "" "likely pathogenic" ""
"0000704529" "0" "99" "11" "57373482" "57373482" "subst" "0" "03256" "SERPING1_000806" "g.57373482G>A" "" "{DOI:Hashimura 2021:10.1111/all.15034} {DOI:Veronez 2021:10.1016/j.jaip.2020.11.039} {DOI:Wang 2022:10.1186/s41065-022-00242-z} {DOI:Shchagina 2024:10.3390/biomedicines12010072}" "" "" "c.686-1G>A affects the canonical acceptor splice site, with subsequent skipping of exon 5" "Germline" "yes" "rs1945404833" "0" "" "" "g.57606009G>A" "{CV:000979216} {CV-RCV:001258391}" "pathogenic" "ACMG"
"0000704547" "0" "11" "11" "57373474" "57373474" "subst" "0.00101114" "03256" "SERPING1_000807" "g.57373474T>C" "0.0004673 (gnomAD)" "" "" "" "" "CLASSIFICATION record" "" "rs141593943" "0" "" "" "g.57606001T>C" "{CV-SCV:007345616.1}" "benign" "ACMG"
"0000704553" "0" "31" "11" "57373304" "57373304" "subst" "0" "03256" "SERPING1_000808" "g.57373304A>G" ">0.05 (1000 Genomes Project)" "{DOI:Germenis 2020:10.1007/s10875-020-00887-3}" "" "" "" "Germline" "" "rs189335964" "0" "" "" "g.57605831A>G" "{CV:000983252}" "likely benign" "ACMG"
"0000708308" "0" "99" "11" "57365787" "57365787" "del" "0" "03256" "SERPING1_000809" "g.57365787del" "" "{DOI:Liu 2019:10.1684/ejd.2018.3487} {DOI:Xu 2020:0.1186/s13601-020-00360-9} {DOI:Wang 2022:10.1186/s41065-022-00242-z.}" "" "" "Introduce in ClinVar as pathogenic by Research Centre for Medical Genetics, Moscow Russia. Variant c.44del meets ACMG/ClinGen criteria to be classified as pathogenic: PVS1, PS4_Mod, PP4_Mod, PM2_Sup." "Germline" "yes" "rs2495421134" "0" "" "" "g.57598314del" "{CV-SCV:005088166.1}" "likely pathogenic" "ACMG"
"0000708309" "0" "77" "11" "57367838" "57367838" "subst" "0" "03256" "SERPING1_000810" "g.57367838C>T" "" "{DOI:Xu 2020:0.1186/s13601-020-00360-9} {DOI:Liu 2019:10.1684/ejd.2018.3487} {DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "" "Introduced in ClinVar as a likely pathogenic variant by Peking Union Medical College Hospital" "Germline" "yes" "rs2135308831" "0" "" "" "g.57600165C>T" "{CV-SCV:001977591.1}" "likely pathogenic" "ACMG"
"0000708311" "0" "79" "11" "57373584" "57373584" "dup" "0" "03256" "SERPING1_000811" "g.57373584dup" "" "{DOI:Xu 2020:0.1186/s13601-020-00360-9}" "" "c.786_787insT" "" "Germline" "yes" "" "0" "" "" "g.57606111dupT" "" "likely pathogenic" "ACMG"
"0000708313" "0" "79" "11" "57373930" "57373930" "del" "0" "03256" "SERPING1_000812" "g.57373930del" "" "{DOI:Xu 2020:0.1186/s13601-020-00360-9} {DOI:Liu 2019:10.1684/ejd.2018.3487}" "" "" "" "Germline" "" "" "0" "" "" "g.57606457del" "" "likely pathogenic" "ACMG"
"0000708314" "0" "79" "11" "57379374" "57379383" "del" "0" "03256" "SERPING1_000813" "g.57379374_57379383del" "" "{DOI:Xu 2020:0.1186/s13601-020-00360-9} {DOI:Liu 2019:10.1684/ejd.2018.3487}" "" "c.1214_1223delCCAGCCAGGA" "" "Germline" "" "" "0" "" "" "g.57611901_57611910del" "" "likely pathogenic" "ACMG"
"0000708489" "0" "55" "11" "57365113" "57365113" "subst" "0" "03256" "SERPING1_000815" "g.57365113C>A" "0.00006 (TOPMed)" "" "" "" "" "CLASSIFICATION record" "" "rs886048397" "0" "" "" "g.57597640C>A" "{CV:000305010}" "VUS" "ACMG"
"0000708494" "0" "99" "11" "57373893" "57373893" "del" "0" "03256" "SERPING1_000816" "g.57373893del" "" "{DOI:Veronez 2021:10.1016/j.jaip.2020.11.039}" "" "" "Predicted loss-of-function associated with low C1-INH plasma levels in patients with hereditary angioedema symptoms." "Germline" "" "rs1945410259" "0" "" "" "g.57606420del" "{CV:000979217}" "pathogenic" "ACMG"
"0000708495" "0" "99" "11" "57373976" "57373976" "subst" "0" "03256" "SERPING1_000817" "g.57373976A>T" "" "{DOI:Veronez 2021:10.1016/j.jaip.2020.11.039} {DOI:Ferriani 2025:10.1016/j.jaip.2025.08.026}" "" "" "" "De novo" "yes" "rs1945411910" "0" "" "" "g.57606503A>T" "{CV:000979218}" "pathogenic" "ACMG"
"0000708496" "0" "99" "11" "57379393" "57379394" "ins" "0" "03256" "SERPING1_000818" "g.57379393_57379394insTC" "" "{DOI:Veronez 2021:10.1016/j.jaip.2020.11.039} {DOI:Ferriani 2025:10.1016/j.jaip.2025.08.026}" "" "" "" "Germline" "yes" "rs1945481508" "0" "" "" "g.57611920_57611921insTC" "{CV:000979219}" "pathogenic" "ACMG"
"0000708497" "0" "70" "11" "57381960" "57381960" "subst" "0" "03256" "SERPING1_000819" "g.57381960T>A" "" "" "" "" "" "CLASSIFICATION record" "" "" "0" "" "" "g.57614487T>A" "{CV:000877134}" "VUS" "ACMG"
"0000708498" "0" "79" "11" "57381960" "57381960" "del" "0" "03256" "SERPING1_000820" "g.57381960del" "" "" "" "" "Submitted to ClinVar as likely pathogenic by GeneDx, Gaithersburg MD" "Germline" "" "rs1590831492" "0" "" "" "g.57614487del" "{CV:000817083}" "likely pathogenic" "ACMG"
"0000708499" "0" "55" "11" "57382004" "57382004" "subst" "3.25198E-5" "03256" "SERPING1_000821" "g.57382004C>G" "0.00001611 (gnomAD V4) 0.00003 (ExAC) 0.00005 (TOPMed)" "" "" "" "Conflicting interpretations of pathogenicity in ClinVar, between VUS (CeGaT, Tübingen) and likely benign (InVitae)" "Germline/De novo (untested)" "" "rs143997164" "0" "" "" "g.57614531C>G" "{CV:000806677}" "VUS" ""
"0000708695" "0" "13" "11" "57367859" "57367859" "subst" "0.000320821" "03256" "SERPING1_000822" "g.57367859C>G" "0.0007891 (gnomAD v4) 0.00024 (ExAC)" "" "" "" "" "CLASSIFICATION record" "" "rs201294420" "0" "" "" "g.57600386C>G" "{CV:000695507}" "likely benign" "ACMG"
"0000708703" "0" "30" "11" "57382120" "57382120" "subst" "0" "03256" "SERPING1_000823" "g.57382120T>C" "" "" "" "" "" "CLASSIFICATION record" "" "" "0" "" "" "g.57614647T>C" "{CV:000878165}" "VUS" "ACMG"
"0000712715" "0" "99" "11" "57367379" "57367379" "dup" "0" "03256" "SERPING1_000825" "g.57367379dup" "" "{DOI:Obtulowicz 2020:10.5114/ceji.2020.101252}" "" "c.79dupA" "" "Germline" "yes" "" "0" "" "" "g.57599906dup" "" "pathogenic" "ACMG"
"0000712717" "0" "99" "11" "57367478" "57367478" "del" "0" "03256" "SERPING1_000826" "g.57367478del" "" "{DOI:Ponard 2019:10.1002/humu.23917} {DOI:Obtulowicz 2020:10.5114/ceji.2020.101252}" "" "c.177delC; Obtulowicz 2020" "Variant c.178del introduced in ClinVar as pathogenic by LabCorp Genetics, San Francisco CA" "Germline" "yes" "" "0" "" "" "g.57600005del" "{CV-SCV:007374956.1}" "pathogenic" "ACMG"
"0000712718" "0" "99" "11" "57367763" "57367763" "subst" "0" "03256" "SERPING1_000827" "g.57367763C>G" "" "{DOI:Obtulowicz 2020:10.5114/ceji.2020.101252}" "" "" "Phe133 position is located at the C-terminus of helix A." "De novo" "yes" "" "0" "" "" "g.57600290C>G" "" "likely pathogenic" "ACMG"
"0000714147" "0" "99" "11" "57367785" "57367798" "delins" "0" "03256" "SERPING1_000828" "g.57367785_57367798delinsTGCTGAGA" "" "{DOI:Obtulowicz 2020:10.5114/ceji.2020.101252}" "" "" "In-frame delins variant" "Germline" "yes" "" "0" "" "" "g.57600312_57600325delinsTGCTGAGA" "" "pathogenic" "ACMG"
"0000714148" "0" "99" "11" "57367839" "57367840" "dup" "0" "03256" "SERPING1_000829" "g.57367839_57367840dup" "" "{DOI:Obtulowicz 2020:10.5114/ceji.2020.101252}" "" "c.540_541insAG" "Published as c.540_541insAG (Obtulowicz 2020)" "Germline" "yes" "" "0" "" "" "g.57600366_57600367dup" "" "pathogenic" "ACMG"
"0000714754" "0" "99" "11" "57369510" "57369510" "dup" "0" "03256" "SERPING1_000830" "g.57369510dup" "" "{DOI:Obtulowicz 2020:10.5114/ceji.2020.101252}" "" "c.553_554insG" "" "Germline" "yes" "" "0" "" "" "g.57602037dup" "" "likely pathogenic" "ACMG"
"0000714759" "0" "99" "11" "57369579" "57369579" "subst" "0" "03256" "SERPING1_000521" "g.57369579C>T" "0.00022 (gnomAD, exomes) 0.00017 (ExAC) 0.00022 (TOPMed)" "{DOI:Loules 2018:10.1016/j.gene.2018.05.029} {DOI:Obtulowicz 2020:10.5114/ceji.2020.101252}" "" "" "The c.622C>T variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PVS1, PP4_Str, PS4_Mod, PM2_Sup" "Germline" "yes" "rs137854583" "0" "" "" "g.57602106C>T" "{CV-SCV:005073719.1}" "pathogenic" "ACMG"
"0000714938" "0" "99" "11" "57373530" "57373530" "dup" "0" "03256" "SERPING1_000831" "g.57373530dup" "" "{DOI:Obtulowicz 2020:10.5114/ceji.2020.101252}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57606057dup" "" "likely pathogenic" "ACMG"
"0000714939" "0" "99" "11" "57373981" "57373981" "subst" "0" "03256" "SERPING1_000832" "g.57373981C>G" "" "{PMID:Verpy 1996:8755917} {DOI:Obtulowicz 2020:10.5114/ceji.2020.101252}" "" "" "Variant introduced in the Lund SERPING1 database https://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "" "0" "" "" "g.57606508C>A" "" "likely pathogenic" "ACMG"
"0000714972" "0" "99" "11" "57381879" "57381879" "subst" "0" "03256" "SERPING1_000833" "g.57381879A>C" "" "{DOI:Obtulowicz 2020:10.5114/ceji.2020.101252}" "" "HGMD CM04572 has been erroneously introduced by Obtulowicz 2020; the reference is associated with c.1334C>G" "His421 is a conserved position among serpins (78%), located in sheet 5A, shutter functional domain, suggested to develop H-bonding with conserved Asn269 and to pack against conserved position Leu388." "Germline" "yes" "" "0" "" "" "g.57614406A>C" "" "likely pathogenic" "ACMG"
"0000729710" "0" "99" "11" "57373482" "57374021" "dup" "0" "03256" "SERPING1_000834" "g.(57369643_57373482)_(57374021_57379189)dup" "" "{DOI:Obtulowicz 2020:10.5114/ceji.2020.101252} {DOI:Grombikirova 2023:10.1007/s10875-023-01565-w}" "" "EX5_6dup" "" "Germline" "yes" "" "0" "" "" "g.(57602170_57606009)_(57606548_57611716)dup" "{CV:VCV001398010.3}" "pathogenic" "ACMG"
"0000729711" "0" "99" "11" "57379410" "57382054" "" "0" "03256" "SERPING1_000835" "g.(57379410_57382054)del" "" "{DOI:Obtulowicz 2020:10.5114/ceji.2020.101252} {DOI:Markocsy 2024:10.1016/j.waojou.2024.100885}" "" "exon 8 deletion" "Exon 8 deletion without identified boundaries" "Germline" "yes" "" "0" "" "" "g.(57611937_57614581)del" "" "pathogenic" "ACMG"
"0000730108" "0" "70" "11" "57365240" "57365240" "subst" "0" "03256" "SERPING1_000334" "g.57365240T>C" "0.0052 (TOPMED); 0.00527 (GnomAD); 0.0012 (6/5008, 1000G)" "{DOI:Roche 2005:10.1002/humu.20197}" "" "c.-504T>C" "Uncharacterized sequence variant at intron 1. \r\nFound in one patient and one affected relative. Co-segregates with disease." "Germline" "yes" "rs183957596" "0" "" "" "g.57597767T>C" "" "VUS (!)" ""
"0000731370" "0" "99" "11" "57365791" "57365791" "del" "0" "03256" "SERPING1_000836" "g.57365791del" "" "{DOI:Loli‐Ausejo 2021:10.1007/s12016-021-08834-9}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57598318del" "" "pathogenic" "ACMG"
"0000731580" "0" "70" "11" "57379210" "57379210" "subst" "0" "03256" "SERPING1_000837" "g.57379210C>G" "" "{DOI:Loli-Ausejo 2021:10.1007/s12016-021-08834-9}" "" "" "" "Germline" "" "" "0" "" "" "g.57611737C>G" "" "VUS" "ACMG"
"0000731582" "0" "99" "11" "57365183" "57382317" "del" "0" "03256" "SERPING1_000838" "g.57365183_57382317del" "" "{DOI:Loli-Ausejo 2021:10.1007/s12016-021-08834-9}" "" "" "" "Germline" "" "" "0" "" "" "g.57597710_57614844del" "" "pathogenic" "ACMG"
"0000760957" "20" "50" "11" "57382111" "57382111" "subst" "0" "03256" "SERPING1_000839" "g.57382111C>G" "" "{DOI:Loules 2020:10.3390/jcm9113402}" "" "" "nlC1-INH-HAE association. Variant c.*57C>G has been found combined with other alleles, as follows BDKRB1, c.844C>T; CPN1, c.1219G>A;p.(Glu407Lys); PLAUR, c.802A>G;p.(Met268Val); MASP1, c.2039T>C;p.(Val680Ala); TLR4, c.842G>A;p.(Cys281Tyr); MPO, c.1571G>A;p.(Arg524His)" "Germline" "yes" "" "0" "" "" "g.57614638C>G" "" "VUS" ""
"0000763347" "0" "99" "11" "57367820" "57367824" "del" "0" "03256" "SERPING1_000840" "g.57367820_57367824del" "" "{DOI:Guryanova 2021:10.1186/s12948-021-00141-0}" "" "c.520_524delATCGC" "" "Germline" "" "" "0" "" "" "g.57600347_57600351del" "" "pathogenic" "ACMG"
"0000763348" "0" "99" "11" "57369506" "57369506" "subst" "0" "03256" "SERPING1_000841" "g.57369506A>C" "" "{DOI:Guryanova 2021:10.1186/s12948-021-00141-0}" "" "" "c.551-2A>C variant affects the canonical splice acceptor site" "Germline" "yes" "rs113574262" "0" "" "" "g.57602033A>C" "" "pathogenic" "ACMG"
"0000763350" "0" "99" "11" "57369507" "57369643" "del" "0" "03256" "SERPING1_000748" "g.(57367851_57369507)_(57369643_57373482)del" "" "{DOI:Guryanova 2021:10.1186/s12948-021-00141-0}" "" "exon-4 deletion of unknown length" "" "De novo" "yes" "" "0" "" "" "g.(57600378_57602034)_(57602170_57606009)del" "" "pathogenic" "ACMG"
"0000763351" "0" "99" "11" "57373541" "57373542" "del" "0" "03256" "SERPING1_000842" "g.57373541_57373542del" "" "{DOI:Guryanova 2021:10.1186/s12948-021-00141-0} {DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "c.744_745delCA" "" "Germline" "yes" "" "0" "" "" "g.57606068_57606069del" "" "pathogenic" "ACMG"
"0000763352" "0" "97" "11" "57373992" "57373992" "subst" "0" "03256" "SERPING1_000843" "g.57373992A>C" "0.000002" "{DOI:Guryanova 2021:10.1186/s12948-021-00141-0}" "" "" "A His to Pro transition at His312 likely disrupts the contribution to 60 Å2 with putative side chain-mediated interactions between C1-INH s1B and C1s loop B.\r\nDiagnosis of C1-INH-HAE of the proband has been based on personal and/or family history of angioedema and on C1-INH function and antigenic C1-INH lower than 50% of normal.\r\nThe c.1001A>C variant in SERPING1 meets ACMG/ClinGen criteria to be classified as likely pathogenic: PP4_Mod, PS4_Sup, PM2_Sup, PP2, PP3." "Germline" "yes" "rs766491693" "0" "" "" "g.57606518A>C" "{CV-SCV:005061755.2}" "likely pathogenic" "ACMG"
"0000763363" "0" "79" "11" "57379197" "57379197" "subst" "0" "03256" "SERPING1_000844" "g.57379197A>C" "" "{DOI:Guryanova 2021:10.1186/s12948-021-00141-0}" "" "" "" "De novo" "" "" "0" "" "" "g.57611724A>C" "" "likely pathogenic" "ACMG"
"0000763364" "0" "99" "11" "57381844" "57381844" "del" "0" "03256" "SERPING1_000845" "g.57381844del" "" "{DOI:Guryanova 2021:10.1186/s12948-021-00141-0}" "" "c.1293delA" "The c.1293delA variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PVS1_Str, PP4_Str, PM2_Sup, PP1" "Germline" "yes" "" "0" "" "" "g.57614381del" "{CV-SCV:005088600.1}" "pathogenic" "ACMG"
"0000763380" "0" "31" "11" "57365794" "57365794" "subst" "0.00029223" "03256" "SERPING1_000846" "g.57365794G>C" "0.0001069 (gnomAD_v4); 0.00117 (exAC)" "" "" "" "Introduced in ClinVar as benign variant by Illumina Laboratory Services, Illumina San Diego CA" "CLASSIFICATION record" "" "rs199473715" "0" "" "" "g.57598321G>C" "{CV-SCV:000372549.3}" "benign" "ACMG"
"0000763381" "0" "11" "11" "57369730" "57369730" "subst" "0" "03256" "SERPING1_000847" "g.57369730G>A" "0.2092 (gnomAD v3); 0.19944 (TOPMed)" "{DOI:Vatsiou 2020:1016/j.alit.2019.12.009 }" "" "" "SPiP interpretation: No effect on splicing" "Germline" "" "rs11229063" "0" "" "" "g.57602257G>A" "{CV:VCV000092196.3} {CV-RCV:RCV001263125.1}" "benign" "ACMG"
"0000763384" "0" "11" "11" "57379170" "57379170" "subst" "0.582149" "03256" "SERPING1_000005" "g.57379170A>G" "0.6526 (gnomAD v4); 0.58664 (ExAC); 0.58436 (TOPMed)" "{PMID:Park 2009:19169411} {DOI:Gorin 2012:10.1016/j.mam.2012.04.004} {DOI:Moreno 2015:10.1016/j.jaci.2014.12.1576} {DOI:Vatsiou 2020:10.1016/j.alit.2019.12.009} {DOI:Hujová 2020:10.1007/s10875-020-00753-2}" "" "" "SPiP prediction: No effect on splicing.\r\nIdentified as benign by multiple submitters. The variation meets the ACMG criteria BA1, BS1, BS2, BP4, BP5, BP6" "Germline" "no" "rs2511988" "0" "" "" "g.57611697A>G" "{CV-SCV:001441216.2}" "benign" "ACMG"
"0000763389" "0" "10" "11" "57375463" "57375463" "subst" "0" "03256" "SERPING1_000848" "g.57375463G>C" "" "{DOI:Vatsiou 2020:10.1016/j.alit.2019.12.009}" "" "" "" "Germline" "no" "" "0" "" "" "g.57607990G>C" "{CV:VCV000983257.2}" "benign" "ACMG"
"0000763390" "0" "10" "11" "57375517" "57375517" "subst" "0" "03256" "SERPING1_000849" "g.57375517A>G" "" "{DOI:Vatsiou 2020:10.1016/j.alit.2019.12.009}" "" "" "" "Germline" "no" "" "0" "" "" "g.57608044A>G" "{CV:VCV000983258.2}" "benign" "ACMG"
"0000763391" "0" "10" "11" "57376130" "57376130" "subst" "0" "03256" "SERPING1_000850" "g.57376130T>C" "" "{DOI:Vatsiou 2020:10.1016/j.alit.2019.12.009}" "" "" "" "Germline" "no" "" "0" "" "" "g.57608657T>C" "{CV:VCV000983259.2}" "benign" "ACMG"
"0000763392" "0" "10" "11" "57376131" "57376131" "subst" "0" "03256" "SERPING1_000851" "g.57376131G>A" "" "{DOI:Vatsiou 2020:10.1016/j.alit.2019.12.009}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.57608658G>A" "{CV:VCV000983260.2}" "benign" "ACMG"
"0000763394" "0" "10" "11" "57374280" "57374280" "subst" "0" "03256" "SERPING1_000852" "g.57374280G>A" "0.00174" "{DOI:Vatsiou 2020:10.1016/j.alit.2019.12.009}" "" "" "The variation meets the ACMG criteria BA1, BS1, BS2, BP4, BP5, BP6" "Germline" "no" "rs191053716" "0" "" "" "g.57606807G>A" "{CV:VCV000983253.2}" "benign" "ACMG"
"0000763395" "0" "10" "11" "57374332" "57374332" "subst" "0" "03256" "SERPING1_000853" "g.57374332T>C" "0.2320" "{DOI:Vatsiou 2020:10.1016/j.alit.2019.12.009}" "" "" "This variation meets the ACMG criteria BA1, BS1, BS2, BP4, BP5, BP6" "Germline" "no" "rs11603020" "0" "" "" "g.57606859T>C" "{CV:VCV000983254.2}" "benign" "ACMG"
"0000763396" "0" "15" "11" "57374871" "57374871" "subst" "0" "03256" "SERPING1_000854" "g.57374871C>G" "" "{DOI:Vatsiou 2020:10.1016/j.alit.2019.12.009}" "" "" "" "Germline" "no" "" "0" "" "" "g.57607398C>G" "{CV-SCV:001441205-2}" "benign" "ACMG"
"0000763398" "0" "10" "11" "57374946" "57374946" "subst" "0" "03256" "SERPING1_000855" "g.57374946G>T" "" "{DOI:Vatsiou 2020:10.1016/j.alit.2019.12.009}" "" "" "" "Germline" "no" "" "0" "" "" "g.57607473G>T" "{CV:VCV000983256.2}" "benign" "ACMG"
"0000763399" "0" "10" "11" "57377992" "57377992" "subst" "0" "03256" "SERPING1_000856" "g.57377992G>T" "" "{DOI:Vatsiou 2020:10.1016/j.alit.2019.12.009}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.57610519G>T" "{CV:VCV000983233.2}" "benign" "ACMG"
"0000763440" "11" "99" "11" "57382031" "57382031" "subst" "0" "03256" "SERPING1_000008" "g.57382031C>T" "" "{DOI:Bork 2020:10.1111/ddg.14036}" "" "" "" "Germline" "" "rs922149386" "0" "" "" "g.57614558C>T" "{CV:VCV000626347.3}" "pathogenic" "ACMG"
"0000763547" "0" "50" "11" "57365119" "57365119" "dup" "0" "03256" "SERPING1_000857" "g.57365119dup" "0.001203 (TOPMed); 0.0080 (40/5008; 1000 Genome)" "" "" "" "" "Germline" "" "rs28362939" "0" "" "" "g.57597646dup" "{CV-SCV:000372541.2}" "likely benign" "ACMG"
"0000763579" "0" "99" "11" "57367495" "57367495" "del" "0" "03256" "SERPING1_000858" "g.57367495del" "" "{DOI:Veronez 2021:10.1016/j.jaip.2020.11.039} {DOI:Ferriani 2025:10.1016/j.jaip.2025.08.026}" "" "" "c.195del variant has been considered pathogenic in agreement with ACMG criteria PVS1, PS3, PS4, PM2, PP4.\r\nIntroduced in ClinVar as pathogenic by Division of Rheumatology, Allergy and Immunology, UCSD CA" "Germline" "yes" "rs1945329402" "0" "" "" "g.57600022del" "{CV-SCV:001435356.1}" "pathogenic" "ACMG"
"0000763580" "0" "50" "11" "57367704" "57367704" "subst" "4.06058E-6" "03256" "SERPING1_000859" "g.57367704G>A" "0.00001" "" "" "" "" "Germline" "" "rs762090349" "0" "" "" "g.57600231G>A" "{CV:VCV001026567.1}" "VUS" ""
"0000763581" "0" "99" "11" "57369533" "57369540" "dup" "0" "03256" "SERPING1_000814" "g.57369533_57369540dup" "" "{DOI:Veronez 2021:10.1016/j.jaip.2020.11.039}" "" "" "c.576_583dup variant meets the ACMG criteria to be characterized as pathogenic PVS1, PS2_Str, PS3, PS4, PP4, PP5" "De novo" "yes" "rs1945353409" "0" "" "" "g.57602060_57602067dup" "{CV-SCV:001435358.1}" "pathogenic" "ACMG"
"0000763833" "0" "70" "11" "57382040" "57382040" "subst" "4.0715E-6" "03256" "SERPING1_000860" "g.57382040G>A" "0.00001 (gnomAD)" "" "" "" "" "Germline" "" "rs1290828029" "0" "" "" "g.57614567G>A" "{CV:VCV001047070.1}" "VUS" "ACMG"
"0000763835" "0" "30" "11" "57381647" "57381647" "subst" "0" "03256" "SERPING1_000861" "g.57381647C>G" "" "{DOI:Vatsiou 2020:10.1016/j.alit.2019.12.009}" "" "" "Creation of an ISE" "Germline" "no" "" "0" "" "" "g.57614174C>G" "{CV:VCV000983244.2}" "benign" "ACMG"
"0000763836" "0" "30" "11" "57379256" "57379256" "subst" "1.62441E-5" "03256" "SERPING1_000862" "g.57379256C>T" "0.00001673" "" "" "" "" "Germline" "" "rs762832059" "0" "" "" "g.57611783C>T" "{CV-SCV:001511477.6}" "VUS" "ACMG"
"0000763837" "0" "77" "11" "57373970" "57373971" "delins" "0" "03256" "SERPING1_000863" "g.57373970_57373971delinsGTGCC" "" "" "" "" "Submitted to ClinVar as likely pathogenic by Greenwood Genetic Center, Greenwood SC" "Germline" "yes" "rs1945411643" "0" "" "" "g.57606497_57606498delinsGTGCC" "{CV-SCV:001468076.1}" "likely pathogenic" "ACMG"
"0000763838" "0" "70" "11" "57373669" "57373669" "subst" "4.06072E-6" "03256" "SERPING1_000864" "g.57373669A>G" "0.000003717 (gnomAD v4)" "" "" "" "Tolerated by SIFT\r\nPossibly damaging by PolyPhen\r\nIntroduced in ClinVar by Illumina San Diego CA as variant of unknown significance" "Germline" "" "rs754401203" "0" "" "" "g.57606196A>G" "{CV-SCV:001259300.1}" "VUS" "ACMG"
"0000765616" "0" "11" "11" "57367222" "57367222" "subst" "0" "03256" "SERPING1_000339" "g.57367222C>T" "0.38498 (12059/31324, GnomAD); 0.410264 (51516/125568, TOPMED)" "{DOI:Holcomb 2021:10.1371/journal.pcbi.1008805}" "" "" "SARSCoV2-SERPING1 gene interactions with\r\n1.) Mut gained hsa-miR-3944-5p (249)\r\n2.) Mut lost hsa-miR-6820-5p (247)" "In silico" "" "rs1005510" "0" "" "" "g.57599749C>T" "{CV:000983239}" "benign" "ACMG"
"0000765617" "0" "10" "11" "57368644" "57368644" "subst" "0" "03256" "SERPING1_000866" "g.57368644C>A" "0.39356 (12283/31210, GnomAD); 0.419096 (52625/125568, TOPMED)" "{DOI:Holcomb 2021:10.1371/journal.pcbi.1008805\r\n}" "" "" "SARSCoV2-SERPING1 gene interactions\r\n1.) Mut increase of target Score by 1 for hsa-miR-4731-5p" "In silico" "" "rs1812005" "0" "" "" "g.57601271C>A" "" "benign" ""
"0000765618" "0" "10" "11" "57370301" "57370301" "subst" "0" "03256" "SERPING1_000867" "g.57370301C>T" "0.39011 (11563/29640, GnomAD); 0.419008 (52614/125568, TOPMED)" "{DOI:Holcomb 2021:10.1371/journal.pcbi.1008805\r\n}" "" "" "SARSCoV2-SERPING1 gene interactions\r\nAnalysis\r\n1.) Mut gained hsa-miR-3944-5p (249)\r\n2.) Mut lost hsa-miR-6820-5p (247)\r\nMeta-analysis\r\n1.) Mut decrease of target score by 4 for hsa-miR-5683\r\n2.) Mut decrease of target score by 10 for hsa-miR-600" "In silico" "" "rs2432810" "0" "" "" "g.57602828C>T" "" "benign" ""
"0000765619" "0" "10" "11" "57370742" "57370742" "subst" "0" "03256" "SERPING1_000868" "g.57370742C>T" "0.22525 (6816/30260, GnomAD); 0.202568 (25436/125568, TOPMED)" "{DOI:Holcomb 2021:10.1371/journal.pcbi.1008805}" "" "" "SARSCoV2-SERPING1 gene interactions: meta-analysis\r\n1.) MUT increase of Target Score by 1 for hsa-miR-7151-3p" "In silico" "" "rs78364821" "0" "" "" "g.57603269C>T" "{CV-SCV:001441195.2}" "benign" ""
"0000765624" "0" "10" "11" "57374946" "57374946" "subst" "0" "03256" "SERPING1_000855" "g.57374946G>T" "0.22789 (7143/31344, GnomAD); 0.201357 (25284/125568, TOPMED)" "{DOI:Holcomb 2021:10.1371/journal.pcbi.1008805}" "" "" "SARSCoV2-SERPING1 gene interactions: data from a meta-analysis, with\r\n1.) Mut increase of target score by 10 for hsa-miR-3162-5p\r\n2.) Mut gained hsa-miR-4524a-3p" "In silico" "" "rs11229067" "0" "" "" "g.57607473G>T" "" "benign" "ACMG"
"0000765625" "0" "10" "11" "57375463" "57375463" "subst" "0" "03256" "SERPING1_000848" "g.57375463G>C" "0.22819 (7157/31364, GnomAD); 0.201421 (25292/125568, TOPMED)" "{DOI:Holcomb 2021:10.1371/journal.pcbi.1008805}" "" "" "SARSCoV2-SERPING1 gene interactions: data from a meta-analysis with\r\n1.) Mut increase of target score by 4 for hsa-miR-1238-5p\r\n2.) Mut increase of target score by 19 for hsa-miR-1261\r\n3.) Mut gained hsa-miR-3681-5p\r\n4.) Mut increase of target score by 11 for hsa-miR-376b-5p\r\n5.) Mut increase of target score by 11 for hsa-miR-376c-5p\r\n6.) Mut gained hsa-miR-4481-5p\r\n7.) Mut gained hsa-miR-4745-5p\r\n8.) Mut increase of target score by 4 for hsa-miR-4758-5p" "In silico" "" "rs78624400" "0" "" "" "g.57607990G>C" "" "benign" "ACMG"
"0000765626" "0" "10" "11" "57376130" "57376130" "subst" "0" "03256" "SERPING1_000850" "g.57376130T>C" "0.38798 (12095/31174, GnomAD); 0.416420 (52289/125568, TOPMED)" "{DOI:Holcomb 2021:10.1371/journal.pcbi.1008805}" "" "" "SARSCov2-SERPING1 gene interactions: data from an analysis, with\r\n1.) Mut target score decreased by 1 for hsa-miR-4756-5p (226)\r\n2.) Mut target score decreased by 1 for hsa-miR-4739 (226)\r\n3.) Mut target score decreased by 1 for hsa-miR-1321 (226)" "In silico" "" "rs2454659" "0" "" "" "g.57608657T>C" "" "benign" "ACMG"
"0000765627" "0" "10" "11" "57376131" "57376131" "subst" "0" "03256" "SERPING1_000851" "g.57376131G>A" "0.22697 (7086/31220, GnomAD); 0.201365 (25285/125568, TOPMED)" "{DOI:Holcomb 2021:10.1371/journal.pcbi.1008805}" "" "" "SARSCoV2-SERPING1 gene interactions: data from a meta-analysis, with\r\n1.) MUT increase of target score by 1 for hsa-miR-4756-5p\r\n2.) MUT increase of target score by 1 for hsa-miR-4739\r\n3.) MUT increase of target score by 1 for hsa-miR-1321\r\n4.) MUT gained hsa-miR-4736" "In silico" "" "rs138770460" "0" "" "" "g.57608658G>A" "" "benign" "ACMG"
"0000765628" "0" "10" "11" "57376947" "57376947" "subst" "0" "03256" "SERPING1_000869" "g.57376947T>G" "" "{DOI:Holcomb 2021:10.1371/journal.pcbi.1008805}" "" "" "SARSCoV2-SERPING1 gene interactions: data from an analysis, with\r\n1.) Mut target score decreased by 1 for hsa-miR-1298-3p (239)\r\n2.) Mut target score decreased by 1 for hsa-miR-6506-5p (101 237)\r\n3.) Mut lost hsa-miR-125b-2-3p (246)\r\n4.) Mut lost hsa-miR-6849-3p (73 253)\r\n5.) Mut target score increase by 29 for hsa-miR-6778-3p (114 282)" "In silico" "" "rs2508442" "0" "" "" "g.57609474T>G" "" "benign" ""
"0000765629" "0" "10" "11" "57377754" "57377754" "subst" "0" "03256" "SERPING1_000870" "g.57377754T>C" "0.00446 (140/31412, GnomAD); 0.005837 (733/125568, TOPMED)" "{DOI:Holcomb 2021:10.1371/journal.pcbi.1008805}" "" "" "SARSCoV2-SERPING1 gene interactions: data from an analysis, with\r\n1.) Mut gained hsa-miR-1229-5p (251)\r\n2.) Mut target score decrease by 8 for hsa-miR-3189-3p (254)" "In silico" "" "rs138906450" "0" "" "" "g.57610281T>C" "" "benign" ""
"0000765940" "0" "10" "11" "57383377" "57383377" "subst" "0" "03256" "SERPING1_000871" "g.57383377G>A" "0.22834 (7106/31120, GnomAD); 0.201461 (25297/125568, TOPMED)" "{DOI:Holcomb 2021:10.1371/journal.pcbi.1008805}" "" "" "SARSCoV2-SERPING1 gene interactions: a meta-analysis, with\r\n1.) MUT lost hsa-miR-196a-3p" "In silico" "" "rs11606677" "0" "" "" "g.57615904G>A" "" "benign" ""
"0000765941" "0" "10" "11" "57384668" "57384668" "subst" "0" "03256" "SERPING1_000872" "g.57384668A>T" "0.39419 (12290/31178, GnomAD); 0.426016 (53494/125568, TOPMED)" "{DOI:Holcomb 2021:10.1371/journal.pcbi.1008805}" "" "" "SARSCoV2-SERPING1 gene interactions: an analysis with\r\n1.) Mut gained hsa-miR-7151-3p (259)" "In silico" "" "rs2511985" "0" "" "" "g.57617195A>T" "" "benign" ""
"0000786037" "0" "99" "11" "57367614" "57367617" "del" "0" "03256" "SERPING1_000873" "g.57367614_57367617del" "" "{DOI:Cumming 2003:10.1136/jmg.40.10.e114}" "" "" "Variant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/\r\nc.314_317del variant considered pathogenic by Division of Rheumatology, Allergy and Immunology, UCSD California" "Germline" "yes" "rs1945331796" "0" "" "" "g.57600136-57600139del" "{CV-SCV:001435357.1}" "pathogenic" "ACMG"
"0000789639" "0" "79" "11" "57367521" "57367521" "subst" "0" "03256" "SERPING1_000874" "g.57367521C>A" "" "" "" "" "c.221C>A variant has been classified as pathogenic by InVitae, San Francisco CA" "Germline" "" "rs2135308212" "0" "" "" "g.57600048C>A" "{CV-SCV:001589292.3}" "pathogenic" ""
"0000789642" "0" "77" "11" "57381875" "57381875" "subst" "0" "03256" "SERPING1_000875" "g.57381875C>G" "" "" "" "" "Submitted to ClinVar as VUS by Baylor Genetics, Houston TX" "Germline" "" "rs1590831346" "0" "" "" "g.57614402C>G" "{CV:VCV001032160.1}" "VUS" "ACMG"
"0000794126" "0" "99" "11" "57365748" "57365749" "del" "0" "03256" "SERPING1_000876" "g.57365748_57365749del" "" "{DOI:Hashimura 2021:10.1111/all.15034}" "" "5_6delCC" "" "Germline" "" "" "0" "" "" "g.57598275_57598276del" "" "pathogenic" "ACMG"
"0000794127" "0" "99" "11" "57365760" "57365767" "dup" "0" "03256" "SERPING1_000877" "g.57365760_57365767dup" "" "{DOI:Hashimura 2021:10.1111/all.15034}" "" "17_24dupCCCTGCTG" "" "Germline" "" "" "0" "" "" "g.57598287_57598294dup" "" "pathogenic" "ACMG"
"0000794128" "0" "99" "11" "57367416" "57367417" "ins" "0" "03256" "SERPING1_000878" "g.57367416_57367417insGGATC" "" "{DOI:Hashimura 2021:10.1111/all.15034}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57599943_57599944insGGATC" "" "pathogenic" "ACMG"
"0000794129" "0" "99" "11" "57367447" "57367447" "del" "0" "03256" "SERPING1_000879" "g.57367447del" "" "{DOI:Hashimura 2021:10.1111/all.15034}" "" "147delT" "" "Germline" "yes" "" "0" "" "" "g.57599974del" "" "pathogenic" "ACMG"
"0000794130" "0" "99" "11" "57367504" "57367504" "del" "0" "03256" "SERPING1_000880" "g.57367504del" "" "{DOI:Hashimura 2021:10.1111/all.15034}" "" "" "" "Germline" "" "" "0" "" "" "g.57600031del" "" "pathogenic" "ACMG"
"0000794131" "0" "99" "11" "57367526" "57367526" "del" "0" "03256" "SERPING1_000881" "g.57367526del" "" "{DOI:Hashimura 2021:10.1111/all.15034}" "" "" "No effect on splicing" "Germline" "" "" "0" "" "" "g.57600102del" "" "pathogenic" ""
"0000794132" "0" "99" "11" "57367700" "57367704" "del" "0" "03256" "SERPING1_000882" "g.57367700_57367704del" "" "{DOI:Hashimura 2021:10.1111/all.15034}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57600227_57600231del" "" "pathogenic" "ACMG"
"0000794133" "0" "97" "11" "57367761" "57367765" "delins" "0" "03256" "SERPING1_000883" "g.57367761_57367765delinsTCAGGGAGGCTCTTCAA" "" "{DOI:Hashimura 2021:10.1111/all.15034}" "" "" "in frame insertion/deletion" "Germline" "" "" "0" "" "" "g.57600288_57600292delinsTCAGGGAGGCTCTTCAA" "" "VUS" "ACMG"
"0000794136" "0" "99" "11" "57367775" "57367775" "del" "0" "03256" "SERPING1_000884" "g.57367775del" "" "{DOI:Hashimura 2021:10.1111/all.15034}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57600302del" "" "pathogenic" "ACMG"
"0000794165" "0" "90" "11" "57369511" "57369512" "ins" "0" "03256" "SERPING1_000885" "g.57369511_57369512insTGTTGCAGGGGC" "" "{DOI:Hashimura 2021:10.1111/all.15034}" "" "" "in-frame insertion" "Germline" "" "" "0" "" "" "g.57602038_57602039insTGTTGCAGGGGC" "" "VUS" "ACMG"
"0000794166" "0" "99" "11" "57373549" "57373549" "subst" "0" "03256" "SERPING1_000886" "g.57373549T>A" "" "{DOI:Hashimura 2021:10.1111/all.15034}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57606076T>A" "" "pathogenic" ""
"0000794167" "0" "99" "11" "57373617" "57373617" "subst" "0" "03256" "SERPING1_000129" "g.57373617A>G" "" "{DOI:Zuraw 2000:10.1067/mai.2000.104780} {DOI:Pappalardo 2008:10.1016/j.molimm.2008.05.007} {DOI:Bafunno 2014:10.1111/ahg.12052} {DOI:Hashimura 2021:10.1111/all.15034} {DOI:Ryø 2023:10.1016/j.jaci.2023.04.023} {DOI:Mak 2025:10.1111/cea.70001} {DOI:Hisamoto 2026:10.1016/j.jdermsci.2026.03.005}" "" "" "Recurrent variant.\r\np.(Ile274Val) is a dominant-negative variant; p.(Ile274Val) variant product is secreted but partially accumulates into cell, affecting transport and secretion of normal C1-INH (Ryø et al 2023).\r\nIle252 residue is localized in a loop between helix F and sheet 3A in a highly conserved position among serpins (84%); a Ile to Val transition might affect the shutter functional region, ie. insertion into Aβ-sheet, with an increased susceptibility to oligomerization.\r\nIn addition the variant c.820A>G causes an aberrant splicing event with subsequent frameshift and premature termination codon. The truncated product p.274Ile_296Serdelfs*24 clearly shows a dominant-negative effect against the wild-type C1INH.\r\nACMG/ClinGen criteria PP4_Str, PS4_Mod, PS3_Str, PM2_Sup, PP2, PP3.\r\nIntroduced in ClinVar as likely pathogenic by Research Centre For Medical Genetics, Moscow Russia\r\nVariant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "yes" "" "0" "" "" "g.57606144A>G" "{CV-SCV:005196399.1}" "pathogenic (dominant)" "ACMG"
"0000794168" "0" "99" "11" "57373649" "57373649" "dup" "0" "03256" "SERPING1_000887" "g.57373649dup" "" "{DOI:Hashimura 2021:10.1111/all.15034}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57606176dup" "" "pathogenic" "ACMG"
"0000794169" "0" "99" "11" "57373956" "57373956" "subst" "0" "03256" "SERPING1_000888" "g.57373956T>G" "" "{DOI:Hashimura 2021:10.1111/all.15034}" "" "" "Val300 is a highly conserved position among serpins (80%), in a buried hydrophobic environment in sheet-3C with involvement in the gate functional domain; it packs against conserved positions of gate at s4C (Phe291), s3C (Met302), s2C (Pro377) and distal hinge (Pro476) in native C1-INH." "Germline" "" "" "0" "" "" "g.57606483T>G" "" "likely pathogenic" ""
"0000794170" "0" "99" "11" "57379188" "57379188" "subst" "0" "03256" "SERPING1_000889" "g.57379188A>G" "" "{DOI:Hashimura 2021:10.1111/all.15034} {DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "" "c.1030-2A>G variant likely affects the acceptor splice site, with a subsequent probable exon 7 skipping" "Germline" "yes" "" "0" "" "" "g.57611715A>G" "" "pathogenic" "ACMG"
"0000794171" "0" "77" "11" "57379279" "57379302" "del" "0" "03256" "SERPING1_000890" "g.57379279_57379302del" "" "{DOI:Hashimura 2021:10.1111/all.15034}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57611806_57611829del" "" "pathogenic" ""
"0000794174" "0" "99" "11" "57379317" "57379318" "del" "0" "03256" "SERPING1_000891" "g.57379317_57379318del" "" "{DOI:Hashimura 2021:10.1111/all.15034} {DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "" "The c.1157_1158del variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PVS1_Str, PM2_Sup, PP4.\r\nThis variant has been submitted to ClinVar as pathogenic by InVitae, San Francisco CA, and as likely pathogenic by Research Centre For Medical Genetics, Moscow Russia." "Germline" "yes" "rs2495452603" "0" "" "" "g.57611844_57611845del" "{CV-SCV:002761809.2}" "pathogenic" "ACMG"
"0000794175" "0" "99" "11" "57379344" "57379345" "del" "0" "03256" "SERPING1_000892" "g.57379344_57379345del" "" "{DOI:Hashimura 2021:10.1111/all.15034}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57611871_57611872del" "" "pathogenic" "ACMG"
"0000794176" "0" "79" "11" "57379379" "57379379" "subst" "0" "03256" "SERPING1_000893" "g.57379379C>T" "" "{DOI:Hashimura 2021:10.1111/all.15034}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57611906C>T" "" "pathogenic" "ACMG"
"0000794177" "0" "99" "11" "57381919" "57381921" "del" "0" "03256" "SERPING1_000894" "g.57381919_57381921del" "" "{DOI:Hashimura 2021:10.1111/all.15034}" "" "" "In-frame deletion of the P7 residue of the RCL likely to affect the target protease recognition" "Germline" "yes" "" "0" "" "" "g.57614446_57614448del" "" "pathogenic" "ACMG"
"0000794178" "0" "99" "11" "57381947" "57381947" "del" "0" "03256" "SERPING1_000895" "g.57381947del" "" "{DOI:Hashimura 2021:10.1111/all.15034}" "" "c.1396delC" "" "Germline" "yes" "" "0" "" "" "g.57614474del" "" "pathogenic" "ACMG"
"0000794179" "0" "99" "11" "57381996" "57381996" "subst" "0" "03256" "SERPING1_000896" "g.57381996G>A" "" "{DOI:Hashimura 2021:10.1111/all.15034}" "" "" "Another variant, c.1446G>A, recognized pathogenic, is presenting with the same nonsense change at codon 482.\r\nSubmitted to ClinVar as pathogenic by LabCorp Genetics, San Francisco CA" "Germline" "yes" "" "0" "" "" "g.57614523G>A" "{CV-SCV:004334613.1}" "pathogenic" "ACMG"
"0000794180" "0" "99" "11" "57382034" "57382036" "del" "0" "03256" "SERPING1_000897" "g.57382034_57382036del" "" "{DOI:Hashimura 2021:10.1111/all.15034}" "" "c.1483_1485delGTA" "" "Germline" "yes" "" "0" "" "" "g.557614561_7614563del" "" "pathogenic" "ACMG"
"0000794181" "0" "99" "11" "0" "0" "" "0" "03256" "SERPING1_000898" "g.(57367851_57369507)_(57382477?)del" "" "{DOI:Hashimura 2021:10.1111/all.15034}" "" "deletion of exon 4 to 8" "Genomic location of variant boundaries not been determined." "Germline" "yes" "" "0" "" "" "g.(57600378_57602034)_(57615004?)del" "" "pathogenic" "ACMG"
"0000794182" "0" "99" "11" "57367351" "57367851" "dup" "0" "03256" "SERPING1_000899" "g.(57365795_57367351)_(57367851_57369507)dup" "" "{DOI:Hashimura 2021:10.1111/all.15034}" "" "Duplication of exon 3" "a duplication encompassing exon 3, unknown length" "Germline" "yes" "" "0" "" "" "g.(57598322_57599878)_(57600378_57602034)dup" "" "pathogenic" "ACMG"
"0000794183" "0" "99" "11" "57369507" "57369643" "dup" "0" "03256" "SERPING1_000014" "g.(57367851_57369507)_(57369643_57373482)dup" "" "{DOI:Hashimura 2021:10.1111/all.15034}" "" "Duplication of exon 4" "A duplication of a genomic region encompassing exon 4, unknown length. Variant predicted to be in-frame, likely preserving the integrity of reading frame, with failed C1-INH expression, HAE type 1 clinical phenotype and loss of C1-INH function." "Germline" "yes" "" "0" "" "" "g.(57600378_57602034)_(57602170_57606009)dup" "" "pathogenic" "ACMG"
"0000794184" "0" "33" "11" "57365748" "57365748" "subst" "0.00128084" "03256" "SERPING1_000002" "g.57365748C>T" "0.0013502 (gnomAD exome); 0.001003 (TOPMED); 0.000799 (1000Genomes)" "{DOI:Gösswein 2008:10.1159/000138883} {DOI:Ponard 2019:10.1002/humu.23917} {DOI:Rasmussen 2019:10.1136/bcr-2019-231122} {DOI:Nabilou 2020:10.1080/08820139.2020.1817068} {DOI:Guryanova 2021:10.1186/s12948-021-00141-0} {DOI:Soyak Aytekin 2021:10.23822/EurAnnACI.1764-1489.146}" "" "" "Conflicting presentations of the c.5C>T variant. Introduced in ClinVar as a VUS by Center for Genomics, Ann and Robert H. Lurie Children\'s Hospital of Chicago.\r\nVariant c.5C>T is carried by 7 affected families, with records in asymptomatic carriers.\r\nFamilies 1 & 2, Germany, 4 affected heterozygous individuals. HAE type not documented.\r\nFamily 3, France, with a single affected individual presenting with a HAE type I mild phenotype.\r\nFamily 4, France, a family where the proband is a compound heterozygous c.[5C>T];[1045C>T] and the c.5C>T allele is carried by the pauci-symptomatic mother.\r\nFamily 5, Denmark, with a c.5C>T carrier associated with anti-C1Inh antibody.\r\nFamily 6, Iran, with 2 male patients affected and presenting with a HAE type I phenotype.\r\nFamily 7, Belarus (n=1), a young female patient presenting with a HAE type I phenotype since puberty.\r\nFamily 8, Turkey (n=2) with a female patient suffering since 2.5 years old (moderate) and a male individual since 10 years old with laryngeal attacks.\r\nFive homozygous carriers c.[5C>T];[5C>T] have been recorded." "Germline" "no" "rs185342631" "0" "" "" "g.57598275C>T" "{CV-SCV:000898969.1}" "VUS" "ACMG"
"0000794185" "3" "99" "11" "57365057" "57365057" "subst" "0" "03256" "SERPING1_000900" "g.57365057A>G" "" "{DOI:Büyüköztürk 2009:10.1016/j.jaci.2008.12.022} {DOI:Kesim 2011:10.1159/000323915}" "" "c.-101A>G; g.[57365057A>G];[57365057A>G]" "Regulatory c.–161A>G variant is coordinated to -687 relative to initiation codon; it changed the sequence of -CAAT- box in 5\'UTR, with subsequent reduced level of C1-INH mRNA in the homozygous proband comparatively to that is shown in heterozygous individuals." "Germline" "no" "" "0" "" "" "g.57597584A>G" "" "pathogenic (recessive)" "ACMG"
"0000794186" "0" "33" "11" "57365118" "57365118" "subst" "0" "03256" "SERPING1_000901" "g.57365118C>G" "" "{PMID:Verpy 1996:8755917}" "" "[-100C>G;816_818del]" "" "Germline" "?" "" "0" "" "" "g.57597645C>G" "" "likely benign" ""
"0000794788" "0" "99" "11" "57382014" "57382014" "dup" "0" "03256" "SERPING1_000902" "g.57382014dup" "" "{DOI:Shukla 2020:10.1177/0961203320935980}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57614541dup" "" "pathogenic" ""
"0000798622" "0" "99" "11" "57367609" "57367612" "del" "0" "03256" "SERPING1_000903" "g.57367609_57367612del" "" "{DOI:Veronez 2021:10.1016/j.jaip.2020.11.039}" "" "c.309_312delCCAA" "c.309_312del variant meets the ACMG criteria to be characterized as pathogenic PVS1, PS2_Str, PS3, PS4, PP5" "De novo" "yes" "" "0" "" "" "g.57600136_57600149del" "" "pathogenic" "ACMG"
"0000805194" "0" "99" "11" "57367420" "57367421" "del" "0" "01804" "SERPING1_000273" "g.57367420_57367421del" "" "" "" "SERPING1(NM_000062.2):c.118_119del (p.(Gly41Argfs*16))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.57599947_57599948del" "" "pathogenic" ""
"0000805195" "0" "33" "11" "57373646" "57373646" "subst" "0.00108015" "01943" "SERPING1_000904" "g.57373646C>T" "" "" "" "SERPING1(NM_000062.2):c.849C>T (p.S283=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.57606173C>T" "{CV:VCV000305027.11}" "likely benign" ""
"0000805196" "0" "99" "11" "57373687" "57373687" "subst" "0" "01804" "SERPING1_000695" "g.57373687G>T" "" "{DOI:Gösswein 2008:10.1159/000138883}" "" "SERPING1(NM_000062.2):c.889+1G>T (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.57606214G>T" "" "pathogenic" ""
"0000812909" "0" "31" "11" "57369353" "57369354" "del" "0" "03256" "SERPING1_000905" "g.57369353_57369354del" "" "single submitter in ClinVar" "" "" "Introduced in ClinVar as a benign variant by GenDx, Gaithersburg MA" "Germline" "" "rs5792050" "0" "" "" "g.57601880_57601881del" "{CV-SCV:001934641.1}" "benign" ""
"0000812912" "0" "30" "11" "57369957" "57369957" "subst" "0" "03256" "SERPING1_000906" "g.57369957T>C" "" "" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.57602484T>C" "{CV:VCV001272213.1}" "benign" "ACMG"
"0000812992" "0" "99" "11" "57381884" "57381887" "del" "0" "03256" "SERPING1_000907" "g.57381884_57381887del" "" "{DOI:Förster 2021:0.1186/s13023-021-02021-x}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57614411_57614414del" "" "pathogenic" "ACMG"
"0000812993" "0" "99" "11" "57381814" "57381815" "dup" "0" "03256" "SERPING1_000908" "g.57381814_57381815dup" "" "{GenBank:Human Gene Mutation Database HGMD professional 2020.1} {DOI:Förster 2021:10.1186/s13023-021-02021-x}" "" "" "" "Germline" "" "" "0" "" "" "g.57614341_57614342dup" "" "pathogenic" "ACMG"
"0000812994" "0" "99" "11" "57382029" "57382029" "subst" "0" "03256" "SERPING1_000909" "g.57382029G>T" "" "{DOI:Förster 2021:10.1186/s13023-021-02021-x}" "" "" "Gly471 residue is located in a highly conserved position among serpins (89%).\r\nShutter domain." "Germline" "yes" "" "0" "" "" "g.57614556G>T" "" "pathogenic" "ACMG"
"0000817285" "0" "11" "11" "57369346" "57369354" "del" "0" "03256" "SERPING1_000910" "g.57369346_57369354del" "" "" "" "" "Introduced in ClinVar as a benign variant by GeneDx, Gaithersburg MA" "Germline" "" "rs5792050" "0" "" "" "g.57601873_57601881del" "{CV-SCV:001849197.1}" "benign" "ACMG"
"0000817296" "0" "33" "11" "57369353" "57369353" "subst" "0" "03256" "SERPING1_000911" "g.57369353A>G" "0.398926 (GnomAD)" "{DOI:Vatsiou 2020:10.1016/j.alit.2019.12.009}" "" "" "c.551-155A>G variant creates an ISE.\r\nIntroduced in ClinVar as a benign variant by CEMIA, Larissa Greece" "Germline" "" "rs2936694" "0" "" "" "g.57601880A>G" "{CV-SCV:001441193.2}" "benign" "ACMG"
"0000817354" "0" "50" "11" "57379414" "57379414" "subst" "0" "03256" "SERPING1_000912" "g.57379414G>C" "" "" "" "" "Predicted donor loss by in silico SpliceAI algorithm.\r\nIntroduced in ClinVar as VUS by Institute of Human Genetics, University of Wuerzburg" "Germline/De novo (untested)" "" "rs1590829846" "0" "" "" "g.57611941G>C" "{CV:000689537.1}" "VUS" ""
"0000817355" "0" "10" "11" "57381519" "57381519" "subst" "0" "03256" "SERPING1_000913" "g.57381519T>C" "" "{DOI:Vatsiou 2020:10.1016/j.alit.2019.12.009}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.57614046T>C" "{CV:VCV000983236.3}" "benign" "ACMG"
"0000823172" "0" "11" "11" "57381808" "57381808" "subst" "4.07272E-6" "03256" "SERPING1_000914" "g.57381808C>T" "0.000007 (1/140228, GnomAD)" "" "" "" "" "Germline" "" "rs775042436" "0" "" "" "g.57614335C>T" "" "benign" "ACMG"
"0000824906" "0" "99" "11" "57373613" "57373615" "del" "0" "03256" "SERPING1_000161" "g.57373613_57373615del" "" "{DOI:Loli-Ausejo 2021:10.1007/s12016-021-08834-9} {DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "" "In frame deletion.\r\nVariant affecting one of the three glycosylation sites of the serpin domain.\r\nProne to oligomerization/latentisation. In frame deletion; p.(Asn272del) affects a N-glycosylation site; the protein sequence for the Asn272 glycosylation site is NN(272)KIS. Asn272 deletion disrupts the recognition site, thereby altering protein folding and function; thus Asn272del is deleterious with a poorly biosynthesized product in recombinant expression studies (Ren 2023), then classifying p.(Asn272del) within class II/III (ie., disturbed insertion of the RCL, conformational transition with spontaneous self or mutual insertion of the RCL).\r\nAsn250 is located at the end of helix F, close to Sheet 3A, with H-bonding with Ala245. Asn250 is a highly exposed residue within the shutter region. \r\nThe c.816_818del variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as likely pathogenic: PP4_Str, PM4, PS4_Mod, PM2_Sup." "Germline" "yes" "rs2495440974" "0" "" "" "g.57606140_57606142del" "{CV-SCV:005200126.1}" "likely pathogenic" "ACMG"
"0000831996" "0" "99" "11" "57367342" "57367342" "subst" "0" "03256" "SERPING1_000915" "g.57367342T>A" "" "{DOI:López-Martínez 2022:10.1111/pai.13681}" "" "" "MaxEnt prediction and Human Splicing Finder identified c.52-10T>A variant as pathogenic.\r\nc.52-10T>A variant has been demonstrated as affecting the exon 3 acceptor splice site, with exon 3 skipping." "Germline" "yes" "" "0" "" "" "g.57599869T>A" "" "likely pathogenic" "ACMG"
"0000832554" "11" "99" "11" "0" "0" "" "" "03256" "SERPING1_001174" "g.[57367836C=/>T]" "" "{DOI:Ebo 2018:10.1016/j.jaip.2017.07.002}" "" "" "Gonadal mosaicism in a family in which only both sisters, but not the parents, show clinical and laboratory findings typical of HAE, with allele segregation demonstrated using Sanger sequencing.\r\nc.536C>T variant not detected in DNA derived from lymphocytes from the father and the mother, whereas present on the DNA prepared from the sperm of the father and on the paternal transmitted chromosome." "Uniparental disomy, paternal allele" "yes" "" "0" "" "" "g.[57600363C=/>T]" "" "pathogenic" "ACMG"
"0000839675" "0" "99" "11" "57365746" "57367373" "del" "0" "03256" "SERPING1_000916" "g.57365746_57367373del" "" "{PMID:Lei 2011:22299312}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57598273_57599900del" "" "pathogenic" "ACMG"
"0000842305" "0" "99" "11" "57373561" "57373561" "dup" "0" "03256" "SERPING1_000917" "g.57373561dup" "" "{DOI:Beken 2022:10.1111/pai.13747}" "" "" "Family screening with C4, C1-INH level, and C1-INH function was found normal for the mother, father, and sibling" "Germline/De novo (untested)" "?" "" "0" "" "" "g.57606088dup" "" "likely pathogenic" "ACMG"
"0000843071" "0" "99" "11" "57379189" "57379410" "dup" "0" "03256" "SERPING1_000918" "g.(57374021_57379189)_(57379410_57381800)dup" "" "{DOI:Szabó 2022:10.3389/falgy.2022.836465} {DOI:Troldborg 2024:10.1016/j.jaci.2024.03.028}" "" "exon 7 duplication" "" "Germline" "yes" "" "0" "" "" "g.(57606548_57611716)_57611937_57614327)dup" "" "pathogenic" "ACMG"
"0000843073" "0" "99" "11" "57373930" "57376535" "del" "0" "03256" "SERPING1_000919" "g.57373930_57376535del" "" "{DOI:Szabó 2022:10.3389/falgy.2022.836465}" "" "" "Hungarian pedigree with 2 affected individuals.\r\nThe c.939_1029+2515del variant includes parts of exon 6 and intron 6. The consequence of this variant is unknown, and therefore reduced points are awarded." "Germline" "yes" "" "0" "" "" "g.57606457_57609062del" "" "pathogenic" "ACMG"
"0000843074" "0" "97" "11" "57369553" "57369553" "subst" "0" "03256" "SERPING1_000920" "g.57369553A>C" "" "{DOI:Szabó 2022:10.3389/falgy.2022.836465}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57602080A>C" "" "pathogenic" ""
"0000843075" "0" "99" "11" "57373594" "57373597" "delins" "0" "03256" "SERPING1_000921" "g.57373594_57373597delinsCTTGGAGCTCAAGAACTTGGAGCT" "" "{DOI:Szabó 2022:10.3389/falgy.2022.836465}" "" "" "" "Germline/De novo (untested)" "yes" "" "0" "" "" "g.57606121_57606124delinsCTTGGAGCTCAAGAACTTGGAGCT" "" "pathogenic" "ACMG"
"0000843076" "0" "99" "11" "57373609" "57373609" "dup" "0" "03256" "SERPING1_000922" "g.57373609dup" "" "{DOI:Szabó 2022:10.3389/falgy.2022.836465}" "" "" "The pathogenicity of c.812dup variant is clear, as by the duplication of one base it shifts the reading frame and results in the generation of a premature termination codon in the formed mRNA." "Germline/De novo (untested)" "yes" "" "0" "" "" "g.57606136dup" "" "pathogenic" "ACMG"
"0000843508" "0" "99" "11" "57369643" "57369643" "del" "0" "03256" "SERPING1_000923" "g.57369643del" "" "{DOI:Grodecká 2017:10.1016/j.clim.2017.03.010} {DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "" "" "Deletion variant affecting the canonical donor site, and activation of cryptic intronic sites, with demonstrated skipping of exon 4 and exons 4 and 5.\r\nThe c.685+1delG variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PS1, PP4_Str, PVS1_Mod, PM2_Sup, PP1." "Germline/De novo (untested)" "yes" "" "0" "" "" "g.57602170del" "{CV-SCV:005186257.1}" "pathogenic" "ACMG"
"0000844770" "0" "99" "11" "57369572" "57369572" "subst" "0" "03256" "SERPING1_000924" "g.57369572T>G" "" "{DOI:Zuraw 2000:10.1067/mai.2000.104780}" "" "" "With a Cys to Trp substitution at codon Cys205, c.615T>G disrupts a disulfide bridge and subsequently C1-INH serpin expression and function.\r\nIntroduced in ClinVar as likely pathogenic by Labcorp Genetics, San Francisco CA" "Germline" "yes" "rs1274312627" "0" "" "" "g.57602099T>G" "{CV-SCV:002277223.3}" "likely pathogenic" "ACMG"
"0000844837" "0" "99" "11" "57373985" "57373985" "del" "0" "03256" "SERPING1_000925" "g.57373985del" "" "" "" "" "Variant introduced in ClinVar by InVitae, San Francisco CA" "Germline/De novo (untested)" "" "rs2135318363" "0" "" "" "g.57606512del" "{CV-SCV:002240199.2}" "pathogenic" "ACMG"
"0000844838" "0" "79" "11" "57381800" "57381800" "subst" "0" "03256" "SERPING1_000926" "g.57381800G>C" "" "" "" "" "Variant introduced as pathogenic in ClinVar by InVitae, San Francisco CA.\r\nThis variant meets the ACMG criteria PS1_Supporting, PVS1_Strong, PM2_Supporting to be considered as likely pathogenic." "Germline/De novo (untested)" "" "rs2135327830" "0" "" "" "g.57614327G>C" "{CV-SCV:002237006.2}" "pathogenic" "ACMG"
"0000844839" "0" "99" "11" "57381912" "57381912" "del" "0" "03256" "SERPING1_000927" "g.57381912del" "" "" "" "" "Introduced as pathogenic variant by Invitae, San Francisco CA" "Germline/De novo (untested)" "" "rs2135328012" "0" "" "" "g.57614439del" "{CV-SCV:002238458.2}" "pathogenic" "ACMG"
"0000844842" "0" "79" "11" "57381980" "57381980" "subst" "0" "03256" "SERPING1_000928" "g.57381980T>C" "" "" "" "" "Introduced in ClinVar as a pathogenic variant by InVitae San Francisco CA and by Research Centre For Medical Genetics, Moscow Russia.\r\nPhe 455 is a highly conserved residue among serpins (97%).\r\nPhe455 is located in sheet 4B, within the gate functional domain. Phe455 packs against conserved positions Phe291, Val337, Pro338, Pro377.\r\nThe c.1429T>C variant meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PP3_Str, PP4_Str, PM2_Sup, PP1, PP2." "Germline/De novo (untested)" "yes" "rs2135328208" "0" "" "" "g.57614507T>C" "{CV-SCV:002214358.2}" "pathogenic" "ACMG"
"0000847292" "0" "99" "11" "57367596" "57367603" "del" "0" "03256" "SERPING1_000929" "g.57367596_57367603del" "" "{DOI:Xu 2012:10.1111/all.12024} {DOI:Liu 2019:10.1684/ejd.2018.3487} {DOI:Xu 2020:/10.1186/s13601-020-00360-9}" "" "c.296_303delCCATCCAA" "" "Germline" "yes" "" "0" "" "" "g.57600123_57600130del" "" "likely pathogenic" "ACMG"
"0000853032" "0" "30" "11" "57379374" "57379374" "subst" "1.6245E-5" "02326" "SERPING1_000930" "g.57379374C>A" "0.00004647" "" "" "SERPING1(NM_000062.2):c.1214C>A (p.T405N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "rs777750972" "0" "" "" "g.57611901C>A" "{CV-SCV:002178930.5}" "VUS" ""
"0000862584" "0" "30" "11" "57373478" "57373478" "subst" "7.7153E-5" "02326" "SERPING1_000278" "g.57373478C>G" "0.0002076" "" "" "SERPING1(NM_000062.2):c.686-5C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "rs28362952" "0" "" "" "g.57606005C>G" "{CV-SCV:002365793.6}" "likely benign" "ACMG"
"0000862585" "0" "30" "11" "57379378" "57379378" "subst" "0.00322885" "02326" "SERPING1_000931" "g.57379378C>T" "" "" "" "SERPING1(NM_000062.2):c.1218C>T (p.S406=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.57611905C>T" "" "likely benign" ""
"0000878038" "0" "99" "11" "57365792" "57365792" "subst" "0" "03256" "SERPING1_000762" "g.57365792G>A" "0.000004479" "{DOI:Wang 2022:10.1186/s41065-022-00242-z} {DOI:Ren 2025:10.1016/j.jaci.2024.12.1044}" "" "" "Both affected carriers of c.49G>A are presenting with a low expression of C1-INH.\r\nIdentified as likely pathogenic by Wang et al. 2022.\r\nVariant p.(Gly17Arg) is not expressed in cell biology investigation where minigene is transfected into 293T cells. Altering the hydrophobic core by substitution by positively charged amino acids can disrupt signal peptide transportation and impair protein secretion." "Germline" "yes" "" "0" "" "" "g.57598319G>A" "" "likely pathogenic" "ACMG"
"0000878039" "0" "99" "11" "57367374" "57367374" "del" "0" "03256" "SERPING1_000932" "g.57367374del" "" "{DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "" "Introduced in ClinVar as a pathogenic variant by Peking Union Medical College Hospital, Peking China" "Germline" "" "rs2135307959" "0" "" "" "g.57599901del" "{CV-SCV:001977563.1}" "pathogenic" "ACMG"
"0000878041" "0" "90" "11" "57367400" "57367400" "subst" "0" "03256" "SERPING1_000933" "g.57367400C>A" "6.196e-7 (gnomAD v4)" "{DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "" "Introduced in ClinVar as a variant of unknown significance by Peking Union Medical College Hospital.\r\nThe variant meets the ACMG criteria BP4, PP4." "Germline/De novo (untested)" "" "rs781444611" "0" "" "" "g.57599927C>A" "{CV-SCV:001977574.1}" "VUS" ""
"0000878043" "0" "99" "11" "57367472" "57367481" "del" "0" "03256" "SERPING1_000934" "g.57367472_57367481del" "" "{DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "" "c.172_181del variant considered pathogenic by Peking Union Medical College Hospital" "Germline/De novo (untested)" "yes" "rs2135308147" "0" "" "" "g.57599999_57600008del" "{CV-SCV:001977585.1}" "pathogenic" "ACMG"
"0000878045" "0" "99" "11" "57367497" "57367497" "dup" "0" "03256" "SERPING1_000935" "g.57367497dup" "" "{DOI:Wang 2022:0.1186/s41065-022-00242-z}" "" "" "c.197dup variant considered as pathogenic by Peking Union Medical College Hospital" "Germline/De novo (untested)" "" "rs2135308182" "0" "" "" "g.57600024dup" "{CV-SCV:001977588.1}" "pathogenic" "ACMG"
"0000878329" "0" "99" "11" "57367529" "57367529" "subst" "0" "03256" "SERPING1_000936" "g.57367529A>T" "0.00015" "{DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "" "c.229A>T variant has been characterized as pathogenic according to the ACMG criteria PVS1, PS3, PM2, PP1, PP4 (InterVar on-line system)\r\nClinVar interpretation as pathogenic by Wang et al Peking Union Medical College Hospital" "Germline/De novo (untested)" "yes" "rs368249322" "0" "" "" "g.57600056A>T" "{CV-SCV:001299743.1}" "pathogenic" "ACMG"
"0000878330" "0" "99" "11" "57367532" "57367532" "del" "0" "03256" "SERPING1_000937" "g.57367532del" "" "{DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "" "c.232del variant considered pathogenic by Peking Union Medical College Hospital" "Germline/De novo (untested)" "yes" "rs2135308232" "0" "" "" "g.57600059del" "{CV:VCV001299744.1}" "pathogenic" "ACMG"
"0000878331" "0" "99" "11" "57367677" "57367677" "del" "0" "03256" "SERPING1_000938" "g.57367677del" "" "{DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "" "Identified as pathogenic by Peking Union Medical College Hospital" "Germline/De novo (untested)" "yes" "rs2495426294" "0" "" "" "g.57600204del" "{CV-SCV:002522446.1}" "pathogenic" "ACMG"
"0000878332" "0" "99" "11" "57367851" "57367851" "subst" "0" "03256" "SERPING1_000939" "g.57367851G>T" "" "{DOI:Wang 2022:10.1186/s41065-022-00242-z} {DOI:Sheikh 2023:10.1007/s10875-022-01399-y}" "" "" "c.550+1G>T variant likely affects the canonical donor splice site\r\nIntroduced in ClinVar as a pathogenic variant by Peking Union Medical College Hospital" "Germline/De novo (untested)" "" "rs2135308859" "0" "" "" "g.57600378G>T" "{CV-SCV:001977592.1}" "pathogenic" "ACMG"
"0000878335" "0" "99" "11" "57369580" "57369580" "dup" "0" "03256" "SERPING1_000940" "g.57369580dup" "" "{DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "" "Introduced in ClinVar by Peking Union Medical College Hospital" "Germline/De novo (untested)" "" "rs2135311324" "0" "" "" "g.57602107dup" "{CV-SCV:001977593.1}" "pathogenic" ""
"0000878336" "0" "99" "11" "57369592" "57369592" "dup" "0" "03256" "SERPING1_000941" "g.57369592dup" "" "{DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "" "Introduced in ClinVar by Peking Union Medical College Hospital" "Germline/De novo (untested)" "" "" "0" "" "" "g.57602119dup" "{CV-SCV:001977564.1}" "pathogenic" ""
"0000878337" "0" "99" "11" "57369630" "57369632" "del" "0" "03256" "SERPING1_000942" "g.57369630_57369632del" "" "{DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "" "In frame deletion" "Germline/De novo (untested)" "" "" "0" "" "" "g.57602157_57602159del" "{CV-RCV:002221644.1}" "pathogenic" ""
"0000878385" "0" "99" "11" "57373505" "57373505" "subst" "0" "03256" "SERPING1_000943" "g.57373505T>G" "" "{DOI:Wang 2022:10.1186/s41065-022-00242-z} {DOI:Jiang 2024:10.1186/s13023-024-03306-7}" "" "" "Phe214 is a highly conserved residue among serpins (75%), located in helix E that plays a crucial role in facilitating the conformation change during the insertion of RCL between s3A and s5A.\r\nPhe214 packs against Leu408 and the conserved Gly162 at the C-terminus of helix B. A Phe to Leu substitution disrupts the hydrogen bond that should normally connect with these residues.\r\nIn vitro transfection investigations suggest that c.708T>G variant may result in the aggregation of C1-INH in the endoplasmic reticulum, with subsequent impaired secretion. This results in the upregulation of GRP75 expression, a cascade of events resulting in Ca2+ overload, disruption of mitochondrial structure and function, and eventually triggering apoptosis.\r\nSubmitted to ClinVar as likely pathogenic by Peking Union Medical College Hospital, Peking China" "Germline/De novo (untested)" "yes" "rs2135317558" "0" "" "" "g.57606032T>G" "{CV-SCV:001977566.1}" "likely pathogenic" "ACMG"
"0000878386" "0" "99" "11" "57373530" "57373533" "dup" "0" "03256" "SERPING1_000944" "g.57373530_57373533dup" "" "{DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "" "Variant introduced in ClinVar as pathogenic by Peking Union Medical College Hospital" "Germline/De novo (untested)" "yes" "rs2135317617" "0" "" "" "g.57606056-5760605dup" "{CV-SCV:001977567.1}" "pathogenic" ""
"0000878387" "0" "33" "11" "57373522" "57373522" "subst" "4.06058E-6" "03256" "SERPING1_000945" "g.57373522C>T" "6.195e-7" "" "" "" "The Thr residue is weakly conserved and there is a moderate physicochemical difference between Thr and Ile.\r\nInsufficient available evidence to determine a role of c.725C>T variant in disease." "Germline/De novo (untested)" "" "rs1162387864" "0" "" "" "g.57606049C>T" "{CV-SCV:002236581.4}" "VUS (!)" ""
"0000878388" "0" "30" "11" "57373518" "57373518" "subst" "4.06055E-6" "03256" "SERPING1_000946" "g.57373518C>T" "0.000003717 (gnomAD v4)" "" "" "" "" "Germline/De novo (untested)" "" "rs145436911" "0" "" "" "g.57606045C>T" "{CV-SCV:002152917.5}" "VUS (!)" ""
"0000878389" "0" "77" "11" "57373545" "57373546" "del" "0" "03256" "SERPING1_000947" "g.57373545_57373546del" "" "" "" "" "Variant introduced in ClinVar as pathogenic by Peking Union Medical College Hospital" "Germline/De novo (untested)" "" "rs2135317631" "0" "" "" "g.57606072-57606073del" "{CV-SCV:002043720.1}" "pathogenic" ""
"0000878390" "0" "99" "11" "57373576" "57373576" "dup" "0" "03256" "SERPING1_000948" "g.57373576dup" "" "{DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "" "Variant introduced in ClinVar as pathogenic by Peking Union Medical College Hospital" "Germline/De novo (untested)" "" "rs2135317696" "0" "" "" "g.57606103dup" "{CV-SCV:001977568.1}" "pathogenic" "ACMG"
"0000878391" "0" "30" "11" "57373546" "57373546" "subst" "3.24847E-5" "03256" "SERPING1_000949" "g.57373546T>A" "0.00002789 (gnomAD)" "" "" "" "" "Germline/De novo (untested)" "" "rs200558314" "0" "" "" "g.57606073T>A" "{CV-SCV:001512762.6}" "VUS (!)" ""
"0000878392" "0" "30" "11" "57373566" "57373566" "subst" "1.6243E-5" "03256" "SERPING1_000950" "g.57373566G>A" "0.00002 (gnomAD)" "" "" "" "Insufficient or conflicting evidence (likely benign, VUS), the clinical significance of this alteration remains unclear." "Germline" "" "rs758561591" "0" "" "" "g.57606093G>A" "{CV-SCV:006425418.1}" "VUS (!)" ""
"0000878393" "0" "30" "11" "57373578" "57373578" "subst" "0" "03256" "SERPING1_000951" "g.57373578C>T" "6.195e-7" "" "" "" "Insufficient available evidence to determine the role of a c.781C>T variant in disease" "Germline" "" "rs1326562515" "0" "" "" "g.57606105C>T" "{CV-SCV:002154876.5}" "VUS" ""
"0000878394" "0" "99" "11" "57373582" "57373582" "dup" "0" "03256" "SERPING1_000952" "g.57373582dup" "" "{DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "" "Variant submitted to ClinVar as pathogenic by Peking Union Medical College Hospital, Peking China" "Germline/De novo (untested)" "" "rs2135317718" "0" "" "" "g.57606109dup" "{CV:VCV001299723.1}" "pathogenic" "ACMG"
"0000878395" "0" "30" "11" "57373605" "57373605" "subst" "0" "03256" "SERPING1_000953" "g.57373605A>G" "" "" "" "" "" "Germline" "" "rs1590826505" "0" "" "" "g.57606132A>G" "{CV-SCV:002253809.4}" "VUS (!)" ""
"0000878396" "0" "99" "11" "57373932" "57373933" "ins" "0" "03256" "SERPING1_000954" "g.57373932_57373933insTC" "" "{DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "" "Variant submitted to ClinVar as pathogenic by Peking Union Medical College Hospital" "Germline/De novo (untested)" "" "rs2135318252" "0" "" "" "g.57606459_57606460insTC" "{CV-SCV:001977570.1}" "pathogenic" "ACMG"
"0000878430" "0" "99" "11" "57373942" "57373942" "dup" "0" "03256" "SERPING1_000955" "g.57373942dup" "" "{DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "" "Variant introduced in ClinVar by Peking Union Medical College Hospital" "Germline/De novo (untested)" "" "rs2135318269" "0" "" "" "g.57606469dup" "{CV-SCV:001977571.1}" "pathogenic" ""
"0000878431" "0" "33" "11" "57373623" "57373623" "subst" "2.43639E-5" "03256" "SERPING1_000956" "g.57373623C>T" "0.00001611" "" "" "" "Conflicting classifications of pathogenicity. Uncertain significance(1); Likely benign(1)" "Germline" "" "rs768520560" "0" "" "" "g. 57606150C>T" "{CV-SCV:002218996.5}" "VUS (!)" ""
"0000878432" "0" "30" "11" "57373624" "57373624" "subst" "3.24855E-5" "03256" "SERPING1_000957" "g.57373624G>A" ".00004337" "" "" "" "" "Germline/De novo (untested)" "" "rs548701651" "0" "" "" "g.57606151G>A" "{CV-SCV:002139977.5}" "VUS (!)" ""
"0000878434" "0" "33" "11" "57373653" "57373653" "subst" "0" "03256" "SERPING1_000958" "g.57373653C>G" "6.195e-7" "" "" "" "" "Germline/De novo (untested)" "" "rs1392305191" "0" "" "" "g.57606180C>G" "{CV-SCV:001259299.1}" "VUS (!)" ""
"0000878435" "0" "30" "11" "57373659" "57373659" "subst" "4.06078E-6" "03256" "SERPING1_000959" "g.57373659G>A" "0.00006 (gnomAD)" "" "" "" "Insufficient available evidence to determine the role of a c.862G>A variant in disease; may meet the ACMG criterion BP4." "Germline/De novo (untested)" "" "rs775757014" "0" "" "" "g.57606186G>A" "{CV-SCV:002110707.5}" "likely benign" ""
"0000878438" "0" "30" "11" "57373944" "57373944" "subst" "0" "03256" "SERPING1_000960" "g.57373944C>T" "6.195e-7" "" "" "" "Introduced in ClinVar as VUS by Illumina and LabCorp Genetics without demonstration of abnormal/normal C1-INH functional evidence." "Germline/De novo (untested)" "" "rs1554995860" "0" "" "" "g.57606471C>T" "{CV-SCV:002224449.5}" "VUS" ""
"0000878439" "0" "99" "11" "57373974" "57373975" "delins" "0" "03256" "SERPING1_000961" "g.57373974_57373975delinsC" "" "{DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "" "Variant introduced in ClinVar as pathogenic by Peking Union Medical College Hospital" "Germline/De novo (untested)" "yes" "rs2135318339" "0" "" "" "g.57606501_57606502delinsC" "{CV-SCV:001977572.1}" "pathogenic" ""
"0000878440" "0" "39" "11" "57373979" "57373979" "subst" "4.06088E-6" "03256" "SERPING1_000625" "g.57373979T>G" "" "" "" "" "Variant classified as a VUS by InVitae, San Francisco CA" "Germline/De novo (untested)" "" "" "0" "" "" "g.57606506T>G" "{CV-SCV:002205408.2}" "VUS (!)" ""
"0000878441" "0" "30" "11" "57373988" "57373988" "subst" "0" "03256" "SERPING1_000962" "g.57373988G>A" "0.00001735" "" "" "" "Characterized as possibly damaging by PolyPhen-2.\r\nNo information pertaining to clinics, biology and family history: the available evidence is currently insufficient to determine the role of the c.997G>A variant in disease." "Germline/De novo (untested)" "" "rs202192543" "0" "" "" "g.57606515G>A" "{CV-SCV:002153800.5}" "benign" ""
"0000878442" "0" "99" "11" "57374001" "57374001" "del" "0" "03256" "SERPING1_000963" "g.57374001del" "" "{DOI:Bafunno 2014:10.1111/ahg.12052}" "" "c.1012_1016del" "" "De novo" "yes" "" "0" "" "" "g.57606528del" "{CV:VCV001452090.1}" "pathogenic" "ACMG"
"0000878443" "0" "99" "11" "57374010" "57374010" "del" "0" "03256" "SERPING1_000964" "g.57374010del" "" "{DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "" "Variant introduced in ClinVar by Peking Union Medical College Hospital" "Germline/De novo (untested)" "" "rs2135318396" "0" "" "" "g.57606537del" "{CV-SCV:001977573.1}" "pathogenic" "ACMG"
"0000878444" "0" "99" "11" "57379211" "57379211" "del" "0" "03256" "SERPING1_000965" "g.57379211del" "" "{DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "" "" "Germline/De novo (untested)" "" "rs2135324476" "0" "" "" "g.57611736del" "{CV:VCV001299729.1}" "pathogenic" "ACMG"
"0000878445" "0" "33" "11" "57379209" "57379209" "subst" "1.21845E-5" "03256" "SERPING1_000966" "g.57379209C>T" "0.000008673" "" "" "" "This variant has not been reported in the literature in individuals affected with SERPING1-related conditions." "Germline/De novo (untested)" "" "rs369960628" "0" "" "" "g.57611736C>T" "{CV:VCV002266273.5}" "VUS" ""
"0000878446" "0" "99" "11" "57379232" "57379232" "del" "0" "03256" "SERPING1_000967" "g.57379232del" "" "{DOI:Bafunno 2014:10.1111/ahg.12052}" "" "" "Submitted to ClinVar as pathogenic by InVitae, San Francisco CA" "Germline" "" "rs2135324522" "0" "" "" "g.57611759del" "{CV-SCV:002171452.2}" "likely pathogenic" "ACMG"
"0000878447" "0" "99" "11" "57379254" "57379254" "dup" "0" "03256" "SERPING1_000968" "g.57379254dup" "" "{DOI:Wang 2022:10.1186/s41065-022-00242-z} {DOI:Jiang 2025:10.22541/au.176675056.63979689/v1}" "" "" "Introduced in ClinVar by Peking Union Medical College Hospital.\r\nAccording to the ACMG guidelines, the c.1094dup variant has been classified as pathogenic according to the following criteria: PVS1, PS4_P, PM2_P" "Germline/De novo (untested)" "yes" "rs2135324565" "0" "" "" "g.57611781dup" "{CV-SCV:001977576.1}" "pathogenic" "ACMG"
"0000878448" "0" "99" "11" "57379260" "57379260" "subst" "0" "03256" "SERPING1_000969" "g.57379260T>G" "" "{DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "" "Variant introduced in ClinVar by Peking Union Medical College Hospital" "Germline/De novo (untested)" "" "rs2135324578" "0" "" "" "g.57611787T>G" "{CV-SCV:001977577.1}" "likely pathogenic" ""
"0000878449" "0" "30" "11" "57379307" "57379307" "subst" "0" "03256" "SERPING1_000970" "g.57379307A>G" "" "" "" "" "c.1147A>G variant not present in large control databases.\r\nData on c.1147A>G variant insufficient for disease classification; may meet the ACMG criteria PM2_Sup, BP4" "Germline/De novo (untested)" "" "rs746382640" "0" "" "" "g.57611834A>G" "{CV-SCV:007349075.1}" "VUS (!)" ""
"0000878450" "0" "99" "11" "57379346" "57379346" "del" "0" "03256" "SERPING1_000971" "g.57379346del" "" "{DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "" "Variant introduced in ClinVar by Peking Union Medical College Hospital" "Germline/De novo (untested)" "" "rs2135324746" "0" "" "" "g.57611873del" "{CV-SCV:001977578.1}" "pathogenic" "ACMG"
"0000878451" "0" "97" "11" "57379352" "57379352" "subst" "0" "03256" "SERPING1_000972" "g.57379352C>G" "" "{DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "" "Variant introduced as likely pathogenic in ClinVar by Peking Union Medical College Hospital" "Germline/De novo (untested)" "" "rs2135324760" "0" "" "" "g.57611879C>G" "{CV-SCV:001977579.1}" "likely pathogenic" ""
"0000878452" "0" "99" "11" "57379353" "57379353" "subst" "0" "03256" "SERPING1_000973" "g.57379353T>G" "" "{DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "" "Variant introduced in ClinVar by Peking Union Medical College Hospital" "Germline/De novo (untested)" "" "rs1945480328" "0" "" "" "g.57611880T>G" "{CV-SCV:001977580.1}" "likely pathogenic" ""
"0000878453" "0" "99" "11" "57379411" "57379411" "subst" "0" "03256" "SERPING1_000974" "g.57379411T>C" "" "{DOI:Wang 2022:10.1186/s41065-022-00242-z} {DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "" "" "Variant likely affecting the canonical donor splice site.\r\nVariant introduced in ClinVar by Peking Union Medical College Hospital" "Germline/De novo (untested)" "" "" "0" "" "" "g.57611938T>C" "{CV-SCV:001977581.1}" "pathogenic" "ACMG"
"0000878454" "0" "79" "11" "57379409" "57379409" "subst" "0" "03256" "SERPING1_000113" "g.57379409G>T" "" "" "" "" "Introduced in ClinVar by InVitae, San Francisco CA" "Germline/De novo (untested)" "" "rs755108467" "0" "" "" "g.57611936G>T" "{CV-SCV:003214325.1}" "likely pathogenic" ""
"0000878560" "0" "99" "11" "57381820" "57381820" "subst" "0" "03256" "SERPING1_000975" "g.57381820T>A" "" "{DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "" "Variant introduced in ClinVar by Peking Union Medical College Hospital as pathogenic" "Germline/De novo (untested)" "" "rs750873571" "0" "" "" "g.57614347T>A" "{CV-SCV:002043721.1}" "pathogenic" "ACMG"
"0000878562" "0" "77" "11" "57381840" "57381840" "subst" "0" "03256" "SERPING1_000976" "g.57381840T>G" "" "{DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "" "Variant introduced in ClinVar by Peking Union Medical College Hospital" "Germline/De novo (untested)" "" "rs281875174" "0" "" "" "g.57614367T>G" "{CV-SCV:001977582.1}" "likely pathogenic" ""
"0000878565" "0" "99" "11" "57381930" "57381930" "subst" "0" "03256" "SERPING1_000977" "g.57381930C>G" "" "{DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "" "P7 residue of the RCL sequence; the identity of residues P8-P7 in the RCL appears to determine whether the serpin is a functional protease inhibitor or not.\r\nIntroduced in ClinVar as likely pathogenic bu Peking Union Medical College Hospital." "Germline/De novo (untested)" "" "rs2135328051" "0" "" "" "g.57614457C>G" "{CV-RCV:002221662.1}" "likely pathogenic" "ACMG"
"0000878568" "0" "99" "11" "57381973" "57381973" "subst" "0" "03256" "SERPING1_000978" "g.57381973G>C" "" "{DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "" "Introduced in ClinVar as likely pathogenic variant by Peking Union Medical College Hospital" "Germline/De novo (untested)" "" "rs1450674538" "0" "" "" "g.57614500G>C" "{CV-SCV:001977584.1}" "likely pathogenic" ""
"0000878569" "0" "99" "11" "57381975" "57381975" "subst" "0" "03256" "SERPING1_000979" "g.57381975A>C" "" "{DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "" "Introduced in ClinVar as likely pathogenic variant by Peking Union Medical College Hospital" "Germline/De novo (untested)" "" "rs1945516584" "0" "" "" "g.57614502A>C" "{CV-SCV:001977586.1}" "likely pathogenic" ""
"0000878570" "0" "99" "11" "57381976" "57381976" "subst" "0" "03256" "SERPING1_000980" "g.57381976G>T" "6.196e-7" "{DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "" "Introduced in ClinVar as likely pathogenic variant by Peking Union Medical College Hospital" "Germline/De novo (untested)" "" "rs1945516624" "0" "" "" "g.57614503G>T" "{CV-SCV:001977587.1}" "likely pathogenic" ""
"0000878571" "0" "99" "11" "57367351" "57369643" "dup" "0" "03256" "SERPING1_000981" "g.(57365795_57367351)_(57369643_57373482)dup" "" "{DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "exons 3-4 duplication" "Duplication of a genomic region encompassing exons 3 to 4 of unknown length." "Germline/De novo (untested)" "" "" "0" "" "" "g.(57598322_57599878)_(57602170_57606009)dup" "" "pathogenic" "ACMG"
"0000878574" "0" "99" "11" "57365721" "57369643" "del" "0" "03256" "SERPING1_000982" "g.(57365196_57365721)_(57369643_57373482)del" "" "{DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "exons 2-4 deletion" "" "Germline" "" "" "0" "" "" "g.(57597723_57598248)_(57602170_57606009)del" "" "pathogenic" "ACMG"
"0000879096" "0" "99" "11" "57379352" "57379352" ";" "0" "03256" "SERPING1_000983" "g.[57379352C>G(;)57381975A>C]" "" "{DOI:Wang 2022:10.1186/s41065-022-00242-z}" "" "" "Combined variants segregate in two generations of the family" "Germline" "yes" "" "0" "" "" "g.[57611879C>G(;)57614502A>C]" "{CV:VCV001299733.1} {CV:VCV001299740.1}" "likely pathogenic" "ACMG"
"0000879696" "0" "55" "11" "57367593" "57367593" "subst" "0" "03256" "SERPING1_000984" "g.57367593C>T" "0.00000" "" "" "" "c.293C>T variant has not been reported as carried by an affected individual; only observed as part of a predisposition screen in a healthy population; no publications were found based with a search on HAE-C1-INH.\r\nc.293C>T variant has been characterized as VUS according to the ACMG criteria PM2, PP3, as introduced in ClinVar by Illumina San Diego CA. \r\nNote that affecting PM1 is highly critical because the variant belongs to the unstructured N-terminal domain." "Germline" "" "rs1945331471" "0" "" "" "g.57600120C>T" "{CV-SCV:001264346.1}" "VUS" ""
"0000889989" "0" "53" "11" "57365748" "57365748" "subst" "0.00128084" "02329" "SERPING1_000002" "g.57365748C>T" "" "" "" "SERPING1(NM_000062.2):c.5C>T (p.A2V), SERPING1(NM_000062.3):c.5C>T (p.A2V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "VUS" ""
"0000889990" "0" "30" "11" "57367442" "57367442" "subst" "0.000487282" "02326" "SERPING1_000987" "g.57367442A>G" "0.0003655" "" "" "SERPING1(NM_000062.2):c.142A>G (p.T48A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "rs11546661" "0" "" "" "g.57599969A>G" "{CV-SCV:001261318.1}" "likely benign" ""
"0000889991" "0" "33" "11" "57373646" "57373646" "subst" "0.00108015" "02326" "SERPING1_000904" "g.57373646C>T" "" "" "" "SERPING1(NM_000062.2):c.849C>T (p.S283=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.57606173C>T" "" "likely benign" ""
"0000900606" "0" "99" "11" "57369180" "57370071" "del" "0" "03256" "SERPING1_000988" "g.57369180_57370071del" "" "{DOI:Sheikh 2022:10.1007/s10875-022-01399-y}" "" "" "In-frame exon 4 deletion detected by MLPA, with identified bounderies" "Germline" "yes" "" "0" "" "" "g.57601707_57602598del" "" "pathogenic" "ACMG"
"0000900607" "0" "99" "11" "57367586" "57367601" "del" "0" "03256" "SERPING1_000989" "g.57367586_57367601del" "" "{DOI:Sheikh 2023:10.1007/s10875-022-01399-y}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.57600113_57600128del" "" "likely pathogenic" "ACMG"
"0000900608" "0" "99" "11" "57379347" "57379347" "dup" "0" "03256" "SERPING1_000990" "g.57379347dup" "" "{DOI:Sheikh 2023:10.1007/s10875-022-01399-y}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.57611874dup" "" "likely pathogenic" "ACMG"
"0000900609" "0" "99" "11" "57382025" "57382025" "del" "0" "03256" "SERPING1_000991" "g.57382025del" "" "{DOI:Sheikh 2023:10.1007/s10875-022-01399-y}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.57614552del" "" "likely pathogenic" "ACMG"
"0000900610" "0" "99" "11" "57367673" "57367673" "subst" "0" "03256" "SERPING1_000992" "g.57367673G>T" "" "{DOI:Sheikh 2023:10.1007/s10875-022-01399-y}" "" "" "Introduced in ClinVar as pathogenic by DGU-KFSHRC\r\nKing Faisal Specialist Hospital and Research Center, Riyadh Saudi Arabia, without any ACMG scoring criteria" "Germline/De novo (untested)" "" "" "0" "" "" "g.57600200G>T" "{CV-SCV:005374374.1}" "likely pathogenic" ""
"0000902927" "0" "99" "11" "57367553" "57367553" "subst" "0" "03256" "SERPING1_000478" "g.57367553G>T" "" "{DOI:Szabó 2022:10.3389/falgy.2022.836465}" "" "" "Variant also described in a compound heterozygous family (Speletas M et al. 2015. J Allergy Clin Immunol. 135:570–3. doi: 10.1016/j.jaci.2014.08.007)" "Germline" "yes" "" "0" "" "" "g.57600080G>T" "" "likely pathogenic" "ACMG"
"0000902929" "0" "99" "11" "57373973" "57373973" "del" "0" "03256" "SERPING1_000993" "g.57373973del" "" "{DOI:Szabo 2022:10.3389/falgy.2022.836465}" "" "" "" "Germline/De novo (untested)" "yes" "" "0" "" "" "g.57606500del" "" "likely pathogenic" "ACMG"
"0000903221" "0" "11" "11" "57369492" "57369492" "subst" "0.000138108" "03256" "SERPING1_000994" "g.57369492C>G" "0.0006" "" "" "" "c.551-16C>G has been introduced in ClinVar as a benign variant by InVitae, San Diego CA \r\nSPiP prediction: No effect on splicing" "Germline/De novo (untested)" "" "rs369478961" "0" "" "" "g.57602019C>G" "{CV-SCV:002395106.2}" "benign" "ACMG"
"0000903296" "0" "30" "11" "57373866" "57373867" "ins" "0" "03256" "SERPING1_000995" "g.57373866_57373867insG" "" "" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.57606393_57606394insG" "{CV:VCV001353874.1}" "VUS (!)" ""
"0000903297" "0" "30" "11" "57373926" "57373926" "subst" "2.03034E-5" "03256" "SERPING1_000996" "g.57373926C>G" "0.00002045" "" "" "" "" "Germline/De novo (untested)" "" "rs777831305" "0" "" "" "g.57606453A>C" "{CV:VCV001437455.1}" "likely benign" "ACMG"
"0000903298" "0" "30" "11" "57373959" "57373959" "subst" "0.000178672" "03256" "SERPING1_000997" "g.57373959C>T" "0.00011" "" "" "" "" "Germline/De novo (untested)" "" "rs61761890" "0" "" "" "g.57606486C>T" "{CV-SCV:001002161.6}" "benign" ""
"0000904334" "0" "33" "11" "57367469" "57367469" "subst" "0.000113698" "03256" "SERPING1_000998" "g.57367469G>A" "0.00007187" "" "" "" "Introduced in ClinVar as a likely benign variant by Illumina Laboratory Services, Illumina san Diego CA" "Germline/De novo (untested)" "" "rs752993036" "0" "" "" "g.57599996G>A" "{CV-SCV:001264344.1}" "likely benign" ""
"0000904335" "0" "33" "11" "57367818" "57367818" "subst" "0" "03256" "SERPING1_000999" "g.57367818G>A" "0.000003101" "" "" "" "Introduced in ClinVar as a VUS by InVitae, San Diego CA\r\nVariant c.518G>A located in the same codon as c.517A>C (p.Ser173) causes a same protein change p.(Ser173Asn) and probably not affecting protein function in contrast to c.517A>C;p.(Ser173Arg), a variant characterized as likely pathogenic. Considering c.518G>A;p.(Ser173Asn), serine and asparagine both display polar uncharged side chain presumably not affecting the helix structure.\r\nMore details on C1-INH function is expecting." "Germline/De novo (untested)" "" "rs1215435134" "0" "" "" "g.57600345G>A" "{CV-SCV:002593171.5}" "VUS" ""
"0000904354" "0" "33" "11" "57367840" "57367840" "subst" "0" "03256" "SERPING1_001000" "g.57367840G>C" "" "" "" "" "Introduced in ClinVar as a VUS by InVitae, san Diego CA" "Germline/De novo (untested)" "" "" "0" "" "" "g.57600367G>C" "{CV-SCV:002310151.2}" "VUS" ""
"0000904370" "0" "30" "11" "57369598" "57369598" "subst" "5.27953E-5" "03256" "SERPING1_001001" "g.57369598C>G" "0.0001" "" "" "" "" "Germline/De novo (untested)" "" "rs61754492" "0" "" "" "g.57602125C>G" "{CV:VCV001439026.1}" "VUS" ""
"0000904371" "0" "33" "11" "57369604" "57369604" "subst" "2.03049E-5" "03256" "SERPING1_001002" "g.57369604A>T" "0.000004337" "" "" "" "" "Germline/De novo (untested)" "" "rs376688019" "0" "" "" "g.57602131A>T" "{CV-SCV:002142670.5}" "VUS" ""
"0000904376" "0" "30" "11" "57373567" "57373567" "subst" "0" "03256" "SERPING1_001003" "g.57373567C>G" "" "" "" "" "" "Germline/De novo (untested)" "" "rs2495440771" "0" "" "" "g.57606094C>G" "{CV-SCV:002591080.4}" "VUS" ""
"0000905147" "0" "30" "11" "57379421" "57379421" "subst" "2.03321E-5" "03256" "SERPING1_001004" "g.57379421C>A" "0.00001494" "" "" "" "" "Germline/De novo (untested)" "" "rs376231460" "0" "" "" "g.57611948C>A" "{CV-SCV:002364675.5}" "likely benign" ""
"0000905148" "0" "30" "11" "57379429" "57379429" "subst" "4.47496E-5" "03256" "SERPING1_001005" "g.57379429G>A" "0.00006947" "" "" "" "" "Germline/De novo (untested)" "" "rs770029513" "0" "" "" "g.57611956G>A" "{CV-SCV:002424665.5}" "likely benign" ""
"0000905149" "0" "30" "11" "57381790" "57381790" "subst" "4.0858E-6" "03256" "SERPING1_001006" "g.57381790T>G" "0.000002480" "" "" "" "" "Germline/De novo (untested)" "" "rs766958427" "0" "" "" "g.57614317T>G" "{CV:VCV001635189.3}" "likely benign" ""
"0000905150" "0" "30" "11" "57381804" "57381804" "subst" "0" "03256" "SERPING1_001007" "g.57381804T>A" "" "" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.57614331T>A" "{CV:VCV001345107.1}" "VUS" ""
"0000905151" "0" "30" "11" "57381810" "57381810" "subst" "0" "03256" "SERPING1_001008" "g.57381810A>G" "" "" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.57614337A>G" "{CV:VCV001715752.1}" "VUS" ""
"0000905152" "0" "31" "11" "57381824" "57381824" "subst" "4.06534E-6" "03256" "SERPING1_001009" "g.57381824C>T" "0.000002478" "" "" "" "Introduced in ClinVar as likely benign by InVitae, San Francisco CA" "Germline/De novo (untested)" "" "rs1230994574" "0" "" "" "g.57614351C>T" "{CV:VCV001364496.1}" "likely benign" ""
"0000905153" "0" "30" "11" "57381911" "57381911" "subst" "8.12691E-6" "03256" "SERPING1_001010" "g.57381911G>T" "0.000003717" "" "" "" "" "Germline/De novo (untested)" "" "rs749446455" "0" "" "" "g.57614438G>T" "{CV:VCV001378499.3}" "VUS" ""
"0000905154" "0" "35" "11" "57381920" "57381920" "subst" "0" "03256" "SERPING1_001011" "g.57381920G>T" "" "" "" "" "Introduced in ClinVar as VUS by LabCorp Genetics San Francisco CA" "Germline/De novo (untested)" "" "rs2135328029" "0" "" "" "g.57614447G>T" "{CV:VCV001511723.3}" "VUS" ""
"0000905155" "0" "30" "11" "57382050" "57382050" "subst" "4.07943E-6" "03256" "SERPING1_001012" "g.57382050C>T" "0.000004" "" "" "" "" "Germline/De novo (untested)" "" "rs745670182" "0" "" "" "g.57614577C>T" "{CV:VCV001503136.1}" "VUS" ""
"0000908394" "20" "99" "11" "57382032" "57382032" "subst" "0" "03256" "SERPING1_001013" "g.57382032G>C" "" "{DOI:Takimoto-Ito 2021:10.1002/cia2.12161}" "" "" "Circulating serpin function exhibits 16% activity of C1-INH; the authors suggest protein-protein interactions between normal and mutant C1-INH, creating large intracellular C1-INH aggregates" "Germline" "yes" "" "0" "" "" "g.57614559G>C" "" "pathogenic" "ACMG"
"0000908580" "0" "70" "11" "57369516" "57369516" "subst" "1.62448E-5" "03256" "SERPING1_001018" "g.57369516G>A" "0.000001859" "" "" "" "Tolerated by SIFT, benign by PolyPhen.\r\nCharacterized as VUS according to ACMG criteria PM1, PM2, BP4, BA1.\r\nGlu187 position is located a the N-terminus of helix C.\r\nMore information on carriers is required for an appropriate curation" "Germline/De novo (untested)" "" "rs755577591" "0" "" "" "g.57602043G>A" "" "VUS (!)" ""
"0000908593" "11" "11" "11" "57379170" "57379170" "subst" "0.582149" "00006" "SERPING1_000005" "g.57379170A>G" "0.48383" "{PMID:Bafunno 2013:23688413}, {DOI:Bafunno 2013:10.1016/j.jaci.2013.04.006}" "" "IVS7-20A>G" "Introduced as benign in ClinVar by CEMIA, Larissa Greece" "Germline" "" "rs2511988" "0" "" "" "g.57611697A>G" "{CV-SCV:001441216.2}" "benign" ""
"0000908594" "11" "11" "11" "57381989" "57381989" "subst" "0.223181" "00006" "SERPING1_000007" "g.57381989G>A" "0.22195 (gnomAD, exomes)" "{PMID:Bafunno 2013:23688413}, {DOI:Bafunno 2013:10.1016/j.jaci.2013.04.006}" "" "" "Meets the ACMG criteria BA1, BP4" "Germline" "" "rs4926" "0" "" "" "g.57614516G>A" "{CV:000254786}" "benign" "ACMG"
"0000908595" "21" "13" "11" "57365723" "57365723" "subst" "0.0289261" "00006" "SERPING1_000001" "g.57365723T>C" "0.029081" "{PMID:Bafunno 2013:23688413}, {DOI:Bafunno 2013:10.1016/j.jaci.2013.04.006} {DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "" "" "The c.-21 T>C variant positioned in trans with another causal variant in the SERPING1 gene was associated with the higher frequency of attacks, lower age at disease onset and higher clinical severity score (Grombirikova 2023)" "Germline" "" "rs28362944" "0" "" "" "g.57598250T>C" "{CV-SCV:000372547}" "benign" ""
"0000908596" "11" "55" "11" "57373597" "57373597" "subst" "0" "00006" "SERPING1_000540" "g.57373597C>T" "" "{PMID:Jaradat 2016:26895475}, {DOI:Jaradat 2016:10.1016/j.molimm.2016.02.001}" "" "" "" "Germline" "" "" "0" "" "" "g.57606124C>T" "" "VUS" ""
"0000908597" "1" "99" "11" "57373613" "57373615" "del" "0" "00006" "SERPING1_000161" "g.57373613_57373615del" "" "{PMID:Verpy 1996:8755917}" "" "[-100C>G;816_818del]" "c.816_818del is a recurrent variant; Asn272 is a N-glycosylation site.\r\nVariant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "Germline" "?" "rs2495440974" "0" "" "" "g.57606140_57606142del" "" "pathogenic" "ACMG"
"0000909410" "0" "99" "11" "57367555" "57367555" "del" "0" "03256" "SERPING1_001021" "g.57367555del" "" "{DOI:Ren 2023:10.1016/j.jaci.2022.11.027}" "" "" "Characterized as pathogenic according to ACMG criteria PVS1, PP1, PM2," "Germline" "" "" "0" "" "" "g.57600082del" "" "pathogenic" "ACMG"
"0000909412" "0" "99" "11" "57367794" "57367795" "ins" "0" "03256" "SERPING1_001022" "g.57367794_57367795insA" "" "{DOI:Ren 2023:10.1016/j.jaci.2022.11.027}" "" "" "Asn166 residue is located in Sheet 6B\r\nCharacterized as pathogenic according to ACMG criteria PVS1, PM2, PP4, PP5" "Germline" "yes" "" "0" "" "" "g.57600321_57600322insA" "{CV-SCV:007392103.1}" "pathogenic" "ACMG"
"0000909443" "1" "73" "11" "57379205" "57379205" "subst" "6.49942E-5" "03256" "SERPING1_000128" "g.57379205C>T" "6.36e-5" "{DOI:Ren 2023:10.1016/j.jaci.2022.11.027}" "" "c.[1045C>T];[1195C>G]" "Leu327 position is located within sheet-2B, breach; conserved among serpins (76%); \r\nIt has been inferred that c.1045C>T variant is carried by the asymptomatic father" "Germline" "" "rs141075266" "0" "" "" "g.57611732C>T" "{CV:VCV001425516.1}" "VUS" ""
"0000909444" "2" "99" "11" "57379355" "57379355" "subst" "0" "03256" "SERPING1_000108" "g.57379355C>G" "" "{DOI:Ren 2023:10.1016/j.jaci.2022.11.027}" "" "c.[1045C>T];[1195C>G]" "Pro377 residue is highly conserved among serpins (97%); located within sheet-2C.\r\np.(Pro399Ala) variant poorly biosynthesized in recombinant expression studies.\r\nCompound variant c.[1045C>T];[1195C>G], trans configuration, has been suggested as contributing to a more severe clinical phenotype" "Germline" "yes" "" "0" "" "" "g.57611882C>G" "{CV-SCV:002254160.1}" "likely pathogenic" "ACMG"
"0000909445" "0" "99" "11" "57381963" "57381963" "subst" "0" "03256" "SERPING1_001023" "g.57381963T>G" "" "{DOI:Ren 2023:10.1016/j.jaci.2022.11.027}" "" "" "Phe449 is a highly conserved position among serpins, locates within sheet-4B, distal to the hinge region. The aromatic side chain from Phe449 is buried in the hydrophobic C1-INH core, whereas Cys is a polar residue that usually resides on the protein surface. p.(Phe471Cys) will likely affect the packing of RCL and subsequent serpin function, this makes p.(Phe471Cys) as a Class II variant. \r\nConsistent with this appraisal, p.(Phe471Cys) is poorly biosynthesized in recombinant expression studies (Ren et al 2023)" "Germline" "" "" "0" "" "" "g.57614490T>G" "" "likely pathogenic" ""
"0000909446" "0" "99" "11" "57365195" "57365795" "del" "0" "03256" "SERPING1_000751" "g.(57365027_57365195)_(57365795_57367351)del" "" "{DOI:Ren 2023:10.1016/j.jaci.2022.11.027}" "" "4.18-kb deletion encompassing exons 1 and 2" "Boundaries uncovered by WGS" "Germline" "yes" "" "0" "" "" "g.(57597554_57597722)_(57598322_57599878)del" "" "pathogenic" "ACMG"
"0000909447" "0" "99" "11" "57373482" "57374021" "del" "0" "03256" "SERPING1_000761" "g.(57369643_57373482)_(57374021_57379189)del" "" "{DOI:Ren 2023:10.1016/j.jaci.2022.11.027}" "" "4.83-kb deletion encompassing exons 5 and 6" "Boundaries uncovered by WGS" "Germline" "yes" "" "0" "" "" "g.(57602170_57606009)_(57606548_57611716)del" "" "pathogenic" "ACMG"
"0000909453" "0" "99" "11" "57373482" "57379410" "del" "0" "03256" "SERPING1_000133" "g.(57369643_57373482)_(57379410_57381800)del" "" "{DOI:Ren 2023:10.1016/j.jaci.2022.11.027}" "" "9.69-kb deletion encompassing exons 5 to 7" "Boundaries uncovered by WGS" "Germline" "" "" "0" "" "" "g.(57602170_57606009)_(57611937_57614327)del" "" "pathogenic" "ACMG"
"0000913626" "0" "99" "11" "57367365" "57367365" "subst" "0" "02327" "SERPING1_000149" "g.57367365C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.57599892C>G" "" "pathogenic" ""
"0000916937" "0" "73" "11" "57367544" "57367544" "subst" "9.00282E-5" "03256" "SERPING1_001024" "g.57367544A>T" "0.00008490" "" "" "" "The clinical significance of this variant remains unclear, 2 observations as likely benign (2020, 2021) and 1 observation as uncertain significance (Ambry Genetics, Aliso Viejo CA, 2022)." "Germline" "" "rs147409450" "0" "" "" "g.57600071A>T" "{CV-SCV:002736795.2}" "VUS" ""
"0000918109" "0" "99" "11" "57367630" "57367631" "ins" "0" "03256" "SERPING1_001025" "g.57367630_57367631insC" "" "" "" "" "c.330_331insC variant identified as pathogenic by Peking Union Medical College Hospital" "Germline/De novo (untested)" "" "rs2135308522" "0" "" "" "g.57600157_57600158insC" "{CV:VCV001329453.1}" "pathogenic" ""
"0000921574" "0" "99" "11" "57379287" "57379290" "dup" "0" "03256" "SERPING1_001026" "g.57379287_57379290dup" "" "{DOI:Ukhanova 2023:10.33029/0206-4952-2023-44-1-103-108}" "" "" "Eight individuals with a severe clinical phenotype.\r\nThe c.1127_1130dup variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PVS1_Str, PP4_Str, PM2_Sup.\r\nSubmitted to ClinVar as pathogenic by Research Centre For Medical Genetics, Moscow Russia" "Germline" "yes" "" "0" "" "" "g.57611814_57611817dup" "{CV-SCV:003242573.1}" "pathogenic" "ACMG"
"0000922456" "0" "55" "11" "57379224" "57379224" "del" "0" "03256" "SERPING1_001027" "g.57379224del" "" "" "" "" "This variant has not been reported in the literature in individuals affected with SERPING1-related conditions.\r\nSubmitted to ClinVar as pathogenic by InVitae, San Francisco CA" "Germline/De novo (untested)" "" "rs2495452211" "0" "" "" "g.57611749del" "{CV-SCV:003234942.1}" "pathogenic" "ACMG"
"0000922457" "0" "50" "11" "57379238" "57379238" "subst" "1.62443E-5" "03256" "SERPING1_001028" "g.57379238C>T" "0.000006815 (gnomAD v4)" "" "" "" "Pro338 is a highly conserved position among serpins (93%)\r\nPro338 is the C-terminal residue of sheet 3B, in a buried hydrophobic area, packs against conserved Phe455\r\nPro338 participates in the gate.\r\nOther variant(s) that disrupt this residue have been observed in individuals with HAE-C1INH - p.(Pro360Leu), Gökmen 2019; p.(Pro360His), Ponard 2019 - suggesting that Pro360 may be a clinically significant amino acid residue, a substitution of which may impact C1-INH function.\r\nVariant introduced in ClinVar by LabCorp Genetics as a VUS." "Germline/De novo (untested)" "" "rs989642546" "0" "" "" "g.57611765C>T" "{CV-SCV:003783800.5}" "likely pathogenic (!)" ""
"0000922461" "0" "53" "11" "57365119" "57365119" "subst" "0" "03256" "SERPING1_001029" "g.57365119C>G" "0.00010" "" "" "" "Introduced as VUS in ClinVar by Illumina, San Diego CA, and benign by Prevention Genetics, Marshfield WI; methods: clinical testing, no C1-INH function analysis" "Germline" "" "rs866115469" "0" "" "" "g.57597646C>G" "{CV-SCV:000372543.3}" "VUS (!)" ""
"0000922477" "0" "50" "11" "57367563" "57367566" "dup" "0" "03256" "SERPING1_001030" "g.57367563_57367566dup" "" "" "" "" "Tc.263_266dup creates a premature translational stop signal in the SERPING1 gene, expected to result in an absent or disrupted protein product.\r\nIntroduced in ClinVar as a pathogenic variant by InVitae, San Francisco CA." "Germline" "" "rs2495425731" "0" "" "" "g.57600087_57600088dup" "{CV-SCV:003234074.1}" "pathogenic" "ACMG"
"0000922481" "0" "99" "11" "57363220" "57367398" "del" "0" "03256" "SERPING1_001031" "g.57363220_57367398del" "" "{DOI:Ren 2023:/10.1016/j.jaci.2022.11.027}" "" "Large deletion 4.18 kb" "A 4.18-kb deletion encompassing entire exons 1 and 2 and a 5\' section of exon 3" "Germline" "yes" "" "0" "" "" "g.57595747_57599925del" "" "pathogenic" "ACMG"
"0000922482" "0" "99" "11" "57370279" "57375104" "del" "0" "03256" "SERPING1_001032" "g.57370279_57375104del" "" "{DOI:Ren 2023:10.1016/j.jaci.2022.11.027}" "" "Large deletion 4.83 kb" "" "Germline" "yes" "" "0" "" "" "g.57602806_57607631del" "" "pathogenic" "ACMG"
"0000922483" "0" "99" "11" "57370279" "57379973" "del" "0" "03256" "SERPING1_001033" "g.57370279_57379973del" "" "{DOI:Ren 2023:10.1016/j.jaci.2022.11.027}" "" "Large deletion 9.69 kb" "" "Germline" "yes" "" "0" "" "" "g.57602806_57612500del" "" "pathogenic" "ACMG"
"0000927465" "0" "99" "11" "57368202" "57370484" "del" "0" "03256" "SERPING1_001034" "g.57368202_57370484del" "" "{DOI:Kanepa 2023:10.1186/s13223-023-00783-6} {DOI:Rozevska 2024:10.1186/s13223-024-00889-5} {DOI:Kurjane 2026:10.3389/fimmu.2026.1696479}" "" "" "Exon 4 deletion with in-frame deletion of 45 residues, with subsequent marquedly reduced C1-INH expression and characterization as HAE type 1" "Germline/De novo (untested)" "yes" "" "0" "" "" "g.57600729_57603011del" "" "pathogenic" "ACMG"
"0000927692" "0" "30" "11" "57381809" "57381809" "subst" "4.07269E-6" "03256" "SERPING1_001035" "g.57381809G>A" "0.000001859" "" "" "" "No published data" "Germline/De novo (untested)" "" "rs760283415" "0" "" "" "g.57614336G>A" "{CV-SCV:003008824.1}" "VUS" ""
"0000927824" "0" "55" "11" "57369510" "57369510" "subst" "0" "03256" "SERPING1_001036" "g.57369510G>A" "0.000001239" "{DOI:Rodriguez Espada 2025:10.1182/bloodadvances.2025017220}" "" "" "The variation disrupts Ala185 position in a turn between helix B and helix C.\r\nDeleterious by SIFT, probably damaging by PolyPhen." "Germline" "yes" "rs1335168882" "0" "" "" "g.57602037G>A" "" "VUS" ""
"0000927936" "0" "99" "11" "57367812" "57367812" "subst" "0" "03256" "SERPING1_001037" "g.57367812C>G" "" "{DOI:Guryanova 2023:10.24412/2709-1201-2023-179-186}" "" "" "Pro149 is a critical position in the structure, a variant at this position affects the N-terminus of helixB: Pro149 residue forms tight turn, with variants at this position disturbing β-sheet A subsequently resulting in the formation of loop-sheet polymers.\r\nVariant characterized as pathogenic according to ACMG criteria PS2, PS3, PM1, PM2, PM5, PP4" "De novo" "" "" "0" "" "" "g.57600339C>G" "" "pathogenic" "ACMG"
"0000933328" "0" "99" "11" "57367853" "57367853" "subst" "0" "03256" "SERPING1_001038" "g.57367853A>C" "" "{DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "" "" "Minigene analysis confirms the deleterious effect on splicing and it showed aberrant splicing with exon 3 skipping in nearly 100% of mutated minigene construct transcripts.\r\nIn silico SpliceAI algorithm predicts a donor site loss for the c.550+3A>C substitution." "Germline" "yes" "" "0" "" "" "g.57600380A>C" "" "likely pathogenic" "ACMG"
"0000933329" "0" "99" "11" "57373482" "57373482" "subst" "0" "03256" "SERPING1_001039" "g.57373482G>T" "" "{DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "" "" "c.686-1G>T affects the canonical acceptor splice site" "Germline/De novo (untested)" "" "" "0" "" "" "g.57606009G>T" "" "pathogenic" "ACMG"
"0000933330" "0" "99" "11" "57367451" "57367452" "del" "0" "03256" "SERPING1_001040" "g.57367451_57367452del" "" "{DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57599978_57599979del" "" "pathogenic" "ACMG"
"0000933331" "0" "99" "11" "57373523" "57373574" "del" "0" "03256" "SERPING1_001041" "g.57373523_57373574del" "" "{DOI:Grombikirova 2023:10.1007/s10875-023-01565-w}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57606050_57606101del" "" "pathogenic" "ACMG"
"0000933332" "0" "99" "11" "57373592" "57373593" "delins" "0" "03256" "SERPING1_001042" "g.57373592_57373593delinsT" "" "{DOI:Grombikirova 2023:10.1007/s10875-023-01565-w}" "" "c.795_796delGGinsT" "" "Germline" "yes" "" "0" "" "" "g.57606119_57506120delinsT" "" "pathogenic" "ACMG"
"0000933333" "0" "99" "11" "57379275" "57379275" "del" "0" "03256" "SERPING1_001043" "g.57379275del" "" "{DOI:Grodecká 2017:10.1016/j.clim.2017.03.010} {DOI:Grombikirova 2023:10.1007/s10875-023-01565-w}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57611802del" "" "pathogenic" "ACMG"
"0000933334" "0" "99" "11" "57381834" "57381834" "del" "0" "03256" "SERPING1_001044" "g.57381834del" "" "{DOI:Grodecká 2017:10.1016/j.clim.2017.03.010} {DOI:Grombikirova 2023:10.1007/s10875-023-01565-w}" "" "" "" "Germline" "" "" "0" "" "" "g.57614361del" "" "pathogenic" "ACMG"
"0000933335" "0" "99" "11" "57382011" "57382017" "del" "0" "03256" "SERPING1_001045" "g.57382011_57382017del" "" "{DOI:Grombikirova 2023:10.1007/s10875-023-01565-w}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57614538_57614544del" "" "pathogenic" "ACMG"
"0000933343" "0" "99" "11" "57373590" "57373590" "subst" "0" "03256" "SERPING1_001046" "g.57373590T>G" "" "{DOI:Grombikirova 2023:10.1007/s10875-023-01565-w}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57606117T>G" "" "likely pathogenic" "ACMG"
"0000933344" "0" "99" "11" "57381912" "57381912" "subst" "0" "03256" "SERPING1_001047" "g.57381912T>G" "" "{DOI:Grombirikova 2023:10.1007/s10875-023-01565-w}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57614439T>G" "" "pathogenic" "ACMG"
"0000933453" "0" "99" "11" "57365195" "57374021" "del" "0" "03256" "SERPING1_000753" "g.(57365027_57365195)_(57374021_57379189)del" "" "{DOI:Grombikirova 2023:10.1007/s10875-023-01565-w}" "" "EX1_6del" "A large deletion of unknown length encompassing exons 1 to 6" "Germline" "yes" "" "0" "" "" "rrg.(57597554_57597722)_(57606548_57611716)del" "" "pathogenic" "ACMG"
"0000933654" "0" "99" "11" "57379229" "57379229" "del" "0" "03256" "SERPING1_001048" "g.57379229del" "" "{DOI:Pappalardo 2000:10.1067/mai.2000.110471}" "" "14070delA" "Variant introduced in the Lund SERPING1 database http://structure.bmc.lu.se/idbase/SERPING1base/" "De novo" "" "" "0" "" "" "g.57611756del" "" "pathogenic" "ACMG"
"0000945942" "3" "99" "11" "57373955" "57373955" "subst" "0" "03256" "SERPING1_001049" "g.57373955G>A" "" "{DOI:Maia 2023:10.3390/jcm12237299} {DOI:Ferriani 2025:10.1016/j.jaip.2025.08.026} {DOI:Rodriguez Espada 2025:10.1182/bloodadvances.2025017220}" "" "c.[964G>A];[964G>A]" "Only homozygous carriers are presenting with HAE clinical and biological phenotypes.\r\nThe variation is at a highly conserved position among serpins (80%), likely to disrupt Val322 position within sheet C (s3C)." "Germline" "yes" "" "0" "" "" "g.57606482G>A" "" "likely pathogenic (recessive)" ""
"0000949719" "0" "99" "11" "57379317" "57379318" "del" "0" "02326" "SERPING1_000891" "g.57379317_57379318del" "" "" "" "SERPING1(NM_000062.2):c.1157_1158delTG (p.L386Rfs*38)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.57611844_57611845del" "" "pathogenic" ""
"0000952089" "0" "99" "11" "57365795" "57365795" "subst" "0" "03256" "SERPING1_001050" "g.57365795G>C" "" "{DOI:Roman 2023:10.1016/j.anai.2023.08.428}" "" "" "The c.51+1G>C substitution affects the donor canonical splice site. Disruption of this splice site results in skipping of exon 2, and is expected to result in the loss of the initiator methionine \r\nMeets the PS1 ACMG criterion.\r\nIntroduced in ClinVar as pathogenic by InVitae, San Francisco CA" "Germline" "yes" "rs1470120365" "0" "" "" "g.57598322G>C" "{CV-SCV:004318176.1}" "pathogenic" "ACMG"
"0000953658" "0" "99" "11" "57365780" "57365788" "del" "0" "03256" "SERPING1_001051" "g.57365780_57365788del" "" "{DOI:Karam 2023:10.1016/j.neurol.2023.10.006} {DOI:Ren 2025:10.1016/j.jaci.2024.12.1044}" "" "" "In-frame deletion.\r\nVariant p.(Leu13_Leu15del) is not expressed in cell biology investigations where minigene is transfected into 293T cells. Altering the hydrophobic core by shortening it with deletion can disrupt signal peptide transportation and impair protein secretion." "Germline" "" "" "0" "" "" "g.57598307_5759815del" "" "likely pathogenic" "ACMG"
"0000954951" "0" "99" "11" "57369646" "57369646" "dup" "0" "03256" "SERPING1_001052" "g.57369646dup" "" "{DOI:Shchagina 2024:10.3390/biomedicines12010072}" "" "" "c.685+4dup variant leads to the loss of the donor splice site and the activation of the cryptic site in exon 4, as predicted by the SpliceAI algorithm (with very low scores). The substantial function decrease (eg. 17.5%) in the proband sample could be interpreted by the observation that the transcript with r.(710_745del) is not a normal product of alternative SERPING1 splicing; it could be speculated as depending on a No-go decay (NGD) mechanism.\r\nAnalysis of the patients’ mRNA (extracted from whole blood) showed that the SERPING1 (NM_000062.3):c.685+4dup variant leads to the loss of the donor splice site and the activation of the cryptic site in exon 4: r.710_745del (p.Gly217_Pro228del).\r\nThe c.685+4dup variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as likely pathogenic: PP4_Str, PM4, PM2_Sup, PP1.\r\nIntroduced in ClinVar as likely pathogenic by Research Centre For Medical Genetics, Moscow Russia" "Germline" "yes" "" "0" "" "" "g.57602173dup" "{CV-SCV:005186258.1}" "likely pathogenic" "ACMG"
"0000959765" "0" "70" "11" "57382043" "57382043" "subst" "0" "03779" "SERPING1_000648" "g.57382043C>T" "" "" "" "" "" "CLASSIFICATION record" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000971528" "3" "99" "11" "57379296" "57379296" "subst" "0" "03256" "SERPING1_000586" "g.57379296T>C" "" "{DOI:Hamidou 2024:10.1016/j.reval.2023.103765}" "" "c.[1136T>C];[1136T>C]" "The proband\'s sister is paucisymptomatic\r\nHer parents have not been investigated" "Germline" "" "" "0" "" "" "g.57611823T>C" "" "likely pathogenic (!)" ""
"0000971590" "0" "99" "11" "57379349" "57379351" "dup" "0" "03256" "SERPING1_001053" "g.57379349_57379351dup" "" "{DOI:Markocsy 2024:10.1016/j.waojou.2024.100885}" "" "" "In-frame duplication with a subsequent HAE-1 phenotype evaluated as likely pathogenic according to ACMG criteria (PM1, PM2, PM4, PP1, PP4)." "Germline" "yes" "" "0" "" "" "g.57611876_57611878dup" "" "likely pathogenic" ""
"0000971591" "0" "99" "11" "57367382" "57367395" "del" "0" "03256" "SERPING1_001054" "g.57367382_57367395del" "" "{DOI:Markocsy 2024:10.1016/j.waojou.2024.100885}" "" "" "predicted to lead to degradation by nonsense mediated mRNA decay (NMD) leaving no transcripts for protein production." "Germline" "yes" "" "0" "" "" "g.57599909_57599922del" "" "pathogenic" "ACMG"
"0000971592" "0" "99" "11" "57367716" "57367716" "subst" "4.06062E-6" "03256" "SERPING1_001055" "g.57367716A>G" "" "{DOI:Markocsy 2024:10.1016/j.waojou.2024.100885}" "" "" "Variant is evaluated as a likely pathogenic according to ACMG criteria (PM1, PM2, PM6, PP4). The change to neutral and compact amino acid glycine is expected to affect the helix structure." "Germline" "yes" "" "0" "" "" "g.57600243A>G" "" "likely pathogenic" "ACMG"
"0000971593" "0" "99" "11" "57367817" "57367817" "subst" "0" "03256" "SERPING1_001056" "g.57367817A>C" "" "{DOI:Markocsy 2024:10.1016/j.waojou.2024.100885}" "" "" "p.(Ser173Arg) variant displays Arg as an amino acid with positively charged side chain, likely to disturb the helix structure.\r\nVariant is evaluated as likely pathogenic according to ACMG criteria PM1, PM2, PP1, PP3, PP4.\r\nClinvar database displays variant c.518G>A;p.(Ser173Asn) and does not consider it to affect protein function (VUS) because Ser and Asp both display uncharged side chain (submitted by InVitae, San Francisco CA)." "Germline" "yes" "" "0" "" "" "g.57600344A>C" "" "likely pathogenic" "ACMG"
"0000971627" "0" "99" "11" "57367351" "57367851" "del" "0" "03256" "SERPING1_001057" "g.(57365795_57367351)_(57367851_57369507)del" "" "{DOI:Markocsy 2024:10.1016/j.waojou.2024.100885}" "" "exon 3 deletion" "evaluated as pathogenic according to ACMG criteria (PVS1, PM2, PP1, PP4)." "Germline" "yes" "" "0" "" "" "g.(57598322_57599878)_(57600378_57602034)del" "" "pathogenic" "ACMG"
"0000971628" "0" "99" "11" "57373945" "57373945" "del" "0" "03256" "SERPING1_001058" "g.57373945del" "" "{DOI:Markocsy 2024:10.1016/j.waojou.2024.100885}" "" "" "Predicted to lead to degradation by nonsense mediated mRNA decay (NMD) leaving no transcripts for protein production.\r\nThe c.954delA variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PVS1, PP4_Mod, PM2_Sup." "Germline" "yes" "" "0" "" "" "g.57606472del" "" "pathogenic" "ACMG"
"0000971629" "0" "99" "11" "57379198" "57379198" "del" "0" "03256" "SERPING1_001059" "g.57379198del" "" "{DOI:Markocsy 2024:10.1016/j.waojou.2024.100885}" "" "" "predicted to lead to degradation by nonsense mediated mRNA decay (NMD) leaving no transcripts for protein production." "Germline" "yes" "" "0" "" "" "g.57611725del" "" "pathogenic" "ACMG"
"0000971690" "0" "99" "11" "57379233" "57379241" "del" "0" "03256" "SERPING1_001060" "g.57379233_57379241del" "" "{DOI:Markocsy 2024:10.1016/j.waojou.2024.100885}" "" "" "In-frame deletion evaluated as likely pathogenic according to ACMG criteria (PM1, PM2, PM4, PP1, PP4)." "Germline" "yes" "" "0" "" "" "g.57611760_57611768del" "" "likely pathogenic" "ACMG"
"0000971691" "0" "99" "11" "57379287" "57379287" "del" "0" "03256" "SERPING1_001061" "g.57379287del" "" "{DOI:Markocsy 2024:10.1016/j.waojou.2024.100885}" "" "" "predicted to lead to degradation by nonsense mediated mRNA decay (NMD) leaving no transcripts for protein production." "Germline" "yes" "" "0" "" "" "g.57611814del" "" "pathogenic" "ACMG"
"0000971692" "0" "99" "11" "57381882" "57381882" "dup" "0" "03256" "SERPING1_001062" "g.57381882dup" "" "{DOI:Markocsy 2024:10.1016/j.waojou.2024.100885}" "" "" "predicted to lead to degradation by nonsense mediated mRNA decay (NMD) leaving no transcripts for protein production." "Germline" "yes" "" "0" "" "" "g.57614409dup" "" "pathogenic" "ACMG"
"0000971693" "0" "99" "11" "57381922" "57381924" "del" "0" "03256" "SERPING1_001063" "g.57381922_57381924del" "" "{DOI:Markocsy 2024:10.1016/j.waojou.2024.100885}" "" "" "In-frame deletion of the P7 residue of the RCL likely to affect the target protease recognition.\r\nEvaluated as likely pathogenic according to ACMG criteria (PM1, PM2, PM4, PP1, PP4)." "Germline" "yes" "" "0" "" "" "g.57614449_57614451del" "" "pathogenic" "ACMG"
"0000971694" "0" "99" "11" "57381897" "57381897" "subst" "0" "03256" "SERPING1_001064" "g.57381897T>A" "" "{DOI:Markocsy 2024:10.1016/j.waojou.2024.100885} {DOI:Du 2026:10.3389/falgy.2026.1899305}" "" "" "With substitution of hydrophobic Leu to uncharged Gln, p.(Leu449Gln) at P5\' residue is likely to affect the RCL structure disturbing the breach functional domain.\r\nVariant c.1346T>A is evaluated as a likely pathogenic according to ACMG criteria (PM1, PM2, PP1, PP3, PP4). Variant found in a large family with clinical diagnosis of HAE-C1-INH." "Germline" "yes" "" "0" "" "" "g.57614424T>A" "" "likely pathogenic" "ACMG"
"0000971695" "1" "33" "11" "57365748" "57365748" "subst" "0.00128084" "03256" "SERPING1_000002" "g.57365748C>T" "" "{DOI:Markocsy 2024:10.1016/j.waojou.2024.100885}" "" "c.[5C>T(;)1397G>A]" "Combination of variants c.[5C>T(;)1397G>A] in a single individual presenting with a HAE type 1 phenotype; the pathogenic variant c.1397G>A fully explains the phenotype. \r\nSegregation analysis of c.5C>T in the family not possible, variant c.5C>T supposed having no impact on clinical phenotype and laboratory observations." "Germline" "?" "" "0" "" "" "g.57598275C>T" "" "VUS" "ACMG"
"0000971696" "2" "99" "11" "57381948" "57381948" "subst" "0" "03256" "SERPING1_000314" "g.57381948G>A" "" "{DOI:Markocsy 2024:10.1016/j.waojou.2024.100885}" "" "c.[5C>T(;)1397G>A]" "Combination of c.[5C>T(;)1397G>A] in a single individual, where the c.1397G>A variant is considered pathogenic." "Germline" "?" "rs121907948" "0" "" "" "g.57614475G>A" "{CV:000003946}" "pathogenic" "ACMG"
"0000971993" "0" "99" "11" "57364832" "57364832" "" "0" "03256" "SERPING1_000731" "g.(57364832?)_(57382477?)del" "" "{DOI:Markocsy 2024:10.1016/j.waojou.2024.100885} {DOI:Horváth 2026:10.1515/bmc-2025-0060}" "" "whole gene deletion from exon 1 to exon 8" "Deletion variant with unidentified boundaries" "Germline" "yes" "" "0" "" "" "g.(57597359?)_(57615004?)del" "" "pathogenic" "ACMG"
"0000979652" "0" "90" "11" "57367351" "57367351" "subst" "0" "02325" "SERPING1_000155" "g.57367351G>A" "" "" "" "SERPING1(NM_000062.3):c.52-1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.57599878G>A" "" "pathogenic" "ACMG"
"0000979653" "0" "50" "11" "57379230" "57379230" "subst" "0" "02326" "SERPING1_000100" "g.57379230T>G" "" "" "" "SERPING1(NM_000062.2):c.1070T>G (p.I357S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000984945" "0" "99" "11" "57381989" "57381993" "delins" "0" "03256" "SERPING1_001065" "g.57381989_57381993delinsATGCC" "" "{DOI:Aydoğdu 2024:10.1620/tjem.2023.J083}" "" "c.1438_1442delGTGCTinsATGCC" "In-frame del/ins variant\r\nc.1438_1442delinsATGCC variant classified by the authors as uncertain according to the ACMG criteria PM1, PM2" "Germline" "yes" "" "0" "" "" "g.57614516_57614520delinsATGCC" "" "likely pathogenic" "ACMG"
"0000988417" "0" "99" "11" "57367351" "57367351" "subst" "0" "03256" "SERPING1_001066" "g.57367351G>C" "" "" "" "" "Variants that disrupt the acceptor splice site typically lead to a loss of protein function; therefore loss-of-function variants in SERPING1 are characterized as pathogenic.\r\nVariant submitted to ClinVar as likely pathogenic by InVitae, San Francisco CA" "Germline" "yes" "rs886041353" "0" "" "" "g.57599878G>C" "{CV-SCV:004488969.2}" "likely pathogenic" "ACMG"
"0000988418" "0" "99" "11" "57367768" "57367768" "del" "0" "03256" "SERPING1_001067" "g.57367768del" "" "" "" "" "The c.468delC variant meets ACMG/ClinGen criteria to be classified as likely pathogenic: PVS1, PP4_Str, PM2_Sup.\r\nVariant submitted to ClinVar as pathogenic by Research Centre For Medical Genetics, Moscow Russia." "Germline" "" "rs2495426601" "0" "" "" "g.57600295del" "{CV-SCV:005061386.2}" "pathogenic" "ACMG"
"0000988437" "0" "99" "11" "57367851" "57367851" "subst" "0" "03256" "SERPING1_001068" "g.57367851G>C" "" "" "" "" "The c.550+1G>C variant in SERPING1 meets ACMG/ClinGen criteria to be classified as pathogenic: PVS1, PP4_Str, PS1_Sup, PM2_Sup, PP1.\r\nVariant submitted to ClinVar as pathogenic by RCMG Research Centre For Medical Genetics, Moscow Russia" "Germline" "" "" "0" "" "" "g.57367851G>C" "{CV-SCV:005068172.1}" "pathogenic" "ACMG"
"0000988453" "0" "99" "11" "57367852" "57367852" "subst" "0" "03256" "SERPING1_001069" "g.57367852T>A" "" "{DOI:Ponard 2020:10.1002/humu.23917}" "" "" "The c.550+2T>A variant in SERPING1 meets ACMG/ClinGen criteria to be classified as pathogenic: PVS1, PM2_Sup, PS1_Sup, PP4 \r\nIt has been submitted to ClinVar as pathogenic by Research Centre For Medical Genetics, Moscow Russia" "Germline" "yes" "" "0" "" "" "g.57367852T>A" "{CV-SCV:005062174.1}" "pathogenic" "ACMG"
"0000988458" "0" "99" "11" "57369556" "57369556" "subst" "0" "03256" "SERPING1_001070" "g.57369556C>T" "" "" "" "" "The c.599C>T variant in SERPING1 meets ACMG/ClinGen criteria to be classified as likely pathogenic: PP4_Str, PP2, PM2_Sup.\r\nIt has been submitted to ClinVar as likely pathogenic by RCMG Research Centre For Medical Genetics, Moscow Russia" "Germline" "" "rs1362220560" "0" "" "" "g.57369556C>T" "{CV-SCV:005061387.1}" "likely pathogenic" "ACMG"
"0000988461" "0" "55" "11" "57369621" "57369624" "del" "0" "03256" "SERPING1_001071" "g.57369621_57369624del" "" "" "" "" "The c.664_667del variant in SERPING1 meets ACMG/ClinGen criteria to be classified as pathogenic: PVS1, PP4_Str, PM2_Sup.\r\nVariant submitted to ClinVar as pathogenic by RCMG Research Centre For Medical Genetics, Moscow Russia" "Germline/De novo (untested)" "" "rs2495431242" "0" "" "" "g.57602148_57602151del" "{CV-SCV:005061749.1}" "pathogenic" "ACMG"
"0000988462" "0" "99" "11" "57373481" "57373481" "subst" "0" "03256" "SERPING1_001072" "g.57373481A>G" "" "" "" "" "The c.686-2A>G variant in SERPING1 meets ACMG/ClinGen criteria to be classified as pathogenic: PVS1_Str, PS1_Mod, PM2_Sup.\r\nVariant submitted to ClinVar as likely pathogenic by Research Centre For Medical Genetics, Moscow Russia" "Germline/De novo (untested)" "" "rs2495440350" "0" "" "" "g.57606008A>G" "{CV-SCV:005061444.1}" "likely pathogenic" "ACMG"
"0000988463" "0" "99" "11" "57373510" "57373510" "del" "0" "03256" "SERPING1_001073" "g.57373510del" "" "" "" "" "Variant submitted to ClinVar as pathogenic by InVitae San Francisco CA" "Germline/De novo (untested)" "" "" "0" "" "" "g.57606037del" "{CV-SCV:004259611.1}" "pathogenic" "ACMG"
"0000988464" "0" "55" "11" "57373517" "57373518" "dup" "0" "03256" "SERPING1_001074" "g.57373517_57373518dup" "" "" "" "" "Submitted to ClinVar as pathogenic by InVitae, San Francisco CA" "Germline/De novo (untested)" "" "rs2495440461" "0" "" "" "g.57606044_57606045dup" "{CV-SCV:004410595.1}" "pathogenic" "ACMG"
"0000988467" "0" "55" "11" "57373529" "57373530" "dup" "0" "03256" "SERPING1_001075" "g.57373529_57373530dup" "" "" "" "" "Submitted to ClinVar as pathogenic by Ambry Genetics, Aliso Viejo CA" "Germline/De novo (untested)" "" "rs2495440542" "0" "" "" "g.57606056_57606057dup" "{CV-SCV:002669751}" "pathogenic" "ACMG"
"0000988468" "0" "55" "11" "57373529" "57373529" "subst" "0" "03256" "SERPING1_001076" "g.57373529C>A" "" "" "" "" "The c.732C>A variant in SERPING1 meets ACMG/ClinGen criteria to be classified as pathogenic: PVS1, PP4_Str, PM2_Sup.\r\nSubmitted to ClinVar as pathogenic by RCMG Research Centre For Medical Genetics, Moscow Russia" "Germline/De novo (untested)" "yes" "rs1565171672" "0" "" "" "g.57606056C>A" "{CV-SCV:005061741.1}" "pathogenic" "ACMG"
"0000988469" "0" "79" "11" "57373963" "57373964" "ins" "0" "03256" "SERPING1_001077" "g.57373963_57373964insGCTGCATAAATGTCTTCTTTTGAGAAGTGTCTGTTCATGTCCTTCGCCCACTTTTTGATGGGGTTGTTTGTTNNNNNNNNNNAAAAAAAAAAAAAAAAAAAAAAAAGTGCCCATG" "" "" "" "" "Submitted to ClinVar as pathogenic by InVitae San Francisco CA" "Germline/De novo (untested)" "" "" "0" "" "" "g.57606477-57606478insGCTGCATAAATGTCTTCTTTTGAGAAGTGTCTGTTCATGTCCTTCGCCCACTTTTTGATGGGGTTGTTTGTTNNNNNNNNNNAAAAAAAAAAAAAAAAAAAAAAAAGTGCCCATG" "{CV-SCV:004408438.1}" "pathogenic" "ACMG"
"0000988470" "0" "99" "11" "57373954" "57373954" "del" "0" "03256" "SERPING1_001078" "g.57373954del" "" "" "" "" "The c.963delA variant in SERPING1 meets ACMG/ClinGen criteria to be classified as pathogenic: PVS1, PP4_Str, PM2_Sup.\r\nVariant submitted to ClinVar as pathogenic by RCMG Research Centre For Medical Genetics, Moscow Russia" "Germline/De novo (untested)" "yes" "rs2495442396" "0" "" "" "g.57606481del" "{CV-SCV:005061390.1}" "pathogenic" "ACMG"
"0000988471" "0" "99" "11" "57373972" "57373978" "del" "0" "03256" "SERPING1_001079" "g.57373972_57373978del" "" "" "" "" "The c.981_987del variant in SERPING1 meets ACMG/ClinGen criteria to be classified as pathogenic: PVS1, PM2_Sup, PP4.\r\nSubmitted to ClinVar as pathogenic by Research Centre For Medical Genetics, Moscow Russia." "Germline/De novo (untested)" "" "" "0" "" "" "g.57606499_57606505del" "{CV-SCV:005061753.1}" "pathogenic" "ACMG"
"0000988472" "0" "99" "11" "57373977" "57373977" "del" "0" "03256" "SERPING1_001080" "g.57373977del" "" "" "" "" "Submitted to ClinVar as pathogenic by InVitae, San Francisco CA" "Germline/De novo (untested)" "" "" "0" "" "" "g.57606504del" "{CV-SCV:003333080.2}" "pathogenic" "ACMG"
"0000988473" "0" "99" "11" "57374003" "57374007" "del" "0" "03256" "SERPING1_001081" "g.57374003_57374007del" "" "" "" "" "Submitted to ClinVar as pathogenic by InVitae, San Francisco CA" "Germline/De novo (untested)" "" "rs2135318388" "0" "" "" "g.57606530_57606534del" "{CV-SCV:002234806.3}" "pathogenic" "ACMG"
"0000988475" "0" "99" "11" "57374021" "57374021" "del" "0" "03256" "SERPING1_001082" "g.57374021del" "" "" "" "" "The c.1029+1delG variant in SERPING1 meets ACMG/ClinGen criteria to be classified as pathogenic: PVS1, PP4_Str, PM2_Sup.\r\nVariant submitted to ClinVar as pathogenic by Research Centre For Medical Genetics, Moscow Russia" "Germline/De novo (untested)" "yes" "" "0" "" "" "g.57606548del" "{CV-SCV:005061428.1}" "pathogenic" "ACMG"
"0000988479" "0" "99" "11" "57379190" "57379190" "del" "0" "03256" "SERPING1_001083" "g.57379190del" "" "" "" "" "The c.1030delG variant in SERPING1 meets ACMG/ClinGen criteria to be classified as pathogenic: PVS1, PS4_Mod, PM2_Sup, PP4.\r\nSubmitted to ClinVar as pathogenic by Research Centre For Medical Genetics, Moscow Russia" "Germline/De novo (untested)" "yes" "rs2495452078" "0" "" "" "g.57611717del" "{CV-SCV:005061765.1}" "pathogenic" "ACMG"
"0000988480" "0" "99" "11" "57379200" "57379200" "subst" "0" "03256" "SERPING1_001084" "g.57379200T>C" "" "" "" "" "The c.1040T>C variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as likely pathogenic: PS4_Mod, PM2_Sup, PP2, PP3, PP4.\r\nVariant submitted to ClinVar as likely pathogenic by Research Centre For Medical Genetics, Moscow Russia" "Germline/De novo (untested)" "yes" "rs2495452135" "0" "" "" "g.57611727T>C" "{CV-SCV:005061766.1}" "likely pathogenic" "ACMG"
"0000988481" "0" "99" "11" "57379293" "57379294" "ins" "0" "03256" "SERPING1_001085" "g.57379293_57379294insA" "" "" "" "" "Submitted to ClinVar as pathogenic by InVitae, San Francisco CA" "Germline/De novo (untested)" "" "rs2495452515" "0" "" "" "g.57611820_57611821insA" "{CV-SCV:002862524.1}" "pathogenic" "ACMG"
"0000988482" "0" "99" "11" "57379347" "57379347" "subst" "0" "03256" "SERPING1_001086" "g.57379347T>G" "" "" "" "" "This variant was found to cosegregate with disease in 4/4 individuals tested.\r\nVariant submitted to ClinVar as likely pathogenic by Ambry Genetics, Aliso Viejo CA" "Germline" "yes" "rs1945480228" "0" "" "" "g.57611874T>G" "{CV-SCV:001743852.2}" "likely pathogenic" ""
"0000988637" "0" "99" "11" "57379403" "57379403" "subst" "0" "03256" "SERPING1_001087" "g.57379403A>T" "" "" "" "" "This variant disrupts a region of the SERPING1 protein in which other variants including p.Arg494* have been determined to be pathogenic .\r\nSubmitted to ClinVar as pathogenic by InVitae, San Francisco CA" "Germline/De novo (untested)" "" "" "0" "" "" "g.57611930A>T" "{CV-SCV:004246179.2}" "pathogenic" "ACMG"
"0000988639" "0" "99" "11" "57381820" "57381820" "del" "0" "03256" "SERPING1_001088" "g.57381820del" "" "" "" "" "The c.1269del variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PVS1_Str, PP4_Str, PM2_Sup.\r\nSubmitted to ClinVar as pathogenic by Research Centre For Medical Genetics, Moscow Russia" "Germline" "" "" "0" "" "" "g.57614347del" "{CV-SCV:005061773.1}" "pathogenic" "ACMG"
"0000988640" "0" "99" "11" "57381824" "57381824" "del" "0" "03256" "SERPING1_001089" "g.57381824del" "" "" "" "" "Submitted to ClinVar as pathogenic by InVitae, San Francsico CA" "Germline/De novo (untested)" "" "" "0" "" "" "g.57614351del" "{CV-SCV:004274474.1}" "pathogenic" "ACMG"
"0000988641" "0" "99" "11" "57381857" "57381857" "del" "0" "03256" "SERPING1_001090" "g.57381857del" "" "" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.57614384del" "{CV-SCV:000024324.4}" "pathogenic" "ACMG"
"0000988642" "0" "99" "11" "57381888" "57381892" "del" "0" "03256" "SERPING1_001091" "g.57381888_57381892del" "" "" "" "" "The c.1337_1341delTGCTG variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PVS1_Str, PP4_Str, PM2_Sup.\r\nSubmitted to ClinVar as pathogenic by Research Centre For Medical Genetics, Moscow Russia" "Germline/De novo (untested)" "" "" "0" "" "" "g.57614415_57614419del" "{CV-SCV:005061785.1}" "pathogenic" "ACMG"
"0000988643" "0" "55" "11" "57381888" "57381888" "subst" "0" "03256" "SERPING1_001092" "g.57381888T>A" "0.000001239" "" "" "" "Submitted to ClinVar as VUS by PreventionGenetics, part of Exact Sciences, Marshfield IL" "Unknown" "" "rs1945513949" "0" "" "" "g.57614415T>A" "{CV-SCV:004778594.2}" "VUS" ""
"0000988644" "0" "99" "11" "57381931" "57381931" "del" "0" "03256" "SERPING1_001093" "g.57381931del" "" "" "" "" "Submitted to ClinVar as pathogenic by InVitae, San Francisco CA" "Germline" "" "" "0" "" "" "g.57614458del" "{CV-SCV:004319080.1}" "pathogenic" "ACMG"
"0000988645" "0" "99" "11" "57381944" "57381945" "del" "0" "03256" "SERPING1_001094" "g.57381944_57381945del" "" "" "" "" "The c.1393_1394delGC variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as likely pathogenic: PVS1_Str, PM2_Sup, PP4.\r\nSubmitted to ClinVar as likely pathogenic by Research Centre For Medical Genetics, Moscow Russia" "Germline" "" "rs2495458312" "0" "" "" "g.57614471_57614472del" "{CV-SCV:005061786.1}" "likely pathogenic" "ACMG"
"0000988703" "0" "99" "11" "57364265" "57367645" "del" "0" "03256" "SERPING1_001095" "g.57364265_57367645del" "" "" "" "" "Variant resulting in the deletion of exons 1-2 and part of exon 3 (c.-953_345del)\r\nSubmitted to ClinVar as pathogenic by InVitae, San Francisco CA" "Germline" "" "" "0" "" "" "g.57596792_57600172del" "{CV-SCV:005064300.1}" "pathogenic" "ACMG"
"0000988704" "0" "99" "11" "57373473" "57382054" "del" "0" "03256" "SERPING1_001096" "g.57373473_57382054del" "" "" "" "exon 5_8 deletion" "Deletion of the genomic region encompassing exons 5 to 8 of the SERPING1 gene, which includes the termination codon.\r\nSubmitted to ClinVar as pathogenic by InVitae, San Francisco CA" "Germline/De novo (untested)" "yes" "" "0" "" "" "g.57606000_57614581del" "{CV-SCV:003790198.3}" "pathogenic" "ACMG"
"0000988705" "0" "99" "11" "57365055" "57374040" "del" "0" "03256" "SERPING1_001097" "g.(57365055_57374040)del" "" "" "" "exons 1-6 deletion" "Gross deletion of the genomic region encompassing exons 1-6 of unknown length, which includes the initiation codon. This deletion extends beyond the assayed region for SERPING1 gene and therefore may encompass additional genes. It is expected to result in an absent or disrupted protein product.\r\nSubmitted to ClinVar as pathogenic by InVitae, San Francisco CA." "Germline/De novo (untested)" "" "" "0" "" "" "g.(57597582_57606567)del" "{CV-SCV:003790197.3}" "pathogenic" "ACMG"
"0000988706" "0" "99" "11" "0" "0" "" "" "03256" "SERPING1_001098" "g.(57365055)_(57367870)del" "" "" "" "exons 1-3 deletion of unknown length" "Gross deletion of the genomic region encompassing exons 1-3, which includes the initiation codon. This deletion extends beyond the assayed region for this gene and therefore may encompass additional genes.\r\nSubmitted to ClinVar as pathogenic by InVitae, San Francisco CA." "Germline/De novo (untested)" "" "" "0" "" "" "g.(57597582)_(57600397)del" "{CV-SCV:002243450.4}" "pathogenic" "ACMG"
"0000988707" "0" "99" "11" "0" "0" "" "" "03256" "SERPING1_001099" "g.(57365055)_(57369662)del" "" "" "" "exons 1-4 deletion of unknown length" "Gross deletion of the genomic region encompassing exons 1-4, which includes the initiation codon. This deletion extends beyond the assayed region for SERPING1 gene and therefore may encompass additional genes.\r\nSubmitted to ClinVar as pathogenic by InVitae, San Francisco CA." "Germline/De novo (untested)" "" "" "0" "" "" "g.(57597582)_(57602189)del" "{CV-SCV:002231896.4}" "pathogenic" "ACMG"
"0000988708" "0" "99" "11" "57373463" "57374040" "del" "0" "03256" "SERPING1_001100" "g.(57373463_57374040)del" "" "" "" "exons 5-6 deletion" "Gross deletion of the genomic region encompassing exons 5-6 of unknown length.\r\nSubmitted to ClinVar as pathogenic by InVitae, San Francisco CA" "Germline/De novo (untested)" "" "" "0" "" "" "g.(57605990_57606567)del" "{CV-SCV:002176878.4}" "pathogenic" "ACMG"
"0000988709" "0" "99" "11" "0" "0" "" "" "03256" "SERPING1_001101" "g.(57369488)_(57369662)del" "" "{DOI:Bara 2026:10.2478/rrlm-2026-0026}" "" "exon 4 deletion" "Exon 4 deletion of unknown length.\r\nThis deletion variant is encompassing the entire exon 4 and would be expected to be in-frame, preserving the integrity of the reading frame.\r\nSubmitted to ClinVar as pathogenic by InVitae, San Francisco CA." "Germline/De novo (untested)" "yes" "" "0" "" "" "g.(57602015)_(57602189)del" "{CV-SCV:002171059.4}" "pathogenic" "ACMG"
"0001008547" "0" "99" "11" "57367436" "57367439" "delins" "0" "03256" "SERPING1_001102" "g.57367436_57367439delinsTTG" "" "" "" "" "The c.136_139delinsTTG variant in SERPING1 meets ACMG/ClinGen criteria to be classified as pathogenic: PVS1, PM2_Sup, PP4.\r\nIntroduced in ClinVar as pathogenic by Research Centre For Medical Genetics, Moscow Russia" "Germline" "yes" "rs2495425264" "0" "" "" "g.57599963_57599966delinsTTG" "{CV-SCV:005088172}" "pathogenic" "ACMG"
"0001008548" "0" "99" "11" "57367682" "57367682" "dup" "0" "03256" "SERPING1_001103" "g.57367682dup" "" "" "" "" "The c.382dup variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PVS1, PM2_Sup, PP4.\r\nIntroduced in ClinVar as pathogenic by Research Centre For Medical Genetics, Moscow Russia, and by Labcorp Genetics, San Francisco CA" "Germline" "yes" "rs2495426328" "0" "" "" "g.57600209dup" "{CV-SCV:005088173.1}" "pathogenic" "ACMG"
"0001008549" "0" "99" "11" "57367823" "57367826" "delins" "0" "03256" "SERPING1_001104" "g.57367823_57367826delinsTG" "" "" "" "" "The c.523_526delinsTG variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PVS1, PP4, PM2_Sup.\r\nIntroduced in ClinVar as pathogenic by Research Centre For Medical Genetics, Moscow Russia." "Germline" "yes" "rs2495426787" "0" "" "" "g.57600350_57600353delinsTG" "{CV-SCV:005068168.3}" "pathogenic" "ACMG"
"0001008552" "0" "33" "11" "57369613" "57369613" "subst" "4.06118E-6" "03256" "SERPING1_001105" "g.57369613C>T" "6.195e-7" "" "" "" "The heterozygous c.656C>T (p.Thr219Ile) variant in SERPING1 was observed in 4 family members (proband with angioedema and erythema marginalis without C1-INH deficiency, and in 2 healthy siblings and their healthy mother).\r\nThe c.656C>T variant in SERPING1 meets ACMG/ClinGen criteria to be classified as a variant of uncertain significance: PP2, BP4.\r\nIntroduced in ClinVar as VUS by Research Centre For Medical Genetics, Moscow Russia" "Germline" "no" "rs775430695" "0" "" "" "g.57602140C>T" "{CV-SCV:005186252.1}" "VUS" "ACMG"
"0001017392" "0" "90" "11" "57367351" "57367351" "subst" "0" "03779" "SERPING1_000155" "g.57367351G>A" "" "" "" "" "" "CLASSIFICATION record" "" "rs886041353" "0" "" "" "" "" "pathogenic" ""
"0001017394" "0" "99" "11" "57367850" "57367850" "subst" "0" "03779" "SERPING1_000287" "g.57367850G>C" "" "" "" "" "" "CLASSIFICATION record" "" "" "0" "" "" "" "" "pathogenic" ""
"0001017673" "0" "99" "11" "57367364" "57367364" "dup" "0" "03256" "SERPING1_001107" "g.57367364dup" "" "" "" "" "50-years old female affected individual in a HAE family of East Siberia.\r\nc.64dup variant meets ACMG/ClinGen criteria to be classified as pathogenic: PVS1, PP4_Str, PM2_Sup." "Germline" "yes" "" "0" "" "" "g.57599891dup" "{CV-SCV:005196393.1}" "pathogenic" "ACMG"
"0001017678" "0" "57" "11" "57367379" "57367385" "del" "0" "03256" "SERPING1_001108" "g.57367379_57367385del" "" "" "" "" "Introduced in ClinVar as pathogenic by Research Centre for Medical Genetics, Moscow Russia.\r\nSubmitters consider that the c.79_85del variant in SERPING1 meets ACMG/ClinGen criteria to be classified as pathogenic: PVS1, PM6, PM2_Sup." "De novo" "yes" "" "0" "" "" "g.57599906_57599912del" "{CV-SCV:005187337.1}" "pathogenic" "ACMG"
"0001017682" "0" "99" "11" "57367382" "57367382" "dup" "0" "03256" "SERPING1_001109" "g.57367382dup" "" "" "" "" "The c.82dup variant in SERPING1 meets ACMG/ClinGen criteria to be classified as pathogenic: PVS1, PP4_Mod, PM2_Sup.\r\nIntroduced in ClinVar by Research Centre for Medical Genetics, Moscow Russia" "Germline" "yes" "" "0" "" "" "g.57599909dup" "{CV-SCV:005199951.1}" "pathogenic" "ACMG"
"0001017686" "0" "99" "11" "57365749" "57365756" "del" "0" "03256" "SERPING1_001110" "g.57365749_57365756del" "" "" "" "" "The c.6_13del variant in SERPING1 meets ACMG/ClinGen criteria to be classified as pathogenic: PVS1, PP4_Mod, PM2_Sup." "De novo" "yes" "" "0" "" "" "g.57598276_57598283del" "{CV-SCV:005186251.1}" "pathogenic" "ACMG"
"0001017687" "0" "99" "11" "57367410" "57367410" "dup" "0" "03256" "SERPING1_001111" "g.57367410dup" "" "" "" "" "The c.110dupT variant in SERPING1 meets ACMG/ClinGen criteria to be classified as pathogenic: PVS1, PP4_Str, PM2_Sup." "Germline" "yes" "" "0" "" "" "g.57599937dup" "{CV-SCV:005088407.1}" "pathogenic" "ACMG"
"0001017688" "0" "99" "11" "57367415" "57367415" "del" "0" "03256" "SERPING1_001112" "g.57367415del" "" "" "" "" "The c.115del variant in SERPING1 meets ACMG/ClinGen criteria to be classified as pathogenic: PVS1, PP4_Str, PM2_Sup, PP1." "Germline" "yes" "rs2495425169" "0" "" "" "g.57599942del" "{CV-SCV:005088516.1}" "pathogenic" "ACMG"
"0001017689" "0" "99" "11" "57367508" "57367512" "del" "0" "03256" "SERPING1_001113" "g.57367508_57367512del" "" "" "" "" "The c.208_212del variant in SERPING1 meets ACMG/ClinGen criteria to be classified as pathogenic: PVS1, PP4_Mod, PM2_Sup" "Germline" "yes" "" "0" "" "" "g.57600035_57600039del" "{CV-SCV:005093799.1}" "pathogenic" "ACMG"
"0001017690" "0" "99" "11" "57367585" "57367585" "del" "0" "03256" "SERPING1_001114" "g.57367585del" "" "" "" "" "The c.285delC variant in SERPING1 meets ACMG/ClinGen criteria to be classified as pathogenic: PVS1, PP4_Str, PM2_Sup, PP1" "Germline" "yes" "" "0" "" "" "g.57600112del" "{CV-SCV:005093800.1}" "pathogenic" "ACMG"
"0001017691" "0" "99" "11" "57367608" "57367611" "dup" "0" "03256" "SERPING1_001115" "g.57367608_57367611dup" "" "" "" "" "The c.308_311dup variant in SERPING1 meets ACMG/ClinGen criteria to be classified as pathogenic: PVS1, PP4_Mod, PM2_Sup." "De novo" "yes" "" "0" "" "" "g.57600135_57600148dup" "{CV-SCV:005200122.1}" "pathogenic" "ACMG"
"0001017692" "0" "99" "11" "57367677" "57367678" "del" "0" "03256" "SERPING1_001116" "g.57367677_57367678del" "" "" "" "" "The c.377_378delCT variant in SERPING1 meets ACMG/ClinGen criteria to be classified as pathogenic: PVS1, PM2_Sup, PP4." "Germline" "" "rs2495426301" "0" "" "" "g.57600204_57600205del" "{CV-SCV:005088170.1}" "pathogenic" "ACMG"
"0001017694" "0" "99" "11" "57367682" "57367691" "dup" "0" "03256" "SERPING1_001117" "g.57367682_57367691dup" "" "" "" "" "The c.382_391dup variant in SERPING1 meets ACMG/ClinGen criteria to be classified as pathogenic: PVS1, PP4_Str, PM2_Sup" "Germline" "yes" "rs2495426314" "0" "" "" "g.57600209_57600218dup" "{CV-SCV:005088171.1}" "pathogenic" "ACMG"
"0001017695" "0" "99" "11" "57367701" "57367701" "dup" "0" "03256" "SERPING1_001118" "g.57367701dup" "" "" "" "" "Variant c.401dup introduced in ClinVar as pathogenic by Labcorp Genetics, San Francisco CA, without any other indication." "Germline/De novo (untested)" "" "rs2495426402" "0" "" "" "g.57600228dup" "{CV-SCV:004310662.1}" "pathogenic" "ACMG"
"0001017696" "0" "99" "11" "57367703" "57367718" "del" "0" "03256" "SERPING1_001119" "g.57367703_57367718del" "" "" "" "" "The c.403_418del variant in SERPING1 meets ACMG/ClinGen criteria to be classified as pathogenic: PVS1, PP4_Mod, PM2_Sup" "Germline/De novo (untested)" "yes" "" "0" "" "" "g.57600230_57600245del" "{CV-SCV:005093815.1}" "pathogenic" "ACMG"
"0001017697" "0" "99" "11" "57367715" "57367715" "subst" "0" "03256" "SERPING1_001120" "g.57367715G>T" "" "" "" "" "The c.415G>T variant in SERPING1 meets ACMG/ClinGen criteria to be classified as pathogenic: PVS1, PP4_Str, PM2_Sup" "Germline" "yes" "" "0" "" "" "g.57600242G>T" "{CV-SCV:005093816.1}" "pathogenic" "ACMG"
"0001017730" "0" "99" "11" "57367816" "57367816" "del" "0" "03256" "SERPING1_001121" "g.57367816del" "" "" "" "" "The c.516delC variant in SERPING1 meets ACMG/ClinGen criteria to be classified as pathogenic: PVS1, PP4_Mod, PM2_Sup" "Germline/De novo (untested)" "yes" "" "0" "" "" "g.57600342del" "{CV-SCV:005186242.1}" "pathogenic" "ACMG"
"0001017731" "0" "99" "11" "57367839" "57367843" "delins" "0" "03256" "SERPING1_001122" "g.57367839_57367843delinsT" "" "" "" "" "" "Germline/De novo (untested)" "yes" "" "0" "" "" "g.57600366_57600370delinsT" "{CV-SCV:005186246.1}" "pathogenic" "ACMG"
"0001017744" "0" "99" "11" "57369511" "57369511" "subst" "0" "03256" "SERPING1_001123" "g.57369511C>A" "" "" "" "" "In silico algorithms as BayesDel, MutPred, REVEL support a deleterious effect of the c.554C>A variant with Moderate evidence of pathogenicity.\r\nResearch Centre For Medical Genetics, Moscow Russia considers the c.554C>A variant in SERPING1 meets ACMG/ClinGen criteria to be classified as pathogenic: PP4_Str, PM5, PP3_Mod, PM2_Sup, PP2." "Germline" "yes" "" "0" "" "" "g.57602038C>A" "{CV-SCV:005186249.1}" "pathogenic" "ACMG"
"0001017754" "0" "99" "11" "57369551" "57369557" "del" "0" "03256" "SERPING1_001124" "g.57369551_57369557del" "" "" "" "" "The c.594_600del variant in SERPING1 meets ACMG/ClinGen criteria to be classified as pathogenic: PVS1, PP4_Mod, PM2_Sup" "Germline" "yes" "" "0" "" "" "g.57602078_57602084del" "{CV-SCV:005186250.1}" "pathogenic" "ACMG"
"0001017756" "0" "97" "11" "57365719" "57365719" "subst" "0" "03256" "SERPING1_001125" "g.57365719C>G" "" "" "" "" "The c.-22-3C>G variant in SERPING1 meets ACMG/ClinGen criteria to be classified as likely pathogenic: PP4_Str, PS1_Mod, PM2_Sup, PP3.\r\nIntroduced in ClinVar as likely pathogenic by Research Centre For Medical Genetics, Moscow Russia" "Germline" "yes" "rs2495420847" "0" "" "" "g.57598246C>G" "{CV-SCV:005077925.1}" "likely pathogenic" "ACMG"
"0001017758" "0" "99" "11" "57367752" "57367752" "subst" "0" "03256" "SERPING1_000492" "g.57367752T>C" "" "" "" "" "The c.452T>C variant in SERPING1 meets ACMG/ClinGen criteria to be classified as likely pathogenic: PP3_Mod, PP4_Mod, PM2_Sup, PP2.\r\nIntroduced in ClinVar as likely pathogenic by Research Centre for Medical Genetics, Moscow Russia." "Germline" "yes" "" "0" "" "" "g.57600279T>C" "{CV-SCV:005186234.1}" "likely pathogenic" "ACMG"
"0001017759" "0" "99" "11" "57367758" "57367758" "subst" "0" "03256" "SERPING1_001126" "g.57367758T>G" "" "" "" "" "In silico algorithms as BayesDel, MutPred, REVEL support a deleterious effect of the c.458T>G variant with Moderate evidence of pathogenicity. \r\nThe c.458T>G variant in SERPING1 meets ACMG/ClinGen criteria to be classified as likely pathogenic: PP3_Mod, PP4_Mod, PM2_Sup, PP2.\r\nIntroduced in ClinVar as likely pathogenic by Research Centre for Medical Genetics, Moscow Russia" "Germline" "yes" "rs2495426562" "0" "" "" "g.57600285T>G" "{CV-SCV:005073722.3}" "likely pathogenic" "ACMG"
"0001017760" "0" "99" "11" "57367819" "57367819" "subst" "0" "03256" "SERPING1_001127" "g.57367819C>A" "" "" "" "" "The c.519C>A variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as likely pathogenic: PP3_Mod, PP4_Mod, PM2_Sup, PP2.\r\nIntroduced in ClinVar as likely pathogenic by Research Centre For Medical Genetics, Moscow Russia" "Germline" "yes" "" "0" "" "" "g.57600346C>A" "{CV-SCV:005186245.1}" "likely pathogenic" "ACMG"
"0001017761" "0" "99" "11" "57369577" "57369577" "subst" "0" "03256" "SERPING1_001128" "g.57369577A>G" "" "" "" "" "The c.620A>G variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as likely pathogenic: PP4_Str, PM2_Sup, PP1, PP2, PP3.\r\nIntroduced in ClinVar as likely pathogenic by Research Centre For Medical Genetics, Moscow Russia" "Germline" "yes" "" "0" "" "" "g.57602104A>G" "{CV-SCV:005200124.1}" "likely pathogenic" "ACMG"
"0001017762" "0" "99" "11" "57373501" "57373518" "del" "0" "03256" "SERPING1_001129" "g.57373501_57373518del" "" "" "" "" "In-frame deletion.\r\nThe c.704_721del variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as likely pathogenic: PP4_Str, PM4, PM2_Sup.\r\nIntroduced in ClinVar as likely pathogenic by Research Centre For Medical Genetics, Moscow Russia" "Germline" "yes" "" "0" "" "" "g.57606028_57606045del" "{CV-SCV:005196395.1}" "likely pathogenic" "ACMG"
"0001017763" "0" "99" "11" "57373515" "57373515" "subst" "0" "03256" "SERPING1_001130" "g.57373515T>C" "" "" "" "" "The c.718T>C variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as likely pathogenic: PP3_Mod, PP4_Mod, PM2_Sup, PP2.\r\nIntroduced in ClinVar as likely pathogenic by Research Centre For Medical Genetics, Moscow Russia" "Germline" "yes" "rs2495440471" "0" "" "" "g.57606042T>C" "{CV-SCV:005073718.3}" "likely pathogenic" "ACMG"
"0001017764" "0" "99" "11" "57373590" "57373591" "ins" "0" "03256" "SERPING1_001131" "g.57373590_57373591insTGGCCACCT" "" "" "" "" "In-frame delins.\r\nThe c.793_794insTGGCCACCT variant in SERPING1 meets ACMG/ClinGen criteria to be classified as likely pathogenic: PP4_Str, PM4, PM2_Sup, PP1.\r\nIntroduced in ClinVar as likely pathogenic by Research Centre For Medical Genetics, Moscow Russia" "Germline" "yes" "" "0" "" "" "g.57606117_57606118insTGGCCACCT" "{CV-SCV:005187338.1}" "likely pathogenic" "ACMG"
"0001017765" "0" "99" "11" "57373605" "57373605" "subst" "0" "03256" "SERPING1_001132" "g.57373605A>C" "" "" "" "" "The c.808A>C variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as likely pathogenic: PP4_Str, PP2, PP3." "Germline" "yes" "rs1590826505" "0" "" "" "g.57606132A>C" "{CV-SCV:005073716.1}" "likely pathogenic" "ACMG"
"0001017767" "0" "99" "11" "57373606" "57373606" "subst" "0" "03256" "SERPING1_001133" "g.57373606C>A" "" "" "" "" "The c.809C>A variant in SERPING1 meets ACMG/ClinGen criteria to be classified as likely pathogenic: PP3_Mod, PP4_Mod, PM2_Sup, PP1, PP2.\r\nIntroduced in ClinVar as likely pathogenic by Research Centre For Medical Genetics, Moscow Russia" "Germline" "yes" "rs2495440966" "0" "" "" "g.57606133C>A" "{CV-SCV:005073711.3}" "likely pathogenic" "ACMG"
"0001017768" "0" "99" "11" "57373671" "57373671" "subst" "0" "03256" "SERPING1_001134" "g.57373671G>C" "" "" "" "" "The c.874G>C variant in SERPING1 was observed in cis with the c.889+81G>C variant of uncertain significance in SERPING1 in a HAE type II family; both variants segregated with the disease in the proband, the mother, her sibling and her son in a cis configuration c.[874G>C;889+81G>C].\r\nThe c.874G>C variant in SERPING1 meets ACMG/ClinGen criteria to be classified as likely pathogenic: PP4_Str, PP3_Mod, PM2_Sup, PP2, PP1.\r\nIntroduced in ClinVar as likely pathogenic by Research Centre For Medical Genetics, Moscow Russia." "Germline" "yes" "" "0" "" "" "g.57606198G>C" "{CV-SCV:005199878.1}" "likely pathogenic" "ACMG"
"0001017769" "0" "99" "11" "57373962" "57373962" "subst" "0" "03256" "SERPING1_001135" "g.57373962T>A" "" "" "" "c.[971T>A;998C>A]." "The Met324 is a highly conserved position among serpins (84%); it is located within the sheet 3B; a Met to Lys transition might be expected to disrupt the gate function of the serpin.\r\nThe c.971T>A variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as likely pathogenic: PP3_Mod, PM5, PM2_Sup, PP2, as suggested by the submitter.\r\nThe c.971T>A variant in SERPING1 has been observed in cis with the likely pathogenic c.998C>A, in a compound heterozygous carrier c.[971T>A;998C>A]. The HAE patient is presenting without a family HAE history, except the same genotype has been detected in her asymptomatic daughter." "Germline/De novo (untested)" "?" "" "0" "" "" "g.57606489T>A" "{CV-SCV:005196588.1}" "likely pathogenic" "ACMG"
"0001017770" "0" "77" "11" "57373989" "57373989" "subst" "0" "03256" "SERPING1_000565" "g.57373989C>A" "" "" "" "c.[971T>A;998C>A]" "Variant in cis configuration with a likely pathogenic c.971T>A variant, with identification of a compound heterozygous carrier c.[971T>A;998C>A], as introduced in ClinVar by Research Centre For Medical Genetics, Moscow Russia." "Germline/De novo (untested)" "?" "" "0" "" "" "g.57606516C>A" "{CV-SCV:005199874.2}" "likely pathogenic" ""
"0001017771" "0" "33" "11" "57373767" "57373767" "subst" "0" "03256" "SERPING1_001136" "g.57373767G>C" "" "" "" "" "The c.889+81G>C variant of uncertain significance in SERPING1 has been found to segregate in a family with 4 affected individuals in a cis configuration c.[874G>C;889+81G>C]." "Germline/De novo (untested)" "yes" "" "0" "" "" "g.57606294G>C" "{CV-SCV:005199878.1}" "VUS" ""
"0001017772" "0" "97" "11" "57373986" "57373986" "subst" "0" "03256" "SERPING1_001137" "g.57373986T>G" "" "" "" "" "The c.995T>G variant in SERPING1 meets ACMG/ClinGen criteria to be classified as likely pathogenic: PP4_Str, PM2_Sup, PP1, PP2, PP3.\r\nIntroduced in ClinVar as likely pathogenic by Research Centre For Medical Genetics, Moscow Russia" "Germline" "yes" "" "0" "" "" "g.57606513T>G" "{CV-SCV:005196587.1}" "likely pathogenic" "ACMG"
"0001017773" "0" "99" "11" "57379268" "57379275" "delins" "0" "03256" "SERPING1_001138" "g.57379268_57379275delinsGATGCTCTCAGCCCTTCTGTTTTCAAGGCCATCATGGAGAAACT" "" "" "" "" "In-frame indel.\r\nThe c.1108_1115delins44 variant in SERPING1 meets ACMG/ClinGen criteria to be classified as likely pathogenic: PP4_Str, PM4, PM2_Sup, PP1.\r\nIntroduced in ClinVar as likely pathogenic by Research Centre For Medical Genetics, Moscow Russia" "Germline" "yes" "" "0" "" "" "g.57611795_57611802delinsGATGCTCTCAGCCCTTCTGTTTTCAAGGCCATCATGGAGAAACT" "{CV-SCV:005200139.1}" "likely pathogenic" "ACMG"
"0001017776" "0" "99" "11" "57379269" "57379269" "subst" "0" "03256" "SERPING1_001139" "g.57379269T>A" "" "{DOI:Kovzel 2023:10.36691/RJA1556}" "" "" "The c.1109T>A variant in SERPING1 meets ACMG/ClinGen criteria to be classified as likely pathogenic: PP4_Str, PS4_Sup, PM2_Sup, PP1, PP2, PP3.\r\nIntroduced in ClinVar as likely pathogenic by Research Centre For Medical Genetics, Moscow Russia" "Germline" "yes" "rs2495452418" "0" "" "" "g.57611796T>A" "{CV-SCV:005061768.2}" "likely pathogenic" "ACMG"
"0001017777" "0" "99" "11" "57379353" "57379355" "dup" "0" "03256" "SERPING1_001140" "g.57379353_57379355dup" "" "" "" "" "In-frame insertion.\r\nAs suggested by russian introduction, the c.1193_1195dup variant in SERPING1 meets ACMG/ClinGen criteria to be classified as likely pathogenic: PP4_Str, PM4, PM2_Sup.\r\nIntroduced in ClinVar as likely pathogenic by Research Centre For Medical Genetics, Moscow Russia.\r\nThe curator considers that additional information - C1-INH biology, segregation - is expected from any submitter." "Germline" "yes" "rs2495452742" "0" "" "" "g.57611880_57611882dup" "{CV-SCV:005088519.2}" "likely pathogenic" "ACMG"
"0001017778" "0" "99" "11" "57382028" "57382028" "subst" "0" "03256" "SERPING1_000645" "g.57382028G>C" "" "" "" "c.[1202T>C;1477G>C]" "The c.1477G>C variant in SERPING1 is present in a cis configuration with the recessive c.1202T>C variant in SERPING1; c.[1202T>C;1477G>C].\r\nThe c.1477G>C variant in SERPING1 meets ACMG/ClinGen criteria to be classified as pathogenic: PP3_Str, PP4_Str, PM2_Sup, PP1.\r\nIntroduced in ClinVar as pathogenic by Research Centre For Medical Genetics, Moscow Russia" "Germline" "yes" "" "0" "" "" "g.57614555G>C" "{CV-SCV:005367816.1}" "pathogenic (dominant)" "ACMG"
"0001017779" "0" "99" "11" "57379406" "57379407" "ins" "0" "03256" "SERPING1_001141" "g.57379406_57379407insGCTCTCAAATCA" "" "" "" "" "In-frame delins variant.\r\nThe c.1246_1247insGCTCTCAAATCA variant in SERPING1 meets ACMG/ClinGen criteria to be classified as variant of likely pathogenic: PP4 _Str, PM4, PM2_Sup, PP1." "Germline" "yes" "" "0" "" "" "g.57611933_57611934insGCTCTCAAATCA" "{CV-SCV:005093798.1}" "likely pathogenic" "ACMG"
"0001017780" "0" "99" "11" "57381831" "57381831" "subst" "0" "03256" "SERPING1_001142" "g.57381831T>C" "" "" "" "" "The c.1280T>C variant in SERPING1 meets ACMG/ClinGen guidance criteria to be classified as likely pathogenic: PP3_Mod, PP4_Mod, PM2_Sup, PP2." "Germline/De novo (untested)" "?" "" "0" "" "" "g.57614358T>C" "{CV-SCV:005088598.1}" "likely pathogenic" "ACMG"
"0001017781" "0" "99" "11" "57381838" "57381838" "del" "0" "03256" "SERPING1_001143" "g.57381838del" "" "" "" "" "The c.1287delG variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as likely pathogenic: PVS1_Str, PM2_Sup, PP4" "Germline" "yes" "rs2495457910" "0" "" "" "g.57614365del" "{CV-SCV:005061777.1}" "likely pathogenic" "ACMG"
"0001017782" "0" "99" "11" "57381840" "57381850" "del" "0" "03256" "SERPING1_001144" "g.57381840_57381850del" "" "" "" "" "The c.1289_1299del variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as likely pathogenic: PVS1_Str, PP4_Mod, PM2_Sup." "Germline" "yes" "" "0" "" "" "g.57614367_57614377del" "{CV-SCV:005088599.1}" "likely pathogenic" "ACMG"
"0001017783" "0" "99" "11" "57381874" "57381895" "del" "0" "03256" "SERPING1_001145" "g.57381874_57381895del" "" "" "" "" "The c.1323_1344del variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as likely pathogenic: PVS1_Str, PM6, PP4_Mod, PM2_Sup" "Germline" "" "" "0" "" "" "g.57614401_57614422del" "{CV-SCV:005088602.1}" "likely pathogenic" "ACMG"
"0001017784" "0" "99" "11" "57381876" "57381876" "del" "0" "03256" "SERPING1_001146" "g.57381876del" "" "" "" "" "The c.1325delA variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as likely pathogenic: PVS1_Str, PP4_Mod, PM2_Sup" "Germline" "yes" "" "0" "" "" "g.57614403del" "{CV-SCV:005088604.1}" "likely pathogenic" "ACMG"
"0001017785" "0" "99" "11" "57381903" "57381903" "subst" "0" "03256" "SERPING1_001147" "g.57381903A>G" "" "" "" "" "The c.1352A>G variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as likely pathogenic: PP3_Mod, PP4_Mod, PM2_Sup, PP2" "Germline" "yes" "" "0" "" "" "g.57614430A>G" "{CV-SCV:005088606.1}" "likely pathogenic" "ACMG"
"0001017786" "0" "99" "11" "57381907" "57381907" "dup" "0" "03256" "SERPING1_001148" "g.57381907dup" "" "" "" "" "The c.1356dupT variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as likely pathogenic: PVS1_Str, PM2_Sup, PP4" "Germline" "yes" "rs2495458168" "0" "" "" "g.57614434dup" "{CV-SCV:005073701.1}" "likely pathogenic" "ACMG"
"0001017787" "0" "99" "11" "57381963" "57381963" "subst" "0" "03256" "SERPING1_001149" "g.57381963T>C" "" "" "" "" "The c.1412T>C variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as likely pathogenic: PP4_Str, PM2_Sup, PP2, PP3" "Germline" "yes" "" "0" "" "" "g.57614490T>C" "{CV-SCV:005088628.1}" "likely pathogenic" "ACMG"
"0001017788" "0" "99" "11" "57381990" "57381990" "subst" "0" "03256" "SERPING1_001150" "g.57381990T>A" "" "" "" "" "The c.1439T>A variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as likely pathogenic: PP4_Str, PM2_Sup, PP1, PP2" "Germline" "yes" "" "0" "" "" "g.57614517T>A" "{CV-SCV:005088635.1}" "likely pathogenic" "ACMG"
"0001017789" "0" "99" "11" "57382030" "57382030" "dup" "0" "03256" "SERPING1_001151" "g.57382030dup" "" "" "" "" "The c.1479dup variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as likely pathogenic: PP4_Str, PVS1_Mod, PM2_Sup" "Germline" "yes" "" "0" "" "" "g.57614557dup" "{CV-SCV:005200135.1}" "likely pathogenic" "ACMG"
"0001017790" "0" "99" "11" "57382032" "57382032" "delins" "0" "03256" "SERPING1_001152" "g.57382032delinsCTGACCCCATGA" "" "" "" "" "The c.1481delinsCTGACCCCATGA variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as likely pathogenic: PS2, PVS1_Mod, PP4_Mod, PM2_Sup.\r\nVariant introduced in ClinVar as likely pathogenic by Research Centre for Medical Genetics, Moscow Russia." "Germline" "yes" "" "0" "" "" "g.57614559delinsCTGACCCCATGA" "{CV-SCV:005093797.1}" "likely pathogenic" "ACMG"
"0001017791" "2" "99" "11" "57381879" "57381879" "subst" "0" "03256" "SERPING1_000610" "g.57381879A>G" "" "{DOI:Xu 2018:10.4168/aair.2018.10.3.285}" "" "c.[167T>C(;)1328A>G]" "The c.1328A>G variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PP4_Str, PM6, PS4_Mod, PP3_Mod, PM2_Sup, PP1.\r\nThe compound heterozygous male individual for c.[167T>C(;)1328A>G] is symptomatic." "Germline" "yes" "" "0" "" "" "g.57614406A>G" "{CV-SCV:005088605.1}" "pathogenic" "ACMG"
"0001017792" "1" "77" "11" "57367467" "57367467" "subst" "0.00376416" "03256" "SERPING1_000184" "g.57367467T>C" "0.001681" "{DOI:Xu 2018:10.4168/aair.2018.10.3.285}" "" "c.[167T>C(;)1328A>G]" "Compound heterozygous symptomatic male carrier c.[167T>C(;)1328A>G]" "Germline" "" "rs11546660" "0" "" "" "" "{CV-SCV:001001262.8};{CV-SCV:005088605.2}" "VUS" "ACMG"
"0001017793" "1" "31" "11" "57367222" "57367222" "subst" "0" "03256" "SERPING1_000339" "g.57367222C>T" "0.388578" "{DOI:López-Lera 2011:10.1016/j.molimm.2011.07.010}" "" "c.[52-130C>T];[671T>G]" "c.52-130C>T variant carried by a compound heterozygous affected individual c.[52-130C>T];[671T>G].\r\nc.52-130C>T variant considered likely benign or benign based on one or more of the following criteria: BS1 (allele frequency >5%), BS2, BP4, BP5, BP6." "Germline" "no" "rs1005510" "0" "" "" "g.57599749C>T" "{CV-SCV:005324292.1}{CV:000983239}" "likely benign" "ACMG"
"0001017794" "2" "99" "11" "57369628" "57369628" "subst" "0" "03256" "SERPING1_000388" "g.57369628T>G" "" "{DOI:López-Lera 2011:10.1016/j.molimm.2011.07.010}" "" "c.[52-130C>T];[671T>G]" "Ile202 position is located within Sheet 2A, partipating in the shutter function, thus facilitating the RCL insertion, with the hydrophobic Ile bearing a long side chain enhancing the stability of the hydrophobic core of Sheet A; the Ile to Ser transition could disrupt the stability of Sheet A, with a significant degree of oligomerization and demonstrated dominant-negative effect, making the p.(Ile224Ser) variant as provisionally introduced in class III of HAE type II.\r\nCharacterized as pathogenic according to ACMG recommendations PS1, PS3, PS4, PP4, PM1, PM2, PM5, PP3." "Germline" "yes" "" "0" "" "" "g.57602155T>G" "" "pathogenic" "ACMG"
"0001017796" "1" "99" "11" "57373617" "57373617" "subst" "0" "03256" "SERPING1_000129" "g.57373617A>G" "" "{DOI:Ponard 2019:10.1002/humu.23917}" "" "c.[820A>G(;)856C>T]" "In silico algorithms support a deleterious effect of this variant with Supporting evidence of pathogenicity, when choosing at least two identical assessments and using the threshold ranges from ClinGen recommendations.\r\nThe c.820A>G variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as likely pathogenic: PP4_Str, PS4_Mod, PM2_Sup, PP2, PP3." "Germline" "yes" "" "0" "" "" "g.57606144A>G" "{CV-SCV:005196399.1}" "likely pathogenic" "ACMG"
"0001017798" "0" "99" "11" "57373520" "57373520" "dup" "0" "03256" "SERPING1_001153" "g.57373520dup" "" "" "" "" "The c.723dup variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PVS1, PP4_Mod, PM2_Sup" "Germline/De novo (untested)" "" "" "0" "" "" "g.57606047dup" "{CV-SCV:005187251.1}" "pathogenic" "ACMG"
"0001017799" "0" "99" "11" "57373541" "57373541" "dup" "0" "03256" "SERPING1_001154" "g.57373541dup" "" "" "" "" "The c.744dupC variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PVS1, PP4_Str, PM2_Sup, PP1." "Germline" "yes" "" "0" "" "" "g.57606068dup" "{CV-SCV:005187274.1}" "pathogenic" "ACMG"
"0001017800" "0" "99" "11" "57373568" "57373571" "delins" "0" "03256" "SERPING1_001155" "g.57373568_57373571delinsTCATCAACTGTTGATGAG" "" "" "" "" "The c.771_774delinsTCATCAACTGTTGATGAG variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PVS1, PP4_Mod, PM2_Sup, PP1." "Germline" "yes" "" "0" "" "" "g.57606095_57606098delinsTCATCAACTGTTGATGAG" "{CV-SCV:005205828.1}" "pathogenic" "ACMG"
"0001017801" "0" "99" "11" "57373576" "57373577" "del" "0" "03256" "SERPING1_001156" "g.57373576_57373577del" "" "" "" "" "The c.779_780del variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PVS1, PP4_Str, PM2_Sup" "Germline" "yes" "" "0" "" "" "g.57606103_57606104del" "{CV-SCV:005187335.1}" "pathogenic" "ACMG"
"0001017804" "0" "99" "11" "57373584" "57373591" "dup" "0" "03256" "SERPING1_001157" "g.57373584_57373591dup" "" "" "" "" "The c.787_794dup variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PVS1, PP4_Mod, PM2_Sup" "Germline/De novo (untested)" "" "" "0" "" "" "g.57606111_57606118dup" "{CV-SCV:005187336.1}" "pathogenic" "ACMG"
"0001017805" "0" "99" "11" "57373605" "57373606" "delins" "0" "03256" "SERPING1_001158" "g.57373605_57373606delinsCAA" "" "" "" "" "The c.808_809delinsCAA variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PVS1, PP4_Str, PM2_Sup" "Germline" "yes" "rs2495440958" "0" "" "" "g.57606132_57606133delinsCAA" "{CV-SCV:005073717.1}" "pathogenic" "ACMG"
"0001017806" "0" "99" "11" "57373643" "57373643" "del" "0" "03256" "SERPING1_001159" "g.57373643del" "" "" "" "" "The c.846del variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PVS1, PP4_Str, PS4_Mod, PM2_Sup" "Germline" "yes" "" "0" "" "" "g.57606170del" "{CV-SCV:005073710.1}" "pathogenic" "ACMG"
"0001017807" "0" "99" "11" "57373657" "57373657" "subst" "0" "03256" "SERPING1_001160" "g.57373657T>G" "" "" "" "" "The c.860T>G variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PP4_Str, PM5, PP3_Mod, PM2_Sup, PP2" "Germline" "yes" "" "0" "" "" "g.57606184T>G" "{CV-SCV:005196581.1}" "pathogenic" "ACMG"
"0001017809" "0" "99" "11" "57373916" "57373916" "subst" "0" "03256" "SERPING1_001161" "g.57373916A>T" "" "" "" "" "The c.925A>T variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PVS1, PP4_Str, PM2_Sup, PP1" "Germline" "yes" "" "0" "" "" "g.57606443A>T" "{CV-SCV:005199873.1}" "pathogenic" "ACMG"
"0001017810" "0" "99" "11" "57373967" "57373971" "delins" "0" "03256" "SERPING1_001162" "g.57373967_57373971delinsTACCCTGTG" "" "" "" "" "The c.976_980delinsTACCCTGTG variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PVS1, PP4_Str, PM2_Sup" "Germline" "yes" "" "0" "" "" "c.976_979delinsTACCCTGT" "{CV-SCV:005196586.1}" "pathogenic" "ACMG"
"0001017811" "0" "99" "11" "57379273" "57379273" "del" "0" "03256" "SERPING1_001163" "g.57379273del" "" "" "" "" "The c.1113delA variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PVS1, PP4_Mod, PM2_Sup, PP1" "Germline" "yes" "" "0" "" "" "g.57611800del" "{CV-SCV:005088515.1}" "pathogenic" "ACMG"
"0001017814" "0" "99" "11" "57379313" "57379313" "subst" "0" "03256" "SERPING1_001164" "g.57379313A>T" "" "" "" "" "The c.1153A>T variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PVS1, PP4_Str, PM2_Sup" "Germline" "yes" "" "0" "" "" "g.57611840A>T" "{CV-SCV:005088191.1}" "pathogenic" "ACMG"
"0001017815" "0" "99" "11" "57379348" "57379349" "delins" "0" "03256" "SERPING1_001165" "g.57379348_57379349delinsC" "" "" "" "" "The c.1188_1189delinsC variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PVS1_Str, PP4_Str, PM2_Sup" "Germline" "yes" "" "0" "" "" "g.57611875_57611876delinsC" "{CV-SCV:005073695.1}" "pathogenic" "ACMG"
"0001017820" "0" "99" "11" "57379411" "57379411" "subst" "0" "03256" "SERPING1_001166" "g.57379411T>G" "" "" "" "" "The c.1249+2T>G variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PVS1_Str, PP4_Str, PS1_Mod, PS4_Mod, PM2_Sup" "Germline" "yes" "" "0" "" "" "g.57611938T>G" "{CV-SCV:005061385.2}" "pathogenic" "ACMG"
"0001017838" "0" "77" "11" "57373495" "57373495" "subst" "8.1213E-6" "03256" "SERPING1_001167" "g.57373495G>C" "0.00001053" "" "" "" "This sequence change replaces arginine, which is basic and polar, with threonine, which is neutral and polar, at codon 233 of the SERPING1 protein (p.Arg233Thr).\r\nIntroduced in ClinVar as a VUS by Labcorp Genetics, San Francisco CA" "Germline" "" "rs1486614831" "0" "" "" "g.57606022G>C" "{CV-SCV:004300840.3}" "VUS" ""
"0001017942" "0" "77" "11" "57373504" "57373504" "subst" "0" "03256" "SERPING1_001168" "g.57373504T>G" "" "" "" "" "Because the available evidence is currently insufficient to determine the role of this variant in HAE, it has been introduced in ClinVar as a VUS by LabCorp, San Francisco CA." "Germline" "" "rs2495440406" "0" "" "" "g.57606031T>G" "{CV-SCV:003302225.2}" "VUS" ""
"0001018802" "0" "99" "11" "57382054" "57382054" "subst" "0" "03256" "SERPING1_001169" "g.57382054A>C" "" "" "" "" "The c.1503A>C variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as likely pathogenic: PP4_Str, PM4, PM2_Sup, as suggested by ClinVar submitter. Additional information on C1-INH biology is expected." "Germline" "yes" "rs2495458767" "0" "" "" "g.57614581A>C" "{CV-SCV:005200137.1}" "likely pathogenic" "ACMG"
"0001020259" "0" "99" "11" "57373606" "57373606" "subst" "0" "03256" "SERPING1_001171" "g.57373606C>T" "" "{DOI:Roosens 2024:10.1016/j.jaip.2024.12.023}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57606133C>T" "" "likely pathogenic" "ACMG"
"0001020738" "0" "99" "11" "57373880" "57374021" "dup" "0" "03256" "SERPING1_001172" "g.(57373687_57373880)_(57374021_57379189)dup" "" "{DOI:Speletas 2015:10.1016/j.jaci.2014.08.007}" "" "" "Exon 5 duplication of unknown length, without any expression of C1-INH protein" "Germline" "yes" "" "0" "" "" "g.(57606214_57606407)_(57606548_57611716)dup" "" "pathogenic" "ACMG"
"0001021588" "1" "99" "11" "57381947" "57381947" "subst" "0" "03256" "SERPING1_000312" "g.57381947C>G" "" "{DOI:Rodriguez 2018:10.1007/s10875-018-0491-1}" "" "c.[1029+84G>A(;)1396C>G]" "c.1396C>G variant has been found in a compound heterozygous Colombian proband (Rodríguez & Narváez 2018) as c.[1029+84G>A(;)1396C>G] and presenting with a severe phenotype.\r\nHighly recurrent variant.\r\nAs other missense variants at the same Arg444 residue (Arg466Cys/Ser/His/Pro/Leu), p.(Arg466Gly) disrupts the Arg P1 residue that targets the Ser-protease; subsequently the variant product is no more able to control any target Ser-protease, ghen classifying p.(Arg466Gly) within class I.\r\nThe c.1396C>G variant in SERPING1 meets ACMG/ClinGen SVI guidance criteria to be classified as pathogenic: PP4_Str, PM1, PM5, PS4_Mod, PM2_Sup, PP1, PP2, PP3." "Germline" "yes" "" "0" "" "" "g.57614474C>G" "{CV-SCV:005088627.1}" "pathogenic" "ACMG"
"0001021589" "2" "55" "11" "57374104" "57374104" "subst" "0" "03256" "SERPING1_000706" "g.57374104G>A" "0.002393" "{DOI:Rodriguez 2018:10.1007/s10875-018-0491-1}" "" "c.[1029+84G>A(;)1396C>G]" "c.1029+84G>A deep intronic variant first identified in an Italian symptomatic carrier (Pappalardo 2008).\r\nIt has been found in a compound heterozygous Colombian proband (Rodríguez & Narváez 2018) as c.[1029+84G>A(;)1396C>G] and presenting with a severe phenotype.\r\nThe c.1029+84G>A variant has been characterized as a benign variant and introduced as such in ClinVar database by Center for Human Genetics Tuebingen, Germany.\r\nACMG criterion: BS1" "Germline" "?" "rs118132731" "0" "" "" "g.57606631G>A" "{CV-SCV:004132143.20}" "benign" "ACMG"
"0001021668" "0" "99" "11" "57365749" "57365749" "dup" "0" "03256" "SERPING1_001106" "g.57365749dup" "" "{DOI:Zhang 2025:10.1016/j.jdcr.2024.10.023} {DOI:Guo 2026:10.1186/s13023-026-04421-3} {DOI:Du 2026:10.3389/falgy.2026.1899305}" "" "" "Patient presenting with recurrent and frequent angioedema attacks.\r\nThe function and concentration of C1-INH and antigenic C4 of the parents and younger brother are normal. Immediate and closest relatives within 3 generations did not have a angioedema history; the possibility of a sporadic genetic mutation is considered.\r\nThe c.6dup variation meets the ACMG criteria PVS1, PM2, PP3, PP4 to be considered pathogenic." "Germline/De novo (untested)" "yes" "" "0" "" "" "g.57598276dup" "" "pathogenic" "ACMG"
"0001023911" "0" "33" "11" "57369608" "57369608" "subst" "0" "03256" "SERPING1_001175" "g.57369608T>A" "" "{DOI:Mak 2025:10.1111/cea.70001}" "" "" "A family with a female proband suffering from hyposmia" "Germline" "" "" "0" "" "" "g.57602135T>A" "" "VUS" ""
"0001023913" "0" "99" "11" "57369621" "57369622" "del" "0" "03256" "SERPING1_001176" "g.57369621_57369622del" "" "{DOI:Mak 2025:10.1111/cea.70001}" "" "g.9597_9598delTC" "" "Germline" "yes" "" "0" "" "" "g.57602148_57602149del" "" "pathogenic" "ACMG"
"0001023914" "0" "99" "11" "57373944" "57373944" "subst" "0" "03256" "SERPING1_001177" "g.57373944C>A" "" "{DOI:Mak 2025:10.1111/cea.70001}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57606471C>A" "" "pathogenic" "ACMG"
"0001023915" "21" "99" "11" "57373880" "57373880" "mosaic" "0" "03256" "SERPING1_001178" "g.[57373880G=/>C]" "" "{DOI:Batlle-Masó 2025:10.3389/fimmu.2025.1550380}" "" "c.[890-1G=/>C]" "The c.890-1G>C allele produces two different aberrantly spliced transcripts: (i) Transcripts with exon 6 skipping, with the new junction between exon 5 and 7 producing a frameshift leading to a premature STOP codon in the first half of exon 7 and a predicted truncated protein of only 320 amino acids; (ii) the loss of the canonical acceptor splice site activating a cryptic acceptor splice site in intron 5 at positions -28 and -29 with respect to exon 6, subsequently including 27 nucleotides of the intron 5 in the novel exon 6 and meaning that, at a protein level, there is a predicted in-frame insertion of 9 amino acids.\r\nThe proband is a heterozygous 13y female. Both parents are asymptomatic with normal biology.\r\nThe mother is carrying a variant in the form of gonadal mosaicism: The presence of the c.890-1G>C variant has been assessed in different tissues from the mother: the mother chromatogram in blood, buccal swap, urine displays a significantly smaller peak corresponding to the variant allele compared to that from patient samples; a somatic pathogenic variant c.890-1G>C has been identified in gonads and blood, with transmission to the daughter in the form of gonosomal mosaicism.\r\nThe degree of mosaicism has been investigated in blood, buccal swap and urine, but not in the liver." "Uniparental disomy, maternal allele" "yes" "" "0" "" "" "g.[57606407G=/>C]" "" "pathogenic" "ACMG"
"0001027542" "0" "99" "11" "0" "0" "" "" "03256" "SERPING1_001179" "g.(57369488)_(57369662)dup" "" "" "" "exon 4 duplication" "Exon 4 duplication of unknown length.\r\nVariant resulting in a copy number gain of the genomic region encompassing exon 4 of the SERPING1 gene, without identified boundaries. Predicted to be in-frame.\r\nSubmitted to ClinVar as pathogenic by InVitae, San Francisco CA." "Germline/De novo (untested)" "" "" "0" "" "" "g.(57602015)_(57602189)dup" "{CV-SCV:002110505.4}" "pathogenic" "ACMG"
"0001029883" "0" "97" "11" "57367401" "57367401" "del" "0" "03256" "SERPING1_001180" "g.57367401del" "" "" "" "" "Introduced in ClinVar as pathogenic by Labcorp Genetics, San Francisco CA" "Germline/De novo (untested)" "" "" "0" "" "" "g.57599928del" "{CV-SCV:005745144.1}" "pathogenic" "ACMG"
"0001029884" "0" "97" "11" "57367502" "57367506" "del" "0" "03256" "SERPING1_001181" "g.57367502_57367506del" "" "" "" "" "Introduced in ClinVar as pathogenic by LabCorp Genetics, San Francisco CA" "Germline/De novo (untested)" "" "" "0" "" "" "g.57600029_57600033del" "{CV-SCV:005845094.1}" "pathogenic" "ACMG"
"0001029885" "0" "99" "11" "57367808" "57367808" "subst" "0" "03256" "SERPING1_000505" "g.57367808T>C" "" "" "" "" "Introduced in ClinVar as pathogenic by LabCorp Genetics, San Francisco CA" "Germline/De novo (untested)" "" "" "0" "" "" "g.57600335T>C" "{CV-SCV:005836082.1}" "pathogenic" "ACMG"
"0001029887" "0" "99" "11" "57373497" "57373497" "del" "0" "03256" "SERPING1_001182" "g.57373497del" "" "" "" "" "Introduced in ClnVar as pathogenic by LabCorp Genetics, San Francisco CA" "Germline/De novo (untested)" "" "" "0" "" "" "g.57606024del" "{CV-SCV:005839112.1}" "pathogenic" "ACMG"
"0001029888" "0" "99" "11" "57373890" "57373890" "dup" "0" "03256" "SERPING1_001183" "g.57373890dup" "" "" "" "" "Introduced in ClinVar as pathogenic by LabCorp, San Francisco CA" "Germline/De novo (untested)" "" "" "0" "" "" "g.57606417dup" "{CV-SCV:005738437.1}" "pathogenic" "ACMG"
"0001029889" "0" "99" "11" "57373974" "57373985" "del" "0" "03256" "SERPING1_001184" "g.57373974_57373985del" "" "" "" "" "In-frame delins variant.\r\nIntroduced in ClinVar as likely pathogenic by LabCorp, San Francisco CA" "De novo" "yes" "" "0" "" "" "g.57606501_57606512del" "{CV-SCV:005759071.1}" "likely pathogenic" "ACMG"
"0001029890" "0" "99" "11" "57379358" "57379358" "del" "0" "03256" "SERPING1_001185" "g.57379358del" "" "" "" "" "Introduced in ClinVar as pathogenic by LabCorp Genetics, San Francisco CA" "Germline/De novo (untested)" "" "" "0" "" "" "g.57611885del" "{CV-SCV:005755633.1}" "pathogenic" "ACMG"
"0001029891" "0" "99" "11" "57381799" "57381799" "subst" "0" "03256" "SERPING1_001186" "g.57381799A>C" "" "" "" "" "Introduced in ClinVar as pathogenic by LabCorp Genetics, San Francisco CA" "Germline/De novo (untested)" "" "" "0" "" "" "g.57614326A>C" "{CV-SCV:005760803.1}" "pathogenic" "ACMG"
"0001030008" "0" "99" "11" "57381993" "57381994" "ins" "0" "03256" "SERPING1_001187" "g.57381993_57381994insGCTGCGTGC" "" "{DOI:Baysheva 2024:10.25557/2073-7998.2024.03.49-53}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.57614520_57614521insGCTGCGTGC" "" "pathogenic" "ACMG"
"0001030118" "0" "99" "11" "57373905" "57373906" "dup" "0" "03256" "SERPING1_001188" "g.57373905_57373906dup" "" "" "" "" "The observations of the carrier of the variant c.914_915dup meets the ACMG criteria PVS1, PP4, PM2 to consider the variant pathogenic.\r\nIntroduced in ClinVar as pathogenic by Center for Human Genetics Tuebingen, Germany." "Germline" "yes" "" "0" "" "" "g.57606432_57606433dup" "{CV-SCV:005890816.1}" "pathogenic" "ACMG"
"0001030119" "0" "99" "11" "57379398" "57379398" "subst" "0" "03256" "SERPING1_001170" "g.57379398T>G" "" "{DOI:Arias-Flórez 2025:10.1371/journal.pone.0311316}" "" "" "The variation is located in a mutational hotspot and introduces a positively charged Arg residue within helix I. \r\nThis variant is new, not reported in population databases such as GnomAD. Multiple lines of computational evidence support a deleterious effect on the gene product. The patient\'s phenotype and family history are highly specific for Hereditary Angioedema type 1.\r\nThe observations meet the criteria to consider the variant likely pathogenic: PP3, PP4, PM1, PM2.\r\nIntroduced in ClinVar as likely pathogenic by Universidad del Rosario, Bogota Colombia" "Germline" "yes" "" "0" "" "" "g.57611925T>G" "{CV-SCV:005201104.1}" "likely pathogenic" "ACMG"
"0001030191" "0" "99" "11" "57373981" "57374036" "del" "0" "03256" "SERPING1_001189" "g.57373981_57374036del" "" "{DOI:Wetherby 2025:10.3389/falgy.2025.1565283}" "" "" "NGS and MLPA did not detect any SERPING1 pathogenic variants or genomic rearrangements, but additional structural variant analysis identified a high rate of soft clipping in exon 6 of the SERPING1 gene. Sanger sequencing of exon 6 revealed a heterozygous 56-base-pair deletion in all three affected individuals.\r\nThe c.990_1029+16del variant likely creates a new premature stop codon, with subsequent nonsense-mediated mRNA decay." "Germline" "yes" "" "0" "" "" "g.57606508_57606563del" "{CV-SCV:005908065.1}" "pathogenic" "ACMG"
"0001038520" "0" "50" "11" "57365748" "57365748" "subst" "0.00128084" "02325" "SERPING1_000002" "g.57365748C>T" "" "" "" "SERPING1(NM_000062.2):c.5C>T (p.A2V), SERPING1(NM_000062.3):c.5C>T (p.A2V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001038521" "0" "30" "11" "57373548" "57373548" "subst" "0.00551838" "02327" "SERPING1_000004" "g.57373548C>T" "" "" "" "SERPING1(NM_000062.2):c.751C>T (p.L251=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0001044610" "0" "99" "11" "57379227" "57379227" "subst" "0" "03256" "SERPING1_001190" "g.57379227T>A" "" "{DOI:Du 2025:10.3389/falgy.2025.1554940} {DOI:Guo 2026:10.1186/s13023-026-04421-3}" "" "" "The variation introduces a negatively charged Glu residue and disrupts the Val356 position within the sheet B (s3B). \r\nThe observation of asymptomatic carriers suggests a partial segregation with a HAE phenotype.\r\nThe variant meets the ACMG criteria PM1_Mod, PP3_Str, PM2_Sup, PP4." "Germline" "yes" "" "0" "" "" "g.57611754T>A" "" "likely pathogenic" "ACMG"
"0001045045" "0" "90" "11" "57367616" "57367616" "del" "0" "03779" "SERPING1_001191" "g.57367616del" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.57600143del" "" "likely pathogenic" "ACMG"
"0001046994" "0" "99" "11" "57367796" "57367797" "ins" "0" "03256" "SERPING1_001192" "g.57367796_57367797insGACA" "" "{DOI:Khodan 2025:10.21802/artm.2025.2.34.119}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57600323_57600324insGACA" "" "pathogenic" "ACMG"
"0001046995" "0" "10" "11" "57367768" "57367768" "subst" "0.00103975" "03256" "SERPING1_000277" "g.57367768C>T" "0.00138" "{DOI:Khodan 2025:10.21802/artm.2025.2.34.119}" "" "" "Synonymous variant. The c.468C>T variant meets ACMG criteria to be considered benign: BP4, BP7, BS2" "Germline" "no" "rs150601964" "0" "" "" "g.57600295C>T" "{CV-SCV:000372557.3}" "likely benign" ""
"0001047491" "0" "99" "11" "57381842" "57381842" "subst" "0" "03256" "SERPING1_001193" "g.57381842A>C" "" "{PMID:Gao 2025:40848077}, {DOI:Gao 2025:10.1007/s10875-025-01912-z}" "" "" "The variation introduces a Pro residue at a Thr431 position between helix I and sheet A (s5A)." "Germline" "yes" "" "0" "" "" "g.57614369A>C" "" "pathogenic" "ACMG"
"0001047492" "0" "99" "11" "57381878" "57381878" "subst" "0" "03256" "SERPING1_001194" "g.57381878C>A" "" "{PMID:Gao 2025:40848077}, {DOI:Gao 2025:10.1007/s10875-025-01912-z}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57614405C>A" "" "likely pathogenic" "ACMG"
"0001047494" "0" "99" "11" "57374018" "57374018" "subst" "0" "03256" "SERPING1_001195" "g.57374018A>T" "" "{PMID:Gao 2025:40848077}, {DOI:Gao 2025:10.1007/s10875-025-01912-z}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57606545A>T" "" "pathogenic" "ACMG"
"0001047497" "0" "99" "11" "57365721" "57382326" "del" "0" "03256" "SERPING1_001196" "g.(57365196_57365721)_(57382326_?)del" "" "{PMID:Gao 2025:40848077}, {DOI:Gao 2025:10.1007/s10875-025-01912-z}" "" "exon 2-8 deletion with 16,312 bp loss" "" "Germline" "yes" "" "0" "" "" "g.(57597723_57598248)_(57614853_?)del" "" "pathogenic" "ACMG"
"0001047498" "0" "99" "11" "57363946" "57372945" "del" "0" "03256" "SERPING1_001197" "g.57363946_57372945del" "" "{PMID:Gao 2025:40848077}, {DOI:Gao 2025:10.1007/s10875-025-01912-z}" "" "g.57363946_57372945del" "" "Germline" "yes" "" "0" "" "" "g.57596473_57605472del" "" "pathogenic" "ACMG"
"0001047499" "0" "99" "11" "57379208" "57379209" "del" "0" "03256" "SERPING1_001198" "g.57379208_57379209del" "" "{PMID:Gao 2025:40848077}, {DOI:Gao 2025:10.1007/s10875-025-01912-z}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57611735_57611736del" "" "pathogenic" "ACMG"
"0001048030" "0" "99" "11" "57367595" "57367602" "del" "0" "03256" "SERPING1_001199" "g.57367595_57367602del" "" "{DOI:Liu 2019:10.1684/ejd.2018.3487}" "" "c.295_302delACCATCCAA" "" "Germline" "yes" "" "0" "" "" "g.57600122_57600129del" "" "pathogenic" "ACMG"
"0001048033" "0" "99" "11" "57367733" "57367755" "del" "0" "03256" "SERPING1_001200" "g.57367733_57367755del" "" "{DOI:Liu 2019:10.1684/ejd.2018.3487}" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "ACMG"
"0001048035" "0" "55" "11" "57373502" "57373503" "del" "0" "03256" "SERPING1_001201" "g.57373502_57373503del" "" "{DOI:Liu 2019:10.1684/ejd.2018.3487}" "" "" "Erroneous published sequence as g.9548_9549delCT" "Germline" "" "" "0" "" "" "g.57606029-57606030del" "" "NA" ""
"0001048036" "0" "55" "11" "57373604" "57373606" "dup" "0" "03256" "SERPING1_001202" "g.57373604_57373606dup" "" "{DOI:Liu 2019:10.1684/ejd.2018.3487}" "" "g.8445_8447insCAC" "" "Germline" "" "" "0" "" "" "g.57606131_57606133dup" "" "VUS" ""
"0001048061" "0" "55" "11" "57382991" "57382991" "del" "0" "03256" "SERPING1_001203" "g.57382991del" "" "{DOI:Liu 2019:10.1684/ejd.2018.3487}" "" "" "" "Germline" "" "" "0" "" "" "g.57615518del" "" "VUS" ""
"0001048062" "0" "55" "11" "57382998" "57382998" "del" "0" "03256" "SERPING1_001204" "g.57382998del" "" "{DOI:Liu 1019:10.1684/ejd.2018.3487}" "" "" "" "Germline" "" "" "0" "" "" "g.57615525del" "" "VUS" ""
"0001048415" "0" "99" "11" "57367845" "57367845" "subst" "0" "03256" "SERPING1_001205" "g.57367845T>C" "" "{DOI:Ferriani 2025:10.1016/j.jaip.2025.08.026}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57600372T>C" "" "likely pathogenic" ""
"0001048417" "0" "99" "11" "57373988" "57373988" "dup" "0" "03256" "SERPING1_001206" "g.57373988dup" "" "{DOI:Ferriani 2025:10.1016/j.jaip.2025.08.026}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57606515dup" "" "likely pathogenic" "ACMG"
"0001048418" "0" "97" "11" "57379386" "57379386" "subst" "0" "03256" "SERPING1_001207" "g.57379386T>G" "" "{DOI:Ferriani 2025:10.1016/j.jaip.2025.08.026}" "" "" "The variation introduces a positively charged Arg residue at the N-terminus of helix I." "Germline" "yes" "" "0" "" "" "g.57611913T>G" "" "likely pathogenic" ""
"0001048419" "0" "99" "11" "57381852" "57381852" "del" "0" "03256" "SERPING1_001208" "g.57381852del" "" "{DOI:Ferriani 2025:10.1016/j.jaip.2025.08.026}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57614379del" "" "pathogenic" "ACMG"
"0001048775" "0" "99" "11" "57381987" "57381988" "dup" "0" "03256" "SERPING1_001209" "g.57381987_57381988dup" "" "{DOI:Xie 2025:10.2147/JAA.S536943}" "" "" "The 9-years old proband\'s brother exhibits a low C1-INH function and has been found asymptomatic" "Germline" "yes" "" "0" "" "" "g.57614514_57614515dup" "" "likely pathogenic" "ACMG"
"0001057715" "0" "99" "11" "57365174" "57381713" "del" "0" "03256" "SERPING1_001210" "g.(?_57365174)_(57381713_?)del" "" "{DOI:Marchionni 2025:10.1186/s13023-025-04092-6}" "" "" "Chromosomic deletion involving the whole SERPING1 gene with unidentified boundaries.\r\nAnalysis discloses both microdeletions 11q12.1 (57,389,932_57,640,909)x1 spanning almost 251 Kb and 17p12 microdeletion 17p12 (14,184,151_15,567,865)x1) spanning almost 1.4 Mb." "Germline" "yes" "" "0" "" "" "g.(?_57597701)_(57614240_?)del" "" "likely pathogenic" "ACMG"
"0001058195" "0" "30" "11" "57367577" "57367577" "subst" "0" "03256" "SERPING1_001211" "g.57367577G>A" "" "{DOI:Reddy 2025:10.1016/j.anai.2025.08.482}" "" "c.[NM_000301.3:598A>G(;)NM_000062.2:277G>A]" "Compound heterozygous carrier of both PLG and SERPING1 variants: c.[NM_000301.3:598A>G(;)NM_000062.2:277G>A]. Plasma C1-INH function and serum antigenic C1-INH have been found normal, making curation of the variant as likely benign or benign." "Germline" "" "" "0" "" "" "g.57600104G>A" "" "likely benign" ""
"0001059325" "0" "99" "11" "57382034" "57382034" "subst" "0" "03256" "SERPING1_001212" "g.57382034G>A" "" "{DOI:Du 2025:10.3389/falgy.2025.1696666} {DOI:Guo 2026: 10.1186/s13023-026-04421-3} {DOI:Du 2026:10.3389/falgy.2026.1899305}" "" "" "Val473 is the C-terminal residue of the sheet 5B in the shutter functional domain.\r\nClassification as Variant of Uncertain Significance according to the ACMG criteria: PP1_Sup, PM2_Sup, PP4_Sup, BP4_Sup." "Germline" "yes" "" "0" "" "" "g.57614561G>A" "" "VUS" "ACMG"
"0001059342" "11" "55" "11" "57382025" "57382025" "subst" "2.43948E-5" "03256" "SERPING1_001213" "g.57382025A>G" "0.00001" "{DOI:Chi 2018:10.1097/MD.0000000000012695}" "" "c.[NM_000383.3:595G>A;NM_000062.2,1474A>G];[NM_001204.6:1481C>T]" "A combined heterozygous male carrying 3 variants, c.[NM_000383.3(AIRE):595G>A;NM_000062.2(SERPING1,474A>G];[NM_001204.6(BMPR2):1481C>T] \r\nMet492 is located in sheet 5B, shutter functional domain." "Germline" "" "rs754081837" "0" "" "" "g.57614552A>G" "{CV-SCV:003460074.3}" "VUS" ""
"0001060089" "0" "99" "11" "57368466" "57369930" "del" "0" "03256" "SERPING1_001214" "g.57368466_57369930del" "" "{DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "11q12.1(57368466-57371760)del" "A 1,464-nt deletion encompassing exon 4, with identified boundaries" "Germline" "yes" "" "0" "" "" "g.57600993_57602457del" "" "pathogenic" "ACMG"
"0001060090" "0" "99" "11" "57368904" "57370856" "del" "0" "03256" "SERPING1_001215" "g.57368904_57370856del" "" "{DOI:Loules 2018:10.1016/j.gene.2018.05.029}" "" "11q12.1(57368904-57370856)del" "A 1,952-nt deletion encompassing exon 4" "Germline" "yes" "" "0" "" "" "g.57601431_57603383del" "" "pathogenic" "ACMG"
"0001060449" "0" "99" "11" "57373593" "57373593" "del" "0" "03256" "SERPING1_001216" "g.57373593del" "" "" "" "" "Introduced in ClinVar as likely pathogenic by Department of Human Genetics, Hannover Germany" "Germline" "yes" "" "0" "" "" "g.57606120del" "{CV-SCV:007095733.1}" "likely pathogenic" "ACMG"
"0001060451" "0" "99" "11" "57373902" "57373913" "del" "0" "03256" "SERPING1_001217" "g.57373902_57373913del" "" "" "" "" "The variation deletes a short 5-residue peptide segment within a non structured region.\r\nIntroduced in ClinVar as VUS by Institute of Human Genetics, Leipzig Germany." "Germline" "" "" "0" "" "" "g.57606429_57606440del" "{CV-SCV:007105815.1}" "VUS" "ACMG"
"0001061949" "0" "51" "11" "57367594" "57367614" "dup" "0" "03256" "SERPING1_001218" "g.57367594_57367614dup" "0.000005725" "" "" "" "The c.294_314dup variant results in the in-frame insertion of 7 aminoacid residues of the C1-INH protein (p.Ile100_Thr106dup) in an unstructured region of C1-INH that is not expected to affect serpin structural domain(s); in line with a preserved serpin function of the variant product and an absence of angioedema clinical phenotype. Normal C1-INH function has been shown by >1 individual.\r\nThe variant meets the ACMG criteria BS1, BS2, BP4." "Germline" "" "rs1945331199" "0" "" "" "g.57600121_57600141dup" "{CV-SCV:005783735}" "likely benign" "ACMG"
"0001062511" "0" "99" "11" "57365766" "57365769" "dup" "0" "03256" "SERPING1_001219" "g.57365766_57365769dup" "" "{DOI:Jiang 2025:10.22541/au.176675056.63979689/v1}" "" "" "According to ACMG guidelines, the According to ACMG guidelines the c.23_26dup variant was classified as Likely Pathogenic: PVS1_Moderate, PM2, PP1, PP4." "Germline" "" "" "0" "" "" "g.57598293_57598296dup" "" "likely pathogenic" "ACMG"
"0001062512" "0" "99" "11" "57381911" "57381911" "del" "0" "03256" "SERPING1_001220" "g.57381911del" "" "{DOI:Jiang 2025:10.22541/au.176675056.63979689/v1}" "" "" "Acording to the ACMG guidelines, the c.1360del variant has been classified as likely pathogenic with the following criteria: PVS1_Strong, PP4, PM2_Supporting." "Germline" "yes" "" "0" "" "" "g.57614438del" "" "likely pathogenic" "ACMG"
"0001062782" "1" "99" "11" "57379274" "57379274" "subst" "0" "03256" "SERPING1_000300" "g.57379274C>T" "" "{PMID:Gao 2025:40848077}, {DOI:Gao 2025:10.1007/s10875-025-01912-z}" "" "" "Compound heterozygous carrier with a MYOF variant c.[NM_000062.2:c.1114C>T];[NM_013451.4:c.548C>T]." "Germline" "yes" "" "0" "" "" "g.57611801C>T" "" "pathogenic" "ACMG"
"0001065471" "0" "50" "11" "57379359" "57379359" "subst" "4.06121E-6" "02325" "SERPING1_001221" "g.57379359G>T" "6.195e-7" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "rs773040870" "0" "" "" "g.57611886G>T" "{CV-SCV:003512418.4}" "VUS" ""
"0001068245" "0" "99" "11" "57367636" "57367637" "ins" "0" "03256" "SERPING1_001222" "g.57367636_57367637insC" "" "{DOI:Cosme Ferreira 2026:10.20344/amp.24214} {DOI:Mendoza-Alvarez 2026:10.21203/rs.3.rs-10662999/v1}" "" "" "The investigation reveals markedly reduced levels of antigenic C1-INH and antigenic C4, with C1-INH function below 25% of reference.\r\nVariant predicted with an activation of the NMD pathway.\r\nThe c.336_337insC variant is classified as pathogenic in line with ACMG criteria : PVS1_Very Strong, PM2_Supporting, PP1_Supporting, PP4_Supporting." "Germline" "yes" "" "0" "" "" "g.57600163_57600164insC" "" "pathogenic" "ACMG"
"0001070757" "0" "99" "11" "57367376" "57367376" "del" "0" "03256" "SERPING1_001223" "g.57367376del" "" "{DOI:Kurjane 2026:10.3389/fimmu.2026.1696479}" "" "c.76delG" "" "Germline" "yes" "" "0" "" "" "g.57599903del" "" "pathogenic" "ACMG"
"0001070759" "0" "97" "11" "57382031" "57382031" "subst" "0" "03256" "SERPING1_001224" "g.57382031C>G" "" "{DOI:Kurjane 2026:10.3389/fimmu.2026.1696479}" "" "" "" "Germline" "" "" "0" "" "" "g.57614558C>G" "" "VUS" ""
"0001071437" "0" "99" "11" "57373982" "57373982" "subst" "0" "03256" "SERPING1_001225" "g.57373982C>A" "" "{DOI:Wang 2026:10.2147/CCID.S581977}" "" "" "Antigenic C1-INH nearly 25% of reference. C1-INH function not investigated.\r\nPro309 is located at the C-terminus of sheet 3C, in the breach/gate functional domain. Substitution of Pro by Thr might disrupt the short interval between sheets 3C and 1B, with possible consequence in the serpin-protease complex forming process." "Germline/De novo (untested)" "" "" "0" "" "" "g.57606509C>A" "" "pathogenic" ""
"0001074612" "0" "97" "11" "57367366" "57367370" "del" "0" "03256" "SERPING1_001226" "g.57367366_57367370del" "" "" "" "" "This variant is not present in population databases (gnomAD no frequency).\r\nThe c.66_70del variant has been introduced in ClinVar database as pathogenic by Labcorp Genetics, San Francisco CA." "Germline" "yes" "" "0" "" "" "g.57599893_57599897del" "{CV-SCV:007382617.1}" "pathogenic" "ACMG"
"0001074703" "0" "99" "11" "57367656" "57367656" "del" "0" "03256" "SERPING1_001227" "g.57367656del" "" "" "" "" "Variant c.356del introduced in ClinVar as pathogenic by LabCorp, San Francisco CA." "Germline" "yes" "" "0" "" "" "g.57600183del" "{CV-SCV:007393146.1}" "pathogenic" "ACMG"
"0001074704" "0" "99" "11" "57367752" "57367752" "dup" "0" "03256" "SERPING1_001228" "g.57367752dup" "" "" "" "" "Variant c.452dup introduced in ClinVar as pathogenic by LabCorp San Francisco CA." "Germline" "yes" "" "0" "" "" "g.57600279dup" "{CV-SCV:007393752}" "pathogenic" "ACMG"
"0001074705" "0" "99" "11" "57367841" "57367841" "dup" "0" "03256" "SERPING1_001229" "g.57367841dup" "" "" "" "" "Variant c.541dup introduced in ClinVar as pathogenic by Labcorp San Francisco CA" "Germline" "yes" "" "0" "" "" "g.57600368dup" "{CV-SCV:007382248.1}" "pathogenic" "ACMG"
"0001074708" "0" "99" "11" "57373482" "57373482" "subst" "0" "03256" "SERPING1_001230" "g.57373482G>C" "" "" "" "" "This change affects a canonical acceptor splice site in intron 4 of the SERPING1 gene, with subsequent disruption of functional RNA splicing and skipping of exon 5." "Germline" "yes" "" "0" "" "" "g.57606009G>C" "{CV-SCV:007401132.1}" "pathogenic" "ACMG"
"0001074713" "0" "99" "11" "57373592" "57373592" "subst" "0" "03256" "SERPING1_001231" "g.57373592G>A" "" "" "" "" "The variant c.795G>A has been introduced in ClinVar database as pathogenic by LabCorp Genetics San Francisco CA" "Germline" "yes" "" "0" "" "" "g.57606119G>A" "{CV-SCV:007374316.1}" "pathogenic" "ACMG"
"0001074714" "0" "99" "11" "57373678" "57373678" "dup" "0" "03256" "SERPING1_001232" "g.57373678dup" "" "" "" "" "c.881dup variant introduced in ClinVar database as pathogenic by LabCorp Genetics.\r\nACMG criteria: PVS1, PS3, PS2_Sup, PM2_Sup" "De novo" "yes" "" "0" "" "" "g.57606205dup" "{CV-SCV:007448739.1}" "pathogenic" "ACMG"
"0001074715" "0" "99" "11" "57373922" "57373922" "del" "0" "03256" "SERPING1_001233" "g.57373922del" "" "" "" "" "The c.931del variant has been introduced in ClinVar database as pathogenic by LabCorp Genetics, San Francisco CA" "Germline" "yes" "" "0" "" "" "g.57606449del" "{CV-SCV:007382778.1}" "pathogenic" "ACMG"
"0001074716" "0" "99" "11" "57373991" "57373991" "del" "0" "03256" "SERPING1_001234" "g.57373991del" "" "" "" "" "The c.1000del variant has been introduced in ClinVar database as pathogenic by LabCorp, San Francisco CA" "Germline" "" "" "0" "" "" "g.57606518del" "{CV-SCV:007395122.1}" "pathogenic" "ACMG"
"0001076297" "0" "33" "11" "57373654" "57373654" "subst" "1.21821E-5" "03256" "SERPING1_000792" "g.57373654G>A" "0.0000107" "{DOI:Tarsitano 2026:10.3390/life16020200}" "" "" "C1-INH antigenic levels and function and antigenic C4 were found within the normal range.\r\nCombined variant with DSP:c.8372G>A and CD36:c.1155dup as [SERPING1:c.857G>A];[DSP:c.8372G>A];[CD36:c.1155dup].\r\nBoth the SERPING1 and DSP variants exhibit CADD scores exceeding 20, indicative of a predicted deleterious impact in the absence of definitive functional validation." "Germline" "" "rs762750068" "0" "" "" "g.57606181G>A" "" "VUS" ""
"0001078322" "0" "53" "11" "57373988" "57373988" "subst" "4.06124E-6" "03256" "SERPING1_001235" "g.57373988G>T" "0.000009" "" "" "" "This variant has not been reported in the literature in individuals affected with SERPING1-related conditions. \r\nNo information on clinics, biology and family history. The available evidence is currently insufficient to determine the role of this variant in disease." "Germline" "" "" "0" "" "" "g.57606515G>T" "{CV-SCV:005783077.2}" "likely benign" ""
"0001078359" "0" "99" "11" "57374022" "57374022" "subst" "0" "03256" "SERPING1_001236" "g.57374022T>A" "" "{DOI:Guo 2026:10.1186/s13023-026-04421-3}" "" "" "Variant disturbing the canonical donor splice site.\r\nFunctional characterization of the identified splice-site variant has been conducted using RT-PCR on patient-derived peripheral blood RNA and an in vitro minigene splicing assay in HEK293T cells. RT-PCR investigation shows a reduced wild-type transcript expression and an aberrant transcript resulting from complete exon 6 skipping c.890_1029del, predicted to cause a frameshift and premature termination codon (p.Ala297Glyfs*25). The minigene assay confirms that the variant construct produced no detectable canonical transcript.\r\nACMG criteria PVS1 and PM2_Sup, with classification as likely pathogenic." "Germline" "yes" "" "0" "" "" "g.57606549T>A" "" "pathogenic" "ACMG"
"0001078360" "0" "99" "11" "57373924" "57373925" "ins" "0" "03256" "SERPING1_001237" "g.57373924_57373925insGGAA" "" "{DOI:Guo 2026:10.1186/s13023-026-04421-3} {DOI:Du 2026:10.3389/falgy.2026.1899305}" "" "" "The variant c.933_934insGGAA meets the ACMG criteria PVS1, PM2, PP1, PP4 to be considered as likely pathogenic." "Germline" "yes" "" "0" "" "" "g.57606451_57606452insGGAA" "" "likely pathogenic" "ACMG"
"0001078508" "0" "30" "11" "57367466" "57367466" "subst" "4.06058E-6" "03256" "SERPING1_001238" "g.57367466G>A" "0.00001" "" "" "" "The variant meets the criterion BP4" "Germline" "" "rs1010623673" "0" "" "" "g.57599993G>A" "{CV-SCV:004269408.3}" "likely benign" ""
"0001080017" "0" "99" "11" "57157405" "57408382" "del" "0" "03256" "SERPING1_001239" "g.57157405_57408382del" "" "{DOI:Marchionni 2026:10.1186/s13023-025-04092-6}" "" "" "The long deleted region identified in the proband DNA and spanning almost 251 Kb and involving the whole SERPING1 gene overlaps with a recurrent 17p12 microdeletion, known as pathogenic in the literature and international databases.\r\nThe deleted region does not involve other disease-causing genes.\r\nGenetic analyses disclose a 17p12 microdeletion g.14184151_15,567,865, spanning almost 1.4 Mb as confirmed by FISH analysis, and involving the disease-causing gene PMP22, associated with HNPP disease. The deleted region involves two other disease-causing genes, COX10 (OMIM #602125) and TEKT3 (OMIM #612683) associated with autosomal recessive conditions (Mitochondrial complex IV deficiency, nuclear type 3 OMIM #619046 and Spermatogenic failure 81 OMIM #620277, respectively) that are not relevant for the clinical phenotype of the proband." "Germline" "" "" "0" "" "" "g.57389932_57640909del" "" "pathogenic" ""
"0001081377" "0" "99" "11" "57367448" "57367448" "dup" "0" "03256" "SERPING1_001240" "g.57367448dup" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "" "{CV-SCV:007615595.1}" "likely pathogenic" "ACMG"
"0001081378" "0" "99" "11" "57373675" "57373675" "subst" "0" "03256" "SERPING1_001241" "g.57373675T>G" "" "" "" "" "The variant meets the ACMG criteria PM1_Mod, PS4_Supp, PP3_Supp, PP4_Supp, PM2_Mod" "Germline" "" "" "0" "" "" "g.57606202T>G" "{CV-SCV:007637003.1}" "likely pathogenic" "ACMG"
"0001081379" "0" "99" "11" "57379301" "57379301" "del" "0" "03256" "SERPING1_001242" "g.57379301del" "" "" "" "" "The variant meets the ACMG criteria PVS1, PM2 and PP4" "Germline" "" "" "0" "" "" "g.57611828del" "{CV-SCV:007613741.1}" "likely pathogenic" "ACMG"
"0001082967" "0" "90" "11" "57379274" "57379274" "subst" "0" "03779" "SERPING1_000300" "g.57379274C>T" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0001083827" "0" "99" "11" "57381909" "57381910" "ins" "0" "03256" "SERPING1_001243" "g.57381909_57381910insCTGG" "" "{DOI:Du 2026:10.3389/falgy.2026.1899305}" "" "" "The c.1358_1359insCTGG variant meets the ACMG criteria PVS1, PM2, PP4 to be considered pathogenic" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic" "ACMG"
"0001089472" "0" "99" "11" "57365707" "57365719" "del" "0" "03256" "SERPING1_001244" "g.57365707_57365719del" "" "{DOI:Mendoza-Alvarez 2026:10.21203/rs.3.rs-10662999/v1}" "" "" "Novel splicing variant" "Germline" "yes" "" "0" "" "" "g.57598234_57598246del" "" "likely pathogenic" "ACMG"
"0001089473" "0" "99" "11" "57373660" "57373660" "subst" "0" "03256" "SERPING1_001245" "g.57373660T>A" "" "{DOI:Mendoza-Alvarez 2026:10.21203/rs.3.rs-10662999/v1}" "" "" "A father and his son are affected.\r\nVal288 residue is located at the end of sheet 3A." "Germline" "yes" "" "0" "" "" "g.57606187T>A" "" "likely pathogenic" ""
"0001089474" "0" "99" "11" "57373528" "57373528" "dup" "0" "03256" "SERPING1_001246" "g.57373528dup" "" "{DOI:Mendoza-Alvarez 2026:10.21203/rs.3.rs-10662999/v1}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57606055dup" "" "likely pathogenic" "ACMG"
"0001089475" "0" "99" "11" "57382006" "57382010" "dup" "0" "03256" "SERPING1_001247" "g.57382006_57382010dup" "" "{DOI:Mendoza-Alvarez 2026:10.21203/rs.3.rs-10662999/v1}" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic" "ACMG"
"0001089476" "0" "99" "11" "57373689" "57373689" "subst" "0" "03256" "SERPING1_001248" "g.57373689A>C" "" "{DOI:Mendoza-Alvarez 2026:10.21203/rs.3.rs-10662999/v1}" "" "" "Predicted to trigger the NMD pathway, with subsequent mRNA degradation and prevention of the production of a truncated C1-INH protein." "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic" "ACMG"
## Variants_On_Transcripts ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Note: Only showing Variants_On_Transcript columns active for Genes SERPING1
## Count = 1309
"{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}"
"0000248233" "00018730" "10" "1030" "-20" "1030" "-20" "c.1030-20A>G" "r.(=)" "p.(=)" "6i"
"0000250936" "00018730" "10" "1030" "-20" "1030" "-20" "c.1030-20A>G" "r.(=)" "p.(=)" "6i"
"0000295754" "00018730" "90" "5" "0" "5" "0" "c.5C>T" "r.(?)" "p.(Ala2Val)" "2"
"0000298124" "00018730" "10" "1438" "0" "1438" "0" "c.1438G>A" "r.(?)" "p.(Val480Met)" "8"
"0000302048" "00018730" "33" "-21" "0" "-21" "0" "c.-21T>C" "r.(?)" "p.(=)" "2"
"0000302049" "00018730" "70" "1033" "0" "1033" "0" "c.1033G>T" "r.(?)" "p.(Gly345Trp)" "7"
"0000302050" "00018730" "10" "1438" "0" "1438" "0" "c.1438G>A" "r.(?)" "p.(Val480Met)" "8"
"0000302051" "00018730" "99" "1480" "0" "1480" "0" "c.1480C>T" "r.(?)" "p.(Arg494Ter)" "8"
"0000302052" "00018730" "30" "751" "0" "751" "0" "c.751C>T" "r.(?)" "p.(Leu251=)" "5"
"0000307916" "00018730" "35" "52" "-5" "52" "-5" "c.52-5C>T" "r.spl?" "p.?" "2i"
"0000338430" "00018730" "13" "-21" "0" "-21" "0" "c.-21T>C" "r.(?)" "p.(=)" "2"
"0000350562" "00018730" "11" "1438" "0" "1438" "0" "c.1438G>A" "r.(?)" "p.(Val480Met)" "8"
"0000351291" "00018730" "10" "1030" "-20" "1030" "-20" "c.1030-20A>G" "r.(=)" "p.(=)" "6i"
"0000472588" "00018730" "99" "234" "0" "235" "0" "c.234_235insCCACTATACC" "r.(?)" "p.(Thr79Profs*6)" "3"
"0000472589" "00018730" "99" "270" "0" "270" "0" "c.270del" "r.(?)" "p.(Thr91Profs*57)" "3"
"0000472590" "00018730" "99" "291" "0" "295" "0" "c.291_295del" "r.(?)" "p.(Gln97Hisfs*34)" "3"
"0000472592" "00018730" "99" "301" "0" "301" "0" "c.301del" "r.(?)" "p.(Gln101Asnfs*47)" "3"
"0000472593" "00018730" "99" "312" "0" "312" "0" "c.312dup" "r.(?)" "p.(Pro105Thrfs*28)" "3"
"0000472594" "00018730" "99" "366" "0" "367" "0" "c.366_367dup" "r.(?)" "p.(Cys123Serfs*26)" "3"
"0000472595" "00018730" "99" "390" "0" "390" "0" "c.390C>G" "r.(?)" "p.(Cys130Trp)" "3"
"0000472596" "00018730" "99" "403" "0" "404" "0" "c.403_404del" "r.(?)" "p.(His136Phefs*120)" "3"
"0000472597" "00018730" "99" "430" "0" "430" "0" "c.430del" "r.(?)" "p.(Asp144Metfs*4)" "3"
"0000472598" "00018730" "99" "443" "0" "444" "0" "c.443_444del" "r.(?)" "p.(Asp148Valfs*108)" "3"
"0000472599" "00018730" "97" "452" "0" "452" "0" "c.452T>G" "r.(?)" "p.(Leu151Arg)" "3"
"0000472600" "00018730" "99" "458" "0" "458" "0" "c.458T>C" "r.(?)" "p.(Leu153Pro)" "3"
"0000472601" "00018730" "99" "462" "0" "462" "0" "c.462C>G" "r.(?)" "p.(Tyr154*)" "3"
"0000472602" "00018730" "99" "497" "0" "497" "0" "c.497A>T" "r.(?)" "p.(Asn166Ile)" "3"
"0000472603" "00018730" "99" "501" "0" "525" "0" "c.501_525dup" "r.(?)" "p.(Ser176Glyfs*89)" "3"
"0000472604" "00018730" "99" "502" "0" "502" "0" "c.502G>A" "r.(?)" "p.(Ala168Thr)" "3"
"0000472605" "00018730" "99" "516" "0" "517" "0" "c.516_517insT" "r.(?)" "p.(Ser173*)" "3"
"0000472606" "00018730" "99" "523" "0" "523" "0" "c.523G>C" "r.(?)" "p.(Ala175Pro)" "3"
"0000472607" "00018730" "99" "550" "0" "550" "0" "c.550G>T" "r.(?), r.52_550del" "p.(Gly184Trp), p.0?" "3"
"0000472608" "00018730" "99" "589" "0" "589" "0" "c.589C>G" "r.(?)" "p.(Leu197Val)" "4"
"0000472609" "00018730" "99" "590" "0" "590" "0" "c.590T>C" "r.(?)" "p.(Leu197Pro)" "4"
"0000472610" "00018730" "99" "597" "0" "597" "0" "c.597C>A" "r.(?)" "p.(Tyr199*)" "4"
"0000472611" "00018730" "99" "613" "0" "613" "0" "c.613T>C" "r.(?)" "p.(Cys205Arg)" "4"
"0000472612" "00018730" "77" "641" "0" "641" "0" "c.641C>T" "r.(?)" "p.(Thr214Met)" "4"
"0000472613" "00018730" "99" "659" "0" "659" "0" "c.659C>A" "r.(?)" "p.(Ser220*)" "4"
"0000472614" "00018730" "99" "664" "0" "664" "0" "c.664T>C" "r.(?)" "p.(Ser222Pro)" "4"
"0000472615" "00018730" "97" "668" "0" "668" "0" "c.668A>C" "r.(?)" "p.(Gln223Pro)" "4"
"0000472617" "00018730" "99" "676" "0" "676" "0" "c.676C>G" "r.(?)" "p.(His226Asp)" "4"
"0000472618" "00018730" "99" "685" "5" "685" "5" "c.685+5G>A" "r.spl?" "p.0?" "4i"
"0000472619" "00018730" "99" "685" "5" "685" "5" "c.685+5G>T" "r.spl?" "p.0?" "4i"
"0000472620" "00018730" "99" "686" "-7" "686" "-7" "c.686-7C>G" "r.spl?" "p.0?" "4i"
"0000472622" "00018730" "99" "701" "0" "705" "0" "c.701_705del" "r.(?)" "p.(Asp234Valfs*21)" "5"
"0000472623" "00018730" "99" "762" "0" "762" "0" "c.762del" "r.(?)" "p.(Asn254Lysfs*25)" "5"
"0000472624" "00018730" "99" "776" "0" "776" "0" "c.776T>A" "r.(?)" "p.(Leu259*)" "5"
"0000472625" "00018730" "99" "785" "0" "785" "0" "c.785T>C" "r.(?)" "p.(Ile262Thr)" "5"
"0000472626" "00018730" "99" "806" "0" "806" "0" "c.806dup" "r.(?)" "p.(Asn269Lysfs*36)" "5"
"0000472627" "00018730" "99" "807" "0" "807" "0" "c.807dup" "r.(?)" "p.(Thr270Hisfs*35)" "5"
"0000472628" "00018730" "99" "816" "0" "818" "0" "c.816_818dup" "r.(?)" "p.(Asn272dup)" "5"
"0000472629" "00018730" "99" "816" "0" "816" "0" "c.816dup" "r.(?)" "p.(Lys273Glnfs*32)" "5"
"0000472630" "00018730" "99" "860" "0" "860" "0" "c.860T>A" "r.(?)" "p.(Leu287His)" "5"
"0000472631" "00018730" "99" "875" "0" "876" "0" "c.875_876del" "r.(?)" "p.(Ala292Aspfs*12)" "5"
"0000472632" "00018730" "99" "889" "1" "889" "1" "c.889+1del" "r.(686_889del)" "p.(Ala297ProfsTer24)" "5i"
"0000472633" "00018730" "90" "890" "-8" "890" "-8" "c.890-8C>G" "r.spl?" "p.0?" "5i"
"0000472635" "00018730" "99" "898" "0" "898" "0" "c.898A>T" "r.(?)" "p.(Lys300*)" "6"
"0000472636" "00018730" "99" "916" "0" "917" "0" "c.916_917ins(37)" "r.(?)" "p.(Lys306Argfs*34)" "6"
"0000472637" "00018730" "99" "924" "0" "924" "0" "c.924del" "r.(?)" "p.(Arg309Glufs*12)" "6"
"0000472638" "00018730" "99" "938" "0" "938" "0" "c.938T>C" "r.(?)" "p.(Phe313Ser)" "6"
"0000472639" "00018730" "99" "941" "0" "941" "0" "c.941dup" "r.(?)" "p.(His314Glnfs*14)" "6"
"0000472640" "00018730" "99" "944" "0" "944" "0" "c.944del" "r.(?)" "p.(Phe315Serfs*6)" "6"
"0000472641" "00018730" "99" "950" "0" "950" "0" "c.950del" "r.(?)" "p.(Asn317ThrfsTer4)" "6"
"0000472642" "00018730" "99" "952" "0" "952" "0" "c.952T>C" "r.(?)" "p.(Ser318Pro)" "6"
"0000472643" "00018730" "99" "961" "0" "961" "0" "c.961A>T" "r.(?)" "p.(Lys321*)" "6"
"0000472644" "00018730" "99" "965" "0" "965" "0" "c.965T>A" "r.(?)" "p.(Val322Glu)" "6"
"0000472645" "00018730" "99" "965" "0" "967" "0" "c.965_967del" "r.(?)" "p.(Val322_Pro323delinsAla)" "6"
"0000472646" "00018730" "99" "973" "0" "973" "0" "c.973A>G" "r.(?)" "p.(Met325Val)" "6"
"0000472647" "00018730" "99" "974" "0" "976" "0" "c.974_976del" "r.(?)" "p.(Met325del)" "6"
"0000472648" "00018730" "99" "990" "0" "990" "0" "c.990C>A" "r.(?)" "p.(Tyr330*)" "6"
"0000472649" "00018730" "99" "991" "0" "991" "0" "c.991C>T" "r.(?)" "p.(Pro331Ser)" "6"
"0000472650" "00018730" "99" "995" "0" "995" "0" "c.995del" "r.(?)" "p.(Val332Glyfs*9)" "6"
"0000472651" "00018730" "99" "1000" "0" "1000" "0" "c.1000C>G" "r.(?)" "p.(His334Asp)" "6"
"0000472652" "00018730" "99" "1029" "2" "1029" "2" "c.1029+2T>G" "r.(890_1029del)" "p.0?" "6i"
"0000472654" "00018730" "99" "1030" "-1" "1030" "-1" "c.1030-1G>T" "r.(1030_1249del)" "p.?" "6i"
"0000472655" "00018730" "99" "1034" "0" "1034" "0" "c.1034G>A" "r.(?)" "p.(Gly345Glu)" "7"
"0000472656" "00018730" "99" "1036" "0" "1036" "0" "c.1036del" "r.(?)" "p.(Gln346Serfs*8)" "7"
"0000472657" "00018730" "99" "1037" "0" "1037" "0" "c.1037del" "r.(?)" "p.(Gln346Argfs*8)" "7"
"0000472658" "00018730" "99" "1053" "0" "1054" "0" "c.1053_1054dup" "r.(?)" "p.(Asn352Thrfs*3)" "7"
"0000472659" "00018730" "99" "1064" "0" "1064" "0" "c.1064T>C" "r.(?)" "p.(Leu355Ser)" "7"
"0000472660" "00018730" "99" "1070" "0" "1070" "0" "c.1070T>G" "r.(?)" "p.(Ile357Ser)" "7"
"0000472661" "00018730" "99" "1075" "0" "1076" "0" "c.1075_1076insA" "r.(?)" "p.(Val359Aspfs*10)" "7"
"0000472662" "00018730" "99" "1079" "0" "1079" "0" "c.1079C>A" "r.(?)" "p.(Pro360His)" "7"
"0000472663" "00018730" "99" "1085" "0" "1085" "0" "c.1085del" "r.(?)" "p.(Asn362Thrfs*2)" "7"
"0000472664" "00018730" "99" "1100" "0" "1100" "0" "c.1100T>C" "r.(?)" "p.(Leu367Pro)" "7"
"0000472666" "00018730" "99" "1108" "0" "1108" "0" "c.1108dup" "r.(?)" "p.(Met370Asnfs*55)" "7"
"0000472667" "00018730" "99" "1114" "0" "1114" "0" "c.1114del" "r.(?)" "p.(Gln372Argfs*25)" "7"
"0000472668" "00018730" "99" "1122" "0" "1123" "0" "c.1122_1123dup" "r.(?)" "p.(Ser375Thrfs*23)" "7"
"0000472671" "00018730" "99" "1195" "0" "1195" "0" "c.1195C>G" "r.(?)" "p.(Pro399Ala)" "7"
"0000472672" "00018730" "99" "1202" "0" "1202" "0" "c.1202T>G" "r.(?)" "p.(Ile401Ser)" "7"
"0000472673" "00018730" "99" "1206" "0" "1206" "0" "c.1206del" "r.(?)" "p.(Val403*)" "7"
"0000472674" "00018730" "99" "1207" "0" "1207" "0" "c.1207del" "r.(?)" "p.(Val403*)" "7"
"0000472675" "00018730" "99" "1219" "0" "1219" "0" "c.1219dup" "r.(?)" "p.(Gln407Profs*18)" "7"
"0000472676" "00018730" "99" "1249" "0" "1249" "0" "c.1249G>T" "r.(?)" "p.(Glu417*)" "7"
"0000472677" "00018730" "99" "1249" "1" "1249" "1" "c.1249+1G>T" "r.(1030_1249del)" "p.0?" "7i"
"0000472678" "00018730" "99" "1256" "0" "1256" "0" "c.1256del" "r.(?)" "p.(Phe419Serfs*12)" "8"
"0000472679" "00018730" "99" "1265" "0" "1266" "0" "c.1265_1266del" "r.(?)" "p.(Ser422Leufs*2)" "8"
"0000472680" "00018730" "99" "1312" "0" "1312" "0" "c.1312del" "r.(?)" "p.(Val438Phefs*12)" "8"
"0000472681" "00018730" "99" "1319" "0" "1319" "0" "c.1319C>T" "r.(?)" "p.(Ala440Val)" "8"
"0000472682" "00018730" "99" "1334" "0" "1334" "0" "c.1334C>G" "r.(?)" "p.(Thr445Arg)" "8"
"0000472683" "00018730" "99" "1346" "0" "1346" "0" "c.1346dup" "r.(?)" "p.(Thr450Aspfs*23)" "8"
"0000472684" "00018730" "99" "1350" "0" "1355" "0" "c.1350_1355del" "r.(?)" "p.(Glu451_Thr452del)" "8"
"0000472686" "00018730" "99" "1379" "0" "1379" "0" "c.1379C>A" "r.(?)" "p.(Ser460Tyr)" "8"
"0000472687" "00018730" "99" "1424" "0" "1424" "0" "c.1424dup" "r.(?)" "p.(Pro476Alafs*22)" "8"
"0000472688" "00018730" "99" "1439" "0" "1439" "0" "c.1439del" "r.(?)" "p.(Val480Glyfs*96)" "8"
"0000472689" "00018730" "99" "1453" "0" "1453" "0" "c.1453C>T" "r.(?)" "p.(Gln485*)" "8"
"0000472690" "00018730" "99" "1455" "0" "1457" "0" "c.1455_1457dup" "r.(?)" "p.(Gln485dup)" "8"
"0000472691" "00018730" "90" "-23" "5" "-23" "5" "c.-23+5del" "r.spl?" "p.?" "1i"
"0000472692" "00018730" "95" "-23" "5" "-23" "5" "c.-23+5G>A" "r.(spl)?" "p.0?" "1i"
"0000472693" "00018730" "97" "-22" "-25" "-22" "-9" "c.-22-25_-22-9del" "r.spl?" "p.0?" "1i"
"0000472694" "00018730" "99" "-22" "-19" "-22" "-4" "c.-22-19_-22-4del" "r.spl?" "p.?" "1i"
"0000472695" "00018730" "99" "-22" "-10" "-22" "-7" "c.-22-10_-22-7del" "r.(=)" "p.(=)" "1i"
"0000472696" "00018730" "97" "-22" "-7" "-22" "-3" "c.-22-7_-22-3del" "r.spl?" "p.?" "1i"
"0000472698" "00018730" "99" "-22" "-2" "-22" "-2" "c.-22-2A>T" "r.spl?" "p.0?" "1i"
"0000472699" "00018730" "99" "29" "0" "29" "0" "c.29T>G" "r.(?)" "p.(Leu10Arg)" "2"
"0000472700" "00018730" "99" "49" "0" "51" "13" "c.49_51+13del" "r.spl?" "p.?" "2_2i"
"0000472701" "00018730" "99" "51" "2" "51" "2" "c.51+2T>A" "r.(-22_51del)" "p.0?" "2i"
"0000472702" "00018730" "99" "51" "3" "51" "3" "c.51+3A>C" "r.[(=,-22_51del)]" "p.?" "2i"
"0000472703" "00018730" "99" "51" "3" "51" "6" "c.51+3_51+6del" "r.spl?" "p.?" "2i"
"0000472704" "00018730" "99" "58" "0" "58" "0" "c.58del" "r.(?)" "p.(Ala20Profs*59)" "3"
"0000472705" "00018730" "99" "112" "0" "112" "0" "c.112C>T" "r.(?)" "p.(Gln38*)" "3"
"0000472706" "00018730" "99" "157" "0" "157" "0" "c.157del" "r.(?)" "p.(Met53Cysfs*26)" "3"
"0000472707" "00018730" "99" "159" "0" "159" "0" "c.159del" "r.(?)" "p.(Met53Ilefs*26)" "3"
"0000472709" "00018730" "99" "208" "0" "211" "0" "c.208_211del" "r.(?)" "p.(Ser70Glnfs*8)" "3"
"0000472710" "00018730" "99" "-22" "-1" "550" "1" "c.(-23+1_-22-1)_(550+1_551-1)del" "r.spl?" "p.?" "1i_3i"
"0000472711" "00018730" "99" "-22" "-1" "889" "1" "c.(-23+1_-22-1)_(889+1_890-1)del" "r.?" "p.0?" "1i_5i"
"0000472712" "00018730" "99" "686" "-1" "1249" "1" "c.(685+1_686-1)_(1249+1_1250-1)del" "r.(?)" "p.0?" "_5_7_"
"0000472713" "00018730" "99" "551" "-1" "685" "1" "c.(550+1_551-1)_(685+1_686-1)dup" "r.(551_685)dup" "p.(Gly184_Pro228)dup" "3i_4i"
"0000472714" "00018730" "99" "686" "-1" "1775" "0" "c.(685+1_686-1)_(*272_?)dup" "r.?" "p.?" "4i_8_"
"0000487592" "00018730" "99" "51" "3" "51" "3" "c.51+3A>C" "r.[(=,-22_51del)]" "p.?" "2i"
"0000497705" "00018730" "99" "878" "0" "881" "0" "c.878_881del" "r.(?)" "p.(Ile293Thrfs*2)" "5"
"0000497739" "00018730" "99" "-22" "-2" "-22" "-2" "c.-22-2A>G" "r.spl?" "p.0?" "1i"
"0000497763" "00018730" "99" "-22" "-2" "-22" "-2" "c.-22-2A>C" "r.spl?" "p.0?" "1i"
"0000497767" "00018730" "99" "6" "0" "13" "0" "c.6_13dup" "r.(?)" "p.(Leu5Profs*4)" "2"
"0000497773" "00018730" "99" "1198" "0" "1198" "0" "c.1198C>T" "r.(?)" "p.(Arg400Cys)" "7;7"
"0000497774" "00018730" "99" "23" "0" "23" "0" "c.23dup" "r.(?)" "p.(Thr9Aspfs*11)" "2"
"0000497777" "00018730" "99" "15" "0" "16" "0" "c.15_16dup" "r.(?)" "p.(Thr6Argfs*4)" "2"
"0000497782" "00018730" "99" "19" "0" "19" "0" "c.19dup" "r.(?)" "p.(Leu7Profs*13)" "2"
"0000497784" "00018730" "99" "51" "3" "51" "9" "c.51+3_51+9del" "r.(-22_51del)" "p.?" "2_2i"
"0000498192" "00018730" "99" "1033" "0" "1033" "0" "c.1033G>A" "r.(?)" "p.(Gly345Arg)" "7"
"0000498193" "00018730" "99" "506" "0" "506" "0" "c.506T>C" "r.(?)" "p.(Phe169Ser)" "3"
"0000498194" "00018730" "55" "856" "0" "856" "0" "c.856C>T" "r.(?)" "p.(Arg286Cys)" "5"
"0000498195" "00018730" "99" "1361" "0" "1361" "0" "c.1361T>A" "r.(?)" "p.(Val454Glu)" "8"
"0000498196" "00018730" "99" "1361" "0" "1361" "0" "c.1361T>A" "r.(?)" "p.(Val454Glu)" "8"
"0000498197" "00018730" "99" "1" "0" "1" "0" "c.1A>G" "r.(1a>g)" "p.(Met1Val)" "2"
"0000498491" "00018730" "99" "1396" "0" "1396" "0" "c.1396C>A" "r.(?)" "p.(Arg466Ser)" "8"
"0000498492" "00018730" "99" "1198" "0" "1198" "0" "c.1198C>T" "r.(?)" "p.(Arg400Cys)" "7"
"0000498530" "00018730" "99" "65" "0" "65" "0" "c.65C>G" "r.(?)" "p.(Ser22*)" "3"
"0000498531" "00018730" "99" "94" "0" "94" "0" "c.94C>T" "r.(?)" "p.(Gln32*)" "3"
"0000498532" "00018730" "99" "1417" "0" "1417" "0" "c.1417G>A" "r.(?)" "p.(Val473Met)" "8"
"0000498541" "00018730" "59" "1394" "0" "1394" "0" "c.1394C>T" "r.(?)" "p.(Ala465Val)" "8"
"0000498543" "00018730" "99" "1030" "-1" "1249" "1" "c.(1029+1_1030-1)_(1249+1_1250-1)del" "r.(1030_1249del)" "p.0?" "6i_7i"
"0000498898" "00018730" "99" "51" "5" "51" "5" "c.51+5G>A" "r.-22_51del" "p.(0)?" "2i"
"0000498899" "00018730" "99" "52" "-1" "52" "-1" "c.52-1G>A" "r.(-22_51del)" "p.0?" "2i"
"0000498902" "00018730" "99" "51" "6" "51" "6" "c.51+6T>G" "r.(=)" "p.0" "2i"
"0000498903" "00018730" "99" "51" "3" "51" "3" "c.51+3A>T" "r.[(=,-22_51del)]" "p.0?" "2i"
"0000498904" "00018730" "99" "51" "3" "51" "3" "c.51+3A>G" "r.-22_51del;52_550del;-22_550del" "p.0?" "2i"
"0000498907" "00018730" "99" "816" "0" "818" "0" "c.816_818del" "r.(?)" "p.(Asn272del)" "5"
"0000498910" "00018730" "90" "1420" "0" "1420" "0" "c.[1420C>G;1442T>G]" "r.(?)" "p.[(Gln474Glu);(Leu481Arg)]" "8;8"
"0000498916" "00018730" "99" "106" "0" "107" "0" "c.106_107del" "r.(?)" "p.(Ser36Phefs*21)" "3"
"0000499065" "00018730" "99" "509" "0" "509" "0" "c.509C>T" "r.(?)" "p.(Ser170Phe)" "3"
"0000499066" "00018730" "99" "512" "0" "512" "0" "c.512C>T" "r.(?)" "p.(Pro171Leu)" "3"
"0000499181" "00018730" "99" "550" "0" "550" "0" "c.550G>A" "r.52_550del" "p.(Gly184Arg)" "3"
"0000499186" "00018730" "99" "587" "0" "587" "0" "c.587T>A" "r.(?)" "p.(Ile196Asn)" "4"
"0000499235" "00018730" "99" "597" "0" "597" "0" "c.597C>G" "r.(?)" "p.(Tyr199*)" "4"
"0000499256" "00018730" "99" "646" "0" "646" "0" "c.646delinsTCAGTGTCGTG" "r.(?)" "p.(Lys216_Ala500delinsSerValSer*)" "4"
"0000499257" "00018730" "99" "689" "0" "689" "0" "c.689T>C" "r.(?)" "p.(Leu230Pro)" "5"
"0000499258" "00018730" "99" "752" "0" "752" "0" "c.752T>C" "r.(?)" "p.(Leu251Pro)" "5"
"0000499259" "00018730" "99" "871" "0" "871" "0" "c.871A>C" "r.(?)" "p.(Asn291His)" "5"
"0000499260" "00018730" "99" "895" "0" "895" "0" "c.895T>C" "r.(?)" "p.(Trp299Arg)" "6"
"0000499261" "00018730" "99" "895" "0" "895" "0" "c.895T>G" "r.(?)" "p.(Trp299Gly)" "6"
"0000499263" "00018730" "99" "1106" "0" "1106" "0" "c.1106del" "r.(?)" "p.(Asp369Alafs*28)" "7"
"0000499264" "00018730" "99" "1322" "0" "1322" "0" "c.1322T>C" "r.(?)" "p.(Met441Thr)" "8"
"0000499266" "00018730" "99" "1357" "0" "1358" "0" "c.1357_1358insTGT" "r.(?)" "p.(Gly453delinsValTrp)" "8"
"0000499268" "00018730" "99" "1372" "0" "1372" "0" "c.1372G>A" "r.(?)" "p.(Ala458Thr)" "8"
"0000499269" "00018730" "99" "1418" "0" "1418" "0" "c.1418T>G" "r.(?)" "p.(Val473Gly)" "8"
"0000499270" "00018730" "99" "1490" "0" "1490" "0" "c.1490A>G" "r.(?)" "p.(Asp497Gly)" "8"
"0000499467" "00018730" "50" "-100" "0" "-100" "0" "c.-100C>G" "r.(=)" "p.(=)" "1"
"0000499468" "00018730" "99" "1442" "0" "1442" "0" "c.1442T>C" "r.(?)" "p.(Leu481Pro)" "8"
"0000499619" "00018730" "33" "167" "0" "167" "0" "c.167T>C" "r.(?)" "p.(Val56Ala)" "3"
"0000499620" "00018730" "99" "1480" "0" "1480" "0" "c.1480C>T" "r.(?)" "p.(Arg494*)" "8"
"0000499665" "00018730" "77" "-21" "0" "-21" "0" "c.[-21T>C];[-21T>C]" "r.(-22_51del)" "p.0?" "2;2"
"0000499666" "00018730" "77" "-163" "0" "-163" "0" "c.-163C>T" "r.(=)" "p.(=)" "1"
"0000499667" "00018730" "77" "-161" "0" "-161" "0" "c.-161A>G" "r.(=)" "p.(=)" "1"
"0000499668" "00018730" "99" "119" "0" "141" "0" "c.119_141dup" "r.(?)" "p.(Thr48Glufs*39)" "3"
"0000499669" "00018730" "99" "143" "0" "144" "0" "c.143_144del" "r.(?)" "p.(Thr48Serfs*9)" "3"
"0000499670" "00018730" "99" "437" "0" "437" "0" "c.437del" "r.(?)" "p.(Leu146Trpfs*2)" "3"
"0000499672" "00018730" "99" "40" "0" "49" "0" "c.40_49del" "r.(?)" "p.(Leu14Glyfs*62)" "2"
"0000499673" "00018730" "99" "94" "0" "94" "0" "c.94del" "r.(?)" "p.(Gln32Argfs*47)" "3"
"0000499675" "00018730" "99" "197" "0" "197" "0" "c.197del" "r.(?)" "p.(Pro66Argfs*13)" "3"
"0000499676" "00018730" "99" "218" "0" "218" "0" "c.218del" "r.(?)" "p.(Asn73Ilefs*6)" "3"
"0000499679" "00018730" "99" "252" "0" "416" "0" "c.252_416del" "r.(?)" "p.(Asp84_Thr138)del" "3"
"0000499680" "00018730" "99" "275" "0" "275" "0" "c.275del" "r.(?)" "p.(Thr92Lysfs*56)" "3"
"0000499684" "00018730" "99" "329" "0" "341" "0" "c.329_341del" "r.(?)" "p.(Pro110Leufs*34)" "3"
"0000499690" "00018730" "99" "358" "0" "377" "0" "c.358_377dup" "r.(?)" "p.(Val127Glyfs*28)" "3"
"0000499697" "00018730" "99" "351" "0" "363" "0" "c.351_363del" "r.(?)" "p.(Thr118Serfs*26)" "3"
"0000499704" "00018730" "99" "459" "0" "459" "0" "c.459del" "r.(?)" "p.(Tyr154Thrfs*7)" "3"
"0000499739" "00018730" "99" "392" "0" "393" "0" "c.392_393del" "r.(?)" "p.(Ser131*)" "3"
"0000499742" "00018730" "99" "444" "0" "454" "0" "c.444_454del" "r.(?)" "p.(Asp148Glufs*105)" "3"
"0000499748" "00018730" "99" "508" "0" "508" "0" "c.508del" "r.(?)" "p.(Ser170Profs*41)" "3"
"0000499749" "00018730" "99" "574" "0" "586" "0" "c.574_586del" "r.(?)" "p.(Asn192Serfs*15)" "4"
"0000499750" "00018730" "99" "586" "0" "589" "0" "c.586_589del" "r.(?)" "p.(Ile196Serfs*14)" "4"
"0000499751" "00018730" "99" "652" "0" "653" "0" "c.652_653del" "r.(?)" "p.(Val218Hisfs*38)" "4"
"0000499752" "00018730" "99" "666" "0" "667" "0" "c.666_667del" "r.(?)" "p.(Gln223Aspfs*33)" "4"
"0000499753" "00018730" "99" "690" "0" "690" "0" "c.690delinsTCCCTTAT" "r.(?)" "p.(Ala231Profs*28)" "5"
"0000499801" "00018730" "99" "705" "0" "705" "0" "c.705del" "r.(?)" "p.(Phe236Leufs*2)" "5"
"0000499802" "00018730" "99" "727" "0" "727" "0" "c.727del" "r.(?)" "p.(Leu243Cysfs*9)" "5"
"0000499803" "00018730" "99" "804" "0" "804" "0" "c.804del" "r.(?)" "p.(Asn269Thrfs*10)" "5"
"0000499804" "00018730" "99" "791" "0" "814" "0" "c.791_814del" "r.(?)" "p.(Thr264_Asn271del)" "5"
"0000499806" "00018730" "99" "864" "0" "884" "0" "c.864_884delinsG" "r.(?)" "p.(Leu289Glufs*9)" "5"
"0000499807" "00018730" "99" "921" "0" "928" "0" "c.921_928del" "r.(?)" "p.(Lys307Asnfs*18)" "6"
"0000499808" "00018730" "99" "963" "0" "964" "0" "c.963_964delinsT" "r.(?)" "p.(Lys321Asnfs*4)" "6"
"0000499809" "00018730" "79" "936" "0" "936" "0" "c.936del" "r.(?)" "p.(His314Thrfs*7)" "6"
"0000499810" "00018730" "99" "964" "0" "964" "0" "c.964del" "r.(?)" "p.(Val322Cysfs*3)" "6"
"0000499811" "00018730" "99" "978" "0" "979" "0" "c.978_979dup" "r.(?)" "p.(Ser327Ilefs*15)" "6"
"0000499812" "00018730" "99" "1026" "0" "1026" "0" "c.1026dup" "r.(?)" "p.(Lys343Glnfs*26)" "6"
"0000499813" "00018730" "99" "1078" "0" "1084" "0" "c.1078_1084del" "r.(?)" "p.(Pro360Thrfs*2)" "7"
"0000499814" "00018730" "79" "1097" "0" "1097" "0" "c.1097del" "r.(?)" "p.(Arg366Leufs*31)" "7"
"0000499815" "00018730" "99" "1127" "0" "1127" "0" "c.1127dup" "r.(?)" "p.(Ser377Phefs*48)" "7"
"0000499817" "00018730" "99" "1147" "0" "1147" "0" "c.1147dup" "r.(?)" "p.(Met383Asnfs*42)" "7"
"0000499818" "00018730" "79" "1180" "0" "1180" "0" "c.1180del" "r.(?)" "p.(Thr394Leufs*3)" "7"
"0000499819" "00018730" "99" "1184" "0" "1184" "0" "c.1184del" "r.(?)" "p.(Leu395Profs*2)" "7"
"0000499820" "00018730" "99" "1184" "0" "1185" "0" "c.1184_1185insTA" "r.(?)" "p.(Leu396Thrfs*2)" "7"
"0000499821" "00018730" "99" "1189" "0" "1189" "0" "c.1189dup" "r.(?)" "p.(Thr397Asnfs*28)" "7"
"0000499822" "00018730" "99" "1212" "0" "1215" "0" "c.1212_1215del" "r.(?)" "p.(Thr405Alafs*25)" "7"
"0000499823" "00018730" "99" "1216" "0" "1216" "0" "c.1216del" "r.(?)" "p.(Ser406Alafs*25)" "7"
"0000499824" "00018730" "99" "1353" "0" "1354" "0" "c.1353_1354del" "r.(?)" "p.(Glu451Aspfs*21)" "8"
"0000499825" "00018730" "99" "1220" "0" "1220" "0" "c.1220del" "r.(?)" "p.(Gln407Argfs*24)" "7"
"0000499826" "00018730" "99" "1245" "0" "1245" "0" "c.1245del" "r.(?)" "p.(Lys415Asnfs*16)" "7"
"0000499827" "00018730" "99" "1342" "0" "1349" "0" "c.1342_1349dup" "r.(?)" "p.(Glu451Asnfs*2)" "8"
"0000499828" "00018730" "99" "1352" "0" "1352" "0" "c.1352dup" "r.(?)" "p.(Thr452Aspfs*21)" "8"
"0000499829" "00018730" "79" "1366" "0" "1369" "0" "c.1366_1369delinsA" "r.(?)" "p.(Ala456_Ala457delinsThr)" "8"
"0000499830" "00018730" "99" "1407" "0" "1427" "0" "c.1407_1427del" "r.(?)" "p.(Val470_Pro476del)" "8"
"0000499831" "00018730" "99" "1408" "0" "1408" "0" "c.1408dup" "r.(?)" "p.(Val470Glyfs*3)" "8"
"0000499832" "00018730" "99" "1410" "0" "1410" "0" "c.1410del" "r.(?)" "p.(Phe471Leufs*105)" "8"
"0000499833" "00018730" "99" "1420" "0" "1420" "0" "c.1420dup" "r.(?)" "p.(Gln474Profs*24)" "8"
"0000499860" "00018730" "99" "1432" "0" "1432" "0" "c.1432del" "r.(?)" "p.(Leu478Serfs*98)" "8"
"0000499861" "00018730" "99" "1466" "0" "1466" "0" "c.1466del" "r.(?)" "p.(Pro489Leufs*87)" "8"
"0000499862" "00018730" "99" "1466" "0" "1466" "0" "c.1466dup" "r.(?)" "p.(Val490Cysfs*8)" "8"
"0000499863" "00018730" "99" "1503" "0" "1509" "0" "c.1503_*6del" "r.(?)" "p.(*501Cysext*72)" "8"
"0000499864" "00018730" "99" "1488" "0" "1488" "0" "c.1488dup" "r.(?)" "p.(Asp497*)" "8"
"0000499865" "00018730" "99" "1501" "0" "1501" "0" "c.1501T>C" "r.(?)" "p.(*501Argext*46)" "8"
"0000499866" "00018730" "99" "1501" "0" "1501" "0" "c.1501T>A" "r.(?)" "p.(*501Argext*46)" "8"
"0000500555" "00018730" "99" "1249" "1" "1249" "1" "c.1249+1G>C" "r.1030_1249del" "p.(Met409Asnfs*14)" "7i"
"0000500558" "00018730" "99" "378" "0" "379" "0" "c.378_379ins(20)" "r.(?)" "p.0?" "3"
"0000500559" "00018730" "99" "690" "0" "696" "0" "c.690_696delinsTCCCTTAT" "r.(?)" "p.(Ala231Profs*3)" "5"
"0000500560" "00018730" "99" "347" "0" "347" "0" "c.347del" "r.(?)" "p.(Gln116Argfs*32)" "3"
"0000500561" "00018730" "99" "486" "0" "499" "0" "c.486_499del" "r.(?)" "p.(Lys162Asnfs*90)" "3"
"0000500563" "00018730" "79" "1198" "0" "1198" "0" "c.1198dup" "r.(?)" "p.(Arg400Profs*25)" "7"
"0000500564" "00018730" "99" "1183" "0" "1183" "0" "c.1183del" "r.(?)" "p.(Leu395Serfs*2)" "7"
"0000500565" "00018730" "99" "1172" "0" "1172" "0" "c.1172del" "r.(?)" "p.(Phe391Serfs*6)" "7"
"0000500594" "00018730" "79" "423" "0" "424" "0" "c.423_424dup" "r.(?)" "p.(Leu142Cysfs*7)" "3"
"0000500595" "00018730" "77" "615" "0" "615" "0" "c.615dup" "r.(?)" "p.(Val206Cysfs*51)" "4"
"0000500597" "00018730" "77" "166" "0" "166" "0" "c.166del" "r.(?)" "p.(Val56Leufs*23)" "3"
"0000500598" "00018730" "79" "400" "0" "400" "0" "c.400del" "r.(?)" "p.(Glu134Argfs*14)" "3"
"0000500599" "00018730" "99" "696" "0" "704" "0" "c.696_704delinsTTATGGCC" "r.(?)" "p.(Arg233Tyrfs*5)" "5"
"0000500600" "00018730" "99" "868" "0" "870" "0" "c.868_870del" "r.(?)" "p.(Leu290del)" "5"
"0000500601" "00018730" "79" "1458" "0" "1465" "0" "c.1458_1465delinsA" "r.(?)" "p.(His486Glnfs*88)" "8"
"0000500602" "00018730" "79" "1391" "0" "1392" "0" "c.1391_1392del" "r.(?)" "p.(Val464Glyfs*8)" "8"
"0000500603" "00018730" "99" "1357" "0" "1383" "0" "c.1357_1383dup" "r.(?)" "p.(Gly453_Ala461dup)" "8"
"0000500604" "00018730" "99" "1296" "0" "1304" "0" "c.1296_1304del" "r.(?)" "p.(Glu432_Pro434del)" "8"
"0000500605" "00018730" "77" "1169" "0" "1175" "0" "c.1169_1175del" "r.(?)" "p.(Lys390Serfs*5)" "7"
"0000500871" "00018730" "99" "600" "0" "600" "0" "c.600del" "r.(?)" "p.(Lys201Argfs*10)" "4"
"0000500889" "00018730" "99" "74" "0" "75" "0" "c.74_75del" "r.(?)" "p.(Asn25Serfs*32)" "3"
"0000501551" "00018730" "99" "120" "0" "120" "0" "c.120del" "r.(?)" "p.(Gly41Alafs*38)" "3"
"0000501552" "00018730" "99" "120" "0" "121" "0" "c.120_121del" "r.52_550del" "p.(Gly41Argfs*16)" "3"
"0000544627" "00018730" "30" "129" "0" "129" "0" "c.129G>A" "r.(?)" "p.(Gly43=)" "3"
"0000544628" "00018730" "10" "279" "0" "279" "0" "c.279dup" "r.(?)" "p.(Pro94AlafsTer39)" "3"
"0000544629" "00018730" "33" "279" "0" "279" "0" "c.279dup" "r.(?)" "p.(Pro94AlafsTer39)" "3"
"0000544630" "00018730" "30" "283" "0" "283" "0" "c.283A>C" "r.(?)" "p.(Thr95Pro)" "3"
"0000544631" "00018730" "30" "468" "0" "468" "0" "c.468C>T" "r.(?)" "p.(Ala156=)" "3"
"0000544632" "00018730" "30" "686" "-5" "686" "-5" "c.686-5C>G" "r.spl?" "p.?" "4i"
"0000544633" "00018730" "31" "751" "0" "751" "0" "c.751C>T" "r.(?)" "p.(Leu251=)" "5"
"0000592743" "00018730" "99" "124" "0" "124" "0" "c.124G>T" "r.(?)" "p.(Glu42*)" "3"
"0000592744" "00018730" "99" "164" "0" "164" "0" "c.164del" "r.(?)" "p.(Phe55Serfs*24)" "3"
"0000592745" "00018730" "99" "235" "0" "235" "0" "c.235del" "r.(?)" "p.(Thr79Glnfs*69)" "3"
"0000592746" "00018730" "99" "122" "0" "122" "0" "c.122del" "r.(?)" "p.(Gly41Alafs*38)" "3"
"0000592747" "00018730" "99" "265" "0" "265" "0" "c.265C>T" "r.(?)" "p.(Gln89*)" "3"
"0000592748" "00018730" "99" "449" "0" "449" "0" "c.449C>T" "r.(?)" "p.(Ser150Phe)" "3"
"0000592751" "00018730" "99" "466" "0" "466" "0" "c.466G>C" "r.(?)" "p.(Ala156Pro)" "3"
"0000592752" "00018730" "99" "467" "0" "467" "0" "c.467C>A" "r.(?)" "p.(Ala156Asp)" "3"
"0000592753" "00018730" "99" "535" "0" "535" "0" "c.535dup" "r.(?)" "p.(Thr179Asnfs*78)" "3"
"0000592756" "00018730" "99" "550" "0" "550" "0" "c.550G>C" "r.(52_550del)" "p.(Gly184Arg)" "3"
"0000592757" "00018730" "99" "566" "0" "566" "0" "c.566C>A" "r.(?)" "p.(Thr189Asn)" "4"
"0000592758" "00018730" "99" "568" "0" "568" "0" "c.568A>G" "r.(?)" "p.(Lys190Glu)" "4"
"0000592759" "00018730" "99" "600" "0" "600" "0" "c.600del" "r.(?)" "p.(Lys201Argfs*10)" "4"
"0000592761" "00018730" "99" "722" "0" "722" "0" "c.722G>C" "r.(?)" "p.(Arg241Pro)" "5"
"0000592762" "00018730" "99" "728" "0" "728" "0" "c.728T>C" "r.(?)" "p.(Leu243Pro)" "5"
"0000593670" "00018730" "99" "878" "0" "878" "0" "c.878T>C" "r.(?)" "p.(Ile293Thr)" "5"
"0000593672" "00018730" "99" "896" "0" "896" "0" "c.896G>A" "r.(?)" "p.(Trp299*)" "6"
"0000593673" "00018730" "99" "908" "0" "908" "0" "c.908T>C" "r.(?)" "p.(Phe303Ser)" "6"
"0000593674" "00018730" "99" "908" "0" "908" "0" "c.908T>G" "r.(?)" "p.(Phe303Cys)" "6"
"0000593675" "00018730" "99" "937" "0" "937" "0" "c.937T>C" "r.(?)" "p.(Phe313Leu)" "6"
"0000593676" "00018730" "99" "939" "0" "939" "0" "c.939T>G" "r.(?)" "p.(Phe313Leu)" "6"
"0000593677" "00018730" "99" "1012" "0" "1012" "0" "c.1012C>T" "r.(?)" "p.(Gln338*)" "6"
"0000593678" "00018730" "99" "1036" "0" "1036" "0" "c.1036C>T" "r.(?)" "p.(Gln346*)" "7"
"0000593682" "00018730" "99" "1114" "0" "1114" "0" "c.1114C>T" "r.(?)" "p.(Gln372*)" "7"
"0000593683" "00018730" "99" "1180" "0" "1180" "0" "c.1180A>C" "r.(?)" "p.(Thr394Pro)" "7"
"0000593684" "00018730" "99" "1187" "0" "1187" "0" "c.1187T>C" "r.(?)" "p.(Leu396Pro)" "7"
"0000593685" "00018730" "99" "1193" "0" "1193" "0" "c.1193T>C" "r.(?)" "p.(Leu398Pro)" "7"
"0000593686" "00018730" "99" "1195" "0" "1195" "0" "c.1195C>T" "r.(?)" "p.(Pro399Ser)" "7"
"0000593687" "00018730" "99" "1226" "0" "1226" "0" "c.1226T>C" "r.(?)" "p.(Met409Thr)" "7"
"0000593689" "00018730" "99" "1232" "0" "1232" "0" "c.1232C>G" "r.(?)" "p.(Ser411*)" "7"
"0000593690" "00018730" "99" "1340" "0" "1340" "0" "c.1340T>C" "r.(?)" "p.(Leu447Pro)" "8"
"0000593691" "00018730" "99" "1350" "0" "1350" "0" "c.1350dup" "r.(?)" "p.(Glu451Argfs*22)" "8"
"0000593692" "00018730" "99" "1356" "0" "1357" "0" "c.1356_1357del" "r.(?)" "p.(Val454Glyfs*18)" "8"
"0000593693" "00018730" "99" "1360" "0" "1360" "0" "c.1360dup" "r.(?)" "p.(Val454Glyfs*19)" "8"
"0000593694" "00018730" "99" "1373" "0" "1373" "0" "c.1373C>T" "r.(?)" "p.(Ala458Val)" "8"
"0000593695" "00018730" "99" "1396" "0" "1396" "0" "c.1396C>G" "r.(?)" "p.(Arg466Gly)" "8"
"0000593709" "00018730" "99" "1396" "0" "1396" "0" "c.1396C>T" "r.(?)" "p.(Arg466Cys)" "8"
"0000593710" "00018730" "99" "1397" "0" "1397" "0" "c.1397G>A" "r.(?)" "p.(Arg466His)" "8"
"0000593711" "00018730" "99" "1402" "0" "1402" "0" "c.1402del" "r.(?)" "p.(Leu468Cysfs*108)" "8"
"0000593712" "00018730" "99" "1427" "0" "1427" "0" "c.1427C>T" "r.(?)" "p.(Pro476Leu)" "8"
"0000593713" "00018730" "99" "1450" "0" "1450" "0" "c.1450C>T" "r.(?)" "p.(Gln484*)" "8"
"0000593714" "00018730" "99" "1466" "0" "1466" "0" "c.1466C>G" "r.(?)" "p.(Pro489Arg)" "8"
"0000593715" "00018730" "99" "1481" "0" "1481" "0" "c.1481G>A" "r.(?)" "p.(Arg494Gln)" "8"
"0000593716" "00018730" "99" "1481" "0" "1481" "0" "c.1481G>T" "r.(?)" "p.(Arg494Leu)" "8"
"0000593717" "00018730" "99" "1493" "0" "1493" "0" "c.1493C>A" "r.(?)" "p.(Pro498His)" "8"
"0000593719" "00018730" "99" "1493" "0" "1493" "0" "c.1493C>T" "r.(?)" "p.(Pro498Leu)" "8"
"0000593720" "00018730" "99" "1493" "0" "1493" "0" "c.1493C>G" "r.(?)" "p.(Pro498Arg)" "8"
"0000593744" "00018730" "99" "855" "0" "856" "0" "c.855_856del" "r.(?)" "p.(Arg286Profs*18)" "5"
"0000594724" "00018730" "99" "1265" "0" "1265" "0" "c.1265del" "r.(?)" "p.(Ser422Phefs*9)" "8"
"0000595702" "00018730" "99" "1604" "0" "1757" "0" "c.*101_*254del" "r.(=)" "p.(=)" "8_"
"0000595706" "00018730" "55" "2763" "0" "2763" "0" "c.*1260del" "r.(=)" "p.(=)" "8_"
"0000595734" "00018730" "30" "1588" "0" "1588" "0" "c.*85dup" "r.(=)" "p.(=)" "8_"
"0000595735" "00018730" "33" "-66" "0" "-65" "0" "c.-66_-65del" "r.(?)" "p.(=)" "1"
"0000595767" "00018730" "73" "-7913" "0" "-7913" "0" "c.-7913G>A" "r.(=)" "p.(=)" "_1"
"0000595793" "00018730" "99" "794" "0" "794" "0" "c.794G>A" "r.(?)" "p.(Trp265*)" "5"
"0000595854" "00018730" "33" "-58" "0" "-58" "0" "c.-58T>C" "r.(=)" "p.(=)" "1"
"0000595856" "00018730" "33" "-56" "0" "-56" "0" "c.-56T>G" "r.(=)" "p.(=)" "1"
"0000595878" "00018730" "30" "-24" "0" "-24" "0" "c.-24G>C" "r.(=)" "p.(=)" "1"
"0000595880" "00018730" "30" "42" "0" "42" "0" "c.42dup" "r.(?)" "p.(Leu15Alafs*5)" "2"
"0000595887" "00018730" "10" "51" "101" "51" "101" "c.51+101G>A" "r.(=)" "p.(=)" "2i"
"0000595888" "00018730" "31" "52" "-130" "52" "-130" "c.52-130C>T" "r.(=)" "p.(=)" "2i"
"0000595889" "00018730" "33" "117" "0" "117" "0" "c.117C>G" "r.(?)" "p.(Asp39Glu)" "3"
"0000595890" "00018730" "97" "129" "0" "129" "0" "c.129G>T" "r.(=)" "p.(Gly64=)" "3"
"0000596994" "00018730" "99" "32" "0" "32" "0" "c.32dup" "r.(?)" "p.(Leu12Alafs*8)" "2"
"0000596995" "00018730" "99" "33" "0" "33" "0" "c.33dup" "r.(?)" "p.(Leu12Alafs*8)" "2"
"0000596996" "00018730" "99" "36" "0" "36" "0" "c.36dup" "r.(?)" "p.(Leu13Alafs*7)" "2"
"0000596997" "00018730" "99" "49" "0" "49" "0" "c.49delinsTT" "r.(?)" "p.(Gly17Leufs*3)" "2"
"0000596999" "00018730" "79" "97" "0" "115" "0" "c.97_115del" "r.(?)" "p.(Asp33Thrfs*40)" "3"
"0000597002" "00018730" "99" "118" "0" "118" "0" "c.118dup" "r.(?)" "p.(Arg40Lysfs*18)" "3"
"0000597003" "00018730" "99" "138" "0" "207" "0" "c.138_207del" "r.(?)" "p.(Thr47Glnfs*9)" "3"
"0000597006" "00018730" "99" "157" "0" "157" "0" "c.157dup" "r.(?)" "p.(Met53Asnfs*5)" "3"
"0000597007" "00018730" "99" "160" "0" "160" "0" "c.160del" "r.(?)" "p.(Leu54Tyrfs*25)" "3"
"0000597008" "00018730" "99" "187" "0" "194" "0" "c.187_194del" "r.(?)" "p.(Ser63Alafs*16)" "3"
"0000597009" "00018730" "99" "187" "0" "187" "0" "c.187del" "r.(?)" "p.(Ser63Profs*16)" "3"
"0000597010" "00018730" "79" "206" "0" "206" "0" "c.206del" "r.(?)" "p.(Asn69Thrfs*10)" "3"
"0000597011" "00018730" "99" "249" "0" "249" "0" "c.249del" "r.(?)" "p.(Asp84Metfs*64)" "3"
"0000597012" "00018730" "99" "267" "0" "267" "0" "c.267del" "r.(?)" "p.(Gln89Hisfs*59)" "3"
"0000597013" "00018730" "99" "267" "0" "267" "0" "c.267dup" "r.(?)" "p.(Pro90Thrfs*43)" "3"
"0000597014" "00018730" "99" "291" "0" "291" "0" "c.291dup" "r.(?)" "p.(Pro98Thrfs*35)" "3"
"0000597019" "00018730" "79" "342" "0" "345" "0" "c.342_345del" "r.(?)" "p.(Thr115Serfs*32)" "3"
"0000597020" "00018730" "99" "360" "0" "379" "0" "c.360_379dup" "r.(?)" "p.(Val127Glyfs*28)" "3"
"0000597044" "00018730" "99" "360" "0" "360" "0" "c.360del" "r.(?)" "p.(Ser121Profs*27)" "3"
"0000597045" "00018730" "99" "387" "0" "388" "0" "c.387_388del" "r.(?)" "p.(Cys130Leufs*2)" "3"
"0000597046" "00018730" "99" "431" "0" "431" "0" "c.431del" "r.(?)" "p.(Asp144Valfs*4)" "3"
"0000597072" "00018730" "99" "533" "0" "534" "0" "c.533_534dup" "r.(?)" "p.(Thr179Leufs*33)" "3"
"0000597089" "00018730" "99" "553" "0" "553" "0" "c.553del" "r.(?)" "p.(Ala185Leufs*26)" "4"
"0000597090" "00018730" "99" "571" "0" "571" "0" "c.571del" "r.(?)" "p.(Thr191Glnfs*20)" "4"
"0000597091" "00018730" "99" "571" "0" "571" "0" "c.571dup" "r.(?)" "p.(Thr191Asnfs*66)" "4"
"0000597093" "00018730" "99" "600" "0" "600" "0" "c.600dup" "r.(?)" "p.(Lys201Glnfs*56)" "4"
"0000597094" "00018730" "99" "575" "0" "586" "0" "c.575_586del" "r.(?)" "p.(Asn192_Ser195del)" "4"
"0000597099" "00018730" "33" "5" "0" "5" "0" "c.5C>T" "r.(?)" "p.(Ala2Val)" "2;7"
"0000597100" "00018730" "99" "530" "0" "530" "0" "c.530T>C" "r.(?)" "p.(Leu177Pro)" "3"
"0000597101" "00018730" "99" "587" "0" "596" "0" "c.587_596del" "r.(?)" "p.(Ile196Thrfs*12)" "4"
"0000597102" "00018730" "99" "592" "0" "619" "0" "c.592_619del" "r.(?)" "p.(Ser198Thrfs*4)" "4"
"0000597103" "00018730" "99" "605" "0" "620" "0" "c.605_620del" "r.(?)" "p.(Asp202Alafs*4)" "4"
"0000597104" "00018730" "99" "780" "0" "804" "0" "c.780_804del" "r.(?)" "p.(Leu261Thrfs*10)" "5"
"0000597105" "00018730" "99" "822" "0" "837" "0" "c.822_837del" "r.(?)" "p.(Ser275Valfs*16)" "5"
"0000597106" "00018730" "99" "835" "0" "840" "0" "c.835_840del" "r.(?)" "p.(Asp279_Ser280del)" "5"
"0000597107" "00018730" "99" "593" "0" "594" "0" "c.593_594del" "r.(?)" "p.(Ser198Leufs*58)" "4"
"0000597108" "00018730" "99" "595" "0" "595" "0" "c.595del" "r.(?)" "p.(Tyr199Thrfs*12)" "4"
"0000597109" "00018730" "99" "600" "0" "600" "0" "c.600dup" "r.(?)" "p.(Lys201Glnfs*56)" "4"
"0000597110" "00018730" "99" "622" "0" "622" "0" "c.622del" "r.(?)" "p.(Gln208Argfs*3)" "4"
"0000597111" "00018730" "99" "628" "0" "628" "0" "c.628del" "r.(?)" "p.(Leu210*)" "4"
"0000597112" "00018730" "99" "629" "0" "645" "0" "c.629_645del" "r.(?)" "p.(Leu210Glnfs*41)" "4"
"0000597113" "00018730" "99" "660" "0" "660" "0" "c.660dup" "r.(?)" "p.(Val221Serfs*36)" "4"
"0000597114" "00018730" "99" "668" "0" "668" "0" "c.668del" "r.(?)" "p.(Gln223Argfs*10)" "4"
"0000597115" "00018730" "99" "669" "0" "670" "0" "c.669_670del" "r.(?)" "p.(Gln223Hisfs*33)" "4"
"0000597116" "00018730" "99" "674" "0" "675" "0" "c.674_675delinsAA" "r.674_675delinsaa" "p.(Phe225*)" "4"
"0000597117" "00018730" "99" "671" "0" "671" "0" "c.671T>G" "r.(?)" "p.(Ile224Ser)" "4"
"0000597118" "00018730" "99" "674" "0" "674" "0" "c.674T>C" "r.(?)" "p.(Phe225Ser)" "4"
"0000597119" "00018730" "99" "685" "0" "685" "0" "c.685G>T" "r.(?)" "p.(Asp229Tyr)" "4"
"0000597127" "00018730" "99" "694" "0" "694" "0" "c.694del" "r.(?)" "p.(Ile232*)" "5"
"0000597128" "00018730" "99" "703" "0" "705" "0" "c.703_705del" "r.(?)" "p.(Thr235del)" "5"
"0000597129" "00018730" "79" "727" "0" "728" "0" "c.727_728del" "r.(?)" "p.(Leu243Valfs*13)" "5"
"0000597130" "00018730" "99" "731" "0" "732" "0" "c.731_732delinsT" "r.(?)" "p.(Tyr244Leufs*8)" "5"
"0000597131" "00018730" "99" "744" "0" "744" "0" "c.744del" "r.(?)" "p.(Arg249Glufs*3)" "5"
"0000597132" "00018730" "99" "751" "0" "751" "0" "c.751del" "r.(?)" "p.(Leu251*)" "5"
"0000597138" "00018730" "99" "762" "0" "763" "0" "c.762_763del" "r.(?)" "p.(Asn254Lysfs*2)" "5"
"0000597139" "00018730" "99" "766" "0" "766" "0" "c.766del" "r.(?)" "p.(Asp256Thrfs*23)" "5"
"0000597140" "00018730" "99" "776" "0" "782" "0" "c.776_782del" "r.(?)" "p.(Leu259Serfs*18)" "5"
"0000597141" "00018730" "99" "785" "0" "787" "0" "c.785_787del" "r.(?)" "p.(Ile262del)" "5"
"0000597149" "00018730" "99" "818" "0" "820" "0" "c.818_820del" "r.(?)" "p.(Lys273del)" "5"
"0000597151" "00018730" "99" "813" "0" "818" "0" "c.813_818del" "r.(?)" "p.(Asn271_Asn272del)" "5"
"0000597152" "00018730" "99" "810" "0" "810" "0" "c.810dup" "r.(?)" "p.(Asn271Glnfs*34)" "5"
"0000597156" "00018730" "99" "805" "0" "809" "0" "c.805_809dup" "r.(?)" "p.(Asn271Thrfs*10)" "5"
"0000597157" "00018730" "99" "818" "0" "820" "0" "c.818_820del" "r.(?)" "p.(Lys273del)" "5"
"0000597158" "00018730" "99" "838" "0" "846" "0" "c.838_846del" "r.(?)" "p.(Leu281_Ser283del)" "5"
"0000597159" "00018730" "99" "856" "0" "856" "0" "c.856del" "r.(?)" "p.(Arg286Alafs*10)" "5"
"0000597190" "00018730" "99" "863" "0" "864" "0" "c.863_864delinsAA" "r.(?)" "p.(Val288Glu)" "5"
"0000597201" "00018730" "99" "868" "0" "870" "0" "c.868_870dup" "r.(?)" "p.(Leu290dup)" "5"
"0000597202" "00018730" "99" "869" "0" "869" "0" "c.869dup" "r.(?)" "p.(Asn291Glnfs*14)" "5"
"0000597213" "00018730" "99" "950" "0" "950" "0" "c.950dup" "r.(?)" "p.(Asn317Lysfs*11)" "6"
"0000597215" "00018730" "99" "936" "0" "936" "0" "c.936dup" "r.(?)" "p.(Phe313Leufs*15)" "6"
"0000597251" "00018730" "99" "-23" "184" "-22" "-152" "c.-23+184_-22-152del" "r.(=)" "p.(=)" "1i"
"0000597252" "00018730" "99" "904" "0" "904" "0" "c.904del" "r.(?)" "p.(Thr302Hisfs*19)" "6"
"0000597253" "00018730" "99" "904" "0" "906" "0" "c.904_906del" "r.(?)" "p.(Thr302del)" "6"
"0000597254" "00018730" "99" "945" "0" "945" "0" "c.945del" "r.(?)" "p.(Phe315Leufs*6)" "6"
"0000597255" "00018730" "99" "946" "0" "951" "0" "c.946_951del" "r.(?)" "p.(Lys316_Asn317del)" "6"
"0000597256" "00018730" "99" "981" "0" "982" "0" "c.981_982del" "r.(?)" "p.(Ser327Argfs*10)" "6"
"0000597257" "00018730" "99" "989" "0" "1001" "0" "c.989_1001del" "r.(?)" "p.(Tyr330Phefs*7)" "6"
"0000597258" "00018730" "99" "1038" "0" "1052" "0" "c.1038_1052del" "r.(?)" "p.(Gln346_Ser350del)" "7"
"0000597270" "00018730" "99" "1093" "0" "1093" "0" "c.1093del" "r.(?)" "p.(His365Ilefs*32)" "7"
"0000597271" "00018730" "99" "1111" "0" "1111" "0" "c.1111del" "r.(?)" "p.(Glu371Asnfs*26)" "7"
"0000597273" "00018730" "99" "1122" "0" "1122" "0" "c.1122del" "r.(?)" "p.(Ser375Alafs*22)" "7"
"0000597274" "00018730" "99" "1129" "0" "1130" "0" "c.1129_1130insA" "r.(?)" "p.(Ser377Tyrfs*48)" "7"
"0000597275" "00018730" "99" "1143" "0" "1143" "0" "c.1143del" "r.(?)" "p.(Ile382Serfs*15)" "7"
"0000597313" "00018730" "99" "1155" "0" "1155" "0" "c.1155del" "r.(?)" "p.(Lys385Asnfs*12)" "7"
"0000597338" "00018730" "99" "1200" "0" "1201" "0" "c.1200_1201insCC" "r.(?)" "p.(Ile401Profs*4)" "7"
"0000597341" "00018730" "99" "1203" "0" "1203" "0" "c.1203dup" "r.(?)" "p.(Lys402Glnfs*23)" "7"
"0000597345" "00018730" "99" "1227" "0" "1227" "0" "c.1227del" "r.(?)" "p.(Met409Ilefs*22)" "7"
"0000597366" "00018730" "99" "1264" "0" "1264" "0" "c.1264dup" "r.(?)" "p.(Ser422Phefs*3)" "8"
"0000597367" "00018730" "99" "1264" "0" "1264" "0" "c.1264del" "r.(?)" "p.(Ser422Leufs*9)" "8"
"0000597368" "00018730" "99" "1268" "0" "1268" "0" "c.1268dup" "r.(?)" "p.(Tyr423*)" "8"
"0000597369" "00018730" "99" "1279" "0" "1279" "0" "c.1279del" "r.(?)" "p.(Leu427Cysfs*4)" "8"
"0000597370" "00018730" "99" "1281" "0" "1281" "0" "c.1281del" "r.(?)" "p.(Cys428Valfs*3)" "8"
"0000597371" "00018730" "99" "1284" "0" "1285" "0" "c.1284_1285del" "r.(?)" "p.(Cys428Trpfs*44)" "8"
"0000597372" "00018730" "99" "1296" "0" "1304" "0" "c.1296_1304del" "r.(?)" "p.(Glu432_Pro434del)" "8"
"0000597373" "00018730" "99" "1297" "0" "1297" "0" "c.1297del" "r.(?)" "p.(Asp433Thrfs*17)" "8"
"0000597374" "00018730" "99" "1305" "0" "1305" "0" "c.1305del" "r.(?)" "p.(Leu436Phefs*14)" "8"
"0000597437" "00018730" "99" "1310" "0" "1315" "0" "c.1310_1315delinsTG" "r.(?)" "p.(Gln437Leufs*12)" "8"
"0000597438" "00018730" "99" "1315" "0" "1315" "0" "c.1315del" "r.(?)" "p.(Ser439Leufs*11)" "8"
"0000597439" "00018730" "99" "1316" "0" "1316" "0" "c.1316del" "r.(?)" "p.(Ser439Leufs*11)" "8"
"0000597440" "00018730" "99" "1335" "0" "1335" "0" "c.1335dup" "r.(?)" "p.(Val446Serfs*27)" "8"
"0000597441" "00018730" "99" "1336" "0" "1336" "0" "c.1336del" "r.(?)" "p.(Val446Cysfs*4)" "8"
"0000597505" "00018730" "99" "1342" "0" "1350" "0" "c.1342_1350dup" "r.(?)" "p.(Glu448_Thr450dup)" "8"
"0000597506" "00018730" "99" "1343" "0" "1345" "0" "c.1343_1345delinsT" "r.(?)" "p.(Glu448Valfs*24)" "8"
"0000597510" "00018730" "99" "1350" "0" "1350" "0" "c.1350del" "r.(?)" "p.(Glu451Argfs*125)" "8"
"0000597513" "00018730" "99" "1357" "0" "1382" "0" "c.1357_1382dup" "r.(?)" "p.(Ile462Glyfs*123)" "8"
"0000597526" "00018730" "99" "1360" "0" "1393" "0" "c.1360_1393del" "r.(?)" "p.(Val454Profs*111)" "8"
"0000597530" "00018730" "99" "1379" "0" "1398" "0" "c.1379_1398dup" "r.(?)" "p.(Thr467Profs*116)" "8"
"0000597531" "00018730" "99" "1383" "0" "1383" "0" "c.1383dup" "r.(?)" "p.(Ile462Hisfs*11)" "8"
"0000597532" "00018730" "79" "1391" "0" "1445" "0" "c.1391_1445del" "r.(?)" "p.(Val464Glyfs*94)" "8"
"0000597538" "00018730" "99" "1479" "0" "1479" "0" "c.1479del" "r.(?)" "p.(Arg494Glufs*82)" "8"
"0000597539" "00018730" "79" "1483" "0" "1487" "0" "c.1483_1487del" "r.(?)" "p.(Val495*)" "8"
"0000597540" "00018730" "99" "1446" "0" "1446" "0" "c.1446G>A" "r.(?)" "p.(Trp482*)" "8"
"0000597541" "00018730" "99" "1442" "0" "1442" "0" "c.1442T>G" "r.(?)" "p.(Leu481Arg)" "8"
"0000597542" "00018730" "77" "1439" "0" "1439" "0" "c.1439T>G" "r.(?)" "p.(Val480Gly)" "8"
"0000597543" "00018730" "77" "239" "0" "239" "0" "c.239C>G" "r.(?)" "p.(Ala80Gly)" "3"
"0000597544" "00018730" "99" "506" "0" "506" "0" "c.506T>C" "r.(?)" "p.(Phe169Ser)" "3"
"0000597545" "00018730" "33" "-21" "0" "-21" "0" "c.-21T>C" "r.(?)" "p.(=)" "2"
"0000597546" "00018730" "99" "1" "0" "1" "0" "c.1A>T" "r.(?)" "p.(Met1Leu)" "2"
"0000597550" "00018730" "99" "1" "0" "1" "0" "c.1A>C" "r.(?)" "p.(Met1Leu)" "2"
"0000597551" "00018730" "99" "2" "0" "2" "0" "c.2T>A" "r.(?)" "p.(Met1Lys)" "2"
"0000597552" "00018730" "99" "2" "0" "2" "0" "c.2T>C" "r.(?)" "p.(Met1Thr)" "2"
"0000597553" "00018730" "77" "2" "0" "2" "0" "c.2T>G" "r.(?)" "p.(Met1Arg)" "2"
"0000597554" "00018730" "99" "3" "0" "3" "0" "c.3G>A" "r.(?)" "p.(Met1?)" "2"
"0000597555" "00018730" "99" "35" "0" "35" "0" "c.35T>G" "r.(?)" "p.(Leu12Arg)" "2"
"0000597556" "00018730" "99" "55" "0" "55" "0" "c.55A>T" "r.(?)" "p.(Arg19*)" "3"
"0000597557" "00018730" "55" "352" "0" "352" "0" "c.352A>G" "r.(?)" "p.(Thr118Ala)" "3"
"0000597558" "00018730" "99" "130" "0" "130" "0" "c.130A>T" "r.(?)" "p.(Lys44*)" "3"
"0000597559" "00018730" "79" "152" "0" "152" "0" "c.152C>T" "r.(?)" "p.(Ser51Phe)" "3"
"0000597560" "00018730" "50" "135" "0" "135" "0" "c.135C>T" "r.(=)" "p.(=)" "3"
"0000597561" "00018730" "99" "161" "0" "161" "0" "c.161T>A" "r.(?)" "p.(Leu54Gln)" "3"
"0000597562" "00018730" "99" "209" "0" "209" "0" "c.209C>G" "r.(?)" "p.(Ser70*)" "3"
"0000597563" "00018730" "55" "227" "0" "227" "0" "c.227C>T" "r.(?)" "p.(Thr76Ile)" "3"
"0000597564" "00018730" "99" "253" "0" "253" "0" "c.253G>T" "r.(?)" "p.(Glu85*)" "3;7"
"0000597565" "00018730" "33" "1097" "0" "1097" "0" "c.1097G>A" "r.(?)" "p.(Arg366His)" "7"
"0000597566" "00018730" "99" "289" "0" "289" "0" "c.289C>T" "r.(?)" "p.(Gln97*)" "3"
"0000597567" "00018730" "99" "301" "0" "301" "0" "c.301C>T" "r.(?)" "p.(Gln101*)" "3"
"0000597568" "00018730" "99" "310" "0" "310" "0" "c.310C>T" "r.(?)" "p.(Gln104*)" "3"
"0000597569" "00018730" "79" "322" "0" "322" "0" "c.322C>T" "r.(?)" "p.(Gln108*)" "3"
"0000597570" "00018730" "99" "346" "0" "346" "0" "c.346C>T" "r.(?)" "p.(Gln116*)" "3"
"0000597571" "00018730" "99" "389" "0" "389" "0" "c.389G>A" "r.(?)" "p.(Cys130Tyr)" "3"
"0000597575" "00018730" "99" "400" "0" "400" "0" "c.400G>T" "r.(?)" "p.(Glu134*)" "3"
"0000597576" "00018730" "99" "425" "0" "425" "0" "c.425T>C" "r.(?)" "p.(Leu142Ser)" "3"
"0000597577" "00018730" "99" "434" "0" "434" "0" "c.434C>A" "r.(?)" "p.(Ala145Asp)" "3"
"0000597578" "00018730" "77" "437" "0" "437" "0" "c.437T>C" "r.(?)" "p.(Leu146Ser)" "3"
"0000597579" "00018730" "77" "445" "0" "445" "0" "c.445T>G" "r.(?)" "p.(Phe149Val)" "3"
"0000597580" "00018730" "79" "448" "0" "448" "0" "c.448T>C" "r.(?)" "p.(Ser150Pro)" "3"
"0000597581" "00018730" "99" "452" "0" "452" "0" "c.452T>C" "r.(?)" "p.(Leu151Pro)" "3"
"0000597582" "00018730" "99" "461" "0" "461" "0" "c.461A>C" "r.(?)" "p.(Tyr154Ser)" "3"
"0000597583" "00018730" "79" "461" "0" "461" "0" "c.461A>G" "r.(?)" "p.(Tyr154Cys)" "3"
"0000597584" "00018730" "99" "464" "0" "464" "0" "c.464A>G" "r.(?)" "p.(His155Arg)" "3"
"0000597641" "00018730" "99" "473" "0" "473" "0" "c.473C>G" "r.(?)" "p.(Ser158*)" "3"
"0000597652" "00018730" "99" "481" "0" "481" "0" "c.481A>T" "r.(?)" "p.(Lys161*)" "3"
"0000597653" "00018730" "99" "490" "0" "490" "0" "c.490G>T" "r.(?)" "p.(Glu164*)" "3"
"0000597654" "00018730" "99" "498" "0" "498" "0" "c.498C>A" "r.(?)" "p.(Asn166Lys)" "3"
"0000597655" "00018730" "77" "500" "0" "500" "0" "c.500T>A" "r.(?)" "p.(Met167Lys)" "3"
"0000597657" "00018730" "57" "502" "0" "502" "0" "c.502G>C" "r.(?)" "p.(Ala168Pro)" "3"
"0000597658" "00018730" "99" "503" "0" "503" "0" "c.503C>A" "r.(?)" "p.(Ala168Asp)" "3"
"0000597659" "00018730" "77" "508" "0" "508" "0" "c.508T>A" "r.(?)" "p.(Ser170Thr)" "3"
"0000597660" "00018730" "99" "508" "0" "508" "0" "c.508T>C" "r.(?)" "p.(Ser170Pro)" "3"
"0000597661" "00018730" "99" "512" "0" "512" "0" "c.512C>A" "r.(?)" "p.(Pro171Gln)" "3"
"0000597662" "00018730" "99" "533" "0" "533" "0" "c.533T>C" "r.(?)" "p.(Leu178Pro)" "3"
"0000597663" "00018730" "99" "536" "0" "536" "0" "c.536C>T" "r.(?)" "p.(Thr179Ile)" "3"
"0000597664" "00018730" "99" "548" "0" "548" "0" "c.548T>C" "r.548u>c" "p.(Leu183Pro)" "3"
"0000597666" "00018730" "99" "551" "0" "551" "0" "c.551G>A" "r.(?)" "p.(Gly184Glu)" "4"
"0000597668" "00018730" "99" "553" "0" "553" "0" "c.553G>C" "r.(?)" "p.(Ala185Pro)" "4"
"0000597671" "00018730" "99" "568" "0" "568" "0" "c.568A>T" "r.(?)" "p.(Lys190*)" "4"
"0000597672" "00018730" "79" "571" "0" "571" "0" "c.571A>C" "r.(?)" "p.(Thr191Pro)" "4"
"0000597673" "00018730" "99" "578" "0" "578" "0" "c.578T>C" "r.(?)" "p.(Leu193Pro)" "4"
"0000597674" "00018730" "99" "595" "0" "595" "0" "c.595T>A" "r.(?)" "p.(Tyr199Asn)" "4"
"0000597693" "00018730" "99" "0" "0" "0" "0" "c.[597C=/>G]" "r.(?)" "p.(Tyr199*)" "4"
"0000597694" "00018730" "79" "601" "0" "601" "0" "c.601A>T" "r.(?)" "p.(Lys201*)" "4"
"0000597696" "00018730" "99" "614" "0" "614" "0" "c.614G>A" "r.(?)" "p.(Cys205Tyr)" "4"
"0000597697" "00018730" "99" "614" "0" "614" "0" "c.614G>C" "r.(?)" "p.(Cys205Ser)" "4"
"0000597698" "00018730" "50" "619" "0" "619" "0" "c.619C>T" "r.(?)" "p.(His207Tyr)" "4"
"0000597700" "00018730" "99" "623" "0" "623" "0" "c.623A>T" "r.(?)" "p.(Gln208Leu)" "4"
"0000597701" "00018730" "99" "629" "0" "629" "0" "c.629T>C" "r.629u>c" "p.(Leu210Pro)" "4"
"0000597702" "00018730" "99" "653" "0" "653" "0" "c.653T>A" "r.(?)" "p.(Val218Asp)" "4"
"0000597703" "00018730" "99" "667" "0" "667" "0" "c.667C>T" "r.(?)" "p.(Gln223*)" "4"
"0000597704" "00018730" "99" "671" "0" "671" "0" "c.671T>A" "r.(?)" "p.(Ile224Asn)" "4"
"0000597705" "00018730" "11" "1030" "-865" "1030" "-865" "c.1030-865C>T" "r.(=)" "p.(=)" "6i"
"0000597706" "00018730" "79" "695" "0" "695" "0" "c.695T>A" "r.(?)" "p.(Ile232Lys)" "5"
"0000597707" "00018730" "99" "695" "0" "695" "0" "c.695T>G" "r.(?)" "p.(Ile232Arg)" "5"
"0000597717" "00018730" "99" "707" "0" "707" "0" "c.707T>C" "r.(?)" "p.(Phe236Ser)" "5"
"0000597718" "00018730" "99" "730" "0" "730" "0" "c.730T>G" "r.(?)" "p.(Tyr244Asp)" "5"
"0000597719" "00018730" "99" "738" "0" "738" "0" "c.738C>A" "r.(?)" "p.(Ser246Arg)" "5"
"0000597720" "00018730" "99" "743" "0" "743" "0" "c.743C>G" "r.(?)" "p.(Pro248Arg)" "5"
"0000597721" "00018730" "93" "764" "0" "764" "0" "c.764G>C" "r.(?)" "p.(Ser255Thr)" "5"
"0000597722" "00018730" "99" "752" "0" "752" "0" "c.752T>G" "r.(?)" "p.(Leu251Arg)" "5"
"0000597724" "00018730" "99" "773" "0" "773" "0" "c.773A>T" "r.(?)" "p.(Asn258Ile)" "5"
"0000597725" "00018730" "99" "778" "0" "778" "0" "c.778G>T" "r.(?)" "p.(Glu260*)" "5"
"0000597800" "00018730" "99" "793" "0" "793" "0" "c.793T>C" "r.(?)" "p.(Trp265Arg)" "5"
"0000597802" "00018730" "33" "800" "0" "800" "0" "c.800C>T" "r.(?)" "p.(Ala267Val)" "5"
"0000597803" "00018730" "99" "203" "0" "203" "0" "c.203C>T" "r.(?)" "p.(Thr68Ile)" "3"
"0000597804" "00018730" "99" "203" "0" "203" "0" "c.203C>T" "r.(?)" "p.(Thr68Ile)" "3"
"0000597807" "00018730" "97" "856" "0" "856" "0" "c.856C>T" "r.(?)" "p.(Arg286Cys)" "5;5"
"0000597808" "00018730" "90" "856" "0" "856" "0" "c.[856C>T(;)1361T>A]" "r.(?)" "p.[(Arg286Cys)(;)(Val454Glu)]" "5;8"
"0000597809" "00018730" "99" "860" "0" "860" "0" "c.860T>C" "r.(?)" "p.(Leu287Pro)" "5"
"0000597810" "00018730" "99" "871" "0" "871" "0" "c.871A>T" "r.(?)" "p.(Asn291Tyr)" "5"
"0000597811" "00018730" "97" "880" "0" "880" "0" "c.880T>A" "r.(?)" "p.(Tyr294Asn)" "5"
"0000597817" "00018730" "79" "882" "0" "882" "0" "c.882C>A" "r.(?)" "p.(Tyr294*)" "5"
"0000597818" "00018730" "99" "882" "0" "882" "0" "c.882C>G" "r.686_889del" "p.(Tyr294*) / p.(Asp229_Ser296del)" "5"
"0000597819" "00018730" "99" "884" "0" "884" "0" "c.884T>G" "r.[686_889del;884u>g]" "p.[(Asp229_Ser296del);(Leu295Arg)]" "5"
"0000597820" "00018730" "99" "889" "0" "889" "0" "c.889G>A" "r.(?)" "p.(Ala297Thr)" "5"
"0000597821" "00018730" "99" "892" "0" "892" "0" "c.892A>T" "r.(?)" "p.(Lys298*)" "6"
"0000597822" "00018730" "77" "902" "0" "902" "0" "c.902C>A" "r.(?)" "p.(Thr301Lys)" "6"
"0000597823" "00018730" "99" "902" "0" "902" "0" "c.902C>T" "r.(?)" "p.(Thr301Ile)" "6"
"0000597824" "00018730" "77" "911" "0" "911" "0" "c.911A>G" "r.(?)" "p.(Asp304Gly)" "6"
"0000597825" "00018730" "77" "922" "0" "922" "0" "c.922A>G" "r.(?)" "p.(Thr308Ala)" "6"
"0000597826" "00018730" "77" "932" "0" "932" "0" "c.932A>C" "r.(?)" "p.(Glu311Ala)" "6"
"0000597827" "00018730" "99" "953" "0" "953" "0" "c.953C>G" "r.(?)" "p.(Ser318*)" "6"
"0000597830" "00018730" "99" "971" "0" "971" "0" "c.971T>G" "r.(?)" "p.(Met324Arg)" "6"
"0000597831" "00018730" "99" "974" "0" "974" "0" "c.974T>C" "r.(?)" "p.(Met325Thr)" "6"
"0000597832" "00018730" "99" "988" "0" "988" "0" "c.988T>A" "r.(?)" "p.(Tyr330Asn)" "6"
"0000597840" "00018730" "99" "889" "1" "889" "1" "c.889+1G>A" "r.(686_889del)" "p.?" "5i"
"0000597841" "00018730" "99" "998" "0" "998" "0" "c.998C>G" "r.(?)" "p.(Ala333Gly)" "6"
"0000597842" "00018730" "97" "998" "0" "998" "0" "c.998C>A" "r.(?)" "p.(Ala333Asp)" "6"
"0000597843" "00018730" "99" "1004" "0" "1004" "0" "c.1004T>C" "r.(?)" "p.(Phe335Ser)" "6"
"0000597844" "00018730" "99" "1010" "0" "1010" "0" "c.1010A>G" "r.(?)" "p.(Asp337Gly)" "6"
"0000597845" "00018730" "77" "1024" "0" "1024" "0" "c.1024G>C" "r.(?)" "p.(Ala342Pro)" "6"
"0000597849" "00018730" "99" "1033" "0" "1033" "0" "c.1033G>C" "r.(?)" "p.(Gly345Arg)" "7"
"0000597853" "00018730" "99" "1042" "0" "1042" "0" "c.1042C>T" "r.(?)" "p.(Gln348*)" "7"
"0000597854" "00018730" "99" "1048" "0" "1048" "0" "c.1048T>C" "r.(?)" "p.(Ser350Pro)" "7"
"0000597855" "00018730" "99" "1055" "0" "1055" "0" "c.1055A>T" "r.(?)" "p.(Asn352Ile)" "7"
"0000597856" "00018730" "99" "1058" "0" "1058" "0" "c.1058T>C" "r.(?)" "p.(Leu353Pro)" "7"
"0000597857" "00018730" "99" "1070" "0" "1070" "0" "c.1070T>A" "r.(?)" "p.(Ile357Asn)" "7"
"0000597858" "00018730" "99" "1102" "0" "1102" "0" "c.1102G>T" "r.(?)" "p.(Glu368*)" "7"
"0000597859" "00018730" "99" "1109" "0" "1109" "0" "c.1109T>G" "r.(?)" "p.(Met370Arg)" "7"
"0000597860" "00018730" "99" "1079" "0" "1079" "0" "c.1079C>T" "r.(?)" "p.(Pro360Leu)" "7"
"0000597861" "00018730" "57" "1121" "0" "1121" "0" "c.1121T>C" "r.(?)" "p.(Leu374Pro)" "7"
"0000597862" "00018730" "99" "1129" "0" "1129" "0" "c.1129T>C" "r.(?)" "p.(Ser377Pro)" "7"
"0000597863" "00018730" "99" "1391" "0" "1392" "0" "c.1391_1392del" "r.(?)" "p.(Val464Glyfs*8)" "8"
"0000597864" "00018730" "99" "435" "0" "476" "0" "c.435_476del" "r.(?)" "p.(Leu146_Ala159)del" "3"
"0000597866" "00018730" "99" "1223" "0" "1223" "0" "c.1223A>T" "r.(?)" "p.(Asp408Val)" "7"
"0000597868" "00018730" "99" "1418" "0" "1418" "0" "c.1418T>A" "r.(?)" "p.(Val473Glu)" "8"
"0000597871" "00018730" "99" "1269" "0" "1269" "0" "c.1269T>G" "r.(?)" "p.(Tyr423*)" "8"
"0000597900" "00018730" "99" "1136" "0" "1136" "0" "c.1136T>C" "r.(?)" "p.(Phe379Ser)" "7"
"0000598041" "00018730" "99" "1142" "0" "1142" "0" "c.1142C>T" "r.(?)" "p.(Ala381Val)" "7"
"0000598042" "00018730" "99" "1165" "0" "1165" "0" "c.1165T>C" "r.(?)" "p.(Ser389Pro)" "7"
"0000598043" "00018730" "99" "1174" "0" "1174" "0" "c.1174C>T" "r.(?)" "p.(Gln392*)" "7"
"0000598044" "00018730" "99" "1193" "0" "1193" "0" "c.1193T>A" "r.(?)" "p.(Leu398Gln)" "7"
"0000598045" "00018730" "99" "1196" "0" "1196" "0" "c.1196C>T" "r.(?)" "p.(Pro399Leu)" "7"
"0000598264" "00018730" "99" "1196" "0" "1196" "0" "c.1196C>G" "r.(?)" "p.(Pro399Arg)" "7"
"0000598265" "00018730" "99" "1205" "0" "1205" "0" "c.1205A>T" "r.(?)" "p.(Lys402Ile)" "7"
"0000598269" "00018730" "99" "1223" "0" "1223" "0" "c.1223A>G" "r.(?)" "p.(Asp408Gly)" "7"
"0000598270" "00018730" "99" "1229" "0" "1229" "0" "c.1229T>C" "r.(?)" "p.(Leu410Pro)" "7"
"0000598271" "00018730" "99" "1232" "0" "1232" "0" "c.1232C>A" "r.(?)" "p.(Ser411*)" "7"
"0000598272" "00018730" "99" "1247" "0" "1247" "0" "c.1247T>A" "r.(?)" "p.(Leu416*)" "7"
"0000598273" "00018730" "50" "1257" "0" "1257" "0" "c.1257C>A" "r.(?)" "p.(Phe419Leu)" "8"
"0000598274" "00018730" "73" "1265" "0" "1265" "0" "c.1265C>T" "r.(?)" "p.(Ser422Phe)" "8"
"0000598275" "00018730" "99" "1277" "0" "1277" "0" "c.1277A>T" "r.(?)" "p.(Asn426Ile)" "8"
"0000598276" "00018730" "90" "1282" "0" "1282" "0" "c.[1282T>C;1342G>C]" "r.(?)" "p.[(Cys428Arg);(Glu448Gln)]" "8;8"
"0000598284" "00018730" "99" "1283" "0" "1283" "0" "c.1283G>A" "r.(?)" "p.(Cys428Tyr)" "8"
"0000598289" "00018730" "79" "1285" "0" "1285" "0" "c.1285G>A" "r.(?)" "p.(Gly429Arg)" "8"
"0000598291" "00018730" "99" "1289" "0" "1289" "0" "c.1289T>C" "r.(?)" "p.(Leu430Pro)" "8"
"0000598292" "00018730" "93" "1379" "0" "1379" "0" "c.[1379C>T];[1379C>T]" "r.(?)" "p.[(Ser460Phe)];[(Ser460Phe)]" "8;8"
"0000598293" "00018730" "99" "1379" "0" "1379" "0" "c.1379C>T" "r.(?)" "p.(Ser460Phe)" "8"
"0000598294" "00018730" "77" "1289" "0" "1289" "0" "c.1289T>A" "r.(?)" "p.(Leu430Gln)" "8"
"0000598295" "00018730" "99" "1309" "0" "1309" "0" "c.1309C>T" "r.(?)" "p.(Gln437*)" "8"
"0000598298" "00018730" "99" "1324" "0" "1324" "0" "c.1324C>T" "r.(?)" "p.(Gln442*)" "8"
"0000598299" "00018730" "99" "1328" "0" "1328" "0" "c.1328A>G" "r.(?)" "p.(His443Arg)" "8"
"0000598300" "00018730" "99" "1330" "0" "1330" "0" "c.1330C>T" "r.(?)" "p.(Gln444*)" "8"
"0000598301" "00018730" "77" "1333" "0" "1333" "0" "c.1333A>C" "r.(?)" "p.(Thr445Pro)" "8"
"0000598302" "00018730" "99" "1342" "0" "1342" "0" "c.1342G>C" "r.(?)" "p.(Glu448Gln)" "8"
"0000598303" "00018730" "79" "1342" "0" "1342" "0" "c.1342G>T" "r.(?)" "p.(Glu448*)" "8"
"0000598304" "00018730" "99" "1346" "0" "1346" "0" "c.1346T>C" "r.(?)" "p.(Leu449Pro)" "8"
"0000598306" "00018730" "99" "1346" "0" "1346" "0" "c.1346T>G" "r.(?)" "p.(Leu449Arg)" "8"
"0000598307" "00018730" "99" "1351" "0" "1351" "0" "c.1351G>A" "r.(?)" "p.(Glu451Lys)" "8"
"0000598309" "00018730" "99" "1367" "0" "1367" "0" "c.1367C>A" "r.(?)" "p.(Ala456Glu)" "8"
"0000598311" "00018730" "99" "1369" "0" "1369" "0" "c.1369G>C" "r.(?)" "p.(Ala457Pro)" "8"
"0000598312" "00018730" "99" "1375" "0" "1375" "0" "c.1375G>C" "r.(?)" "p.(Ala459Pro)" "8"
"0000598337" "00018730" "99" "1376" "0" "1376" "0" "c.1376C>A" "r.(?)" "p.(Ala459Asp)" "8"
"0000598339" "00018730" "99" "1075" "0" "1089" "0" "c.1075_1089del" "r.(?)" "p.(Val359_Leu363del)" "7"
"0000598340" "00018730" "99" "1154" "0" "1154" "0" "c.1154A>G" "r.(?)" "p.(Lys385Arg)" "7"
"0000598341" "00018730" "99" "889" "4" "889" "8" "c.889+4_889+8del" "r.spl?" "p.?" "5i"
"0000598342" "00018730" "99" "988" "0" "988" "0" "c.988T>G" "r.(?)" "p.(Tyr330Asp)" "6"
"0000598356" "00018730" "99" "1378" "0" "1378" "0" "c.1378T>C" "r.(?)" "p.(Ser460Pro)" "8"
"0000598357" "00018730" "99" "1381" "0" "1381" "0" "c.1381G>C" "r.(?)" "p.(Ala461Pro)" "8"
"0000598358" "00018730" "77" "1382" "0" "1382" "0" "c.1382C>T" "r.(?)" "p.(Ala461Val)" "8"
"0000598359" "00018730" "99" "1385" "0" "1385" "0" "c.1385T>G" "r.(1385u>g)" "p.(Ile462Ser)" "8"
"0000598383" "00018730" "99" "1397" "0" "1397" "0" "c.1397G>T" "r.(?)" "p.(Arg466Leu)" "8"
"0000598384" "00018730" "99" "1397" "0" "1397" "0" "c.1397G>C" "r.(?)" "p.(Arg466Pro)" "8"
"0000598385" "00018730" "99" "1399" "0" "1399" "0" "c.1399A>C" "r.(?)" "p.(Thr467Pro)" "8"
"0000598386" "00018730" "33" "1420" "0" "1420" "0" "c.1420C>G" "r.(?)" "p.(Gln474Glu)" "8"
"0000598397" "00018730" "99" "1420" "0" "1420" "0" "c.1420C>T" "r.(?)" "p.(Gln474*)" "8"
"0000598398" "00018730" "99" "1427" "0" "1427" "0" "c.1427C>G" "r.(?)" "p.(Pro476Arg)" "8"
"0000598399" "00018730" "99" "1430" "0" "1430" "0" "c.1430T>C" "r.(?)" "p.(Phe477Ser)" "8"
"0000598400" "00018730" "99" "1431" "0" "1431" "0" "c.1431C>A" "r.(?)" "p.(Phe477Leu)" "8"
"0000598401" "00018730" "99" "1431" "0" "1431" "0" "c.1431C>G" "r.(?)" "p.(Phe477Leu)" "8"
"0000598402" "00018730" "77" "1435" "0" "1435" "0" "c.1435T>C" "r.(?)" "p.(Phe479Leu)" "8"
"0000598403" "00018730" "99" "1459" "0" "1459" "0" "c.1459A>T" "r.(?)" "p.(Lys487*)" "8"
"0000598404" "00018730" "99" "1469" "0" "1469" "0" "c.1469T>A" "r.(?)" "p.(Val490Asp)" "8"
"0000598405" "00018730" "99" "1475" "0" "1475" "0" "c.1475T>A" "r.(?)" "p.(Met492Lys)" "8"
"0000598406" "00018730" "55" "1475" "0" "1475" "0" "c.1475T>C" "r.(?)" "p.(Met492Thr)" "8"
"0000598407" "00018730" "99" "1477" "0" "1477" "0" "c.1477G>A" "r.(?)" "p.(Gly493Arg)" "8"
"0000598408" "00018730" "99" "1477" "0" "1477" "0" "c.1477G>C" "r.(?)" "p.(Gly493Arg)" "8"
"0000598409" "00018730" "99" "1478" "0" "1478" "0" "c.1478G>A" "r.(?)" "p.(Gly493Glu)" "8"
"0000598410" "00018730" "99" "1488" "0" "1488" "0" "c.1488T>G" "r.(?)" "p.(Tyr496*)" "8"
"0000598411" "00018730" "99" "1492" "0" "1492" "0" "c.1492C>T" "r.(?)" "p.(Pro498Ser)" "8"
"0000598412" "00018730" "99" "1081" "0" "1081" "0" "c.1081C>T" "r.(?)" "p.(Gln361*)" "7"
"0000598413" "00018730" "99" "1157" "0" "1157" "0" "c.1157del" "r.(?)" "p.(Leu386Argfs*11)" "7"
"0000598414" "00018730" "99" "1056" "0" "1056" "0" "c.1056dup" "r.(?)" "p.(Leu353Serfs*16)" "7"
"0000598415" "00018730" "99" "0" "0" "0" "0" "c.[69_139del/=]" "r.(?)" "p.(Pro24Asnfs*10)" "3"
"0000598416" "00018730" "99" "1423" "0" "1423" "0" "c.1423C>T" "r.(?)" "p.(Gln475*)" "8"
"0000598417" "00018730" "99" "1492" "0" "1492" "0" "c.1492C>A" "r.(?)" "p.(Pro498Thr)" "8"
"0000598421" "00018730" "99" "1235" "0" "1235" "0" "c.1235T>A" "r.(?)" "p.(Ile412Asn)" "7"
"0000598422" "00018730" "99" "323" "0" "323" "0" "c.323dup" "r.(?)" "p.(Leu109Alafs*24)" "3"
"0000598423" "00018730" "99" "890" "-2" "890" "-2" "c.890-2A>G" "r.(890_1029del)" "p.?" "5i"
"0000598424" "00018730" "99" "-22" "-1" "-22" "-1" "c.-22-1G>A" "r.-22_51del" "p.?" "1i"
"0000598425" "00018730" "99" "50" "0" "51" "6" "c.50_51+6del" "r.-22_51del;-22_550del" "p.0" "2_2i"
"0000598426" "00018730" "99" "51" "1" "51" "1" "c.51+1G>A" "r.(-22_51del)" "p.?" "2i"
"0000598427" "00018730" "99" "51" "1" "51" "1" "c.51+1G>T" "r.(-22_51del)" "p.?" "2i"
"0000598428" "00018730" "99" "51" "2" "51" "2" "c.51+2T>C" "r.(-22_51del)" "p.?" "2i"
"0000598431" "00018730" "99" "52" "-2" "52" "-2" "c.52-2del" "r.(-22_51del)" "p.?" "2i"
"0000598432" "00018730" "99" "52" "-2" "52" "-2" "c.52-2A>G" "r.(-22_51del)" "p.?" "2i"
"0000598451" "00018730" "99" "550" "1" "550" "1" "c.550+1G>A" "r.(52_550del)" "p.?" "3i"
"0000598452" "00018730" "99" "550" "2" "550" "2" "c.550+2T>C" "r.(52_550del)" "p.?" "3i"
"0000598453" "00018730" "99" "550" "2" "550" "2" "c.550+2dup" "r.(52_550del)" "p.?" "3i"
"0000598454" "00018730" "99" "550" "5" "550" "5" "c.550+5G>C" "r.[(=,52_550del)]" "p.?" "3i"
"0000598455" "00018730" "99" "550" "5" "550" "5" "c.550+5G>A" "r.52_550del" "p.?" "3i"
"0000598457" "00018730" "99" "551" "-8" "558" "0" "c.551-8_558del" "r.(551_685del)" "p.?" "3i_4"
"0000598459" "00018730" "99" "551" "-5" "551" "-5" "c.551-5T>A" "r.(551_685del)" "p.?" "3i"
"0000598460" "00018730" "99" "551" "-3" "551" "-3" "c.551-3C>G" "r.(551_685del)" "p.?" "3i"
"0000598461" "00018730" "99" "551" "-2" "551" "-2" "c.551-2A>G" "r.[551_685del;551_889del]" "p.[(Gly184_Pro228del);(Ala185 Leufs*54)]" "3i"
"0000598462" "00018730" "99" "551" "-2" "551" "-2" "c.551-2del" "r.551_685del" "p.?" "3i"
"0000598463" "00018730" "99" "551" "-1" "551" "-1" "c.551-1dup" "r.(551_685del)" "p.0?" "3i"
"0000598464" "00018730" "99" "551" "-1" "551" "-1" "c.551-1G>A" "r.(551_685del)" "p.?" "3i"
"0000598465" "00018730" "79" "551" "-1" "551" "-1" "c.551-1G>C" "r.(551_685del)" "p.?" "3i"
"0000598466" "00018730" "99" "685" "0" "685" "0" "c.685del" "r.[551_685del;551_889del]" "p.[(Gly184_Pro228del);(Gly184_Ser296del)]" "4"
"0000598467" "00018730" "99" "685" "1" "685" "1" "c.685+1G>A" "r.[(551_685del);(551_889del)]" "p.?" "4i"
"0000598468" "00018730" "99" "685" "1" "685" "1" "c.685+1G>T" "r.[(551_685del);(551_889del)]" "p.?" "4i"
"0000598469" "00018730" "99" "685" "2" "685" "2" "c.685+2T>A" "r.551_685del" "p.(Gly184_Pro228del)" "4i"
"0000598476" "00018730" "99" "685" "2" "685" "2" "c.685+2T>G" "r.(551_685del)" "p.?" "4i"
"0000598477" "00018730" "99" "685" "2" "685" "13" "c.685+2_685+13del" "r.spl?" "p.?" "4i"
"0000598478" "00018730" "71" "685" "31" "685" "31" "c.685+31G>A" "r.(=)" "p.(=)" "4i"
"0000598479" "00018730" "99" "686" "-12" "686" "-12" "c.686-12A>G" "r.spl" "p.(Asp229Alafs*8)" "4i"
"0000598480" "00018730" "99" "305" "0" "317" "0" "c.305_317del" "r.(?)" "p.(Pro102Leufs*42)" "3"
"0000598481" "00018730" "77" "564" "0" "569" "0" "c.564_569dup" "r.(?)" "p.(Asn188_Thr189dup)" "4"
"0000598482" "00018730" "99" "706" "0" "706" "0" "c.706T>G" "r.(?)" "p.(Phe236Val)" "5"
"0000598483" "00018730" "99" "897" "0" "897" "0" "c.897G>A" "r.(?)" "p.(Trp299*)" "6"
"0000598488" "00018730" "77" "369" "0" "369" "0" "c.369C>G" "r.(?)" "p.(Cys123Trp)" "3"
"0000598489" "00018730" "99" "1202" "0" "1202" "0" "c.1202T>A" "r.1202u>a" "p.(Ile401Asn)" "7"
"0000598490" "00018730" "59" "1322" "0" "1322" "0" "c.1322T>A" "r.1322u>a" "p.(Met441Lys)" "8"
"0000598491" "00018730" "99" "686" "-3" "686" "-3" "c.686-3C>G" "r.686_889del" "p.(Asp229_Ser296del)" "4i"
"0000598492" "00018730" "99" "889" "1" "889" "1" "c.889+1G>T" "r.(686_889del)" "p.?" "5i"
"0000598493" "00018730" "99" "889" "2" "889" "2" "c.889+2T>C" "r.686_889del" "p.(Asp229_Ser296del)" "5i"
"0000598494" "00018730" "99" "889" "3" "889" "3" "c.[889+3A>G(;)1249+4A>G]" "r.spl?" "p.?" "5i;7i"
"0000598496" "00018730" "99" "889" "3" "889" "3" "c.889+3A>T" "r.686_889del" "p.(Asp229_Ser296del)" "5i"
"0000598497" "00018730" "99" "890" "-88" "924" "0" "c.890-88_924del" "r.?" "p.?" "5i_6"
"0000598498" "00018730" "99" "890" "-14" "890" "-14" "c.890-14C>G" "r.(=)" "p.(=)" "5i"
"0000598499" "00018730" "99" "890" "-1" "890" "-1" "c.890-1G>A" "r.(890_1029del)" "p.?" "5i"
"0000598501" "00018730" "99" "1029" "1" "1029" "1" "c.1029+1G>T" "r.(890_1029del)" "p.?" "6i"
"0000598502" "00018730" "99" "1029" "1" "1029" "1" "c.1029+1G>A" "r.(890_1029del)" "p.?" "6i"
"0000598503" "00018730" "99" "1029" "4" "1029" "4" "c.1029+4del" "r.spl?" "p.?" "6i"
"0000598504" "00018730" "99" "1029" "3" "1029" "6" "c.1029+3_1029+6del" "r.spl?" "p.?" "6i"
"0000598505" "00018730" "97" "1029" "84" "1029" "84" "c.1029+84G>A" "r.(=)" "p.(=)" "6i"
"0000598506" "00018730" "99" "1030" "-12" "1046" "0" "c.1030-12_1046del" "r.(1030_1249del)" "p.?" "6i_7"
"0000598507" "00018730" "99" "1030" "-2" "1031" "0" "c.1030-2_1031delinsGCA" "r.(1030_1249del)" "p.?" "6i_7"
"0000598510" "00018730" "99" "1033" "0" "1033" "0" "c.1033G>T" "r.(?)" "p.(Gly345Trp)" "7"
"0000598511" "00018730" "99" "1030" "-10" "1048" "0" "c.1030-10_1048del" "r.(1030_1249del)" "p.?" "6i_7"
"0000598513" "00018730" "99" "1030" "-1" "1030" "-1" "c.1030-1G>A" "r.(1030_1249del)" "p.?" "6i"
"0000598514" "00018730" "99" "1030" "-1" "1030" "-1" "c.1030-1G>C" "r.1030_1249del" "p.?" "6i"
"0000598515" "00018730" "99" "1030" "-1" "1030" "-1" "c.1030-1del" "r.(1030_1249del)" "p.(0)?" "6i"
"0000598517" "00018730" "99" "1225" "0" "1249" "19" "c.1225_1249+19del" "r.1030_1249del" "p.(Met409Asnfs*14)" "7_7i"
"0000598518" "00018730" "99" "1249" "1" "1249" "1" "c.1249+1G>A" "r.(1030_1249del)" "p.?" "7i"
"0000598519" "00018730" "99" "1249" "2" "1249" "2" "c.1249+2del" "r.1030_1249del" "p.(Val344_Leu416Asnfs)" "7i"
"0000598520" "00018730" "99" "1249" "2" "1249" "2" "c.1249+2T>A" "r.1030_1249del" "p.?" "7i"
"0000598521" "00018730" "99" "1249" "4" "1249" "4" "c.1249+4A>G" "r.spl?" "p.?" "7i"
"0000598522" "00018730" "99" "1249" "5" "1249" "5" "c.1249+5G>A" "r.1030_1249del" "p.(Val344Asnfs*14;Val403Asnfs*14)" "7i"
"0000598523" "00018730" "77" "1249" "5" "1249" "5" "c.1249+5G>T" "r.spl?" "p.?" "7i"
"0000598524" "00018730" "11" "1249" "91" "1249" "92" "c.1249+91_1249+92del" "r.(=)" "p.(=)" "7i"
"0000598525" "00018730" "77" "1250" "-13" "1250" "-13" "c.1250-13G>A" "r.(=)" "p.(=)" "7i"
"0000598526" "00018730" "99" "1250" "-2" "1250" "-2" "c.1250-2A>G" "r.spl?" "p.?" "7i"
"0000598527" "00018730" "99" "1250" "-1" "1250" "-1" "c.1250-1G>A" "r.spl?" "p.?" "7i"
"0000598528" "00018730" "99" "351" "0" "351" "0" "c.351del" "r.(?)" "p.(Thr118Leufs*30)" "3"
"0000598531" "00018730" "99" "0" "0" "0" "0" "c.[1202T>C]" "r.[(1202u>c)]" "p.[(Ile401Thr)]" "7"
"0000598542" "00018730" "99" "550" "617" "685" "289" "c.550+617_685+289del" "r.(551_685del)" "p.(Gly184_Pro228del)" "3i_4i"
"0000598544" "00018730" "99" "550" "618" "686" "-1725" "c.550+618_686-1725del" "r.(?)" "p.(Gly184_Pro228del)" "3i_4i"
"0000598546" "00018730" "99" "551" "-604" "685" "84" "c.551-604_685+84del" "r.(551_685del)" "p.(Gly184_Pro228del)" "3i_4i"
"0000598547" "00018730" "99" "1249" "181" "1925" "0" "c.1249+181_*422del" "r.?" "p.?" "7i_8_"
"0000598548" "00018730" "99" "-387" "0" "1925" "0" "c.-387_*422del" "r.(0?)" "p.(0?)" "_1_8_"
"0000598549" "00018730" "99" "-387" "0" "52" "-123" "c.-387_52-123del" "r.?" "p.?" "_1_2i"
"0000598550" "00018730" "99" "51" "627" "685" "84" "c.51+627_685+84del" "r.(52_685del)" "p.(Asp18Thrfs*4)" "2i_4i"
"0000598551" "00018730" "99" "550" "87" "685" "289" "c.550+87_685+289del" "r.(551_685del)" "p.(Gly184_Pro228del)" "3i_4i"
"0000598552" "00018730" "99" "551" "-604" "685" "288" "c.551-604_685+288del" "r.(551_685del)" "p.(Gly184_Pro228del)" "3i_4i"
"0000598553" "00018730" "99" "551" "-508" "685" "1214" "c.551-508_685+1214dup" "r.(551_685)dup" "p.(Gly184_Pro228)dup" "3i_4i"
"0000598554" "00018730" "99" "550" "616" "685" "1214" "c.550+616_685+1214del" "r.(551_685)del" "p.(Gly184_Pro228del)" "3i_5i"
"0000598555" "00018730" "99" "551" "-289" "685" "1214" "c.551-289_685+1214del" "r.(551_685del)" "p.(Gly184_Pro228del)" "3i_4i"
"0000598556" "00018730" "99" "686" "-1724" "1030" "-2547" "c.686-1724_1030-2547del" "r.(686_1029)del" "p.(Asp229Glyfs*25)" "4i_6i"
"0000598557" "00018730" "99" "686" "-424" "1030" "-803" "c.686-424_1030-803dup" "r.(686_1029)dup" "p.?" "4i_6i"
"0000598558" "00018730" "99" "1029" "1639" "1925" "0" "c.1029+1639_*422del" "r.(1030_*422del)" "p.?" "6i_8_"
"0000598559" "00018730" "99" "1030" "-1585" "1250" "-859" "c.1030-1585_1250-859del" "r.(1030_1249)del" "p.(Val344Asnfs*14)" "6i_7i"
"0000598560" "00018730" "99" "1235" "0" "1249" "782" "c.1235_1249+782del" "r.(1030_1249)del" "p.?" "7_7i"
"0000598561" "00018730" "99" "1249" "376" "1618" "0" "c.1249+376_*115del" "r.(1250_*115del)" "p.?" "7i_8_"
"0000598565" "00018730" "51" "25" "0" "25" "0" "c.25A>C" "r.(?)" "p.(Thr9Pro)" "2"
"0000598566" "00018730" "55" "1381" "0" "1381" "0" "c.1381G>A" "r.(?)" "p.(Ala461Thr)" "8"
"0000598579" "00018730" "99" "686" "-1301" "1029" "170" "c.686-1301_1029+170del" "r.(686_1029)del" "p.(Asp229Glyfs*25)" "4i_6i"
"0000598823" "00018730" "99" "551" "-1" "685" "1" "c.(550+1_551-1)_(685+1_686-1)del" "r.(551_685del)" "p.(Gly184_Pro228)del" "3i_4i"
"0000599135" "00018730" "99" "-22" "-1" "685" "1" "c.(-191_-22-1)_(685+1_686-1)del" "r.(0?)" "p.(0?)" "_1_4i"
"0000599281" "00018730" "99" "1030" "-1" "1249" "1" "c.(1029+1_1030-1)_(1249+1_1250-1)del" "r.(1030_1249del)" "p.?" "6i_7i"
"0000599313" "00018730" "99" "550" "501" "685" "1597" "c.550+501_685+1597del" "r.(?)" "p.(Gly184_Pro228del)" "3i_4i"
"0000599314" "00018730" "99" "-23" "0" "51" "1" "c.(-191_-23)_(51+1_52-1)del" "r.0?" "p.0?" "_1_2i"
"0000599316" "00018730" "99" "-23" "0" "685" "1" "c.(-191_-23)_(685+1_686-1)del" "r.0?" "p.0?" "_1_4i"
"0000599317" "00018730" "99" "-23" "0" "685" "1" "c.(-191_-23)_(685+1_686-1)del" "r.0?" "p.0?" "_1_4i"
"0000599318" "00018730" "99" "-23" "0" "1029" "1" "c.(-191_-23)_(1029+1_1030-1)del" "r.0?" "p.0?" "_1_6i"
"0000599319" "00018730" "99" "-23" "0" "1029" "1" "c.(-191_-23)_(1029+1_1030-1)del" "r.0?" "p.0?" "_1_6i"
"0000599320" "00018730" "99" "-23" "0" "1249" "1" "c.(-191_-23)_(1249+1_1250-1)del" "r.0?" "p.0?" "_1_7i"
"0000599321" "00018730" "99" "-23" "0" "1775" "0" "c.(-191_-23)_(*272_?)del" "r.0?" "p.0?" "_1_8_"
"0000599322" "00018730" "99" "-22" "-1" "51" "1" "c.(-23+1_-22-1)_(51+1_52-1)del" "r.(?)" "p.(0?)" "1i_2i"
"0000599324" "00018730" "99" "52" "-1" "1029" "1" "c.(51+1_52-1)_(1029+1_1030-1)del" "r.(?)" "p.(0?)" "2i_6i"
"0000599325" "00018730" "99" "551" "-1" "685" "1" "c.(550+1_551-1)_(685+1_686-1)del" "r.(551_685del)" "p.(Gly184_Pro228)del" "3i_4i"
"0000599326" "00018730" "99" "551" "-1" "685" "1" "c.(550+1_551-1)_(685+1_686-1)del" "r.(551_685del)" "p.(Gly184_Pro228)del" "3i_4i"
"0000599327" "00018730" "99" "551" "-1" "685" "1" "c.(550+1_551-1)_(685+1_686-1)del" "r.(551_685del)" "p.(Gly184_Pro228)del" "3i_4i"
"0000600818" "00018730" "99" "551" "-1" "685" "1" "c.(550+1_551-1)_(685+1_686-1)del" "r.(551_685del)" "p.(Gly184_Pro228del)" "3i_4i"
"0000600819" "00018730" "99" "551" "-1" "685" "1" "c.(550+1_551-1)_(685+1_686-1)del" "r.(551_685del)" "p.(Gly184_Pro228del)" "3i_4i"
"0000600820" "00018730" "99" "551" "-1" "685" "1" "c.(550+1_551-1)_(685+1_686-1)del" "r.(551_685del)" "p.(?)" "3i_4i"
"0000600821" "00018730" "99" "551" "-1" "685" "1" "c.(550+1_551-1)_(685+1_686-1)del" "r.(551_685del)" "p.(Gly184_Pro228del)" "3i_4i"
"0000600822" "00018730" "99" "551" "-1" "1029" "1" "c.(550+1_551-1)_(1029+1_1030-1)del" "r.(551_1029)del" "p.?" "3i_6i"
"0000600823" "00018730" "99" "686" "-1" "889" "1" "c.(685+1_686-1)_(889+1_890-1)dup" "r.(686_889)dup" "p.(0?)" "4i_5i"
"0000600824" "00018730" "99" "686" "-1" "1029" "1" "c.(685+1_686-1)_(1029+1_1030-1)del" "r.(686_1029)del" "p.(?)" "4i_6i"
"0000600825" "00018730" "99" "686" "-1" "1029" "1" "c.(685+1_686-1)_(1029+1_1030-1)del" "r.(686_1029)del" "p.(?)" "_5_6_"
"0000600826" "00018730" "97" "49" "0" "49" "0" "c.49G>A" "r.(?)" "p.(Gly17Arg)" "2"
"0000600828" "00018730" "99" "686" "-1" "1775" "0" "c.(685+1_686-1)_(*272_?)del" "r.(686_*272)del" "p.(?)" "4i_8_"
"0000600846" "00018730" "99" "1030" "-1" "1775" "0" "c.(1029+1_1030-1)_(*272_?)del" "r.(1030_*272)del" "p.?" "6i_8_"
"0000600847" "00018730" "99" "1030" "-1" "1775" "0" "c.(1029+1_1030-1)_(*272_?)del" "r.(1030_*272)del" "p.?" "6i_8_"
"0000600848" "00018730" "99" "1250" "-1" "1775" "0" "c.(1249+1_1250-1)_(*272_?)del" "r.(1250_*272)del" "p.?" "7i_8_"
"0000600849" "00018730" "99" "1250" "-1" "1775" "0" "c.(1249+1_1250-1)_(*272_?)del" "r.(1250_*272)del" "p.?" "7i_8_"
"0000600850" "00018730" "99" "890" "-1" "1029" "1" "c.(889+1_890-1)_(1029+1_1030-1)del" "r.(890_1029del)" "p.?" "5i_6i"
"0000600851" "00018730" "99" "686" "-1" "1775" "0" "c.(685+1_686-1)_(*272_?)del" "r.(686_*272)del" "p.?" "4i_8_"
"0000601059" "00018730" "99" "550" "377" "685" "1803" "c.550+377_685+1803del" "r.(551_685del)" "p.(Gly184_Pro228del)" "3i_4i"
"0000601060" "00018730" "99" "550" "454" "685" "1276" "c.550+454_685+1276del" "r.(551_685del)" "p.(Gly184_Pro228del)" "3i_4i;3i_4i"
"0000601061" "00018730" "99" "551" "-1" "685" "1" "c.(550+1_551-1)_(685+1_686-1)dup" "r.(551_685)dup" "p.?" "3i_4i;3i_4i"
"0000601062" "00018730" "99" "-23" "0" "550" "1" "c.(-191_-23)_(550+1_551-1)del" "r.0?" "p.0?" "_1_3i"
"0000601069" "00018730" "99" "550" "428" "685" "439" "c.550+428_685+439del" "r.(551_685del)" "p.(Gly184_Pro228del)" "3i_4i"
"0000601070" "00018730" "99" "551" "-1" "1029" "1" "c.(550+1_551-1)_(1029+1_1030-1)del" "r.(551_1029)del" "p.?" "3i_6i"
"0000601071" "00018730" "99" "551" "-1" "1029" "1" "c.(550+1_551-1)_(1029+1_1030-1)del" "r.(551_1029)del" "p.?" "3i_6i"
"0000601072" "00018730" "99" "550" "745" "685" "308" "c.550+745_685+308del" "r.?" "p.(Gly184_Pro228del)" "3i_4i"
"0000602972" "00018730" "99" "1104" "0" "1104" "0" "c.1104del" "r.(?)" "p.(Asp369Thrfs*28)" "7"
"0000602973" "00018730" "99" "597" "0" "597" "0" "c.597C>G" "r.(?)" "p.(Tyr199*)" "4"
"0000602977" "00018730" "99" "51" "1" "51" "1" "c.51+1del" "r.spl?" "p.(Asp18IlefsTer61)" "2i"
"0000602978" "00018730" "99" "51" "5" "51" "5" "c.51+5G>T" "r.(-22_51del)" "p.?" "2i"
"0000602979" "00018730" "99" "551" "-1" "685" "1" "c.(550+1_551-1)_(685+1_686-1)del" "r.(551_685del)" "p.(Gly184_Pro228del)" "3i_4i"
"0000604194" "00018730" "55" "-2332054" "0" "138175" "0" "c.-2332054_*136672dup" "r.0?" "p.0?" "_1_8_"
"0000604195" "00018730" "53" "-59207" "0" "288798" "0" "c.-59207_*287295dup" "r.0?" "p.0?" "_1_8_"
"0000604196" "00018730" "53" "-218202" "0" "286671" "0" "c.-218202_*285168dup" "r.0?" "p.0?" "_1_8_"
"0000604197" "00018730" "55" "0" "0" "0" "0" "c.-191_*272{2}" "r.(=)" "p.(=)" "_1_8_"
"0000604224" "00018730" "50" "1045" "0" "1045" "0" "c.1045C>T" "r.(?)" "p.(Leu349Phe)" "7"
"0000613452" "00018730" "30" "280" "0" "280" "0" "c.280C>G" "r.(?)" "p.(Pro94Ala)" "3"
"0000613453" "00018730" "33" "283" "0" "283" "0" "c.283A>C" "r.(?)" "p.(Thr95Pro)" "3"
"0000613454" "00018730" "30" "286" "0" "286" "0" "c.286A>C" "r.(?)" "p.(Thr96Pro)" "3"
"0000613455" "00018730" "30" "465" "0" "465" "0" "c.465C>T" "r.(?)" "p.(His155=)" "3"
"0000613456" "00018730" "33" "1164" "0" "1164" "0" "c.1164G>A" "r.(?)" "p.(Met388Ile)" "7"
"0000613457" "00018730" "97" "1346" "0" "1346" "0" "c.1346T>G" "r.(?)" "p.(Leu449Arg)" "8"
"0000630999" "00018730" "79" "491" "0" "502" "0" "c.491_502del" "r.(?)" "p.(Glu164_Met167del)" "3"
"0000631000" "00018730" "70" "1183" "0" "1183" "0" "c.1183C>G" "r.(?)" "p.(Leu395Val)" "7"
"0000631001" "00018730" "77" "1250" "-3" "1250" "-3" "c.1250-3T>G" "r.spl?" "p.?" "7i"
"0000631826" "00018730" "99" "-22" "-155" "-22" "-155" "c.-22-155G>T" "r.(=)" "p.(=)" "1i"
"0000631880" "00018730" "99" "314" "0" "317" "0" "c.314_317dup" "r.(?)" "p.(Thr107Asnfs*27)" "3"
"0000632024" "00018730" "99" "1029" "384" "1029" "384" "c.1029+384A>G" "r.(=)" "p.(=)" "6i"
"0000648311" "00018730" "53" "5" "0" "5" "0" "c.5C>T" "r.(?)" "p.(Ala2Val)" "2"
"0000656817" "00018730" "30" "133" "0" "133" "0" "c.133G>T" "r.(?)" "p.(Val45Phe)" "3"
"0000656818" "00018730" "30" "768" "0" "768" "0" "c.768C>T" "r.(?)" "p.(Asp256=)" "5"
"0000667723" "00018730" "99" "1202" "0" "1202" "0" "c.1202T>C" "r.(1202u>c)" "p.(Ile401Thr)" "7"
"0000674989" "00018730" "33" "1045" "0" "1045" "0" "c.1045C>T" "r.(?)" "p.(Leu349Phe)" "7"
"0000674990" "00018730" "99" "953" "0" "953" "0" "c.953C>G" "r.(?)" "p.(Ser318*)" "6"
"0000679226" "00018730" "30" "857" "0" "857" "0" "c.857G>A" "r.(?)" "p.(Arg286His)" "5"
"0000687265" "00018730" "99" "-387" "0" "-387" "0" "c.(-387?)_(*422?)del" "r(0?)" "p(0?)" "_1_8_"
"0000693803" "00018730" "99" "427" "0" "427" "0" "c.427G>A" "r.(?)" "p.(Gly143Arg)" "3"
"0000693804" "00018730" "97" "440" "0" "440" "0" "c.440T>A" "r.(?)" "p.(Val147Glu)" "3"
"0000693939" "00018730" "99" "650" "0" "650" "0" "c.650del" "r.(?)" "p.(Gly217Valfs*16)" "4"
"0000694133" "00018730" "77" "1196" "0" "1196" "0" "c.1196C>A" "r.(?)" "p.(Pro399His)" "7"
"0000697191" "00018730" "77" "9" "0" "9" "0" "c.9del" "r.(?)" "p.(Arg4Glyfs*2)" "2"
"0000697922" "00018730" "99" "48" "0" "48" "0" "c.[48T>G;51+3A>G]" "r.[(=;-22_51del)]" "p.[(Ala16=);(0?)]" "2;2i"
"0000704464" "00018730" "99" "189" "0" "190" "0" "c.189_190insG" "r.(?)" "p.(Ser64Glufs*18)" "3"
"0000704465" "00018730" "77" "869" "0" "869" "0" "c.869T>A" "r.(?)" "p.(Leu290His)" "5"
"0000704466" "00018730" "99" "1100" "0" "1100" "0" "c.1100T>A" "r.(?)" "p.(Leu367His)" "7"
"0000704467" "00018730" "99" "1046" "0" "1046" "0" "c.1046T>C" "r.(?)" "p.(Leu349Pro)" "7"
"0000704468" "00018730" "99" "1284" "0" "1284" "0" "c.1284T>A" "r.(?)" "p.(Cys428*)" "8"
"0000704527" "00018730" "99" "1343" "0" "1344" "0" "c.1343_1344insTGA" "r.(?)" "p.(Leu447_Glu448insAsp)" "8"
"0000704528" "00018730" "77" "1429" "0" "1429" "0" "c.1429T>G" "r.(?)" "p.(Phe477Val)" "8"
"0000704529" "00018730" "99" "686" "-1" "686" "-1" "c.686-1G>A" "r.746_949del" "p.(Asp229_Ser296del)" "4i"
"0000704547" "00018730" "11" "686" "-9" "686" "-9" "c.686-9T>C" "r.(=)" "p.(=)" "4i"
"0000704553" "00018730" "31" "686" "-179" "686" "-179" "c.686-179A>G" "r.(=?)" "p.(=?)" "4i"
"0000708308" "00018730" "99" "44" "0" "44" "0" "c.44del" "r.(?)" "p.(Leu15Argfs*64)" "2"
"0000708309" "00018730" "77" "538" "0" "538" "0" "c.538C>T" "r.(?)" "p.(Gln180*)" "3"
"0000708311" "00018730" "79" "787" "0" "787" "0" "c.787dup" "r.(?)" "p.(Asn263Lysfs*42)" "5"
"0000708313" "00018730" "79" "939" "0" "939" "0" "c.939del" "r.(?)" "p.(His314Thrfs*7)" "6"
"0000708314" "00018730" "79" "1214" "0" "1223" "0" "c.1214_1223del" "r.(?)" "p.(Thr405Ilefs*23)" "7"
"0000708489" "00018730" "55" "-105" "0" "-105" "0" "c.-105C>A" "r.(=)" "p.(=)" "1"
"0000708494" "00018730" "99" "902" "0" "902" "0" "c.902del" "r.(?)" "p.(Thr301Lysfs*20)" "6"
"0000708495" "00018730" "99" "985" "0" "985" "0" "c.985A>T" "r.(?)" "p.(Lys329*)" "6"
"0000708496" "00018730" "99" "1233" "0" "1234" "0" "c.1233_1234insTC" "r.(?)" "p.(Ile412Serfs*20)" "7"
"0000708497" "00018730" "70" "1409" "0" "1409" "0" "c.1409T>A" "r.(?)" "p.(Val470Asp)" "8"
"0000708498" "00018730" "79" "1409" "0" "1409" "0" "c.1409del" "r.(?)" "p.(Val470Alafs*106)" "8"
"0000708499" "00018730" "55" "1453" "0" "1453" "0" "c.1453C>G" "r.(?)" "p.(Gln485Glu)" "8"
"0000708695" "00018730" "13" "550" "9" "550" "9" "c.550+9C>G" "r.(=)" "p.(=)" "3i"
"0000708703" "00018730" "30" "1569" "0" "1569" "0" "c.*66T>C" "r.(=)" "p.(=)" "8_"
"0000712715" "00018730" "99" "79" "0" "79" "0" "c.79dup" "r.(?)" "p.(Thr27Asnfs*31)" "3"
"0000712717" "00018730" "99" "178" "0" "178" "0" "c.178del" "r.(?)" "p.(Leu60Trpfs*19)" "3"
"0000712718" "00018730" "99" "463" "0" "463" "0" "c.463C>G" "r.(?)" "p.(His155Asp)" "3"
"0000714147" "00018730" "99" "485" "0" "498" "0" "c.485_498delinsTGCTGAGA" "r.(?)" "p.(Lys162_Asn166delinsMetLeuArg)" "3"
"0000714148" "00018730" "99" "539" "0" "540" "0" "c.539_540dup" "r.(?)" "p.(Val181Argfs*31)" "3"
"0000714754" "00018730" "99" "553" "0" "553" "0" "c.553dup" "r.(?)" "p.(Ala185Glyfs*72)" "4"
"0000714759" "00018730" "99" "622" "0" "622" "0" "c.622C>T" "r.(?)" "p.(Gln208*)" "4"
"0000714938" "00018730" "99" "733" "0" "733" "0" "c.733dup" "r.(?)" "p.(Ser245Lysfs*12)" "5"
"0000714939" "00018730" "99" "990" "0" "990" "0" "c.990C>G" "r.(?)" "p.(Tyr330*)" "6"
"0000714972" "00018730" "99" "1328" "0" "1328" "0" "c.1328A>C" "r.(?)" "p.(His443Pro)" "8"
"0000729710" "00018730" "99" "686" "-1" "1029" "1" "c.(685+1_686-1)_(1029+1_1030-1)dup" "r.(686_1029)dup" "p.(?)" "_5_6_"
"0000729711" "00018730" "99" "1249" "1" "1503" "0" "c.(1249+1_1503)del" "r.(1250_1503)del" "p.?" "7i_8_"
"0000730108" "00018730" "70" "-23" "45" "-23" "45" "c.-23+45T>C" "r.(=)" "p.(=)" "1i"
"0000731370" "00018730" "99" "48" "0" "48" "0" "c.48del" "r.(?)" "p.(Asp18Ilefs*61)" "2"
"0000731580" "00018730" "70" "1050" "0" "1050" "0" "c.1050C>G" "r.(=)" "p.(=)" "7"
"0000731582" "00018730" "99" "-35" "0" "1766" "0" "c.-35_*263del" "r.?" "p.?" "1_8_"
"0000760957" "00018730" "50" "1560" "0" "1560" "0" "c.*57C>G" "r.(=)" "p.(=)" "8_"
"0000763347" "00018730" "99" "520" "0" "524" "0" "c.520_524del" "r.(?)" "p.(Ile174Glnfs*81)" "3"
"0000763348" "00018730" "99" "551" "-2" "551" "-2" "c.551-2A>C" "r.spl?" "p.?" "3i"
"0000763350" "00018730" "99" "551" "-1" "685" "1" "c.(550+1_551-1)_(685+1_686-1)del" "r.(?)" "p.(?)" "3i_4i"
"0000763351" "00018730" "99" "744" "0" "745" "0" "c.744_745del" "r.(?)" "p.(Arg249Serfs*7)" "5"
"0000763352" "00018730" "97" "1001" "0" "1001" "0" "c.1001A>C" "r.(?)" "p.(His334Pro)" "6"
"0000763363" "00018730" "79" "1037" "0" "1037" "0" "c.1037A>C" "r.(?)" "p.(Gln346Pro)" "7"
"0000763364" "00018730" "99" "1293" "0" "1293" "0" "c.1293del" "r.(?)" "p.(Glu432Argfs*18)" "8"
"0000763380" "00018730" "31" "51" "0" "51" "0" "c.51G>C" "r.(=)" "p.(=)" "2"
"0000763381" "00018730" "11" "685" "88" "685" "88" "c.685+88G>A" "r.(=)" "p.(=)" "4i"
"0000763384" "00018730" "11" "1030" "-20" "1030" "-20" "c.1030-20A>G" "r.(=)" "p.(=)" "6i"
"0000763389" "00018730" "10" "1029" "1443" "1029" "1443" "c.1029+1443G>C" "r.(=)" "p.(=)" "6i"
"0000763390" "00018730" "10" "1029" "1497" "1029" "1497" "c.1029+1497A>G" "r.(=)" "p.(=)" "6i"
"0000763391" "00018730" "10" "1029" "2110" "1029" "2110" "c.1029+2110T>C" "r.(=)" "p.(=)" "6i"
"0000763392" "00018730" "10" "1029" "2111" "1029" "2111" "c.1029+2111G>A" "r.(=)" "p.(=)" "6i"
"0000763394" "00018730" "10" "1029" "260" "1029" "260" "c.1029+260G>A" "r.(=)" "p.(=)" "6i"
"0000763395" "00018730" "10" "1029" "312" "1029" "312" "c.1029+312T>C" "r.(=)" "p.(=)" "6i"
"0000763396" "00018730" "15" "1029" "851" "1029" "851" "c.1029+851C>G" "r.(=)" "p.(=)" "6i"
"0000763398" "00018730" "10" "1029" "926" "1029" "926" "c.1029+926G>T" "r.(=)" "p.(=)" "6i"
"0000763399" "00018730" "10" "1030" "-1198" "1030" "-1198" "c.1030-1198G>T" "r.(=)" "p.(=)" "6i"
"0000763440" "00018730" "99" "1480" "0" "1480" "0" "c.1480C>T" "r.(?)" "p.(Arg494*)" "8"
"0000763547" "00018730" "50" "-99" "0" "-99" "0" "c.-99dup" "r.(=)" "p.(=)" "1"
"0000763579" "00018730" "99" "195" "0" "195" "0" "c.195del" "r.(?)" "p.(Leu65Phefs*14)" "3"
"0000763580" "00018730" "50" "404" "0" "404" "0" "c.404G>A" "r.(?)" "p.(Ser135Asn)" "3"
"0000763581" "00018730" "99" "576" "0" "583" "0" "c.576_583dup" "r.(?)" "p.(Ser195Thrfs*19)" "4"
"0000763833" "00018730" "70" "1489" "0" "1489" "0" "c.1489G>A" "r.(?)" "p.(Asp497Asn)" "8"
"0000763835" "00018730" "30" "1250" "-154" "1250" "-154" "c.1250-154C>G" "r.(=)" "p.(=)" "7i"
"0000763836" "00018730" "30" "1096" "0" "1096" "0" "c.1096C>T" "r.(?)" "p.(Arg366Cys)" "7"
"0000763837" "00018730" "77" "979" "0" "980" "0" "c.979_980delinsGTGCC" "r.(?)" "p.(Ser327delinsValPro)" "6"
"0000763838" "00018730" "70" "872" "0" "872" "0" "c.872A>G" "r.(?)" "p.(Asn291Ser)" "5"
"0000765616" "00018730" "11" "52" "-130" "52" "-130" "c.52-130C>T" "r.(=)" "p.(=)" "2i"
"0000765617" "00018730" "10" "550" "794" "550" "794" "c.550+794C>A" "r.(=)" "p.(=)" "3i"
"0000765618" "00018730" "10" "685" "659" "685" "659" "c.685+659C>T" "r.(=)" "p.(=)" "4i"
"0000765619" "00018730" "10" "685" "1100" "685" "1100" "c.685+1100C>T" "r.(=)" "p.(=)" "4i"
"0000765624" "00018730" "10" "1029" "926" "1029" "926" "c.1029+926G>T" "r.(=)" "p.(=)" "6i"
"0000765625" "00018730" "10" "1029" "1443" "1029" "1443" "c.1029+1443G>C" "r.(=)" "p.(=)" "6i"
"0000765626" "00018730" "10" "1029" "2110" "1029" "2110" "c.1029+2110T>C" "r.(=)" "p.(=)" "6i"
"0000765627" "00018730" "10" "1029" "2111" "1029" "2111" "c.1029+2111G>A" "r.(=)" "p.(=)" "6i"
"0000765628" "00018730" "10" "1030" "-2243" "1030" "-2243" "c.1030-2243T>G" "r.(=)" "p.(=)" "6i"
"0000765629" "00018730" "10" "1030" "-1436" "1030" "-1436" "c.1030-1436T>C" "r.(=)" "p.(=)" "6i"
"0000765940" "00018730" "10" "2826" "0" "2826" "0" "c.*1323G>A" "r.(=)" "p.(=)" "8_"
"0000765941" "00018730" "10" "4117" "0" "4117" "0" "c.*2614A>T" "r.(=)" "p.(=)" "8_"
"0000786037" "00018730" "99" "314" "0" "317" "0" "c.314_317del" "r.(?)" "p.(Pro105Leufs*42)" "3"
"0000789639" "00018730" "79" "221" "0" "221" "0" "c.221C>A" "r.(?)" "p.(Ser74*)" "3"
"0000789642" "00018730" "77" "1324" "0" "1324" "0" "c.1324C>G" "r.(?)" "p.(Gln442Glu)" "8"
"0000794126" "00018730" "99" "5" "0" "6" "0" "c.5_6del" "r.(?)" "p.(Ala2Valfs*17)" "2"
"0000794127" "00018730" "99" "17" "0" "24" "0" "c.17_24dup" "r.(?)" "p.(Thr9Profs*3)" "2"
"0000794128" "00018730" "99" "116" "0" "117" "0" "c.116_117insGGATC" "r.(?)" "p.(Asp39Glufs*42)" "3"
"0000794129" "00018730" "99" "147" "0" "147" "0" "c.147del" "r.(?)" "p.(Ile50Serfs*29)" "3"
"0000794130" "00018730" "99" "204" "0" "204" "0" "c.204del" "r.(?)" "p.(Asn69Thrfs*10)" "3"
"0000794131" "00018730" "99" "226" "0" "226" "0" "c.226del" "r.(?)" "p.(Thr76Profs*3)" "3"
"0000794132" "00018730" "99" "400" "0" "404" "0" "c.400_404del" "r.(?)" "p.(Glu134Serfs*121)" "3"
"0000794133" "00018730" "97" "461" "0" "465" "0" "c.461_465delinsTCAGGGAGGCTCTTCAA" "r.(?)" "p.(Tyr154_His155delinsPheArgGluAlaLeuGln)" "3"
"0000794136" "00018730" "99" "475" "0" "475" "0" "c.475del" "r.(?)" "p.(Ala159Glnfs*2)" "3"
"0000794165" "00018730" "90" "554" "0" "555" "0" "c.554_555insTGTTGCAGGGGC" "r.(?)" "p.(Ala185_Gly186insValAlaGlyAla)" "4"
"0000794166" "00018730" "99" "752" "0" "752" "0" "c.752T>A" "r.(?)" "p.(Leu251Gln)" "5"
"0000794167" "00018730" "99" "820" "0" "820" "0" "c.820A>G" "r.(?)" "p.(Ile274Val)" "5"
"0000794168" "00018730" "99" "852" "0" "852" "0" "c.852dup" "r.(?)" "p.(Thr285Tyrfs*20)" "5"
"0000794169" "00018730" "99" "965" "0" "965" "0" "c.965T>G" "r.(?)" "p.(Val322Gly)" "6"
"0000794170" "00018730" "99" "1030" "-2" "1030" "-2" "c.1030-2A>G" "r.spl?" "p.?" "6i"
"0000794171" "00018730" "77" "1119" "0" "1142" "0" "c.1119_1142del" "r.(?)" "p.(Leu374_Ala381del)" "7"
"0000794174" "00018730" "99" "1157" "0" "1158" "0" "c.1157_1158del" "r.(?)" "p.(Leu386Argfs*38)" "7"
"0000794175" "00018730" "99" "1184" "0" "1185" "0" "c.1184_1185del" "r.(?)" "p.(Leu395Profs*29)" "7"
"0000794176" "00018730" "79" "1219" "0" "1219" "0" "c.1219C>T" "r.(?)" "p.(Gln407*)" "7"
"0000794177" "00018730" "99" "1368" "0" "1370" "0" "c.1368_1370del" "r.(?)" "p.(Ala459del)" "8"
"0000794178" "00018730" "99" "1396" "0" "1396" "0" "c.1396del" "r.(?)" "p.(Arg466Alafs*110)" "8"
"0000794179" "00018730" "99" "1445" "0" "1445" "0" "c.1445G>A" "r.(?)" "p.(Trp482*)" "8"
"0000794180" "00018730" "99" "1483" "0" "1485" "0" "c.1483_1485del" "r.(?)" "p.(Val495del)" "8"
"0000794181" "00018730" "99" "0" "0" "0" "0" "c.(550+1_551-1)_(*422?)del" "r.(?)" "p?" "3i_8_"
"0000794182" "00018730" "99" "52" "-1" "550" "1" "c.(51+1_52-1)_(550+1_551-1)dup" "r.(?)" "p?" "2i_3i"
"0000794183" "00018730" "99" "551" "-1" "685" "1" "c.(550+1_551-1)_(685+1_686-1)dup" "r.(551_685)dup" "p.(Gly184_Pro228)dup" "3i_4i"
"0000794184" "00018730" "33" "5" "0" "5" "0" "c.5C>T" "r.(?)" "p.(Ala2Val)" "2"
"0000794185" "00018730" "99" "-161" "0" "-161" "0" "c.[-161A>G];[-161A>G]" "r.(=)" "p.(=)" "1;1"
"0000794186" "00018730" "33" "-100" "0" "-100" "0" "c.-100C>G" "r.(=)" "p.(=)" "1"
"0000794788" "00018730" "99" "1463" "0" "1463" "0" "c.1463dup" "r.(?)" "p.(Val490Cysfs*8)" "8"
"0000798622" "00018730" "99" "309" "0" "312" "0" "c.309_312del" "r.(?)" "p.(Pro105Leufs*42)" "3"
"0000805194" "00018730" "99" "120" "0" "121" "0" "c.120_121del" "r.(?)" "p.(Gly41Argfs*16)" "3"
"0000805195" "00018730" "33" "849" "0" "849" "0" "c.849C>T" "r.(?)" "p.(Ser283=)" "5"
"0000805196" "00018730" "99" "889" "1" "889" "1" "c.889+1G>T" "r.spl?" "p.?" "5i"
"0000812909" "00018730" "31" "551" "-155" "551" "-154" "c.551-155_551-154del" "r.(=)" "p.(=)" "3i"
"0000812912" "00018730" "30" "685" "315" "685" "315" "c.685+315T>C" "r.(=)" "p.(=)" "4i"
"0000812992" "00018730" "99" "1333" "0" "1336" "0" "c.1333_1336del" "r.(?)" "p.(Thr445Cysfs*4)" "8"
"0000812993" "00018730" "99" "1263" "0" "1264" "0" "c.1263_1264dup" "r.(?)" "p.(Ser422Phefs*10)" "8"
"0000812994" "00018730" "99" "1478" "0" "1478" "0" "c.1478G>T" "r.(?)" "p.(Gly493Val)" "8"
"0000817285" "00018730" "11" "551" "-162" "551" "-154" "c.551-162_551-154del" "r.(=)" "p.(=)" "3i"
"0000817296" "00018730" "33" "551" "-155" "551" "-155" "c.551-155A>G" "r.(=)" "p.(=)" "3i"
"0000817354" "00018730" "50" "1249" "5" "1249" "5" "c.1249+5G>C" "r.spl?" "p.?" "7i"
"0000817355" "00018730" "10" "1250" "-282" "1250" "-282" "c.1250-282T>C" "r.(=)" "p.(=)" "7i"
"0000823172" "00018730" "11" "1257" "0" "1257" "0" "c.1257C>T" "r.(=)" "p.(Phe419=)" "8"
"0000824906" "00018730" "99" "816" "0" "818" "0" "c.816_818del" "r.(?)" "p.(Asn272del)" "5"
"0000831996" "00018730" "99" "52" "-10" "52" "-10" "c.52-10T>A" "r.(=)" "p.(=)" "2i"
"0000832554" "00018730" "99" "0" "0" "0" "0" "c.[536C=/>T]" "r.(?)" "p.(Thr179Ile)" "3"
"0000839675" "00018730" "99" "3" "0" "73" "0" "c.3_73del" "r.?" "p.?" "2_3"
"0000842305" "00018730" "99" "764" "0" "764" "0" "c.764dup" "r.(?)" "p.(Ser255Argfs*2)" "5"
"0000843071" "00018730" "99" "1030" "-1" "1249" "1" "c.(1029-1_1030-1)_(1249+1_1250-1)dup" "r.0?" "p.0?" "6i_7i"
"0000843073" "00018730" "99" "939" "0" "1029" "2515" "c.939_1029+2515del" "r.?" "p.?" "6_7i"
"0000843074" "00018730" "97" "596" "0" "596" "0" "c.596A>C" "r.(?)" "p.(Tyr199Ser)" "4"
"0000843075" "00018730" "99" "797" "0" "800" "0" "c.797_800delinsCTTGGAGCTCAAGAACTTGGAGCT" "r.(?)" "p.(Val266Alafs*20)" "5"
"0000843076" "00018730" "99" "812" "0" "812" "0" "c.812dup" "r.(?)" "p.(Asn271Lysfs*34)" "5"
"0000843508" "00018730" "99" "685" "1" "685" "1" "c.685+1del" "r.spl?" "p.?" "4i"
"0000844770" "00018730" "99" "615" "0" "615" "0" "c.615T>G" "r.(?)" "p.(Cys205Trp)" "4"
"0000844837" "00018730" "99" "994" "0" "994" "0" "c.994del" "r.(?)" "p.(Val332Trpfs*9)" "6"
"0000844838" "00018730" "79" "1250" "-1" "1250" "-1" "c.1250-1G>C" "r.spl?" "p.?" "7i"
"0000844839" "00018730" "99" "1361" "0" "1361" "0" "c.1361del" "r.(?)" "p.(Val454Glyfs*122)" "8"
"0000844842" "00018730" "79" "1429" "0" "1429" "0" "c.1429T>C" "r.(?)" "p.(Phe477Leu)" "8"
"0000847292" "00018730" "99" "296" "0" "303" "0" "c.296_303del" "r.(?)" "p.(Ile100Hisfs*30)" "3"
"0000853032" "00018730" "30" "1214" "0" "1214" "0" "c.1214C>A" "r.(?)" "p.(Thr405Asn)" "7"
"0000862584" "00018730" "30" "686" "-5" "686" "-5" "c.686-5C>G" "r.spl?" "p.?" "4i"
"0000862585" "00018730" "30" "1218" "0" "1218" "0" "c.1218C>T" "r.(?)" "p.(Ser406=)" ""
"0000878038" "00018730" "99" "49" "0" "49" "0" "c.49G>A" "r.(?)" "p.(Gly17Arg)" "2"
"0000878039" "00018730" "99" "74" "0" "74" "0" "c.74del" "r.(?)" "p.(Asn25Metfs*54)" "3"
"0000878041" "00018730" "90" "100" "0" "100" "0" "c.100C>A" "r.(?)" "p.(Pro34Thr)" "3"
"0000878043" "00018730" "99" "172" "0" "181" "0" "c.172_181del" "r.(?)" "p.(Pro58Argfs*18)" "3"
"0000878045" "00018730" "99" "197" "0" "197" "0" "c.197dup" "r.(?)" "p.(Thr67Aspfs*15)" "3"
"0000878329" "00018730" "99" "229" "0" "229" "0" "c.229A>T" "r.(?)" "p.(Lys77*)" "3"
"0000878330" "00018730" "99" "232" "0" "232" "0" "c.232del" "r.(?)" "p.(Ile78*)" "3"
"0000878331" "00018730" "99" "377" "0" "377" "0" "c.377del" "r.(?)" "p.(Pro126Leufs*22)" "3"
"0000878332" "00018730" "99" "550" "1" "550" "1" "c.550+1G>T" "r.(52_550del)" "p.?" "3i"
"0000878335" "00018730" "99" "623" "0" "623" "0" "c.623dup" "r.(?)" "p.(Ala209Glyfs*48)" "4"
"0000878336" "00018730" "99" "635" "0" "635" "0" "c.635dup" "r.(?)" "p.(Phe213Leufs*44)" "4"
"0000878337" "00018730" "99" "673" "0" "675" "0" "c.673_675del" "r.(?)" "p.(Phe225del)" "4"
"0000878385" "00018730" "99" "708" "0" "708" "0" "c.708T>G" "r.(?)" "p.(Phe236Leu)" "5"
"0000878386" "00018730" "99" "733" "0" "736" "0" "c.733_736dup" "r.(?)" "p.(Ser246Lysfs*12)" "5"
"0000878387" "00018730" "33" "725" "0" "725" "0" "c.725C>T" "r.(?)" "p.(Thr242Ile)" "5"
"0000878388" "00018730" "30" "721" "0" "721" "0" "c.721C>T" "r.(?)" "p.(Arg241Trp)" "5"
"0000878389" "00018730" "77" "748" "0" "749" "0" "c.748_749del" "r.(?)" "p.(Val250Profs*6)" "5"
"0000878390" "00018730" "99" "779" "0" "779" "0" "c.779dup" "r.(?)" "p.(Leu261Alafs*44)" "5"
"0000878391" "00018730" "30" "749" "0" "749" "0" "c.749T>A" "r.(?)" "p.(Val250Asp)" "5"
"0000878392" "00018730" "30" "769" "0" "769" "0" "c.769G>A" "r.(?)" "p.(Ala257Thr)" "5"
"0000878393" "00018730" "30" "781" "0" "781" "0" "c.781C>T" "r.(?)" "p.(Leu261Phe)" "5"
"0000878394" "00018730" "99" "785" "0" "785" "0" "c.785dup" "r.(?)" "p.(Asn263Glnfs*42)" "5"
"0000878395" "00018730" "30" "808" "0" "808" "0" "c.808A>G" "r.(?)" "p.(Thr270Ala)" "5"
"0000878396" "00018730" "99" "941" "0" "942" "0" "c.941_942insTC" "r.(?)" "p.(Phe315Profs*7)" "6"
"0000878430" "00018730" "99" "951" "0" "951" "0" "c.951dup" "r.(?)" "p.(Ser318Leufs*10)" "6"
"0000878431" "00018730" "33" "826" "0" "826" "0" "c.826C>T" "r.(?)" "p.(Arg276Trp)" "5"
"0000878432" "00018730" "30" "827" "0" "827" "0" "c.827G>A" "r.(?)" "p.(Arg276Gln)" "5"
"0000878434" "00018730" "33" "856" "0" "856" "0" "c.856C>G" "r.(?)" "p.(Arg286Gly)" "5"
"0000878435" "00018730" "30" "862" "0" "862" "0" "c.862G>A" "r.(?)" "p.(Val288Ile)" "5"
"0000878438" "00018730" "30" "953" "0" "953" "0" "c.953C>T" "r.(?)" "p.(Ser318Leu)" "6"
"0000878439" "00018730" "99" "983" "0" "984" "0" "c.983_984delinsC" "r.(?)" "p.(Lys328Thrfs*13)" "6"
"0000878440" "00018730" "39" "988" "0" "988" "0" "c.988T>G" "r.(?)" "p.(Tyr330Asp)" "6"
"0000878441" "00018730" "30" "997" "0" "997" "0" "c.997G>A" "r.(?)" "p.(Ala333Thr)" "6"
"0000878442" "00018730" "99" "1010" "0" "1010" "0" "c.1010del" "r.(?)" "p.(Asp337Alafs*4)" "6"
"0000878443" "00018730" "99" "1019" "0" "1019" "0" "c.1019del" "r.(?)" "p.(Leu340*)" "6"
"0000878444" "00018730" "99" "1051" "0" "1051" "0" "c.1051del" "r.(?)" "p.(His351Thrfs*3)" "7"
"0000878445" "00018730" "33" "1049" "0" "1049" "0" "c.1049C>T" "r.(?)" "p.(Ser350Phe)" "7"
"0000878446" "00018730" "99" "1072" "0" "1072" "0" "c.1072del" "r.(?)" "p.(Leu358Trpfs*6)" "7"
"0000878447" "00018730" "99" "1094" "0" "1094" "0" "c.1094dup" "r.(?)" "p.(His365Glnfs*4)" "7"
"0000878448" "00018730" "99" "1100" "0" "1100" "0" "c.1100T>G" "r.(?)" "p.(Leu367Arg)" "7"
"0000878449" "00018730" "30" "1147" "0" "1147" "0" "c.1147A>G" "r.(?)" "p.(Met383Val)" "7"
"0000878450" "00018730" "99" "1186" "0" "1186" "0" "c.1186del" "r.(?)" "p.(Leu396*)" "7"
"0000878451" "00018730" "97" "1192" "0" "1192" "0" "c.1192C>G" "r.(?)" "p.(Leu398Val)" "7"
"0000878452" "00018730" "99" "1193" "0" "1193" "0" "c.1193T>G" "r.(?)" "p.(Leu398Arg)" "7"
"0000878453" "00018730" "99" "1249" "2" "1249" "2" "c.1249+2T>C" "r.(1030_1249del)" "p.?" "7i"
"0000878454" "00018730" "79" "1249" "0" "1249" "0" "c.1249G>T" "r.(?)" "p.(Glu417*)" "7"
"0000878560" "00018730" "99" "1269" "0" "1269" "0" "c.1269T>A" "r.(?)" "p.(Tyr423*)" "8"
"0000878562" "00018730" "77" "1289" "0" "1289" "0" "c.1289T>G" "r.(?)" "p.(Leu430Arg)" "8"
"0000878565" "00018730" "99" "1379" "0" "1379" "0" "c.1379C>G" "r.(?)" "p.(Ser460Cys)" "8"
"0000878568" "00018730" "99" "1422" "0" "1422" "0" "c.1422G>C" "r.(?)" "p.(Gln474His)" "8"
"0000878569" "00018730" "99" "1424" "0" "1424" "0" "c.1424A>C" "r.(?)" "p.(Gln475Pro)" "8"
"0000878570" "00018730" "99" "1425" "0" "1425" "0" "c.1425G>T" "r.(?)" "p.(Gln475His)" "8"
"0000878571" "00018730" "99" "52" "-1" "685" "1" "c.(51+1_52-1)_(685+1_686-1)dup" "r.(52_685)dup" "p.(?)" "_3_4_"
"0000878574" "00018730" "99" "-22" "-1" "685" "1" "c.(-23+1_-22-1)_(685+1_686-1)del" "r.(52_685del)" "p.(?)" "_2_4_"
"0000879096" "00018730" "99" "1192" "0" "1192" "0" "c.[1192C>G(;)1424A>C]" "r.(?)" "p.[(Leu398Val)(;)p.(Gln475Pro)]" "7;8"
"0000879696" "00018730" "55" "293" "0" "293" "0" "c.293C>T" "r.(?)" "p.(Pro98Leu)" "3"
"0000889989" "00018730" "53" "5" "0" "5" "0" "c.5C>T" "r.(?)" "p.(Ala2Val)" "2"
"0000889990" "00018730" "30" "142" "0" "142" "0" "c.142A>G" "r.(?)" "p.(Thr48Ala)" "3"
"0000889991" "00018730" "33" "849" "0" "849" "0" "c.849C>T" "r.(?)" "p.(Ser283=)" "5"
"0000900606" "00018730" "99" "551" "-328" "685" "429" "c.551-328_685+429del" "r.(551_685del)" "p.(Gly184_Pro228del)" "3i_4i"
"0000900607" "00018730" "99" "286" "0" "301" "0" "c.286_301del" "r.(?)" "p.(Thr96Asnfs*47)" "3"
"0000900608" "00018730" "99" "1187" "0" "1187" "0" "c.1187dup" "r.(?)" "p.(Thr397Asnfs*28)" "7"
"0000900609" "00018730" "99" "1474" "0" "1474" "0" "c.1474del" "r.(?)" "p.(Met492Trpfs*84)" "8"
"0000900610" "00018730" "99" "373" "0" "373" "0" "c.373G>T" "r.(?)" "p.(Gly125*)" "3"
"0000902927" "00018730" "99" "253" "0" "253" "0" "c.253G>T" "r.(?)" "p.(Glu85*)" "3"
"0000902929" "00018730" "99" "982" "0" "982" "0" "c.982del" "r.(?)" "p.(Lys328Argfs*13)" "6"
"0000903221" "00018730" "11" "551" "-16" "551" "-16" "c.551-16C>G" "r.(=)" "p.(=)" "3i"
"0000903296" "00018730" "30" "890" "-15" "890" "-14" "c.890-15_890-14insG" "r.(=)" "p.(=)" "5i"
"0000903297" "00018730" "30" "935" "0" "935" "0" "c.935C>G" "r.(?)" "p.(Pro312Arg)" "6"
"0000903298" "00018730" "30" "968" "0" "968" "0" "c.968C>T" "r.(?)" "p.(Pro323Leu)" "6"
"0000904334" "00018730" "33" "169" "0" "169" "0" "c.169G>A" "r.(?)" "p.(Glu57Lys)" "3"
"0000904335" "00018730" "33" "518" "0" "518" "0" "c.518G>A" "r.(?)" "p.(Ser173Asn)" "3"
"0000904354" "00018730" "33" "540" "0" "540" "0" "c.540G>C" "r.(?)" "p.(Gln180His)" "3"
"0000904370" "00018730" "30" "641" "0" "641" "0" "c.641C>G" "r.(?)" "p.(Thr214Arg)" "4"
"0000904371" "00018730" "33" "647" "0" "647" "0" "c.647A>T" "r.(?)" "p.(Lys216Ile)" "4"
"0000904376" "00018730" "30" "770" "0" "770" "0" "c.770C>G" "r.(?)" "p.(Ala257Gly)" "5"
"0000905147" "00018730" "30" "1249" "12" "1249" "12" "c.1249+12C>A" "r.(=)" "p.(=)" "7i"
"0000905148" "00018730" "30" "1249" "20" "1249" "20" "c.1249+20G>A" "r.(=)" "p.(=)" "7i"
"0000905149" "00018730" "30" "1250" "-11" "1250" "-11" "c.1250-11T>G" "r.(=)" "p.(=)" "7i"
"0000905150" "00018730" "30" "1253" "0" "1253" "0" "c.1253T>A" "r.(?)" "p.(Phe418Tyr)" "8"
"0000905151" "00018730" "30" "1259" "0" "1259" "0" "c.1259A>G" "r.(?)" "p.(Asp420Gly)" "8"
"0000905152" "00018730" "31" "1273" "0" "1273" "0" "c.1273C>T" "r.(?)" "p.(Leu425Phe)" "8"
"0000905153" "00018730" "30" "1360" "0" "1360" "0" "c.1360G>T" "r.(?)" "p.(Val454Leu)" "8"
"0000905154" "00018730" "35" "1369" "0" "1369" "0" "c.1369G>T" "r.(?)" "p.(Ala457Ser)" "8"
"0000905155" "00018730" "30" "1499" "0" "1499" "0" "c.1499C>T" "r.(?)" "p.(Ala500Val)" "8"
"0000908394" "00018730" "99" "1481" "0" "1481" "0" "c.1481G>C" "r.(?)" "p.(Arg494Pro)" "8"
"0000908580" "00018730" "70" "559" "0" "559" "0" "c.559G>A" "r.(?)" "p.(Glu187Lys)" "4"
"0000908593" "00018730" "11" "1030" "-20" "1030" "-20" "c.1030-20A>G" "r.(=)" "p.(=)" "6i"
"0000908594" "00018730" "11" "1438" "0" "1438" "0" "c.1438G>A" "r.(?)" "p.(Val480Met)" "8"
"0000908595" "00018730" "13" "-21" "0" "-21" "0" "c.-21T>C" "r.(=)" "p.(=)" "2"
"0000908596" "00018730" "55" "800" "0" "800" "0" "c.800C>T" "r.(?)" "p.(Ala267Val)" "5"
"0000908597" "00018730" "99" "816" "0" "818" "0" "c.816_818del" "r.(?)" "p.(Asn272del)" "5"
"0000909410" "00018730" "99" "255" "0" "255" "0" "c.255del" "r.(?)" "p.(Glu85Aspfs*63)" "3"
"0000909412" "00018730" "99" "494" "0" "495" "0" "c.494_495insA" "r.(?)" "p.(Asn166Glnfs*91)" "3"
"0000909443" "00018730" "73" "1045" "0" "1045" "0" "c.1045C>T" "r.(?)" "p.(Leu349Phe)" "7"
"0000909444" "00018730" "99" "1195" "0" "1195" "0" "c.1195C>G" "r.(?)" "p.(Pro399Ala)" "7"
"0000909445" "00018730" "99" "1412" "0" "1412" "0" "c.1412T>G" "r.(?)" "p.(Phe471Cys)" "8"
"0000909446" "00018730" "99" "-23" "0" "51" "1" "c.(-191_-23)_(51+1_52-1)del" "r.0?" "p.0?" "_1_2i"
"0000909447" "00018730" "99" "686" "-1" "1029" "1" "c.(685+1_686-1)_(1029+1_1030-1)del" "r.(686_1029)del" "p.0?" "4i_6i"
"0000909453" "00018730" "99" "686" "-1" "1249" "1" "c.(685+1_686-1)_(1249+1_1250-1)del" "r.(686_1249)del" "p.0?" "_5_7_"
"0000913626" "00018730" "99" "65" "0" "65" "0" "c.65C>G" "r.(?)" "p.(Ser22*)" "3"
"0000916937" "00018730" "73" "244" "0" "244" "0" "c.244A>T" "r.(?)" "p.(Thr82Ser)" "3"
"0000918109" "00018730" "99" "330" "0" "331" "0" "c.330_331insC" "r.(?)" "p.(Thr111Hisfs*22)" "3"
"0000921574" "00018730" "99" "1127" "0" "1130" "0" "c.1127_1130dup" "r.(?)" "p.(Val378Phefs*48)" "7"
"0000922456" "00018730" "55" "1064" "0" "1064" "0" "c.1064del" "r.(?)" "p.(Leu355Trpfs*2)" "7"
"0000922457" "00018730" "50" "1078" "0" "1078" "0" "c.1078C>T" "r.(?)" "p.(Pro360Ser)" "7"
"0000922461" "00018730" "53" "-99" "0" "-99" "0" "c.-99C>G" "r.(=)" "p.(=)" "1"
"0000922477" "00018730" "50" "263" "0" "266" "0" "c.263_266dup" "r.(?)" "p.(Gln89Hisfs*45)" "3"
"0000922481" "00018730" "99" "-1998" "0" "98" "0" "c.-1998_98del" "r.?" "p.?" "_1_2"
"0000922482" "00018730" "99" "685" "637" "1029" "1084" "c.685+637_1029+1084del" "r.(?)" "p.(Asp229Glyfs*25)" "4i_6i"
"0000922483" "00018730" "99" "685" "637" "1249" "564" "c.685+637_1249+564del" "r.(?)" "p.(Asp229_Leu416del)" "4i_7i"
"0000927465" "00018730" "99" "550" "352" "685" "842" "c.550+352_685+842del" "r.(?)" "p.(Gly184_Pro228del)" "3i_4i"
"0000927692" "00018730" "30" "1258" "0" "1258" "0" "c.1258G>A" "r.(?)" "p.(Asp420Asn)" "8"
"0000927824" "00018730" "55" "553" "0" "553" "0" "c.553G>A" "r.(?)" "p.(Ala185Thr)" "4"
"0000927936" "00018730" "99" "512" "0" "512" "0" "c.512C>G" "r.(?)" "p.(Pro171Arg)" "3"
"0000933328" "00018730" "99" "550" "3" "550" "3" "c.550+3A>C" "r.spl?" "p.?" "3i"
"0000933329" "00018730" "99" "686" "-1" "686" "-1" "c.686-1G>T" "r.spl?" "p.?" "4i"
"0000933330" "00018730" "99" "151" "0" "152" "0" "c.151_152del" "r.(?)" "p.(Ser51Glnfs*6)" "3"
"0000933331" "00018730" "99" "726" "0" "777" "0" "c.726_777del" "r.(?)" "p.(Leu243Serfs*19)" "5"
"0000933332" "00018730" "99" "795" "0" "796" "0" "c.795_796delinsT" "r.(?)" "p.(Trp265Cysfs*14)" "5"
"0000933333" "00018730" "99" "1115" "0" "1115" "0" "c.1115del" "r.(?)" "p.(Gln372Argfs*25)" "7"
"0000933334" "00018730" "99" "1283" "0" "1283" "0" "c.1283del" "r.(?)" "p.(Cys428Leufs*3)" "8"
"0000933335" "00018730" "99" "1460" "0" "1466" "0" "c.1460_1466del" "r.(?)" "p.(Lys487Metfs*87)" "8"
"0000933343" "00018730" "99" "793" "0" "793" "0" "c.793T>G" "r.(?)" "p.(Trp265Gly)" "5"
"0000933344" "00018730" "99" "1361" "0" "1361" "0" "c.1361T>G" "r.(?)" "p.(Val454Gly)" "8"
"0000933453" "00018730" "99" "-23" "0" "1029" "1" "c.(-191_-23)_(1029+1_1030-1)del" "r.0?" "p.0?" "_1_6i"
"0000933654" "00018730" "99" "1069" "0" "1069" "0" "c.1069del" "r.(?)" "p.(Ile357Serfs*7)" "7"
"0000945942" "00018730" "99" "964" "0" "964" "0" "c.964G>A" "r.(?)" "p.(Val322Met)" "6"
"0000949719" "00018730" "99" "1157" "0" "1158" "0" "c.1157_1158del" "r.(?)" "p.(Leu386Argfs*38)" "7"
"0000952089" "00018730" "99" "51" "1" "51" "1" "c.51+1G>C" "r.(-22_51del)" "p.?" "2i"
"0000953658" "00018730" "99" "37" "0" "45" "0" "c.37_45del" "r.(?)" "p.(Leu13_Leu15del)" "2"
"0000954951" "00018730" "99" "685" "4" "685" "4" "c.685+4dup" "r.(710_745del)" "p.(Gly217_Pro228del)" "4i"
"0000959765" "00018730" "70" "1492" "0" "1492" "0" "c.1492C>T" "r.(?)" "p.(Pro498Ser)" ""
"0000971528" "00018730" "99" "1136" "0" "1136" "0" "c.1136T>C" "r.(?)" "p.(Phe379Ser)" "7"
"0000971590" "00018730" "99" "1189" "0" "1191" "0" "c.1189_1191dup" "r.(?)" "p.(Thr397dup)" "7"
"0000971591" "00018730" "99" "82" "0" "95" "0" "c.82_95del" "r.(?)" "p.(Ser28Glyfs*25)" "3"
"0000971592" "00018730" "99" "416" "0" "416" "0" "c.416A>G" "r.(?)" "p.(Glu139Gly)" "3"
"0000971593" "00018730" "99" "517" "0" "517" "0" "c.517A>C" "r.(?)" "p.(Ser173Arg)" "3"
"0000971627" "00018730" "99" "52" "-1" "550" "1" "c.(51+1_52-1)_(550+1_551-1)del" "r.(?)" "p?" "2i_3i"
"0000971628" "00018730" "99" "954" "0" "954" "0" "c.954del" "r.(?)" "p.(Val319Leufs*2)" "6"
"0000971629" "00018730" "99" "1038" "0" "1038" "0" "c.1038del" "r.(?)" "p.(Gln346Hisfs*8)" "7"
"0000971690" "00018730" "99" "1073" "0" "1081" "0" "c.1073_1081del" "r.(?)" "p.(Leu358_Pro360del)" "7"
"0000971691" "00018730" "99" "1127" "0" "1127" "0" "c.1127del" "r.(?)" "p.(Pro376Leufs*21)" "7"
"0000971692" "00018730" "99" "1331" "0" "1331" "0" "c.1331dup" "r.(?)" "p.(Thr445Aspfs*28)" "8"
"0000971693" "00018730" "99" "1371" "0" "1373" "0" "c.1371_1373del" "r.(?)" "p.(Ala459del)" "8"
"0000971694" "00018730" "99" "1346" "0" "1346" "0" "c.1346T>A" "r.(?)" "p.(Leu449Gln)" "8"
"0000971695" "00018730" "33" "5" "0" "5" "0" "c.5C>T" "r.(?)" "p.(Ala2Val)" "2;8"
"0000971696" "00018730" "99" "1397" "0" "1397" "0" "c.1397G>A" "r.(?)" "p.(Arg466His)" "2;8"
"0000971993" "00018730" "99" "-387" "0" "-387" "0" "c.(-387?)_(*422?)del" "r(0?)" "p(0?)" "_1_8_"
"0000979652" "00018730" "90" "52" "-1" "52" "-1" "c.52-1G>A" "r.spl?" "p.?" "2i"
"0000979653" "00018730" "50" "1070" "0" "1070" "0" "c.1070T>G" "r.(?)" "p.(Ile357Ser)" ""
"0000984945" "00018730" "99" "1438" "0" "1442" "0" "c.1438_1442delinsATGCC" "r.(?)" "p.(Val480_Leu481delinsMetPro)" "8"
"0000988417" "00018730" "99" "52" "-1" "52" "-1" "c.52-1G>C" "r.(-22_51del); r.spl?" "p.?" "2i"
"0000988418" "00018730" "99" "468" "0" "468" "0" "c.468del" "r.(?)" "p.(Phe157Serfs*4)" "3"
"0000988437" "00018730" "99" "550" "1" "550" "1" "c.550+1G>C" "r.spl?" "p.?" "3i"
"0000988453" "00018730" "99" "550" "2" "550" "2" "c.550+2T>A" "r.spl?" "p.?" "3i"
"0000988458" "00018730" "99" "599" "0" "599" "0" "c.599C>T" "r.(?)" "p.(Pro200Leu)" "4"
"0000988461" "00018730" "55" "664" "0" "667" "0" "c.664_667del" "r.(?)" "p.(Ser222Argfs*10)" "4"
"0000988462" "00018730" "99" "686" "-2" "686" "-2" "c.686-2A>G" "r.(746_949del)" "p.(Asp229_Ser296del)" "4i"
"0000988463" "00018730" "99" "713" "0" "713" "0" "c.713del" "r.(?)" "p.(Asn238Metfs*14)" "5"
"0000988464" "00018730" "55" "720" "0" "721" "0" "c.720_721dup" "r.(?)" "p.(Arg241Leufs*12)" "5"
"0000988467" "00018730" "55" "732" "0" "733" "0" "c.732_733dup" "r.(?)" "p.(Ser245Thrfs*8)" "5"
"0000988468" "00018730" "55" "732" "0" "732" "0" "c.732C>A" "r.(?)" "p.(Tyr244*)" "5"
"0000988469" "00018730" "79" "972" "0" "973" "0" "c.972_973insGCTGCATAAATGTCTTCTTTTGAGAAGTGTCTGTTCATGTCCTTCGCCCACTTTTTGATGGGGTTGTTTGTTNNNNNNNNNNAAAAAAAAAAAAAAAAAAAAAAAAGTGCCCATG" "r.(?)" "p.(Met325delinsAlaAlaTer)" "6"
"0000988470" "00018730" "99" "963" "0" "963" "0" "c.963del" "r.(?)" "p.(Val322Cysfs*3)" "6"
"0000988471" "00018730" "99" "981" "0" "987" "0" "c.981_987del" "r.(?)" "p.(Lys328Thrfs*11)" "6"
"0000988472" "00018730" "99" "986" "0" "986" "0" "c.986del" "r.(?)" "p.(Lys329Serfs*12)" "6"
"0000988473" "00018730" "99" "1012" "0" "1016" "0" "c.1012_1016del" "r.(?)" "p.(Gln338Phefs*29)" "6"
"0000988475" "00018730" "99" "1029" "1" "1029" "1" "c.1029+1del" "r.spl?" "p.?" "6i"
"0000988479" "00018730" "99" "1030" "0" "1030" "0" "c.1030del" "r.(?)" "p.(Val344Trpfs*10)" "7"
"0000988480" "00018730" "99" "1040" "0" "1040" "0" "c.1040T>C" "r.(?)" "p.(Leu347Pro)" "7"
"0000988481" "00018730" "99" "1133" "0" "1134" "0" "c.1133_1134insA" "r.(?)" "p.(Lys380Glnfs*45)" "7"
"0000988482" "00018730" "99" "1187" "0" "1187" "0" "c.1187T>G" "r.(?)" "p.(Leu396Arg)" "7"
"0000988637" "00018730" "99" "1243" "0" "1243" "0" "c.1243A>T" "r.(?)" "p.(Lys415*)" "7"
"0000988639" "00018730" "99" "1269" "0" "1269" "0" "c.1269del" "r.(?)" "p.(Tyr423*)" "8"
"0000988640" "00018730" "99" "1273" "0" "1273" "0" "c.1273del" "r.(?)" "p.(Asn426Thrfs*5)" "8"
"0000988641" "00018730" "99" "1306" "0" "1306" "0" "c.1306del" "r.(?)" "p.(Leu436Phefs*14)" "8"
"0000988642" "00018730" "99" "1337" "0" "1341" "0" "c.1337_1341del" "r.(?)" "p.(Val446Glyfs*25)" "8"
"0000988643" "00018730" "55" "1337" "0" "1337" "0" "c.1337T>A" "r.(?)" "p.(Val446Glu)" "8"
"0000988644" "00018730" "99" "1380" "0" "1380" "0" "c.1380del" "r.(?)" "p.(Ala461Profs*115)" "8"
"0000988645" "00018730" "99" "1393" "0" "1394" "0" "c.1393_1394del" "r.(?)" "p.(Ala465Profs*7)" "8"
"0000988703" "00018730" "99" "-953" "0" "345" "0" "c.-953_345del" "r.?" "p.?" "_1_3"
"0000988704" "00018730" "99" "686" "-10" "1503" "0" "c.686-10_1503del" "r.?" "p.?" "_5_8"
"0000988705" "00018730" "99" "0" "0" "0" "0" "c.(_-163)_(1029+20_1030-1)del" "r.?" "p.?" "_1_6_"
"0000988706" "00018730" "99" "0" "0" "0" "0" "c.(_-163)_(550+20_551-1)del" "r.?" "p.?" "_1_3_"
"0000988707" "00018730" "99" "0" "0" "0" "0" "c.(_-163)_(685+20_686-1)del" "r.?" "p.?" "_1_4_"
"0000988708" "00018730" "99" "686" "-20" "1029" "20" "c.(685+1_686-20)_(1029+20_1030-1)del" "r.(?)" "p.(Asp229Glyfs*25)" "_5_6_"
"0000988709" "00018730" "99" "551" "-20" "685" "20" "c.(550+1_551-20)_(685+20_686-1)del" "r.(551_685)del" "p.(Gly184_Pro228)del" "_4_"
"0001008547" "00018730" "99" "136" "0" "139" "0" "c.136_139delinsTTG" "r.(?)" "p.(Ala46Leufs*33)" "3"
"0001008548" "00018730" "99" "382" "0" "382" "0" "c.382dup" "r.(?)" "p.(Thr128Asnfs*5)" "3"
"0001008549" "00018730" "99" "523" "0" "526" "0" "c.523_526delinsTG" "r.(?)" "p.(Ala175Trpfs*81)" "3"
"0001008552" "00018730" "33" "656" "0" "656" "0" "c.656C>T" "r.(?)" "p.(Thr219Ile)" "4"
"0001017392" "00018730" "90" "52" "-1" "52" "-1" "c.52-1G>A" "r.(?)" "p.(?)" ""
"0001017394" "00018730" "99" "550" "0" "550" "0" "c.550G>C" "r.(?)" "p.(Gly184Arg)" ""
"0001017673" "00018730" "99" "64" "0" "64" "0" "c.64dup" "r.(?)" "p.(Ser22Phefs*36)" "3"
"0001017678" "00018730" "57" "79" "0" "85" "0" "c.79_85del" "r.(?)" "p.(Thr27Profs*50)" "3"
"0001017682" "00018730" "99" "82" "0" "82" "0" "c.82dup" "r.(?)" "p.(Ser28Lysfs*30)" "3"
"0001017686" "00018730" "99" "6" "0" "13" "0" "c.6_13del" "r.(?)" "p.(Ser3Aspfs*14)" "2"
"0001017687" "00018730" "99" "110" "0" "110" "0" "c.110dup" "r.(?)" "p.(Leu37Phefs*21)" "3"
"0001017688" "00018730" "99" "115" "0" "115" "0" "c.115del" "r.(?)" "p.(Asp39Thrfs*40)" "3"
"0001017689" "00018730" "99" "208" "0" "212" "0" "c.208_212del" "r.(?)" "p.(Ser70Asnfs*10)" "3"
"0001017690" "00018730" "99" "285" "0" "285" "0" "c.285del" "r.(?)" "p.(Thr96Profs*52)" "3"
"0001017691" "00018730" "99" "308" "0" "311" "0" "c.308_311dup" "r.(?)" "p.(Gln104Hisfs*30)" "3"
"0001017692" "00018730" "99" "377" "0" "378" "0" "c.377_378del" "r.(?)" "p.(Pro126Argfs*6)" "3"
"0001017694" "00018730" "99" "382" "0" "391" "0" "c.382_391dup" "r.(?)" "p.(Ser131Tyrfs*5)" "3"
"0001017695" "00018730" "99" "401" "0" "401" "0" "c.401dup" "r.(?)" "p.(Ser135Glufs*122)" "3"
"0001017696" "00018730" "99" "403" "0" "418" "0" "c.403_418del" "r.(?)" "p.(Ser135Profs*8)" "3"
"0001017697" "00018730" "99" "415" "0" "415" "0" "c.415G>T" "r.(?)" "p.(Glu139*)" "3"
"0001017730" "00018730" "99" "516" "0" "516" "0" "c.516del" "r.(?)" "p.(Phe172Leufs*39)" "3"
"0001017731" "00018730" "99" "539" "0" "543" "0" "c.539_543delinsT" "r.(?)" "p.(Gln180Leufs*30)" "3"
"0001017744" "00018730" "99" "554" "0" "554" "0" "c.554C>A" "r.(?)" "p.(Ala185Asp)" "4"
"0001017754" "00018730" "99" "594" "0" "600" "0" "c.594_600del" "r.(?)" "p.(Tyr199Argfs*10)" "4"
"0001017756" "00018730" "97" "-22" "-3" "-22" "-3" "c.-22-3C>G" "r.spl?" "p.?" "1i"
"0001017758" "00018730" "99" "452" "0" "452" "0" "c.452T>C" "r.(?)" "p.(Leu151Pro)" "3"
"0001017759" "00018730" "99" "458" "0" "458" "0" "c.458T>G" "r.(?)" "p.(Leu153Arg)" "3"
"0001017760" "00018730" "99" "519" "0" "519" "0" "c.519C>A" "r.(?)" "p.(Ser173Arg)" "3"
"0001017761" "00018730" "99" "620" "0" "620" "0" "c.620A>G" "r.(?)" "p.(His207Arg)" "4"
"0001017762" "00018730" "99" "704" "0" "721" "0" "c.704_721del" "r.(?)" "p.(Thr235_Ser240del)" "5"
"0001017763" "00018730" "99" "718" "0" "718" "0" "c.718T>C" "r.(?)" "p.(Ser240Pro)" "5"
"0001017764" "00018730" "99" "793" "0" "794" "0" "c.793_794insTGGCCACCT" "r.(?)" "p.(Thr264_Trp265insLeuAlaThr)" "5"
"0001017765" "00018730" "99" "808" "0" "808" "0" "c.808A>C" "r.(?)" "p.(Thr270Pro)" "5"
"0001017767" "00018730" "99" "809" "0" "809" "0" "c.809C>A" "r.(?)" "p.(Thr270Asn)" "5"
"0001017768" "00018730" "99" "874" "0" "874" "0" "c.874G>C" "r.(?)" "p.(Ala292Pro)" "5"
"0001017769" "00018730" "99" "971" "0" "971" "0" "c.971T>A" "r.(?)" "p.(Met324Lys)" "6"
"0001017770" "00018730" "77" "998" "0" "998" "0" "c.998C>A" "r.(?)" "p.(Ala333Asp)" "6"
"0001017771" "00018730" "33" "889" "81" "889" "81" "c.889+81G>C" "r.(=)" "p.(=)" "5i"
"0001017772" "00018730" "97" "995" "0" "995" "0" "c.995T>G" "r.(?)" "p.(Val332Gly)" "6"
"0001017773" "00018730" "99" "1108" "0" "1115" "0" "c.1108_1115delinsGATGCTCTCAGCCCTTCTGTTTTCAAGGCCATCATGGAGAAACT" "r.(?)" "p.(Met370_Gln372delinsAspAlaLeuSerProSerValPheLysAlaIleMetGluLysLeu)" "7"
"0001017776" "00018730" "99" "1109" "0" "1109" "0" "c.1109T>A" "r.(?)" "p.(Met370Lys)" "7"
"0001017777" "00018730" "99" "1193" "0" "1195" "0" "c.1193_1195dup" "r.(?)" "p.(Leu398dup)" "7"
"0001017778" "00018730" "99" "1477" "0" "1477" "0" "c.1477G>C" "r.(?)" "p.(Gly493Arg)" "8"
"0001017779" "00018730" "99" "1246" "0" "1247" "0" "c.1246_1247insGCTCTCAAATCA" "r.(?)" "p.(Leu416delinsCysSerGlnIleMet)" "7"
"0001017780" "00018730" "99" "1280" "0" "1280" "0" "c.1280T>C" "r.(?)" "p.(Leu427Pro)" "8"
"0001017781" "00018730" "99" "1287" "0" "1287" "0" "c.1287del" "r.(?)" "p.(Leu430*)" "8"
"0001017782" "00018730" "99" "1289" "0" "1299" "0" "c.1289_1299del" "r.(?)" "p.(Leu430Profs*39)" "8"
"0001017783" "00018730" "99" "1323" "0" "1344" "0" "c.1323_1344del" "r.(?)" "p.(Met441Ilefs*2)" "8"
"0001017784" "00018730" "99" "1325" "0" "1325" "0" "c.1325del" "r.(?)" "p.(Gln442Argfs*8)" "8"
"0001017785" "00018730" "99" "1352" "0" "1352" "0" "c.1352A>G" "r.(?)" "p.(Glu451Gly)" "8"
"0001017786" "00018730" "99" "1356" "0" "1356" "0" "c.1356dup" "r.(?)" "p.(Gly453Trpfs*20)" "8"
"0001017787" "00018730" "99" "1412" "0" "1412" "0" "c.1412T>C" "r.(?)" "p.(Phe471Ser)" "8"
"0001017788" "00018730" "99" "1439" "0" "1439" "0" "c.1439T>A" "r.(?)" "p.(Val480Glu)" "8"
"0001017789" "00018730" "99" "1479" "0" "1479" "0" "c.1479dup" "r.(?)" "p.(Arg494Alafs*4)" "8"
"0001017790" "00018730" "99" "1481" "0" "1481" "0" "c.1481delinsCTGACCCCATGA" "r.(?)" "p.(Arg494Profs*86)" "8"
"0001017791" "00018730" "99" "1328" "0" "1328" "0" "c.1328A>G" "r.(?)" "p.(His443Arg)" "8"
"0001017792" "00018730" "77" "167" "0" "167" "0" "c.167T>C" "r.(?)" "p.(Val56Ala)" "3"
"0001017793" "00018730" "31" "52" "-130" "52" "-130" "c.52-130C>T" "r.(=)" "p.(=)" "2i"
"0001017794" "00018730" "99" "671" "0" "671" "0" "c.671T>G" "r.(?)" "p.(Ile224Ser)" "4"
"0001017796" "00018730" "99" "820" "0" "820" "0" "c.820A>G" "r.(?)" "p.(Ile274Val)" "5"
"0001017798" "00018730" "99" "723" "0" "723" "0" "c.723dup" "r.(?)" "p.(Thr242Aspfs*15)" "5"
"0001017799" "00018730" "99" "744" "0" "744" "0" "c.744dup" "r.(?)" "p.(Arg249Glnfs*8)" "5"
"0001017800" "00018730" "99" "771" "0" "774" "0" "c.771_774delinsTCATCAACTGTTGATGAG" "r.(?)" "p.(Asn258Hisfs*26)" "5"
"0001017801" "00018730" "99" "779" "0" "780" "0" "c.779_780del" "r.(?)" "p.(Glu260Alafs*44)" "5"
"0001017804" "00018730" "99" "787" "0" "794" "0" "c.787_794dup" "r.(?)" "p.(Trp265*)" "5"
"0001017805" "00018730" "99" "808" "0" "809" "0" "c.808_809delinsCAA" "r.(?)" "p.(Thr270Glnfs*35)" "5"
"0001017806" "00018730" "99" "846" "0" "846" "0" "c.846del" "r.(?)" "p.(Ser283Profs*13)" "5"
"0001017807" "00018730" "99" "860" "0" "860" "0" "c.860T>G" "r.(?)" "p.(Leu287Arg)" "5"
"0001017809" "00018730" "99" "925" "0" "925" "0" "c.925A>T" "r.(?)" "p.(Arg309*)" "6"
"0001017810" "00018730" "99" "976" "0" "980" "0" "c.976_980delinsTACCCTGTG" "r.(?)" "p.(Asn326Tyrfs*13)" "6"
"0001017811" "00018730" "99" "1113" "0" "1113" "0" "c.1113del" "r.(?)" "p.(Glu371Aspfs*26)" "7"
"0001017814" "00018730" "99" "1153" "0" "1153" "0" "c.1153A>T" "r.(?)" "p.(Lys385*)" "7"
"0001017815" "00018730" "99" "1188" "0" "1189" "0" "c.1188_1189delinsC" "r.(?)" "p.(Thr397Hisfs*7)" "7"
"0001017820" "00018730" "99" "1249" "2" "1249" "2" "c.1249+2T>G" "r.spl?" "p.?" "7i"
"0001017838" "00018730" "77" "698" "0" "698" "0" "c.698G>C" "r.(?)" "p.(Arg233Thr)" "4"
"0001017942" "00018730" "77" "707" "0" "707" "0" "c.707T>G" "r.(?)" "p.(Phe236Cys)" "5"
"0001018802" "00018730" "99" "1503" "0" "1503" "0" "c.1503A>C" "r.(?)" "p.(*501Cysext*46)" "8"
"0001020259" "00018730" "99" "809" "0" "809" "0" "c.809C>T" "r.(?)" "p.(Thr270Ile)" "5"
"0001020738" "00018730" "99" "890" "-1" "1029" "1" "c.(889+1_890-1)_(1029+1_1030-1)dup" "r.(890_1029)dup" "p.?" "4i_5i"
"0001021588" "00018730" "99" "1396" "0" "1396" "0" "c.1396C>G" "r.(?)" "p.(Arg466Gly)" "8"
"0001021589" "00018730" "55" "1029" "84" "1029" "84" "c.1029+84G>A" "r.(=)" "p.(=)" "6i"
"0001021668" "00018730" "99" "6" "0" "6" "0" "c.6dup" "r.(?)" "p.(Ser3Leufs*17)" "2"
"0001023911" "00018730" "33" "651" "0" "651" "0" "c.651T>A" "r.(=)" "p.(=)" "4"
"0001023913" "00018730" "99" "664" "0" "665" "0" "c.664_665del" "r.(?)" "p.(Gln223Aspfs*33)" "4"
"0001023914" "00018730" "99" "953" "0" "953" "0" "c.953C>A" "r.(?)" "p.(Ser318*)" "5"
"0001023915" "00018730" "99" "890" "-1" "890" "-1" "c.[890-1G=/>C]" "r.(890_1029del)" "p.?" "5i"
"0001027542" "00018730" "99" "551" "-20" "685" "20" "c.(550+1_551-20)_(685+20_686-1)dup" "r.(551_685)dup" "p.(Gly184_Pro228)dup" "_4_"
"0001029883" "00018730" "97" "101" "0" "101" "0" "c.101del" "r.(?)" "p.(Pro34Glnfs*45)" "3"
"0001029884" "00018730" "97" "202" "0" "206" "0" "c.202_206del" "r.(?)" "p.(Thr68Leufs*12)" "3"
"0001029885" "00018730" "99" "508" "0" "508" "0" "c.508T>C" "r.(?)" "p.(Ser170Pro)" "3"
"0001029887" "00018730" "99" "700" "0" "700" "0" "c.700del" "r.(?)" "p.(Asp234Thrfs*4)" "5"
"0001029888" "00018730" "99" "899" "0" "899" "0" "c.899dup" "r.(?)" "p.(Thr301Aspfs*4)" "6"
"0001029889" "00018730" "99" "983" "0" "994" "0" "c.983_994del" "r.(?)" "p.(Lys328_Val332delinsMet)" "6"
"0001029890" "00018730" "99" "1198" "0" "1198" "0" "c.1198del" "r.(?)" "p.(Arg400Alafs*4)" "7"
"0001029891" "00018730" "99" "1250" "-2" "1250" "-2" "c.1250-2A>C" "r.spl?" "p.?" "7i"
"0001030008" "00018730" "99" "0" "0" "0" "0" "с.1442_1443insGCTGCGTGCT" "r.(?)" "p.(Trp482Leufs*19)" "8"
"0001030118" "00018730" "99" "914" "0" "915" "0" "c.914_915dup" "r.(?)" "p.(Lys306Profs*16)" "6"
"0001030119" "00018730" "99" "1238" "0" "1238" "0" "c.1238T>G" "r.(?)" "p.(Met413Arg)" "7"
"0001030191" "00018730" "99" "990" "0" "1029" "16" "c.990_1029+16del" "r.?" "p.?" "6_6i"
"0001038520" "00018730" "50" "5" "0" "5" "0" "c.5C>T" "r.(?)" "p.(Ala2Val)" ""
"0001038521" "00018730" "30" "751" "0" "751" "0" "c.751C>T" "r.(?)" "p.(Leu251=)" ""
"0001044610" "00018730" "99" "1067" "0" "1067" "0" "c.1067T>A" "r.(?)" "p.(Val356Glu)" "7"
"0001045045" "00018730" "90" "316" "0" "316" "0" "c.316del" "r.(?)" "p.(Thr106LeufsTer42)" ""
"0001046994" "00018730" "99" "496" "0" "497" "0" "c.496_497insGACA" "r.(?)" "p.(Asn166Argfs*92)" "3"
"0001046995" "00018730" "10" "468" "0" "468" "0" "c.468C>T" "r.(=)" "p.(=)" "3"
"0001047491" "00018730" "99" "1291" "0" "1291" "0" "c.1291A>C" "r.(?)" "p.(Thr431Pro)" "8"
"0001047492" "00018730" "99" "1327" "0" "1327" "0" "c.1327C>A" "r.(?)" "p.(His444Asn)" "8"
"0001047494" "00018730" "99" "1027" "0" "1027" "0" "c.1027A>T" "r.(?)" "p.(Lys343*)" "6"
"0001047497" "00018730" "99" "0" "0" "0" "0" "c.(-23+1_-22-1)_(*272?)del" "r.(52_*272)del" "p.?" "_2_8_"
"0001047498" "00018730" "99" "-1272" "0" "686" "-538" "c.-1272_686-538del" "r.(-22_685?)del" "p.?" "_1_4i"
"0001047499" "00018730" "99" "1048" "0" "1049" "0" "c.1048_1049del" "r.(?)" "p.(Ser350Profs*18)" "6"
"0001048030" "00018730" "99" "295" "0" "302" "0" "c.295_302del" "r.(?)" "p.(Ile100Hisfs*30)" "3"
"0001048033" "00018730" "99" "433" "0" "455" "0" "c.433_455del" "r.(?)" "p.(Val147Profs*102)" "3"
"0001048035" "00018730" "55" "705" "0" "706" "0" "c.705_706del" "r.(?)" "p.(Phe236Cysfs*20)" "5"
"0001048036" "00018730" "55" "807" "0" "809" "0" "c.807_809dup" "r.(?)" "p.(Thr270dup)" "5"
"0001048061" "00018730" "55" "2440" "0" "2440" "0" "c.*937del" "r.(=)" "p.(=)" "8_"
"0001048062" "00018730" "55" "2447" "0" "2447" "0" "c.*944del" "r.(=)" "p.(=)" "8_"
"0001048415" "00018730" "99" "545" "0" "545" "0" "c.545T>C" "r.(?)" "p.(Leu182Pro)" "3"
"0001048417" "00018730" "99" "997" "0" "997" "0" "c.997dup" "r.(?)" "p.(Ala333Glyfs*5)" "6"
"0001048418" "00018730" "97" "1226" "0" "1226" "0" "c.1226T>G" "r.(?)" "p.(Met409Arg)" "7"
"0001048419" "00018730" "99" "1301" "0" "1301" "0" "c.1301del" "r.(?)" "p.(Pro434Glnfs*16)" "8"
"0001048775" "00018730" "99" "1436" "0" "1437" "0" "c.1436_1437dup" "r.(?)" "p.(Val480Serfs*97)" "8"
"0001057715" "00018730" "99" "-45" "0" "1503" "0" "c.(?_-45)_(1503_?)del" "r.(0?)" "p.(0?)" "_1_8_"
"0001058195" "00018730" "30" "277" "0" "277" "0" "c.277G>A" "r.(?)" "p.(Glu93Lys)" "3"
"0001059325" "00018730" "99" "1483" "0" "1483" "0" "c.1483G>A" "r.(?)" "p.(Val495Ile)" "8"
"0001059342" "00018730" "55" "1474" "0" "1474" "0" "c.1474A>G" "r.(?)" "p.(Met492Val)" "8"
"0001060089" "00018730" "99" "550" "616" "685" "288" "c.550+616_685+288del" "r.(?)" "p.(Gly184_Pro228del)" "3i_4i"
"0001060090" "00018730" "99" "551" "-604" "685" "1214" "c.551-604_685+1214del" "r.(551_685)del" "p.(Gly184_Pro228del)" "3i_4i"
"0001060449" "00018730" "99" "796" "0" "796" "0" "c.796del" "r.(?)" "p.(Val266Trpfs*13)" "5"
"0001060451" "00018730" "99" "911" "0" "922" "0" "c.911_922del" "r.(?)" "p.(Asp304_Thr308delinsAla)" "6"
"0001061949" "00018730" "51" "294" "0" "314" "0" "c.294_314dup" "r.(?)" "p.(Ile100_Thr106dup)" "3"
"0001062511" "00018730" "99" "23" "0" "26" "0" "c.23_26dup" "r.(?)" "p.(Leu10Aspfs*11)" "2"
"0001062512" "00018730" "99" "1360" "0" "1360" "0" "c.1360del" "r.(?)" "p.(Val454Trpfs*122)" "8"
"0001062782" "00018730" "99" "1114" "0" "1114" "0" "c.1114C>T" "r.(?)" "p.(Gln372*)" "8"
"0001065471" "00018730" "50" "1199" "0" "1199" "0" "c.1199G>T" "r.(?)" "p.(Arg400Leu)" ""
"0001068245" "00018730" "99" "336" "0" "337" "0" "c.336_337insC" "r.(?)" "p.(Ser113Leufs*20)" "3"
"0001070757" "00018730" "99" "76" "0" "76" "0" "c.76del" "r.(?)" "p.(Ala26Leufs*53)" "3"
"0001070759" "00018730" "97" "1480" "0" "1480" "0" "c.1480C>G" "r.(?)" "p.(Arg494Gly)" "8"
"0001071437" "00018730" "99" "991" "0" "991" "0" "c.991C>A" "r.(?)" "p.(Pro331Thr)" "6"
"0001074612" "00018730" "97" "66" "0" "70" "0" "c.66_70del" "r.(?)" "p.(Asn23Lysfs*33)" "3"
"0001074703" "00018730" "99" "356" "0" "356" "0" "c.356del" "r.(?)" "p.(Thr119Metfs*29)" "3"
"0001074704" "00018730" "99" "452" "0" "452" "0" "c.452dup" "r.(?)" "p.(Lys152Glufs*105)" "3"
"0001074705" "00018730" "99" "541" "0" "541" "0" "c.541dup" "r.(?)" "p.(Val181Glyfs*76)" "3"
"0001074708" "00018730" "99" "686" "-1" "686" "-1" "c.686-1G>C" "r.(746_949del)" "p.(Asp229_Ser296del)" "4i"
"0001074713" "00018730" "99" "795" "0" "795" "0" "c.795G>A" "r.(?)" "p.(Trp265*)" "5"
"0001074714" "00018730" "99" "881" "0" "881" "0" "c.881dup" "r.(?)" "p.(Tyr294*)" "5"
"0001074715" "00018730" "99" "931" "0" "931" "0" "c.931del" "r.(?)" "p.(Glu311Asnfs*10)" "6"
"0001074716" "00018730" "99" "1000" "0" "1000" "0" "c.1000del" "r.(?)" "p.(His334Ilefs*7)" "6"
"0001076297" "00018730" "33" "857" "0" "857" "0" "c.857G>A" "r.(?)" "p.(Arg286His)" "5"
"0001078322" "00018730" "53" "997" "0" "997" "0" "c.997G>T" "r.(?)" "p.(Ala333Ser)" "6"
"0001078359" "00018730" "99" "1029" "2" "1029" "2" "c.1029+2T>A" "r.890_1029del" "p.(Ala297Glyfs*25)" "6i"
"0001078360" "00018730" "99" "933" "0" "934" "0" "c.933_934insGGAA" "r.(?)" "p.(Pro312Glyfs*17)" "6"
"0001078508" "00018730" "30" "166" "0" "166" "0" "c.166G>A" "r.(?)" "p.(Val56Ile)" "3"
"0001080017" "00018730" "99" "-207813" "0" "27831" "0" "c.-207813_*26328del" "r.0?" "p.0?" "_1_8_"
"0001081377" "00018730" "99" "148" "0" "148" "0" "c.148dup" "r.(?)" "p.(Ile50Asnfs*8)" "3"
"0001081378" "00018730" "99" "878" "0" "878" "0" "c.878T>G" "r.(?)" "p.(Ile293Ser)" "5"
"0001081379" "00018730" "99" "1141" "0" "1141" "0" "c.1141del" "r.(?)" "p.(Ala381Profs*16)" "7"
"0001082967" "00018730" "90" "1114" "0" "1114" "0" "c.1114C>T" "r.(?)" "p.(Gln372Ter)" ""
"0001083827" "00018730" "99" "1358" "0" "1359" "0" "c.1358_1359insCTGG" "r.(?)" "p.(Val454Trpfs*20)" "8"
"0001089472" "00018730" "99" "-22" "-15" "-22" "-3" "c.-22-15_-22-3del" "r.spl?" "p.?" "1i"
"0001089473" "00018730" "99" "863" "0" "863" "0" "c.863T>A" "r.(?)" "p.(Val288Asp)" "5"
"0001089474" "00018730" "99" "731" "0" "731" "0" "c.731dup" "r.(?)" "p.(Tyr244*)" "5"
"0001089475" "00018730" "99" "1455" "0" "1459" "0" "c.1455_1459dup" "r.(?)" "p.(Lys487Serfs*91)" "8"
"0001089476" "00018730" "99" "889" "3" "889" "3" "c.889+3A>C" "r.spl?" "p.?" "5i"
## Screenings_To_Variants ## Do not remove or alter this header ##
## Count = 1255
"{{screeningid}}" "{{variantid}}"
"0000230893" "0000472588"
"0000230894" "0000472589"
"0000230895" "0000472590"
"0000230898" "0000472592"
"0000230899" "0000472593"
"0000230900" "0000472594"
"0000230901" "0000472595"
"0000230902" "0000472596"
"0000230903" "0000472597"
"0000230904" "0000472598"
"0000230905" "0000472599"
"0000230906" "0000472600"
"0000230907" "0000472601"
"0000230908" "0000472602"
"0000230909" "0000472603"
"0000230910" "0000472604"
"0000230911" "0000472605"
"0000230912" "0000472606"
"0000230913" "0000472607"
"0000230914" "0000472608"
"0000230915" "0000472609"
"0000230916" "0000472610"
"0000230917" "0000472611"
"0000230918" "0000472612"
"0000230919" "0000472613"
"0000230920" "0000472614"
"0000230922" "0000472615"
"0000230923" "0000472617"
"0000230924" "0000472618"
"0000230925" "0000472619"
"0000230927" "0000472620"
"0000230928" "0000472622"
"0000230929" "0000472623"
"0000230930" "0000472624"
"0000230931" "0000472625"
"0000230932" "0000472626"
"0000230933" "0000472627"
"0000230934" "0000472628"
"0000230935" "0000472629"
"0000230936" "0000472630"
"0000230937" "0000472631"
"0000230938" "0000472632"
"0000230939" "0000472633"
"0000230941" "0000472635"
"0000230942" "0000472636"
"0000230943" "0000472637"
"0000230944" "0000472638"
"0000230945" "0000472639"
"0000230946" "0000472640"
"0000230947" "0000472641"
"0000230948" "0000472642"
"0000230949" "0000472643"
"0000230950" "0000472644"
"0000230951" "0000472645"
"0000230952" "0000472646"
"0000230953" "0000472647"
"0000230954" "0000472648"
"0000230955" "0000472649"
"0000230956" "0000472650"
"0000230957" "0000472651"
"0000230958" "0000472652"
"0000230960" "0000472654"
"0000230961" "0000472655"
"0000230963" "0000472656"
"0000230964" "0000472657"
"0000230965" "0000472658"
"0000230966" "0000472659"
"0000230967" "0000472660"
"0000230968" "0000472661"
"0000230970" "0000472662"
"0000230971" "0000472663"
"0000230972" "0000472664"
"0000230973" "0000472666"
"0000230974" "0000472667"
"0000230975" "0000472668"
"0000230977" "0000472671"
"0000230978" "0000472672"
"0000230979" "0000472673"
"0000230980" "0000472674"
"0000230981" "0000472675"
"0000230982" "0000472676"
"0000230983" "0000472677"
"0000230984" "0000472678"
"0000230985" "0000472679"
"0000230986" "0000472680"
"0000230987" "0000472681"
"0000230988" "0000472682"
"0000230989" "0000472683"
"0000230990" "0000472684"
"0000230992" "0000472686"
"0000230993" "0000472687"
"0000230994" "0000472688"
"0000230995" "0000472689"
"0000230996" "0000472690"
"0000230997" "0000472691"
"0000230998" "0000472692"
"0000230999" "0000472693"
"0000231000" "0000472694"
"0000231001" "0000472695"
"0000231002" "0000472696"
"0000231004" "0000472698"
"0000231005" "0000472699"
"0000231006" "0000472700"
"0000231007" "0000472701"
"0000231008" "0000472702"
"0000231009" "0000472703"
"0000231010" "0000472704"
"0000231011" "0000472705"
"0000231012" "0000472706"
"0000231013" "0000472707"
"0000231015" "0000472709"
"0000231016" "0000472710"
"0000231017" "0000472711"
"0000231018" "0000472712"
"0000231019" "0000472713"
"0000231020" "0000472714"
"0000241515" "0000592761"
"0000241582" "0000487592"
"0000245532" "0000592762"
"0000245559" "0000497705"
"0000245583" "0000497739"
"0000245598" "0000497763"
"0000245601" "0000497767"
"0000245606" "0000497773"
"0000245607" "0000497774"
"0000245609" "0000497777"
"0000245611" "0000497782"
"0000245614" "0000497784"
"0000245984" "0000498192"
"0000245985" "0000498193"
"0000245986" "0000498194"
"0000245986" "0000498195"
"0000245987" "0000498196"
"0000245988" "0000498197"
"0000246174" "0000498491"
"0000246175" "0000498492"
"0000246176" "0000498530"
"0000246177" "0000498531"
"0000246178" "0000498532"
"0000246182" "0000498541"
"0000246183" "0000498543"
"0000246311" "0000498898"
"0000246312" "0000498899"
"0000246315" "0000498902"
"0000246316" "0000498903"
"0000246317" "0000498904"
"0000246319" "0000498907"
"0000246319" "0000499467"
"0000246322" "0000498910"
"0000246322" "0000499468"
"0000246328" "0000498916"
"0000246340" "0000499065"
"0000246341" "0000499066"
"0000246456" "0000499181"
"0000246461" "0000499186"
"0000246510" "0000499235"
"0000246531" "0000499256"
"0000246531" "0000908593"
"0000246531" "0000908594"
"0000246531" "0000908595"
"0000246532" "0000499257"
"0000246533" "0000499258"
"0000246534" "0000499259"
"0000246535" "0000499260"
"0000246536" "0000499261"
"0000246538" "0000499263"
"0000246539" "0000499264"
"0000246541" "0000499266"
"0000246543" "0000499268"
"0000246544" "0000499269"
"0000246545" "0000499270"
"0000246829" "0000499619"
"0000246830" "0000499620"
"0000246857" "0000499665"
"0000246858" "0000499666"
"0000246859" "0000499667"
"0000246860" "0000499668"
"0000246861" "0000499669"
"0000246862" "0000499670"
"0000246864" "0000499672"
"0000246865" "0000499673"
"0000246867" "0000499675"
"0000246869" "0000499676"
"0000246872" "0000499679"
"0000246874" "0000499680"
"0000246875" "0000499684"
"0000246876" "0000499690"
"0000246877" "0000499697"
"0000246879" "0000499704"
"0000246909" "0000499739"
"0000246912" "0000499742"
"0000246914" "0000499748"
"0000246918" "0000499749"
"0000246919" "0000499750"
"0000246920" "0000499751"
"0000246921" "0000499752"
"0000246922" "0000499753"
"0000246961" "0000499801"
"0000246962" "0000499802"
"0000246963" "0000499803"
"0000246964" "0000499804"
"0000246966" "0000499806"
"0000246967" "0000499807"
"0000246968" "0000499808"
"0000246969" "0000499809"
"0000246970" "0000499810"
"0000246971" "0000499811"
"0000246972" "0000499812"
"0000246973" "0000499813"
"0000246974" "0000499814"
"0000246975" "0000499815"
"0000246977" "0000499817"
"0000246978" "0000499818"
"0000246979" "0000499819"
"0000246980" "0000499820"
"0000246981" "0000499821"
"0000246982" "0000499822"
"0000246983" "0000499823"
"0000246984" "0000499824"
"0000246985" "0000499825"
"0000246986" "0000499826"
"0000246987" "0000499827"
"0000246988" "0000499828"
"0000246989" "0000499829"
"0000246990" "0000499830"
"0000246991" "0000499831"
"0000246992" "0000499832"
"0000246993" "0000499833"
"0000247015" "0000499860"
"0000247016" "0000499861"
"0000247017" "0000499862"
"0000247018" "0000499863"
"0000247019" "0000499864"
"0000247020" "0000499865"
"0000247021" "0000499866"
"0000247688" "0000500555"
"0000247691" "0000500558"
"0000247692" "0000500559"
"0000247693" "0000500560"
"0000247694" "0000500561"
"0000247696" "0000500563"
"0000247697" "0000500564"
"0000247698" "0000500565"
"0000247724" "0000500594"
"0000247725" "0000500595"
"0000247728" "0000500597"
"0000247729" "0000500598"
"0000247730" "0000500599"
"0000247731" "0000500600"
"0000247732" "0000500601"
"0000247733" "0000500602"
"0000247734" "0000500603"
"0000247735" "0000500604"
"0000247736" "0000500605"
"0000247986" "0000500871"
"0000248002" "0000500889"
"0000248622" "0000501551"
"0000248623" "0000501552"
"0000262450" "0000592743"
"0000262451" "0000592744"
"0000262452" "0000592745"
"0000262453" "0000592746"
"0000262454" "0000592747"
"0000262455" "0000592748"
"0000262456" "0000592751"
"0000262457" "0000592752"
"0000262458" "0000592753"
"0000262461" "0000592756"
"0000262462" "0000592757"
"0000262463" "0000592758"
"0000262464" "0000592759"
"0000263190" "0000593670"
"0000263192" "0000593672"
"0000263193" "0000593673"
"0000263194" "0000593674"
"0000263195" "0000593675"
"0000263196" "0000593676"
"0000263197" "0000593677"
"0000263198" "0000593678"
"0000263202" "0000593682"
"0000263203" "0000593683"
"0000263204" "0000593684"
"0000263205" "0000593685"
"0000263206" "0000593686"
"0000263207" "0000593687"
"0000263209" "0000593689"
"0000263210" "0000593690"
"0000263211" "0000593691"
"0000263212" "0000593692"
"0000263213" "0000593693"
"0000263214" "0000593694"
"0000263215" "0000593695"
"0000263227" "0000593709"
"0000263228" "0000593710"
"0000263229" "0000593711"
"0000263230" "0000593712"
"0000263231" "0000593713"
"0000263232" "0000593714"
"0000263233" "0000593715"
"0000263234" "0000593716"
"0000263235" "0000593717"
"0000263237" "0000593719"
"0000263238" "0000593720"
"0000264158" "0000593744"
"0000264225" "0000594724"
"0000265119" "0000595702"
"0000265124" "0000598579"
"0000265127" "0000595706"
"0000265157" "0000595734"
"0000265158" "0000595735"
"0000265186" "0000595767"
"0000265210" "0000595793"
"0000265249" "0000595854"
"0000265251" "0000595856"
"0000265268" "0000595878"
"0000265269" "0000595880"
"0000265275" "0000595887"
"0000265276" "0000595888"
"0000265277" "0000595889"
"0000265278" "0000595890"
"0000266333" "0000596994"
"0000266334" "0000596995"
"0000266335" "0000596996"
"0000266337" "0000596997"
"0000266339" "0000596999"
"0000266341" "0000597002"
"0000266342" "0000597003"
"0000266343" "0000597006"
"0000266344" "0000597007"
"0000266345" "0000597008"
"0000266346" "0000597009"
"0000266347" "0000597010"
"0000266348" "0000597011"
"0000266349" "0000597012"
"0000266350" "0000597013"
"0000266351" "0000597014"
"0000266357" "0000597019"
"0000266358" "0000597020"
"0000266379" "0000597044"
"0000266380" "0000597045"
"0000266381" "0000597046"
"0000266406" "0000597072"
"0000266425" "0000597089"
"0000266426" "0000597090"
"0000266427" "0000597091"
"0000266430" "0000597093"
"0000266431" "0000597094"
"0000266435" "0000597099"
"0000266435" "0000674989"
"0000266436" "0000597100"
"0000266437" "0000597101"
"0000266438" "0000597102"
"0000266439" "0000597103"
"0000266440" "0000597104"
"0000266441" "0000597105"
"0000266442" "0000597106"
"0000266443" "0000597107"
"0000266444" "0000597108"
"0000266445" "0000597109"
"0000266446" "0000597110"
"0000266447" "0000597111"
"0000266448" "0000597112"
"0000266449" "0000597113"
"0000266450" "0000597114"
"0000266451" "0000597115"
"0000266452" "0000597116"
"0000266454" "0000597117"
"0000266455" "0000597118"
"0000266456" "0000597119"
"0000266465" "0000597127"
"0000266466" "0000597128"
"0000266467" "0000597129"
"0000266468" "0000597130"
"0000266469" "0000597131"
"0000266470" "0000597132"
"0000266476" "0000597138"
"0000266477" "0000597139"
"0000266478" "0000597140"
"0000266479" "0000597141"
"0000266488" "0000597149"
"0000266490" "0000597151"
"0000266491" "0000597152"
"0000266495" "0000597156"
"0000266496" "0000597157"
"0000266497" "0000597158"
"0000266498" "0000597159"
"0000266508" "0000597190"
"0000266511" "0000597201"
"0000266512" "0000597202"
"0000266522" "0000597213"
"0000266524" "0000597215"
"0000266552" "0000597251"
"0000266553" "0000597252"
"0000266554" "0000597253"
"0000266555" "0000597254"
"0000266556" "0000597255"
"0000266557" "0000597256"
"0000266558" "0000597257"
"0000266560" "0000597258"
"0000266566" "0000597270"
"0000266568" "0000597271"
"0000266569" "0000597273"
"0000266570" "0000597274"
"0000266571" "0000597275"
"0000266606" "0000597313"
"0000266612" "0000597338"
"0000266631" "0000597341"
"0000266634" "0000597345"
"0000266648" "0000597366"
"0000266649" "0000597367"
"0000266650" "0000597368"
"0000266651" "0000597369"
"0000266652" "0000597370"
"0000266653" "0000597371"
"0000266654" "0000597372"
"0000266655" "0000597373"
"0000266656" "0000597374"
"0000266657" "0000597437"
"0000266698" "0000597438"
"0000266699" "0000597439"
"0000266700" "0000597440"
"0000266701" "0000597441"
"0000266702" "0000597505"
"0000266703" "0000597506"
"0000266706" "0000597510"
"0000266707" "0000597513"
"0000266716" "0000597526"
"0000266717" "0000597530"
"0000266718" "0000597531"
"0000266719" "0000597532"
"0000266723" "0000927824"
"0000266725" "0000597538"
"0000266726" "0000597539"
"0000266727" "0000597540"
"0000266728" "0000597541"
"0000266729" "0000597542"
"0000266730" "0000597543"
"0000266731" "0000597544"
"0000266731" "0000597545"
"0000266732" "0000597546"
"0000266733" "0000597550"
"0000266734" "0000597551"
"0000266735" "0000597552"
"0000266736" "0000597553"
"0000266737" "0000597554"
"0000266738" "0000597555"
"0000266739" "0000597556"
"0000266740" "0000597557"
"0000266742" "0000597558"
"0000266743" "0000597559"
"0000266744" "0000597560"
"0000266745" "0000597561"
"0000266746" "0000597562"
"0000266747" "0000597563"
"0000266748" "0000597564"
"0000266748" "0000597565"
"0000266749" "0000597566"
"0000266750" "0000597567"
"0000266751" "0000597568"
"0000266752" "0000597569"
"0000266753" "0000597570"
"0000266754" "0000597571"
"0000266757" "0000597575"
"0000266758" "0000597576"
"0000266759" "0000597577"
"0000266760" "0000597578"
"0000266761" "0000597579"
"0000266762" "0000597580"
"0000266764" "0000597581"
"0000266765" "0000597582"
"0000266766" "0000597583"
"0000266767" "0000597584"
"0000266821" "0000597641"
"0000266824" "0000597652"
"0000266825" "0000597653"
"0000266827" "0000597654"
"0000266828" "0000597655"
"0000266830" "0000597657"
"0000266831" "0000597658"
"0000266832" "0000597659"
"0000266833" "0000597660"
"0000266834" "0000597661"
"0000266835" "0000597662"
"0000266836" "0000597663"
"0000266837" "0000597664"
"0000266839" "0000597666"
"0000266840" "0000597668"
"0000266842" "0000597671"
"0000266843" "0000597672"
"0000266844" "0000597673"
"0000266845" "0000597674"
"0000266865" "0000597693"
"0000266866" "0000597694"
"0000266867" "0000597696"
"0000266868" "0000597697"
"0000266869" "0000597698"
"0000266871" "0000597700"
"0000266872" "0000597701"
"0000266873" "0000597702"
"0000266874" "0000597703"
"0000266875" "0000597704"
"0000266876" "0000597705"
"0000266877" "0000597706"
"0000266878" "0000597707"
"0000266879" "0000597717"
"0000266880" "0000597718"
"0000266881" "0000597719"
"0000266882" "0000597720"
"0000266883" "0000597721"
"0000266884" "0000597722"
"0000266885" "0000597724"
"0000266886" "0000597725"
"0000266957" "0000597800"
"0000266960" "0000597802"
"0000266961" "0000597803"
"0000266962" "0000597804"
"0000266962" "0000908596"
"0000266965" "0000597807"
"0000266965" "0001017796"
"0000266966" "0000597808"
"0000266967" "0000597809"
"0000266968" "0000597810"
"0000266969" "0000597811"
"0000266972" "0000597817"
"0000266973" "0000597818"
"0000266974" "0000597819"
"0000266975" "0000597820"
"0000266976" "0000597821"
"0000266977" "0000597822"
"0000266978" "0000597823"
"0000266979" "0000597824"
"0000266980" "0000597825"
"0000266981" "0000597826"
"0000266982" "0000597827"
"0000266984" "0000597830"
"0000266985" "0000597831"
"0000266986" "0000597832"
"0000266992" "0000597840"
"0000266993" "0000597841"
"0000266994" "0000597842"
"0000266995" "0000597843"
"0000266996" "0000597844"
"0000266997" "0000597845"
"0000267001" "0000597849"
"0000267005" "0000597853"
"0000267006" "0000597854"
"0000267007" "0000597855"
"0000267008" "0000597856"
"0000267009" "0000597857"
"0000267010" "0000597858"
"0000267011" "0000597859"
"0000267012" "0000597860"
"0000267013" "0000597861"
"0000267014" "0000597862"
"0000267015" "0000597863"
"0000267016" "0000597864"
"0000267018" "0000597866"
"0000267020" "0000597868"
"0000267022" "0000597871"
"0000267036" "0000597900"
"0000267106" "0000598041"
"0000267107" "0000598042"
"0000267108" "0000598043"
"0000267109" "0000598044"
"0000267110" "0000598045"
"0000267224" "0000598264"
"0000267225" "0000598265"
"0000267229" "0000598269"
"0000267230" "0000598270"
"0000267231" "0000598271"
"0000267232" "0000598272"
"0000267233" "0000598273"
"0000267234" "0000598274"
"0000267235" "0000598275"
"0000267236" "0000598276"
"0000267243" "0000598284"
"0000267250" "0000598289"
"0000267251" "0000598291"
"0000267252" "0000598292"
"0000267253" "0000598293"
"0000267254" "0000598294"
"0000267255" "0000598295"
"0000267256" "0000598298"
"0000267257" "0000598299"
"0000267258" "0000598300"
"0000267259" "0000598301"
"0000267260" "0000598302"
"0000267261" "0000598303"
"0000267262" "0000598304"
"0000267264" "0000598306"
"0000267265" "0000598307"
"0000267266" "0000598309"
"0000267269" "0000598311"
"0000267270" "0000598312"
"0000267285" "0000598337"
"0000267287" "0000598339"
"0000267288" "0000598340"
"0000267289" "0000598341"
"0000267290" "0000598342"
"0000267299" "0000598356"
"0000267300" "0000598357"
"0000267301" "0000598358"
"0000267302" "0000598359"
"0000267324" "0000598383"
"0000267326" "0000598384"
"0000267327" "0000598385"
"0000267328" "0000598386"
"0000267337" "0000598397"
"0000267338" "0000598398"
"0000267339" "0000598399"
"0000267340" "0000598400"
"0000267341" "0000598401"
"0000267342" "0000598402"
"0000267343" "0000598403"
"0000267344" "0000598404"
"0000267345" "0000598405"
"0000267346" "0000598406"
"0000267347" "0000598407"
"0000267348" "0000598408"
"0000267349" "0000598409"
"0000267350" "0000598410"
"0000267351" "0000598411"
"0000267352" "0000598412"
"0000267354" "0000598413"
"0000267355" "0000598414"
"0000267356" "0000598415"
"0000267357" "0000598416"
"0000267359" "0000598417"
"0000267363" "0000598421"
"0000267364" "0000598422"
"0000267365" "0000598423"
"0000267366" "0000598424"
"0000267367" "0000598425"
"0000267368" "0000598426"
"0000267369" "0000598427"
"0000267370" "0000598428"
"0000267372" "0000598431"
"0000267373" "0000598432"
"0000267393" "0000598451"
"0000267394" "0000598452"
"0000267395" "0000598453"
"0000267396" "0000598454"
"0000267397" "0000598455"
"0000267399" "0000598457"
"0000267401" "0000598459"
"0000267402" "0000598460"
"0000267403" "0000598461"
"0000267404" "0000598462"
"0000267405" "0000598463"
"0000267406" "0000598464"
"0000267407" "0000598465"
"0000267408" "0000598466"
"0000267409" "0000598467"
"0000267410" "0000598468"
"0000267411" "0000598469"
"0000267418" "0000598476"
"0000267419" "0000598477"
"0000267420" "0000598478"
"0000267421" "0000598479"
"0000267422" "0000598480"
"0000267423" "0000598481"
"0000267424" "0000598482"
"0000267425" "0000598483"
"0000267428" "0000598488"
"0000267429" "0000598489"
"0000267430" "0000598490"
"0000267431" "0000598491"
"0000267433" "0000598492"
"0000267434" "0000598493"
"0000267435" "0000598494"
"0000267437" "0000598496"
"0000267438" "0000598497"
"0000267439" "0000598498"
"0000267440" "0000598499"
"0000267442" "0000598501"
"0000267443" "0000598502"
"0000267444" "0000598503"
"0000267445" "0000598504"
"0000267446" "0000598505"
"0000267447" "0000598506"
"0000267448" "0000598507"
"0000267451" "0000598510"
"0000267452" "0000598511"
"0000267454" "0000598513"
"0000267455" "0000598514"
"0000267456" "0000598515"
"0000267458" "0000598517"
"0000267459" "0000598518"
"0000267460" "0000598519"
"0000267461" "0000598520"
"0000267462" "0000598521"
"0000267463" "0000598522"
"0000267464" "0000598523"
"0000267465" "0000598524"
"0000267466" "0000598525"
"0000267467" "0000598526"
"0000267468" "0000598527"
"0000267469" "0000598528"
"0000267472" "0000598531"
"0000267482" "0000598542"
"0000267484" "0000598544"
"0000267486" "0000598546"
"0000267487" "0000598547"
"0000267488" "0000598548"
"0000267489" "0000598549"
"0000267490" "0000598550"
"0000267491" "0000598551"
"0000267492" "0000598552"
"0000267493" "0000598553"
"0000267494" "0000598554"
"0000267495" "0000598555"
"0000267496" "0000598556"
"0000267497" "0000598557"
"0000267498" "0000598558"
"0000267499" "0000598559"
"0000267500" "0000598560"
"0000267501" "0000598561"
"0000267504" "0000598565"
"0000267506" "0000598566"
"0000267588" "0000598823"
"0000267612" "0000599135"
"0000267755" "0000599281"
"0000267786" "0000599313"
"0000267787" "0000599314"
"0000267789" "0000599316"
"0000267790" "0000599317"
"0000267791" "0000599318"
"0000267792" "0000599319"
"0000267793" "0000599320"
"0000267794" "0000599321"
"0000267795" "0000599322"
"0000267797" "0000599324"
"0000267798" "0000599325"
"0000267799" "0000599326"
"0000267800" "0000599327"
"0000268143" "0000600818"
"0000268144" "0000600819"
"0000268145" "0000600820"
"0000268146" "0000600821"
"0000268147" "0000600822"
"0000268148" "0000600823"
"0000268149" "0000600824"
"0000268150" "0000600825"
"0000268151" "0000600826"
"0000268151" "0000674990"
"0000268154" "0000600828"
"0000268168" "0000600846"
"0000268169" "0000600847"
"0000268170" "0000600848"
"0000268171" "0000600849"
"0000268172" "0000600850"
"0000268173" "0000600851"
"0000268369" "0000601059"
"0000268370" "0000601060"
"0000268371" "0000601061"
"0000268372" "0000601062"
"0000268379" "0000601069"
"0000268380" "0000601070"
"0000268381" "0000601071"
"0000268382" "0000601072"
"0000270235" "0000602972"
"0000270236" "0000602973"
"0000270240" "0000602977"
"0000270241" "0000602978"
"0000270243" "0000602979"
"0000270434" "0000604194"
"0000270435" "0000604195"
"0000270436" "0000604196"
"0000270437" "0000604197"
"0000270455" "0000604224"
"0000276849" "0000630999"
"0000276850" "0000631000"
"0000276851" "0000631001"
"0000277094" "0000631826"
"0000277150" "0000631880"
"0000277257" "0000632024"
"0000291622" "0000648311"
"0000304292" "0000667723"
"0000304292" "0001017778"
"0000311758" "0000687265"
"0000312246" "0000693803"
"0000312247" "0000693804"
"0000312349" "0000693939"
"0000312544" "0000694133"
"0000315116" "0000697191"
"0000315821" "0000697922"
"0000321555" "0000704464"
"0000321556" "0000704465"
"0000321558" "0000704466"
"0000321559" "0000704467"
"0000321560" "0000704468"
"0000321616" "0000704527"
"0000321617" "0000704528"
"0000321618" "0000704529"
"0000321633" "0000704553"
"0000325328" "0000708308"
"0000325329" "0000708309"
"0000325331" "0000708311"
"0000325333" "0000708313"
"0000325334" "0000708314"
"0000325484" "0000708494"
"0000325485" "0000708495"
"0000325486" "0000708496"
"0000325487" "0000708497"
"0000325488" "0000708498"
"0000325489" "0000708499"
"0000325576" "0000708695"
"0000325585" "0000708703"
"0000328698" "0000712715"
"0000328700" "0000712717"
"0000328701" "0000712718"
"0000329762" "0000714147"
"0000329763" "0000714148"
"0000330227" "0000714754"
"0000330228" "0000714759"
"0000330353" "0000714938"
"0000330354" "0000714939"
"0000330382" "0000714972"
"0000332456" "0000729710"
"0000332457" "0000729711"
"0000332821" "0000730108"
"0000333650" "0000731370"
"0000333774" "0000731580"
"0000333775" "0000731582"
"0000360848" "0000760957"
"0000362958" "0000763347"
"0000362959" "0000763348"
"0000362960" "0000763350"
"0000362961" "0000763351"
"0000362962" "0000763352"
"0000362974" "0000763363"
"0000362975" "0000763364"
"0000362990" "0000763380"
"0000362991" "0000763381"
"0000362995" "0000763389"
"0000362996" "0000763390"
"0000362997" "0000763391"
"0000362999" "0000763392"
"0000363000" "0000763394"
"0000363001" "0000763395"
"0000363002" "0000763396"
"0000363004" "0000763398"
"0000363005" "0000763399"
"0000363031" "0000763440"
"0000363120" "0000763547"
"0000363137" "0000763579"
"0000363138" "0000763580"
"0000363139" "0000763581"
"0000363260" "0000763833"
"0000363261" "0000763835"
"0000363262" "0000763836"
"0000363263" "0000763837"
"0000363264" "0000763838"
"0000364712" "0000765616"
"0000364713" "0000765617"
"0000364714" "0000765618"
"0000364715" "0000765619"
"0000364721" "0000765624"
"0000364722" "0000765625"
"0000364723" "0000765626"
"0000364724" "0000765627"
"0000364725" "0000765628"
"0000364726" "0000765629"
"0000364990" "0000765940"
"0000364991" "0000765941"
"0000375029" "0000786037"
"0000377330" "0000789639"
"0000377332" "0000789642"
"0000380890" "0000794126"
"0000380893" "0000794127"
"0000380894" "0000794128"
"0000380895" "0000794129"
"0000380896" "0000794130"
"0000380897" "0000794131"
"0000380898" "0000794132"
"0000380899" "0000794133"
"0000380900" "0000794136"
"0000380924" "0000794165"
"0000380925" "0000794166"
"0000380926" "0000794167"
"0000380927" "0000794168"
"0000380928" "0000794169"
"0000380929" "0000794170"
"0000380930" "0000794171"
"0000380932" "0000794174"
"0000380933" "0000794175"
"0000380934" "0000794176"
"0000380935" "0000794177"
"0000380936" "0000794178"
"0000380937" "0000794179"
"0000380938" "0000794180"
"0000380939" "0000794181"
"0000380940" "0000794182"
"0000380941" "0000794183"
"0000380942" "0000794184"
"0000380943" "0000794185"
"0000380944" "0000794186"
"0000380944" "0000908597"
"0000381371" "0000794788"
"0000384181" "0000798622"
"0000385780" "0000812909"
"0000385783" "0000812912"
"0000385834" "0000812992"
"0000385835" "0000812993"
"0000385836" "0000812994"
"0000388585" "0000817285"
"0000388596" "0000817296"
"0000388634" "0000817354"
"0000388635" "0000817355"
"0000392738" "0000823172"
"0000394011" "0000824906"
"0000399481" "0000831996"
"0000399892" "0000832554"
"0000404088" "0000839675"
"0000406100" "0000842305"
"0000406696" "0000843071"
"0000406699" "0000843073"
"0000406700" "0000843074"
"0000406701" "0000843075"
"0000406702" "0000843076"
"0000407044" "0000843508"
"0000407927" "0000844770"
"0000407977" "0000844837"
"0000407978" "0000844838"
"0000407979" "0000844839"
"0000407982" "0000844842"
"0000410046" "0000847292"
"0000418282" "0000878038"
"0000418284" "0000878039"
"0000418285" "0000878041"
"0000418287" "0000878043"
"0000418289" "0000878045"
"0000418538" "0000878329"
"0000418539" "0000878330"
"0000418540" "0000878331"
"0000418541" "0000878332"
"0000418543" "0000878335"
"0000418544" "0000878336"
"0000418545" "0000878337"
"0000418578" "0000878385"
"0000418579" "0000878386"
"0000418580" "0000878387"
"0000418581" "0000878388"
"0000418582" "0000878389"
"0000418583" "0000878390"
"0000418584" "0000878391"
"0000418585" "0000878392"
"0000418586" "0000878393"
"0000418587" "0000878394"
"0000418588" "0000878395"
"0000418589" "0000878396"
"0000418621" "0000878430"
"0000418622" "0000878431"
"0000418623" "0000878432"
"0000418624" "0000878434"
"0000418625" "0000878435"
"0000418627" "0000878438"
"0000418628" "0000878439"
"0000418629" "0000878440"
"0000418630" "0000878441"
"0000418631" "0000878442"
"0000418632" "0000878443"
"0000418633" "0000878444"
"0000418634" "0000878445"
"0000418635" "0000878446"
"0000418636" "0000878447"
"0000418637" "0000878448"
"0000418638" "0000878449"
"0000418639" "0000878450"
"0000418640" "0000878451"
"0000418641" "0000878452"
"0000418642" "0000878453"
"0000418643" "0000878454"
"0000418722" "0000878560"
"0000418724" "0000878562"
"0000418726" "0000878565"
"0000418729" "0000878568"
"0000418730" "0000878569"
"0000418731" "0000878570"
"0000418732" "0000878571"
"0000418733" "0000878574"
"0000419160" "0000879096"
"0000424537" "0000900606"
"0000424538" "0000900607"
"0000424539" "0000900608"
"0000424540" "0000900609"
"0000424541" "0000900610"
"0000426101" "0000902927"
"0000426102" "0000902929"
"0000426260" "0000903221"
"0000426327" "0000903296"
"0000426328" "0000903297"
"0000426329" "0000903298"
"0000427080" "0000904334"
"0000427090" "0000904335"
"0000427102" "0000904354"
"0000427117" "0000904370"
"0000427118" "0000904371"
"0000427119" "0000904376"
"0000427705" "0000905147"
"0000427706" "0000905148"
"0000427707" "0000905149"
"0000427708" "0000905150"
"0000427709" "0000905151"
"0000427710" "0000905152"
"0000427711" "0000905153"
"0000427712" "0000905154"
"0000427713" "0000905155"
"0000428987" "0000908394"
"0000429155" "0000908580"
"0000429788" "0000909410"
"0000429789" "0000909412"
"0000429815" "0000909443"
"0000429815" "0000909444"
"0000429816" "0000909445"
"0000429817" "0000909446"
"0000429818" "0000909447"
"0000429824" "0000909453"
"0000431678" "0000916937"
"0000432572" "0000918109"
"0000435570" "0000921574"
"0000436115" "0000922456"
"0000436116" "0000922457"
"0000436118" "0000922461"
"0000436122" "0000922477"
"0000436124" "0000922481"
"0000436125" "0000922482"
"0000436126" "0000922483"
"0000436478" "0000927465"
"0000436633" "0000927692"
"0000436796" "0000927936"
"0000437884" "0000933328"
"0000437885" "0000933329"
"0000437886" "0000933330"
"0000437887" "0000933331"
"0000437888" "0000933332"
"0000437889" "0000933333"
"0000437890" "0000933334"
"0000437891" "0000933335"
"0000437897" "0000933343"
"0000437898" "0000933344"
"0000437966" "0000933453"
"0000438118" "0000933654"
"0000444096" "0000945942"
"0000445189" "0000952089"
"0000445575" "0000953658"
"0000446600" "0000954951"
"0000449945" "0000971528"
"0000449976" "0000971590"
"0000449977" "0000971591"
"0000449978" "0000971592"
"0000449979" "0000971593"
"0000449998" "0000971627"
"0000449999" "0000971628"
"0000450000" "0000971629"
"0000450060" "0000971690"
"0000450061" "0000971691"
"0000450062" "0000971692"
"0000450063" "0000971693"
"0000450064" "0000971694"
"0000450065" "0000971695"
"0000450065" "0000971696"
"0000450066" "0000971993"
"0000451159" "0000984945"
"0000453669" "0000988417"
"0000453670" "0000988418"
"0000453688" "0000988437"
"0000453689" "0000988453"
"0000453702" "0000988458"
"0000453704" "0000988461"
"0000453705" "0000988462"
"0000453706" "0000988463"
"0000453707" "0000988464"
"0000453710" "0000988467"
"0000453711" "0000988468"
"0000453712" "0000988469"
"0000453713" "0000988470"
"0000453714" "0000988471"
"0000453715" "0000988472"
"0000453716" "0000988473"
"0000453717" "0000988475"
"0000453718" "0000988479"
"0000453719" "0000988480"
"0000453720" "0000988481"
"0000453721" "0000988482"
"0000453869" "0000988637"
"0000453871" "0000988639"
"0000453872" "0000988640"
"0000453873" "0000988641"
"0000453874" "0000988642"
"0000453875" "0000988643"
"0000453876" "0000988644"
"0000453877" "0000988645"
"0000453924" "0000988703"
"0000453925" "0000988704"
"0000453926" "0000988705"
"0000453927" "0000988706"
"0000453928" "0000988707"
"0000453929" "0000988708"
"0000453930" "0000988709"
"0000456301" "0001008547"
"0000456302" "0001008548"
"0000456303" "0001008549"
"0000456306" "0001008552"
"0000459602" "0001017673"
"0000459607" "0001017678"
"0000459611" "0001017682"
"0000459615" "0001017686"
"0000459616" "0001017687"
"0000459617" "0001017688"
"0000459618" "0001017689"
"0000459619" "0001017690"
"0000459620" "0001017691"
"0000459621" "0001017692"
"0000459622" "0001017694"
"0000459623" "0001017695"
"0000459624" "0001017696"
"0000459625" "0001017697"
"0000459645" "0001017730"
"0000459646" "0001017731"
"0000459654" "0001017744"
"0000459662" "0001017754"
"0000459663" "0001017756"
"0000459666" "0001017758"
"0000459667" "0001017759"
"0000459668" "0001017760"
"0000459669" "0001017761"
"0000459670" "0001017762"
"0000459671" "0001017763"
"0000459672" "0001017764"
"0000459673" "0001017765"
"0000459675" "0001017767"
"0000459676" "0001017768"
"0000459676" "0001017771"
"0000459677" "0001017769"
"0000459677" "0001017770"
"0000459678" "0001017772"
"0000459679" "0001017773"
"0000459681" "0001017776"
"0000459682" "0001017777"
"0000459683" "0001017779"
"0000459684" "0001017780"
"0000459685" "0001017781"
"0000459686" "0001017782"
"0000459687" "0001017783"
"0000459688" "0001017784"
"0000459689" "0001017785"
"0000459690" "0001017786"
"0000459691" "0001017787"
"0000459692" "0001017788"
"0000459693" "0001017789"
"0000459694" "0001017790"
"0000459695" "0001017791"
"0000459695" "0001017792"
"0000459696" "0001017793"
"0000459696" "0001017794"
"0000459699" "0001017798"
"0000459700" "0001017799"
"0000459701" "0001017800"
"0000459702" "0001017801"
"0000459703" "0001017804"
"0000459704" "0001017805"
"0000459705" "0001017806"
"0000459706" "0001017807"
"0000459708" "0001017809"
"0000459709" "0001017810"
"0000459710" "0001017811"
"0000459711" "0001017814"
"0000459712" "0001017815"
"0000459716" "0001017820"
"0000459724" "0001017838"
"0000459794" "0001017942"
"0000459867" "0001018802"
"0000461149" "0001020259"
"0000461422" "0001020738"
"0000462204" "0001021588"
"0000462204" "0001021589"
"0000462220" "0001021668"
"0000463860" "0001023911"
"0000463862" "0001023913"
"0000463864" "0001023914"
"0000463865" "0001023915"
"0000463922" "0001027542"
"0000466060" "0001029883"
"0000466061" "0001029884"
"0000466062" "0001029885"
"0000466064" "0001029887"
"0000466065" "0001029888"
"0000466066" "0001029889"
"0000466067" "0001029890"
"0000466068" "0001029891"
"0000466157" "0001030008"
"0000466215" "0001030118"
"0000466216" "0001030119"
"0000466270" "0001030191"
"0000466962" "0001044610"
"0000467715" "0001046994"
"0000467715" "0001046995"
"0000468032" "0001047491"
"0000468033" "0001047492"
"0000468035" "0001047494"
"0000468036" "0001047497"
"0000468037" "0001047498"
"0000468038" "0001047499"
"0000468251" "0001048030"
"0000468252" "0001048033"
"0000468253" "0001048035"
"0000468254" "0001048036"
"0000468278" "0001048061"
"0000468279" "0001048062"
"0000468540" "0001048415"
"0000468541" "0001048417"
"0000468542" "0001048418"
"0000468543" "0001048419"
"0000468810" "0001048775"
"0000469685" "0001057715"
"0000470108" "0001058195"
"0000471200" "0001059325"
"0000471209" "0001059342"
"0000471807" "0001060089"
"0000471808" "0001060090"
"0000472038" "0001060449"
"0000472039" "0001060451"
"0000473170" "0001061949"
"0000473649" "0001062511"
"0000473650" "0001062512"
"0000473853" "0001062782"
"0000474099" "0001068245"
"0000476026" "0001070757"
"0000476028" "0001070759"
"0000476548" "0001071437"
"0000478783" "0001074612"
"0000478856" "0001074703"
"0000478857" "0001074704"
"0000478858" "0001074705"
"0000478860" "0001074708"
"0000478861" "0001074713"
"0000478862" "0001074714"
"0000478863" "0001074715"
"0000478864" "0001074716"
"0000480159" "0001076297"
"0000481645" "0001078322"
"0000481648" "0001078359"
"0000481649" "0001078360"
"0000481710" "0001078508"
"0000482766" "0001080017"
"0000483671" "0001081377"
"0000483672" "0001081378"
"0000483673" "0001081379"
"0000485798" "0001083827"
"0000486472" "0001089472"
"0000486473" "0001089473"
"0000486474" "0001089474"
"0000486475" "0001089475"
"0000486476" "0001089476"