### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = SERPINH1) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "SERPINH1" "serpin family H member 1" "11" "q13.5" "unknown" "NG_012052.1" "UD_132319505232" "" "https://www.LOVD.nl/SERPINH1" "Osteogenesis Imperfecta & Ehlers-Danlos syndrome variant databases \r\nOsteogenesis Imperfecta Federation Europe (OIFE) " "1" "1546" "871" "600943" "1" "1" "1" "1" "Establishment of the database was supported by the European Community\'s Seventh Framework Programme (FP7/2007-2013) under grant agreement No 200754 - the GEN2PHEN project.\r\nThis database is supported by Osteogenesis Imperfecta Federation Europe (OIFE)" "" "g" "https://databases.lovd.nl/shared/refseq/SERPINH1_codingDNA.html" "1" "" "
Osteogenesis Imperfecta Variant Database\r\n
\r\n\r\n
" "-1" "" "-1" "00001" "2009-11-23 00:00:00" "00085" "2022-04-05 13:11:40" "00006" "2026-01-11 12:15:19" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00018731" "SERPINH1" "transcript variant 1" "001" "NM_001207014.1" "" "NP_001193943.1" "" "" "" "-342" "1978" "1257" "75273101" "75283849" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 6 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00000" "Healthy/Control" "Healthy individual / control" "" "" "" "" "" "00000" "2012-07-26 17:29:43" "" "" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "02952" "PPROM" "preterm premature rupture of membranes (PPROM)" "" "610504" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2016-03-20 12:15:43" "03462" "OI10" "osteogenesis imperfecta, type X (OI10)" "AR" "613848" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-05-16 13:12:31" "05296" "OI" "osteogenesis imperfecta" "" "" "" "" "" "00006" "2017-06-26 22:59:16" "00006" "2025-09-23 21:54:31" "05398" "CLCRP" "Cole-Carpenter syndrome (CLCRP)" "" "" "" "" "" "00006" "2018-02-23 14:44:55" "00006" "2021-12-10 21:51:32" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 3 "{{geneid}}" "{{diseaseid}}" "SERPINH1" "02952" "SERPINH1" "03462" "SERPINH1" "05296" ## Individuals ## Do not remove or alter this header ## ## Count = 17 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00154404" "" "" "" "1" "" "00006" "{PMID:Rauch 2015:25683117}, {PMID:Cole 1987:3794889}" "2-generation family, 1 affected, unaffected parents" "M" "no" "Canada" "" "0" "" "" "" "25683117-Pat1" "00372899" "" "" "" "1" "" "00085" "{PMID:Schwarze et al.,2019:31179625}" "The patient is described as having a moderate form of osteogenesis imperfecta." "" "" "" "" "0" "" "" "" "" "00372900" "" "" "" "1" "" "00085" "{PMID:Barbirato 2016:27706701}" "" "" "" "Brazil" "" "0" "" "" "" "P.6" "00372901" "" "" "" "1" "" "00085" "{PMID:Barbirato 2016:27706701}" "" "" "" "Brazil" "" "0" "" "" "" "P.5" "00372902" "" "" "" "1" "" "00085" "" "" "" "" "" "" "0" "" "" "" "" "00372903" "" "" "" "1" "" "03894" "{PMID:Li 2019:30715774}, {DOI:Li 2019:10.1002/humu.23718}, {PMID:Li 2020:33093841}" "" "" "" "China" "" "0" "" "" "" "PUMC-285" "00372904" "" "" "" "1" "" "03704" "{PMID:Christiansen 2010:20188343}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "" "00372905" "" "" "" "1" "" "00085" "" "" "" "" "" "" "0" "" "" "" "" "00372906" "" "" "" "1" "" "00085" "{PMID:Marshall 2016:27677223}" "" "" "" "Mexico" "" "0" "" "" "" "" "00372907" "" "" "" "1" "" "00085" "" "" "" "" "" "" "0" "" "" "" "" "00372908" "" "" "" "1" "" "03894" "{PMID:Li 2019:30715774}, {DOI:Li 2019:10.1002/humu.23718}, {PMID:Li 2020:33093841}" "" "" "" "China" "" "0" "" "" "" "PUMC-324" "00372909" "" "" "" "1" "" "00085" "" "" "" "" "" "" "0" "" "" "" "" "00372910" "" "" "" "1" "" "01819" "{PMID:Essawi 2018:29150909}" "" "" "" "Palestine" "" "0" "" "" "" "AN_005832" "00372911" "" "" "" "1" "" "00085" "" "" "" "" "" "" "0" "" "" "" "" "00372912" "" "" "" "1" "" "00085" "{PMID:Duran 2014:25510505}" "The OI phenotype is described as moderately severe. The parents are third cousins." "" "" "" "" "0" "" "" "" "" "00372913" "" "" "" "1" "" "00085" "" "" "" "" "" "" "0" "" "" "" "" "00427684" "" "" "" "1" "" "04400" "" "" "F" "?" "Russian Federation" "" "" "" "" "" "" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 17 "{{individualid}}" "{{diseaseid}}" "00154404" "05398" "00372899" "05296" "00372900" "05296" "00372901" "05296" "00372902" "00198" "00372903" "05296" "00372904" "05296" "00372905" "00198" "00372906" "05296" "00372907" "00198" "00372908" "05296" "00372909" "00198" "00372910" "05296" "00372911" "00198" "00372912" "05296" "00372913" "00198" "00427684" "00000" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00000, 00198, 02952, 03462, 05296, 05398 ## Count = 16 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000127078" "05398" "00154404" "00006" "Isolated (sporadic)" "" "see papers; ..., craniosynostosis, Wormian bones, communicating hydrocephalus, midface hypoplasia, ocular proptosis, cognitive function normal, sclera white, dentinogenesis imperfecta, normsl hearing, normal vision, 1m-first fracture, final height 120 cm, lumbar spine areal BMD before pamidronate treatment z-score -3.9, lumbar spine areal BMD after pamidronate z-score -2.4, long-bone deformities, scoliosis, vertebral compression fractures, wheelchair bound, normal serum biochemistry (calcium, inorganic phosphorus, alkaline phosphatase, parathyroid hormone)" "01y" "" "multiple fractures" "" "" "" "" "" "" "" "" "0000268175" "05296" "00372899" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI" "" "0000268176" "05296" "00372900" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI III" "" "0000268177" "05296" "00372901" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI IV" "" "0000268178" "00198" "00372902" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000268179" "05296" "00372903" "03894" "Familial, autosomal recessive" "" "3y-first fracture, 16 fractures; height Z -2.35; no scoliosis; blue sclerae; no dentinogenesis imperfecta; no hearing loss; able to walk; no ptosis" "" "" "" "" "" "" "" "" "OI10" "osteogenesis imperfecta" "" "0000268180" "05296" "00372904" "03704" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI III" "" "0000268181" "00198" "00372905" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000268182" "05296" "00372906" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI II" "" "0000268183" "00198" "00372907" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000268184" "05296" "00372908" "03894" "Familial, autosomal recessive" "" "0y-first fracture, 10 fractures; height Z -11.61; scoliosis; no blue sclerae; dentinogenesis imperfecta; no hearing loss; not able to walk independently; no ptosis" "" "" "" "" "" "" "" "" "OI10" "osteogenesis imperfecta" "" "0000268185" "00198" "00372909" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000268186" "05296" "00372910" "01819" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI III" "" "0000268187" "00198" "00372911" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000268188" "05296" "00372912" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI" "" "0000268189" "00198" "00372913" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" ## Screenings ## Do not remove or alter this header ## ## Count = 17 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000155264" "00154404" "1" "00006" "00006" "2018-02-23 15:06:12" "00006" "2018-02-23 15:12:10" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "" "WES" "0000374133" "00372899" "1" "00085" "00085" "2019-08-13 12:09:43" "00085" "2019-08-30 15:48:28" "SEQ" "DNA" "" "" "0000374134" "00372900" "1" "00085" "00085" "2019-09-02 14:14:03" "" "" "SEQ" "DNA" "" "" "0000374135" "00372901" "1" "00085" "00085" "2019-09-02 14:09:54" "" "" "SEQ" "DNA" "" "" "0000374136" "00372902" "1" "00085" "00085" "2009-11-27 16:38:45" "00085" "2010-03-01 11:50:34" "?" "?" "" "" "0000374137" "00372903" "1" "03894" "03894" "2018-09-25 14:41:39" "00085" "2018-10-02 14:00:06" "PCR;SEQ;SEQ-NG" "DNA" "" "WES" "0000374138" "00372904" "1" "03704" "00085" "2010-02-25 09:21:45" "00085" "2015-02-18 10:09:57" "PCR;SEQ" "DNA" "" "" "0000374139" "00372905" "1" "00085" "00085" "2009-11-30 11:57:03" "00085" "2010-03-01 11:51:24" "?" "?" "" "" "0000374140" "00372906" "1" "00085" "00085" "2016-10-21 09:17:43" "" "" "SEQ-NG" "DNA" "" "custom gene panel" "0000374141" "00372907" "1" "00085" "00085" "2009-11-30 11:58:36" "00085" "2010-03-01 11:52:03" "?" "?" "" "" "0000374142" "00372908" "1" "03894" "03894" "2018-09-25 14:46:46" "" "" "PCR;SEQ" "DNA" "" "" "0000374143" "00372909" "1" "00085" "00085" "2009-11-30 12:00:29" "00085" "2010-03-01 11:52:24" "?" "?" "" "" "0000374144" "00372910" "1" "01819" "01819" "2016-11-28 18:08:10" "" "" "PCR;SEQ" "DNA" "" "" "0000374145" "00372911" "1" "00085" "00085" "2009-11-30 12:02:00" "00085" "2010-03-01 11:52:59" "?" "?" "" "" "0000374146" "00372912" "1" "00085" "00085" "2014-12-17 15:10:23" "00085" "2014-12-17 15:12:46" "PCR;SEQ" "DNA" "" "" "0000374147" "00372913" "1" "00085" "00085" "2009-11-30 12:03:40" "00085" "2010-03-01 11:54:51" "?" "?" "" "" "0000429005" "00427684" "1" "04400" "04400" "2022-12-11 10:09:35" "00006" "2022-12-12 12:35:22" "SEQ-NG-I" "DNA" "" "WES" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 16 "{{screeningid}}" "{{geneid}}" "0000155264" "P4HB" "0000374133" "SERPINH1" "0000374134" "SERPINH1" "0000374135" "SERPINH1" "0000374136" "SERPINH1" "0000374137" "SERPINH1" "0000374138" "SERPINH1" "0000374139" "SERPINH1" "0000374140" "SERPINH1" "0000374141" "SERPINH1" "0000374142" "SERPINH1" "0000374143" "SERPINH1" "0000374144" "SERPINH1" "0000374145" "SERPINH1" "0000374146" "SERPINH1" "0000374147" "SERPINH1" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 48 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000248307" "0" "10" "11" "75277628" "75277628" "subst" "0.899522" "02325" "SERPINH1_000002" "g.75277628A>G" "" "" "" "SERPINH1(NM_001207014.3):c.234A>G (p.L78=), SERPINH1(NM_001235.5):c.234A>G (p.L78=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.75566583A>G" "" "benign" "" "0000250042" "0" "10" "11" "75277628" "75277628" "subst" "0.899522" "02329" "SERPINH1_000002" "g.75277628A>G" "" "" "" "SERPINH1(NM_001207014.3):c.234A>G (p.L78=), SERPINH1(NM_001235.5):c.234A>G (p.L78=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.75566583A>G" "" "benign" "" "0000298125" "0" "10" "11" "75282882" "75282882" "subst" "0.345035" "02325" "SERPINH1_000006" "g.75282882G>A" "" "" "" "SERPINH1(NM_001207014.3):c.1011G>A (p.L337=), SERPINH1(NM_001235.5):c.1011G>A (p.L337=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.75571837G>A" "" "benign" "" "0000298126" "0" "10" "11" "75277757" "75277757" "subst" "0.345967" "02325" "SERPINH1_000003" "g.75277757C>G" "" "" "" "SERPINH1(NM_001207014.3):c.363C>G (p.S121=), SERPINH1(NM_001235.5):c.363C>G (p.S121=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.75566712C>G" "" "benign" "" "0000298127" "0" "10" "11" "75277992" "75277992" "subst" "0.436931" "02325" "SERPINH1_000004" "g.75277992C>T" "" "" "" "SERPINH1(NM_001207014.3):c.598C>T (p.L200=), SERPINH1(NM_001235.5):c.598C>T (p.L200=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.75566947C>T" "" "benign" "" "0000298128" "0" "10" "11" "75279846" "75279846" "subst" "0.345043" "02325" "SERPINH1_000005" "g.75279846C>T" "" "" "" "SERPINH1(NM_001207014.3):c.693C>T (p.T231=), SERPINH1(NM_001235.5):c.693C>T (p.T231=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.75568801C>T" "" "benign" "" "0000299413" "0" "10" "11" "75282882" "75282882" "subst" "0.345035" "02329" "SERPINH1_000006" "g.75282882G>A" "" "" "" "SERPINH1(NM_001207014.3):c.1011G>A (p.L337=), SERPINH1(NM_001235.5):c.1011G>A (p.L337=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.75571837G>A" "" "benign" "" "0000299414" "0" "50" "11" "75282989" "75282989" "subst" "4.06491E-6" "02329" "SERPINH1_000108" "g.75282989G>A" "" "" "" "SERPINH1(NM_001235.5):c.1118G>A (p.R373H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.75571944G>A" "" "VUS" "" "0000299415" "0" "30" "11" "75277661" "75277661" "subst" "0.00205023" "02329" "SERPINH1_000102" "g.75277661G>A" "" "" "" "SERPINH1(NM_001235.5):c.267G>A (p.T89=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.75566616G>A" "" "likely benign" "" "0000299416" "0" "10" "11" "75277757" "75277757" "subst" "0.345967" "02329" "SERPINH1_000003" "g.75277757C>G" "" "" "" "SERPINH1(NM_001207014.3):c.363C>G (p.S121=), SERPINH1(NM_001235.5):c.363C>G (p.S121=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.75566712C>G" "" "benign" "" "0000299417" "0" "10" "11" "75277992" "75277992" "subst" "0.436931" "02329" "SERPINH1_000004" "g.75277992C>T" "" "" "" "SERPINH1(NM_001207014.3):c.598C>T (p.L200=), SERPINH1(NM_001235.5):c.598C>T (p.L200=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.75566947C>T" "" "benign" "" "0000299418" "0" "10" "11" "75279846" "75279846" "subst" "0.345043" "02329" "SERPINH1_000005" "g.75279846C>T" "" "" "" "SERPINH1(NM_001207014.3):c.693C>T (p.T231=), SERPINH1(NM_001235.5):c.693C>T (p.T231=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.75568801C>T" "" "benign" "" "0000299419" "0" "30" "11" "75280006" "75280006" "subst" "0.00336858" "02329" "SERPINH1_000106" "g.75280006C>T" "" "" "" "SERPINH1(NM_001235.5):c.744C>T (p.D248=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.75568961C>T" "" "likely benign" "" "0000354934" "0" "50" "11" "75279842" "75279842" "subst" "4.06065E-6" "00006" "SERPINH1_000109" "g.75279842A>G" "" "{PMID:Rauch 2015:25683117}" "" "" "" "Germline" "" "" "0" "" "" "g.75568797A>G" "" "VUS" "" "0000545746" "0" "30" "11" "75277634" "75277634" "subst" "2.95112E-5" "02329" "SERPINH1_000110" "g.75277634C>T" "" "" "" "SERPINH1(NM_001235.5):c.240C>T (p.L80=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.75566589C>T" "" "likely benign" "" "0000545747" "0" "10" "11" "75282820" "75282820" "subst" "0.00704468" "02329" "SERPINH1_000111" "g.75282820C>A" "" "" "" "SERPINH1(NM_001207014.1):c.955-6C>A (p.(=)), SERPINH1(NM_001235.5):c.955-6C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.75571775C>A" "" "benign" "" "0000545748" "0" "30" "11" "75283062" "75283062" "subst" "2.44019E-5" "02329" "SERPINH1_000112" "g.75283062C>T" "" "" "" "SERPINH1(NM_001235.5):c.1191C>T (p.S397=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.75572017C>T" "" "likely benign" "" "0000622729" "0" "30" "11" "75282990" "75282990" "subst" "0.000166653" "02329" "SERPINH1_000113" "g.75282990C>T" "" "" "" "SERPINH1(NM_001235.5):c.1119C>T (p.R373=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.75571945C>T" "" "likely benign" "" "0000656915" "0" "50" "11" "75277974" "75277974" "subst" "0.000746649" "01804" "SERPINH1_000114" "g.75277974C>A" "" "" "" "SERPINH1(NM_001207014.1):c.580C>A (p.(Arg194Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.75566929C>A" "" "VUS" "" "0000723711" "0" "10" "11" "75282820" "75282820" "subst" "0.00704468" "01804" "SERPINH1_000111" "g.75282820C>A" "" "" "" "SERPINH1(NM_001207014.1):c.955-6C>A (p.(=)), SERPINH1(NM_001235.5):c.955-6C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000784850" "11" "99" "11" "0" "0" "?" "0" "00085" "SERPINH1_000016" "g.?" "" "{PMID:Schwarze et al.,2019:31179625}" "" "NC_000011.9:g.75265452_75270725del" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000784851" "0" "33" "11" "75273232" "75273232" "subst" "0" "00085" "SERPINH1_000018" "g.75273232G>A" "" "{PMID:Barbirato 2016:27706701}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely benign" "" "0000784852" "0" "37" "11" "75273253" "75273253" "subst" "0" "00085" "SERPINH1_000017" "g.75273253A>G" "" "{PMID:Barbirato 2016:27706701}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely benign" "" "0000784853" "0" "51" "11" "75277515" "75277515" "subst" "0" "00085" "SERPINH1_000001" "g.75277515G>C" "" "" "" "" "" "Germline" "" "rs7105528" "0" "" "" "" "" "VUS" "" "0000784854" "21" "97" "11" "75277543" "75277543" "subst" "0" "03894" "SERPINH1_000011" "g.75277543T>G" "" "{PMID:Li 2019:30715774}, {DOI:Li 2019:10.1002/humu.23718}, {PMID:Li 2020:33093841}" "" "" "" "Germline" "" "" "0" "" "" "g.75566498T>G" "" "pathogenic (recessive)" "" "0000784855" "3" "99" "11" "75277627" "75277627" "subst" "0" "03704" "SERPINH1_000007" "g.75277627T>C" "" "{PMID:Christiansen 2010:20188343}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000784856" "0" "51" "11" "75277628" "75277628" "subst" "0.899522" "00085" "SERPINH1_000002" "g.75277628A>G" "" "" "" "" "" "Germline" "" "rs584961" "0" "" "" "" "" "VUS" "" "0000784857" "3" "99" "11" "75277732" "75277751" "delins" "0" "00085" "SERPINH1_000009" "g.75277732_75277751delinsTGCAACGTGACCCACGCACGTG" "" "{PMID:Marshall 2016:27677223}" "" "" "The inserted bases were later confirmed by the authors to be:; TGCAACGTGACCCACGCACGTG" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000784858" "0" "51" "11" "75277757" "75277757" "subst" "0.345967" "00085" "SERPINH1_000003" "g.75277757C>G" "" "" "" "" "" "Germline" "" "rs650241" "0" "" "" "" "" "VUS" "" "0000784859" "11" "97" "11" "75277983" "75277983" "subst" "4.26923E-6" "03894" "SERPINH1_000013" "g.75277983G>C" "" "{PMID:Li 2019:30715774}, {DOI:Li 2019:10.1002/humu.23718}, {PMID:Li 2020:33093841}" "" "" "" "Germline" "" "" "0" "" "" "g.75566938G>C" "" "pathogenic (recessive)" "" "0000784860" "0" "51" "11" "75277992" "75277992" "subst" "0.436931" "00085" "SERPINH1_000004" "g.75277992C>T" "" "" "" "" "" "Germline" "" "rs651581" "0" "" "" "" "" "VUS" "" "0000784861" "3" "75" "11" "75277708" "75277719" "del" "0" "01819" "SERPINH1_000010" "g.75277708_75277719del" "" "{PMID:Essawi 2018:29150909}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000784862" "0" "51" "11" "75279846" "75279846" "subst" "0.345043" "00085" "SERPINH1_000005" "g.75279846C>T" "" "" "" "" "" "Germline" "" "rs649257" "0" "" "" "" "" "VUS" "" "0000784863" "3" "99" "11" "75279863" "75279863" "subst" "0" "00085" "SERPINH1_000008" "g.75279863T>C" "" "{PMID:Duran 2014:25510505}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000784864" "21" "97" "11" "75280062" "75280062" "subst" "0" "03894" "SERPINH1_000014" "g.75280062T>C" "" "{PMID:Li 2019:30715774}, {DOI:Li 2019:10.1002/humu.23718}, {PMID:Li 2020:33093841}" "" "" "" "Germline" "" "" "0" "" "" "g.75569017T>C" "" "pathogenic (recessive)" "" "0000784865" "0" "51" "11" "75282882" "75282882" "subst" "0.345035" "00085" "SERPINH1_000006" "g.75282882G>A" "" "" "" "" "" "Germline" "" "rs585821" "0" "" "" "" "" "VUS" "" "0000784866" "11" "97" "11" "75283085" "75283085" "subst" "8.13557E-6" "03894" "SERPINH1_000012" "g.75283085G>A" "" "{PMID:Li 2019:30715774}, {DOI:Li 2019:10.1002/humu.23718}, {PMID:Li 2020:33093841}" "" "" "" "Germline" "" "" "0" "" "" "g.75572040G>A" "" "pathogenic (recessive)" "" "0000784867" "21" "99" "11" "75283104" "75283104" "dup" "0" "00085" "SERPINH1_000015" "g.75283104dup" "" "{PMID:Schwarze 2019:31179625}" "" "1233dupT" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000805404" "0" "50" "11" "75277548" "75277548" "subst" "0" "01804" "SERPINH1_000115" "g.75277548T>C" "" "" "" "SERPINH1(NM_001207014.1):c.154T>C (p.(Phe52Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000853179" "0" "30" "11" "75279971" "75279971" "subst" "0.000809384" "02329" "SERPINH1_000116" "g.75279971G>A" "" "" "" "SERPINH1(NM_001235.5):c.722-13G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000890178" "0" "50" "11" "75277621" "75277621" "subst" "0.000142448" "01804" "SERPINH1_000117" "g.75277621C>T" "" "" "" "SERPINH1(NM_001207014.1):c.227C>T (p.(Ser76Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000890179" "0" "50" "11" "75282847" "75282847" "subst" "4.07342E-6" "01804" "SERPINH1_000118" "g.75282847C>G" "" "" "" "SERPINH1(NM_001207014.1):c.976C>G (p.(Leu326Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000908416" "0" "70" "11" "75280043" "75280043" "dup" "0" "04400" "SERPINH1_000119" "g.75280043dup" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.75568998dup" "" "likely pathogenic (recessive)" "ACMG" "0000925504" "0" "30" "11" "75279883" "75279883" "subst" "0.000426438" "02329" "SERPINH1_000120" "g.75279883T>C" "" "" "" "SERPINH1(NM_001235.5):c.721+9T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000925505" "0" "30" "11" "75282891" "75282891" "subst" "2.03169E-5" "01804" "SERPINH1_000121" "g.75282891G>A" "" "" "" "SERPINH1(NM_001207014.1):c.1020G>A (p.(Met340Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001038783" "0" "30" "11" "75277975" "75277975" "subst" "0" "01804" "SERPINH1_000122" "g.75277975G>A" "" "" "" "SERPINH1(NM_001235.5):c.581G>A (p.(Arg194His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001054003" "0" "50" "11" "75277880" "75277880" "subst" "1.23085E-5" "01804" "SERPINH1_000123" "g.75277880C>G" "" "" "" "SERPINH1(NM_001235.5):c.486C>G (p.(Asn162Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001054004" "0" "50" "11" "75280194" "75280194" "subst" "0" "01804" "SERPINH1_000124" "g.75280194T>C" "" "" "" "SERPINH1(NM_001235.5):c.932T>C (p.(Val311Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes SERPINH1 ## Count = 48 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000248307" "00018731" "10" "234" "0" "234" "0" "c.234A>G" "r.(?)" "p.(Leu78=)" "" "0000250042" "00018731" "10" "234" "0" "234" "0" "c.234A>G" "r.(?)" "p.(Leu78=)" "" "0000298125" "00018731" "10" "1011" "0" "1011" "0" "c.1011G>A" "r.(?)" "p.(Leu337=)" "" "0000298126" "00018731" "10" "363" "0" "363" "0" "c.363C>G" "r.(?)" "p.(Ser121=)" "" "0000298127" "00018731" "10" "598" "0" "598" "0" "c.598C>T" "r.(?)" "p.(Leu200=)" "" "0000298128" "00018731" "10" "693" "0" "693" "0" "c.693C>T" "r.(?)" "p.(Thr231=)" "" "0000299413" "00018731" "10" "1011" "0" "1011" "0" "c.1011G>A" "r.(?)" "p.(Leu337=)" "" "0000299414" "00018731" "50" "1118" "0" "1118" "0" "c.1118G>A" "r.(?)" "p.(Arg373His)" "" "0000299415" "00018731" "30" "267" "0" "267" "0" "c.267G>A" "r.(?)" "p.(Thr89=)" "" "0000299416" "00018731" "10" "363" "0" "363" "0" "c.363C>G" "r.(?)" "p.(Ser121=)" "" "0000299417" "00018731" "10" "598" "0" "598" "0" "c.598C>T" "r.(?)" "p.(Leu200=)" "" "0000299418" "00018731" "10" "693" "0" "693" "0" "c.693C>T" "r.(?)" "p.(Thr231=)" "" "0000299419" "00018731" "30" "744" "0" "744" "0" "c.744C>T" "r.(?)" "p.(Asp248=)" "" "0000354934" "00018731" "50" "689" "0" "689" "0" "c.689A>G" "r.(?)" "p.(Tyr230Cys)" "" "0000545746" "00018731" "30" "240" "0" "240" "0" "c.240C>T" "r.(?)" "p.(Leu80=)" "" "0000545747" "00018731" "10" "955" "-6" "955" "-6" "c.955-6C>A" "r.(=)" "p.(=)" "" "0000545748" "00018731" "30" "1191" "0" "1191" "0" "c.1191C>T" "r.(?)" "p.(Ser397=)" "" "0000622729" "00018731" "30" "1119" "0" "1119" "0" "c.1119C>T" "r.(?)" "p.(Arg373=)" "" "0000656915" "00018731" "50" "580" "0" "580" "0" "c.580C>A" "r.(?)" "p.(Arg194Ser)" "" "0000723711" "00018731" "10" "955" "-6" "955" "-6" "c.955-6C>A" "r.(=)" "p.(=)" "" "0000784850" "00018731" "99" "0" "0" "0" "0" "c.?" "r.?" "p.?" "_1_5_" "0000784851" "00018731" "33" "-211" "0" "-211" "0" "c.-211G>A" "r.(?)" "p.?" "1" "0000784852" "00018731" "37" "-190" "0" "-190" "0" "c.-190A>G" "r.(?)" "p.?" "1" "0000784853" "00018731" "51" "121" "0" "121" "0" "c.121G>C" "r.(?)" "p.(Ala41Pro)" "2" "0000784854" "00018731" "97" "149" "0" "149" "0" "c.149T>G" "r.(?)" "p.(Leu50Arg)" "2" "0000784855" "00018731" "99" "233" "0" "233" "0" "c.233T>C" "r.(?)" "p.(Leu78Pro)" "2" "0000784856" "00018731" "51" "234" "0" "234" "0" "c.234A>G" "r.(?)" "p.(=)" "2" "0000784857" "00018731" "99" "338" "0" "357" "0" "c.338_357delinsTGCAACGTGACCCACGCACGTG" "r.(?)" "p.(Glu113Valfs*8)" "2" "0000784858" "00018731" "51" "363" "0" "363" "0" "c.363C>G" "r.(?)" "p.(=)" "2" "0000784859" "00018731" "97" "589" "0" "589" "0" "c.589G>C" "r.(?)" "p.(Gly197Arg)" "2" "0000784860" "00018731" "51" "598" "0" "598" "0" "c.598C>T" "r.(?)" "p.(=)" "2" "0000784861" "00018731" "75" "314" "0" "325" "0" "c.314_325del" "r.(?)" "p.(Glu105_His108del)" "3" "0000784862" "00018731" "51" "693" "0" "693" "0" "c.693C>T" "r.(?)" "p.(=)" "3" "0000784863" "00018731" "99" "710" "0" "710" "0" "c.710T>C" "r.(?)" "p.(Met237Thr)" "3" "0000784864" "00018731" "97" "800" "0" "800" "0" "c.800T>C" "r.(?)" "p.(Leu267Pro)" "4" "0000784865" "00018731" "51" "1011" "0" "1011" "0" "c.1011G>A" "r.(?)" "p.(=)" "5" "0000784866" "00018731" "97" "1214" "0" "1214" "0" "c.1214G>A" "r.(?)" "p.(Arg405His)" "5" "0000784867" "00018731" "99" "1233" "0" "1233" "0" "c.1233dup" "r.(?)" "p.Asp412*" "5" "0000805404" "00018731" "50" "154" "0" "154" "0" "c.154T>C" "r.(?)" "p.(Phe52Leu)" "" "0000853179" "00018731" "30" "722" "-13" "722" "-13" "c.722-13G>A" "r.(=)" "p.(=)" "" "0000890178" "00018731" "50" "227" "0" "227" "0" "c.227C>T" "r.(?)" "p.(Ser76Leu)" "" "0000890179" "00018731" "50" "976" "0" "976" "0" "c.976C>G" "r.(?)" "p.(Leu326Val)" "" "0000908416" "00018731" "70" "781" "0" "781" "0" "c.781dup" "r.(?)" "p.(Ala261GlyfsTer22)" "5" "0000925504" "00018731" "30" "721" "9" "721" "9" "c.721+9T>C" "r.(=)" "p.(=)" "" "0000925505" "00018731" "30" "1020" "0" "1020" "0" "c.1020G>A" "r.(?)" "p.(Met340Ile)" "" "0001038783" "00018731" "30" "581" "0" "581" "0" "c.581G>A" "r.(?)" "p.(Arg194His)" "" "0001054003" "00018731" "50" "486" "0" "486" "0" "c.486C>G" "r.(?)" "p.(Asn162Lys)" "" "0001054004" "00018731" "50" "932" "0" "932" "0" "c.932T>C" "r.(?)" "p.(Val311Ala)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 20 "{{screeningid}}" "{{variantid}}" "0000155264" "0000354934" "0000374133" "0000784850" "0000374133" "0000784867" "0000374134" "0000784851" "0000374135" "0000784852" "0000374136" "0000784853" "0000374137" "0000784854" "0000374137" "0000784866" "0000374138" "0000784855" "0000374139" "0000784856" "0000374140" "0000784857" "0000374141" "0000784858" "0000374142" "0000784859" "0000374142" "0000784864" "0000374143" "0000784860" "0000374144" "0000784861" "0000374145" "0000784862" "0000374146" "0000784863" "0000374147" "0000784865" "0000429005" "0000908416"