### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = SETBP1) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "SETBP1" "SET binding protein 1" "18" "q21.1" "unknown" "NG_027527.2" "UD_132118986932" "" "https://www.LOVD.nl/SETBP1" "" "1" "15573" "26040" "611060" "1" "1" "1" "1" "Establishment of the database was supported by the European Community\'s Seventh Framework Programme (FP7/2007-2013) under grant agreement No 200754 - the GEN2PHEN project." "" "g" "http://databases.lovd.nl/shared/refseq/SETBP1_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2010-06-25 00:00:00" "00006" "2017-11-11 21:04:12" "00000" "2026-01-20 18:57:21" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00024168" "SETBP1" "transcript variant 1" "004" "NM_015559.2" "" "NP_056374.2" "" "" "" "-296" "9603" "4791" "42260863" "42648475" "00006" "2016-09-14 16:47:38" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 11 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00139" "ID" "intellectual disability (ID)" "" "" "" "" "" "00084" "2013-06-04 18:18:07" "00006" "2015-02-09 10:02:49" "00189" "TSC2" "tuberous sclerosis, type 2" "AD" "613254" "" "" "" "00006" "2013-09-05 22:00:33" "00006" "2022-08-19 09:49:18" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00741" "SGS" "Schinzel-Giedion midface retraction syndrome (SGS)" "AD" "269150" "" "autosomal dominant" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "02412" "SPCH" "speech-language disorder (SPCH)" "" "" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2019-02-14 16:20:22" "04270" "epilepsy" "epilepsy" "" "" "" "" "" "00006" "2015-05-14 16:00:06" "00006" "2017-09-07 14:25:59" "04655" "MRD29" "mental retardation, autosomal dominant, type 29 (MRD29)" "AD" "616078" "" "" "" "00000" "2015-09-23 10:25:23" "00006" "2020-11-03 13:29:43" "05162" "DD" "developmental delay (DD)" "" "" "" "" "" "00006" "2016-05-10 21:15:54" "00006" "2020-05-25 13:52:33" "05342" "CAKUT" "kidney and urinary tract, anomalies, congenital (CAKUT)" "" "" "" "" "" "00006" "2017-11-10 19:49:59" "00006" "2017-11-10 19:51:20" "05533" "MR;ID" "mental retardation (MR, intellectual disability (ID))" "" "" "" "" "" "00006" "2018-12-18 09:22:07" "" "" "05611" "NDD" "neurodevelopmental disorder (NDD)" "" "" "" "" "" "00006" "2019-06-19 12:27:20" "00006" "2024-12-13 11:12:21" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 3 "{{geneid}}" "{{diseaseid}}" "SETBP1" "00139" "SETBP1" "00741" "SETBP1" "04655" ## Individuals ## Do not remove or alter this header ## ## Count = 113 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00050414" "" "" "" "1" "" "00006" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "family, 1 affected" "F" "" "United Kingdom (Great Britain)" "" "0" "Decipher" "" "" "" "00081091" "" "" "" "1" "" "01758" "{PMID:Trujillano 2017:27848944}" "unaffected non-carrier parents" "" "" "" "" "0" "" "" "" "" "00132978" "" "" "" "1" "" "00006" "{PMID:Sanna-Cherchi 2017:29100090}, {DOI:Sanna-Cherchi 2017:10.1016/j.ajhg.2017.09.018}" "" "M" "" "" "" "0" "" "" "" "29100090-FamDC20" "00144433" "" "" "" "1" "" "01807" "" "" "F" "" "(Germany)" "" "0" "" "" "" "" "00163908" "" "" "" "1" "" "01807" "" "" "M" "" "(Germany)" "" "0" "" "" "" "" "00183668" "" "" "" "1" "" "00006" "{PMID:Martinez 2017:27620904}, {DOI:Martinez 2017:10.1136/jmedgenet-2017-103964}" "" "" "" "Spain" "" "0" "" "" "" "27620904-Pat13" "00207318" "" "" "" "1" "" "00000" "" "" "M" "" "" "" "0" "" "" "Turkish" "" "00207319" "" "" "" "1" "" "00000" "" "" "M" "" "" "" "0" "" "" "European" "" "00207320" "" "" "" "1" "" "00000" "" "" "F" "" "" "" "0" "" "" "European" "" "00207321" "" "" "" "1" "" "00000" "" "" "M" "" "" "" "0" "" "" "European" "" "00207322" "" "" "" "1" "" "00000" "" "" "F" "" "" "" "0" "" "" "European" "" "00207323" "" "" "" "1" "" "00000" "" "" "F" "" "" "" "0" "" "" "European" "" "00207324" "" "" "" "1" "" "00000" "" "" "F" "" "" "" "0" "" "" "European" "" "00207325" "" "" "" "1" "" "00000" "" "" "M" "" "" "" "0" "" "" "European" "" "00207326" "" "" "" "1" "" "00000" "" "" "F" "" "" "" "0" "" "" "European" "" "00207327" "" "" "" "1" "" "00000" "" "" "M" "" "" "" "0" "" "" "European" "" "00207328" "" "" "" "1" "" "00000" "" "" "F" "" "" "" "0" "" "" "European" "" "00207329" "" "" "" "1" "" "00000" "" "" "M" "" "" "" "0" "" "" "European" "" "00207330" "" "" "" "1" "" "00000" "" "" "M" "" "" "" "0" "" "" "European" "" "00275873" "" "" "" "1" "" "03833" "{PMID:Eising 2018:29463886}" "analysis 19 individuals with childhood apraxia of speech" "F" "" "" "" "0" "" "" "" "Pat13" "00289344" "" "" "" "1" "" "03288" "" "" "M" "no" "Italy" "01y" "0" "" "" "" "1123" "00291955" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00291956" "" "" "" "13" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00302661" "" "" "" "1" "" "01238" "{PMID:Leonardi 2020:32214004}, {DOI:Leonardi 2020:10.3390/genes11030344}" "carries de novo LoF variant in SETBP1" "M" "" "Italy" "" "0" "" "" "" "" "00302777" "" "" "" "1" "" "00006" "{PMID:Hamdan 2015:25356899}" "" "M" "" "Canada" "" "0" "" "" "French" "1861.653" "00307768" "" "" "" "1" "" "00006" "{PMID:Grozeva 2015:26350204}, {DOI:Grozeva 2015:10.1002/humu.22901}" "" "M" "" "" "" "0" "" "" "" "UK10K_FINDWGA5411268" "00308009" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" "" "00315900" "" "" "" "1" "" "01238" "" "" "M" "no" "Italy" "" "0" "" "" "" "MR3016_01" "00315901" "" "" "" "1" "" "01238" "" "" "M" "no" "Italy" "" "0" "" "" "" "MR2274_01" "00315902" "" "" "" "1" "" "01238" "" "" "F" "no" "Italy" "" "0" "" "" "" "MR466_01" "00316191" "" "" "" "1" "" "01238" "" "" "M" "no" "Italy" "" "0" "" "" "" "MR2128_01" "00316193" "" "" "" "1" "" "03833" "Morgan 2021, submitted" "parents deceased, unaffected sister did not carry variant" "F" "" "Netherlands" "" "0" "" "" "" "Ind3" "00316194" "" "" "" "1" "" "01238" "" "" "F" "no" "Romania" "" "0" "" "" "" "MR2622_01" "00316195" "" "" "" "1" "" "01238" "" "" "M" "no" "Ukraine" "" "0" "" "" "" "MR2627_01" "00316196" "" "" "" "1" "" "01238" "" "" "M" "no" "Albania" "" "0" "" "" "" "MR2703_01" "00316197" "" "" "" "1" "" "01238" "" "" "M" "no" "Italy" "" "0" "" "" "" "MR2633_01" "00316198" "" "" "" "1" "" "01238" "" "" "M" "no" "Italy" "" "0" "" "" "" "MR2618_01" "00316200" "" "" "" "1" "" "01238" "" "" "M" "?" "Italy" "" "0" "" "" "" "MR3700_01" "00316202" "" "" "" "1" "" "01238" "" "" "M" "no" "Italy" "" "0" "" "" "" "MR3951_01" "00320172" "" "" "" "1" "" "01807" "" "" "F" "" "" "" "0" "" "" "" "" "00324308" "" "" "" "4" "" "00006" "{PMID:Filges 2020:21037274}" "analysis 142 cases developmental delay" "" "" "Japan" "" "0" "" "" "" "case" "00324309" "" "" "" "1" "" "00006" "{PMID:Filges 2020:21037274}" "analysis 142 cases developmental delay" "" "" "Japan" "" "0" "" "" "" "case" "00324310" "" "" "" "3" "" "00006" "{PMID:Filges 2020:21037274}" "analysis 142 cases developmental delay" "" "" "Japan" "" "0" "" "" "" "case" "00324311" "" "" "" "1" "" "00006" "{PMID:Filges 2020:21037274}" "analysis 142 cases developmental delay" "" "" "Japan" "" "0" "" "" "" "case" "00324312" "" "" "" "2" "" "00006" "{PMID:Filges 2020:21037274}" "analysis 142 cases developmental delay" "" "" "Japan" "" "0" "" "" "" "case" "00324313" "" "" "" "12" "" "00006" "{PMID:Filges 2020:21037274}" "analysis 142 cases developmental delay" "" "" "Japan" "" "0" "" "" "" "case" "00324314" "" "" "" "1" "" "00006" "{PMID:Filges 2020:21037274}" "analysis 142 cases developmental delay" "" "" "Japan" "" "0" "" "" "" "case" "00324315" "" "" "" "1" "" "00006" "{PMID:Filges 2020:21037274}" "analysis 142 cases developmental delay" "" "" "Japan" "" "0" "" "" "" "case" "00324316" "" "" "" "90" "" "00006" "{PMID:Filges 2020:21037274}" "analysis 142 cases developmental delay" "" "" "Japan" "" "0" "" "" "" "case" "00324317" "" "" "" "1" "" "00006" "{PMID:Filges 2020:21037274}" "analysis 142 cases developmental delay" "" "" "Japan" "" "0" "" "" "" "case" "00324318" "" "" "" "66" "" "00006" "{PMID:Filges 2020:21037274}" "analysis 142 cases developmental delay" "" "" "Japan" "" "0" "" "" "" "case" "00324319" "" "" "" "1" "" "00006" "{PMID:Filges 2020:21037274}" "analysis 142 cases developmental delay" "" "" "Japan" "" "0" "" "" "" "case" "00324320" "" "" "" "2" "" "00006" "{PMID:Filges 2020:21037274}" "analysis 142 cases developmental delay" "" "" "Japan" "" "0" "" "" "" "case" "00324321" "" "" "" "1" "" "00006" "{PMID:Filges 2020:21037274}" "analysis 142 cases developmental delay" "" "" "Japan" "" "0" "" "" "" "case" "00324322" "" "" "" "3" "" "00006" "{PMID:Filges 2020:21037274}" "analysis 142 cases developmental delay" "" "" "Japan" "" "0" "" "" "" "case" "00324323" "" "" "" "1" "" "00006" "{PMID:Filges 2020:21037274}" "analysis 142 cases developmental delay" "" "" "Japan" "" "0" "" "" "" "case" "00324324" "" "" "" "1" "" "00006" "{PMID:Filges 2020:21037274}" "analysis 142 cases developmental delay" "" "" "Japan" "" "0" "" "" "" "case" "00324325" "" "" "" "1" "" "00006" "{PMID:Filges 2020:21037274}" "analysis 142 cases developmental delay" "" "" "Japan" "" "0" "" "" "" "case" "00324346" "" "" "" "1" "" "03833" "{PMID:Coe 2014:25217958}" "" "F" "" "Netherlands" "" "0" "" "" "" "" "00324347" "" "" "" "1" "" "03833" "{PMID:Coe 2014:25217958}" "" "F" "" "Netherlands" "" "0" "" "" "" "" "00324348" "" "" "" "1" "" "03833" "Morgan 2021, submitted" "parents deceased, unaffected sisters do not have variant" "F" "" "Netherlands" "" "0" "" "" "" "Ind4" "00324349" "" "" "" "1" "" "03833" "{PMID:Coe 2014:25217958}" "" "M" "" "United States" "" "0" "" "" "" "" "00324350" "" "" "" "1" "" "03833" "Morgan 2021, submitted" "" "M" "" "France" "" "0" "" "" "" "Ind6" "00324351" "" "" "" "1" "" "03833" "Morgan 2021, submitted" "" "M" "" "United States" "" "0" "" "" "" "Ind7" "00324352" "" "" "" "1" "" "03833" "Morgan 2021, submitted" "" "M" "" "France" "" "0" "" "" "" "Ind8" "00324353" "" "" "" "1" "" "03833" "Morgan 2021, submitted" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "Ind9" "00324354" "" "" "" "1" "" "03833" "Morgan 2021, submitted" "" "F" "" "Netherlands" "" "0" "" "" "" "Ind10" "00324355" "" "" "" "1" "" "03833" "Morgan 2021, submitted" "" "F" "" "Netherlands" "" "0" "" "" "" "Ind11" "00324356" "" "" "" "1" "" "03833" "Morgan 2021, submitted" "" "F" "" "France" "" "0" "" "" "" "Ind12" "00324357" "" "" "" "1" "" "03833" "Morgan 2021, submitted" "" "F" "" "Netherlands" "" "0" "" "" "" "Ind13" "00324358" "" "" "" "1" "" "03833" "Morgan 2021, submitted" "" "F" "" "United States" "" "0" "" "" "" "Ind14" "00324359" "" "" "" "1" "" "03833" "Morgan 2021, submitted" "" "M" "" "United States" "" "0" "" "" "" "Ind16" "00324360" "" "" "" "1" "" "03833" "{PMID:Coe 2014:25217958}" "" "M" "" "France" "" "0" "" "" "" "" "00324361" "" "" "" "1" "" "03833" "Morgan 2021, submitted" "" "M" "" "United States" "" "0" "" "" "" "Ind18" "00324362" "" "" "" "1" "" "03833" "Morgan 2021, submitted" "" "M" "" "United States" "" "0" "" "" "" "Ind19" "00324363" "" "" "" "1" "" "03833" "Morgan 2021, submitted" "" "F" "" "Israel" "" "0" "" "" "" "Ind20" "00324364" "" "" "" "1" "" "03833" "Morgan 2021, submitted" "" "M" "" "United States" "" "0" "" "" "" "Ind21" "00324365" "" "" "" "1" "" "03833" "Morgan 2021, submitted" "" "M" "" "United States" "" "0" "" "" "" "Ind22" "00324366" "" "" "" "1" "" "03833" "Morgan 2021, submitted" "" "M" "" "United States" "" "0" "" "" "" "Ind23" "00324367" "" "" "" "1" "" "03833" "Morgan 2021, submitted" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "Ind24" "00324368" "" "" "" "1" "" "03833" "Morgan 2021, submitted" "" "M" "" "United States" "" "0" "" "" "" "Ind25" "00324369" "" "" "" "1" "" "03833" "{PMID:Eising 2019:29463886}, {PMID:Hildebrand 2020:32345733}" "" "F" "" "Australia" "" "0" "" "" "" "?/Pat1" "00324370" "" "" "" "1" "" "03833" "{PMID:Coe 2014:25217958}" "" "M" "" "Netherlands" "" "0" "" "" "" "" "00324371" "" "" "" "1" "" "03833" "{PMID:Coe 2014:25217958}" "" "M" "" "Netherlands" "" "0" "" "" "" "" "00324372" "" "" "" "1" "" "03833" "{PMID:Coe 2014:25217958}" "" "F" "" "Netherlands" "" "0" "" "" "" "" "00324373" "" "" "" "1" "" "03833" "{PMID:Coe 2014:25217958}" "" "M" "" "Netherlands" "" "0" "" "" "" "" "00324374" "" "" "" "1" "" "03833" "{PMID:Coe 2014:25217958}" "" "M" "" "Italy" "" "0" "" "" "" "" "00324375" "" "" "" "1" "" "03833" "{PMID:Coe 2014:25217958}" "" "F" "" "Italy" "" "0" "" "" "" "" "00324376" "" "" "" "1" "" "03833" "{PMID:Rauch 2012:23020937}" "" "F" "" "Germany" "" "0" "" "" "" "BO22/10" "00324377" "" "" "" "1" "" "03833" "{PMID:Marseglia 2012:22333924}" "" "M" "" "Italy" "" "0" "" "" "" "patient" "00324378" "" "" "" "1" "" "03833" "{PMID:Filges 2020:21037274}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat1" "00324379" "" "" "" "1" "" "00006" "{PMID:Filges 2020:21037274}" "" "M" "" "Japan" "" "0" "" "" "" "Pat2" "00335726" "" "" "" "1" "" "01807" "" "" "M" "" "" "" "0" "" "" "" "" "00359556" "" "" "" "1" "" "04031" "Morgan 2021, submitted" "" "F" "" "Australia" "" "0" "" "" "" "Pat3" "00359557" "" "" "" "1" "" "04031" "Morgan 2021, submitted" "" "M" "" "Australia" "" "0" "" "" "" "Pat4" "00359558" "" "" "" "1" "" "04031" "Morgan 2021, submitted" "" "M" "" "Australia" "" "0" "" "" "" "Pat10" "00359559" "" "" "" "1" "" "04031" "Morgan 2021, submitted" "" "M" "" "Australia" "" "0" "" "" "" "Pat15" "00359560" "" "" "" "1" "" "04031" "Morgan 2021, submitted" "" "F" "" "Australia" "" "0" "" "" "" "Pat22" "00359561" "" "" "" "1" "" "04031" "Morgan 2021, submitted" "" "M" "" "Australia" "" "0" "" "" "" "Pat24" "00359562" "" "" "" "1" "" "04031" "Morgan 2021, submitted" "" "M" "" "Australia" "" "0" "" "" "" "Pat25" "00361490" "" "" "" "1" "" "00006" "{PMID:Anazi 2017:27431290}" "simplex case" "F" "no" "Saudi Arabia" "" "0" "" "" "" "11DG0891" "00374435" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-4839" "00380400" "" "" "" "1" "" "00006" "{PMID:Goodman 2021:34314705}, {DOI:Goodman 2021:10.1016/j.ajhg.2021.06.019}" "" "" "" "Australia" "" "0" "" "" "" "Pat5" "00387785" "" "" "" "3" "" "00006" "{PMID:Hu 2019:29302074}" "family, 3 affected individuals, first cousin parents" "" "yes" "Iran" "" "0" "" "" "Persia" "M8600213" "00391858" "" "" "" "1" "" "02494" "" "" "F" "no" "Spain" "" "" "" "" "" "241P" "00401306" "" "" "" "1" "" "02494" "" "" "M" "no" "Spain" "" "" "" "" "" "083P" "00428281" "" "" "" "1" "" "01164" "" "" "F" "no" "Germany" "" "0" "" "" "" "211479" "00438327" "" "" "" "1" "" "00006" "{PMID:Chuan 2022:35571021}" "" "F" "" "China" "" "0" "" "" "" "Pat45" "00438375" "" "" "" "1" "" "00006" "{PMID:Chuan 2022:35571021}" "" "M" "" "China" "" "0" "" "" "" "Pat93" "00449746" "" "" "" "1" "" "03544" "" "" "M" "-" "- (not applicable)" "" "" "" "" "" "" "00458101" "" "" "" "1" "" "03544" "" "" "F" "-" "- (not applicable)" "" "" "" "" "white" "" "00464360" "" "" "" "1" "" "04459" "" "" "" "" "" "" "" "" "" "" "" "00469352" "" "" "" "1" "" "00006" "{PMID:Retterer 2016:26633542}" "analysis proband (1/3040); possible combination of variants not reported" "" "" "United States" "" "0" "" "" "" "" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 117 "{{individualid}}" "{{diseaseid}}" "00050414" "00198" "00081091" "00741" "00132978" "05342" "00144433" "00198" "00163908" "00198" "00183668" "00139" "00207318" "00198" "00207319" "00741" "00207320" "00741" "00207321" "00741" "00207322" "00741" "00207323" "00741" "00207324" "00741" "00207325" "00741" "00207326" "00741" "00207327" "00741" "00207328" "00741" "00207329" "00741" "00207330" "00741" "00275873" "02412" "00289344" "00741" "00291955" "00198" "00291956" "00198" "00302661" "00139" "00302777" "00139" "00307768" "00139" "00308009" "00198" "00315900" "04655" "00315901" "04655" "00315902" "00741" "00316191" "05533" "00316193" "00198" "00316194" "05533" "00316195" "05533" "00316196" "05533" "00316197" "05533" "00316198" "05533" "00316200" "04270" "00316202" "04270" "00320172" "00198" "00324308" "05162" "00324309" "05162" "00324310" "05162" "00324311" "05162" "00324312" "05162" "00324313" "05162" "00324314" "05162" "00324315" "05162" "00324316" "05162" "00324317" "05162" "00324318" "05162" "00324319" "05162" "00324320" "05162" "00324321" "05162" "00324322" "05162" "00324323" "05162" "00324324" "05162" "00324325" "05162" "00324346" "00198" "00324347" "00198" "00324348" "00198" "00324349" "00198" "00324350" "00198" "00324351" "00198" "00324352" "00198" "00324353" "00198" "00324354" "00198" "00324355" "00198" "00324356" "00198" "00324357" "00198" "00324358" "00198" "00324359" "00198" "00324360" "00198" "00324361" "00198" "00324362" "00198" "00324363" "00198" "00324364" "00198" "00324365" "00198" "00324366" "00198" "00324367" "00198" "00324368" "00198" "00324369" "00198" "00324370" "00198" "00324371" "00198" "00324372" "00198" "00324373" "00198" "00324374" "00198" "00324375" "00198" "00324376" "00198" "00324377" "00198" "00324378" "00198" "00324379" "00198" "00335726" "00198" "00359556" "00189" "00359557" "00189" "00359558" "00189" "00359559" "00189" "00359560" "00189" "00359561" "00189" "00359562" "00189" "00361490" "00139" "00374435" "00198" "00380400" "05611" "00387785" "00139" "00391858" "00139" "00391858" "00741" "00391858" "04655" "00401306" "00139" "00401306" "00741" "00401306" "04655" "00428281" "04655" "00438327" "04270" "00438375" "04270" "00449746" "00139" "00458101" "05162" "00464360" "04655" "00469352" "00198" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00139, 00189, 00198, 00741, 02412, 04270, 04655, 05162, 05342, 05533, 05611 ## Count = 77 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Development/Cognition}}" "{{Phenotype/Seizures}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/TSC}}" "{{Phenotype/Development_delay_global/HPO_0001263}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Intellectual_dis/HPO_0001249}}" "{{Phenotype/Hypertension/HPO_0000822}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000037026" "00198" "00050414" "00006" "Isolated (sporadic)" "" "nephrocalcinosis, velopharyngeal insufficiency, joint hypermobility, widely spaced teeth, delayed speech and language development, intellectual disability" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000060660" "00741" "00081091" "01758" "Isolated (sporadic)" "" "Schinzel-Giedion midface retraction syndrome (OMIM:269150)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000105739" "05342" "00132978" "00006" "Unknown" "" "CAKUT, renal agenesis right" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000117201" "00198" "00144433" "01807" "Unknown" "" "Intellectual disability (HP:0001249); Global developmental delay (HP:0001263)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000129020" "00198" "00163908" "01807" "Unknown" "" "Global developmental delay (HP:0001263); Muscular hypotonia (HP:0001252)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000144354" "00139" "00183668" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "SGS" "intellectual disability" "" "0000155112" "00198" "00207318" "00008" "Familial, autosomal recessive" "" "Nonsyndromic Hearing Impairment" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000210473" "02412" "00275873" "00006" "Unknown" "12y" "childhood apraxia of speech; late onset language use; listening comprehension scales standard scores <85; mild intelletual disability IQ<70; oral expression scales standard scores <85; gross or fine motor impairment; oral nonverbal motor impairment; dysarthria" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "childhood apraxia of speech" "" "0000222964" "00741" "00289344" "03288" "Isolated (sporadic)" "00y04m" "" "00y00m" "" "" "01y" "" "" "" "" "" "" "" "" "" "" "S" "" "" "0000229742" "00139" "00302661" "01238" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000229859" "00139" "00302777" "03833" "Isolated (sporadic)" "11y06m" "pregnancy partial placental abruption, analysis found placental necrosis, 40w-vaginal delivery using suction cups,Apgar score was 9, then 10. , , birth weight 2.460kg (p2); weight p3, height p2, OFC p3; motor development first words < 12m. makes 2-3 word sentences at 6.5 ys. 100 words at 25 months. pronuncation is difficult; speech furst words <12 ms; moderate intelletual disability.; 7y3m-IQ47-59, specialised primary school; ADD (medication: biphentin every day (30mg)), social normal behavior; no autism spectrum disorder; hypotonia; no seizures; EEG normal; 2y-MRI brain normal except for myelination delay; no congenital anomalies; thin lips, micrognatia; color blindness, wear glasses, no further information; recurrent ear infetions 6-14ms. every two months periods of daily diarrhea; feeding problems" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000233432" "00198" "00308009" "01164" "Unknown" "" "Global developmental delay (HP:0001263); Cleft palate (HP:0000175); Abnormality of the ear (HP:0000598); Hyperactivity (HP:0000752); Absent speech (HP:0001344); Autism (HP:0000717)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000239645" "04655" "00315900" "01238" "Isolated (sporadic)" "" "" "" "" "" "07y" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000239646" "04655" "00315901" "01238" "Isolated (sporadic)" "" "" "" "" "" "05y" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000239647" "00741" "00315902" "01238" "Familial" "" "High forehead, Prominent forehead, Intellectual Disability, severe, Absent speech, seizures" "" "" "" "12y" "" "" "" "" "" "" "" "" "" "" "Atypical SGS" "" "" "0000239938" "05533" "00316191" "01238" "Isolated (sporadic)" "02y" "Global developmental delay; stereotypy; recurrent fever" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000239939" "00198" "00316193" "03833" "Isolated (sporadic)" "50y" "weight normal, height p16, OFC p67; motor development barely speaks, uses sign language; severe intelletual disability; level of development 4 years; aggresive, violent, impulsive, self-mutilation; no autism spectrum disorder; no attention deficit hyperactivity disorder/ADD; normal tonus; no seizures; broad nasal tip, flat philtrum, strabismus, posteriorly rotated ears, high palate; normal hearing; unknown abnormality intestine operated; hand tremor" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "MRD29" "intellectual disability" "" "0000239941" "05533" "00316194" "01238" "Isolated (sporadic)" "03y" "Language impairment; Mild Intellectual Disability" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000239942" "05533" "00316195" "01238" "Isolated (sporadic)" "17y" "Psychiatric disorder, Moderate Intellectual Disability" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000239943" "05533" "00316196" "01238" "Isolated (sporadic)" "03y" "Language impairment, Severe expressive language delay, poor motor coordination" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000239944" "05533" "00316197" "01238" "Isolated (sporadic)" "02y" "Autism, Language impairment, Absent speech" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000239945" "05533" "00316198" "01238" "Familial" "03y" "Autism" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000239947" "04270" "00316200" "01238" "Isolated (sporadic)" "01y" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000239948" "04270" "00316202" "01238" "Isolated (sporadic)" "" "West Syndrome" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000242218" "00198" "00320172" "01807" "Unknown" "" "Strabismus (HP:0000486); Behavioral abnormality (HP:0000708); Delayed speech and language development (HP:0000750); Intellectual disability (HP:0001249)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000242889" "00198" "00324346" "03833" "Isolated (sporadic)" "4y" "fetal distress (meconium stained amniotic fluid) leads to emergency cesa; rean section, APGAR 3/8/9, single uterine artery, birth 40+2w, birth weight 2.4kg (p2); weight p80, height p69, OFC p46; motor development delayed. first word at age of 3. five words at 4 years. uses sign language language. understanding milder affected. still learning short sentences.; speech furst words 36m; moderate intelletual disability; 3y-IQ69 (Bailey II); temper tantrums, attention/concentration deficit, impulsivity; no autism spectrum disorder; no attention deficit hyperactivity disorder/ADD; hypertonia, spasticity; 1.5y-febrile seizures, no medication; sleep disturbance; no congenital anomalies; no facial dysmorphisms; normal hearing; normal eyes; strong body odor" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000242890" "00198" "00324347" "03833" "Isolated (sporadic)" "2y4m" "dysmature, hypotonia, birth 38+3w, birth weight 2.335kg (p2); weight p67, height p13, OFC p65; motor development impairment. does not speak. uses sign language. little facial expression. language comprehension at 26 months at age of 10 months; moderate intelletual disability; 26m-IQ of 16m; anxieties, attention/concentration deficit, tempert tantrums, impulsivity, gnash, fear of abandonment by going to sleep; no autism spectrum disorder; no attention deficit hyperactivity disorder/ADD; hypotonia; no seizures; 1y-MRI brain normal; sleep disturbance; congenital ankyloglossis, frenectomy; broad nasal bridge, epicanthal folds, low-set ears; simian line (fourfinger line); normal hearing; 2.5y-OD: S+2 OS: S+3, glasses, exophoria, strabismus sursoadductorius OD; beta thalassemie minor, microcytic anemia. mild eczema;" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000242891" "00198" "00324348" "03833" "Unknown" "64y" "weight normal, height p16, OFC p67; motor development speaks a little; moderate intelletual disability; no autism spectrum disorder; no attention deficit hyperactivity disorder/ADD; normal tonus; no seizures; broad nasal tip, flat philtrum, high palate; normal hearing;" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000242892" "00198" "00324349" "03833" "Isolated (sporadic)" "10y" "birth weight 3.37kg (p50), ,; weight p5, height p40, OFC p50; motor development 2 word phrases at 2.5 ys. full sentences at 3.5 ys. hypernasal speech. currently speaks in phrases and short sentences. solid nonverbal communication including integrating eye contact, gestures, and facial expressions with his speech. moderately low expressive vocabulary. therapy 5 days a week for several years. preschool for children with language based learning disorders. speaks well now, but occasionally muffled, difficult to understand; speech furst words 12m; borderline intelletual disability (we had mild); 10y-global IQ score 69, full scale IQ 72; attention/concentration deficit, takes intuniv, quillivant and vayarin for attention deficit hyperactivity disorder. socially immature; no autism spectrum disorder; attention deficit hyperactivity disorder/ADD; hypotonia; no seizures; MRI brain normal; no congenital anomalies; strabismus, almond shaped full eyes, small eyes, intermittent exotropia. thin upper lip. bulbous nose, wide nasal bridge; normal hearing; normal eyes; recurrent ear infections, ear tubes surgery. medical history of constipation and reflux;" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000242893" "00198" "00324350" "03833" "Isolated (sporadic)" "11y" "birth 41w, birth weight 3.32kg (p35),; weight p50, height p98, OFC p50; motor development delayed. simple sentences, articulation disorder. good vocabulary. good verbal comprehension; speech furst words 2,5y; mild intelletual disability, can write and read; anxieties, attention/concentration deficit, hand bitting, enuresis, mild relational disorder; no autism spectrum disorder; no attention deficit hyperactivity disorder/ADD; normal tonus; no seizures; no congenital anomalies; downslant palbebral fissures, ptosis, infra-orbital folds, protruding ears; normal hearing; hypermetropia; good general health, vesical hyperactivity, dry skin;" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000242894" "00198" "00324351" "03833" "Isolated (sporadic)" "14y" "no concerns during pregnancy/birth, birth weight 3.63kg (p57); weight p50, height p79, OFC p84; motor development delayed. used words at 6 months, but lost them. first words at 4 ys (48 m). first phrases at 7 ys. phrases and short sentences currently (14 y) he has extremely low receptive vocabulary and expressive vocabulary; speech furst words 4y; severe intelletual disability; full scale IQ33, verbal IQ31, nonverbal IQ42; anxieties, temper tantrums, attention deficit hyperactivity disorder takes concerta and risperdone. diagnosed with autism spectrum disorder PDD-Nos; autism spectrum disorder; attention deficit hyperactivity disorder/ADD; normal tonus; no seizures; 5y-MRI brain normal; 1d-abnormal vertebrae, cleft lip, cleft palate, undescended testicles; high hairline, prominent forehead, bilateral dimples, high nasal root with a wide tip and wide prominent nose. crowded teeth, pointed canines, narrow palate; flat tips of fingers and toes and hockey stick palmar creases; spatulate finger tips with depressed/flat nail beds; bilateral 5th finger clinodactyly; small 5th toenails; mild 2-3 syndactyly of toes birthmark 7 ys; normal hearing; hypermetropia, left astigmatism; 72-84m-GERD, 9m-orchipexy, 7y-adenoidectomy and birthmark removed, medication: concerta and resperidon (ADHD);" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000242895" "00198" "00324352" "03833" "Isolated (sporadic)" "17y" "birth weight 3.055kg (p13), ,; weight p75, height p90, OFC p90; motor development at 17 years : simple sentences, no reading and no writting; moderate intelletual disability; anxieties, solitary behavior; no autism spectrum disorder; no attention deficit hyperactivity disorder/ADD; normal tonus; no seizures; 7y-EEG normal; 7y-MRI brain normal, 14y-MRI brain normal; no congenital anomalies; hyperpigmented spots on the tongue; overlaps toes; normal hearing; normal eyes;" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000242896" "00198" "00324353" "03833" "Isolated (sporadic)" "14y" "forceps delivery, resuscitated at birth, Apgar 2, 10-20 min Apgar 8. pneumothorax, one week observation at neonatal intensive care unit, whooping cough , birth weight 3.8kg (p75); weight p50, height p95, OFC p84; motor development delayed. sign language at 2 ys. speech almost absent at 11 ys, at 12 years going to speach/language school. short sentences at 14 ys. poor pronunciation, grumble; speech furst words 132m; severe intelletual disability; hyperactivity, attention/concentration deficit. agressive behavior. sensory issues, sensitive to sounds. compulsive behaviour, not official diagnosed.; no autism spectrum disorder; no attention deficit hyperactivity disorder/ADDt diagno attention deficit hyperactivity disorder/ADDsed; normal tonus; no seizures; congenital ankyglossis; retrognatia, hypotone face, prominent nose, mild retrognathia, ptosis, prominent anti-helix; cavus foot; normal hearing; lack of binocular vision; coeliac disease (diet gluten, casein, soya, sugar, starch free), 2y-recurrent ear infections, 2.5y-operations grommets and adenoidectomy, 7y-tongue tie operation (80% tongue tie), medication: antihistamines, ketotifen (zaditen);" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000242897" "00198" "00324354" "03833" "Isolated (sporadic)" "13y" "vacuum delivery, low first Apgar then good recovery, birth weight 3.4kg (p36); weight p38, height p60,; motor development delayed. first words at 14 months, 16 months no speaking, 20 months a few words, good language comprehension. 2 word sentences at 4,5 year. short sentences 6-7y. 13 years: phrases with multiple words, she has to search for her words.; speech furst words 14m; mild intelletual disability; 13y-global IQ59; reduced load capacity. aversion to food, additional feeding needed untill puberty. hyperactivity and attention/concentration deficit.; no autism spectrum disorder; no attention deficit hyperactivity disorder/ADDt diagno attention deficit hyperactivity disorder/ADDsed; hypotonia; no seizures; 2.5y-MRI brain normal; no congenital anomalies; normal echocardiography; retrognatia, high nasal root, full nasal tip, downslant palbebral fissures, hypertelorism, synophrys, low-set ears, downturned corners of the mouth, smal mouh, thin upper lip.; feet: slight 2-3 syndactyly, clinodactyly dig 4 and 5. sagging foot vaults.; >9y on one side conductive 30 db loss by recurrent infections (perforated eardrum), solo hearing equipment; hypermetropia, glasses 13y +1 1/2 / +1 1/2; asthma, coeliac disease (diet gluten and wheat), hay fever. recurrent ear infections < 1 year. sleep problems untill puberty, goes better with melatonin at age of 13. medication: azelastine/fluticason, ear drups, fluticason aersosol, salbutamol aerosol, resource optifbre, melatonine 0,1 mg; abnormal movements/tics" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000242898" "00198" "00324355" "03833" "Isolated (sporadic)" "6y" "no concerns during pregnancy/birth, birth 39w, birth weight 3kg (p30); weight p80, height p1,; motor development delayed. speaks little and unclear. at this moment (6 year) she has 20 words in vocubular.; speech furst words 2-3Y; moderare intelletual disability; 3.5y-IQ measured of 1.5 years old.; temper tantrums, concentration/attention deficit, self-mutilation. regularly frustrated cannot express herself well, can be aggressive towards other children when she cannot express herself. can make good contact with other children / adults. unrestrained eating behavior; no autism spectrum disorder; no attention deficit hyperactivity disorder/ADDt diagno attention deficit hyperactivity disorder/ADDsed; normal tonus; no seizures; no congenital anomalies; frontal bossing, small bitemporal length,; normal hearing; amblyoplia, resolved with patch; good general health, loose stools, 3y-ear tubes operation; 2y delayed skeletal age" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000242899" "00198" "00324356" "03833" "Isolated (sporadic)" "8y" "birth weight 3.64kg (p75), ,; weight p75, height p84, OFC p98; motor development normal; speech furst words normal; moderate intelletual disability; 8y-global IQ43; no autism spectrum disorder; no attention deficit hyperactivity disorder/ADD; normal tonus; no seizures; MRI brain normal; no congenital anomalies; high and prominent forehead, broad nasal bridge, hypertelorism, open mouth, buccal hypotonia; normal hearing; normal eyes;" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000242900" "00198" "00324357" "03833" "Isolated (sporadic)" "3y" "normal pregnancy, birth low apgar scores, emergency drive to hospital due to tracheomalacie, birth 39w, birth weight 2.9kg (p15); weight p19,6, height p17,3, OFC p64; motor development expressive language impairment and below average language comprehension. first words <12m. 3 years: 4-5 words communication with hand signs. only understands commands that often occurs; speech furst words <12 ms; no intelletual disability; attention/concentration deficit, temper tantrums towards mother. spontaneous, cheerful, helpful character; no autism spectrum disorder; no attention deficit hyperactivity disorder/ADD; hypotonia; no seizures; 5-28m physiotherapy for hypermobility and hypotonia; congenital tracheomalacie; long face, full nose tip, telecanthus, folded top of the helix edge, small mouth, thick lower lip, long philtrum.; pes planus; normal hearing; normal eyes; eczema. allergies: cow milk. intolerance: tap water. medication: erytromycine, nexium; hypermobility, delayed sensory information processing" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000242901" "00198" "00324358" "03833" "Isolated (sporadic)" "1y8m" "birth weight 3.74kg (p80), ,; weight p80, height p80, OFC p90; motor development babbling 20 ms; speech furst words 20m; no autism spectrum disorder; no attention deficit hyperactivity disorder/ADD; hypotonia; no seizures; no congenital anomalies; plagiocephaly, craniosynostosis,; normal hearing; hypermetropia;" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000242902" "00198" "00324359" "03833" "Isolated (sporadic)" "6y" "pregnancy: polyhydramnios and partial placenta previa, birth 42w via induced vaginal delivery, at birth cyanotic requiring routine resuscitation, did not require NICU stay, birth 42w, birth weight 3.88kg (p75); weight p36, height p59, OFC p73; motor development smiling normal standpoint. first words at 13 ms. 20 words at 3 ys. 2 word phrases at 3,5 ys. short sentences 4-5ys; speech furst words 13m; mild intelletual disability; fFull scale IQ53, verbal IQ80, nonverbal IQ41; diagnosis of attention deficit hyperactivity disorder, methylphenidate (10mg 1x a day in the morning) impulsive. fidgety, obsessions. temper tantrums. repetitive behavior (repetitive motor movements, some repetitive speech, some problems adjusting to change); no autism spectrum disorder; attention deficit hyperactivity disorder/ADD; hypotonia; no seizures; 4y-MRI brain normal; congenital unilateral hydronephrosis/unilateral atrophic kidney (little brother same renal phenotype), diagnosed with ankyloglssia, 6d-frenectomy, undescended left testicle (operated 9m/20m); downslant palpebral fissures, epicanthal folds. narrow nose with anteverted nares, tented mouth, small squared-off teeth.; 5th finger clinodactyly bilaterally; normal hearing; severe myopia, astigmatism; healthy boy. 2 orchiopexy surgeries at 9 and 18 months. frenectomy 6 days old. recurrent ear infections 0-2 years. chronic loose stools from age 36 to 48 months that improved with diet (gluten and casein free). iga deficiency (48 ms). allergies: amoxicillin, gluten, processed soy, dairy;" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000242903" "00198" "00324360" "03833" "Isolated (sporadic)" "3y" "birth weight 3.3kg (p50), ,; weight , ,; motor development speech developmental delay; mild intelletual disability; attention/concentration deficit, hyperactivity, temper tantrums; no autism spectrum disorder; no attention deficit hyperactivity disorder/ADD; hypotonia; no seizures; MRI brain normal; ECG-normal; frontal bossing, hairline anomalies, high forehead, micrognathia, prominent forehead, retrognathia, triangular face, deep-set eyes, downslant palpebral fissures, epicanthal folds, hypertelorism, ptosis, short palpebral fissures, posteriorly rotated ears, high palate, thick upper lip.; short fingers; normal hearing; normal eyes;" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000242904" "00198" "00324361" "03833" "Isolated (sporadic)" "6y" "weight p45, height p75,; motor development first word 2-3 ys 30-50 words at 6 ys. 150-200 signs at 6 ys; speech furst words 2-3y; attention/concentration deficit; no autism spectrum disorder; no attention deficit hyperactivity disorder/ADD; hypotonia; no seizures; 18m-MRI brain delayed myelination; bulbous nose, relatively small eyes; broad hands and feet; normal hearing; hypermetropia;" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000242905" "00198" "00324362" "03833" "Isolated (sporadic)" "8y" "low amniotic fluid, bBradycardia, normal fetal echo, birth 38w, birth weight 2.9kg (p10); weight p70, height p45,; motor development first words > 18 m, short sentences 4-5 ys; speech furst words 18m; borderline intelletual disability; WISC 80; attention deficit hyperactivity disorder diagnosed at age of 8 years (flocalin xr 10 mg weekdays) no other behavioral problems; no autism spectrum disorder; attention deficit hyperactivity disorder; unknown; no seizures; normal hearing; normal eyes; eczema. hay fever;" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000242906" "00198" "00324363" "03833" "Isolated (sporadic)" "3y" "birth 38w, birth weight 2.4kg (p5),; weight p50, height p10, OFC p15; motor development first words < 12 m. still learning short sentences at age of almost 4.; speech furst words <12m; mild intelletual disability; BAYLEY II: 33m-functioned as 17m, MDI < 50, DQ51. VINELAND II: ABC71. COMMUNICATION = 71: she understands better than she express herself. Daily living skills = 78, Socialization = 76, Motor skills = 72.; attention/concentration deficit, hyperactivity, sensory processing disorder agressive, restricted and repetitive behavior. obsessions.; no autism spectrum disorder; no attention deficit hyperactivity disorder/ADD; <4y febrile seizures, medication \'Sodium Valporate 200/5 - 180mg 2 times a day; EEG normal; MRI brain normal; ataxia; surgery for tied tongue (frenectomy); micrognatia, ptosis, underbite; bilateral asymmetric hearloss, mild (25-39dBHL); normal eyes; recurrent ear infections 4-5x/year. atopic eczema. medication: restlessness. she takes 2 drops a day of neuleptil 4%\' sodium valproate 200/5 - 180mg 2 times a day. (fever seizures);" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000242907" "00198" "00324364" "03833" "Isolated (sporadic)" "1y3m" "birth 41w, birth weight 3.29kg (p15),; weight p2, height p50, OFC p40; motor development still learning, no speech yet; no autism spectrum disorder; no attention deficit hyperactivity disorder/ADD; no seizures; tied tongue, frenectomy; prominent forehead (like father), hypertelorism, ptosis, small mouth, thin lips; normal hearing; normal eyes; ear infections 2x / year. frequent skin rashes;" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000242908" "00198" "00324365" "03833" "Isolated (sporadic)" "6y2m" "birth 40,5w, birth weight 3.490kg (p40),; weight p67, height p67,; motor development first words > 18 m. short sentences 4-5 ys; speech furst words >18m; no intelletual disability, we said borderline intelletual disability, mainstream school with speech therapy (90 min/week), occupational therapy (90 min/month), specialized academic instruction (one-on-one aintelletual disabilitye); anxieties, diagnosed attention deficit hyperactivity disorder at age of 6 ys (medication: adderall), impulsivity; no autism spectrum disorder; attention deficit hyperactivity disorder; 2y-febrile seizure, 4y-febrile seizure, no medication; 6y-EEG normal; normal hearing; normal eyes; sensitive skin with eczema rashes (especially as baby); drooling" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000242909" "00198" "00324366" "03833" "Isolated (sporadic)" "00y09m" "placenta Previa, no concerns in utero\' 2d NICU for rapid breathing, birth 36w, birth weight 2.7kg (p45); weight p35, height p1, OFC p90; motor development not yet; no autism spectrum disorder; no attention deficit hyperactivity disorder/ADD; hypotonia; no seizures; MRI brain normal; normal hearing; normal eyes;" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000242910" "00198" "00324367" "03833" "Unknown" "23y" "normal pregnancy, spontaneous onset of labour, long labour, eventually signs of foetal distress, episiotomy, born with help, Apgar score OK but in hospital incident where baby was sick, bringing up lots of black meconium., birth 42w, birth weight 3.5kg (p20); weight p36, height p87,; motor development age first words < 12 m. short sentences 2-3 ys; speech furst words <12m; no intelletual disability; full scale IQ 115, significant inter subtest scatter in both verbal and non verbal tasks - individual subtest scores and overall index scores significantly different.(interpret with caution) Perceptual reasoning IQ in superior range. preferred mode of processing appears to be visual, rather than auditory. Underdeveloped social and emotional intelligence with a rigid and restricted social communication style (ASD) Working memory difficulties characterised by listening and concentration problems and auditory sequential memory deficits.; anxieties, autism, sensory processing disorder since age of 9 ys. tics at age of ten; autism spectrum disorder; no attention deficit hyperactivity disorder/ADD; hypotonia; no seizures; high palate; striae on his back and posterior axilla and minimal the thigh. (at age 15); normal hearing; wear glasses, far and short sighted, strabismus, had eye training; depression and anxiety problems at age of 22 diagnosed, uses medication.;" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000242911" "00198" "00324368" "03833" "Isolated (sporadic)" "7y" "pregnancy: fetal heart arhythmia , birth 39w, birth weight 3.4kg (p60); weight p20, height p25,; motor development first words >18m, short sentences 4-5y. language regression; speech furst words >18m; borderline intelletual disability; full scale IQ83; autism since age of 5 year. sensory processing disorder diagnosed at age of 2 years. agressive, impulsivity, obsessions, attention/concentration deficit, aggresive to himself.; autism spectrum disorder; no attention deficit hyperactivity disorder/ADD; hypotonia; seizures; EEG slowed brain waves; MRI brain normal; congenital undescended testicles; broad nasal bridge/nose, hypertelorism, short philtrum; normal hearing; normal eyes; has low energy output threshold. he still naps almost everyday and did shorter school days than other kids due to fatigue. meds: abilify-impulse control/aggression; hypermobility joints, muscle biopsy-checking for mitochondrial disease" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000242912" "00198" "00324369" "03833" "Isolated (sporadic)" "8y11m" "weight , ,; motor development oral motor impairment, severe receptive and expressive speech impairment. also reading and spelling deficits.; no intelletual disability; borderline IQ; no behavioural/psychiatric problems; no autism spectrum disorder; no attention deficit hyperactivity disorder/ADD; febrile seizures; MRI brain normal; no facial dysmorphisms; normal hearing;" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000242913" "00198" "00324370" "03833" "Isolated (sporadic)" "19y" "birth emergency cesarean section, Apgar 1/6/8, birth weight 3.775kg (p42); weight p99, height p45, OFC p67; motor development first words 18 m. 3 yrs: stereotypic words, autistiform behaviour. almost no speech till 4- yrs, used sign language and pictos. 4-5 years short sentences. speaks at 14 yrs, but hard to understand, wrong order, difficulty finding words. specialised secondary school; speech furst words 18m; mild intelletual disability; SON: 11y-IQ64 TIQ49 VIQ55 PIQ55, 15y-IQ67; diagnosed with attention deficit hyperactivity disorder (medication: methylphenidate), temper tantrums, possesive behavior. at 19 years no behavioral problems any more; no autism spectrum disorder; attention deficit hyperactivity disorder; hypotonia; no seizures; EEG normal; 3y-MRI brain no structural abnormalities; congenital facialis paresis; high palate, broad dental ridges, flattened crux superior of the ears, blepharophimosis, straight eyebrows; cafe aut lait spot back. inverted nipples. clinodactyly 5th fingers and 3rd, 4th and 5th toes. short ip 5th fingers; normal eyes; 19y-full time work 30h/w in form of internship" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000242914" "00198" "00324371" "03833" "Unknown" "73y" "normal pregnancy, birth, ,; weight p50, height p16, OFC p50; motor development 54 years: still lack of speech. learned some signs of non-verbal communication; severe intelletual disability; 25y-global IQ30; anxieties, does not like to make contact; no autism spectrum disorder; no attention deficit hyperactivity disorder/ADD; normal tonus; no seizures; no congenital anomalies; long face, flat midface, high hairline, in the neck brittle hairs, large ears, sparce eyebrows; long hands/fingers. hollow feet. skin disease like eczema or psoriasis. brittle hairs. thoracic hyperkyphosis, pes cavus; 52y-hearing loss 70dB left ear; normal eyes; skin disease which resembled psoriasis or eczema. received radiation therapty at skull at 7 yrs, cause unknown;" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000242915" "00198" "00324372" "03833" "Unknown" "36y" "normal pregnancy, birth, ,; weight p84, height p33, OFC p16; motor development attended special school for children with language and hearing delay. dysphasia.; moderate intelletual disability. social functioning at the age of 12 years. had special education. works supervised in housekeeping; 36y-IQ of 6-7y; compulsive behavior and signs within the autism spectrum and attention deficit hyperactivity disorder (hyperactivity, concentration deficit), but insufficient evidence for a formal ASD or attention deficit hyperactivity disorder diagnosis.; no autism spectrum disorder; no attention deficit hyperactivity disorder/ADD; normal tonus; no seizures; MRI brain normal; congenital bilateral hip dysplasia ; full nasal tip, high palate, small mouth, short palpebral fissures; increased lumbal lordosis, pes cavus, multiple naevi.; normal eyes;" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000242916" "00198" "00324373" "03833" "Isolated (sporadic)" "14y" "normal pregnancy, birth, birth weight 3.500kg (p50); weight p40, height p84, OFC p45; motor development first words 1 yr, stopped speaking after a while. almost absent speech. likes to communicate with others with sign language. 12 years: 15 words; speech furst words 12m; mild-moderate intelletual disability; 9y-total IQ55; is developping aggresive behaviour. impulsivity, anxieties, hyperactivity, social normal behavior; no autism spectrum disorder; no attention deficit hyperactivity disorder/ADD; normal tonus; 3y-seizures, medication Depakine, 5y-no seizures and medication anymore; EEG during sleep a lot of epileptiformal activity at right centroparietal lobe, without ictal signs; normal cerebral MRI; congenital shawl-scrotum, 5y-circumcision; broad nasal bridge, pointed chin. frontal bossing, hairline anomalies. thin upper lip, flat and long philtrum, folded helices, upturned ear lobules, low-set ears, posteriorly rotated ears, downslant palbebral fissures, hypertelorism, long eyelashes, ptosis, synophrys; small chest. short, broad halluxes, short 4th and 5th toes. left clinodactyly 2nd toe. naevus flammeus right lower arm (acquiered portwine stain). 2 cafe au lait spots at back; 14y-hypermetropia (+9 dpt) both eyes; 9y-sleeping problems,14y-no sleeping problems; craving to food" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000242917" "00198" "00324374" "03833" "Isolated (sporadic)" "19y" "weight p18, height p25, OFC p25; motor development speech absent at 4 ys. impairement of expressive speech. repetitive and poorly understandable speech; severe intelletual disability; queit slightly apathic behavior. sociable in familiar setting; no autism spectrum disorder; no attention deficit hyperactivity disorder/ADD; normal tonus; no seizures; 3.5y-MRI brain normal; brachycephaly, low-set anterior hairline, low-set ears, downslant palbebral fissures, hypertelorism, ptosis; winged scapulae; hypermetropia astigmatism;" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000242918" "00198" "00324375" "03833" "Unknown" "34y" "motor development poor speech; severe intelletual disability; hypotonia; febriles eizures reported at 18 and 22 months. Generalized Seizure at 22 years. Generalized Seizures and motor automotisms since 33 years. Currently on antiepileptic treatment with Lamotrigine.; no congenital anomalies; long face, low-set hairline. dental crowding, high narrow palate, large and low-set ears, ptosis; hirsutism, interdigital webbing. prominent interdigital folds, brachydactyly, dubois sign, wide halluces. lubar hyperlordosis; diabetic mellitus type 2;" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000242919" "00198" "00324376" "03833" "Isolated (sporadic)" "13y10m" "birth weight 3.290kg (p27), ,; weight , height p30, OFC p96; motor development first words at 13 m. reduced vocabulary at 13 ys.; speech furst words 13m; mild intelletual disability; IQ62; autism, attention/concentration deficit; autism spectrum disorder; no attention deficit hyperactivity disorder/ADD; no seizures; unknown; midface retraction. broad nose. broad nasal tip. oligodontia, small mouth, hypertelorism; right cutaneous syndactyly 2/3 finger; myopia;" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000242920" "00198" "00324377" "03833" "Isolated (sporadic)" "15y" "birth weight 3.650kg (p50), ,; weight p50, height p97, OFC p97; motor development almost absent at 16 ys, oral dyspraxia, communication with sign, gestures and mimic. trog test , 4 ys at 13 ys, significant differences between expressive and receptive language skills.; mild intelletual disability; 10y-general I58, fluid reasoning score 52; aggressive, impulsive, violent. concentration deficit, hyperactity. autistic features (no shared activities, repetitive and atypical interests in objects); no autism spectrum disorder; no attention deficit hyperactivity disorder/ADD; normal tonus; no seizures; 6y-EEG poor organization of the background rhythm and diffuse slowing (no epileptiform potentials); 6y-MRI brain normal; no congenital anomalies; long face, high forehead, small midface. small chin. primonent nasal bridge. broad nasal tip. broad philtrum. narrow naris. thin upper lip, thick lower lip, high palate, small ear-lobules, synophrys, short palpebral fissures, ptosis, periorbital fullness, epicanthal folds, deep-set eyes, blepharophimosis.; pectus excavatum. clinodactyly of 5th finger. broad great toes; normal eyes;" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000242921" "00198" "00324378" "03833" "Isolated (sporadic)" "7y" "birth weight 2.504kg (p8), ,; weight p2, height p35, OFC p8; motor development first words at 5 ys. spoke few words at 7 ys; speech furst words 5ys; moderate development delay (Kyoto developmental scale: 40); febrile seizures; EEG normal; MRI brain normal; triangular face (pointed chin), prominent forehead, narrow ptosis, periorbital fullness, epicanthal folds; hypermetropia both eyes +8 dtp;" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000242922" "00198" "00324379" "03833" "Isolated (sporadic)" "" "see paper; ..., frontal upsweep, lighter blond hair corona in front, hypertelorism, ptosis eyelids predominantly left, periorbital fullness, straight sparse eyebrows, flat nasal bridge, short nose, thin upper lip, short fingers, broad distal phalanges" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000253645" "00198" "00335726" "01807" "Unknown" "" "Tall stature (HP:0000098); Intellectual disability (HP:0001249); Sagittal craniosynostosis (HP:0004442); Narrow palpebral fissure (HP:0045025)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000254811" "00189" "00359556" "04031" "Isolated (sporadic)" "2y11m" "see paper; ..., feeding difficulties; speech therapy; fine motor ability Mod. Low (Vineland Adaptive Behaviour Scale); gross motor ability Mod. Low (Vineland Adaptive Behaviour Scale); receives occupational therapy, receives physiotherapy; no attention deficit hyperactivity disorder, no attention deficits; spoken words not yet achieved, short sentences not yet achieved, minimally verbal, childhood apraxia of speech, language ability low expressive, language ability moderate-low receptivelanguage ability adequate social" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000254812" "00189" "00359557" "04031" "Isolated (sporadic)" "3y2m" "see paper; ..., feeding difficulties; speech therapy; fine motor ability Mod. Low (Vineland Adaptive Behaviour Scale); gross motor ability Mod. Low (Vineland Adaptive Behaviour Scale); receives no occupational therapy, receives no physiotherapy; no attention deficit hyperactivity disorder, no attention deficits; 15-18m-spoken words, short sentences not yet achieved, minimally verbal, language ability low expressive, language ability moderate-low receptive, language ability moderate-low written, language ability moderate-low social" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000254813" "00189" "00359558" "04031" "Isolated (sporadic)" "6y1m" "see paper; ..., feeding difficulties; moderate intellectual disability; speech therapy; fine motor ability Mod. Low (Vineland Adaptive Behaviour Scale); gross motor ability Mod. Low (Vineland Adaptive Behaviour Scale); receives occupational therapy, receives physiotherapy; no attention deficit hyperactivity disorder, no attention deficits; 15-18m-spoken words, 4-5y-short sentences, phonological disorder, childhood apraxia of speech, language ability low expressive, language ability adequate receptive, language ability low written, language ability adequate social" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000254814" "00189" "00359559" "04031" "Isolated (sporadic)" "7y6m" "see paper; ..., feeding difficulties; mild-moderate intellectual disability; speech therapy; fine motor ability Mod. Low (Vineland Adaptive Behaviour Scale); gross motor ability Mod. Low (Vineland Adaptive Behaviour Scale); receives occupational therapy, receives physiotherapy; no attention deficit hyperactivity disorder, no attention deficits; >18m-spoken words, 4-5y-short sentences, phonological disorder, childhood apraxia of speech, dysfluencylanguage ability low expressive, language ability moderate-low receptive, language ability low written, language ability moderate-low social" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000254815" "00189" "00359560" "04031" "Isolated (sporadic)" "12y0m" "see paper; ..., feeding difficulties; mild intellectual disability; speech therapy; fine motor ability Mod. Low (Vineland Adaptive Behaviour Scale); gross motor ability Mod. Low (Vineland Adaptive Behaviour Scale); receives occupational therapy, receives physiotherapy; attention deficit hyperactivity disorde; 15-18m-spoken words, 6-7y-short sentences, articulation disorder, phonological disorder, childhood apraxia of speech, language ability adequate expressive, language ability moderate-low receptive, language ability low written, language ability adequate social" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000254816" "00189" "00359561" "04031" "Isolated (sporadic)" "13y0m" "see paper; ..., no feeding difficulties; moderate intellectual disability; speech therapy; fine motor ability; receives no occupational therapy, receives no physiotherapy; no attention deficit hyperactivity disorder, no attention deficits; spoken words not yet achieved, short sentences not yet achieved, minimally verbal, articulation disorder, childhood apraxia of speechlanguage ability severe expressive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000254817" "00189" "00359562" "04031" "Isolated (sporadic)" "13y5m" "see paper; ..., no feeding difficulties; severe intellectual disability; speech therapy; fine motor ability Low (Vineland Adaptive Behaviour Scale); fine motor ability adequate; receives no occupational therapy, receives no physiotherapy; no attention deficit hyperactivity disorder, no attention deficits; spoken words not yet achieved, short sentences not yet achieved, minimally verbal, childhood apraxia of speech, language ability low expressive, language ability moderate-low receptivelanguage ability low written" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000256895" "00139" "00361490" "00006" "Isolated (sporadic)" "10y" "syndromic; intellectual disability, short stature and dysmorphism" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000269645" "00198" "00374435" "00006" "Familial, autosomal recessive" "" "Delayed motor development, obesity, global developmental delay, mild ID, microcephaly, hypertelorism, bilateral epicanthic fold, hirsutism, thick ear lobes, depressed nasal bridge and short neck with elevated total cholesterol, LDL and TSH levels" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "microcephaly, intellectual disability" "" "0000274250" "05611" "00380400" "00006" "Isolated (sporadic)" "23m" "global developmental delays; speech impaired; motor impaired; no dysmorphic features; no behavioral deficits; GI/feeding abnormalities; ophthalmologic abnormalities; hypotonia muscle; movement/neurological disorder; no seizures; microcephaly; MRI brain abnormalities" "3m" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "neurodevelopmental delay" "" "0000281353" "00139" "00387785" "00006" "Familial, autosomal recessive" "" "non-syndromic intellectual disability, no microcephaly, epilepsy" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000319186" "04655" "00428281" "01164" "Unknown" "01y" "Macrocephaly, Mild global developmental delay, Infantile axial hypotonia, Motor delay, High palate; mother reported to have macrocephaly as well" "" "" "" "" "" "01164" "" "" "" "" "" "" "" "" "" "" "" "0000328231" "04270" "00438327" "00006" "Isolated (sporadic)" "" "HP:0001250 seizures; HP:0001249 intellectual disability" "11y" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "epilepsy" "" "0000328279" "04270" "00438375" "00006" "Isolated (sporadic)" "" "HP:0001250 seizures; HP:0002353 eeg abnormality; HP:0001903 anemia; HP:0002090 pneumonia; HP:0002094 dyspnea; HP:0002878 respiratory failure; HP:0002719 recurrent infections; HP:0002721 immunodeficiency; HP:0002014 diarrhea" "1y" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "epilepsy" "" "0000338907" "00139" "00449746" "03544" "Isolated (sporadic)" "" "HP:0002194, HP:0012758, HP:0040080, HP:0000378, HP:0000565, HP:0001357, HP:0000473, HP:0001263, HP:0003745" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "SGS" "intellectual disability" "" "0000346548" "05162" "00458101" "03544" "Isolated (sporadic)" "" "HP:0002474, HP:0000750, HP:0001249" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "MRD29" "neurodevelopmental disorder" "" "0000354505" "00198" "00469352" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "multiple congenital anomalies" "" ## Screenings ## Do not remove or alter this header ## ## Count = 113 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000050359" "00050414" "1" "00006" "00006" "2015-09-27 16:16:40" "" "" "SEQ;SEQ-NG-I" "DNA" "" "" "0000081203" "00081091" "1" "01758" "00006" "2016-09-07 13:24:08" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000133812" "00132978" "1" "00006" "00006" "2017-11-11 21:33:23" "" "" "SEQ" "DNA" "" "WES" "0000145291" "00144433" "0" "01807" "01807" "2017-12-13 15:18:02" "" "" "SEQ" "DNA" "" "" "0000164772" "00163908" "1" "01807" "01807" "2018-04-23 08:51:06" "" "" "SEQ" "DNA" "" "" "0000184636" "00183668" "1" "00006" "00006" "2018-10-27 10:06:27" "" "" "SEQ;SEQ-NG" "DNA" "" "1256 gene panel" "0000208354" "00207318" "1" "00000" "00115" "2010-07-22 11:56:06" "00115" "2010-09-07 15:18:22" "SEQ" "DNA" "" "" "0000208355" "00207319" "1" "00000" "00115" "2010-07-22 11:56:06" "00115" "2010-09-07 15:20:40" "SEQ" "DNA" "" "" "0000208356" "00207320" "1" "00000" "00115" "2010-07-22 11:56:06" "00115" "2010-09-07 15:20:40" "SEQ" "DNA" "" "" "0000208357" "00207321" "1" "00000" "00115" "2010-07-22 11:56:06" "00115" "2010-09-07 15:20:40" "SEQ" "DNA" "" "" "0000208358" "00207322" "1" "00000" "00115" "2010-07-22 11:56:06" "00115" "2010-09-07 15:20:40" "SEQ" "DNA" "" "" "0000208359" "00207323" "1" "00000" "00115" "2010-07-22 11:56:06" "00115" "2010-09-07 15:20:40" "SEQ" "DNA" "" "" "0000208360" "00207324" "1" "00000" "00115" "2010-07-22 11:56:06" "00115" "2010-09-07 15:20:40" "SEQ" "DNA" "" "" "0000208361" "00207325" "1" "00000" "00115" "2010-07-22 11:56:06" "00115" "2010-09-07 15:20:40" "SEQ" "DNA" "" "" "0000208362" "00207326" "1" "00000" "00115" "2010-07-22 11:56:06" "00115" "2010-09-07 15:20:40" "SEQ" "DNA" "" "" "0000208363" "00207327" "1" "00000" "00115" "2010-07-22 11:56:06" "00115" "2010-09-07 15:20:40" "SEQ" "DNA" "" "" "0000208364" "00207328" "1" "00000" "00115" "2010-07-22 11:56:06" "00115" "2010-09-07 15:20:40" "SEQ" "DNA" "" "" "0000208365" "00207329" "1" "00000" "00115" "2010-07-22 11:56:06" "00115" "2010-09-07 15:20:40" "SEQ" "DNA" "" "" "0000208366" "00207330" "1" "00000" "00115" "2010-07-22 11:56:06" "00115" "2010-09-07 15:20:40" "SEQ" "DNA" "" "" "0000277027" "00275873" "1" "03833" "00006" "2020-01-19 13:09:58" "00006" "2020-12-07 14:21:57" "SEQ;SEQ-NG" "DNA" "" "study WGS Illumina’s HiSeq Xten" "0000290514" "00289344" "1" "03288" "03288" "2020-03-04 12:58:41" "" "" "SEQ-NG" "DNA" "Blood" "WES" "0000293123" "00291955" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000293124" "00291956" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000303785" "00302661" "1" "01238" "00006" "2020-05-27 13:46:58" "" "" "SEQ;SEQ-NG" "DNA" "" "74-gene panel ID" "0000303903" "00302777" "1" "03833" "00006" "2020-06-01 10:33:11" "00006" "2020-12-07 14:18:24" "SEQ-NG" "DNA" "" "study WES Illumina HiSeq2000" "0000308908" "00307768" "1" "00006" "00006" "2020-08-18 13:19:45" "" "" "SEQ;SEQ-NG" "DNA" "" "565 gene panel" "0000309153" "00308009" "1" "01164" "01164" "2020-08-25 11:37:01" "" "" "SEQ-NG-S" "DNA" "" "" "0000317080" "00315900" "1" "01238" "01238" "2020-10-29 20:33:06" "" "" "SEQ-NG-IT" "DNA" "" "" "0000317081" "00315901" "1" "01238" "01238" "2020-10-29 20:45:39" "" "" "SEQ-NG-IT" "DNA" "" "" "0000317082" "00315902" "1" "01238" "01238" "2020-10-29 21:03:18" "" "" "SEQ-NG-IT" "DNA" "" "" "0000317373" "00316191" "1" "01238" "01238" "2020-11-03 10:30:56" "" "" "SEQ-NG-IT" "DNA" "" "gene panel" "0000317374" "00316193" "1" "03833" "00006" "2020-11-03 13:31:01" "00006" "2020-11-03 13:33:54" "SEQ;SEQ-NG" "DNA" "" "diagnostic WES Intellectual disability panel Illumina HiSeq, gene panel version DG-2.5 Radboudumc" "0000317376" "00316194" "1" "01238" "01238" "2020-11-03 14:22:34" "" "" "SEQ-NG-IT" "DNA" "" "gene panel" "0000317377" "00316195" "1" "01238" "01238" "2020-11-03 14:31:07" "" "" "SEQ-NG-IT" "DNA" "" "gene panel" "0000317378" "00316196" "1" "01238" "01238" "2020-11-03 14:43:22" "" "" "SEQ-NG-IT" "DNA" "" "gene panel" "0000317379" "00316197" "1" "01238" "01238" "2020-11-03 14:49:56" "" "" "SEQ-NG-IT" "DNA" "" "gene panel" "0000317380" "00316198" "1" "01238" "01238" "2020-11-03 14:56:20" "" "" "SEQ-NG-IT" "DNA" "" "gene panel" "0000317382" "00316200" "1" "01238" "01238" "2020-11-03 15:03:23" "" "" "SEQ-NG-IT" "DNA" "" "gene panel" "0000317384" "00316202" "1" "01238" "01238" "2020-11-03 16:11:23" "" "" "SEQ-NG-IT" "DNA" "" "gene panel" "0000321357" "00320172" "1" "01807" "01807" "2020-11-23 17:45:01" "" "" "SEQ" "DNA" "" "" "0000325498" "00324308" "1" "00006" "00006" "2020-12-07 10:05:08" "" "" "SEQ" "DNA" "" "" "0000325499" "00324309" "1" "00006" "00006" "2020-12-07 10:05:08" "" "" "SEQ" "DNA" "" "" "0000325500" "00324310" "1" "00006" "00006" "2020-12-07 10:05:08" "" "" "SEQ" "DNA" "" "" "0000325501" "00324311" "1" "00006" "00006" "2020-12-07 10:05:08" "" "" "SEQ" "DNA" "" "" "0000325502" "00324312" "1" "00006" "00006" "2020-12-07 10:05:08" "" "" "SEQ" "DNA" "" "" "0000325503" "00324313" "1" "00006" "00006" "2020-12-07 10:05:08" "" "" "SEQ" "DNA" "" "" "0000325504" "00324314" "1" "00006" "00006" "2020-12-07 10:05:08" "" "" "SEQ" "DNA" "" "" "0000325505" "00324315" "1" "00006" "00006" "2020-12-07 10:05:08" "" "" "SEQ" "DNA" "" "" "0000325506" "00324316" "1" "00006" "00006" "2020-12-07 10:05:08" "" "" "SEQ" "DNA" "" "" "0000325507" "00324317" "1" "00006" "00006" "2020-12-07 10:05:08" "" "" "SEQ" "DNA" "" "" "0000325508" "00324318" "1" "00006" "00006" "2020-12-07 10:05:08" "" "" "SEQ" "DNA" "" "" "0000325509" "00324319" "1" "00006" "00006" "2020-12-07 10:05:08" "" "" "SEQ" "DNA" "" "" "0000325510" "00324320" "1" "00006" "00006" "2020-12-07 10:05:08" "" "" "SEQ" "DNA" "" "" "0000325511" "00324321" "1" "00006" "00006" "2020-12-07 10:05:08" "" "" "SEQ" "DNA" "" "" "0000325512" "00324322" "1" "00006" "00006" "2020-12-07 10:05:08" "" "" "SEQ" "DNA" "" "" "0000325513" "00324323" "1" "00006" "00006" "2020-12-07 10:05:08" "" "" "SEQ" "DNA" "" "" "0000325514" "00324324" "1" "00006" "00006" "2020-12-07 10:05:08" "" "" "SEQ" "DNA" "" "" "0000325515" "00324325" "1" "00006" "00006" "2020-12-07 10:05:08" "" "" "SEQ" "DNA" "" "" "0000325536" "00324346" "1" "03833" "00006" "2020-12-07 19:16:12" "" "" "SEQ;SEQ-NG" "DNA" "" "diagnostic WES Intellectual disability panel Illumina HiSeq, gene panel version DG-2.9 Radboudumc" "0000325537" "00324347" "1" "03833" "00006" "2020-12-07 19:16:12" "" "" "SEQ;SEQ-NG" "DNA" "" "diagnostic WES Intellectual disability panel Illumina HiSeq, gene panel LUMC" "0000325538" "00324348" "1" "03833" "00006" "2020-12-07 19:16:12" "" "" "SEQ;SEQ-NG" "DNA" "" "diagnostic WES Intellectual disability panel Illumina HiSeq, gene panel version DG-2.5 Radboudumc" "0000325539" "00324349" "1" "03833" "00006" "2020-12-07 19:16:12" "" "" "SEQ;SEQ-NG" "DNA" "" "diagnostic WES Intellectual disability panel" "0000325540" "00324350" "1" "03833" "00006" "2020-12-07 19:16:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted 275 ID genes panel using SureSelect QXT capture" "0000325541" "00324351" "1" "03833" "00006" "2020-12-07 19:16:12" "" "" "SEQ;SEQ-NG" "DNA" "" "diagnostic WES Intellectual disability panel" "0000325542" "00324352" "1" "03833" "00006" "2020-12-07 19:16:12" "" "" "SEQ;SEQ-NG" "DNA" "" "focused-exome, Agilent Technologies (Dr Christèle Dubourg, Rennes)" "0000325543" "00324353" "1" "03833" "00006" "2020-12-07 19:16:12" "" "" "SEQ;SEQ-NG" "DNA" "" "Study WES DDD study Illumina Hiseq" "0000325544" "00324354" "1" "03833" "00006" "2020-12-07 19:16:12" "" "" "SEQ;SEQ-NG" "DNA" "" "WES Illumina HiSeq" "0000325545" "00324355" "1" "03833" "00006" "2020-12-07 19:16:12" "" "" "SEQ;SEQ-NG" "DNA" "" "diagnostic WES Intellectual disability panel Illumina HiSeq, gene panel LUMC" "0000325546" "00324356" "1" "03833" "00006" "2020-12-07 19:16:12" "" "" "SEQ;SEQ-NG" "DNA" "" "diagnostic WES Intellectual disability panel" "0000325547" "00324357" "1" "03833" "00006" "2020-12-07 19:16:12" "" "" "SEQ;SEQ-NG" "DNA" "" "diagnostic WES Intellectual disability panel Illumina HiSeq, gene panel version DG-2.17 Radboudumc" "0000325548" "00324358" "1" "03833" "00006" "2020-12-07 19:16:12" "" "" "SEQ;SEQ-NG" "DNA" "" "diagnostic WES GeneDx XomeDxPlus" "0000325549" "00324359" "1" "03833" "00006" "2020-12-07 19:16:12" "" "" "SEQ;SEQ-NG" "DNA" "" "diagnostic WES GeneDx XomeDxPlus" "0000325550" "00324360" "1" "03833" "00006" "2020-12-07 19:16:12" "" "" "SEQ;SEQ-NG" "DNA" "" "diagnostic WES Intellectual disability panel" "0000325551" "00324361" "1" "03833" "00006" "2020-12-07 19:16:12" "" "" "SEQ;SEQ-NG" "DNA" "" "diagnostic WES GeneDx XomeDxPlus" "0000325552" "00324362" "1" "03833" "00006" "2020-12-07 19:16:12" "" "" "SEQ;SEQ-NG" "DNA" "" "2678 gene panel" "0000325553" "00324363" "1" "03833" "00006" "2020-12-07 19:16:12" "" "" "SEQ;SEQ-NG" "DNA" "" "clinical WES" "0000325554" "00324364" "1" "03833" "00006" "2020-12-07 19:16:12" "" "" "arraySNP" "DNA" "" "" "0000325555" "00324365" "1" "03833" "00006" "2020-12-07 19:16:12" "" "" "SEQ;SEQ-NG" "DNA" "" "GeneDx XomeDx/Clinical Exome Sequence Analysis" "0000325556" "00324366" "1" "03833" "00006" "2020-12-07 19:16:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000325557" "00324367" "1" "03833" "00006" "2020-12-07 19:16:12" "" "" "SEQ;SEQ-NG" "DNA" "" "diagnostic WGS" "0000325558" "00324368" "1" "03833" "00006" "2020-12-07 19:16:12" "" "" "SEQ;SEQ-NG" "DNA" "" "GeneDx XomeDx" "0000325559" "00324369" "1" "03833" "00006" "2020-12-07 19:16:12" "" "" "SEQ;SEQ-NG" "DNA" "" "Study WGS Illumina’s HiSeq Xten" "0000325560" "00324370" "1" "03833" "00006" "2020-12-07 19:16:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted 26 ID genes panel using MIP based capture" "0000325561" "00324371" "1" "03833" "00006" "2020-12-07 19:16:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted 26 ID genes panel using MIP based capture" "0000325562" "00324372" "1" "03833" "00006" "2020-12-07 19:16:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted 26 ID genes panel using MIP based capture" "0000325563" "00324373" "1" "03833" "00006" "2020-12-07 19:16:12" "" "" "SEQ;SEQ-NG" "DNA" "" "diagnostic WES Intellectual disability panel Illumina HiSeq2000TM" "0000325564" "00324374" "1" "03833" "00006" "2020-12-07 19:16:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted 26 ID genes panel using MIP based capture" "0000325565" "00324375" "1" "03833" "00006" "2020-12-07 19:16:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted 26 ID genes panel using MIP based capture" "0000325566" "00324376" "1" "03833" "00006" "2020-12-07 19:16:12" "" "" "SEQ;SEQ-NG" "DNA" "" "Study WES Illumina HiSeq2000" "0000325567" "00324377" "1" "03833" "00006" "2020-12-07 19:16:12" "" "" "arrayCGH" "DNA" "" "conventional chromosomal analysis, Agilent Human Genome CGH 44K Microarray" "0000325568" "00324378" "1" "03833" "00006" "2020-12-07 19:16:12" "" "" "arrayCGH" "DNA" "" "" "0000325569" "00324379" "1" "00006" "00006" "2020-12-07 19:16:12" "" "" "arrayCGH" "DNA" "" "" "0000336955" "00335726" "1" "01807" "01807" "2021-03-08 13:25:01" "" "" "SEQ" "DNA" "" "" "0000360785" "00359556" "1" "04031" "00006" "2021-03-25 11:58:20" "" "" "SEQ" "DNA" "" "" "0000360786" "00359557" "1" "04031" "00006" "2021-03-25 11:58:20" "" "" "SEQ" "DNA" "" "" "0000360787" "00359558" "1" "04031" "00006" "2021-03-25 11:58:20" "" "" "SEQ" "DNA" "" "" "0000360788" "00359559" "1" "04031" "00006" "2021-03-25 11:58:20" "" "" "SEQ" "DNA" "" "" "0000360789" "00359560" "1" "04031" "00006" "2021-03-25 11:58:20" "" "" "SEQ" "DNA" "" "" "0000360790" "00359561" "1" "04031" "00006" "2021-03-25 11:58:20" "" "" "SEQ" "DNA" "" "" "0000360791" "00359562" "1" "04031" "00006" "2021-03-25 11:58:20" "" "" "SEQ" "DNA" "" "" "0000362718" "00361490" "1" "00006" "00006" "2021-04-07 19:07:03" "" "" "SEQ-NG" "DNA" "" "758-gene panel" "0000375629" "00374435" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000381614" "00380400" "1" "00006" "00006" "2021-08-16 13:20:55" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000389016" "00387785" "1" "00006" "00006" "2021-10-31 12:02:46" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000393100" "00391858" "1" "02494" "02494" "2021-11-19 12:07:25" "" "" "SEQ-NG" "DNA" "" "" "0000402550" "00401306" "1" "02494" "02494" "2022-01-31 12:21:56" "" "" "SEQ-NG" "DNA" "" "WES" "0000429692" "00428281" "1" "01164" "01164" "2022-12-29 14:24:53" "" "" "SEQ-NG-I" "DNA" "" "" "0000439809" "00438327" "1" "00006" "00006" "2023-10-20 19:13:42" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000439857" "00438375" "1" "00006" "00006" "2023-10-20 19:13:42" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000451340" "00449746" "1" "03544" "03544" "2024-05-09 14:26:41" "" "" "SEQ-NG-I" "DNA" "peripheral blood" "WES" "0000459719" "00458101" "1" "03544" "03544" "2024-11-29 12:57:54" "" "" "SEQ-NG-I" "DNA" "peripheral blood" "CES" "0000465990" "00464360" "1" "04459" "04459" "2025-03-06 08:25:05" "" "" "SEQ-NG" "DNA" "" "" "0000471020" "00469352" "1" "00006" "00006" "2025-11-13 13:02:43" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 86 "{{screeningid}}" "{{geneid}}" "0000050359" "SETBP1" "0000081203" "SETBP1" "0000133812" "SETBP1" "0000184636" "SETBP1" "0000208354" "SETBP1" "0000208355" "SETBP1" "0000208356" "SETBP1" "0000208357" "SETBP1" "0000208358" "SETBP1" "0000208359" "SETBP1" "0000208360" "SETBP1" "0000208361" "SETBP1" "0000208362" "SETBP1" "0000208363" "SETBP1" "0000208364" "SETBP1" "0000208365" "SETBP1" "0000208366" "SETBP1" "0000290514" "SETBP1" "0000303903" "SETBP1" "0000308908" "SETBP1" "0000317373" "SETBP1" "0000317374" "SETBP1" "0000325498" "SETBP1" "0000325499" "SETBP1" "0000325500" "SETBP1" "0000325501" "SETBP1" "0000325502" "SETBP1" "0000325503" "SETBP1" "0000325504" "SETBP1" "0000325505" "SETBP1" "0000325506" "SETBP1" "0000325507" "SETBP1" "0000325508" "SETBP1" "0000325509" "SETBP1" "0000325510" "SETBP1" "0000325511" "SETBP1" "0000325512" "SETBP1" "0000325513" "SETBP1" "0000325514" "SETBP1" "0000325515" "SETBP1" "0000325536" "SETBP1" "0000325537" "SETBP1" "0000325538" "SETBP1" "0000325539" "SETBP1" "0000325540" "SETBP1" "0000325541" "SETBP1" "0000325542" "SETBP1" "0000325543" "SETBP1" "0000325544" "SETBP1" "0000325545" "SETBP1" "0000325546" "SETBP1" "0000325547" "SETBP1" "0000325548" "SETBP1" "0000325549" "SETBP1" "0000325550" "SETBP1" "0000325551" "SETBP1" "0000325552" "SETBP1" "0000325553" "SETBP1" "0000325554" "SETBP1" "0000325555" "SETBP1" "0000325556" "SETBP1" "0000325557" "SETBP1" "0000325558" "SETBP1" "0000325559" "SETBP1" "0000325560" "SETBP1" "0000325561" "SETBP1" "0000325562" "SETBP1" "0000325563" "SETBP1" "0000325564" "SETBP1" "0000325565" "SETBP1" "0000325566" "SETBP1" "0000325567" "SETBP1" "0000325568" "SETBP1" "0000325569" "SETBP1" "0000360785" "SETBP1" "0000360786" "SETBP1" "0000360787" "SETBP1" "0000360788" "SETBP1" "0000360789" "SETBP1" "0000360790" "SETBP1" "0000360791" "SETBP1" "0000362718" "SETBP1" "0000375629" "PCNT" "0000389016" "SETBP1" "0000429692" "SETBP1" "0000465990" "SETBP1" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 248 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000079339" "0" "90" "18" "42531866" "42531866" "subst" "0" "00006" "SETBP1_000007" "g.42531866C>G" "" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "" "" "" "De novo" "" "" "0" "" "" "g.44951901C>G" "" "pathogenic" "" "0000130289" "0" "90" "18" "42531907" "42531907" "subst" "0" "01758" "SETBP1_000003" "g.42531907G>A" "" "{PMID:Trujillano 2017:27848944}" "" "" "" "De novo" "" "" "0" "" "" "g.44951942G>A" "" "pathogenic" "ACMG" "0000223240" "0" "70" "18" "42529986" "42529987" "ins" "0" "00006" "SETBP1_000008" "g.42529986_42529987insTT" "" "{PMID:Sanna-Cherchi 2017:29100090}, {DOI:Sanna-Cherchi 2017:10.1016/j.ajhg.2017.09.018}" "" "" "" "Germline" "" "" "0" "" "" "g.44950021_44950022insTT" "" "likely pathogenic" "" "0000236390" "0" "90" "18" "42531976" "42531976" "del" "0" "01807" "SETBP1_000009" "g.42531976del" "" "" "" "2671delA" "" "Unknown" "" "" "0" "" "" "g.44952011del" "" "pathogenic" "" "0000249428" "0" "30" "18" "42532604" "42532604" "subst" "0.0011413" "02325" "SETBP1_000024" "g.42532604A>G" "" "" "" "SETBP1(NM_015559.3):c.3299A>G (p.H1100R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44952639A>G" "" "likely benign" "" "0000255051" "0" "30" "18" "42643382" "42643382" "subst" "0" "01943" "SETBP1_000029" "g.42643382A>T" "" "" "" "SETBP1(NM_015559.3):c.4510A>T (p.T1504S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45063417A>T" "" "likely benign" "" "0000256158" "0" "50" "18" "42530151" "42530151" "subst" "0" "01943" "SETBP1_000015" "g.42530151A>G" "" "" "" "SETBP1(NM_015559.3):c.846A>G (p.K282=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44950186A>G" "" "VUS" "" "0000298130" "0" "90" "18" "42531070" "42531070" "subst" "0" "02325" "SETBP1_000019" "g.42531070C>T" "" "" "" "SETBP1(NM_015559.3):c.1765C>T (p.R589*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44951105C>T" "" "pathogenic" "" "0000298131" "0" "30" "18" "42618610" "42618610" "subst" "6.09657E-5" "02325" "SETBP1_000027" "g.42618610G>A" "" "" "" "SETBP1(NM_015559.3):c.4161G>A (p.T1387=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45038645G>A" "" "likely benign" "" "0000298132" "0" "10" "18" "42456653" "42456653" "subst" "0.520842" "02325" "SETBP1_000010" "g.42456653G>A" "" "" "" "SETBP1(NM_001130110.2):c.664G>A (p.A222T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44876688G>A" "" "benign" "" "0000298134" "0" "10" "18" "42529996" "42529996" "subst" "0.192036" "02325" "SETBP1_000012" "g.42529996G>C" "" "" "" "SETBP1(NM_015559.3):c.691G>C (p.V231L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44950031G>C" "" "benign" "" "0000298135" "0" "30" "18" "42530074" "42530074" "subst" "4.48855E-5" "02325" "SETBP1_000014" "g.42530074G>A" "" "" "" "SETBP1(NM_015559.3):c.769G>A (p.V257M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44950109G>A" "" "likely benign" "" "0000299426" "0" "90" "18" "42531035" "42531054" "del" "0" "02329" "SETBP1_000018" "g.42531035_42531054del" "" "" "" "SETBP1(NM_015559.3):c.1730_1749delTTACTGTGATCACTCCAGTC (p.L577Qfs*20)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44951070_44951089del" "" "pathogenic" "" "0000299427" "0" "90" "18" "42531070" "42531070" "subst" "0" "02329" "SETBP1_000019" "g.42531070C>T" "" "" "" "SETBP1(NM_015559.3):c.1765C>T (p.R589*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44951105C>T" "" "pathogenic" "" "0000307921" "0" "10" "18" "42530796" "42530796" "subst" "0.00277566" "01943" "SETBP1_000017" "g.42530796G>A" "" "" "" "SETBP1(NM_015559.3):c.1491G>A (p.P497=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44950831G>A" "" "benign" "" "0000307922" "0" "50" "18" "42531179" "42531179" "subst" "2.05256E-5" "01943" "SETBP1_000021" "g.42531179G>A" "" "" "" "SETBP1(NM_015559.3):c.1874G>A (p.R625Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44951214G>A" "" "VUS" "" "0000307923" "0" "50" "18" "42531274" "42531274" "subst" "6.66522E-5" "01943" "SETBP1_000022" "g.42531274G>A" "" "" "" "SETBP1(NM_015559.3):c.1969G>A (p.V657M, p.(Val657Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44951309G>A" "" "VUS" "" "0000307924" "0" "30" "18" "42643426" "42643426" "subst" "0" "01943" "SETBP1_000030" "g.42643426G>A" "" "" "" "SETBP1(NM_015559.3):c.4554G>A (p.E1518=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45063461G>A" "" "likely benign" "" "0000307925" "0" "30" "18" "42530062" "42530062" "subst" "3.26083E-5" "01943" "SETBP1_000013" "g.42530062G>A" "" "" "" "SETBP1(NM_015559.3):c.757G>A (p.A253T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44950097G>A" "" "likely benign" "" "0000325876" "0" "50" "18" "42532178" "42532178" "subst" "0.000174704" "01804" "SETBP1_000023" "g.42532178A>G" "" "" "" "SETBP1(NM_015559.2):c.2873A>G (p.(Glu958Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44952213A>G" "" "VUS" "" "0000338062" "0" "10" "18" "42260348" "42260348" "subst" "0" "02327" "SETBP1_000032" "g.42260348C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44680383C>T" "" "benign" "" "0000338993" "0" "70" "18" "42530062" "42530062" "del" "0" "02327" "SETBP1_000036" "g.42530062del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44950097del" "" "likely pathogenic" "" "0000340062" "0" "10" "18" "42530796" "42530796" "subst" "0.00277566" "02327" "SETBP1_000017" "g.42530796G>A" "" "" "" "SETBP1(NM_015559.3):c.1491G>A (p.P497=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44950831G>A" "" "benign" "" "0000340063" "0" "10" "18" "42532923" "42532923" "subst" "0.00674818" "02327" "SETBP1_000043" "g.42532923T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44952958T>C" "" "benign" "" "0000340064" "0" "10" "18" "42618580" "42618580" "subst" "0.00207595" "02327" "SETBP1_000045" "g.42618580G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45038615G>A" "" "benign" "" "0000341276" "0" "10" "18" "42456653" "42456653" "subst" "0.520842" "02327" "SETBP1_000010" "g.42456653G>A" "" "" "" "SETBP1(NM_001130110.2):c.664G>A (p.A222T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44876688G>A" "" "benign" "" "0000346308" "0" "90" "18" "42531914" "42531914" "subst" "0" "02327" "SETBP1_000040" "g.42531914G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44951949G>A" "" "pathogenic" "" "0000346309" "0" "90" "18" "42531913" "42531913" "subst" "0" "02327" "SETBP1_000039" "g.42531913G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44951948G>A" "" "pathogenic" "" "0000346817" "0" "90" "18" "42531917" "42531917" "subst" "8.13378E-6" "02327" "SETBP1_000041" "g.42531917T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44951952T>C" "" "pathogenic" "" "0000349374" "0" "10" "18" "42456670" "42456671" "ins" "0.520879" "02327" "SETBP1_000034" "g.42456670_42456671insTCTT" "" "" "" "SETBP1(NM_001130110.2):c.681_682insTCTT (p.T228Sfs*8)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44876705_44876706insTCTT" "" "benign" "" "0000350243" "0" "10" "18" "42532606" "42532606" "subst" "0.122516" "02327" "SETBP1_000042" "g.42532606G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44952641G>A" "" "benign" "" "0000350285" "0" "10" "18" "42618578" "42618578" "subst" "0.00807624" "02327" "SETBP1_000044" "g.42618578G>C" "" "" "" "SETBP1(NM_015559.3):c.4129G>C (p.(Val1377Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45038613G>C" "" "benign" "" "0000351187" "0" "30" "18" "42529838" "42529838" "subst" "3.30548E-5" "02327" "SETBP1_000035" "g.42529838A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44949873A>G" "" "likely benign" "" "0000368374" "0" "70" "18" "42533075" "42533105" "dup" "0" "01807" "SETBP1_000046" "g.42533075_42533105dup" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.44953110_44953140dup" "" "likely pathogenic" "" "0000408759" "0" "90" "18" "42531917" "42531917" "subst" "8.13378E-6" "00006" "SETBP1_000041" "g.42531917T>C" "" "{PMID:Martinez 2017:27620904}, {DOI:Martinez 2017:10.1136/jmedgenet-2017-103964}" "" "" "" "De novo" "" "" "0" "" "" "g.44951952T>C" "" "pathogenic (dominant)" "" "0000438188" "21" "95" "18" "42530038" "42530038" "subst" "0" "00000" "SETBP1_000001" "g.42530038G>T" "" "{PMID:Hoischen 2010:20436468}" "" "c.733G>T (E245X)" "Variant Error [EREF/ESYNTAX]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000438189" "0" "95" "18" "42531907" "42531907" "subst" "0" "00000" "SETBP1_000003" "g.42531907G>A" "" "{PMID:Hoischen 2010:20436468}" "" "G2602A, D868N" "" "De novo" "" "" "0" "" "" "g.44951942G>A" "" "pathogenic" "" "0000438190" "0" "95" "18" "42531907" "42531907" "subst" "0" "00000" "SETBP1_000003" "g.42531907G>A" "" "{PMID:Hoischen 2010:20436468}" "" "G2602A, D868N" "" "De novo" "" "" "0" "" "" "g.44951942G>A" "" "pathogenic" "" "0000438191" "0" "95" "18" "42531907" "42531907" "subst" "0" "00000" "SETBP1_000003" "g.42531907G>A" "" "{PMID:Hoischen 2010:20436468}" "" "G2602A, D868N" "" "De novo" "" "" "0" "" "" "g.44951942G>A" "" "pathogenic" "" "0000438192" "0" "95" "18" "42531907" "42531907" "subst" "0" "00000" "SETBP1_000003" "g.42531907G>A" "" "{PMID:Hoischen 2010:20436468}" "" "G2602A, D868N" "" "De novo" "" "" "0" "" "" "g.44951942G>A" "" "pathogenic" "" "0000438193" "0" "95" "18" "42531908" "42531908" "subst" "0" "00000" "SETBP1_000005" "g.42531908A>C" "" "{PMID:Hoischen 2010:20436468}" "" "A2603C, D868A" "" "Unknown" "" "" "0" "" "" "g.44951943A>C" "" "pathogenic" "" "0000438194" "0" "95" "18" "42531913" "42531913" "subst" "0" "00000" "SETBP1_000006" "g.42531913G>A" "" "{PMID:Hoischen 2010:20436468}" "" "G2608A, G870S" "" "De novo" "" "" "0" "" "" "g.44951948G>A" "" "pathogenic" "" "0000438195" "0" "95" "18" "42531914" "42531914" "subst" "0" "00000" "SETBP1_000004" "g.42531914G>A" "" "{PMID:Hoischen 2010:20436468}" "" "G2609A, G870D" "" "De novo" "" "" "0" "" "" "g.44951949G>A" "" "pathogenic" "" "0000438196" "0" "95" "18" "42531917" "42531917" "subst" "8.13378E-6" "00000" "SETBP1_000002" "g.42531917T>C" "" "{PMID:Hoischen 2010:20436468}" "" "T2612C, I871T" "" "De novo" "" "" "0" "" "" "g.44951952T>C" "" "pathogenic" "" "0000438197" "0" "95" "18" "42531917" "42531917" "subst" "8.13378E-6" "00000" "SETBP1_000002" "g.42531917T>C" "" "{PMID:Hoischen 2010:20436468}" "" "T2612C, I871T" "" "De novo" "" "" "0" "" "" "g.44951952T>C" "" "pathogenic" "" "0000438198" "0" "95" "18" "42531917" "42531917" "subst" "8.13378E-6" "00000" "SETBP1_000002" "g.42531917T>C" "" "{PMID:Hoischen 2010:20436468}" "" "T2612C, I871T" "" "Unknown" "" "" "0" "" "" "g.44951952T>C" "" "pathogenic" "" "0000438199" "0" "95" "18" "42531917" "42531917" "subst" "8.13378E-6" "00000" "SETBP1_000002" "g.42531917T>C" "" "{PMID:Hoischen 2010:20436468}" "" "T2612C, I871T" "" "De novo" "" "" "0" "" "" "g.44951952T>C" "" "pathogenic" "" "0000438200" "0" "95" "18" "42531917" "42531917" "subst" "8.13378E-6" "00000" "SETBP1_000002" "g.42531917T>C" "" "{PMID:Hoischen 2010:20436468}" "" "T2612C, I871T" "" "De novo" "" "" "0" "" "" "g.44951952T>C" "" "pathogenic" "" "0000564757" "0" "90" "18" "42281355" "42281355" "del" "0" "02329" "SETBP1_000048" "g.42281355del" "" "" "" "SETBP1(NM_015559.3):c.44delG (p.G15Afs*49)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44701390del" "" "pathogenic" "" "0000564758" "0" "30" "18" "42281554" "42281554" "subst" "7.73106E-5" "01943" "SETBP1_000049" "g.42281554G>A" "" "" "" "SETBP1(NM_015559.3):c.243G>A (p.V81=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44701589G>A" "" "likely benign" "" "0000564760" "0" "90" "18" "42281751" "42281751" "dup" "0" "01943" "SETBP1_000051" "g.42281751dup" "" "" "" "SETBP1(NM_015559.3):c.440dupA (p.N147Kfs*2)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44701786dup" "" "pathogenic" "" "0000564761" "0" "50" "18" "42456591" "42456591" "subst" "9.23507E-5" "01943" "SETBP1_000052" "g.42456591A>G" "" "" "" "SETBP1(NM_001130110.1):c.602A>G (p.K201R), SETBP1(NM_001130110.2):c.602A>G (p.(Lys201Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44876626A>G" "" "VUS" "" "0000564762" "0" "10" "18" "42456670" "42456671" "ins" "0.520879" "02325" "SETBP1_000034" "g.42456670_42456671insTCTT" "" "" "" "SETBP1(NM_001130110.2):c.681_682insTCTT (p.T228Sfs*8)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44876705_44876706insTCTT" "" "benign" "" "0000564763" "0" "70" "18" "42456692" "42456692" "subst" "8.2913E-5" "01804" "SETBP1_000053" "g.42456692C>T" "" "" "" "SETBP1(NM_001130110.1):c.703C>T (p.(Pro235Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44876727C>T" "" "likely pathogenic" "" "0000564764" "0" "30" "18" "42529888" "42529888" "subst" "2.85314E-5" "01804" "SETBP1_000054" "g.42529888A>C" "" "" "" "SETBP1(NM_015559.2):c.583A>C (p.(Thr195Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44949923A>C" "" "likely benign" "" "0000564766" "0" "30" "18" "42530232" "42530232" "subst" "8.23093E-5" "02326" "SETBP1_000056" "g.42530232C>T" "" "" "" "SETBP1(NM_015559.3):c.927C>T (p.N309=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44950267C>T" "" "likely benign" "" "0000564767" "0" "30" "18" "42530786" "42530786" "subst" "0" "01943" "SETBP1_000057" "g.42530786T>C" "" "" "" "SETBP1(NM_015559.3):c.1481T>C (p.V494A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44950821T>C" "" "likely benign" "" "0000564769" "0" "50" "18" "42531238" "42531238" "subst" "2.08049E-5" "01943" "SETBP1_000059" "g.42531238G>A" "" "" "" "SETBP1(NM_015559.2):c.1933G>A (p.(Glu645Lys)), SETBP1(NM_015559.3):c.1933G>A (p.E645K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44951273G>A" "" "VUS" "" "0000564770" "0" "50" "18" "42531275" "42531275" "subst" "0" "01943" "SETBP1_000060" "g.42531275T>C" "" "" "" "SETBP1(NM_015559.2):c.1970T>C (p.(Val657Ala)), SETBP1(NM_015559.3):c.1970T>C (p.V657A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44951310T>C" "" "VUS" "" "0000564771" "0" "50" "18" "42531292" "42531292" "subst" "2.49536E-5" "01804" "SETBP1_000061" "g.42531292A>G" "" "" "" "SETBP1(NM_015559.2):c.1987A>G (p.(Ile663Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44951327A>G" "" "VUS" "" "0000564772" "0" "90" "18" "42531907" "42531907" "subst" "0" "02327" "SETBP1_000003" "g.42531907G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44951942G>A" "" "pathogenic" "" "0000564773" "0" "90" "18" "42531935" "42531935" "del" "0" "02329" "SETBP1_000062" "g.42531935del" "" "" "" "SETBP1(NM_015559.3):c.2630delG (p.S877Tfs*84)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44951970del" "" "pathogenic" "" "0000564774" "0" "30" "18" "42532488" "42532488" "subst" "0" "01804" "SETBP1_000063" "g.42532488G>A" "" "" "" "SETBP1(NM_015559.2):c.3183G>A (p.(Met1061Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44952523G>A" "" "likely benign" "" "0000564775" "0" "30" "18" "42532542" "42532542" "subst" "0.000236376" "01943" "SETBP1_000064" "g.42532542T>C" "" "" "" "SETBP1(NM_015559.3):c.3237T>C (p.L1079=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44952577T>C" "" "likely benign" "" "0000564776" "0" "50" "18" "42532790" "42532790" "subst" "2.03196E-5" "02329" "SETBP1_000065" "g.42532790G>A" "" "" "" "SETBP1(NM_015559.3):c.3485G>A (p.R1162Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44952825G>A" "" "VUS" "" "0000564777" "0" "30" "18" "42532819" "42532819" "subst" "0" "02327" "SETBP1_000066" "g.42532819G>C" "" "" "" "SETBP1(NM_015559.2):c.3514G>C (p.(Gly1172Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44952854G>C" "" "likely benign" "" "0000564778" "0" "50" "18" "42532866" "42532866" "subst" "4.0657E-6" "02327" "SETBP1_000067" "g.42532866C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44952901C>G" "" "VUS" "" "0000564779" "0" "30" "18" "42532964" "42532964" "subst" "4.07159E-6" "01943" "SETBP1_000068" "g.42532964A>G" "" "" "" "SETBP1(NM_015559.3):c.3659A>G (p.K1220R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44952999A>G" "" "likely benign" "" "0000564781" "0" "10" "18" "42533130" "42533130" "subst" "0.881202" "02325" "SETBP1_000070" "g.42533130A>G" "" "" "" "SETBP1(NM_015559.3):c.3825A>G (p.S1275=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44953165A>G" "" "benign" "" "0000564782" "0" "50" "18" "42533267" "42533267" "subst" "0.000517131" "01943" "SETBP1_000071" "g.42533267G>A" "" "" "" "SETBP1(NM_015559.3):c.3962G>A (p.R1321H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44953302G>A" "" "VUS" "" "0000564783" "0" "50" "18" "42618473" "42618473" "subst" "0" "02325" "SETBP1_000072" "g.42618473G>A" "" "" "" "SETBP1(NM_015559.3):c.4024G>A (p.(Val1342Met), p.V1342M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45038508G>A" "" "VUS" "" "0000564784" "0" "30" "18" "42618578" "42618578" "subst" "0.00807624" "01804" "SETBP1_000044" "g.42618578G>C" "" "" "" "SETBP1(NM_015559.3):c.4129G>C (p.(Val1377Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45038613G>C" "" "likely benign" "" "0000564786" "0" "30" "18" "42643426" "42643426" "subst" "0" "02326" "SETBP1_000030" "g.42643426G>A" "" "" "" "SETBP1(NM_015559.3):c.4554G>A (p.E1518=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45063461G>A" "" "likely benign" "" "0000617155" "0" "30" "18" "42260844" "42260844" "dup" "0" "02327" "SETBP1_000077" "g.42260844dup" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44680879dup" "" "likely benign" "" "0000617156" "0" "90" "18" "42532287" "42532287" "subst" "0" "02327" "SETBP1_000078" "g.42532287C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44952322C>G" "" "pathogenic" "" "0000631977" "0" "90" "18" "42531086" "42531086" "del" "0" "00006" "SETBP1_000079" "g.42531086del" "" "{PMID:Eising 2018:29463886}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.44951121del" "" "pathogenic" "" "0000647197" "0" "90" "18" "42531913" "42531913" "subst" "0" "03288" "SETBP1_000006" "g.42531913G>A" "" "" "" "" "" "De novo" "yes" "rs267607040" "0" "" "" "g.44951948G>A" "" "pathogenic (dominant)" "" "0000649812" "1" "10" "18" "42531184" "42531184" "subst" "0.00998955" "03575" "SETBP1_000080" "g.42531184C>T" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs146193261}" "Germline" "" "rs146193261" "0" "" "" "g.44951219C>T" "" "benign" "" "0000649813" "1" "30" "18" "42648173" "42648173" "subst" "0" "03575" "SETBP1_000081" "g.42648173T>C" "13/2762 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "13 heterozygous, no homozygous; {DB:CLININrs76077260}" "Germline" "" "rs76077260" "0" "" "" "g.45068208T>C" "" "likely benign" "" "0000667305" "0" "70" "18" "42531126" "42531126" "del" "0" "00006" "SETBP1_000083" "g.42531126del" "" "{PMID:Hamdan 2015:25356899}" "" "" "" "De novo" "" "" "0" "" "" "g.44951161del" "" "pathogenic (dominant)" "" "0000681144" "0" "90" "18" "42530031" "42530031" "del" "0" "02325" "SETBP1_000084" "g.42530031del" "" "" "" "SETBP1(NM_015559.3):c.726delC (p.R243Efs*100)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000681145" "0" "90" "18" "42530935" "42530935" "subst" "0" "02327" "SETBP1_000085" "g.42530935C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000681146" "0" "30" "18" "42531984" "42531984" "subst" "4.07325E-5" "01943" "SETBP1_000086" "g.42531984T>G" "" "" "" "SETBP1(NM_015559.3):c.2679T>G (p.S893=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000681147" "0" "30" "18" "42618532" "42618532" "subst" "1.62493E-5" "01943" "SETBP1_000087" "g.42618532G>A" "" "" "" "SETBP1(NM_015559.3):c.4083G>A (p.R1361=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000683342" "0" "70" "18" "42531178" "42531178" "subst" "0" "00006" "SETBP1_000020" "g.42531178C>T" "" "{PMID:Grozeva 2015:26350204}, {DOI:Grozeva 2015:10.1002/humu.22901}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.44951213C>T" "" "likely pathogenic (dominant)" "" "0000683633" "0" "50" "18" "42643178" "42643178" "subst" "0" "01164" "SETBP1_000090" "g.42643178G>C" "" "" "" "" "ACMG grading: PM1,PM2,PP3" "Germline" "" "" "0" "" "" "" "" "VUS" "ACMG" "0000692595" "0" "70" "18" "42532159" "42532159" "subst" "0" "01804" "SETBP1_000091" "g.42532159C>T" "" "" "" "SETBP1(NM_015559.2):c.2854C>T (p.(Gln952*))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000699265" "0" "90" "18" "42531070" "42531070" "subst" "0" "01238" "SETBP1_000019" "g.42531070C>T" "1/656" "" "" "" "" "De novo" "-" "" "0" "" "" "g.44951105C>T" "" "pathogenic" "ACMG" "0000699266" "0" "90" "18" "42531504" "42531508" "del" "0" "01238" "SETBP1_000092" "g.42531504_42531508del" "1/656" "" "" "" "" "De novo" "-" "" "0" "" "" "g.44951539_44951543del" "" "pathogenic" "ACMG" "0000699267" "21" "70" "18" "42531877" "42531877" "subst" "0" "01238" "SETBP1_000093" "g.42531877G>A" "1/656 patients" "" "" "" "" "Germline" "no" "rs1178702025" "0" "" "" "g.44951912G>A" "" "likely pathogenic" "ACMG" "0000699956" "0" "50" "18" "42529976" "42529976" "subst" "0" "01238" "SETBP1_000094" "g.42529976C>T" "1/656" "" "" "Thr224Ile" "" "Germline" "no" "" "0" "" "" "" "" "VUS" "ACMG" "0000699979" "0" "90" "18" "42531349" "42531351" "delins" "0" "03833" "SETBP1_000037" "g.42531349_42531351delinsAT" "" "Morgan 2021, submitted" "" "" "parents deceased, unaffected sisters do not carry variant" "Germline/De novo (untested)" "" "" "0" "" "" "g.44951384_44951386delinsAT" "" "pathogenic (dominant)" "" "0000699981" "11" "30" "18" "42530173" "42530173" "subst" "2.89797E-5" "01238" "SETBP1_000095" "g.42530173G>T" "1/656" "" "" "p.Ala290Ser" "" "Germline" "no" "rs764954143" "0" "" "" "" "" "VUS" "ACMG" "0000699982" "21" "30" "18" "42532328" "42532328" "subst" "4.87543E-5" "01238" "SETBP1_000097" "g.42532328G>A" "1/656" "" "" "" "" "Germline" "no" "rs760902522" "0" "" "" "g.44952363G>A" "" "VUS" "ACMG" "0000699983" "11" "50" "18" "42532532" "42532532" "subst" "4.07276E-6" "01238" "SETBP1_000098" "g.42532532C>T" "1/656" "" "" "" "" "Germline" "no" "" "0" "" "" "g.44952567C>T" "" "VUS" "ACMG" "0000699984" "21" "50" "18" "42532652" "42532652" "subst" "6.09885E-5" "01238" "SETBP1_000099" "g.42532652A>G" "1/656" "" "" "" "" "Germline" "no" "rs765137543" "0" "" "" "g.44952687A>G" "" "VUS" "ACMG" "0000699985" "0" "50" "18" "42618486" "42618486" "subst" "0" "01238" "SETBP1_000101" "g.42618486C>A" "1/656" "" "" "" "" "Germline" "?" "rs973611154" "0" "" "" "g.45038521C>A" "" "VUS" "ACMG" "0000699986" "0" "50" "18" "42530507" "42530507" "subst" "7.76639E-5" "01238" "SETBP1_000096" "g.42530507G>A" "1/656" "" "" "" "" "Germline" "?" "rs144407969" "0" "" "" "g.44950542G>A" "" "VUS" "ACMG" "0000699990" "0" "30" "18" "42533181" "42533181" "subst" "2.04212E-5" "01238" "SETBP1_000100" "g.42533181C>G" "1/656" "" "" "" "" "Germline" "?" "rs139106261" "0" "" "" "g.44953216C>G" "" "VUS" "ACMG" "0000701793" "0" "70" "18" "42531070" "42531070" "subst" "0" "01238" "SETBP1_000019" "g.42531070C>T" "1/656" "" "" "" "" "De novo" "-" "" "0" "" "" "g.44951105C>T" "" "pathogenic" "ACMG" "0000704186" "0" "70" "18" "42532456" "42532456" "dup" "0" "01807" "SETBP1_000102" "g.42532456dup" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000708508" "0" "10" "18" "42529996" "42529996" "subst" "0.192036" "00006" "SETBP1_000012" "g.42529996G>C" "4/142 cases developmental delay" "{PMID:Filges 2020:21037274}" "" "" "" "Germline" "" "rs11082414" "0" "" "" "g.44950031G>C" "" "benign" "" "0000708509" "0" "10" "18" "42530474" "42530474" "subst" "8.18096E-6" "00006" "SETBP1_000112" "g.42530474C>T" "1/142 cases developmental delay" "{PMID:Filges 2020:21037274}" "" "" "" "Germline" "" "rs8091231" "0" "" "" "g.44950509C>T" "" "benign" "" "0000708510" "0" "50" "18" "42531184" "42531184" "subst" "0.00998955" "00006" "SETBP1_000080" "g.42531184C>T" "3/142 cases developmental delay" "{PMID:Filges 2020:21037274}" "" "" "not found in 70 controls" "Germline" "" "" "0" "" "" "g.44951219C>T" "" "VUS" "" "0000708511" "0" "10" "18" "42531216" "42531216" "subst" "2.07388E-5" "00006" "SETBP1_000121" "g.42531216G>A" "1/142 cases developmental delay" "{PMID:Filges 2020:21037274}" "" "" "" "Germline" "" "" "0" "" "" "g.44951251G>A" "" "benign" "" "0000708512" "0" "10" "18" "42531237" "42531237" "subst" "0.00198051" "00006" "SETBP1_000122" "g.42531237C>T" "2/142 cases developmental delay" "{PMID:Filges 2020:21037274}" "" "" "" "Germline" "" "rs3744824" "0" "" "" "g.44951272C>T" "" "benign" "" "0000708513" "0" "10" "18" "42531912" "42531912" "subst" "0.000390482" "00006" "SETBP1_000126" "g.42531912C>T" "12/142 cases developmental delay" "{PMID:Filges 2020:21037274}" "" "" "" "Germline" "" "" "0" "" "" "g.44951947C>T" "" "benign" "" "0000708514" "0" "50" "18" "42532178" "42532178" "subst" "0.000174704" "00006" "SETBP1_000023" "g.42532178A>G" "1/142 cases developmental delay" "{PMID:Filges 2020:21037274}" "" "" "not found in 70 controls" "Germline" "" "" "0" "" "" "g.44952213A>G" "" "VUS" "" "0000708515" "0" "50" "18" "42532504" "42532504" "subst" "2.84613E-5" "00006" "SETBP1_000130" "g.42532504G>A" "1/142 cases developmental delay" "{PMID:Filges 2020:21037274}" "" "" "not found in 70 controls" "Germline" "" "" "0" "" "" "g.44952539G>A" "" "VUS" "" "0000708516" "0" "10" "18" "42532606" "42532606" "subst" "0.122516" "00006" "SETBP1_000042" "g.42532606G>A" "90/142 cases developmental delay" "{PMID:Filges 2020:21037274}" "" "" "" "Germline" "" "rs3744825" "0" "" "" "g.44952641G>A" "" "benign" "" "0000708517" "0" "10" "18" "42532677" "42532677" "subst" "4.06329E-6" "00006" "SETBP1_000131" "g.42532677C>T" "1/142 cases developmental delay" "{PMID:Filges 2020:21037274}" "" "" "" "Germline" "" "" "0" "" "" "g.44952712C>T" "" "benign" "" "0000708518" "0" "50" "18" "42532693" "42532693" "subst" "0.137787" "00006" "SETBP1_000132" "g.42532693C>A" "66/142 cases developmental delay" "{PMID:Filges 2020:21037274}" "" "" "" "Germline" "" "rs1064204" "0" "" "" "g.44952728C>A" "" "VUS" "" "0000708519" "1" "30" "18" "42533031" "42533031" "subst" "0" "00006" "SETBP1_000133" "g.42533031G>C" "1/142 cases developmental delay" "{PMID:Filges 2020:21037274}" "" "" "not found in 70 controls, variant found in healthy parent" "Germline" "" "" "0" "" "" "g.44953066G>C" "" "likely benign" "" "0000708520" "0" "10" "18" "42533130" "42533130" "subst" "0.881202" "00006" "SETBP1_000070" "g.42533130A>G" "2/142 cases developmental delay" "{PMID:Filges 2020:21037274}" "" "" "not found in 70 controls" "Germline" "" "rs8096662" "0" "" "" "g.44953165A>G" "" "benign" "" "0000708521" "0" "10" "18" "42618459" "42618459" "subst" "7.71931E-5" "00006" "SETBP1_000135" "g.42618459G>C" "1/142 cases developmental delay" "{PMID:Filges 2020:21037274}" "" "" "" "Germline" "" "" "0" "" "" "g.45038494G>C" "" "benign" "" "0000708522" "0" "50" "18" "42643270" "42643270" "subst" "0.0114615" "00006" "SETBP1_000073" "g.42643270G>T" "3/142 cases developmental delay" "{PMID:Filges 2020:21037274}" "" "" "phenotype patient not matching SETBP1" "Germline" "" "" "0" "" "" "g.45063305G>T" "" "VUS" "" "0000708523" "0" "10" "18" "42643435" "42643435" "subst" "0" "00006" "SETBP1_000136" "g.42643435C>G" "1/142 cases developmental delay" "{PMID:Filges 2020:21037274}" "" "" "" "Germline" "" "" "0" "" "" "g.45063470C>G" "" "benign" "" "0000708524" "0" "50" "18" "42643449" "42643449" "subst" "0" "00006" "SETBP1_000137" "g.42643449C>A" "1/142 cases developmental delay" "{PMID:Filges 2020:21037274}" "" "" "phenotype patient not matching SETBP1" "Germline" "" "" "0" "" "" "g.45063484C>A" "" "VUS" "" "0000708525" "1" "30" "18" "42643545" "42643545" "subst" "0.00012154" "00006" "SETBP1_000138" "g.42643545A>T" "1/142 cases developmental delay" "{PMID:Filges 2020:21037274}" "" "" "variant found in healthy parent" "Germline" "" "" "0" "" "" "g.45063580A>T" "" "likely benign" "" "0000708551" "0" "90" "18" "42531181" "42531181" "subst" "0" "03833" "SETBP1_000120" "g.42531181C>T" "" "{PMID:Coe 2014:25217958}" "" "" "" "De novo" "" "" "0" "" "" "g.44951216C>T" "" "pathogenic (dominant)" "" "0000708552" "0" "90" "18" "42531178" "42531178" "subst" "0" "03833" "SETBP1_000020" "g.42531178C>T" "" "{PMID:Coe 2014:25217958}" "" "" "" "De novo" "" "" "0" "" "" "g.44951213C>T" "" "pathogenic (dominant)" "" "0000708553" "0" "90" "18" "42531349" "42531351" "delins" "0" "03833" "SETBP1_000037" "g.42531349_42531351delinsAT" "" "Morgan 2021, submitted" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.44951384_44951386delinsAT" "" "pathogenic (dominant)" "" "0000708554" "0" "90" "18" "42531178" "42531178" "subst" "0" "03833" "SETBP1_000020" "g.42531178C>T" "" "{PMID:Coe 2014:25217958}" "" "" "" "De novo" "" "" "0" "" "" "g.44951213C>T" "" "pathogenic (dominant)" "" "0000708555" "0" "90" "18" "42281718" "42281719" "del" "0" "03833" "SETBP1_000104" "g.42281718_42281719del" "" "Morgan 2021, submitted" "" "" "" "De novo" "" "" "0" "" "" "g.44701753_44701754del" "" "pathogenic (dominant)" "" "0000708556" "0" "90" "18" "42532021" "42532022" "ins" "0" "03833" "SETBP1_000128" "g.42532021_42532022insGG" "" "Morgan 2021, submitted" "" "" "" "De novo" "" "" "0" "" "" "g.44952056_44952057insGG" "" "pathogenic (dominant)" "" "0000708557" "0" "90" "18" "42533070" "42533070" "dup" "0" "03833" "SETBP1_000134" "g.42533070dup" "" "Morgan 2021, submitted" "" "" "" "De novo" "" "" "0" "" "" "g.44953105dup" "" "pathogenic (dominant)" "" "0000708558" "0" "90" "18" "42531461" "42531461" "del" "0" "03833" "SETBP1_000124" "g.42531461del" "" "Morgan 2021, submitted" "" "" "" "De novo" "" "" "0" "" "" "g.44951496del" "" "pathogenic (dominant)" "" "0000708559" "0" "90" "18" "42531381" "42531397" "delins" "0" "03833" "SETBP1_000123" "g.42531381_42531397delinsC" "" "Morgan 2021, submitted" "" "" "" "De novo" "" "" "0" "" "" "g.44951416_44951432delinsC" "" "pathogenic (dominant)" "" "0000708560" "0" "90" "18" "42533106" "42533106" "dup" "0" "03833" "SETBP1_000025" "g.42533106dup" "" "Morgan 2021, submitted" "" "" "" "De novo" "" "" "0" "" "" "g.44953141dup" "" "pathogenic (dominant)" "" "0000708561" "0" "90" "18" "42530060" "42530061" "delins" "0" "03833" "SETBP1_000110" "g.42530060_42530061delinsT" "" "Morgan 2021, submitted" "" "3799_3800insC" "" "De novo" "" "" "0" "" "" "g.44950095_44950096delinsT" "" "pathogenic (dominant)" "" "0000708562" "0" "90" "18" "42530935" "42530935" "subst" "0" "03833" "SETBP1_000085" "g.42530935C>T" "" "Morgan 2021, submitted" "" "" "" "De novo" "" "" "0" "" "" "g.44950970C>T" "" "pathogenic (dominant)" "" "0000708563" "0" "90" "18" "42530938" "42530938" "subst" "0" "03833" "SETBP1_000116" "g.42530938G>T" "" "Morgan 2021, submitted" "" "" "" "De novo" "" "" "0" "" "" "g.44950973G>T" "" "pathogenic (dominant)" "" "0000708564" "0" "90" "18" "42530873" "42530873" "del" "0" "03833" "SETBP1_000114" "g.42530873del" "" "Morgan 2021, submitted" "" "" "" "De novo" "" "" "0" "" "" "g.44950908del" "" "pathogenic (dominant)" "" "0000708565" "0" "90" "18" "42531178" "42531178" "subst" "0" "03833" "SETBP1_000020" "g.42531178C>T" "" "{PMID:Coe 2014:25217958}" "" "" "" "De novo" "" "" "0" "" "" "g.44951213C>T" "" "pathogenic (dominant)" "" "0000708566" "0" "90" "18" "42530981" "42530981" "del" "0" "03833" "SETBP1_000117" "g.42530981del" "" "Morgan 2021, submitted" "" "" "" "De novo" "" "" "0" "" "" "g.44951016del" "" "pathogenic (dominant)" "" "0000708567" "0" "90" "18" "42530126" "42530126" "subst" "0" "03833" "SETBP1_000111" "g.42530126G>A" "" "Morgan 2021, submitted" "" "" "" "De novo" "" "" "0" "" "" "g.44950161G>A" "" "pathogenic (dominant)" "" "0000708568" "0" "90" "18" "42531082" "42531082" "subst" "0" "03833" "SETBP1_000119" "g.42531082C>T" "" "Morgan 2021, submitted" "" "" "" "De novo" "" "" "0" "" "" "g.44951117C>T" "" "pathogenic (dominant)" "" "0000708569" "0" "90" "18" "42519449" "42567840" "del" "0" "03833" "SETBP1_000108" "g.(?_42519449)_(42567840_?)del" "" "Morgan 2021, submitted" "" "arr[GRCh37] 18q12.3(42519449_42567840)x1" "" "De novo" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000708570" "0" "90" "18" "42530031" "42530037" "del" "0" "03833" "SETBP1_000109" "g.42530031_42530037del" "" "Morgan 2021, submitted" "" "" "" "De novo" "" "" "0" "" "" "g.44950066_44950072del" "" "pathogenic (dominant)" "" "0000708571" "0" "90" "18" "42281764" "42281765" "ins" "0" "03833" "SETBP1_000106" "g.42281764_42281765insTGGG" "" "Morgan 2021, submitted" "" "" "" "De novo" "" "" "0" "" "" "g.44701799_44701800insTGGG" "" "pathogenic (dominant)" "" "0000708572" "0" "90" "18" "42532287" "42532287" "subst" "0" "03833" "SETBP1_000078" "g.42532287C>G" "" "Morgan 2021, submitted" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.44952322C>G" "" "pathogenic (dominant)" "" "0000708573" "0" "90" "18" "42532425" "42532425" "subst" "0" "03833" "SETBP1_000129" "g.42532425C>A" "" "Morgan 2021, submitted" "" "" "" "De novo" "" "" "0" "" "" "g.44952460C>A" "" "pathogenic (dominant)" "" "0000708574" "0" "90" "18" "42531970" "42531970" "subst" "0" "03833" "SETBP1_000127" "g.42531970C>T" "" "{PMID:Eising 2019:29463886}, {PMID:Hildebrand 2020:32345733}" "" "" "ACMG PP3 PP4 PM2 PM4 PS2 PS3 PVS1" "De novo" "" "" "0" "" "" "g.44952005C>T" "" "pathogenic (dominant)" "ACMG" "0000708575" "0" "90" "18" "42531769" "42531769" "del" "0" "03833" "SETBP1_000125" "g.42531769del" "" "{PMID:Coe 2014:25217958}" "" "" "" "De novo" "" "" "0" "" "" "g.44951804del" "" "pathogenic (dominant)" "" "0000708576" "0" "90" "18" "42530536" "42530537" "del" "0" "03833" "SETBP1_000113" "g.42530536_42530537del" "" "{PMID:Coe 2014:25217958}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.44950571_44950572del" "" "pathogenic (dominant)" "" "0000708577" "0" "90" "18" "42531178" "42531178" "subst" "0" "03833" "SETBP1_000020" "g.42531178C>T" "" "{PMID:Coe 2014:25217958}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.44951213C>T" "" "pathogenic (dominant)" "" "0000708578" "0" "90" "18" "42281350" "42281351" "del" "0" "03833" "SETBP1_000033" "g.42281350_42281351del" "" "{PMID:Coe 2014:25217958}" "" "" "" "De novo" "" "" "0" "" "" "g.44701385_44701386del" "" "pathogenic (dominant)" "" "0000708579" "0" "90" "18" "42530901" "42530901" "subst" "0" "03833" "SETBP1_000115" "g.42530901G>A" "" "{PMID:Coe 2014:25217958}" "" "" "" "De novo" "" "" "0" "" "" "g.44950936G>A" "" "pathogenic (dominant)" "" "0000708580" "0" "90" "18" "42281738" "42281738" "del" "0" "03833" "SETBP1_000105" "g.42281738del" "" "{PMID:Coe 2014:25217958}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.44701773del" "" "pathogenic (dominant)" "" "0000708581" "0" "90" "18" "42531079" "42531079" "subst" "0" "03833" "SETBP1_000118" "g.42531079A>T" "" "{PMID:Rauch 2012:23020937}" "" "" "" "De novo" "" "" "0" "" "" "g.44951114A>T" "" "pathogenic (dominant)" "" "0000708582" "0" "90" "18" "42532243" "42904307" "del" "0" "03833" "SETBP1_000107" "g.(42459002_42532243)_(42904307_43015002)del" "" "{PMID:Marseglia 2012:22333924}" "" "arr 18q12.3(40,786,241–41,158,305)x1" "372kb deletion" "De novo" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000708583" "0" "90" "18" "42028936" "43015201" "del" "0" "03833" "SETBP1_000103" "g.(?_42028936)_(43015201_?)del" "" "{PMID:Filges 2020:21037274}" "" "hg18 18q12.3(40282934-41269199)x1" "986kb deletion" "De novo" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000708584" "0" "90" "18" "41979805" "42834226" "del" "0" "00006" "SETBP1_000103" "g.(?_41979805)_(42834226_?)del" "" "{PMID:Filges 2020:21037274}" "" "hg18 18q12.3(40233803-41088224)x1" "850kb deletion" "De novo" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000726882" "0" "90" "18" "42281400" "42281409" "dup" "0" "01943" "SETBP1_000139" "g.42281400_42281409dup" "" "" "" "SETBP1(NM_015559.3):c.89_98dupCTCCTGGCTG (p.A34Sfs*32)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000726883" "0" "50" "18" "42531896" "42531896" "subst" "0" "02329" "SETBP1_000082" "g.42531896C>A" "" "" "" "SETBP1(NM_015559.3):c.2591C>A (p.T864K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000736495" "0" "90" "18" "42531677" "42531692" "del" "0" "01807" "SETBP1_000140" "g.42531677_42531692del" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.44951712_44951727del" "" "pathogenic" "" "0000760893" "0" "90" "18" "42530893" "42530893" "subst" "0" "04031" "SETBP1_000145" "g.42530893C>T" "" "Morgan 2021, submitted" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.44950928C>T" "" "pathogenic (dominant)" "" "0000760894" "0" "90" "18" "34576844" "43015201" "del" "0" "04031" "SETBP1_000103" "g.(?_34576844)_(43015201_?)del" "" "Morgan 2021, submitted" "" "arr 18q12.2q12.3(34576844_43015201)x1" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000760895" "0" "90" "18" "42530713" "42530713" "del" "0" "04031" "SETBP1_000144" "g.42530713del" "" "Morgan 2021, submitted" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.44950748del" "" "pathogenic (dominant)" "" "0000760896" "0" "90" "18" "42281648" "42281648" "del" "0" "04031" "SETBP1_000141" "g.42281648del" "" "Morgan 2021, submitted" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.44701683del" "" "pathogenic (dominant)" "" "0000760897" "0" "90" "18" "42281733" "42281733" "dup" "0" "04031" "SETBP1_000143" "g.42281733dup" "" "Morgan 2021, submitted" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.44701768dup" "" "pathogenic (dominant)" "" "0000760898" "0" "90" "18" "39600614" "45460709" "del" "0" "04031" "SETBP1_000103" "g.(?_39600614)_(45460709_?)del" "" "Morgan 2021, submitted" "" "arr[hg19] 18q12.3q21.1(39600614_45460709)x1" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000760899" "0" "90" "18" "42281714" "42281714" "subst" "0" "04031" "SETBP1_000142" "g.42281714C>T" "" "Morgan 2021, submitted" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.44701749C>T" "" "pathogenic (dominant)" "" "0000763092" "1" "70" "18" "42532222" "42532222" "subst" "0" "00006" "SETBP1_000146" "g.42532222A>T" "" "{PMID:Anazi 2017:27431290}" "" "" "ACMG PS2, PM2, PP3" "De novo" "" "" "0" "" "" "g.44952257A>T" "" "likely pathogenic" "ACMG" "0000787513" "0" "50" "18" "42532240" "42532240" "subst" "1.2189E-5" "00000" "SETBP1_000147" "g.42532240G>A" "" "0" "" "" "" "Germline" "" "rs373493544" "0" "" "" "g.44952275G>A" "" "VUS" "" "0000795109" "0" "50" "18" "42643437" "42643437" "delins" "0" "00006" "SETBP1_000148" "g.42643437delinsGGC" "" "{PMID:Goodman 2021:34314705}, {DOI:Goodman 2021:10.1016/j.ajhg.2021.06.019}" "" "" "" "De novo" "" "" "0" "" "" "" "" "VUS" "" "0000808485" "0" "30" "18" "42281472" "42281472" "subst" "0.000174891" "01943" "SETBP1_000149" "g.42281472G>A" "" "" "" "SETBP1(NM_015559.3):c.161G>A (p.R54H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000808486" "0" "30" "18" "42529880" "42529880" "subst" "0.000232516" "01943" "SETBP1_000150" "g.42529880A>G" "" "" "" "SETBP1(NM_015559.3):c.575A>G (p.H192R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000808487" "0" "30" "18" "42530232" "42530232" "subst" "8.23093E-5" "01943" "SETBP1_000056" "g.42530232C>T" "" "" "" "SETBP1(NM_015559.3):c.927C>T (p.N309=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000808488" "0" "90" "18" "42530569" "42530569" "subst" "0" "01943" "SETBP1_000151" "g.42530569C>T" "" "" "" "SETBP1(NM_015559.3):c.1264C>T (p.Q422*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000817809" "3" "50" "18" "42529853" "42529853" "subst" "8.2058E-6" "00006" "SETBP1_000152" "g.42529853A>G" "" "{PMID:Hu 2019:29302074}" "" "" "" "Germline" "" "" "0" "" "" "g.44949888A>G" "" "VUS" "ACMG" "0000823710" "0" "70" "18" "42532105" "42532105" "subst" "0" "02494" "SETBP1_000153" "g.42532105A>T" "" "" "" "" "" "De novo" "" "" "" "" "" "" "" "likely pathogenic (dominant)" "" "0000836780" "0" "70" "18" "42530935" "42530935" "subst" "0" "02494" "SETBP1_000085" "g.42530935C>T" "" "" "" "" "" "De novo" "" "" "" "" "" "" "" "likely pathogenic (dominant)" "" "0000855300" "0" "50" "18" "42281696" "42281696" "subst" "4.06161E-6" "01943" "SETBP1_000154" "g.42281696A>G" "" "" "" "SETBP1(NM_015559.3):c.385A>G (p.I129V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000855301" "0" "30" "18" "42530553" "42530553" "subst" "0.000587731" "01943" "SETBP1_000155" "g.42530553T>C" "" "" "" "SETBP1(NM_015559.3):c.1248T>C (p.H416=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000855302" "0" "50" "18" "42532564" "42532564" "subst" "0" "01943" "SETBP1_000157" "g.42532564A>G" "" "" "" "SETBP1(NM_015559.3):c.3259A>G (p.R1087G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000855303" "0" "30" "18" "42532604" "42532604" "subst" "0.0011413" "01943" "SETBP1_000024" "g.42532604A>G" "" "" "" "SETBP1(NM_015559.3):c.3299A>G (p.H1100R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000865685" "0" "30" "18" "42530795" "42530795" "subst" "0.0011541" "01943" "SETBP1_000156" "g.42530795C>T" "" "" "" "SETBP1(NM_015559.2):c.1490C>T (p.(Pro497Leu)), SETBP1(NM_015559.3):c.1490C>T (p.P497L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000865686" "0" "30" "18" "42643461" "42643461" "subst" "0" "01943" "SETBP1_000158" "g.42643461T>C" "" "" "" "SETBP1(NM_015559.3):c.4589T>C (p.L1530P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000877959" "0" "50" "18" "42618600" "42618600" "subst" "4.06312E-6" "03779" "SETBP1_000159" "g.42618600C>G" "" "" "" "" "" "CLASSIFICATION record" "" "rs1296546263" "0" "" "" "" "" "VUS" "" "0000894565" "0" "10" "18" "42532881" "42532881" "subst" "0.000370072" "02326" "SETBP1_000160" "g.42532881C>T" "" "" "" "SETBP1(NM_015559.3):c.3576C>T (p.S1192=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000909294" "0" "90" "18" "42530045" "42530045" "del" "0" "01164" "SETBP1_000161" "g.42530045del" "" "" "" "" "ACMG: PVS1, PS2_SUP, PM2_SUP, confirmed de novo in trio-exome" "De novo" "?" "" "0" "" "" "g.44950080del" "" "pathogenic (dominant)" "ACMG" "0000926743" "0" "50" "18" "42281511" "42281511" "subst" "0" "02325" "SETBP1_000162" "g.42281511G>T" "" "" "" "SETBP1(NM_015559.3):c.200G>T (p.R67L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000935938" "0" "90" "18" "42531877" "42531877" "subst" "0" "00006" "SETBP1_000093" "g.42531877G>A" "" "{PMID:Chuan 2022:35571021}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.44951912G>A" "" "pathogenic (dominant)" "" "0000935986" "0" "70" "18" "42530552" "42530552" "subst" "4.0817E-6" "00006" "SETBP1_000163" "g.42530552A>G" "" "{PMID:Chuan 2022:35571021}" "" "" "ACMG PM1,PM2,PP3,PP4" "Germline/De novo (untested)" "" "" "0" "" "" "g.44950587A>G" "" "likely pathogenic (dominant)" "ACMG" "0000951134" "0" "90" "18" "42531574" "42531574" "del" "0" "02325" "SETBP1_000164" "g.42531574del" "" "" "" "SETBP1(NM_015559.3):c.2269delG (p.D757Mfs*27)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000969404" "0" "30" "18" "42449253" "42449253" "subst" "0" "02325" "SETBP1_000165" "g.42449253G>C" "" "" "" "SETBP1(NM_015559.3):c.540+5G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000983041" "0" "90" "18" "42281350" "42281351" "del" "0" "02325" "SETBP1_000033" "g.42281350_42281351del" "" "" "" "SETBP1(NM_015559.3):c.39_40delAG (p.G15Rfs*47)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000983042" "0" "30" "18" "42531178" "42531178" "subst" "0" "02325" "SETBP1_000166" "g.42531178C>A" "" "" "" "SETBP1(NM_015559.3):c.1873C>A (p.R625=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000983043" "0" "50" "18" "42531572" "42531572" "subst" "0.000166686" "01804" "SETBP1_000167" "g.42531572C>T" "" "" "" "SETBP1(NM_015559.2):c.2267C>T (p.(Pro756Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000983044" "0" "50" "18" "42618612" "42618612" "subst" "8.12935E-6" "01804" "SETBP1_000168" "g.42618612C>T" "" "" "" "SETBP1(NM_015559.3):c.4163C>T (p.(Ser1388Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000985194" "0" "70" "18" "42531869" "42531869" "subst" "0" "03544" "SETBP1_000169" "g.42531869C>T" "" "" "" "" "" "De novo" "-" "" "" "" "" "g.44951904C>T" "" "likely pathogenic" "ACMG" "0001004092" "0" "30" "18" "42281357" "42281357" "subst" "0.000118575" "01804" "SETBP1_000170" "g.42281357G>A" "" "" "" "SETBP1(NM_015559.2):c.46G>A (p.(Glu16Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001004093" "0" "30" "18" "42456594" "42456594" "subst" "1.979E-5" "01804" "SETBP1_000171" "g.42456594A>G" "" "" "" "SETBP1(NM_001130110.1):c.605A>G (p.(Lys202Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001004094" "0" "30" "18" "42456623" "42456623" "subst" "0" "01804" "SETBP1_000172" "g.42456623T>C" "" "" "" "SETBP1(NM_001130110.1):c.634T>C (p.(Cys212Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001004095" "0" "50" "18" "42456660" "42456660" "subst" "9.02315E-6" "01804" "SETBP1_000173" "g.42456660C>G" "" "" "" "SETBP1(NM_001130110.1):c.671C>G (p.(Pro224Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001004096" "0" "50" "18" "42529913" "42529913" "subst" "0" "01804" "SETBP1_000174" "g.42529913G>A" "" "" "" "SETBP1(NM_015559.2):c.608G>A (p.(Gly203Asp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001004097" "0" "50" "18" "42530366" "42530366" "subst" "0" "01804" "SETBP1_000175" "g.42530366G>C" "" "" "" "SETBP1(NM_015559.2):c.1061G>C (p.(Trp354Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001004098" "0" "30" "18" "42530422" "42530422" "subst" "4.08597E-6" "01804" "SETBP1_000176" "g.42530422T>G" "" "" "" "SETBP1(NM_015559.2):c.1117T>G (p.(Ser373Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001004099" "0" "30" "18" "42530515" "42530515" "subst" "1.22589E-5" "01804" "SETBP1_000177" "g.42530515A>G" "" "" "" "SETBP1(NM_015559.2):c.1210A>G (p.(Ile404Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001004100" "0" "30" "18" "42530731" "42530731" "subst" "4.06352E-6" "01804" "SETBP1_000178" "g.42530731C>T" "" "" "" "SETBP1(NM_015559.2):c.1426C>T (p.(Pro476Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001004101" "0" "30" "18" "42530795" "42530795" "subst" "0.0011541" "01804" "SETBP1_000156" "g.42530795C>T" "" "" "" "SETBP1(NM_015559.2):c.1490C>T (p.(Pro497Leu)), SETBP1(NM_015559.3):c.1490C>T (p.P497L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001004102" "0" "50" "18" "42530807" "42530807" "subst" "4.06392E-6" "01804" "SETBP1_000179" "g.42530807C>T" "" "" "" "SETBP1(NM_015559.2):c.1502C>T (p.(Pro501Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001004103" "0" "30" "18" "42530821" "42530821" "subst" "0" "01804" "SETBP1_000180" "g.42530821C>G" "" "" "" "SETBP1(NM_015559.2):c.1516C>G (p.(Pro506Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001004104" "0" "30" "18" "42531238" "42531238" "subst" "2.08049E-5" "01804" "SETBP1_000059" "g.42531238G>A" "" "" "" "SETBP1(NM_015559.2):c.1933G>A (p.(Glu645Lys)), SETBP1(NM_015559.3):c.1933G>A (p.E645K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001004105" "0" "50" "18" "42531263" "42531263" "subst" "0" "01804" "SETBP1_000181" "g.42531263G>A" "" "" "" "SETBP1(NM_015559.2):c.1958G>A (p.(Gly653Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001004106" "0" "30" "18" "42531275" "42531275" "subst" "0" "01804" "SETBP1_000060" "g.42531275T>C" "" "" "" "SETBP1(NM_015559.2):c.1970T>C (p.(Val657Ala)), SETBP1(NM_015559.3):c.1970T>C (p.V657A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001004107" "0" "70" "18" "42531594" "42531594" "del" "0" "01804" "SETBP1_000182" "g.42531594del" "" "" "" "SETBP1(NM_015559.2):c.2289delC (p.(Asn764fs))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001004108" "0" "50" "18" "42531886" "42531886" "subst" "0" "01804" "SETBP1_000183" "g.42531886A>G" "" "" "" "SETBP1(NM_015559.2):c.2581A>G (p.(Ser861Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001004109" "0" "30" "18" "42532129" "42532129" "subst" "4.06517E-5" "01804" "SETBP1_000184" "g.42532129C>T" "" "" "" "SETBP1(NM_015559.2):c.2824C>T (p.(Arg942Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001004110" "0" "50" "18" "42532322" "42532322" "subst" "4.06243E-6" "01804" "SETBP1_000185" "g.42532322A>G" "" "" "" "SETBP1(NM_015559.2):c.3017A>G (p.(Tyr1006Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001004111" "0" "30" "18" "42532388" "42532388" "subst" "2.43756E-5" "01804" "SETBP1_000186" "g.42532388C>G" "" "" "" "SETBP1(NM_015559.2):c.3083C>G (p.(Thr1028Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001004112" "0" "70" "18" "42532409" "42532409" "subst" "0" "01804" "SETBP1_000187" "g.42532409T>A" "" "" "" "SETBP1(NM_015559.2):c.3104T>A (p.(Leu1035*))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001004113" "0" "30" "18" "42532732" "42532732" "subst" "2.84486E-5" "01804" "SETBP1_000188" "g.42532732T>C" "" "" "" "SETBP1(NM_015559.2):c.3427T>C (p.(Ser1143Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001004114" "0" "30" "18" "42532819" "42532819" "subst" "0" "01804" "SETBP1_000066" "g.42532819G>C" "" "" "" "SETBP1(NM_015559.2):c.3514G>C (p.(Gly1172Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001004115" "0" "30" "18" "42533181" "42533181" "subst" "2.04212E-5" "01804" "SETBP1_000100" "g.42533181C>G" "" "" "" "SETBP1(NM_015559.2):c.3876C>G (p.(Asp1292Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001004116" "0" "30" "18" "42533225" "42533225" "subst" "0" "01804" "SETBP1_000189" "g.42533225G>A" "" "" "" "SETBP1(NM_015559.2):c.3920G>A (p.(Gly1307Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001004117" "0" "30" "18" "42533252" "42533252" "subst" "0" "01804" "SETBP1_000190" "g.42533252C>A" "" "" "" "SETBP1(NM_015559.2):c.3947C>A (p.(Ala1316Asp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001004118" "0" "50" "18" "42618470" "42618470" "subst" "4.0624E-6" "01804" "SETBP1_000191" "g.42618470A>G" "" "" "" "SETBP1(NM_015559.2):c.4021A>G (p.(Lys1341Glu)), SETBP1(NM_015559.3):c.4021A>G (p.K1341E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001004119" "0" "30" "18" "42618581" "42618581" "subst" "0" "01804" "SETBP1_000192" "g.42618581T>G" "" "" "" "SETBP1(NM_015559.2):c.4132T>G (p.(Leu1378Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001015700" "0" "70" "18" "42531392" "42531393" "del" "0" "02325" "SETBP1_000193" "g.42531392_42531393del" "" "" "" "SETBP1(NM_015559.3):c.2087_2088delCA (p.P696Rfs*10)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001017824" "0" "70" "18" "42530898" "42530898" "del" "0" "03544" "SETBP1_000194" "g.42530898del" "" "" "" "" "" "De novo" "-" "" "0" "" "" "g.44950933del" "{CV:3383975}" "likely pathogenic" "ACMG" "0001029802" "0" "70" "18" "42531910" "42531910" "subst" "0" "04459" "SETBP1_000195" "g.42531910A>G" "" "" "" "" "" "De novo" "" "" "0" "" "" "g.44951945A>G" "" "likely pathogenic (dominant)" "" "0001042426" "0" "50" "18" "42259614" "42259614" "subst" "0" "01804" "SETBP1_000196" "g.42259614G>A" "" "" "" "SETBP1(NM_015559.3):c.-1545G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001042427" "0" "50" "18" "42456573" "42456573" "subst" "6.60136E-6" "01804" "SETBP1_000197" "g.42456573G>T" "" "" "" "SETBP1(NM_001130110.2):c.584G>T (p.(Gly195Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001042428" "0" "30" "18" "42456591" "42456591" "subst" "9.23507E-5" "01804" "SETBP1_000052" "g.42456591A>G" "" "" "" "SETBP1(NM_001130110.1):c.602A>G (p.K201R), SETBP1(NM_001130110.2):c.602A>G (p.(Lys201Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001042429" "0" "30" "18" "42456997" "42456997" "subst" "0" "01804" "SETBP1_000198" "g.42456997G>A" "" "" "" "SETBP1(NM_001130110.2):c.*279G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001042430" "0" "30" "18" "42530756" "42530756" "subst" "0" "01804" "SETBP1_000199" "g.42530756G>C" "" "" "" "SETBP1(NM_015559.3):c.1451G>C (p.(Gly484Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001042431" "0" "30" "18" "42531274" "42531274" "subst" "6.66522E-5" "01804" "SETBP1_000022" "g.42531274G>A" "" "" "" "SETBP1(NM_015559.3):c.1969G>A (p.V657M, p.(Val657Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001042432" "0" "30" "18" "42531403" "42531403" "subst" "0" "01804" "SETBP1_000200" "g.42531403C>T" "" "" "" "SETBP1(NM_015559.3):c.2098C>T (p.(Pro700Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001042433" "0" "30" "18" "42532096" "42532096" "subst" "1.62745E-5" "01804" "SETBP1_000201" "g.42532096G>A" "" "" "" "SETBP1(NM_015559.3):c.2791G>A (p.(Glu931Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001042434" "0" "30" "18" "42618979" "42618979" "subst" "0" "01804" "SETBP1_000202" "g.42618979A>C" "" "" "" "SETBP1(NM_015559.3):c.4171+359A>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001042435" "0" "30" "18" "42643471" "42643479" "del" "0" "01804" "SETBP1_000203" "g.42643471_42643479del" "" "" "" "SETBP1(NM_015559.3):c.4599_4607del (p.(Pro1535_Pro1537del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001042436" "0" "50" "18" "42643571" "42643585" "dup" "0" "01804" "SETBP1_000204" "g.42643571_42643585dup" "" "" "" "SETBP1(NM_015559.3):c.4699_4713dup (p.(Ser1567_Gln1571dup))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001046700" "0" "50" "18" "42618470" "42618470" "subst" "4.0624E-6" "02325" "SETBP1_000191" "g.42618470A>G" "" "" "" "SETBP1(NM_015559.2):c.4021A>G (p.(Lys1341Glu)), SETBP1(NM_015559.3):c.4021A>G (p.K1341E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001056321" "0" "30" "18" "42448863" "42448863" "subst" "0" "01804" "SETBP1_000205" "g.42448863A>G" "" "" "" "SETBP1(NM_015559.3):c.487-332A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001056322" "0" "50" "18" "42533123" "42533123" "subst" "4.0831E-6" "01804" "SETBP1_000206" "g.42533123C>T" "" "" "" "SETBP1(NM_015559.3):c.3818C>T (p.(Thr1273Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001056323" "0" "50" "18" "42618473" "42618473" "subst" "0" "01804" "SETBP1_000072" "g.42618473G>A" "" "" "" "SETBP1(NM_015559.3):c.4024G>A (p.(Val1342Met), p.V1342M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001056324" "0" "50" "18" "42643219" "42643219" "subst" "0" "01804" "SETBP1_000207" "g.42643219C>T" "" "" "" "SETBP1(NM_015559.3):c.4347C>T (p.(Phe1449=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001056325" "0" "50" "18" "42643487" "42643487" "subst" "0" "01804" "SETBP1_000208" "g.42643487C>A" "" "" "" "SETBP1(NM_015559.3):c.4615C>A (p.(Pro1539Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001059142" "0" "70" "18" "42531889" "42531889" "subst" "0" "00006" "SETBP1_000209" "g.42531889G>A" "" "{PMID:Retterer 2016:26633542}" "" "" "variants reported seperately, unknown if mono-allelic or bi-allelic" "Unknown" "" "" "0" "" "" "g.44951924G>A" "" "likely pathogenic" "" "0001066980" "0" "50" "18" "42281375" "42281375" "subst" "4.97512E-6" "01804" "chr18_003003" "g.42281375G>T" "" "" "" "SETBP1(NM_015559.3):c.64G>T (p.(Val22Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001066981" "0" "50" "18" "42530233" "42530233" "subst" "4.11479E-6" "02325" "chr18_003004" "g.42530233G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001066982" "0" "50" "18" "42530752" "42530752" "subst" "0" "01804" "chr18_003005" "g.42530752G>T" "" "" "" "SETBP1(NM_015559.3):c.1447G>T (p.(Gly483Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001066983" "0" "50" "18" "42531752" "42531752" "subst" "4.06547E-6" "02325" "chr18_003006" "g.42531752C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001066984" "0" "50" "18" "42531774" "42531774" "subst" "4.06455E-6" "01804" "chr18_003007" "g.42531774C>G" "" "" "" "SETBP1(NM_015559.3):c.2469C>G (p.(His823Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001066985" "0" "50" "18" "42531950" "42531950" "subst" "8.14286E-6" "01804" "chr18_003008" "g.42531950C>T" "" "" "" "SETBP1(NM_015559.3):c.2645C>T (p.(Ala882Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001066986" "0" "50" "18" "42532488" "42532488" "subst" "0" "02325" "SETBP1_000063" "g.42532488G>A" "" "" "" "SETBP1(NM_015559.2):c.3183G>A (p.(Met1061Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes SETBP1 ## Count = 248 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000079339" "00024168" "00" "2561" "0" "2561" "0" "c.2561C>G" "r.(?)" "p.(Ser854Cys)" "" "0000130289" "00024168" "90" "2602" "0" "2602" "0" "c.2602G>A" "r.(?)" "p.(Asp868Asn)" "" "0000223240" "00024168" "70" "681" "0" "682" "0" "c.681_682insTT" "r.(?)" "p.(Ser228Leufs*116)" "" "0000236390" "00024168" "90" "2671" "0" "2671" "0" "c.2671del" "r.(?)" "p.(Arg891Glyfs*70)" "" "0000249428" "00024168" "30" "3299" "0" "3299" "0" "c.3299A>G" "r.(?)" "p.(His1100Arg)" "" "0000255051" "00024168" "30" "4510" "0" "4510" "0" "c.4510A>T" "r.(?)" "p.(Thr1504Ser)" "" "0000256158" "00024168" "50" "846" "0" "846" "0" "c.846A>G" "r.(?)" "p.(Lys282=)" "" "0000298130" "00024168" "90" "1765" "0" "1765" "0" "c.1765C>T" "r.(?)" "p.(Arg589Ter)" "" "0000298131" "00024168" "30" "4161" "0" "4161" "0" "c.4161G>A" "r.(?)" "p.(Thr1387=)" "" "0000298132" "00024168" "10" "540" "7405" "540" "7405" "c.540+7405G>A" "r.(=)" "p.(=)" "" "0000298134" "00024168" "10" "691" "0" "691" "0" "c.691G>C" "r.(?)" "p.(Val231Leu)" "" "0000298135" "00024168" "30" "769" "0" "769" "0" "c.769G>A" "r.(?)" "p.(Val257Met)" "" "0000299426" "00024168" "90" "1730" "0" "1749" "0" "c.1730_1749del" "r.(?)" "p.(Leu577GlnfsTer20)" "" "0000299427" "00024168" "90" "1765" "0" "1765" "0" "c.1765C>T" "r.(?)" "p.(Arg589Ter)" "" "0000307921" "00024168" "10" "1491" "0" "1491" "0" "c.1491G>A" "r.(?)" "p.(Pro497=)" "" "0000307922" "00024168" "50" "1874" "0" "1874" "0" "c.1874G>A" "r.(?)" "p.(Arg625Gln)" "" "0000307923" "00024168" "50" "1969" "0" "1969" "0" "c.1969G>A" "r.(?)" "p.(Val657Met)" "" "0000307924" "00024168" "30" "4554" "0" "4554" "0" "c.4554G>A" "r.(?)" "p.(Glu1518=)" "" "0000307925" "00024168" "30" "757" "0" "757" "0" "c.757G>A" "r.(?)" "p.(Ala253Thr)" "" "0000325876" "00024168" "50" "2873" "0" "2873" "0" "c.2873A>G" "r.(?)" "p.(Glu958Gly)" "" "0000338062" "00024168" "10" "-811" "0" "-811" "0" "c.-811C>T" "r.(?)" "p.(=)" "" "0000338993" "00024168" "70" "757" "0" "757" "0" "c.757del" "r.(?)" "p.(Ala253LeufsTer90)" "" "0000340062" "00024168" "10" "1491" "0" "1491" "0" "c.1491G>A" "r.(?)" "p.(Pro497=)" "" "0000340063" "00024168" "10" "3618" "0" "3618" "0" "c.3618T>C" "r.(?)" "p.(His1206=)" "" "0000340064" "00024168" "10" "4131" "0" "4131" "0" "c.4131G>A" "r.(?)" "p.(Val1377=)" "" "0000341276" "00024168" "10" "540" "7405" "540" "7405" "c.540+7405G>A" "r.(=)" "p.(=)" "" "0000346308" "00024168" "90" "2609" "0" "2609" "0" "c.2609G>A" "r.(?)" "p.(Gly870Asp)" "" "0000346309" "00024168" "90" "2608" "0" "2608" "0" "c.2608G>A" "r.(?)" "p.(Gly870Ser)" "" "0000346817" "00024168" "90" "2612" "0" "2612" "0" "c.2612T>C" "r.(?)" "p.(Ile871Thr)" "" "0000349374" "00024168" "10" "540" "7422" "540" "7423" "c.540+7422_540+7423insTCTT" "r.(=)" "p.(=)" "" "0000350243" "00024168" "10" "3301" "0" "3301" "0" "c.3301G>A" "r.(?)" "p.(Val1101Ile)" "" "0000350285" "00024168" "10" "4129" "0" "4129" "0" "c.4129G>C" "r.(?)" "p.(Val1377Leu)" "" "0000351187" "00024168" "30" "541" "-8" "541" "-8" "c.541-8A>G" "r.(=)" "p.(=)" "" "0000368374" "00024168" "70" "3770" "0" "3800" "0" "c.3770_3800dup" "r.(?)" "p.(Gly1268Leufs*26)" "" "0000408759" "00024168" "90" "2612" "0" "2612" "0" "c.2612T>C" "r.(?)" "p.(Ile871Thr)" "4" "0000438188" "00024168" "95" "0" "0" "0" "0" "c.?" "r.(?)" "p.(Glu245*)" "?" "0000438189" "00024168" "95" "2602" "0" "2602" "0" "c.2602G>A" "r.(?)" "p.(Asp868Asn)" "?" "0000438190" "00024168" "95" "2602" "0" "2602" "0" "c.2602G>A" "r.(?)" "p.(Asp868Asn)" "?" "0000438191" "00024168" "95" "2602" "0" "2602" "0" "c.2602G>A" "r.(?)" "p.(Asp868Asn)" "?" "0000438192" "00024168" "95" "2602" "0" "2602" "0" "c.2602G>A" "r.(?)" "p.(Asp868Asn)" "?" "0000438193" "00024168" "95" "2603" "0" "2603" "0" "c.2603A>C" "r.(?)" "p.(Asp868Ala)" "?" "0000438194" "00024168" "95" "2608" "0" "2608" "0" "c.2608G>A" "r.(?)" "p.(Gly870Ser)" "?" "0000438195" "00024168" "95" "2609" "0" "2609" "0" "c.2609G>A" "r.(?)" "p.(Gly870Asp)" "?" "0000438196" "00024168" "95" "2612" "0" "2612" "0" "c.2612T>C" "r.(?)" "p.(Ile871Thr)" "?" "0000438197" "00024168" "95" "2612" "0" "2612" "0" "c.2612T>C" "r.(?)" "p.(Ile871Thr)" "?" "0000438198" "00024168" "95" "2612" "0" "2612" "0" "c.2612T>C" "r.(?)" "p.(Ile871Thr)" "?" "0000438199" "00024168" "95" "2612" "0" "2612" "0" "c.2612T>C" "r.(?)" "p.(Ile871Thr)" "?" "0000438200" "00024168" "95" "2612" "0" "2612" "0" "c.2612T>C" "r.(?)" "p.(Ile871Thr)" "?" "0000564757" "00024168" "90" "44" "0" "44" "0" "c.44del" "r.(?)" "p.(Gly15AlafsTer49)" "" "0000564758" "00024168" "30" "243" "0" "243" "0" "c.243G>A" "r.(?)" "p.(Val81=)" "" "0000564760" "00024168" "90" "440" "0" "440" "0" "c.440dup" "r.(?)" "p.(Asn147LysfsTer2)" "" "0000564761" "00024168" "50" "540" "7343" "540" "7343" "c.540+7343A>G" "r.(=)" "p.(=)" "" "0000564762" "00024168" "10" "540" "7422" "540" "7423" "c.540+7422_540+7423insTCTT" "r.(=)" "p.(=)" "" "0000564763" "00024168" "70" "540" "7444" "540" "7444" "c.540+7444C>T" "r.(=)" "p.(=)" "" "0000564764" "00024168" "30" "583" "0" "583" "0" "c.583A>C" "r.(?)" "p.(Thr195Pro)" "" "0000564766" "00024168" "30" "927" "0" "927" "0" "c.927C>T" "r.(?)" "p.(Asn309=)" "" "0000564767" "00024168" "30" "1481" "0" "1481" "0" "c.1481T>C" "r.(?)" "p.(Val494Ala)" "" "0000564769" "00024168" "50" "1933" "0" "1933" "0" "c.1933G>A" "r.(?)" "p.(Glu645Lys)" "" "0000564770" "00024168" "50" "1970" "0" "1970" "0" "c.1970T>C" "r.(?)" "p.(Val657Ala)" "" "0000564771" "00024168" "50" "1987" "0" "1987" "0" "c.1987A>G" "r.(?)" "p.(Ile663Val)" "" "0000564772" "00024168" "90" "2602" "0" "2602" "0" "c.2602G>A" "r.(?)" "p.(Asp868Asn)" "" "0000564773" "00024168" "90" "2630" "0" "2630" "0" "c.2630del" "r.(?)" "p.(Ser877ThrfsTer84)" "" "0000564774" "00024168" "30" "3183" "0" "3183" "0" "c.3183G>A" "r.(?)" "p.(Met1061Ile)" "" "0000564775" "00024168" "30" "3237" "0" "3237" "0" "c.3237T>C" "r.(?)" "p.(Leu1079=)" "" "0000564776" "00024168" "50" "3485" "0" "3485" "0" "c.3485G>A" "r.(?)" "p.(Arg1162Gln)" "" "0000564777" "00024168" "30" "3514" "0" "3514" "0" "c.3514G>C" "r.(?)" "p.(Gly1172Arg)" "" "0000564778" "00024168" "50" "3561" "0" "3561" "0" "c.3561C>G" "r.(?)" "p.(Ser1187Arg)" "" "0000564779" "00024168" "30" "3659" "0" "3659" "0" "c.3659A>G" "r.(?)" "p.(Lys1220Arg)" "" "0000564781" "00024168" "10" "3825" "0" "3825" "0" "c.3825A>G" "r.(?)" "p.(Ser1275=)" "" "0000564782" "00024168" "50" "3962" "0" "3962" "0" "c.3962G>A" "r.(?)" "p.(Arg1321His)" "" "0000564783" "00024168" "50" "4024" "0" "4024" "0" "c.4024G>A" "r.(?)" "p.(Val1342Met)" "" "0000564784" "00024168" "30" "4129" "0" "4129" "0" "c.4129G>C" "r.(?)" "p.(Val1377Leu)" "" "0000564786" "00024168" "30" "4554" "0" "4554" "0" "c.4554G>A" "r.(?)" "p.(Glu1518=)" "" "0000617155" "00024168" "30" "-315" "0" "-315" "0" "c.-315dup" "r.(?)" "p.(=)" "" "0000617156" "00024168" "90" "2982" "0" "2982" "0" "c.2982C>G" "r.(?)" "p.(Tyr994Ter)" "" "0000631977" "00024168" "90" "1781" "0" "1781" "0" "c.1781del" "r.(?)" "p.(Pro594Leufs*36)" "" "0000647197" "00024168" "90" "2608" "0" "2608" "0" "c.2608G>A" "r.(?)" "p.(Gly870Ser)" "4" "0000649812" "00024168" "10" "1879" "0" "1879" "0" "c.1879C>T" "r.(?)" "p.(Arg627Cys)" "" "0000649813" "00024168" "30" "9301" "0" "9301" "0" "c.*4510T>C" "r.(=)" "p.(=)" "" "0000667305" "00024168" "70" "1821" "0" "1821" "0" "c.1821del" "r.(?)" "p.(Ser608Alafs*22)" "" "0000681144" "00024168" "90" "726" "0" "726" "0" "c.726del" "r.(?)" "p.(Arg243GlufsTer100)" "" "0000681145" "00024168" "90" "1630" "0" "1630" "0" "c.1630C>T" "r.(?)" "p.(Arg544Ter)" "" "0000681146" "00024168" "30" "2679" "0" "2679" "0" "c.2679T>G" "r.(?)" "p.(Ser893=)" "" "0000681147" "00024168" "30" "4083" "0" "4083" "0" "c.4083G>A" "r.(?)" "p.(Arg1361=)" "" "0000683342" "00024168" "70" "1873" "0" "1873" "0" "c.1873C>T" "r.(?)" "p.(Arg625*)" "" "0000683633" "00024168" "50" "4306" "0" "4306" "0" "c.4306G>C" "r.(?)" "p.(Ala1436Pro)" "" "0000692595" "00024168" "70" "2854" "0" "2854" "0" "c.2854C>T" "r.(?)" "p.(Gln952Ter)" "" "0000699265" "00024168" "90" "1765" "0" "1765" "0" "c.1765C>T" "r.(?)" "p.(Arg589*)" "4" "0000699266" "00024168" "90" "2199" "0" "2203" "0" "c.2199_2203del" "r.(?)" "p.(Glu734Alafs*19)" "4" "0000699267" "00024168" "70" "2572" "0" "2572" "0" "c.2572G>A" "r.(?)" "p.(Glu858Lys)" "4" "0000699956" "00024168" "50" "671" "0" "671" "0" "c.671C>T" "r.(?)" "p.(Thr224Ile)" "4" "0000699979" "00024168" "90" "2044" "0" "2046" "0" "c.2044_2046delinsAT" "r.(?)" "p.(Leu682Ilefs*9)" "" "0000699981" "00024168" "30" "868" "0" "868" "0" "c.868G>T" "r.(?)" "p.(Ala290Ser)" "4" "0000699982" "00024168" "30" "3023" "0" "3023" "0" "c.3023G>A" "r.(?)" "p.(Arg1008His)" "4" "0000699983" "00024168" "50" "3227" "0" "3227" "0" "c.3227C>T" "r.(?)" "p.(Ser1076Leu)" "4" "0000699984" "00024168" "50" "3347" "0" "3347" "0" "c.3347A>G" "r.(?)" "p.(His1116Arg)" "4" "0000699985" "00024168" "50" "4037" "0" "4037" "0" "c.4037C>A" "r.(?)" "p.(Ala1346Glu)" "5" "0000699986" "00024168" "50" "1202" "0" "1202" "0" "c.1202G>A" "r.(?)" "p.(Arg401Gln)" "4" "0000699990" "00024168" "30" "3876" "0" "3876" "0" "c.3876C>G" "r.(?)" "p.(Asp1292Glu)" "4" "0000701793" "00024168" "70" "1765" "0" "1765" "0" "c.1765C>T" "r.(?)" "p.(Arg589*)" "4" "0000704186" "00024168" "70" "3151" "0" "3151" "0" "c.3151dup" "r.(?)" "p.(Tyr1051LeufsTer58)" "" "0000708508" "00024168" "10" "691" "0" "691" "0" "c.691G>C" "r.(?)" "p.(Val231Leu)" "4" "0000708509" "00024168" "10" "1169" "0" "1169" "0" "c.1169C>T" "r.(?)" "p.(Ala390Val)" "4" "0000708510" "00024168" "50" "1879" "0" "1879" "0" "c.1879C>T" "r.(?)" "p.(Arg627Cys)" "4" "0000708511" "00024168" "10" "1911" "0" "1911" "0" "c.1911G>A" "r.(?)" "p.(Pro637=)" "4" "0000708512" "00024168" "10" "1932" "0" "1932" "0" "c.1932C>T" "r.(?)" "p.(Ser644=)" "4" "0000708513" "00024168" "10" "2607" "0" "2607" "0" "c.2607C>T" "r.(?)" "p.(Ser869=)" "4" "0000708514" "00024168" "50" "2873" "0" "2873" "0" "c.2873A>G" "r.(?)" "p.(Glu958Gly)" "4" "0000708515" "00024168" "50" "3199" "0" "3199" "0" "c.3199G>A" "r.(?)" "p.(Gly1067Ser)" "4" "0000708516" "00024168" "10" "3301" "0" "3301" "0" "c.3301G>A" "r.(?)" "p.(Val1101Ile)" "4" "0000708517" "00024168" "10" "3372" "0" "3372" "0" "c.3372C>T" "r.(?)" "p.(Gly1124=)" "4" "0000708518" "00024168" "50" "3388" "0" "3388" "0" "c.3388C>A" "r.(?)" "p.(Pro1130Thr)" "4" "0000708519" "00024168" "30" "3726" "0" "3726" "0" "c.3726G>C" "r.(?)" "p.(Trp1242Cys)" "4" "0000708520" "00024168" "10" "3825" "0" "3825" "0" "c.3825A>G" "r.(?)" "p.(Ser1275=)" "4" "0000708521" "00024168" "10" "4010" "0" "4010" "0" "c.4010G>C" "r.(?)" "p.(Ser1337Thr)" "5" "0000708522" "00024168" "50" "4398" "0" "4398" "0" "c.4398G>T" "r.(?)" "p.(Glu1466Asp)" "6" "0000708523" "00024168" "10" "4563" "0" "4563" "0" "c.4563C>G" "r.(?)" "p.(Pro1521=)" "6" "0000708524" "00024168" "50" "4577" "0" "4577" "0" "c.4577C>A" "r.(?)" "p.(Pro1526Gln)" "6" "0000708525" "00024168" "30" "4673" "0" "4673" "0" "c.4673A>T" "r.(?)" "p.(Gln1558Leu)" "6" "0000708551" "00024168" "90" "1876" "0" "1876" "0" "c.1876C>T" "r.(?)" "p.(Arg626*)" "" "0000708552" "00024168" "90" "1873" "0" "1873" "0" "c.1873C>T" "r.(?)" "p.(Arg625*)" "" "0000708553" "00024168" "90" "2044" "0" "2046" "0" "c.2044_2046delinsAT" "r.(?)" "p.(Leu682Ilefs*9)" "" "0000708554" "00024168" "90" "1873" "0" "1873" "0" "c.1873C>T" "r.(?)" "p.(Arg625*)" "" "0000708555" "00024168" "90" "407" "0" "408" "0" "c.407_408del" "r.(?)" "p.(Ser136Trpfs*12)" "" "0000708556" "00024168" "90" "2716" "0" "2717" "0" "c.2716_2717insGG" "r.(?)" "p.(Pro906Argfs*56)" "" "0000708557" "00024168" "90" "3765" "0" "3765" "0" "c.3765dup" "r.(?)" "p.(Val1256Cysfs*28)" "" "0000708558" "00024168" "90" "2156" "0" "2156" "0" "c.2156del" "r.(?)" "p.(Gly719Glufs*65)" "" "0000708559" "00024168" "90" "2076" "0" "2092" "0" "c.2076_2092delinsC" "r.(?)" "p.(Lys693Profs*86)" "" "0000708560" "00024168" "90" "3801" "0" "3801" "0" "c.3801dup" "r.(?)" "p.(Gly1267Alafs*17)" "" "0000708561" "00024168" "90" "755" "0" "756" "0" "c.755_756delinsT" "r.(?)" "p.(Pro252Leufs*91)" "" "0000708562" "00024168" "90" "1630" "0" "1630" "0" "c.1630C>T" "r.(?)" "p.(Arg544*)" "" "0000708563" "00024168" "90" "1633" "0" "1633" "0" "c.1633G>T" "r.(?)" "p.(Glu545*)" "" "0000708564" "00024168" "90" "1568" "0" "1568" "0" "c.1568del" "r.(?)" "p.(His523Leufs*32)" "" "0000708565" "00024168" "90" "1873" "0" "1873" "0" "c.1873C>T" "r.(?)" "p.(Arg625*)" "" "0000708566" "00024168" "90" "1676" "0" "1676" "0" "c.1676del" "r.(?)" "p.(Pro559Argfs*21)" "" "0000708567" "00024168" "90" "821" "0" "821" "0" "c.821G>A" "r.(?)" "p.(Trp274*)" "" "0000708568" "00024168" "90" "1777" "0" "1777" "0" "c.1777C>T" "r.(?)" "p.(Gln593*)" "" "0000708569" "00024168" "90" "541" "-10397" "4000" "34535" "c.(?_541-10397)_(4000+34535_?)del" "r.?" "p.?" "" "0000708570" "00024168" "90" "726" "0" "732" "0" "c.726_732del" "r.(?)" "p.(Arg243Leufs*98)" "" "0000708571" "00024168" "90" "453" "0" "454" "0" "c.453_454insTGGG" "r.(?)" "p.(Lys152Trpfs*18)" "" "0000708572" "00024168" "90" "2982" "0" "2982" "0" "c.2982C>G" "r.(?)" "p.(Tyr994*)" "" "0000708573" "00024168" "90" "3120" "0" "3120" "0" "c.3120C>A" "r.(?)" "p.(Tyr1040*)" "" "0000708574" "00024168" "90" "2665" "0" "2665" "0" "c.2665C>T" "r.(?)" "p.(Arg889*)" "" "0000708575" "00024168" "90" "2464" "0" "2464" "0" "c.2464del" "r.(?)" "p.(Ile822Tyrfs*13)" "" "0000708576" "00024168" "90" "1231" "0" "1232" "0" "c.1231_1232del" "r.(?)" "p.(Leu411Glyfs*6)" "" "0000708577" "00024168" "90" "1873" "0" "1873" "0" "c.1873C>T" "r.(?)" "p.(Arg625*)" "" "0000708578" "00024168" "90" "39" "0" "40" "0" "c.39_40del" "r.(?)" "p.(Gly15Argfs*47)" "" "0000708579" "00024168" "90" "1596" "0" "1596" "0" "c.1596G>A" "r.(?)" "p.(Trp532*)" "" "0000708580" "00024168" "90" "427" "0" "427" "0" "c.427del" "r.(?)" "p.(Arg143Valfs*64)" "" "0000708581" "00024168" "90" "1774" "0" "1774" "0" "c.1774A>T" "r.(?)" "p.(Lys592*)" "" "0000708582" "00024168" "90" "" "0" "" "0" "c.(?_2938)_*4812{0}" "r.?" "p.?" "" "0000708583" "00024168" "90" "" "0" "" "0" "c.-296_*4812{0}" "r.0" "p.0" "_1_6_" "0000708584" "00024168" "90" "" "0" "" "0" "c.-296_*4812{0}" "r.0" "p.0" "_1_6_" "0000726882" "00024168" "90" "89" "0" "98" "0" "c.89_98dup" "r.(?)" "p.(Ala34Serfs*32)" "" "0000726883" "00024168" "50" "2591" "0" "2591" "0" "c.2591C>A" "r.(?)" "p.(Thr864Lys)" "" "0000736495" "00024168" "90" "2372" "0" "2387" "0" "c.2372_2387del" "r.(?)" "p.(Ser791LysfsTer7)" "" "0000760893" "00024168" "90" "1588" "0" "1588" "0" "c.1588C>T" "r.(?)" "p.(Arg530*)" "" "0000760894" "00024168" "90" "0" "0" "0" "0" "c.-296_*4812{0}" "r.0" "p.0" "_1_6_" "0000760895" "00024168" "90" "1408" "0" "1408" "0" "c.1408del" "r.(?)" "p.(Met470*)" "" "0000760896" "00024168" "90" "337" "0" "337" "0" "c.337del" "r.(?)" "p.(Ala113Leufs*94)" "" "0000760897" "00024168" "90" "422" "0" "422" "0" "c.422dup" "r.(?)" "p.(Arg142Valfs*7)" "" "0000760898" "00024168" "90" "0" "0" "0" "0" "c.-296_*4812{0}" "r.0" "p.0" "_1_6_" "0000760899" "00024168" "90" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Gln135*)" "" "0000763092" "00024168" "70" "2917" "0" "2917" "0" "c.2917A>T" "r.(?)" "p.(Ser973Cys)" "" "0000787513" "00024168" "50" "2935" "0" "2935" "0" "c.2935G>A" "r.(?)" "p.(Glu979Lys)" "4" "0000795109" "00024168" "50" "4565" "0" "4565" "0" "c.4565delinsGGC" "r.(?)" "p.(Leu1522Argfs*59)" "" "0000808485" "00024168" "30" "161" "0" "161" "0" "c.161G>A" "r.(?)" "p.(Arg54His)" "" "0000808486" "00024168" "30" "575" "0" "575" "0" "c.575A>G" "r.(?)" "p.(His192Arg)" "" "0000808487" "00024168" "30" "927" "0" "927" "0" "c.927C>T" "r.(?)" "p.(Asn309=)" "" "0000808488" "00024168" "90" "1264" "0" "1264" "0" "c.1264C>T" "r.(?)" "p.(Gln422*)" "" "0000817809" "00024168" "50" "548" "0" "548" "0" "c.548A>G" "r.(?)" "p.(Glu183Gly)" "" "0000823710" "00024168" "70" "2800" "0" "2800" "0" "c.2800A>T" "r.(?)" "p.(Lys934*)" "" "0000836780" "00024168" "70" "1630" "0" "1630" "0" "c.1630C>T" "r.(?)" "p.(Arg544*)" "" "0000855300" "00024168" "50" "385" "0" "385" "0" "c.385A>G" "r.(?)" "p.(Ile129Val)" "" "0000855301" "00024168" "30" "1248" "0" "1248" "0" "c.1248T>C" "r.(?)" "p.(His416=)" "" "0000855302" "00024168" "50" "3259" "0" "3259" "0" "c.3259A>G" "r.(?)" "p.(Arg1087Gly)" "" "0000855303" "00024168" "30" "3299" "0" "3299" "0" "c.3299A>G" "r.(?)" "p.(His1100Arg)" "" "0000865685" "00024168" "30" "1490" "0" "1490" "0" "c.1490C>T" "r.(?)" "p.(Pro497Leu)" "" "0000865686" "00024168" "30" "4589" "0" "4589" "0" "c.4589T>C" "r.(?)" "p.(Leu1530Pro)" "" "0000877959" "00024168" "50" "4151" "0" "4151" "0" "c.4151C>G" "r.(?)" "p.(Ser1384Cys)" "" "0000894565" "00024168" "10" "3576" "0" "3576" "0" "c.3576C>T" "r.(?)" "p.(Ser1192=)" "" "0000909294" "00024168" "90" "740" "0" "740" "0" "c.740del" "r.(?)" "p.(Ser247Thrfs*96)" "" "0000926743" "00024168" "50" "200" "0" "200" "0" "c.200G>T" "r.(?)" "p.(Arg67Leu)" "" "0000935938" "00024168" "90" "2572" "0" "2572" "0" "c.2572G>A" "r.(?)" "p.(Glu858Lys)" "" "0000935986" "00024168" "70" "1247" "0" "1247" "0" "c.1247A>G" "r.(?)" "p.(His416Arg)" "" "0000951134" "00024168" "90" "2269" "0" "2269" "0" "c.2269del" "r.(?)" "p.(Asp757Metfs*27)" "" "0000969404" "00024168" "30" "540" "5" "540" "5" "c.540+5G>C" "r.spl?" "p.?" "" "0000983041" "00024168" "90" "39" "0" "40" "0" "c.39_40del" "r.(?)" "p.(Gly15ArgfsTer47)" "" "0000983042" "00024168" "30" "1873" "0" "1873" "0" "c.1873C>A" "r.(?)" "p.(=)" "" "0000983043" "00024168" "50" "2267" "0" "2267" "0" "c.2267C>T" "r.(?)" "p.(Pro756Leu)" "" "0000983044" "00024168" "50" "4163" "0" "4163" "0" "c.4163C>T" "r.(?)" "p.(Ser1388Leu)" "" "0000985194" "00024168" "70" "2564" "0" "2564" "0" "c.2564C>T" "r.(?)" "p.(Pro855Leu)" "4" "0001004092" "00024168" "30" "46" "0" "46" "0" "c.46G>A" "r.(?)" "p.(Glu16Lys)" "" "0001004093" "00024168" "30" "540" "7346" "540" "7346" "c.540+7346A>G" "r.(=)" "p.(=)" "" "0001004094" "00024168" "30" "540" "7375" "540" "7375" "c.540+7375T>C" "r.(=)" "p.(=)" "" "0001004095" "00024168" "50" "540" "7412" "540" "7412" "c.540+7412C>G" "r.(=)" "p.(=)" "" "0001004096" "00024168" "50" "608" "0" "608" "0" "c.608G>A" "r.(?)" "p.(Gly203Asp)" "" "0001004097" "00024168" "50" "1061" "0" "1061" "0" "c.1061G>C" "r.(?)" "p.(Trp354Ser)" "" "0001004098" "00024168" "30" "1117" "0" "1117" "0" "c.1117T>G" "r.(?)" "p.(Ser373Ala)" "" "0001004099" "00024168" "30" "1210" "0" "1210" "0" "c.1210A>G" "r.(?)" "p.(Ile404Val)" "" "0001004100" "00024168" "30" "1426" "0" "1426" "0" "c.1426C>T" "r.(?)" "p.(Pro476Ser)" "" "0001004101" "00024168" "30" "1490" "0" "1490" "0" "c.1490C>T" "r.(?)" "p.(Pro497Leu)" "" "0001004102" "00024168" "50" "1502" "0" "1502" "0" "c.1502C>T" "r.(?)" "p.(Pro501Leu)" "" "0001004103" "00024168" "30" "1516" "0" "1516" "0" "c.1516C>G" "r.(?)" "p.(Pro506Ala)" "" "0001004104" "00024168" "30" "1933" "0" "1933" "0" "c.1933G>A" "r.(?)" "p.(Glu645Lys)" "" "0001004105" "00024168" "50" "1958" "0" "1958" "0" "c.1958G>A" "r.(?)" "p.(Gly653Glu)" "" "0001004106" "00024168" "30" "1970" "0" "1970" "0" "c.1970T>C" "r.(?)" "p.(Val657Ala)" "" "0001004107" "00024168" "70" "2289" "0" "2289" "0" "c.2289del" "r.(?)" "p.(Asn764Thrfs*20)" "" "0001004108" "00024168" "50" "2581" "0" "2581" "0" "c.2581A>G" "r.(?)" "p.(Ser861Gly)" "" "0001004109" "00024168" "30" "2824" "0" "2824" "0" "c.2824C>T" "r.(?)" "p.(Arg942Trp)" "" "0001004110" "00024168" "50" "3017" "0" "3017" "0" "c.3017A>G" "r.(?)" "p.(Tyr1006Cys)" "" "0001004111" "00024168" "30" "3083" "0" "3083" "0" "c.3083C>G" "r.(?)" "p.(Thr1028Ser)" "" "0001004112" "00024168" "70" "3104" "0" "3104" "0" "c.3104T>A" "r.(?)" "p.(Leu1035*)" "" "0001004113" "00024168" "30" "3427" "0" "3427" "0" "c.3427T>C" "r.(?)" "p.(Ser1143Pro)" "" "0001004114" "00024168" "30" "3514" "0" "3514" "0" "c.3514G>C" "r.(?)" "p.(Gly1172Arg)" "" "0001004115" "00024168" "30" "3876" "0" "3876" "0" "c.3876C>G" "r.(?)" "p.(Asp1292Glu)" "" "0001004116" "00024168" "30" "3920" "0" "3920" "0" "c.3920G>A" "r.(?)" "p.(Gly1307Glu)" "" "0001004117" "00024168" "30" "3947" "0" "3947" "0" "c.3947C>A" "r.(?)" "p.(Ala1316Asp)" "" "0001004118" "00024168" "50" "4021" "0" "4021" "0" "c.4021A>G" "r.(?)" "p.(Lys1341Glu)" "" "0001004119" "00024168" "30" "4132" "0" "4132" "0" "c.4132T>G" "r.(?)" "p.(Leu1378Val)" "" "0001015700" "00024168" "70" "2087" "0" "2088" "0" "c.2087_2088del" "r.(?)" "p.(Pro696Argfs*10)" "" "0001017824" "00024168" "70" "1593" "0" "1593" "0" "c.1593del" "r.(?)" "p.(Arg531Serfs*24)" "4" "0001029802" "00024168" "70" "2605" "0" "2605" "0" "c.2605A>G" "r.(?)" "p.(Ser869Gly)" "" "0001042426" "00024168" "50" "-1545" "0" "-1545" "0" "c.-1545G>A" "r.(?)" "p.(=)" "" "0001042427" "00024168" "50" "540" "7325" "540" "7325" "c.540+7325G>T" "r.(=)" "p.(=)" "" "0001042428" "00024168" "30" "540" "7343" "540" "7343" "c.540+7343A>G" "r.(=)" "p.(=)" "" "0001042429" "00024168" "30" "540" "7749" "540" "7749" "c.540+7749G>A" "r.(=)" "p.(=)" "" "0001042430" "00024168" "30" "1451" "0" "1451" "0" "c.1451G>C" "r.(?)" "p.(Gly484Ala)" "" "0001042431" "00024168" "30" "1969" "0" "1969" "0" "c.1969G>A" "r.(?)" "p.(Val657Met)" "" "0001042432" "00024168" "30" "2098" "0" "2098" "0" "c.2098C>T" "r.(?)" "p.(Pro700Ser)" "" "0001042433" "00024168" "30" "2791" "0" "2791" "0" "c.2791G>A" "r.(?)" "p.(Glu931Lys)" "" "0001042434" "00024168" "30" "4171" "359" "4171" "359" "c.4171+359A>C" "r.(=)" "p.(=)" "" "0001042435" "00024168" "30" "4599" "0" "4607" "0" "c.4599_4607del" "r.(?)" "p.(Pro1535_Pro1537del)" "" "0001042436" "00024168" "50" "4699" "0" "4713" "0" "c.4699_4713dup" "r.(?)" "p.(Ser1567_Gln1571dup)" "" "0001046700" "00024168" "50" "4021" "0" "4021" "0" "c.4021A>G" "r.(?)" "p.(Lys1341Glu)" "" "0001056321" "00024168" "30" "487" "-332" "487" "-332" "c.487-332A>G" "r.(=)" "p.(=)" "" "0001056322" "00024168" "50" "3818" "0" "3818" "0" "c.3818C>T" "r.(?)" "p.(Thr1273Met)" "" "0001056323" "00024168" "50" "4024" "0" "4024" "0" "c.4024G>A" "r.(?)" "p.(Val1342Met)" "" "0001056324" "00024168" "50" "4347" "0" "4347" "0" "c.4347C>T" "r.(?)" "p.(=)" "" "0001056325" "00024168" "50" "4615" "0" "4615" "0" "c.4615C>A" "r.(?)" "p.(Pro1539Thr)" "" "0001059142" "00024168" "70" "2584" "0" "2584" "0" "c.2584G>A" "r.(?)" "p.(Glu862Lys)" "" "0001066980" "00024168" "50" "64" "0" "64" "0" "c.64G>T" "r.(?)" "p.(Val22Phe)" "" "0001066981" "00024168" "50" "928" "0" "928" "0" "c.928G>A" "r.(?)" "p.(Gly310Arg)" "" "0001066982" "00024168" "50" "1447" "0" "1447" "0" "c.1447G>T" "r.(?)" "p.(Gly483Cys)" "" "0001066983" "00024168" "50" "2447" "0" "2447" "0" "c.2447C>A" "r.(?)" "p.(Thr816Asn)" "" "0001066984" "00024168" "50" "2469" "0" "2469" "0" "c.2469C>G" "r.(?)" "p.(His823Gln)" "" "0001066985" "00024168" "50" "2645" "0" "2645" "0" "c.2645C>T" "r.(?)" "p.(Ala882Val)" "" "0001066986" "00024168" "50" "3183" "0" "3183" "0" "c.3183G>A" "r.(?)" "p.(Met1061Ile)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 113 "{{screeningid}}" "{{variantid}}" "0000050359" "0000079339" "0000081203" "0000130289" "0000133812" "0000223240" "0000145291" "0000236390" "0000164772" "0000368374" "0000184636" "0000408759" "0000208354" "0000438188" "0000208355" "0000438189" "0000208356" "0000438190" "0000208357" "0000438191" "0000208358" "0000438192" "0000208359" "0000438193" "0000208360" "0000438194" "0000208361" "0000438195" "0000208362" "0000438196" "0000208363" "0000438197" "0000208364" "0000438198" "0000208365" "0000438199" "0000208366" "0000438200" "0000277027" "0000631977" "0000290514" "0000647197" "0000293123" "0000649812" "0000293124" "0000649813" "0000303785" "0000701793" "0000303903" "0000667305" "0000308908" "0000683342" "0000309153" "0000683633" "0000317080" "0000699265" "0000317081" "0000699266" "0000317082" "0000699267" "0000317373" "0000699956" "0000317374" "0000699979" "0000317376" "0000699981" "0000317377" "0000699982" "0000317378" "0000699983" "0000317379" "0000699984" "0000317380" "0000699985" "0000317382" "0000699986" "0000317384" "0000699990" "0000321357" "0000704186" "0000325498" "0000708508" "0000325499" "0000708509" "0000325500" "0000708510" "0000325501" "0000708511" "0000325502" "0000708512" "0000325503" "0000708513" "0000325504" "0000708514" "0000325505" "0000708515" "0000325506" "0000708516" "0000325507" "0000708517" "0000325508" "0000708518" "0000325509" "0000708519" "0000325510" "0000708520" "0000325511" "0000708521" "0000325512" "0000708522" "0000325513" "0000708523" "0000325514" "0000708524" "0000325515" "0000708525" "0000325536" "0000708551" "0000325537" "0000708552" "0000325538" "0000708553" "0000325539" "0000708554" "0000325540" "0000708555" "0000325541" "0000708556" "0000325542" "0000708557" "0000325543" "0000708558" "0000325544" "0000708559" "0000325545" "0000708560" "0000325546" "0000708561" "0000325547" "0000708562" "0000325548" "0000708563" "0000325549" "0000708564" "0000325550" "0000708565" "0000325551" "0000708566" "0000325552" "0000708567" "0000325553" "0000708568" "0000325554" "0000708569" "0000325555" "0000708570" "0000325556" "0000708571" "0000325557" "0000708572" "0000325558" "0000708573" "0000325559" "0000708574" "0000325560" "0000708575" "0000325561" "0000708576" "0000325562" "0000708577" "0000325563" "0000708578" "0000325564" "0000708579" "0000325565" "0000708580" "0000325566" "0000708581" "0000325567" "0000708582" "0000325568" "0000708583" "0000325569" "0000708584" "0000336955" "0000736495" "0000360785" "0000760893" "0000360786" "0000760894" "0000360787" "0000760895" "0000360788" "0000760896" "0000360789" "0000760897" "0000360790" "0000760898" "0000360791" "0000760899" "0000362718" "0000763092" "0000375629" "0000787513" "0000381614" "0000795109" "0000389016" "0000817809" "0000393100" "0000823710" "0000402550" "0000836780" "0000429692" "0000909294" "0000439809" "0000935938" "0000439857" "0000935986" "0000451340" "0000985194" "0000459719" "0001017824" "0000465990" "0001029802" "0000471020" "0001059142"