### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = SF3B2) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "SF3B2" "splicing factor 3b, subunit 2, 145kDa" "11" "q13" "unknown" "NC_000011.9" "UD_132465725127" "" "https://www.LOVD.nl/SF3B2" "" "1" "10769" "10992" "605591" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was performed by Johan den Dunnen, supported by Global Variome." "" "" "" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2025-10-09 16:41:54" "00000" "2026-01-20 18:57:21" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00018767" "SF3B2" "splicing factor 3b, subunit 2, 145kDa" "001" "NM_006842.2" "" "NP_006833.2" "" "" "" "-40" "2854" "2688" "65819816" "65836382" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 4 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "04254" "CLP" "cleft lip, cleft palate (CLP)" "" "" "" "" "" "00006" "2015-05-08 09:59:28" "00006" "2015-05-08 10:00:15" "05219" "CFM1;HFM" "craniofacial microsomia (Goldenhar syndrome)" "AD" "164210" "" "" "" "00006" "2017-01-26 22:15:05" "00006" "2025-10-09 16:45:37" "05611" "NDD" "neurodevelopmental disorder (NDD)" "" "" "" "" "" "00006" "2019-06-19 12:27:20" "00006" "2024-12-13 11:12:21" "06906" "DEE" "encephalopathy, developmental and epileptic" "" "" "" "" "" "00006" "2022-04-07 09:24:23" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 1 "{{geneid}}" "{{diseaseid}}" "SF3B2" "05219" ## Individuals ## Do not remove or alter this header ## ## Count = 3 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00415243" "" "" "" "1" "" "00006" "{PMID:Ziegler 2022:35858628}, {DOI:Ziegler 2022:10.1016/j.ajhg.2022.06.010}" "brother" "M" "" "Bosnia and Herzegovina;Croatia (Hrvatska)" "" "0" "" "" "Bosnia" "Fam2Pat3" "00438621" "" "" "" "1" "" "00006" "{PMID:Hamdan 2017:29100083}" "WGS analysis 197 individuals with unexplained DEE (unaffected parents)" "" "" "Canada" "" "0" "" "pharmaco-resistant seizures" "" "HSC0096" "00467265" "" "" "" "1" "" "04760" "CLP-972-3" "" "M" "no" "" "" "" "" "" "" "CLP-972-3" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 3 "{{individualid}}" "{{diseaseid}}" "00415243" "05611" "00438621" "06906" "00467265" "04254" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 04254, 05219, 05611, 06906 ## Count = 3 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "0000307041" "05611" "00415243" "00006" "Familial, autosomal recessive" "17y" "birth 40w, weight 4,210 g (+1.05 SD), length 55 cm (+2 SD), ; no neonatal problems; 15y9m-height 146.5 cm (-3.28 SD), weight 29.2 kg (-4.42 SD), OFC 47.4 cm (-5.98 SD); 29m-sit; 4y9m-walk; no speech; happy demeanor; generalized epilepsy, 11y-drop attacks, 15y-myoclonus, 16y-fever-associated focal seizures then generalized seizures; hypotonia, truncal ataxia; MRI brain 2y-hypomyelination, corpus callosum hypoplasia; ECG atrioventricular block type 1, reduced ventricular function with EF 0.82, Holter ECG; monomorphic ventricular extasystolia, shortened PQ period under effort; strabismus convergens, 16y-ablatio retinae left with unilateral amaurosis; recurrent infections (pneumonia)" "" "" "" "" "" "" "" "" "neurodevelopmental delay" "0000328524" "06906" "00438621" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "developmental and epileptic encephalopathy" "0000352472" "04254" "00467265" "04760" "Isolated (sporadic)" "14y" "complete cleft palate" "" "" "" "" "" "" "" "" "" ## Screenings ## Do not remove or alter this header ## ## Count = 3 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000416525" "00415243" "1" "00006" "00006" "2022-08-10 16:14:56" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000440103" "00438621" "1" "00006" "00006" "2023-10-21 19:20:17" "" "" "SEQ;SEQ-NG" "DNA" "" "WGS" "0000468928" "00467265" "1" "04760" "04760" "2025-10-09 15:26:48" "" "" "SEQ-NG" "DNA" "" "WES (whole exome sequencing)" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 0 ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 36 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000266496" "0" "10" "11" "65790527" "65790527" "subst" "0.514662" "02325" "CATSPER1_000002" "g.65790527G>T" "" "" "" "CATSPER1(NM_053054.4):c.1222C>A (p.R408=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.66023056G>T" "" "benign" "" "0000266497" "0" "10" "11" "65788072" "65788072" "subst" "0.981389" "02325" "CATSPER1_000001" "g.65788072C>T" "" "" "" "CATSPER1(NM_053054.4):c.1954G>A (p.V652I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.66020601C>T" "" "benign" "" "0000266498" "0" "10" "11" "65793454" "65793454" "subst" "0.31185" "02325" "CATSPER1_000003" "g.65793454C>T" "" "" "" "CATSPER1(NM_053054.4):c.397G>A (p.G133S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.66025983C>T" "" "benign" "" "0000304903" "0" "50" "11" "65838263" "65838263" "subst" "0" "01943" "PACS1_000005" "g.65838263C>A" "" "" "" "PACS1(NM_018026.3):c.306C>A (p.N102K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.66070792C>A" "" "VUS" "" "0000322316" "0" "30" "11" "65810948" "65810948" "subst" "5.01199E-5" "01804" "GAL3ST3_000001" "g.65810948C>T" "" "" "" "GAL3ST3(NM_033036.2):c.326G>A (p.(Arg109His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.66043477C>T" "" "likely benign" "" "0000545048" "0" "30" "11" "65790365" "65790365" "subst" "4.06068E-6" "01943" "CATSPER1_000005" "g.65790365C>G" "" "" "" "CATSPER1(NM_053054.3):c.1384G>C (p.V462L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.66022894C>G" "" "likely benign" "" "0000545053" "0" "30" "11" "65838061" "65838061" "subst" "0" "01804" "PACS1_000014" "g.65838061A>C" "" "" "" "PACS1(NM_018026.3):c.104A>C (p.Q35P, p.(Gln35Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.66070590A>C" "" "likely benign" "" "0000545054" "0" "30" "11" "65838229" "65838229" "subst" "0" "01804" "PACS1_000015" "g.65838229G>C" "" "" "" "PACS1(NM_018026.3):c.272G>C (p.(Gly91Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.66070758G>C" "" "likely benign" "" "0000613575" "0" "30" "11" "65838073" "65838078" "dup" "0" "01804" "PACS1_000019" "g.65838073_65838078dup" "" "" "" "PACS1(NM_018026.3):c.101_102insGCAGCA (p.(Gln39_Gln40dup))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.66070602_66070607dup" "" "likely benign" "" "0000723592" "0" "50" "11" "65838061" "65838081" "dup" "0" "02325" "PACS1_000022" "g.65838061_65838081dup" "" "" "" "PACS1(NM_018026.4):c.104_124dupAGCAGCAGCAGCAGCAGCCGC (p.Q35_P41dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000723593" "0" "50" "11" "65838163" "65838163" "subst" "5.00636E-6" "02329" "PACS1_000003" "g.65838163C>T" "" "" "" "PACS1(NM_018026.4):c.206C>T (p.S69F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000853094" "0" "30" "11" "65822606" "65822606" "subst" "0" "02330" "CATSPER1_000007" "g.65822606G>A" "" "" "" "SF3B2(NM_006842.3):c.318G>A (p.P106=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000853095" "0" "30" "11" "65829457" "65829457" "subst" "0.00472482" "02330" "SF3B2_000001" "g.65829457G>A" "" "" "" "SF3B2(NM_006842.3):c.1965G>A (p.S655=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000862638" "0" "10" "11" "65835675" "65835675" "subst" "0.00256498" "02330" "PACS1_000024" "g.65835675G>A" "" "" "" "SF3B2(NM_006842.3):c.2487G>A (p.A829=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000862639" "0" "30" "11" "65838061" "65838061" "subst" "0" "01943" "PACS1_000014" "g.65838061A>C" "" "" "" "PACS1(NM_018026.3):c.104A>C (p.Q35P, p.(Gln35Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000874705" "0" "50" "11" "65826339" "65826339" "subst" "0" "00006" "SF3B2_000002" "g.65826339G>T" "" "{PMID:Ziegler 2022:35858628}, {DOI:Ziegler 2022:10.1016/j.ajhg.2022.06.010}" "" "" "" "De novo" "no" "" "0" "" "" "" "" "VUS" "" "0000890081" "0" "30" "11" "65824765" "65824765" "subst" "4.47431E-5" "02330" "CATSPER1_000008" "g.65824765C>T" "" "" "" "SF3B2(NM_006842.3):c.696C>T (p.P232=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000890082" "0" "10" "11" "65829174" "65829174" "subst" "0.00325675" "02330" "SF3B2_000003" "g.65829174A>G" "" "" "" "SF3B2(NM_006842.3):c.1797A>G (p.T599=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000890083" "0" "30" "11" "65829479" "65829479" "subst" "0" "02330" "SF3B2_000004" "g.65829479G>T" "" "" "" "SF3B2(NM_006842.3):c.1977+10G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000913662" "0" "30" "11" "65822645" "65822645" "subst" "5.35862E-5" "02330" "CATSPER1_000009" "g.65822645T>C" "" "" "" "SF3B2(NM_006842.3):c.357T>C (p.F119=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000936404" "0" "50" "11" "65824808" "65824808" "subst" "8.14624E-6" "00006" "SF3B2_000005" "g.65824808C>T" "" "{PMID:Hamdan 2017:29100083}" "" "NM_006842:c.C739T (R247C)" "" "De novo" "" "" "0" "" "" "" "" "VUS" "" "0000979757" "0" "30" "11" "65835612" "65835612" "subst" "2.03495E-5" "01804" "PACS1_000030" "g.65835612T>C" "" "" "" "SF3B2(NM_006842.3):c.2431-7T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000979758" "0" "30" "11" "65838234" "65838234" "subst" "0" "01804" "PACS1_000031" "g.65838234G>C" "" "" "" "PACS1(NM_018026.4):c.277G>C (p.(Gly93Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000999295" "0" "30" "11" "65822590" "65822590" "subst" "0" "01804" "CATSPER1_000011" "g.65822590C>G" "" "" "" "SF3B2(NM_006842.2):c.302C>G (p.(Pro101Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000999296" "0" "50" "11" "65830588" "65830588" "subst" "0" "01804" "SF3B2_000006" "g.65830588G>A" "" "" "" "SF3B2(NM_006842.2):c.2085+1G>A (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000999297" "0" "30" "11" "65835811" "65835811" "subst" "0.000530248" "01804" "PACS1_000037" "g.65835811G>A" "" "" "" "SF3B2(NM_006842.2):c.2616+7G>A (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000999298" "0" "30" "11" "65838076" "65838078" "del" "0" "01804" "PACS1_000038" "g.65838076_65838078del" "" "" "" "PACS1(NM_018026.3):c.119_121delAGC (p.(Gln40del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000999299" "0" "30" "11" "65838096" "65838096" "subst" "0" "01804" "PACS1_000039" "g.65838096C>A" "" "" "" "PACS1(NM_018026.3):c.139C>A (p.(Pro47Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000999300" "0" "30" "11" "65838115" "65838115" "subst" "0" "01804" "PACS1_000040" "g.65838115C>T" "" "" "" "PACS1(NM_018026.3):c.158C>T (p.(Ala53Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000999301" "0" "50" "11" "65838306" "65838306" "subst" "0" "01804" "PACS1_000041" "g.65838306G>A" "" "" "" "PACS1(NM_018026.3):c.349G>A (p.(Val117Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001038606" "0" "50" "11" "65822589" "65822589" "subst" "4.77911E-6" "01804" "CATSPER1_000012" "g.65822589C>G" "" "" "" "SF3B2(NM_006842.3):c.301C>G (p.(Pro101Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001038607" "0" "30" "11" "65824387" "65824387" "subst" "1.21863E-5" "01804" "CATSPER1_000013" "g.65824387A>G" "" "" "" "SF3B2(NM_006842.3):c.628A>G (p.(Met210Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001038608" "0" "30" "11" "65838058" "65838058" "subst" "0" "01804" "PACS1_000050" "g.65838058C>A" "" "" "" "PACS1(NM_018026.4):c.101C>A (p.(Pro34Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001038609" "0" "30" "11" "65838059" "65838059" "subst" "0.00167261" "01804" "PACS1_000051" "g.65838059G>A" "" "" "" "PACS1(NM_018026.4):c.102G>A (p.(Pro34=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001048965" "11" "70" "11" "65830872" "65830872" "subst" "1.22978E-5" "04760" "SF3B2_000007" "g.65830872C>T" "" "" "" "" "" "Germline" "no" "" "0" "" "" "g.66063401C>T" "" "likely pathogenic" "ACMG" "0001065515" "0" "50" "11" "65826316" "65826316" "subst" "0" "02325" "chr11_008702" "g.65826316A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes SF3B2 ## Count = 36 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000266496" "00018767" "10" "-29329" "0" "-29329" "0" "c.-29329G>T" "r.(?)" "p.(=)" "" "0000266497" "00018767" "10" "-31784" "0" "-31784" "0" "c.-31784C>T" "r.(?)" "p.(=)" "" "0000266498" "00018767" "10" "-26402" "0" "-26402" "0" "c.-26402C>T" "r.(?)" "p.(=)" "" "0000304903" "00018767" "50" "4735" "0" "4735" "0" "c.*2047C>A" "r.(=)" "p.(=)" "" "0000322316" "00018767" "30" "-8908" "0" "-8908" "0" "c.-8908C>T" "r.(?)" "p.(=)" "" "0000545048" "00018767" "30" "-29491" "0" "-29491" "0" "c.-29491C>G" "r.(?)" "p.(=)" "" "0000545053" "00018767" "30" "4533" "0" "4533" "0" "c.*1845A>C" "r.(=)" "p.(=)" "" "0000545054" "00018767" "30" "4701" "0" "4701" "0" "c.*2013G>C" "r.(=)" "p.(=)" "" "0000613575" "00018767" "30" "4545" "0" "4550" "0" "c.*1857_*1862dup" "r.(=)" "p.(=)" "" "0000723592" "00018767" "50" "4533" "0" "4553" "0" "c.*1845_*1865dup" "r.(=)" "p.(=)" "" "0000723593" "00018767" "50" "4635" "0" "4635" "0" "c.*1947C>T" "r.(=)" "p.(=)" "" "0000853094" "00018767" "30" "318" "0" "318" "0" "c.318G>A" "r.(?)" "p.(Pro106=)" "" "0000853095" "00018767" "30" "1965" "0" "1965" "0" "c.1965G>A" "r.(?)" "p.(Ser655=)" "" "0000862638" "00018767" "10" "2487" "0" "2487" "0" "c.2487G>A" "r.(?)" "p.(Ala829=)" "" "0000862639" "00018767" "30" "4533" "0" "4533" "0" "c.*1845A>C" "r.(=)" "p.(=)" "" "0000874705" "00018767" "50" "1005" "0" "1005" "0" "c.1005G>T" "r.(?)" "p.(Lys335Asn)" "" "0000890081" "00018767" "30" "696" "0" "696" "0" "c.696C>T" "r.(?)" "p.(Pro232=)" "" "0000890082" "00018767" "10" "1797" "0" "1797" "0" "c.1797A>G" "r.(?)" "p.(Thr599=)" "" "0000890083" "00018767" "30" "1977" "10" "1977" "10" "c.1977+10G>T" "r.(=)" "p.(=)" "" "0000913662" "00018767" "30" "357" "0" "357" "0" "c.357T>C" "r.(?)" "p.(Phe119=)" "" "0000936404" "00018767" "50" "739" "0" "739" "0" "c.739C>T" "r.(?)" "p.(Arg247Cys)" "" "0000979757" "00018767" "30" "2431" "-7" "2431" "-7" "c.2431-7T>C" "r.(=)" "p.(=)" "" "0000979758" "00018767" "30" "4706" "0" "4706" "0" "c.*2018G>C" "r.(=)" "p.(=)" "" "0000999295" "00018767" "30" "302" "0" "302" "0" "c.302C>G" "r.(?)" "p.(Pro101Arg)" "" "0000999296" "00018767" "50" "2085" "1" "2085" "1" "c.2085+1G>A" "r.spl?" "p.?" "" "0000999297" "00018767" "30" "2616" "7" "2616" "7" "c.2616+7G>A" "r.(=)" "p.(=)" "" "0000999298" "00018767" "30" "4548" "0" "4550" "0" "c.*1860_*1862del" "r.(=)" "p.(=)" "" "0000999299" "00018767" "30" "4568" "0" "4568" "0" "c.*1880C>A" "r.(=)" "p.(=)" "" "0000999300" "00018767" "30" "4587" "0" "4587" "0" "c.*1899C>T" "r.(=)" "p.(=)" "" "0000999301" "00018767" "50" "4778" "0" "4778" "0" "c.*2090G>A" "r.(=)" "p.(=)" "" "0001038606" "00018767" "50" "301" "0" "301" "0" "c.301C>G" "r.(?)" "p.(Pro101Ala)" "" "0001038607" "00018767" "30" "628" "0" "628" "0" "c.628A>G" "r.(?)" "p.(Met210Val)" "" "0001038608" "00018767" "30" "4530" "0" "4530" "0" "c.*1842C>A" "r.(=)" "p.(=)" "" "0001038609" "00018767" "30" "4531" "0" "4531" "0" "c.*1843G>A" "r.(=)" "p.(=)" "" "0001048965" "00018767" "70" "2087" "0" "2087" "0" "c.2087C>T" "r.(?)" "p.(Thr696Ile)" "" "0001065515" "00018767" "50" "982" "0" "982" "0" "c.982A>G" "r.(?)" "p.(Arg328Gly)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 3 "{{screeningid}}" "{{variantid}}" "0000416525" "0000874705" "0000440103" "0000936404" "0000468928" "0001048965"