### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = SGSH) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "SGSH" "N-sulfoglucosamine sulfohydrolase" "17" "q25.3" "unknown" "NG_008229.1" "UD_132118840984" "" "https://www.LOVD.nl/SGSH" "" "1" "10818" "6448" "605270" "1" "1" "1" "1" "An NCL gene variant database\r\nEstablishment of this gene variant database (LSDB) was supported by the European Community\'s Seventh Framework Programme (FP7/2007-2013) under grant agreement No 200754 - the GEN2PHEN project." "" "g" "http://databases.lovd.nl/shared/refseq/SGSH_codingDNA.html" "1" "" "An NCL gene variant database\r\n
\r\n
" "-1" "" "-1" "00002" "2010-04-29 00:00:00" "00006" "2017-04-03 21:12:18" "00000" "2025-05-05 21:14:00" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00000039" "SGSH" "N-sulfoglucosamine sulfohydrolase" "001" "NM_000199.3" "" "NP_000190.1" "" "" "" "-87" "2681" "1509" "78194199" "78183079" "00002" "2012-05-11 13:11:54" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 10 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00138" "autism" "autism" "" "209850" "" "" "" "00084" "2013-06-04 18:17:33" "00006" "2015-12-08 23:54:35" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "01933" "MPS3A" "mucopolysaccharidosis, type IIIA (MPS-3A)" "AR" "252900" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "02501" "SPG11" "paraplegia, spastic, autosomal recessive, type 11 (SPG-11)" "AR" "604360" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "04062" "BBSOAS" "Bosch-Boonstra-Schaaf optic atrophy syndrome (BBSOAS)" "AD" "615722" "" "developmental delay, speech delay 0.96 (44/46), motor delay 0.87 (41/47)), hypotonia 0.84 (39/46), optic nerve atrophy 0.83 (30/36), nystagmus (0.82 (37/45),strabismus 0.77 (34/44)" "" "00006" "2014-09-25 23:29:40" "00006" "2025-02-24 12:35:13" "04214" "-" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00001" "2023-03-09 14:26:26" "05258" "CLN" "lipofuscinosis, ceroid, neuronal (CLN)" "" "" "" "" "" "00006" "2017-04-03 15:00:30" "00006" "2017-04-04 08:43:07" "05378" "BMD/DMD" "dystrophinopathy (BMD or DMD)" "" "" "" "" "" "00006" "2018-01-13 20:18:25" "00006" "2019-03-26 16:49:54" "05517" "skeletal dysplasia" "dysplasia, skeletal" "" "" "" "" "" "00006" "2018-11-16 16:43:21" "" "" "05580" "MPS" "mucopolysaccharidosis (MPS)" "" "" "" "" "" "00006" "2019-03-01 09:43:46" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 1 "{{geneid}}" "{{diseaseid}}" "SGSH" "01933" ## Individuals ## Do not remove or alter this header ## ## Count = 52 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00000006" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "" "" "" "" "" "00000014" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "0" "" "" "" "" "00000049" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "0" "" "" "" "" "00000085" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "" "" "" "" "" "00102744" "" "" "" "1" "" "00011" "{PMID:Sleat 2009:19383612}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "?" "" "11y4m" "0" "" "" "" "UMB563" "00102745" "" "" "" "1" "" "00011" "{PMID:Sleat 2009:19383612}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "?" "" "53y" "0" "" "" "" "HSB4165" "00143765" "" "" "" "1" "" "02335" "" "" "M" "" "" "" "0" "" "" "" "" "00226364" "" "" "" "1" "" "00006" "{PMID:Ouesleti 2011:21910976}" "" "" "yes" "Tunisia" "" "0" "" "" "Sfax" "Pat1A" "00226365" "" "" "" "1" "" "00006" "{PMID:Ouesleti 2011:21910976}" "" "" "yes" "Tunisia" "" "0" "" "" "Bizerte" "Pat3A" "00226366" "" "" "" "1" "" "00006" "{PMID:Ouesleti 2011:21910976}" "" "" "yes" "Tunisia" "" "0" "" "" "Tunis" "Pat4A" "00226367" "" "" "" "1" "" "00006" "{PMID:Ouesleti 2011:21910976}" "" "" "yes" "Tunisia" "" "0" "" "" "Bizerte" "Pat5A" "00226368" "" "" "" "1" "" "00006" "{PMID:Ouesleti 2011:21910976}" "" "" "yes" "Tunisia" "" "0" "" "" "Tunis" "Pat6A" "00226369" "" "" "" "1" "" "00006" "{PMID:Ouesleti 2011:21910976}" "" "" "no" "Tunisia" "" "0" "" "" "Kairouan" "Pat2A" "00226370" "" "" "" "1" "" "00006" "{PMID:Ouesleti 2011:21910976}" "" "" "yes" "Tunisia" "" "0" "" "" "Kairouan" "Pat7A" "00291886" "" "" "" "3" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00291887" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00291888" "" "" "" "178" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00304610" "" "" "" "2" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00304611" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00311172" "" "" "" "1" "" "03763" "{PMID:Kaiwar 2017:28963436}" "" "F" "?" "" "" "0" "" "" "" "Case 2" "00331564" "" "" "" "1" "" "00000" "{PMID:Maddirevula 2018:29620724}" "isolated case" "F" "yes" "" "" "0" "" "" "" "11DG0195" "00361900" "" "" "" "1" "" "03219" "" "" "" "" "" "" "" "" "" "" "" "00374487" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-4682" "00379495" "" "" "" "1" "" "00000" "{PMID:Ousleti-2011:21910976}" "Novel" "" "yes" "Tunisia" "" "0" "" "" "Sfax" "" "00379496" "" "" "" "1" "" "00000" "{PMID:Ousleti-2011:21910976}" "Reference: Di Natale P. et al 1998" "" "no" "Tunisia" "" "0" "" "" "Kairouan" "" "00379497" "" "" "" "1" "" "00000" "{PMID:Ousleti-2011:21910976}" "Rference: Esposito S. et al 2000" "" "yes" "Tunisia" "" "0" "" "" "Bizerte" "" "00379498" "" "" "" "1" "" "00000" "{PMID:Ousleti-2011:21910976}" "" "" "yes" "Tunisia" "" "0" "" "" "Tunis" "" "00379499" "" "" "" "1" "" "00000" "{PMID:Ousleti-2011:21910976}" "Reference:Blanch L. et al 1997" "" "yes" "Tunisia" "" "0" "" "" "Bizerte" "" "00379500" "" "" "" "1" "" "00000" "{PMID:Ousleti-2011:21910976}" "" "" "yes" "Tunisia" "" "0" "" "" "Tunis" "" "00455287" "" "" "" "1" "" "00006" "{PMID:Pollard 2013:22976768}, {PMID:Pollard 2016:22976768}" "" "" "" "United States" "" "0" "" "" "" "SGSH-1" "00455288" "" "" "" "1" "" "00006" "{PMID:Pollard 2013:22976768}, {PMID:Pollard 2016:22976768}" "" "" "" "United States" "" "0" "" "" "" "SGSH-2" "00455289" "" "" "" "1" "" "00006" "{PMID:Pollard 2013:22976768}, {PMID:Pollard 2016:22976768}" "" "" "" "United States" "" "0" "" "" "" "SGSH-3" "00455290" "" "" "" "1" "" "00006" "{PMID:Pollard 2013:22976768}, {PMID:Pollard 2016:22976768}" "" "" "" "United States" "" "0" "" "" "" "SGSH-4" "00455291" "" "" "" "1" "" "00006" "{PMID:Pollard 2013:22976768}, {PMID:Pollard 2016:22976768}" "" "" "" "United States" "" "0" "" "" "" "SGSH-5" "00455292" "" "" "" "1" "" "00006" "{PMID:Pollard 2013:22976768}, {PMID:Pollard 2016:22976768}" "" "" "" "United States" "" "0" "" "" "" "SGSH-6" "00455293" "" "" "" "2" "" "00006" "{PMID:Pollard 2013:22976768}, {PMID:Pollard 2016:22976768}" "family, 2 affected sibs" "" "" "United States" "" "0" "" "" "" "SGSH-7" "00455294" "" "" "" "2" "" "00006" "{PMID:Pollard 2013:22976768}, {PMID:Pollard 2016:22976768}" ">1 unrelated patients" "" "" "United States" "" "0" "" "" "" "SGSH-8" "00455295" "" "" "" "1" "" "00006" "{PMID:Pollard 2013:22976768}, {PMID:Pollard 2016:22976768}" "" "" "" "United States" "" "0" "" "" "" "SGSH-9" "00455296" "" "" "" "2" "" "00006" "{PMID:Pollard 2013:22976768}, {PMID:Pollard 2016:22976768}" ">1 unrelated patients" "" "" "United States" "" "0" "" "" "" "SGSH-10" "00455297" "" "" "" "2" "" "00006" "{PMID:Pollard 2013:22976768}, {PMID:Pollard 2016:22976768}" "family, 2 affected sibs" "" "" "United States" "" "0" "" "" "" "SGSH-11" "00455298" "" "" "" "2" "" "00006" "{PMID:Pollard 2013:22976768}, {PMID:Pollard 2016:22976768}" "family, 2 affected sibs" "" "" "United States" "" "0" "" "" "" "SGSH-12" "00455299" "" "" "" "1" "" "00006" "{PMID:Pollard 2013:22976768}, {PMID:Pollard 2016:22976768}" "" "" "" "United States" "" "0" "" "" "" "SGSH-13" "00455300" "" "" "" "2" "" "00006" "{PMID:Pollard 2013:22976768}, {PMID:Pollard 2016:22976768}" ">1 unrelated patients" "" "" "United States" "" "0" "" "" "" "SGSH-14" "00455301" "" "" "" "1" "" "00006" "{PMID:Pollard 2013:22976768}, {PMID:Pollard 2016:22976768}" "" "" "" "United States" "" "0" "" "" "" "SGSH-15" "00455302" "" "" "" "1" "" "00006" "{PMID:Pollard 2013:22976768}, {PMID:Pollard 2016:22976768}" "" "" "" "United States" "" "0" "" "" "" "SGSH-16" "00455303" "" "" "" "2" "" "00006" "{PMID:Pollard 2013:22976768}, {PMID:Pollard 2016:22976768}" "family, 2 affected sibs" "" "" "United States" "" "0" "" "" "" "SGSH-17" "00455304" "" "" "" "1" "" "00006" "{PMID:Pollard 2013:22976768}, {PMID:Pollard 2016:22976768}" "" "" "" "United States" "" "0" "" "" "" "SGSH-18" "00455305" "" "" "" "1" "" "00006" "{PMID:Pollard 2013:22976768}, {PMID:Pollard 2016:22976768}" "" "" "" "United States" "" "0" "" "" "" "SGSH-19" "00455306" "" "" "" "2" "" "00006" "{PMID:Pollard 2016:22976768}" "family, 2 affected sibs" "" "" "United States" "" "0" "" "" "" "SGSH" "00456256" "" "" "" "1" "" "00006" "{PMID:Fernandez-Marmiesse 2014:24767253}" "" "M" "" "Spain" "" "0" "" "" "" "Pat34" "00456543" "" "" "" "1" "" "00006" "{PMID:Fang 2022:34813777}" "" "F" "" "China" "" "0" "" "" "" "Pat33" "00456544" "" "" "" "1" "" "00006" "{PMID:Fang 2022:34813777}" "" "F" "" "China" "" "0" "" "" "" "Pat34" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 51 "{{individualid}}" "{{diseaseid}}" "00000014" "00138" "00000014" "05378" "00102744" "01933" "00102745" "05258" "00143765" "01933" "00226364" "00198" "00226365" "00198" "00226366" "00198" "00226367" "00198" "00226368" "00198" "00226369" "00198" "00226370" "00198" "00291886" "00198" "00291887" "00198" "00291888" "00198" "00304610" "00198" "00304611" "00198" "00311172" "04062" "00331564" "05517" "00361900" "01933" "00361900" "02501" "00374487" "00198" "00379495" "04214" "00379496" "04214" "00379497" "04214" "00379498" "04214" "00379499" "04214" "00379500" "04214" "00455287" "05580" "00455288" "05580" "00455289" "05580" "00455290" "05580" "00455291" "05580" "00455292" "05580" "00455293" "05580" "00455294" "05580" "00455295" "05580" "00455296" "05580" "00455297" "05580" "00455298" "05580" "00455299" "05580" "00455300" "05580" "00455301" "05580" "00455302" "05580" "00455303" "05580" "00455304" "05580" "00455305" "05580" "00455306" "05580" "00456256" "00198" "00456543" "05580" "00456544" "05580" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00138, 00198, 01933, 02501, 04062, 04214, 05258, 05378, 05517, 05580 ## Count = 43 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000080877" "01933" "00102744" "00011" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080878" "05258" "00102745" "00011" "Isolated (sporadic)" "" "" "29y" "" "" "" "" "" "" "" "" "adult NCL" "" "0000116535" "01933" "00143765" "02335" "Familial, autosomal recessive" "03y" "" "" "" "" "" "" "" "" "" "" "" "" "0000171476" "00198" "00226364" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "MPS-3A" "intellectual disability" "" "0000171477" "00198" "00226365" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "MPS-3A" "intellectual disability" "" "0000171478" "00198" "00226366" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "MPS-3A" "intellectual disability" "" "0000171479" "00198" "00226367" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "MPS-3A" "intellectual disability" "" "0000171480" "00198" "00226368" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "MPS-3A" "intellectual disability" "" "0000171481" "00198" "00226369" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "MPS-3A" "intellectual disability" "" "0000171482" "00198" "00226370" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "MPC-3A" "intellectual disability" "" "0000236426" "04062" "00311172" "03763" "Isolated (sporadic)" "05y" "Caesarian section (HP:0011410); Premature rupture of membranes (HP:0001788); Maternal hypertension (HP:0008071); Hyperemesis gravidarum (HP:0012188); Feeding difficulties in infancy (HP:0008872); Nasogastric tube feeding in infancy (HP:0011470); Heart murmur (HP:0030148); Bicuspid aortic valve (HP:0001647); Aortic aneurysm (HP:0004942); Muscular hypotonia (HP:0001252); Amblyopia (HP:0000646); Anisometropia (HP:0012803); Strabismus (HP:0000486); Neurodevelopmental delay (HP:0012758); Motor delay (HP:0001270); Delayed speech and language development (HP:0000750); Stereotypy (HP:0000733); Hypertelorism (HP:0000316); Synophrys (HP:0000664); Cupped ear (HP:0000378); Macrocephaly (HP:0000256); Broad proximal phalanges of the hand (HP:0009852)" "00y00m03d" "" "" "" "" "" "" "" "" "" "" "0000249756" "05517" "00331564" "00000" "Familial, autosomal recessive" "" "Arab (Suda Kyphosis, Myopia, Hearing Impairment, Frontal bossing, Coarse facial features, HepatomeYes" "" "" "" "" "" "" "" "" "Lysosomal Storage Diseases with Skeletal Involvement (dysostosis multiplex group)" "skeletal dysplasia" "" "0000257295" "01933" "00361900" "03219" "Familial, autosomal recessive" "" "Intellectual delay, coarse face, enzyme assay suggestive of Sanfilipo disease" "" "" "" "" "" "" "" "" "" "" "" "0000269697" "00198" "00374487" "00006" "Familial, autosomal recessive" "" "Delayed speech and motor development, cognitive regression, hyperactivity, hypertrichosis, short stature, coarse facies and mild dysostosis multiplex" "" "" "" "" "" "" "" "" "" "developmental delay" "" "0000273368" "04214" "00379495" "00000" "Unknown" "3y" "" "" "" "" "" "" "" "" "" "" "Mucoplysaccharidoses" "" "0000273369" "04214" "00379496" "00000" "Unknown" "3y" "Known, Dental absces" "" "" "" "" "" "" "" "" "" "Mucoplysaccharidoses" "" "0000273370" "04214" "00379497" "00000" "Unknown" "8y" "Cerebral atrophy corpus callosum agenesis" "" "" "" "" "" "" "" "" "" "Mucoplysaccharidoses" "" "0000273371" "04214" "00379498" "00000" "Unknown" "6y" "Ataxia" "" "" "" "" "" "" "" "" "" "Mucoplysaccharidoses" "" "0000273372" "04214" "00379499" "00000" "Unknown" "2y" "" "" "" "" "" "" "" "" "" "" "Mucoplysaccharidoses" "" "0000273373" "04214" "00379500" "00000" "Unknown" "3y" "Encephalopathy" "" "" "" "" "" "" "" "" "" "Mucoplysaccharidoses" "" "0000343867" "05580" "00455287" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MPS3A" "mucopolysaccharidosis" "" "0000343868" "05580" "00455288" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MPS3A" "mucopolysaccharidosis" "" "0000343869" "05580" "00455289" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MPS3A" "mucopolysaccharidosis" "" "0000343870" "05580" "00455290" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MPS3A" "mucopolysaccharidosis" "" "0000343871" "05580" "00455291" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MPS3A" "mucopolysaccharidosis" "" "0000343872" "05580" "00455292" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MPS3A" "mucopolysaccharidosis" "" "0000343873" "05580" "00455293" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MPS3A" "mucopolysaccharidosis" "" "0000343874" "05580" "00455294" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MPS3A" "mucopolysaccharidosis" "" "0000343875" "05580" "00455295" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MPS3A" "mucopolysaccharidosis" "" "0000343876" "05580" "00455296" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MPS3A" "mucopolysaccharidosis" "" "0000343877" "05580" "00455297" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MPS3A" "mucopolysaccharidosis" "" "0000343878" "05580" "00455298" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MPS3A" "mucopolysaccharidosis" "" "0000343879" "05580" "00455299" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MPS3A" "mucopolysaccharidosis" "" "0000343880" "05580" "00455300" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MPS3A" "mucopolysaccharidosis" "" "0000343881" "05580" "00455301" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MPS3A" "mucopolysaccharidosis" "" "0000343882" "05580" "00455302" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MPS3A" "mucopolysaccharidosis" "" "0000343883" "05580" "00455303" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MPS3A" "mucopolysaccharidosis" "" "0000343884" "05580" "00455304" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MPS3A" "mucopolysaccharidosis" "" "0000343885" "05580" "00455305" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MPS3A" "mucopolysaccharidosis" "" "0000343886" "05580" "00455306" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MPS3A" "mucopolysaccharidosis" "" "0000344775" "00198" "00456256" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "lysosomal storage disorder" "" "0000345051" "05580" "00456543" "00006" "Familial, X-linked recessive" "" "severe" "2y" "2y" "" "" "" "" "" "" "MPS3A" "mucopolysaccharidosis" "" "0000345052" "05580" "00456544" "00006" "Familial, X-linked recessive" "" "severe" "3y" "4y" "" "" "" "" "" "" "MPS3A" "mucopolysaccharidosis" "" ## Screenings ## Do not remove or alter this header ## ## Count = 52 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000000006" "00000006" "1" "00004" "" "2012-05-11 13:18:37" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000014" "00000014" "1" "00004" "" "2012-05-11 13:18:39" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000049" "00000049" "1" "00004" "" "2012-05-11 13:18:49" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000085" "00000085" "1" "00004" "" "2012-05-11 13:19:11" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000103196" "00102744" "0" "00011" "00011" "2012-11-02 17:07:43" "" "" "MS;SEQ" "DNA;protein" "" "" "0000103197" "00102745" "0" "00011" "00011" "2012-11-02 17:07:43" "" "" "MS;SEQ" "DNA;protein" "" "" "0000144623" "00143765" "1" "02335" "02335" "2017-12-05 10:59:30" "" "" "SEQ" "DNA" "" "" "0000227452" "00226364" "1" "00006" "00006" "2019-03-08 20:05:38" "" "" "SEQ" "DNA" "" "" "0000227453" "00226365" "1" "00006" "00006" "2019-03-08 20:09:23" "" "" "SEQ" "DNA" "" "" "0000227454" "00226366" "1" "00006" "00006" "2019-03-08 20:13:18" "" "" "SEQ" "DNA" "" "" "0000227455" "00226367" "1" "00006" "00006" "2019-03-08 20:15:47" "" "" "SEQ" "DNA" "" "" "0000227456" "00226368" "1" "00006" "00006" "2019-03-08 20:18:08" "" "" "SEQ" "DNA" "" "" "0000227457" "00226369" "1" "00006" "00006" "2019-03-08 20:20:40" "" "" "SEQ" "DNA" "" "" "0000227458" "00226370" "1" "00006" "00006" "2019-03-08 21:24:18" "" "" "SEQ" "DNA" "" "" "0000293054" "00291886" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000293055" "00291887" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000293056" "00291888" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000305739" "00304610" "1" "03575" "00006" "2020-06-24 11:55:42" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000305740" "00304611" "1" "03575" "00006" "2020-06-24 11:55:42" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000312329" "00311172" "1" "03763" "03763" "2020-09-21 10:37:23" "" "" "SEQ-NG" "DNA" "" "" "0000332783" "00331564" "1" "00000" "00006" "2021-02-11 15:29:38" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000363128" "00361900" "1" "03219" "03219" "2021-04-12 06:22:50" "" "" "SEQ-NG" "DNA" "" "" "0000375681" "00374487" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000380695" "00379495" "1" "00000" "00008" "2021-08-05 00:17:46" "" "" "SEQ" "DNA" "blood" "" "0000380696" "00379496" "1" "00000" "00008" "2021-08-05 00:17:46" "" "" "SEQ" "DNA" "blood" "" "0000380697" "00379497" "1" "00000" "00008" "2021-08-05 00:17:46" "" "" "SEQ" "DNA" "blood" "" "0000380698" "00379498" "1" "00000" "00008" "2021-08-05 00:17:46" "" "" "SEQ" "DNA" "blood" "" "0000380699" "00379499" "1" "00000" "00008" "2021-08-05 00:17:46" "" "" "SEQ" "DNA" "blood" "" "0000380700" "00379500" "1" "00000" "00008" "2021-08-05 00:17:46" "" "" "SEQ" "DNA" "blood" "" "0000456901" "00455287" "1" "00006" "00006" "2024-10-07 09:56:02" "" "" "SEQ" "DNA" "" "gene panel" "0000456902" "00455288" "1" "00006" "00006" "2024-10-07 09:56:02" "" "" "SEQ" "DNA" "" "gene panel" "0000456903" "00455289" "1" "00006" "00006" "2024-10-07 09:56:02" "" "" "SEQ" "DNA" "" "gene panel" "0000456904" "00455290" "1" "00006" "00006" "2024-10-07 09:56:02" "" "" "SEQ" "DNA" "" "gene panel" "0000456905" "00455291" "1" "00006" "00006" "2024-10-07 09:56:02" "" "" "SEQ" "DNA" "" "gene panel" "0000456906" "00455292" "1" "00006" "00006" "2024-10-07 09:56:02" "" "" "SEQ" "DNA" "" "gene panel" "0000456907" "00455293" "1" "00006" "00006" "2024-10-07 09:56:02" "" "" "SEQ" "DNA" "" "gene panel" "0000456908" "00455294" "1" "00006" "00006" "2024-10-07 09:56:02" "" "" "SEQ" "DNA" "" "gene panel" "0000456909" "00455295" "1" "00006" "00006" "2024-10-07 09:56:02" "" "" "SEQ" "DNA" "" "gene panel" "0000456910" "00455296" "1" "00006" "00006" "2024-10-07 09:56:02" "" "" "SEQ" "DNA" "" "gene panel" "0000456911" "00455297" "1" "00006" "00006" "2024-10-07 09:56:02" "" "" "SEQ" "DNA" "" "gene panel" "0000456912" "00455298" "1" "00006" "00006" "2024-10-07 09:56:02" "" "" "SEQ" "DNA" "" "gene panel" "0000456913" "00455299" "1" "00006" "00006" "2024-10-07 09:56:02" "" "" "SEQ" "DNA" "" "gene panel" "0000456914" "00455300" "1" "00006" "00006" "2024-10-07 09:56:02" "" "" "SEQ" "DNA" "" "gene panel" "0000456915" "00455301" "1" "00006" "00006" "2024-10-07 09:56:02" "" "" "SEQ" "DNA" "" "gene panel" "0000456916" "00455302" "1" "00006" "00006" "2024-10-07 09:56:02" "" "" "SEQ" "DNA" "" "gene panel" "0000456917" "00455303" "1" "00006" "00006" "2024-10-07 09:56:02" "" "" "SEQ" "DNA" "" "gene panel" "0000456918" "00455304" "1" "00006" "00006" "2024-10-07 09:56:02" "" "" "SEQ" "DNA" "" "gene panel" "0000456919" "00455305" "1" "00006" "00006" "2024-10-07 09:56:02" "" "" "SEQ" "DNA" "" "gene panel" "0000456920" "00455306" "1" "00006" "00006" "2024-10-07 09:56:02" "" "" "SEQ" "DNA" "" "gene panel" "0000457873" "00456256" "1" "00006" "00006" "2024-10-24 08:52:57" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000458160" "00456543" "1" "00006" "00006" "2024-10-28 14:01:06" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000458161" "00456544" "1" "00006" "00006" "2024-10-28 14:01:06" "" "" "SEQ;SEQ-NG" "DNA" "" "" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 94 "{{screeningid}}" "{{geneid}}" "0000000006" "ACADM" "0000000006" "APTX" "0000000006" "ATP7B" "0000000006" "GALC" "0000000006" "MTHFR" "0000000006" "SERPINA1" "0000000006" "SGSH" "0000000006" "SLC26A2" "0000000014" "ALG6" "0000000014" "ATP7B" "0000000014" "CFTR" "0000000014" "DPYD" "0000000014" "ETFB" "0000000014" "GLB1" "0000000014" "GNPTAB" "0000000014" "HEXB" "0000000014" "IGHMBP2" "0000000014" "MYO5A" "0000000014" "NHLRC1" "0000000014" "NPHP4" "0000000014" "NPHS1" "0000000014" "PKHD1" "0000000014" "SERPINA1" "0000000014" "SFTPB" "0000000014" "SGSH" "0000000014" "TSFM" "0000000049" "ATP7B" "0000000049" "CYP21A2" "0000000049" "DPYD" "0000000049" "ETFB" "0000000049" "GALC" "0000000049" "GLB1" "0000000049" "IGHMBP2" "0000000049" "LAMA2" "0000000049" "MPL" "0000000049" "MYO5A" "0000000049" "NPHP4" "0000000049" "SERPINA1" "0000000049" "SGSH" "0000000049" "SLC26A2" "0000000085" "ADA" "0000000085" "ATP7B" "0000000085" "ETFB" "0000000085" "FGG" "0000000085" "FKTN" "0000000085" "HEXB" "0000000085" "IGHMBP2" "0000000085" "MYO5A" "0000000085" "NHLRC1" "0000000085" "PKHD1" "0000000085" "POLG" "0000000085" "SERPINA1" "0000000085" "SGSH" "0000103196" "SGSH" "0000103197" "SGSH" "0000144623" "SGSH" "0000227452" "SGSH" "0000227453" "SGSH" "0000227454" "SGSH" "0000227455" "SGSH" "0000227456" "SGSH" "0000227457" "SGSH" "0000227458" "SGSH" "0000312329" "SGSH" "0000332783" "SGSH" "0000375681" "SGSH" "0000380695" "SGSH" "0000380696" "SGSH" "0000380697" "SGSH" "0000380698" "SGSH" "0000380699" "SGSH" "0000380700" "SGSH" "0000456901" "SGSH" "0000456902" "SGSH" "0000456903" "SGSH" "0000456904" "SGSH" "0000456905" "SGSH" "0000456906" "SGSH" "0000456907" "SGSH" "0000456908" "SGSH" "0000456909" "SGSH" "0000456910" "SGSH" "0000456911" "SGSH" "0000456912" "SGSH" "0000456913" "SGSH" "0000456914" "SGSH" "0000456915" "SGSH" "0000456916" "SGSH" "0000456917" "SGSH" "0000456918" "SGSH" "0000456919" "SGSH" "0000456920" "SGSH" "0000458160" "SGSH" "0000458161" "SGSH" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 345 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000000670" "0" "50" "17" "78184680" "78184681" "del" "0" "00002" "SGSH_000007" "g.78184680_78184681del" "" "" "" "" "Authors description: chr17:g.75799275_75799276del; mutant allele: G; not known correct genotype; mutation misannotated" "Germline" "" "" "" "" "" "g.80210881_80210882del" "" "VUS" "" "0000000671" "0" "50" "17" "78190883" "78190883" "subst" "9.53982E-5" "00002" "SGSH_000008" "g.78190883G>C" "" "" "" "" "" "Germline" "" "" "" "" "" "g.80217084G>C" "" "VUS" "" "0000000672" "0" "50" "17" "78188529" "78188529" "subst" "2.85074E-5" "00002" "SGSH_000005" "g.78188529C>T" "" "" "" "" "" "Germline" "" "" "" "" "" "g.80214730C>T" "" "VUS" "" "0000000673" "0" "50" "17" "78187647" "78187647" "subst" "0.000722313" "00002" "SGSH_000004" "g.78187647G>C" "" "" "" "" "" "Germline" "" "" "" "" "" "g.80213848G>C" "" "VUS" "" "0000000674" "0" "50" "17" "78187614" "78187614" "subst" "0.000330121" "00002" "SGSH_000003" "g.78187614C>T" "" "" "" "" "" "Germline" "" "" "" "" "" "g.80213815C>T" "" "VUS" "" "0000000675" "0" "50" "17" "78184421" "78184421" "subst" "6.92848E-5" "00002" "SGSH_000006" "g.78184421C>T" "" "" "" "" "" "Germline" "" "" "" "" "" "g.80210622C>T" "" "VUS" "" "0000166301" "3" "90" "17" "78187614" "78187614" "subst" "0.000330121" "00011" "SGSH_000003" "g.78187614C>T" "" "{PMID:Sleat 2009:19383612}" "" "746G>A" "protein analysis (LC-MS/MS) brain SGSH absent" "Germline" "" "" "0" "" "" "g.80213815C>T" "" "pathogenic" "" "0000166302" "1" "90" "17" "78185927" "78185927" "subst" "9.35423E-5" "00011" "SGSH_000001" "g.78185927A>G" "" "{PMID:Sleat 2009:19383612}" "" "904T>C" "protein analysis (LC-MS/MS) brain SGSH absent" "Germline" "" "" "0" "" "" "g.80212128A>G" "" "pathogenic" "" "0000166303" "2" "90" "17" "78184697" "78184697" "subst" "2.87201E-5" "00011" "SGSH_000002" "g.78184697C>T" "" "{PMID:Sleat 2009:19383612}" "" "1075G>A" "protein analysis (LC-MS/MS) brain SGSH absent" "Germline" "" "" "0" "" "" "g.80210898C>T" "" "pathogenic" "" "0000235427" "21" "90" "17" "78190860" "78190860" "subst" "0.000145679" "02335" "SGSH_000011" "g.78190860G>A" "" "" "" "" "" "Germline" "" "rs104894636" "0" "" "" "g.80217061G>A" "" "pathogenic" "" "0000235428" "11" "90" "17" "78184552" "78184554" "del" "0" "02335" "SGSH_000009" "g.78184552_78184554del" "" "" "" "" "the father (not symptomatic) of the patient carries this pathogenic variant as well as the probably pathogenic variant c.96C>A p.(D32E), the two variants are therefore thought to be on the same allele (not confirmed)" "Germline" "" "" "0" "" "" "g.80210753_80210755del" "" "pathogenic" "" "0000235429" "10" "70" "17" "78190984" "78190984" "subst" "0" "02335" "SGSH_000010" "g.78190984G>T" "" "" "" "" "another variant affecting this amino acid is described as pathogenic: c.95A>G p.(D32G); the father of the patient (not symptomatic) carries this probably pathogenic variant as well as the pathogenic variant c.1207_1209del p.(Y403del) but is, the two variants are therfore thought to be on one allele (not confirmed)" "Germline" "" "" "0" "" "" "g.80217185G>T" "" "likely pathogenic" "" "0000247429" "0" "10" "17" "78187954" "78187954" "subst" "0.451808" "02330" "SGSH_000030" "g.78187954A>G" "" "" "" "SGSH(NM_000199.4):c.663+17T>C, SGSH(NM_000199.5):c.663+17T>C, SGSH(NM_001352921.3):c.663+17T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80214155A>G" "" "benign" "" "0000247932" "0" "10" "17" "78187954" "78187954" "subst" "0.451808" "02325" "SGSH_000030" "g.78187954A>G" "" "" "" "SGSH(NM_000199.4):c.663+17T>C, SGSH(NM_000199.5):c.663+17T>C, SGSH(NM_001352921.3):c.663+17T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80214155A>G" "" "benign" "" "0000248148" "0" "90" "17" "78185927" "78185927" "subst" "9.35423E-5" "02325" "SGSH_000001" "g.78185927A>G" "" "" "" "SGSH(NM_000199.3):c.892T>C (p.(Ser298Pro)), SGSH(NM_000199.4):c.892T>C (p.S298P), SGSH(NM_000199.5):c.892T>C (p.S298P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80212128A>G" "" "pathogenic" "" "0000251615" "0" "10" "17" "78180637" "78180637" "subst" "0" "02326" "SGSH_000012" "g.78180637A>C" "" "" "" "CARD14(NM_024110.4):c.2692-132A>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80206838A>C" "" "benign" "" "0000251939" "0" "30" "17" "78162209" "78162209" "subst" "0.00115432" "02326" "CARD14_000022" "g.78162209A>C" "" "" "" "CARD14(NM_024110.4):c.709A>C (p.N237H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80188410A>C" "" "likely benign" "" "0000253193" "0" "10" "17" "78187954" "78187954" "subst" "0.451808" "01943" "SGSH_000030" "g.78187954A>G" "" "" "" "SGSH(NM_000199.4):c.663+17T>C, SGSH(NM_000199.5):c.663+17T>C, SGSH(NM_001352921.3):c.663+17T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80214155A>G" "" "benign" "" "0000255406" "0" "90" "17" "78185927" "78185927" "subst" "9.35423E-5" "01943" "SGSH_000001" "g.78185927A>G" "" "" "" "SGSH(NM_000199.3):c.892T>C (p.(Ser298Pro)), SGSH(NM_000199.4):c.892T>C (p.S298P), SGSH(NM_000199.5):c.892T>C (p.S298P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80212128A>G" "" "pathogenic" "" "0000266479" "0" "10" "17" "78176233" "78176233" "subst" "0.414285" "02325" "CARD14_000036" "g.78176233T>A" "" "" "" "CARD14(NM_001257970.1):c.*10T>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80202434T>A" "" "benign" "" "0000266480" "0" "10" "17" "78178893" "78178893" "subst" "0.414286" "02325" "CARD14_000040" "g.78178893C>T" "" "" "" "CARD14(NM_024110.4):c.2458C>T (p.R820W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80205094C>T" "" "benign" "" "0000266481" "0" "10" "17" "78162170" "78162170" "subst" "0.330034" "02325" "CARD14_000020" "g.78162170G>A" "" "" "" "CARD14(NM_024110.4):c.676-6G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80188371G>A" "" "benign" "" "0000269722" "0" "30" "17" "78164674" "78164674" "subst" "0.000553381" "02326" "CARD14_000023" "g.78164674C>T" "" "" "" "CARD14(NM_024110.4):c.1065C>T (p.C355=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80190875C>T" "" "likely benign" "" "0000269723" "0" "30" "17" "78165095" "78165095" "subst" "8.25532E-6" "02326" "CARD14_000025" "g.78165095C>T" "" "" "" "CARD14(NM_024110.4):c.1090-27C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80191296C>T" "" "likely benign" "" "0000269724" "0" "10" "17" "78165088" "78165088" "subst" "0.0154703" "02326" "CARD14_000024" "g.78165088G>A" "" "" "" "CARD14(NM_024110.4):c.1090-34G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80191289G>A" "" "benign" "" "0000269725" "0" "30" "17" "78165214" "78165214" "subst" "8.14558E-6" "02326" "CARD14_000026" "g.78165214C>T" "" "" "" "CARD14(NM_024110.4):c.1182C>T (p.D394=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80191415C>T" "" "likely benign" "" "0000269726" "0" "10" "17" "78166326" "78166326" "subst" "0.0227766" "02326" "CARD14_000027" "g.78166326G>A" "" "" "" "CARD14(NM_024110.4):c.1264G>A (p.E422K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80192527G>A" "" "benign" "" "0000269727" "0" "70" "17" "78168989" "78168989" "subst" "4.15407E-6" "02326" "CARD14_000028" "g.78168989G>A" "" "" "" "CARD14(NM_024110.4):c.1357-1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80195190G>A" "" "likely pathogenic" "" "0000269728" "0" "10" "17" "78169374" "78169374" "subst" "0.0138385" "02326" "CARD14_000030" "g.78169374C>T" "" "" "" "CARD14(NM_024110.4):c.1517C>T (p.P506L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80195575C>T" "" "benign" "" "0000269729" "0" "30" "17" "78155396" "78155396" "subst" "0.000140959" "02326" "CARD14_000018" "g.78155396C>T" "" "" "" "CARD14(NM_024110.4):c.159C>T (p.D53=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80181597C>T" "" "likely benign" "" "0000269730" "0" "10" "17" "78172564" "78172564" "subst" "0.0208228" "02326" "CARD14_000033" "g.78172564C>T" "" "" "" "CARD14(NM_024110.4):c.1851+174C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80198765C>T" "" "benign" "" "0000269731" "0" "30" "17" "78175608" "78175608" "subst" "0.00151138" "02326" "CARD14_000034" "g.78175608C>T" "" "" "" "CARD14(NM_024110.4):c.1917C>T (p.A639=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80201809C>T" "" "likely benign" "" "0000269732" "0" "30" "17" "78175964" "78175964" "subst" "0.0032306" "02326" "CARD14_000035" "g.78175964G>A" "" "" "" "CARD14(NM_024110.4):c.1979-15G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80202165G>A" "" "likely benign" "" "0000269733" "0" "10" "17" "78176044" "78176044" "subst" "0.011201" "02326" "CARD14_000014" "g.78176044C>T" "" "" "" "CARD14(NM_024110.4):c.2044C>T (p.R682W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80202245C>T" "" "benign" "" "0000269734" "0" "30" "17" "78176233" "78176233" "subst" "0.0202382" "02326" "CARD14_000037" "g.78176233T>G" "" "" "" "CARD14(NM_024110.4):c.2219+14T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80202434T>G" "" "likely benign" "" "0000269735" "0" "30" "17" "78178838" "78178838" "subst" "0.000823254" "02326" "CARD14_000039" "g.78178838C>T" "" "" "" "CARD14(NM_024110.4):c.2403C>T (p.S801=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80205039C>T" "" "likely benign" "" "0000269736" "0" "30" "17" "78178911" "78178911" "subst" "0.000265486" "02326" "CARD14_000041" "g.78178911C>T" "" "" "" "CARD14(NM_001366385.1):c.2476C>T (p.R826W), CARD14(NM_024110.4):c.2476C>T (p.R826W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80205112C>T" "" "likely benign" "" "0000269737" "0" "30" "17" "78178931" "78178931" "subst" "0.00371681" "02326" "CARD14_000042" "g.78178931C>T" "" "" "" "CARD14(NM_024110.4):c.2496C>T (p.L832=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80205132C>T" "" "likely benign" "" "0000269738" "0" "30" "17" "78179008" "78179008" "subst" "0.0017552" "02326" "CARD14_000043" "g.78179008T>C" "" "" "" "CARD14(NM_024110.4):c.2569+4T>C (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80205209T>C" "" "likely benign" "" "0000269739" "0" "30" "17" "78179408" "78179408" "subst" "0.00720564" "02326" "CARD14_000044" "g.78179408G>A" "" "" "" "CARD14(NM_001257970.1):c.*3185G>A (p.(=)), CARD14(NM_024110.4):c.2648G>A (p.R883H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80205609G>A" "" "likely benign" "" "0000269740" "0" "10" "17" "78179566" "78179566" "subst" "0" "02326" "CARD14_000045" "g.78179566C>T" "" "" "" "CARD14(NM_024110.4):c.2691+115C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80205767C>T" "" "benign" "" "0000269741" "0" "10" "17" "78182014" "78182014" "subst" "0.00973958" "02326" "SGSH_000014" "g.78182014G>A" "" "" "" "CARD14(NM_024110.4):c.2885G>A (p.R962Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80208215G>A" "" "benign" "" "0000269742" "0" "30" "17" "78157961" "78157961" "subst" "0.00637585" "02326" "CARD14_000009" "g.78157961G>A" "" "" "" "CARD14(NM_024110.4):c.599G>A (p.S200N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80184162G>A" "" "likely benign" "" "0000269743" "0" "30" "17" "78162146" "78162146" "subst" "0.000732467" "02326" "CARD14_000019" "g.78162146C>T" "" "" "" "CARD14(NM_024110.4):c.676-30C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80188347C>T" "" "likely benign" "" "0000269744" "0" "70" "17" "78162181" "78162181" "subst" "5.38436E-5" "02326" "CARD14_000021" "g.78162181T>G" "" "" "" "CARD14(NM_024110.4):c.681T>G (p.Y227*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80188382T>G" "" "likely pathogenic" "" "0000272611" "0" "30" "17" "78169048" "78169048" "subst" "8.22125E-5" "01943" "CARD14_000029" "g.78169048G>A" "" "" "" "CARD14(NM_024110.4):c.1415G>A (p.R472H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80195249G>A" "" "likely benign" "" "0000272612" "0" "30" "17" "78171904" "78171904" "subst" "3.65583E-5" "01943" "CARD14_000031" "g.78171904C>T" "" "" "" "CARD14(NM_024110.4):c.1601C>T (p.P534L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80198105C>T" "" "likely benign" "" "0000272613" "0" "10" "17" "78172201" "78172201" "subst" "0.00115512" "01943" "CARD14_000032" "g.78172201C>T" "" "" "" "CARD14(NM_024110.4):c.1662C>T (p.G554=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80198402C>T" "" "benign" "" "0000272614" "0" "30" "17" "78178077" "78178077" "subst" "0.000553166" "01943" "CARD14_000038" "g.78178077G>A" "" "" "" "CARD14(NM_024110.4):c.2335G>A (p.A779T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80204278G>A" "" "likely benign" "" "0000272615" "0" "30" "17" "78178931" "78178931" "subst" "0.00371681" "01943" "CARD14_000042" "g.78178931C>T" "" "" "" "CARD14(NM_024110.4):c.2496C>T (p.L832=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80205132C>T" "" "likely benign" "" "0000272616" "0" "30" "17" "78179008" "78179008" "subst" "0.0017552" "01943" "CARD14_000043" "g.78179008T>C" "" "" "" "CARD14(NM_024110.4):c.2569+4T>C (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80205209T>C" "" "likely benign" "" "0000272617" "0" "10" "17" "78180849" "78180849" "subst" "0.00151557" "01943" "SGSH_000013" "g.78180849C>T" "" "" "" "CARD14(NM_024110.4):c.2772C>T (p.H924=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80207050C>T" "" "benign" "" "0000295802" "0" "10" "17" "78184737" "78184737" "subst" "0" "02330" "SGSH_000026" "g.78184737G>A" "" "" "" "SGSH(NM_000199.5):c.1023C>T (p.I341=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80210938G>A" "" "benign" "" "0000295803" "0" "10" "17" "78184679" "78184679" "subst" "0.0501449" "02330" "SGSH_000024" "g.78184679C>T" "" "" "" "SGSH(NM_000199.3):c.1081G>A (p.(Val361Ile)), SGSH(NM_000199.4):c.1081G>A (p.V361I), SGSH(NM_000199.5):c.1081G>A (p.V361I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80210880C>T" "" "benign" "" "0000295804" "0" "30" "17" "78184601" "78184601" "subst" "0.0135984" "02330" "SGSH_000019" "g.78184601C>T" "" "" "" "SGSH(NM_000199.3):c.1159G>A (p.(Val387Met)), SGSH(NM_000199.5):c.1159G>A (p.V387M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80210802C>T" "" "likely benign" "" "0000295805" "0" "10" "17" "78184551" "78184551" "subst" "0.000182903" "02330" "SGSH_000018" "g.78184551G>A" "" "" "" "SGSH(NM_000199.5):c.1209C>T (p.Y403=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80210752G>A" "" "benign" "" "0000295806" "0" "10" "17" "78184393" "78184393" "subst" "0.368056" "02330" "SGSH_000015" "g.78184393C>T" "" "" "" "SGSH(NM_000199.4):c.1367G>A (p.R456H), SGSH(NM_000199.5):c.1367G>A (p.R456H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80210594C>T" "" "benign" "" "0000298180" "0" "90" "17" "78184681" "78184681" "del" "0" "02325" "SGSH_000025" "g.78184681del" "" "" "" "SGSH(NM_000199.4):c.1080delC (p.V361Sfs*52), SGSH(NM_000199.5):c.1080delC (p.V361Sfs*52)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80210882del" "" "pathogenic" "" "0000298181" "0" "10" "17" "78184679" "78184679" "subst" "0.0501449" "02325" "SGSH_000024" "g.78184679C>T" "" "" "" "SGSH(NM_000199.3):c.1081G>A (p.(Val361Ile)), SGSH(NM_000199.4):c.1081G>A (p.V361I), SGSH(NM_000199.5):c.1081G>A (p.V361I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80210880C>T" "" "benign" "" "0000298182" "0" "90" "17" "78190883" "78190883" "subst" "9.53982E-5" "02325" "SGSH_000008" "g.78190883G>C" "" "" "" "SGSH(NM_000199.4):c.197C>G (p.S66W), SGSH(NM_000199.5):c.197C>G (p.S66W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80217084G>C" "" "pathogenic" "" "0000298183" "0" "90" "17" "78190860" "78190860" "subst" "0.000145679" "02325" "SGSH_000011" "g.78190860G>A" "" "" "" "SGSH(NM_000199.4):c.220C>T (p.R74C), SGSH(NM_000199.5):c.220C>T (p.R74C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80217061G>A" "" "pathogenic" "" "0000298184" "0" "90" "17" "78188556" "78188556" "subst" "2.04548E-5" "02325" "SGSH_000035" "g.78188556C>T" "" "" "" "SGSH(NM_000199.4):c.364G>A (p.G122R), SGSH(NM_000199.5):c.364G>A (p.G122R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80214757C>T" "" "pathogenic" "" "0000298185" "0" "90" "17" "78187614" "78187614" "subst" "0.000330121" "02325" "SGSH_000003" "g.78187614C>T" "" "" "" "SGSH(NM_000199.3):c.734G>A (p.(Arg245His)), SGSH(NM_000199.4):c.734G>A (p.R245H), SGSH(NM_001352921.3):c.734G>A (p.R245H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80213815C>T" "" "pathogenic" "" "0000298186" "0" "90" "17" "78185942" "78185942" "subst" "2.84775E-5" "02325" "SGSH_000027" "g.78185942G>A" "" "" "" "SGSH(NM_000199.5):c.877C>T (p.P293S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80212143G>A" "" "pathogenic" "" "0000308001" "0" "90" "17" "78184681" "78184681" "del" "0" "01943" "SGSH_000025" "g.78184681del" "" "" "" "SGSH(NM_000199.4):c.1080delC (p.V361Sfs*52), SGSH(NM_000199.5):c.1080delC (p.V361Sfs*52)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80210882del" "" "pathogenic" "" "0000308002" "0" "10" "17" "78184679" "78184679" "subst" "0.0501449" "01943" "SGSH_000024" "g.78184679C>T" "" "" "" "SGSH(NM_000199.3):c.1081G>A (p.(Val361Ile)), SGSH(NM_000199.4):c.1081G>A (p.V361I), SGSH(NM_000199.5):c.1081G>A (p.V361I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80210880C>T" "" "benign" "" "0000308003" "0" "90" "17" "78184655" "78184655" "subst" "4.07349E-6" "01943" "SGSH_000022" "g.78184655C>T" "" "" "" "SGSH(NM_000199.4):c.1105G>A (p.E369K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80210856C>T" "" "pathogenic" "" "0000308004" "0" "90" "17" "78184655" "78184655" "subst" "4.07349E-6" "01943" "SGSH_000023" "g.78184655C>A" "" "" "" "SGSH(NM_000199.4):c.1105G>T (p.E369*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80210856C>A" "" "pathogenic" "" "0000308005" "0" "90" "17" "78184630" "78184630" "subst" "4.06544E-6" "01943" "SGSH_000021" "g.78184630C>T" "" "" "" "SGSH(NM_000199.4):c.1130G>A (p.R377H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80210831C>T" "" "pathogenic" "" "0000308006" "0" "90" "17" "78184621" "78184621" "subst" "3.25148E-5" "01943" "SGSH_000020" "g.78184621T>C" "" "" "" "SGSH(NM_000199.3):c.1139A>G (p.(Gln380Arg)), SGSH(NM_000199.4):c.1139A>G (p.Q380R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80210822T>C" "" "pathogenic" "" "0000308007" "0" "90" "17" "78184552" "78184554" "del" "0" "01943" "SGSH_000009" "g.78184552_78184554del" "" "" "" "SGSH(NM_000199.4):c.1207_1209delTAC (p.Y403del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80210753_80210755del" "" "pathogenic" "" "0000308008" "0" "90" "17" "78184463" "78184463" "subst" "1.62741E-5" "01943" "SGSH_000017" "g.78184463G>A" "" "" "" "SGSH(NM_000199.4):c.1297C>T (p.R433W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80210664G>A" "" "pathogenic" "" "0000308009" "0" "90" "17" "78184462" "78184462" "subst" "1.22062E-5" "01943" "SGSH_000016" "g.78184462C>T" "" "" "" "SGSH(NM_000199.3):c.1298G>A (p.(Arg433Gln)), SGSH(NM_000199.4):c.1298G>A (p.R433Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80210663C>T" "" "pathogenic" "" "0000308010" "0" "10" "17" "78184393" "78184393" "subst" "0.368056" "01943" "SGSH_000015" "g.78184393C>T" "" "" "" "SGSH(NM_000199.4):c.1367G>A (p.R456H), SGSH(NM_000199.5):c.1367G>A (p.R456H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80210594C>T" "" "benign" "" "0000308011" "0" "90" "17" "78190883" "78190883" "subst" "9.53982E-5" "01943" "SGSH_000008" "g.78190883G>C" "" "" "" "SGSH(NM_000199.4):c.197C>G (p.S66W), SGSH(NM_000199.5):c.197C>G (p.S66W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80217084G>C" "" "pathogenic" "" "0000308012" "0" "90" "17" "78190860" "78190860" "subst" "0.000145679" "01943" "SGSH_000011" "g.78190860G>A" "" "" "" "SGSH(NM_000199.4):c.220C>T (p.R74C), SGSH(NM_000199.5):c.220C>T (p.R74C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80217061G>A" "" "pathogenic" "" "0000308013" "0" "10" "17" "78188963" "78188963" "subst" "0.509821" "01943" "SGSH_000036" "g.78188963G>A" "" "" "" "SGSH(NM_000199.4):c.250-26C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80215164G>A" "" "benign" "" "0000308014" "0" "90" "17" "78188556" "78188556" "subst" "2.04548E-5" "01943" "SGSH_000035" "g.78188556C>T" "" "" "" "SGSH(NM_000199.4):c.364G>A (p.G122R), SGSH(NM_000199.5):c.364G>A (p.G122R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80214757C>T" "" "pathogenic" "" "0000308016" "0" "90" "17" "78188471" "78188471" "subst" "1.62692E-5" "01943" "SGSH_000033" "g.78188471C>T" "" "" "" "SGSH(NM_000199.4):c.449G>A (p.R150Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80214672C>T" "" "pathogenic" "" "0000308017" "0" "90" "17" "78188063" "78188063" "subst" "1.66152E-5" "01943" "SGSH_000032" "g.78188063C>T" "" "" "" "SGSH(NM_000199.4):c.571G>A (p.G191R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80214264C>T" "" "pathogenic" "" "0000308018" "0" "10" "17" "78187720" "78187723" "delins" "0" "01943" "SGSH_000029" "g.78187720_78187723delinsGC" "" "" "" "SGSH(NM_000199.4):c.664-39_664-36delCTGTinsGC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80213921_80213924delinsGC" "" "benign" "" "0000308019" "0" "90" "17" "78187614" "78187614" "subst" "0.000330121" "01943" "SGSH_000003" "g.78187614C>T" "" "" "" "SGSH(NM_000199.3):c.734G>A (p.(Arg245His)), SGSH(NM_000199.4):c.734G>A (p.R245H), SGSH(NM_001352921.3):c.734G>A (p.R245H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80213815C>T" "" "pathogenic" "" "0000308020" "0" "90" "17" "78186002" "78186002" "subst" "8.14551E-6" "01943" "SGSH_000028" "g.78186002C>T" "" "" "" "SGSH(NM_000199.4):c.817G>A (p.D273N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80212203C>T" "" "pathogenic" "" "0000308324" "0" "50" "17" "78195427" "78195427" "subst" "0" "01943" "SLC26A11_000001" "g.78195427G>A" "" "" "" "SLC26A11(NM_001166347.2):c.68G>A (p.C23Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80221628G>A" "" "VUS" "" "0000325753" "0" "30" "17" "78182048" "78182048" "subst" "0.00170218" "01804" "CARD14_000016" "g.78182048C>G" "" "" "" "CARD14(NM_024110.4):c.2919C>G (p.D973E, p.(Asp973Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80208249C>G" "" "likely benign" "" "0000342397" "0" "90" "17" "78187614" "78187614" "subst" "0.000330121" "02327" "SGSH_000003" "g.78187614C>T" "" "" "" "SGSH(NM_000199.3):c.734G>A (p.(Arg245His)), SGSH(NM_000199.4):c.734G>A (p.R245H), SGSH(NM_001352921.3):c.734G>A (p.R245H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80213815C>T" "" "pathogenic" "" "0000348918" "0" "90" "17" "78185927" "78185927" "subst" "9.35423E-5" "02327" "SGSH_000001" "g.78185927A>G" "" "" "" "SGSH(NM_000199.3):c.892T>C (p.(Ser298Pro)), SGSH(NM_000199.4):c.892T>C (p.S298P), SGSH(NM_000199.5):c.892T>C (p.S298P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.80212128A>G" "" "pathogenic" "" "0000467287" "3" "90" "17" "78194111" "78194111" "subst" "0" "00006" "SGSH_000038" "g.78194111A>G" "" "{PMID:Ouesleti 2011:21910976}" "" "" "" "Germline" "" "" "0" "" "" "g.80220312A>G" "" "pathogenic (recessive)" "" "0000467288" "3" "90" "17" "78184667" "78184667" "subst" "0" "00006" "SGSH_000039" "g.78184667G>A" "" "{PMID:Ouesleti 2011:21910976}" "" "" "" "Germline" "" "" "0" "" "" "g.80210868G>A" "" "pathogenic (recessive)" "" "0000467289" "3" "90" "17" "78194084" "78194084" "dup" "0" "00006" "SGSH_000040" "g.78194084dup" "" "{PMID:Ouesleti 2011:21910976}" "" "" "" "Germline" "" "" "0" "" "" "g.80220285dup" "" "pathogenic (recessive)" "" "0000467290" "3" "90" "17" "78190883" "78190883" "subst" "9.53982E-5" "00006" "SGSH_000008" "g.78190883G>C" "" "{PMID:Ouesleti 2011:21910976}" "" "" "" "Germline" "" "" "0" "" "" "g.80217084G>C" "" "pathogenic (recessive)" "" "0000467291" "3" "90" "17" "78184681" "78184681" "del" "0" "00006" "SGSH_000025" "g.78184681del" "" "{PMID:Ouesleti 2011:21910976}" "" "" "" "Germline" "" "" "0" "" "" "g.80210882del" "" "pathogenic (recessive)" "" "0000467292" "1" "90" "17" "78184631" "78184631" "subst" "3.65913E-5" "00006" "SGSH_000041" "g.78184631G>A" "" "{PMID:Ouesleti 2011:21910976}" "" "" "" "Germline" "" "" "0" "" "" "g.80210832G>A" "" "pathogenic (recessive)" "" "0000467293" "2" "90" "17" "78187707" "78194799" "del" "0" "00006" "SGSH_000042" "g.78187707_78194799del" "" "{PMID:Ouesleti 2011:21910976}" "" "g.75802301_75809393del" "" "Germline" "" "" "0" "" "" "g.80213908_80221000del" "" "pathogenic (recessive)" "" "0000467294" "3" "90" "17" "78187707" "78194799" "del" "0" "00006" "SGSH_000042" "g.78187707_78194799del" "" "{PMID:Ouesleti 2011:21910976}" "" "g.75802301_75809393del" "" "Germline" "" "" "0" "" "" "g.80213908_80221000del" "" "pathogenic (recessive)" "" "0000563562" "0" "50" "17" "78155359" "78155359" "subst" "0" "01943" "SGSH_000043" "g.78155359C>T" "" "" "" "CARD14(NM_024110.4):c.122C>T (p.P41L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80181560C>T" "" "VUS" "" "0000563563" "0" "10" "17" "78155422" "78155422" "subst" "0.00130456" "01943" "CARD14_000012" "g.78155422G>A" "" "" "" "CARD14(NM_024110.4):c.185G>A (p.R62Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80181623G>A" "" "benign" "" "0000563564" "0" "50" "17" "78155442" "78155442" "subst" "0.000149148" "02327" "SGSH_000044" "g.78155442C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80181643C>T" "" "VUS" "" "0000563565" "0" "30" "17" "78155455" "78155455" "subst" "5.14169E-5" "02326" "SGSH_000045" "g.78155455G>A" "" "" "" "CARD14(NM_024110.4):c.211+7G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80181656G>A" "" "likely benign" "" "0000563566" "0" "30" "17" "78156585" "78156585" "subst" "4.06296E-5" "02326" "SGSH_000046" "g.78156585T>C" "" "" "" "CARD14(NM_001366385.1):c.345T>C (p.F115=), CARD14(NM_024110.4):c.345T>C (p.F115=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80182786T>C" "" "likely benign" "" "0000563567" "0" "50" "17" "78157769" "78157769" "subst" "0" "02327" "SGSH_000047" "g.78157769A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80183970A>C" "" "VUS" "" "0000563568" "0" "70" "17" "78157802" "78157804" "del" "0" "02327" "SGSH_000048" "g.78157802_78157804del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80184003_80184005del" "" "likely pathogenic" "" "0000563569" "0" "30" "17" "78162324" "78162324" "subst" "0.000142937" "02325" "SGSH_000049" "g.78162324G>A" "" "" "" "CARD14(NM_024110.4):c.824G>A (p.R275H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80188525G>A" "" "likely benign" "" "0000563570" "0" "50" "17" "78163633" "78163633" "subst" "1.37961E-5" "01943" "SGSH_000050" "g.78163633C>T" "" "" "" "CARD14(NM_024110.4):c.925C>T (p.R309W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80189834C>T" "" "VUS" "" "0000563571" "0" "30" "17" "78164621" "78164621" "subst" "0.000125885" "02326" "SGSH_000051" "g.78164621A>G" "" "" "" "CARD14(NM_024110.4):c.1012A>G (p.M338V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80190822A>G" "" "likely benign" "" "0000563572" "0" "50" "17" "78165123" "78165123" "subst" "0.000237293" "01943" "SGSH_000052" "g.78165123C>T" "" "" "" "CARD14(NM_024110.4):c.1091C>T (p.A364V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80191324C>T" "" "VUS" "" "0000563573" "0" "30" "17" "78165231" "78165231" "subst" "0.000130573" "01943" "SGSH_000053" "g.78165231G>A" "" "" "" "CARD14(NM_024110.4):c.1199G>A (p.R400H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80191432G>A" "" "likely benign" "" "0000563574" "0" "30" "17" "78166339" "78166339" "subst" "0.000150511" "01943" "SGSH_000054" "g.78166339G>A" "" "" "" "CARD14(NM_024110.4):c.1277G>A (p.R426Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80192540G>A" "" "likely benign" "" "0000563575" "0" "30" "17" "78169018" "78169018" "subst" "0.000347073" "02326" "SGSH_000055" "g.78169018C>T" "" "" "" "CARD14(NM_024110.4):c.1385C>T (p.T462M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80195219C>T" "" "likely benign" "" "0000563576" "0" "30" "17" "78169096" "78169096" "subst" "0" "02326" "SGSH_000056" "g.78169096T>C" "" "" "" "CARD14(NM_024110.4):c.1463T>C (p.V488A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80195297T>C" "" "likely benign" "" "0000563577" "0" "30" "17" "78169159" "78169187" "del" "0" "02326" "SGSH_000057" "g.78169159_78169187del" "" "" "" "CARD14(NM_001257970.1):c.1499+27_1499+55delCTGGGGTGGCACTGGGGTCCTTCCTGGCA, CARD14(NM_001366385.1):c.1499+27_1499+55delCTGGGGTGGCACTGGGGTCCTTCCTGGCA,..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80195360_80195388del" "" "likely benign" "" "0000563578" "0" "10" "17" "78171944" "78171944" "subst" "0.372038" "02325" "SGSH_000058" "g.78171944G>C" "" "" "" "CARD14(NM_024110.4):c.1641G>C (p.R547S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80198145G>C" "" "benign" "" "0000563579" "0" "50" "17" "78172242" "78172242" "subst" "0" "02325" "SGSH_000059" "g.78172242A>C" "" "" "" "CARD14(NM_024110.4):c.1703A>C (p.Q568P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80198443A>C" "" "VUS" "" "0000563580" "0" "30" "17" "78172277" "78172277" "subst" "0.000223688" "02326" "SGSH_000060" "g.78172277C>T" "" "" "" "CARD14(NM_024110.4):c.1738C>T (p.L580=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80198478C>T" "" "likely benign" "" "0000563581" "0" "30" "17" "78172345" "78172345" "subst" "0.000429961" "02326" "SGSH_000061" "g.78172345G>A" "" "" "" "CARD14(NM_024110.4):c.1806G>A (p.S602=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80198546G>A" "" "likely benign" "" "0000563582" "0" "50" "17" "78172368" "78172368" "subst" "0.000148123" "01943" "SGSH_000062" "g.78172368G>A" "" "" "" "CARD14(NM_024110.4):c.1829G>A (p.R610H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80198569G>A" "" "VUS" "" "0000563583" "0" "30" "17" "78175689" "78175689" "subst" "6.83603E-5" "02326" "SGSH_000063" "g.78175689C>T" "" "" "" "CARD14(NM_024110.4):c.1978+20C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80201890C>T" "" "likely benign" "" "0000563584" "0" "30" "17" "78178015" "78178015" "subst" "0" "02326" "SGSH_000064" "g.78178015C>T" "" "" "" "CARD14(NM_024110.4):c.2284-11C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80204216C>T" "" "likely benign" "" "0000563585" "0" "10" "17" "78178830" "78178830" "subst" "0.412511" "02325" "SGSH_000065" "g.78178830A>G" "" "" "" "CARD14(NM_024110.4):c.2399-4A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80205031A>G" "" "benign" "" "0000563587" "0" "30" "17" "78179466" "78179466" "subst" "0.00226918" "02326" "SGSH_000066" "g.78179466G>A" "" "" "" "CARD14(NM_024110.4):c.2691+15G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80205667G>A" "" "likely benign" "" "0000563588" "0" "30" "17" "78182048" "78182048" "subst" "0.00170218" "01943" "CARD14_000016" "g.78182048C>G" "" "" "" "CARD14(NM_024110.4):c.2919C>G (p.D973E, p.(Asp973Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80208249C>G" "" "likely benign" "" "0000563589" "0" "30" "17" "78182048" "78182048" "subst" "0.00170218" "02326" "CARD14_000016" "g.78182048C>G" "" "" "" "CARD14(NM_024110.4):c.2919C>G (p.D973E, p.(Asp973Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80208249C>G" "" "likely benign" "" "0000563590" "0" "30" "17" "78184314" "78184314" "subst" "0.000217684" "01943" "SGSH_000067" "g.78184314G>A" "" "" "" "SGSH(NM_000199.4):c.1446C>T (p.A482=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80210515G>A" "" "likely benign" "" "0000563591" "0" "90" "17" "78184322" "78184325" "dup" "0" "01943" "SGSH_000068" "g.78184322_78184325dup" "" "" "" "SGSH(NM_000199.4):c.1437_1440dupGGTG (p.C481Gfs*22)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80210523_80210526dup" "" "pathogenic" "" "0000563592" "0" "30" "17" "78184350" "78184350" "subst" "0" "02330" "SGSH_000069" "g.78184350C>T" "" "" "" "SGSH(NM_000199.5):c.1410G>A (p.K470=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80210551C>T" "" "likely benign" "" "0000563593" "0" "30" "17" "78184578" "78184578" "subst" "0.00327565" "01804" "SGSH_000070" "g.78184578C>A" "" "" "" "SGSH(NM_000199.3):c.1182G>T (p.(Met394Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80210779C>A" "" "likely benign" "" "0000563594" "0" "30" "17" "78184601" "78184601" "subst" "0.0135984" "01804" "SGSH_000019" "g.78184601C>T" "" "" "" "SGSH(NM_000199.3):c.1159G>A (p.(Val387Met)), SGSH(NM_000199.5):c.1159G>A (p.V387M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80210802C>T" "" "likely benign" "" "0000563595" "0" "30" "17" "78184616" "78184616" "subst" "4.47089E-5" "01804" "SGSH_000071" "g.78184616G>A" "" "" "" "SGSH(NM_000199.3):c.1144C>T (p.(Arg382Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80210817G>A" "" "likely benign" "" "0000563596" "0" "70" "17" "78184630" "78184630" "subst" "4.06544E-6" "02327" "SGSH_000021" "g.78184630C>T" "" "" "" "SGSH(NM_000199.4):c.1130G>A (p.R377H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80210831C>T" "" "likely pathogenic" "" "0000563597" "0" "10" "17" "78184644" "78184644" "subst" "0.00543522" "02330" "SGSH_000072" "g.78184644C>T" "" "" "" "SGSH(NM_000199.5):c.1116G>A (p.M372I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80210845C>T" "" "benign" "" "0000563598" "0" "30" "17" "78184679" "78184679" "subst" "0.0501449" "01804" "SGSH_000024" "g.78184679C>T" "" "" "" "SGSH(NM_000199.3):c.1081G>A (p.(Val361Ile)), SGSH(NM_000199.4):c.1081G>A (p.V361I), SGSH(NM_000199.5):c.1081G>A (p.V361I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80210880C>T" "" "likely benign" "" "0000563600" "0" "90" "17" "78185927" "78185927" "subst" "9.35423E-5" "01804" "SGSH_000001" "g.78185927A>G" "" "" "" "SGSH(NM_000199.3):c.892T>C (p.(Ser298Pro)), SGSH(NM_000199.4):c.892T>C (p.S298P), SGSH(NM_000199.5):c.892T>C (p.S298P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80212128A>G" "" "pathogenic" "" "0000563601" "0" "30" "17" "78186077" "78186077" "subst" "0.00971544" "01804" "SGSH_000074" "g.78186077T>C" "" "" "" "SGSH(NM_000199.3):c.746-4A>G (p.?), SGSH(NM_001352921.3):c.746-4A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80212278T>C" "" "likely benign" "" "0000563602" "0" "10" "17" "78187647" "78187647" "subst" "0.000722313" "02327" "SGSH_000004" "g.78187647G>C" "" "" "" "SGSH(NM_000199.4):c.701C>G (p.A234G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80213848G>C" "" "benign" "" "0000563603" "0" "10" "17" "78187954" "78187954" "subst" "0.451808" "02327" "SGSH_000030" "g.78187954A>G" "" "" "" "SGSH(NM_000199.4):c.663+17T>C, SGSH(NM_000199.5):c.663+17T>C, SGSH(NM_001352921.3):c.663+17T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80214155A>G" "" "benign" "" "0000563604" "0" "50" "17" "78187993" "78187993" "subst" "0.000278" "02330" "SGSH_000075" "g.78187993G>T" "" "" "" "SGSH(NM_000199.4):c.641C>A (p.A214D), SGSH(NM_000199.5):c.641C>A (p.A214D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80214194G>T" "" "VUS" "" "0000563605" "0" "30" "17" "78187993" "78187993" "subst" "0.000278" "01943" "SGSH_000075" "g.78187993G>T" "" "" "" "SGSH(NM_000199.4):c.641C>A (p.A214D), SGSH(NM_000199.5):c.641C>A (p.A214D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80214194G>T" "" "likely benign" "" "0000563606" "0" "50" "17" "78188089" "78188089" "subst" "2.08578E-5" "02327" "SGSH_000076" "g.78188089C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80214290C>T" "" "VUS" "" "0000563608" "0" "50" "17" "78188126" "78188126" "subst" "3.7859E-5" "01804" "SGSH_000078" "g.78188126G>C" "" "" "" "SGSH(NM_000199.3):c.508C>G (p.(Pro170Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80214327G>C" "" "VUS" "" "0000563609" "0" "10" "17" "78188509" "78188509" "subst" "0.00244" "02330" "SGSH_000079" "g.78188509C>T" "" "" "" "SGSH(NM_000199.4):c.411G>A (p.A137=), SGSH(NM_000199.5):c.411G>A (p.A137=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80214710C>T" "" "benign" "" "0000563610" "0" "30" "17" "78188509" "78188509" "subst" "0.00244" "01943" "SGSH_000079" "g.78188509C>T" "" "" "" "SGSH(NM_000199.4):c.411G>A (p.A137=), SGSH(NM_000199.5):c.411G>A (p.A137=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80214710C>T" "" "likely benign" "" "0000563611" "0" "90" "17" "78188544" "78188544" "dup" "0" "01943" "SGSH_000080" "g.78188544dup" "" "" "" "SGSH(NM_000199.4):c.376dupG (p.V126Gfs*10)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80214745dup" "" "pathogenic" "" "0000616899" "0" "30" "17" "78155272" "78155272" "subst" "0.000155809" "01943" "SGSH_000082" "g.78155272C>T" "" "" "" "CARD14(NM_024110.4):c.35C>T (p.T12M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80181473C>T" "" "likely benign" "" "0000616900" "0" "30" "17" "78157932" "78157932" "subst" "0" "01943" "SGSH_000084" "g.78157932G>A" "" "" "" "CARD14(NM_024110.4):c.570G>A (p.E190=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80184133G>A" "" "likely benign" "" "0000616901" "0" "30" "17" "78182057" "78182057" "subst" "0" "02325" "SGSH_000088" "g.78182057C>T" "" "" "" "CARD14(NM_024110.4):c.2928C>T (p.S976=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80208258C>T" "" "likely benign" "" "0000616902" "0" "90" "17" "78184625" "78184625" "del" "0" "01943" "SGSH_000090" "g.78184625del" "" "" "" "SGSH(NM_000199.4):c.1135delG (p.V379Cfs*34)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80210826del" "" "pathogenic" "" "0000616903" "0" "50" "17" "78186011" "78186011" "subst" "6.92521E-5" "01804" "SGSH_000091" "g.78186011A>G" "" "" "" "SGSH(NM_000199.3):c.808T>C (p.(Phe270Leu)), SGSH(NM_001352921.3):c.808T>C (p.F270L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80212212A>G" "" "VUS" "" "0000616904" "0" "30" "17" "78187976" "78187976" "subst" "0.000190096" "01804" "SGSH_000092" "g.78187976C>A" "" "" "" "SGSH(NM_000199.3):c.658G>T (p.(Val220Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80214177C>A" "" "likely benign" "" "0000616905" "0" "50" "17" "78188843" "78188843" "subst" "1.23141E-5" "01943" "SGSH_000095" "g.78188843C>A" "" "" "" "SGSH(NM_000199.4):c.344G>T (p.G115V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80215044C>A" "" "VUS" "" "0000623780" "0" "50" "17" "78155448" "78155448" "subst" "0" "01943" "SGSH_000083" "g.78155448G>A" "" "" "" "CARD14(NM_024110.4):c.211G>A (p.G71R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80181649G>A" "" "VUS" "" "0000623781" "0" "30" "17" "78166436" "78166437" "del" "0" "02326" "SGSH_000085" "g.78166436_78166437del" "" "" "" "CARD14(NM_024110.4):c.1356+18_1356+19delGC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80192637_80192638del" "" "likely benign" "" "0000623782" "0" "30" "17" "78177680" "78177680" "subst" "0" "02325" "SGSH_000086" "g.78177680G>A" "" "" "" "CARD14(NM_024110.4):c.2279G>A (p.R760H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80203881G>A" "" "likely benign" "" "0000623783" "0" "30" "17" "78181988" "78181988" "subst" "0.000853683" "02326" "SGSH_000087" "g.78181988G>A" "" "" "" "CARD14(NM_024110.4):c.2859G>A (p.A953=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80208189G>A" "" "likely benign" "" "0000623784" "0" "30" "17" "78184477" "78184477" "subst" "0.000439271" "01943" "SGSH_000089" "g.78184477C>T" "" "" "" "SGSH(NM_000199.4):c.1283G>A (p.R428H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80210678C>T" "" "likely benign" "" "0000623785" "0" "50" "17" "78186011" "78186011" "subst" "6.92521E-5" "02325" "SGSH_000091" "g.78186011A>G" "" "" "" "SGSH(NM_000199.3):c.808T>C (p.(Phe270Leu)), SGSH(NM_001352921.3):c.808T>C (p.F270L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80212212A>G" "" "VUS" "" "0000623786" "0" "50" "17" "78188036" "78188036" "subst" "4.1448E-6" "01943" "SGSH_000093" "g.78188036C>T" "" "" "" "SGSH(NM_001352921.1):c.598G>A (p.G200R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80214237C>T" "" "VUS" "" "0000623787" "0" "50" "17" "78188837" "78188837" "subst" "0" "02325" "SGSH_000094" "g.78188837C>A" "" "" "" "SGSH(NM_001352921.3):c.350G>T (p.R117L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80215038C>A" "" "VUS" "" "0000649743" "1" "10" "17" "78181951" "78181951" "subst" "0.000991765" "03575" "SGSH_000096" "g.78181951G>A" "3/2781 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "3 heterozygous, no homozygous; {DB:CLININrs74000616}" "Germline" "" "rs74000616" "0" "" "" "g.80208152G>A" "" "benign" "" "0000649744" "1" "70" "17" "78184421" "78184421" "subst" "6.92848E-5" "03575" "SGSH_000006" "g.78184421C>T" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs104894639}" "Germline" "" "rs104894639" "0" "" "" "g.80210622C>T" "" "likely pathogenic" "" "0000649745" "1" "10" "17" "78184601" "78184601" "subst" "0.0135984" "03575" "SGSH_000019" "g.78184601C>T" "178/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "178 heterozygous; {DB:CLININrs62620232}" "Germline" "" "rs62620232" "0" "" "" "g.80210802C>T" "" "benign" "" "0000658288" "0" "30" "17" "78156585" "78156585" "subst" "4.06296E-5" "01943" "SGSH_000046" "g.78156585T>C" "" "" "" "CARD14(NM_001366385.1):c.345T>C (p.F115=), CARD14(NM_024110.4):c.345T>C (p.F115=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80182786T>C" "" "likely benign" "" "0000658289" "0" "30" "17" "78163630" "78163630" "subst" "0.000711594" "02326" "SGSH_000097" "g.78163630C>T" "" "" "" "CARD14(NM_024110.4):c.922C>T (p.L308=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80189831C>T" "" "likely benign" "" "0000658290" "0" "70" "17" "78164572" "78164572" "subst" "0" "01943" "SGSH_000098" "g.78164572G>A" "" "" "" "CARD14(NM_001366385.1):c.964-1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80190773G>A" "" "likely pathogenic" "" "0000658291" "0" "30" "17" "78165166" "78165166" "subst" "0.000374626" "02326" "SGSH_000099" "g.78165166C>G" "" "" "" "CARD14(NM_024110.4):c.1134C>G (p.S378R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.80191367C>G" "" "likely benign" "" "0000669427" "3" "10" "17" "78184601" "78184601" "subst" "0.0135984" "03575" "SGSH_000019" "g.78184601C>T" "2/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "2 homozygous; {DB:CLININrs62620232}" "Germline" "" "rs62620232" "0" "" "" "g.80210802C>T" "" "benign" "" "0000669428" "3" "50" "17" "78187976" "78187976" "subst" "0.000190096" "03575" "SGSH_000092" "g.78187976C>A" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 homozygous; {DB:CLININrs150508741}" "Germline" "" "rs150508741" "0" "" "" "g.80214177C>A" "" "VUS" "" "0000681063" "0" "30" "17" "78166404" "78166404" "subst" "1.62951E-5" "02326" "SGSH_000100" "g.78166404G>A" "" "" "" "CARD14(NM_024110.4):c.1342G>A (p.V448I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000681064" "0" "30" "17" "78169447" "78169447" "subst" "4.99048E-5" "01943" "SGSH_000101" "g.78169447G>A" "" "" "" "CARD14(NM_001366385.1):c.1590G>A (p.T530=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000681065" "0" "30" "17" "78184545" "78184545" "subst" "4.06491E-6" "01943" "SGSH_000102" "g.78184545T>G" "" "" "" "SGSH(NM_000199.4):c.1215A>C (p.S405=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000681066" "0" "30" "17" "78188134" "78188134" "subst" "0.000312339" "01943" "SGSH_000103" "g.78188134G>A" "" "" "" "SGSH(NM_000199.3):c.507-7C>T (p.(=)), SGSH(NM_001352921.1):c.507-7C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000692505" "0" "50" "17" "78156474" "78156474" "subst" "0.000219425" "01943" "SGSH_000104" "g.78156474G>T" "" "" "" "CARD14(NM_024110.4):c.234G>T (p.K78N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000692506" "0" "30" "17" "78157740" "78157740" "subst" "0.00216151" "01943" "SGSH_000105" "g.78157740G>A" "" "" "" "CARD14(NM_024110.4):c.378G>A (p.E126=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000692507" "0" "30" "17" "78166422" "78166422" "subst" "0.000315179" "02325" "SGSH_000106" "g.78166422C>T" "" "" "" "CARD14(NM_024110.4):c.1356+4C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000692508" "0" "30" "17" "78184671" "78184671" "subst" "8.158E-6" "01943" "SGSH_000107" "g.78184671G>A" "" "" "" "SGSH(NM_000199.4):c.1089C>T (p.G363=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000692509" "0" "50" "17" "78190917" "78190917" "subst" "0.000778612" "01943" "SGSH_000108" "g.78190917G>A" "" "" "" "SGSH(NM_001352921.1):c.163C>T (p.R55C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000692510" "0" "50" "17" "78194025" "78194025" "subst" "8.92124E-6" "01943" "SGSH_000109" "g.78194025C>T" "" "" "" "SGSH(NM_001352921.1):c.88G>A (p.A30T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000693913" "11" "50" "17" "78190860" "78190860" "subst" "0.000145679" "03763" "SGSH_000011" "g.78190860G>A" "" "{PMID:Kaiwar 2017:28963436}" "" "" "" "Germline" "?" "" "0" "" "" "" "" "VUS" "" "0000726748" "0" "30" "17" "78157811" "78157811" "subst" "0.00102682" "01943" "CARD14_000013" "g.78157811T>G" "" "" "" "CARD14(NM_001366385.1):c.449T>G (p.L150R), CARD14(NM_024110.4):c.449T>G (p.L150R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000726749" "0" "30" "17" "78157842" "78157842" "subst" "0" "01943" "SGSH_000110" "g.78157842G>A" "" "" "" "CARD14(NM_024110.4):c.480G>A (p.L160=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000726750" "0" "50" "17" "78165230" "78165230" "subst" "5.30331E-5" "01943" "SGSH_000111" "g.78165230C>T" "" "" "" "CARD14(NM_024110.4):c.1198C>T (p.R400C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000726751" "0" "30" "17" "78178911" "78178911" "subst" "0.000265486" "01943" "CARD14_000041" "g.78178911C>T" "" "" "" "CARD14(NM_001366385.1):c.2476C>T (p.R826W), CARD14(NM_024110.4):c.2476C>T (p.R826W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000726752" "0" "30" "17" "78180852" "78180852" "subst" "0.00119058" "01943" "SGSH_000112" "g.78180852C>T" "" "" "" "CARD14(NM_001366385.1):c.2775C>T (p.V925=), CARD14(NM_024110.4):c.2775C>T (p.V925=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000726753" "0" "50" "17" "78182013" "78182013" "subst" "4.97179E-5" "01943" "SGSH_000113" "g.78182013C>T" "" "" "" "CARD14(NM_024110.4):c.2884C>T (p.R962W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000726754" "0" "50" "17" "78184438" "78184438" "subst" "0.0008756" "01943" "SGSH_000114" "g.78184438C>T" "" "" "" "SGSH(NM_000199.3):c.1322G>A (p.(Arg441Gln)), SGSH(NM_000199.4):c.1322G>A (p.R441Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000726755" "0" "50" "17" "78184885" "78184885" "subst" "0" "01943" "SGSH_000116" "g.78184885C>T" "" "" "" "SGSH(NM_001352921.1):c.1051G>A (p.V351I), SGSH(NM_001352921.3):c.1051G>A (p.(Val351Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000726756" "0" "50" "17" "78186067" "78186067" "subst" "0.00175917" "01943" "SGSH_000117" "g.78186067C>G" "" "" "" "SGSH(NM_001352921.1):c.752G>C (p.G251A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000726757" "0" "50" "17" "78187647" "78187647" "subst" "0.000722313" "02329" "SGSH_000004" "g.78187647G>C" "" "" "" "SGSH(NM_000199.4):c.701C>G (p.A234G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000726758" "0" "30" "17" "78188017" "78188017" "subst" "0" "01804" "SGSH_000118" "g.78188017C>T" "" "" "" "SGSH(NM_000199.3):c.617G>A (p.(Arg206His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000726759" "0" "10" "17" "78188112" "78188112" "subst" "0.00145892" "02330" "SGSH_000119" "g.78188112G>A" "" "" "" "SGSH(NM_000199.5):c.522C>T (p.(Tyr174=)), SGSH(NM_001352921.3):c.522C>T (p.Y174=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000726760" "0" "30" "17" "78190903" "78190903" "subst" "0" "01943" "SGSH_000120" "g.78190903G>A" "" "" "" "SGSH(NM_001352921.1):c.177C>T (p.L59=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000726761" "0" "30" "17" "78196546" "78196546" "subst" "0.000154303" "01943" "SGSH_000121" "g.78196546C>A" "" "" "" "SLC26A11(NM_173626.3):c.327C>A (p.S109=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000730065" "3" "90" "17" "78184657" "78184657" "subst" "0" "00000" "SGSH_000115" "g.78184657T>C" "" "{PMID:Maddirevula 2018:29620724}" "" "NM_000199.3:c.1103A>G:p.(His368Arg)" "" "Germline" "" "" "0" "" "" "g.80210858T>C" "" "likely pathogenic (recessive)" "" "0000763558" "3" "90" "17" "78190969" "78190969" "subst" "0" "03219" "SGSH_000122" "g.78190969A>T" "" "" "" "" "" "Germline" "" "" "" "" "" "" "" "likely pathogenic" "ACMG" "0000787032" "1" "50" "17" "78194030" "78194030" "subst" "0" "00006" "SGSH_000123" "g.78194030A>G" "" "{PMID:Ganapathy 2019:31069529}" "" "" "" "Germline" "" "" "0" "" "" "g.80220231A>G" "" "VUS" "" "0000787526" "2" "70" "17" "78188063" "78188063" "subst" "1.66152E-5" "00000" "SGSH_000032" "g.78188063C>T" "" "0" "" "" "" "Germline" "" "" "0" "" "" "g.80214264C>T" "" "likely pathogenic" "" "0000793847" "0" "90" "17" "78194111" "78194111" "subst" "0" "00000" "SGSH_000038" "g.78194111A>G" "" "{PMID:Ousleti-2011:21910976}" "" "c.2T>C" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000793848" "0" "90" "17" "78194111" "78194111" "subst" "0" "00000" "SGSH_000038" "g.78194111A>G" "" "{PMID:Ousleti-2011:21910976}" "" "c.2T>C" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000793849" "0" "90" "17" "78184631" "78184631" "subst" "3.65913E-5" "00000" "SGSH_000041" "g.78184631G>A" "" "{PMID:Ousleti-2011:21910976}" "" "c.1129C>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000793851" "0" "90" "17" "78184667" "78184667" "subst" "0" "00000" "SGSH_000039" "g.78184667G>A" "" "{PMID:Ousleti-2011:21910976}" "" "c.1093C>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000793852" "0" "90" "17" "78184667" "78184667" "subst" "0" "00000" "SGSH_000039" "g.78184667G>A" "" "{PMID:Ousleti-2011:21910976}" "" "c.1093C>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000793853" "0" "90" "17" "78194084" "78194084" "dup" "0" "00000" "SGSH_000040" "g.78194084dup" "" "{PMID:Ousleti-2011:21910976}" "" "c.29dup" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000793854" "0" "90" "17" "78194084" "78194084" "dup" "0" "00000" "SGSH_000040" "g.78194084dup" "" "{PMID:Ousleti-2011:21910976}" "" "c.29dup" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000793855" "0" "90" "17" "78190883" "78190883" "subst" "9.53982E-5" "00000" "SGSH_000008" "g.78190883G>C" "" "{PMID:Ousleti-2011:21910976}" "" "c.197C>G" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000793856" "0" "90" "17" "78190883" "78190883" "subst" "9.53982E-5" "00000" "SGSH_000008" "g.78190883G>C" "" "{PMID:Ousleti-2011:21910976}" "" "c.197C>G" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000793857" "0" "90" "17" "78184680" "78184680" "del" "6.93906E-5" "00000" "SGSH_000025" "g.78184680del" "" "{PMID:Ousleti-2011:21910976}" "" "c.1080del" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000793858" "0" "90" "17" "78184680" "78184680" "del" "6.93906E-5" "00000" "SGSH_000025" "g.78184680del" "" "{PMID:Ousleti-2011:21910976}" "" "c.1080del" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000808317" "0" "50" "17" "78157858" "78157858" "subst" "4.6253E-5" "01943" "SGSH_000124" "g.78157858C>T" "" "" "" "CARD14(NM_001366385.1):c.496C>T (p.R166C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000808318" "0" "30" "17" "78171964" "78171964" "subst" "0" "02325" "SGSH_000125" "g.78171964A>G" "" "" "" "CARD14(NM_024110.4):c.1658+3A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000808319" "0" "50" "17" "78172242" "78172242" "subst" "0" "01943" "SGSH_000059" "g.78172242A>C" "" "" "" "CARD14(NM_024110.4):c.1703A>C (p.Q568P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000808320" "0" "30" "17" "78172311" "78172311" "subst" "0.000689222" "01943" "SGSH_000126" "g.78172311C>T" "" "" "" "CARD14(NM_024110.4):c.1772C>T (p.T591M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000808321" "0" "30" "17" "78178974" "78178974" "subst" "8.14817E-6" "01943" "SGSH_000127" "g.78178974C>T" "" "" "" "CARD14(NM_024110.4):c.2539C>T (p.L847F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000808322" "0" "30" "17" "78179465" "78179465" "subst" "0" "02326" "SGSH_000128" "g.78179465C>G" "" "" "" "CARD14(NM_024110.4):c.2691+14C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000808323" "0" "30" "17" "78180812" "78180812" "subst" "4.06319E-5" "02326" "SGSH_000129" "g.78180812C>G" "" "" "" "CARD14(NM_024110.4):c.2735C>G (p.T912S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000808324" "0" "50" "17" "78184452" "78184452" "subst" "0" "01943" "SGSH_000130" "g.78184452C>G" "" "" "" "SGSH(NM_000199.4):c.1308G>C (p.W436C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000808325" "0" "90" "17" "78184593" "78184593" "subst" "2.03212E-5" "02325" "SGSH_000131" "g.78184593G>T" "" "" "" "SGSH(NM_000199.5):c.1167C>A (p.N389K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000808326" "0" "50" "17" "78184903" "78184903" "subst" "0" "01943" "SGSH_000132" "g.78184903C>T" "" "" "" "SGSH(NM_001352921.1):c.1033G>A (p.G345R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000808327" "0" "70" "17" "78190859" "78190859" "subst" "0" "02327" "SGSH_000133" "g.78190859C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000855145" "0" "30" "17" "78162169" "78162169" "subst" "4.20239E-6" "01943" "SGSH_000134" "g.78162169C>T" "" "" "" "CARD14(NM_001257970.1):c.676-7C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000855146" "0" "30" "17" "78162359" "78162359" "subst" "0.00327327" "02326" "SGSH_000135" "g.78162359C>T" "" "" "" "CARD14(NM_024110.4):c.843+16C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000855147" "0" "50" "17" "78172344" "78172344" "subst" "0.000221101" "02325" "SGSH_000137" "g.78172344C>T" "" "" "" "CARD14(NM_024110.4):c.1805C>T (p.S602L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000855148" "0" "50" "17" "78175668" "78175668" "subst" "6.56814E-5" "01943" "SGSH_000139" "g.78175668C>T" "" "" "" "CARD14(NM_001366385.1):c.1977C>T (p.D659=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000855149" "0" "10" "17" "78176044" "78176044" "subst" "0.011201" "02325" "CARD14_000014" "g.78176044C>T" "" "" "" "CARD14(NM_024110.4):c.2044C>T (p.R682W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000855150" "0" "10" "17" "78184679" "78184679" "subst" "0.0501449" "02326" "SGSH_000024" "g.78184679C>T" "" "" "" "SGSH(NM_000199.3):c.1081G>A (p.(Val361Ile)), SGSH(NM_000199.4):c.1081G>A (p.V361I), SGSH(NM_000199.5):c.1081G>A (p.V361I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000855151" "0" "50" "17" "78184711" "78184711" "subst" "4.53246E-5" "01943" "SGSH_000143" "g.78184711G>A" "" "" "" "SGSH(NM_000199.4):c.1049C>T (p.P350L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000855152" "0" "50" "17" "78186068" "78186068" "subst" "1.29793E-5" "01943" "SGSH_000144" "g.78186068C>T" "" "" "" "SGSH(NM_001352921.1):c.751G>A (p.G251R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000865541" "0" "30" "17" "78164674" "78164674" "subst" "0.000553381" "01943" "CARD14_000023" "g.78164674C>T" "" "" "" "CARD14(NM_024110.4):c.1065C>T (p.C355=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000865542" "0" "30" "17" "78166388" "78166388" "subst" "0" "01943" "SGSH_000136" "g.78166388C>G" "" "" "" "CARD14(NM_001366385.1):c.1326C>G (p.D442E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000865543" "0" "50" "17" "78172406" "78172406" "subst" "0.000141185" "01943" "SGSH_000138" "g.78172406C>T" "" "" "" "CARD14(NM_052819.2):c.1156C>T (p.P386S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000865544" "0" "30" "17" "78176193" "78176193" "subst" "0.00214976" "02326" "SGSH_000140" "g.78176193G>A" "" "" "" "CARD14(NM_024110.4):c.2193G>A (p.A731=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000865545" "0" "30" "17" "78180840" "78180840" "subst" "0.00143019" "02326" "SGSH_000141" "g.78180840C>T" "" "" "" "CARD14(NM_024110.4):c.2763C>T (p.I921=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000865546" "0" "30" "17" "78181958" "78181958" "subst" "0.0012413" "02326" "SGSH_000142" "g.78181958C>T" "" "" "" "CARD14(NM_024110.4):c.2829C>T (p.G943=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000865547" "0" "10" "17" "78184393" "78184393" "subst" "0.368056" "02327" "SGSH_000015" "g.78184393C>T" "" "" "" "SGSH(NM_000199.4):c.1367G>A (p.R456H), SGSH(NM_000199.5):c.1367G>A (p.R456H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000865548" "0" "90" "17" "78184621" "78184621" "subst" "3.25148E-5" "01804" "SGSH_000020" "g.78184621T>C" "" "" "" "SGSH(NM_000199.3):c.1139A>G (p.(Gln380Arg)), SGSH(NM_000199.4):c.1139A>G (p.Q380R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000865549" "0" "90" "17" "78184655" "78184655" "subst" "4.07349E-6" "02327" "SGSH_000022" "g.78184655C>T" "" "" "" "SGSH(NM_000199.4):c.1105G>A (p.E369K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000865550" "0" "30" "17" "78188426" "78188426" "subst" "4.0792E-6" "01943" "SGSH_000145" "g.78188426G>C" "" "" "" "SGSH(NM_001352921.1):c.494C>G (p.T165S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000865551" "0" "90" "17" "78190860" "78190860" "subst" "0.000145679" "02327" "SGSH_000011" "g.78190860G>A" "" "" "" "SGSH(NM_000199.4):c.220C>T (p.R74C), SGSH(NM_000199.5):c.220C>T (p.R74C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000894334" "0" "30" "17" "78155199" "78155199" "subst" "0.000503807" "02326" "SGSH_000146" "g.78155199C>T" "" "" "" "CARD14(NM_024110.4):c.-20-19C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000894335" "0" "50" "17" "78155271" "78155271" "dup" "0" "02325" "SGSH_000147" "g.78155271dup" "" "" "" "CARD14(NM_024110.4):c.34dupA (p.T12Nfs*87)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000894336" "0" "90" "17" "78156590" "78156590" "subst" "0" "02327" "SGSH_000148" "g.78156590G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000894337" "0" "30" "17" "78157740" "78157740" "subst" "0.00216151" "02326" "SGSH_000105" "g.78157740G>A" "" "" "" "CARD14(NM_024110.4):c.378G>A (p.E126=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000894338" "0" "30" "17" "78163668" "78163668" "subst" "0.00125563" "02326" "SGSH_000149" "g.78163668G>A" "" "" "" "CARD14(NM_024110.4):c.960G>A (p.E320=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000894339" "0" "30" "17" "78166436" "78166436" "subst" "0.000347682" "02326" "SGSH_000150" "g.78166436G>A" "" "" "" "CARD14(NM_024110.4):c.1356+18G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000894340" "0" "10" "17" "78169145" "78169145" "subst" "0.00230991" "02326" "SGSH_000151" "g.78169145G>A" "" "" "" "CARD14(NM_024110.4):c.1499+13G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000894341" "0" "30" "17" "78169455" "78169455" "subst" "2.55074E-5" "02326" "SGSH_000152" "g.78169455A>G" "" "" "" "CARD14(NM_024110.4):c.1594+4A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000894342" "0" "50" "17" "78176201" "78176201" "subst" "8.19155E-6" "02329" "SGSH_000153" "g.78176201C>T" "" "" "" "CARD14(NM_001366385.1):c.2201C>T (p.T734I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000894343" "0" "30" "17" "78177668" "78177668" "subst" "0.00229269" "02326" "SGSH_000154" "g.78177668G>A" "" "" "" "CARD14(NM_024110.4):c.2267G>A (p.C756Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000894344" "0" "30" "17" "78179401" "78179401" "subst" "5.24054E-5" "02326" "SGSH_000155" "g.78179401G>A" "" "" "" "CARD14(NM_024110.4):c.2641G>A (p.G881R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000894345" "0" "30" "17" "78188134" "78188134" "subst" "0.000312339" "01804" "SGSH_000103" "g.78188134G>A" "" "" "" "SGSH(NM_000199.3):c.507-7C>T (p.(=)), SGSH(NM_001352921.1):c.507-7C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000914992" "0" "90" "17" "78157718" "78157718" "subst" "0" "02327" "SGSH_000156" "g.78157718T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000914993" "0" "30" "17" "78166423" "78166423" "subst" "0.000106454" "02325" "SGSH_000157" "g.78166423G>A" "" "" "" "CARD14(NM_024110.4):c.1356+5G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000914994" "0" "10" "17" "78172201" "78172201" "subst" "0.00115512" "02326" "CARD14_000032" "g.78172201C>T" "" "" "" "CARD14(NM_024110.4):c.1662C>T (p.G554=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000914995" "0" "30" "17" "78176038" "78176038" "subst" "2.43681E-5" "02325" "SGSH_000158" "g.78176038T>C" "" "" "" "CARD14(NM_024110.4):c.2038T>C (p.Y680H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000914996" "0" "30" "17" "78178908" "78178908" "subst" "5.72045E-5" "02326" "SGSH_000159" "g.78178908G>A" "" "" "" "CARD14(NM_024110.4):c.2473G>A (p.A825T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000914997" "0" "10" "17" "78184393" "78184393" "subst" "0.368056" "02329" "SGSH_000015" "g.78184393C>T" "" "" "" "SGSH(NM_000199.4):c.1367G>A (p.R456H), SGSH(NM_000199.5):c.1367G>A (p.R456H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000914998" "0" "10" "17" "78187954" "78187954" "subst" "0.451808" "02329" "SGSH_000030" "g.78187954A>G" "" "" "" "SGSH(NM_000199.4):c.663+17T>C, SGSH(NM_000199.5):c.663+17T>C, SGSH(NM_001352921.3):c.663+17T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000926667" "0" "30" "17" "78157811" "78157811" "subst" "0.00102682" "02326" "CARD14_000013" "g.78157811T>G" "" "" "" "CARD14(NM_001366385.1):c.449T>G (p.L150R), CARD14(NM_024110.4):c.449T>G (p.L150R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000926668" "0" "30" "17" "78157961" "78157961" "subst" "0.00140876" "02326" "SGSH_000160" "g.78157961G>T" "" "" "" "CARD14(NM_024110.4):c.599G>T (p.S200I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000926669" "0" "30" "17" "78178961" "78178961" "subst" "1.62909E-5" "01804" "SGSH_000161" "g.78178961C>T" "" "" "" "CARD14(NM_001257970.1):c.*2738C>T (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000926670" "0" "30" "17" "78180771" "78180771" "subst" "0" "02326" "SGSH_000162" "g.78180771C>T" "" "" "" "CARD14(NM_024110.4):c.2694C>T (p.N898=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000926671" "0" "50" "17" "78184462" "78184462" "subst" "1.22062E-5" "01804" "SGSH_000016" "g.78184462C>T" "" "" "" "SGSH(NM_000199.3):c.1298G>A (p.(Arg433Gln)), SGSH(NM_000199.4):c.1298G>A (p.R433Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000926672" "0" "10" "17" "78184679" "78184679" "subst" "0.0501449" "02329" "SGSH_000024" "g.78184679C>T" "" "" "" "SGSH(NM_000199.3):c.1081G>A (p.(Val361Ile)), SGSH(NM_000199.4):c.1081G>A (p.V361I), SGSH(NM_000199.5):c.1081G>A (p.V361I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000926673" "0" "70" "17" "78188020" "78188020" "subst" "0" "02327" "SGSH_000163" "g.78188020C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000930900" "0" "50" "17" "78169391" "78169391" "subst" "0" "02329" "SGSH_000164" "g.78169391G>T" "" "" "" "CARD14(NM_001366385.1):c.1534G>T (p.A512S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000930901" "0" "10" "17" "78172328" "78172328" "subst" "0.00278295" "02326" "CARD14_000046" "g.78172328C>T" "" "" "" "CARD14(NM_024110.4):c.1789C>T (p.R597W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000930902" "0" "30" "17" "78176025" "78176025" "subst" "4.06161E-5" "02326" "SGSH_000165" "g.78176025G>A" "" "" "" "CARD14(NM_024110.4):c.2025G>A (p.S675=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000930903" "0" "30" "17" "78180852" "78180852" "subst" "0.00119058" "02326" "SGSH_000112" "g.78180852C>T" "" "" "" "CARD14(NM_001366385.1):c.2775C>T (p.V925=), CARD14(NM_024110.4):c.2775C>T (p.V925=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000930904" "0" "30" "17" "78180894" "78180894" "subst" "0.000689976" "02326" "SGSH_000166" "g.78180894C>T" "" "" "" "CARD14(NM_024110.4):c.2807+10C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000930905" "0" "90" "17" "78190883" "78190883" "subst" "9.53982E-5" "02327" "SGSH_000008" "g.78190883G>C" "" "" "" "SGSH(NM_000199.4):c.197C>G (p.S66W), SGSH(NM_000199.5):c.197C>G (p.S66W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000951059" "0" "50" "17" "78157911" "78157911" "subst" "0" "02325" "SGSH_000167" "g.78157911G>C" "" "" "" "CARD14(NM_024110.4):c.549G>C (p.E183D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000951060" "0" "50" "17" "78163589" "78163589" "subst" "0.000167306" "02325" "CARD14_000048" "g.78163589C>T" "" "" "" "CARD14(NM_024110.4):c.881C>T (p.A294V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000951061" "0" "50" "17" "78163600" "78163600" "subst" "1.88706E-5" "02326" "SGSH_000168" "g.78163600C>T" "" "" "" "CARD14(NM_024110.4):c.892C>T (p.R298*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000951062" "0" "30" "17" "78178095" "78178095" "subst" "2.96673E-5" "02325" "SGSH_000169" "g.78178095C>T" "" "" "" "CARD14(NM_024110.4):c.2353C>T (p.R785C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000951063" "0" "30" "17" "78179408" "78179408" "subst" "0.00720564" "01804" "CARD14_000044" "g.78179408G>A" "" "" "" "CARD14(NM_001257970.1):c.*3185G>A (p.(=)), CARD14(NM_024110.4):c.2648G>A (p.R883H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000969269" "0" "50" "17" "78169159" "78169187" "del" "0" "01943" "SGSH_000057" "g.78169159_78169187del" "" "" "" "CARD14(NM_001257970.1):c.1499+27_1499+55delCTGGGGTGGCACTGGGGTCCTTCCTGGCA, CARD14(NM_001366385.1):c.1499+27_1499+55delCTGGGGTGGCACTGGGGTCCTTCCTGGCA,..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000969271" "0" "10" "17" "78186077" "78186077" "subst" "0.00971544" "02329" "SGSH_000074" "g.78186077T>C" "" "" "" "SGSH(NM_000199.3):c.746-4A>G (p.?), SGSH(NM_001352921.3):c.746-4A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000969272" "0" "90" "17" "78188544" "78188544" "dup" "0" "02327" "SGSH_000080" "g.78188544dup" "" "" "" "SGSH(NM_000199.4):c.376dupG (p.V126Gfs*10)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000982866" "0" "30" "17" "78155442" "78155442" "subst" "7.10227E-6" "02325" "SGSH_000170" "g.78155442C>A" "" "" "" "CARD14(NM_024110.4):c.205C>A (p.R69=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000982867" "0" "30" "17" "78177659" "78177659" "subst" "0" "01804" "SGSH_000171" "g.78177659C>A" "" "" "" "CARD14(NM_001366385.1):c.2258C>A (p.(Thr753Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000982868" "0" "10" "17" "78178893" "78178893" "subst" "0.414286" "02326" "CARD14_000040" "g.78178893C>T" "" "" "" "CARD14(NM_024110.4):c.2458C>T (p.R820W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000982869" "0" "50" "17" "78184298" "78184298" "subst" "5.50838E-5" "01804" "SGSH_000172" "g.78184298C>T" "" "" "" "SGSH(NM_000199.5):c.1462G>A (p.(Glu488Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000982870" "0" "30" "17" "78184875" "78184875" "subst" "0" "01804" "SGSH_000173" "g.78184875G>A" "" "" "" "SGSH(NM_001352921.3):c.1061C>T (p.(Ala354Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000982871" "0" "50" "17" "78184885" "78184885" "subst" "0" "01804" "SGSH_000116" "g.78184885C>T" "" "" "" "SGSH(NM_001352921.1):c.1051G>A (p.V351I), SGSH(NM_001352921.3):c.1051G>A (p.(Val351Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000982872" "0" "50" "17" "78184941" "78184941" "subst" "0" "01804" "SGSH_000174" "g.78184941G>A" "" "" "" "SGSH(NM_001352921.3):c.995C>T (p.(Ser332Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000982873" "0" "30" "17" "78188112" "78188112" "subst" "0.00145892" "01804" "SGSH_000119" "g.78188112G>A" "" "" "" "SGSH(NM_000199.5):c.522C>T (p.(Tyr174=)), SGSH(NM_001352921.3):c.522C>T (p.Y174=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000982874" "0" "50" "17" "78188411" "78188411" "subst" "0" "01804" "SGSH_000175" "g.78188411T>C" "" "" "" "SGSH(NM_000199.5):c.506+3A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000989165" "0" "50" "17" "78184529" "78184529" "subst" "0" "03779" "SGSH_000176" "g.78184529G>A" "" "" "" "" "" "CLASSIFICATION record" "" "rs1200985827" "0" "" "" "" "" "VUS" "" "0001003782" "0" "50" "17" "78172359" "78172359" "subst" "0" "02326" "SGSH_000177" "g.78172359T>C" "" "" "" "CARD14(NM_024110.4):c.1820T>C (p.M607T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001003783" "0" "30" "17" "78179008" "78179008" "subst" "0.0017552" "01804" "CARD14_000043" "g.78179008T>C" "" "" "" "CARD14(NM_024110.4):c.2569+4T>C (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001003784" "0" "30" "17" "78184438" "78184438" "subst" "0.0008756" "01804" "SGSH_000114" "g.78184438C>T" "" "" "" "SGSH(NM_000199.3):c.1322G>A (p.(Arg441Gln)), SGSH(NM_000199.4):c.1322G>A (p.R441Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001003785" "0" "50" "17" "78185882" "78185882" "subst" "2.03388E-5" "01804" "SGSH_000178" "g.78185882C>T" "" "" "" "SGSH(NM_000199.3):c.937G>A (p.(Val313Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001003786" "0" "90" "17" "78187614" "78187614" "subst" "0.000330121" "01804" "SGSH_000003" "g.78187614C>T" "" "" "" "SGSH(NM_000199.3):c.734G>A (p.(Arg245His)), SGSH(NM_000199.4):c.734G>A (p.R245H), SGSH(NM_001352921.3):c.734G>A (p.R245H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001011286" "1" "70" "17" "78194112" "78194112" "subst" "0" "00006" "SGSH_000198" "g.78194112T>C" "" "{PMID:Pollard 2016:22976768}" "" "" "" "Germline" "" "" "0" "" "" "g.80220313T>C" "" "likely pathogenic (recessive)" "" "0001011287" "1" "70" "17" "78194025" "78194025" "subst" "1.78425E-5" "00006" "SGSH_000197" "g.78194025C>G" "" "{PMID:Pollard 2016:22976768}" "" "" "" "Germline" "" "" "0" "" "" "g.80220226C>G" "" "likely pathogenic (recessive)" "" "0001011288" "3" "70" "17" "78190983" "78190983" "subst" "0" "00006" "SGSH_000196" "g.78190983C>T" "" "{PMID:Pollard 2016:22976768}" "" "" "" "Germline" "" "" "0" "" "" "g.80217184C>T" "" "likely pathogenic (recessive)" "" "0001011289" "1" "70" "17" "78190911" "78190931" "del" "0" "00006" "SGSH_000195" "g.78190911_78190931del" "" "{PMID:Pollard 2016:22976768}" "" "149_169del21" "" "Germline" "" "" "0" "" "" "g.80217112_80217132del" "" "likely pathogenic (recessive)" "" "0001011290" "1" "70" "17" "78188919" "78188923" "del" "0" "00006" "SGSH_000193" "g.78188919_78188923del" "" "{PMID:Pollard 2016:22976768}" "" "265_269delTACGG" "" "Germline" "" "" "0" "" "" "g.80215120_80215124del" "" "likely pathogenic (recessive)" "" "0001011291" "1" "70" "17" "78188885" "78188887" "del" "0" "00006" "SGSH_000192" "g.78188885_78188887del" "" "{PMID:Pollard 2016:22976768}" "" "301_303delTTC" "" "Germline" "" "" "0" "" "" "g.80215086_80215088del" "" "likely pathogenic (recessive)" "" "0001011292" "1" "70" "17" "78188476" "78188512" "dup" "0" "00006" "SGSH_000191" "g.78188476_78188512dup" "" "{PMID:Pollard 2016:22976768}" "" "408_444dup37" "" "Germline" "" "" "0" "" "" "g.80214677_80214713dup" "" "likely pathogenic (recessive)" "" "0001011293" "1" "70" "17" "78188052" "78188052" "subst" "0" "00006" "SGSH_000190" "g.78188052A>T" "" "{PMID:Pollard 2016:22976768}" "" "" "" "Germline" "" "" "0" "" "" "g.80214253A>T" "" "likely pathogenic (recessive)" "" "0001011294" "1" "70" "17" "78185956" "78185956" "subst" "4.06914E-6" "00006" "SGSH_000189" "g.78185956G>A" "" "{PMID:Pollard 2016:22976768}" "" "" "" "Germline" "" "" "0" "" "" "g.80212157G>A" "" "likely pathogenic (recessive)" "" "0001011295" "3" "90" "17" "78190883" "78190883" "subst" "9.53982E-5" "00006" "SGSH_000008" "g.78190883G>C" "" "{PMID:Pollard 2016:22976768}" "" "" "" "Germline" "" "" "0" "" "" "g.80217084G>C" "" "pathogenic (recessive)" "" "0001011296" "1" "50" "17" "78185887" "78185887" "subst" "4.06745E-6" "00006" "SGSH_000187" "g.78185887G>T" "" "{PMID:Pollard 2016:22976768}" "" "" "" "Germline" "" "" "0" "" "" "g.80212088G>T" "" "VUS" "" "0001011297" "1" "70" "17" "78185870" "78185870" "subst" "4.07116E-6" "00006" "SGSH_000186" "g.78185870C>G" "" "{PMID:Pollard 2016:22976768}" "" "" "" "Germline" "" "" "0" "" "" "g.80212071C>G" "" "likely pathogenic (recessive)" "" "0001011298" "1" "70" "17" "78184630" "78184630" "subst" "0" "00006" "SGSH_000185" "g.78184630C>A" "" "{PMID:Pollard 2016:22976768}" "" "" "" "Germline" "" "" "0" "" "" "g.80210831C>A" "" "likely pathogenic (recessive)" "" "0001011299" "3" "70" "17" "78184594" "78184594" "subst" "0" "00006" "SGSH_000184" "g.78184594T>C" "" "{PMID:Pollard 2016:22976768}" "" "" "" "Germline" "" "" "0" "" "" "g.80210795T>C" "" "likely pathogenic (recessive)" "" "0001011300" "1" "70" "17" "78184551" "78184551" "subst" "0" "00006" "SGSH_000183" "g.78184551G>T" "" "{PMID:Pollard 2016:22976768}" "" "" "" "Germline" "" "" "0" "" "" "g.80210752G>T" "" "likely pathogenic (recessive)" "" "0001011301" "1" "70" "17" "78184517" "78184517" "subst" "0" "00006" "SGSH_000182" "g.78184517T>G" "" "{PMID:Pollard 2016:22976768}" "" "" "" "Germline" "" "" "0" "" "" "g.80210718T>G" "" "likely pathogenic (recessive)" "" "0001011302" "1" "70" "17" "78184417" "78184417" "del" "0" "00006" "SGSH_000181" "g.78184417del" "" "{PMID:Pollard 2016:22976768}" "" "1343delC" "" "Germline" "" "" "0" "" "" "g.80210618del" "" "likely pathogenic (recessive)" "" "0001011303" "1" "70" "17" "78184344" "78184344" "subst" "0" "00006" "SGSH_000180" "g.78184344C>G" "" "{PMID:Pollard 2016:22976768}" "" "" "" "Germline" "" "" "0" "" "" "g.80210545C>G" "" "likely pathogenic (recessive)" "" "0001011304" "1" "70" "17" "78184331" "78184331" "del" "8.33125E-6" "00006" "SGSH_000179" "g.78184331del" "" "{PMID:Pollard 2016:22976768}" "" "1429delG" "" "Germline" "" "" "0" "" "" "g.80210532del" "" "likely pathogenic (recessive)" "" "0001011305" "3" "70" "17" "78184594" "78184594" "subst" "0" "00006" "SGSH_000184" "g.78184594T>C" "" "{PMID:Pollard 2016:22976768}" "" "" "" "Germline" "" "" "0" "" "" "g.80210795T>C" "" "likely pathogenic (recessive)" "" "0001011331" "2" "90" "17" "78188556" "78188556" "subst" "2.04548E-5" "00006" "SGSH_000035" "g.78188556C>T" "" "{PMID:Pollard 2016:22976768}" "" "" "" "Germline" "" "" "0" "" "" "g.80214757C>T" "" "pathogenic (recessive)" "" "0001011332" "2" "90" "17" "78187614" "78187614" "subst" "0.000330121" "00006" "SGSH_000003" "g.78187614C>T" "" "{PMID:Pollard 2016:22976768}" "" "" "" "Germline" "" "" "0" "" "" "g.80213815C>T" "" "pathogenic (recessive)" "" "0001011333" "2" "90" "17" "78185927" "78185927" "subst" "9.35423E-5" "00006" "SGSH_000001" "g.78185927A>G" "" "{PMID:Pollard 2016:22976768}" "" "" "" "Germline" "" "" "0" "" "" "g.80212128A>G" "" "pathogenic (recessive)" "" "0001011334" "2" "90" "17" "78184655" "78184655" "subst" "4.07349E-6" "00006" "SGSH_000022" "g.78184655C>T" "" "{PMID:Pollard 2016:22976768}" "" "" "" "Germline" "" "" "0" "" "" "g.80210856C>T" "" "pathogenic (recessive)" "" "0001011335" "2" "90" "17" "78187614" "78187614" "subst" "0.000330121" "00006" "SGSH_000003" "g.78187614C>T" "" "{PMID:Pollard 2016:22976768}" "" "" "" "Germline" "" "" "0" "" "" "g.80213815C>T" "" "pathogenic (recessive)" "" "0001011336" "2" "90" "17" "78187614" "78187614" "subst" "0.000330121" "00006" "SGSH_000003" "g.78187614C>T" "" "{PMID:Pollard 2016:22976768}" "" "" "" "Germline" "" "" "0" "" "" "g.80213815C>T" "" "pathogenic (recessive)" "" "0001011337" "2" "50" "17" "78190860" "78190860" "subst" "0.000145679" "00006" "SGSH_000011" "g.78190860G>A" "" "{PMID:Pollard 2016:22976768}" "" "" "" "Germline" "" "" "0" "" "" "g.80217061G>A" "" "VUS" "" "0001011338" "2" "90" "17" "78190883" "78190883" "subst" "9.53982E-5" "00006" "SGSH_000008" "g.78190883G>C" "" "{PMID:Pollard 2016:22976768}" "" "" "" "Germline" "" "" "0" "" "" "g.80217084G>C" "" "pathogenic (recessive)" "" "0001011339" "2" "90" "17" "78187614" "78187614" "subst" "0.000330121" "00006" "SGSH_000003" "g.78187614C>T" "" "{PMID:Pollard 2016:22976768}" "" "" "" "Germline" "" "" "0" "" "" "g.80213815C>T" "" "pathogenic (recessive)" "" "0001011340" "2" "70" "17" "78185908" "78185908" "subst" "8.13306E-6" "00006" "SGSH_000188" "g.78185908C>A" "" "{PMID:Pollard 2016:22976768}" "" "" "" "Germline" "" "" "0" "" "" "g.80212109C>A" "" "likely pathogenic (recessive)" "" "0001011341" "2" "90" "17" "78184681" "78184681" "del" "0" "00006" "SGSH_000025" "g.78184681del" "" "{PMID:Pollard 2016:22976768}" "" "1080delC" "" "Germline" "" "" "0" "" "" "g.80210882del" "" "pathogenic (recessive)" "" "0001011342" "2" "90" "17" "78185942" "78185942" "subst" "2.84775E-5" "00006" "SGSH_000027" "g.78185942G>A" "" "{PMID:Pollard 2016:22976768}" "" "" "" "Germline" "" "" "0" "" "" "g.80212143G>A" "" "pathogenic (recessive)" "" "0001011343" "2" "90" "17" "78185927" "78185927" "subst" "9.35423E-5" "00006" "SGSH_000001" "g.78185927A>G" "" "{PMID:Pollard 2016:22976768}" "" "" "" "Germline" "" "" "0" "" "" "g.80212128A>G" "" "pathogenic (recessive)" "" "0001011344" "2" "50" "17" "78190845" "78190845" "subst" "0" "00006" "SGSH_000194" "g.78190845T>G" "" "{PMID:Pollard 2016:22976768}" "" "" "" "Germline" "" "" "0" "" "" "g.80217046T>G" "" "VUS" "" "0001011345" "2" "90" "17" "78187614" "78187614" "subst" "0.000330121" "00006" "SGSH_000003" "g.78187614C>T" "" "{PMID:Pollard 2016:22976768}" "" "" "" "Germline" "" "" "0" "" "" "g.80213815C>T" "" "pathogenic (recessive)" "" "0001011346" "2" "90" "17" "78184681" "78184681" "del" "0" "00006" "SGSH_000025" "g.78184681del" "" "{PMID:Pollard 2016:22976768}" "" "1080delC" "" "Germline" "" "" "0" "" "" "g.80210882del" "" "pathogenic (recessive)" "" "0001011347" "2" "90" "17" "78184681" "78184681" "del" "0" "00006" "SGSH_000025" "g.78184681del" "" "{PMID:Pollard 2016:22976768}" "" "1080delC" "" "Germline" "" "" "0" "" "" "g.80210882del" "" "pathogenic (recessive)" "" "0001011348" "2" "90" "17" "78184463" "78184463" "subst" "1.62741E-5" "00006" "SGSH_000017" "g.78184463G>A" "" "{PMID:Pollard 2016:22976768}" "" "" "" "Germline" "" "" "0" "" "" "g.80210664G>A" "" "pathogenic (recessive)" "" "0001011349" "2" "90" "17" "78187614" "78187614" "subst" "0.000330121" "00006" "SGSH_000003" "g.78187614C>T" "" "{PMID:Pollard 2016:22976768}" "" "" "" "Germline" "" "" "0" "" "" "g.80213815C>T" "" "pathogenic (recessive)" "" "0001011350" "2" "90" "17" "78187614" "78187614" "subst" "0.000330121" "00006" "SGSH_000003" "g.78187614C>T" "" "{PMID:Pollard 2016:22976768}" "" "" "" "Germline" "" "" "0" "" "" "g.80213815C>T" "" "pathogenic (recessive)" "" "0001012420" "1" "50" "17" "78188879" "78188879" "subst" "4.49736E-5" "00006" "SGSH_000199" "g.78188879T>C" "" "{PMID:Fernandez-Marmiesse 2014:24767253}" "" "" "" "Germline" "" "" "0" "" "" "g.80215080T>C" "" "VUS" "" "0001012769" "1" "90" "17" "78188090" "78188090" "subst" "1.2515E-5" "00006" "SGSH_000202" "g.78188090G>A" "" "{PMID:Fang 2022:34813777}" "" "" "" "Germline" "" "" "0" "" "" "g.80214291G>A" "" "pathogenic (recessive)" "" "0001012770" "1" "90" "17" "78188063" "78188063" "subst" "1.66152E-5" "00006" "SGSH_000032" "g.78188063C>T" "" "{PMID:Fang 2022:34813777}" "" "" "" "Germline" "" "" "0" "" "" "g.80214264C>T" "" "pathogenic (recessive)" "" "0001012789" "2" "90" "17" "78184631" "78184631" "subst" "3.65913E-5" "00006" "SGSH_000041" "g.78184631G>A" "" "{PMID:Fang 2022:34813777}" "" "" "" "Germline" "" "" "0" "" "" "g.80210832G>A" "" "pathogenic (recessive)" "" "0001012790" "2" "90" "17" "78184342" "78184342" "subst" "0" "00006" "SGSH_000201" "g.78184342C>T" "" "{PMID:Fang 2022:34813777}" "" "" "" "Germline" "" "" "0" "" "" "g.80210543C>T" "" "pathogenic (recessive)" "" "0001015641" "0" "50" "17" "78179407" "78179407" "subst" "2.35816E-5" "02325" "SGSH_000200" "g.78179407C>T" "" "" "" "CARD14(NM_024110.4):c.2647C>T (p.R883C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001042240" "0" "30" "17" "78169414" "78169414" "subst" "1.63956E-5" "01804" "SGSH_000203" "g.78169414C>T" "" "" "" "CARD14(NM_001366385.1):c.1557C>T (p.(Gly519=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001042241" "0" "30" "17" "78175593" "78175593" "subst" "1.21866E-5" "01804" "SGSH_000204" "g.78175593G>A" "" "" "" "CARD14(NM_001366385.1):c.1902G>A (p.(Thr634=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001042242" "0" "30" "17" "78184959" "78184959" "subst" "0" "01804" "SGSH_000205" "g.78184959G>A" "" "" "" "SGSH(NM_001352921.3):c.977C>T (p.(Ala326Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001042243" "0" "50" "17" "78188071" "78188071" "subst" "4.15866E-6" "01804" "SGSH_000206" "g.78188071G>A" "" "" "" "SGSH(NM_000199.5):c.563C>T (p.(Pro188Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001042244" "0" "30" "17" "78188570" "78188570" "subst" "8.23621E-6" "01804" "SGSH_000207" "g.78188570C>T" "" "" "" "SGSH(NM_000199.5):c.356-6G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001042245" "0" "50" "17" "78188838" "78188838" "subst" "3.2901E-5" "01804" "SGSH_000208" "g.78188838G>A" "" "" "" "SGSH(NM_000199.5):c.349C>T (p.(Arg117Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001042246" "0" "50" "17" "78188911" "78188911" "subst" "0.000102269" "01804" "SGSH_000209" "g.78188911G>C" "" "" "" "SGSH(NM_000199.5):c.276C>G (p.(His92Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001042247" "0" "50" "17" "78190990" "78190990" "subst" "9.11212E-5" "01804" "SGSH_000210" "g.78190990C>T" "" "" "" "SGSH(NM_000199.5):c.90G>A (p.(Ala30=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes SGSH ## Count = 345 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000000670" "00000039" "50" "1079" "0" "1080" "0" "c.1079_1080del" "r.(?)" "p.(Thr360Serfs*141)" "" "0000000671" "00000039" "50" "197" "0" "197" "0" "c.197C>G" "r.(?)" "p.(Ser66Trp)" "" "0000000672" "00000039" "50" "391" "0" "391" "0" "c.391G>A" "r.(?)" "p.(Val131Met)" "" "0000000673" "00000039" "50" "701" "0" "701" "0" "c.701C>G" "r.(?)" "p.(Ala234Gly)" "" "0000000674" "00000039" "50" "734" "0" "734" "0" "c.734G>A" "r.(?)" "p.(Arg245His)" "" "0000000675" "00000039" "50" "1339" "0" "1339" "0" "c.1339G>A" "r.(?)" "p.(Glu447Lys)" "" "0000166301" "00000039" "90" "734" "0" "734" "0" "c.734G>A" "r.(?)" "p.(Arg245His)" "7" "0000166302" "00000039" "90" "892" "0" "892" "0" "c.892T>C" "r.(?)" "p.(Ser298Pro)" "7" "0000166303" "00000039" "90" "1063" "0" "1063" "0" "c.1063G>A" "r.(?)" "p.(Glu355Lys)" "8" "0000235427" "00000039" "90" "220" "0" "220" "0" "c.220C>T" "r.(?)" "p.(Arg74Cys)" "2" "0000235428" "00000039" "90" "1207" "0" "1209" "0" "c.1207_1209del" "r.(?)" "p.(Tyr403del)" "8" "0000235429" "00000039" "70" "96" "0" "96" "0" "c.96C>A" "r.(?)" "p.(Asp32Glu)" "2" "0000247429" "00000039" "10" "663" "17" "663" "17" "c.663+17T>C" "r.(=)" "p.(=)" "" "0000247932" "00000039" "10" "663" "17" "663" "17" "c.663+17T>C" "r.(=)" "p.(=)" "" "0000248148" "00000039" "90" "892" "0" "892" "0" "c.892T>C" "r.(?)" "p.(Ser298Pro)" "" "0000251615" "00000039" "10" "5123" "0" "5123" "0" "c.*3614T>G" "r.(=)" "p.(=)" "" "0000251939" "00000039" "30" "23551" "0" "23551" "0" "c.*22042T>G" "r.(=)" "p.(=)" "" "0000253193" "00000039" "10" "663" "17" "663" "17" "c.663+17T>C" "r.(=)" "p.(=)" "" "0000255406" "00000039" "90" "892" "0" "892" "0" "c.892T>C" "r.(?)" "p.(Ser298Pro)" "" "0000266479" "00000039" "10" "9527" "0" "9527" "0" "c.*8018A>T" "r.(=)" "p.(=)" "" "0000266480" "00000039" "10" "6867" "0" "6867" "0" "c.*5358G>A" "r.(=)" "p.(=)" "" "0000266481" "00000039" "10" "23590" "0" "23590" "0" "c.*22081C>T" "r.(=)" "p.(=)" "" "0000269722" "00000039" "30" "21086" "0" "21086" "0" "c.*19577G>A" "r.(=)" "p.(=)" "" "0000269723" "00000039" "30" "20665" "0" "20665" "0" "c.*19156G>A" "r.(=)" "p.(=)" "" "0000269724" "00000039" "10" "20672" "0" "20672" "0" "c.*19163C>T" "r.(=)" "p.(=)" "" "0000269725" "00000039" "30" "20546" "0" "20546" "0" "c.*19037G>A" "r.(=)" "p.(=)" "" "0000269726" "00000039" "10" "19434" "0" "19434" "0" "c.*17925C>T" "r.(=)" "p.(=)" "" "0000269727" "00000039" "70" "16771" "0" "16771" "0" "c.*15262C>T" "r.(=)" "p.(=)" "" "0000269728" "00000039" "10" "16386" "0" "16386" "0" "c.*14877G>A" "r.(=)" "p.(=)" "" "0000269729" "00000039" "30" "30364" "0" "30364" "0" "c.*28855G>A" "r.(=)" "p.(=)" "" "0000269730" "00000039" "10" "13196" "0" "13196" "0" "c.*11687G>A" "r.(=)" "p.(=)" "" "0000269731" "00000039" "30" "10152" "0" "10152" "0" "c.*8643G>A" "r.(=)" "p.(=)" "" "0000269732" "00000039" "30" "9796" "0" "9796" "0" "c.*8287C>T" "r.(=)" "p.(=)" "" "0000269733" "00000039" "10" "9716" "0" "9716" "0" "c.*8207G>A" "r.(=)" "p.(=)" "" "0000269734" "00000039" "30" "9527" "0" "9527" "0" "c.*8018A>C" "r.(=)" "p.(=)" "" "0000269735" "00000039" "30" "6922" "0" "6922" "0" "c.*5413G>A" "r.(=)" "p.(=)" "" "0000269736" "00000039" "30" "6849" "0" "6849" "0" "c.*5340G>A" "r.(=)" "p.(=)" "" "0000269737" "00000039" "30" "6829" "0" "6829" "0" "c.*5320G>A" "r.(=)" "p.(=)" "" "0000269738" "00000039" "30" "6752" "0" "6752" "0" "c.*5243A>G" "r.(=)" "p.(=)" "" "0000269739" "00000039" "30" "6352" "0" "6352" "0" "c.*4843C>T" "r.(=)" "p.(=)" "" "0000269740" "00000039" "10" "6194" "0" "6194" "0" "c.*4685G>A" "r.(=)" "p.(=)" "" "0000269741" "00000039" "10" "3746" "0" "3746" "0" "c.*2237C>T" "r.(=)" "p.(=)" "" "0000269742" "00000039" "30" "27799" "0" "27799" "0" "c.*26290C>T" "r.(=)" "p.(=)" "" "0000269743" "00000039" "30" "23614" "0" "23614" "0" "c.*22105G>A" "r.(=)" "p.(=)" "" "0000269744" "00000039" "70" "23579" "0" "23579" "0" "c.*22070A>C" "r.(=)" "p.(=)" "" "0000272611" "00000039" "30" "16712" "0" "16712" "0" "c.*15203C>T" "r.(=)" "p.(=)" "" "0000272612" "00000039" "30" "13856" "0" "13856" "0" "c.*12347G>A" "r.(=)" "p.(=)" "" "0000272613" "00000039" "10" "13559" "0" "13559" "0" "c.*12050G>A" "r.(=)" "p.(=)" "" "0000272614" "00000039" "30" "7683" "0" "7683" "0" "c.*6174C>T" "r.(=)" "p.(=)" "" "0000272615" "00000039" "30" "6829" "0" "6829" "0" "c.*5320G>A" "r.(=)" "p.(=)" "" "0000272616" "00000039" "30" "6752" "0" "6752" "0" "c.*5243A>G" "r.(=)" "p.(=)" "" "0000272617" "00000039" "10" "4911" "0" "4911" "0" "c.*3402G>A" "r.(=)" "p.(=)" "" "0000295802" "00000039" "10" "1023" "0" "1023" "0" "c.1023C>T" "r.(?)" "p.(Ile341=)" "" "0000295803" "00000039" "10" "1081" "0" "1081" "0" "c.1081G>A" "r.(?)" "p.(Val361Ile)" "" "0000295804" "00000039" "30" "1159" "0" "1159" "0" "c.1159G>A" "r.(?)" "p.(Val387Met)" "" "0000295805" "00000039" "10" "1209" "0" "1209" "0" "c.1209C>T" "r.(?)" "p.(Tyr403=)" "" "0000295806" "00000039" "10" "1367" "0" "1367" "0" "c.1367G>A" "r.(?)" "p.(Arg456His)" "" "0000298180" "00000039" "90" "1080" "0" "1080" "0" "c.1080del" "r.(?)" "p.(Val361SerfsTer52)" "" "0000298181" "00000039" "10" "1081" "0" "1081" "0" "c.1081G>A" "r.(?)" "p.(Val361Ile)" "" "0000298182" "00000039" "90" "197" "0" "197" "0" "c.197C>G" "r.(?)" "p.(Ser66Trp)" "" "0000298183" "00000039" "90" "220" "0" "220" "0" "c.220C>T" "r.(?)" "p.(Arg74Cys)" "" "0000298184" "00000039" "90" "364" "0" "364" "0" "c.364G>A" "r.(?)" "p.(Gly122Arg)" "" "0000298185" "00000039" "90" "734" "0" "734" "0" "c.734G>A" "r.(?)" "p.(Arg245His)" "" "0000298186" "00000039" "90" "877" "0" "877" "0" "c.877C>T" "r.(?)" "p.(Pro293Ser)" "" "0000308001" "00000039" "90" "1080" "0" "1080" "0" "c.1080del" "r.(?)" "p.(Val361SerfsTer52)" "" "0000308002" "00000039" "10" "1081" "0" "1081" "0" "c.1081G>A" "r.(?)" "p.(Val361Ile)" "" "0000308003" "00000039" "90" "1105" "0" "1105" "0" "c.1105G>A" "r.(?)" "p.(Glu369Lys)" "" "0000308004" "00000039" "90" "1105" "0" "1105" "0" "c.1105G>T" "r.(?)" "p.(Glu369Ter)" "" "0000308005" "00000039" "90" "1130" "0" "1130" "0" "c.1130G>A" "r.(?)" "p.(Arg377His)" "" "0000308006" "00000039" "90" "1139" "0" "1139" "0" "c.1139A>G" "r.(?)" "p.(Gln380Arg)" "" "0000308007" "00000039" "90" "1207" "0" "1209" "0" "c.1207_1209del" "r.(?)" "p.(Tyr403del)" "" "0000308008" "00000039" "90" "1297" "0" "1297" "0" "c.1297C>T" "r.(?)" "p.(Arg433Trp)" "" "0000308009" "00000039" "90" "1298" "0" "1298" "0" "c.1298G>A" "r.(?)" "p.(Arg433Gln)" "" "0000308010" "00000039" "10" "1367" "0" "1367" "0" "c.1367G>A" "r.(?)" "p.(Arg456His)" "" "0000308011" "00000039" "90" "197" "0" "197" "0" "c.197C>G" "r.(?)" "p.(Ser66Trp)" "" "0000308012" "00000039" "90" "220" "0" "220" "0" "c.220C>T" "r.(?)" "p.(Arg74Cys)" "" "0000308013" "00000039" "10" "250" "-26" "250" "-26" "c.250-26C>T" "r.(=)" "p.(=)" "" "0000308014" "00000039" "90" "364" "0" "364" "0" "c.364G>A" "r.(?)" "p.(Gly122Arg)" "" "0000308016" "00000039" "90" "449" "0" "449" "0" "c.449G>A" "r.(?)" "p.(Arg150Gln)" "" "0000308017" "00000039" "90" "571" "0" "571" "0" "c.571G>A" "r.(?)" "p.(Gly191Arg)" "" "0000308018" "00000039" "10" "664" "-39" "664" "-36" "c.664-39_664-36delinsGC" "r.(=)" "p.(=)" "" "0000308019" "00000039" "90" "734" "0" "734" "0" "c.734G>A" "r.(?)" "p.(Arg245His)" "" "0000308020" "00000039" "90" "817" "0" "817" "0" "c.817G>A" "r.(?)" "p.(Asp273Asn)" "" "0000308324" "00000039" "50" "-1315" "0" "-1315" "0" "c.-1315C>T" "r.(?)" "p.(=)" "" "0000325753" "00000039" "30" "3712" "0" "3712" "0" "c.*2203G>C" "r.(=)" "p.(=)" "" "0000342397" "00000039" "90" "734" "0" "734" "0" "c.734G>A" "r.(?)" "p.(Arg245His)" "" "0000348918" "00000039" "90" "892" "0" "892" "0" "c.892T>C" "r.(?)" "p.(Ser298Pro)" "" "0000467287" "00000039" "90" "2" "0" "2" "0" "c.2T>C" "r.(?)" "p.0?" "" "0000467288" "00000039" "90" "1093" "0" "1093" "0" "c.1093C>T" "r.(?)" "p.(Gln365*)" "" "0000467289" "00000039" "90" "29" "0" "29" "0" "c.29dup" "r.(?)" "p.(Leu11Alafs*22)" "" "0000467290" "00000039" "90" "197" "0" "197" "0" "c.197C>G" "r.(?)" "p.(Ser66Trp)" "" "0000467291" "00000039" "90" "1080" "0" "1080" "0" "c.1080del" "r.(?)" "p.(Val361Serfs*52)" "" "0000467292" "00000039" "90" "1129" "0" "1129" "0" "c.1129C>T" "r.(?)" "p.(Arg377Cys)" "" "0000467293" "00000039" "90" "-687" "0" "664" "-23" "c.-687_664-23del" "r.0?" "p.0?" "_1_5i" "0000467294" "00000039" "90" "-687" "0" "664" "-23" "c.-687_664-23del" "r.0?" "p.0?" "_1_5i" "0000563562" "00000039" "50" "30401" "0" "30401" "0" "c.*28892G>A" "r.(=)" "p.(=)" "" "0000563563" "00000039" "10" "30338" "0" "30338" "0" "c.*28829C>T" "r.(=)" "p.(=)" "" "0000563564" "00000039" "50" "30318" "0" "30318" "0" "c.*28809G>A" "r.(=)" "p.(=)" "" "0000563565" "00000039" "30" "30305" "0" "30305" "0" "c.*28796C>T" "r.(=)" "p.(=)" "" "0000563566" "00000039" "30" "29175" "0" "29175" "0" "c.*27666A>G" "r.(=)" "p.(=)" "" "0000563567" "00000039" "50" "27991" "0" "27991" "0" "c.*26482T>G" "r.(=)" "p.(=)" "" "0000563568" "00000039" "70" "27959" "0" "27961" "0" "c.*26450_*26452del" "r.(=)" "p.(=)" "" "0000563569" "00000039" "30" "23436" "0" "23436" "0" "c.*21927C>T" "r.(=)" "p.(=)" "" "0000563570" "00000039" "50" "22127" "0" "22127" "0" "c.*20618G>A" "r.(=)" "p.(=)" "" "0000563571" "00000039" "30" "21139" "0" "21139" "0" "c.*19630T>C" "r.(=)" "p.(=)" "" "0000563572" "00000039" "50" "20637" "0" "20637" "0" "c.*19128G>A" "r.(=)" "p.(=)" "" "0000563573" "00000039" "30" "20529" "0" "20529" "0" "c.*19020C>T" "r.(=)" "p.(=)" "" "0000563574" "00000039" "30" "19421" "0" "19421" "0" "c.*17912C>T" "r.(=)" "p.(=)" "" "0000563575" "00000039" "30" "16742" "0" "16742" "0" "c.*15233G>A" "r.(=)" "p.(=)" "" "0000563576" "00000039" "30" "16664" "0" "16664" "0" "c.*15155A>G" "r.(=)" "p.(=)" "" "0000563577" "00000039" "30" "16594" "0" "16622" "0" "c.*15085_*15113del" "r.(=)" "p.(=)" "" "0000563578" "00000039" "10" "13816" "0" "13816" "0" "c.*12307C>G" "r.(=)" "p.(=)" "" "0000563579" "00000039" "50" "13518" "0" "13518" "0" "c.*12009T>G" "r.(=)" "p.(=)" "" "0000563580" "00000039" "30" "13483" "0" "13483" "0" "c.*11974G>A" "r.(=)" "p.(=)" "" "0000563581" "00000039" "30" "13415" "0" "13415" "0" "c.*11906C>T" "r.(=)" "p.(=)" "" "0000563582" "00000039" "50" "13392" "0" "13392" "0" "c.*11883C>T" "r.(=)" "p.(=)" "" "0000563583" "00000039" "30" "10071" "0" "10071" "0" "c.*8562G>A" "r.(=)" "p.(=)" "" "0000563584" "00000039" "30" "7745" "0" "7745" "0" "c.*6236G>A" "r.(=)" "p.(=)" "" "0000563585" "00000039" "10" "6930" "0" "6930" "0" "c.*5421T>C" "r.(=)" "p.(=)" "" "0000563587" "00000039" "30" "6294" "0" "6294" "0" "c.*4785C>T" "r.(=)" "p.(=)" "" "0000563588" "00000039" "30" "3712" "0" "3712" "0" "c.*2203G>C" "r.(=)" "p.(=)" "" "0000563589" "00000039" "30" "3712" "0" "3712" "0" "c.*2203G>C" "r.(=)" "p.(=)" "" "0000563590" "00000039" "30" "1446" "0" "1446" "0" "c.1446C>T" "r.(?)" "p.(Ala482=)" "" "0000563591" "00000039" "90" "1437" "0" "1440" "0" "c.1437_1440dup" "r.(?)" "p.(Cys481GlyfsTer22)" "" "0000563592" "00000039" "30" "1410" "0" "1410" "0" "c.1410G>A" "r.(?)" "p.(Lys470=)" "" "0000563593" "00000039" "30" "1182" "0" "1182" "0" "c.1182G>T" "r.(?)" "p.(Met394Ile)" "" "0000563594" "00000039" "30" "1159" "0" "1159" "0" "c.1159G>A" "r.(?)" "p.(Val387Met)" "" "0000563595" "00000039" "30" "1144" "0" "1144" "0" "c.1144C>T" "r.(?)" "p.(Arg382Trp)" "" "0000563596" "00000039" "70" "1130" "0" "1130" "0" "c.1130G>A" "r.(?)" "p.(Arg377His)" "" "0000563597" "00000039" "10" "1116" "0" "1116" "0" "c.1116G>A" "r.(?)" "p.(Met372Ile)" "" "0000563598" "00000039" "30" "1081" "0" "1081" "0" "c.1081G>A" "r.(?)" "p.(Val361Ile)" "" "0000563600" "00000039" "90" "892" "0" "892" "0" "c.892T>C" "r.(?)" "p.(Ser298Pro)" "" "0000563601" "00000039" "30" "746" "-4" "746" "-4" "c.746-4A>G" "r.spl?" "p.?" "" "0000563602" "00000039" "10" "701" "0" "701" "0" "c.701C>G" "r.(?)" "p.(Ala234Gly)" "" "0000563603" "00000039" "10" "663" "17" "663" "17" "c.663+17T>C" "r.(=)" "p.(=)" "" "0000563604" "00000039" "50" "641" "0" "641" "0" "c.641C>A" "r.(?)" "p.(Ala214Asp)" "" "0000563605" "00000039" "30" "641" "0" "641" "0" "c.641C>A" "r.(?)" "p.(Ala214Asp)" "" "0000563606" "00000039" "50" "545" "0" "545" "0" "c.545G>A" "r.(?)" "p.(Arg182His)" "" "0000563608" "00000039" "50" "508" "0" "508" "0" "c.508C>G" "r.(?)" "p.(Pro170Ala)" "" "0000563609" "00000039" "10" "411" "0" "411" "0" "c.411G>A" "r.(?)" "p.(Ala137=)" "" "0000563610" "00000039" "30" "411" "0" "411" "0" "c.411G>A" "r.(?)" "p.(Ala137=)" "" "0000563611" "00000039" "90" "376" "0" "376" "0" "c.376dup" "r.(?)" "p.(Val126GlyfsTer10)" "" "0000616899" "00000039" "30" "30488" "0" "30488" "0" "c.*28979G>A" "r.(=)" "p.(=)" "" "0000616900" "00000039" "30" "27828" "0" "27828" "0" "c.*26319C>T" "r.(=)" "p.(=)" "" "0000616901" "00000039" "30" "3703" "0" "3703" "0" "c.*2194G>A" "r.(=)" "p.(=)" "" "0000616902" "00000039" "90" "1135" "0" "1135" "0" "c.1135del" "r.(?)" "p.(Val379CysfsTer34)" "" "0000616903" "00000039" "50" "808" "0" "808" "0" "c.808T>C" "r.(?)" "p.(Phe270Leu)" "" "0000616904" "00000039" "30" "658" "0" "658" "0" "c.658G>T" "r.(?)" "p.(Val220Leu)" "" "0000616905" "00000039" "50" "344" "0" "344" "0" "c.344G>T" "r.(?)" "p.(Gly115Val)" "" "0000623780" "00000039" "50" "30312" "0" "30312" "0" "c.*28803C>T" "r.(=)" "p.(=)" "" "0000623781" "00000039" "30" "19324" "0" "19325" "0" "c.*17815_*17816del" "r.(=)" "p.(=)" "" "0000623782" "00000039" "30" "8080" "0" "8080" "0" "c.*6571C>T" "r.(=)" "p.(=)" "" "0000623783" "00000039" "30" "3772" "0" "3772" "0" "c.*2263C>T" "r.(=)" "p.(=)" "" "0000623784" "00000039" "30" "1283" "0" "1283" "0" "c.1283G>A" "r.(?)" "p.(Arg428His)" "" "0000623785" "00000039" "50" "808" "0" "808" "0" "c.808T>C" "r.(?)" "p.(Phe270Leu)" "" "0000623786" "00000039" "50" "598" "0" "598" "0" "c.598G>A" "r.(?)" "p.(Gly200Arg)" "" "0000623787" "00000039" "50" "350" "0" "350" "0" "c.350G>T" "r.(?)" "p.(Arg117Leu)" "" "0000649743" "00000039" "10" "3809" "0" "3809" "0" "c.*2300C>T" "r.(=)" "p.(=)" "" "0000649744" "00000039" "70" "1339" "0" "1339" "0" "c.1339G>A" "r.(?)" "p.(Glu447Lys)" "" "0000649745" "00000039" "10" "1159" "0" "1159" "0" "c.1159G>A" "r.(?)" "p.(Val387Met)" "" "0000658288" "00000039" "30" "29175" "0" "29175" "0" "c.*27666A>G" "r.(=)" "p.(=)" "" "0000658289" "00000039" "30" "22130" "0" "22130" "0" "c.*20621G>A" "r.(=)" "p.(=)" "" "0000658290" "00000039" "70" "21188" "0" "21188" "0" "c.*19679C>T" "r.(=)" "p.(=)" "" "0000658291" "00000039" "30" "20594" "0" "20594" "0" "c.*19085G>C" "r.(=)" "p.(=)" "" "0000669427" "00000039" "10" "1159" "0" "1159" "0" "c.1159G>A" "r.(?)" "p.(Val387Met)" "" "0000669428" "00000039" "50" "658" "0" "658" "0" "c.658G>T" "r.(?)" "p.(Val220Leu)" "" "0000681063" "00000039" "30" "19356" "0" "19356" "0" "c.*17847C>T" "r.(=)" "p.(=)" "" "0000681064" "00000039" "30" "16313" "0" "16313" "0" "c.*14804C>T" "r.(=)" "p.(=)" "" "0000681065" "00000039" "30" "1215" "0" "1215" "0" "c.1215A>C" "r.(?)" "p.(Ser405=)" "" "0000681066" "00000039" "30" "507" "-7" "507" "-7" "c.507-7C>T" "r.(=)" "p.(=)" "" "0000692505" "00000039" "50" "29286" "0" "29286" "0" "c.*27777C>A" "r.(=)" "p.(=)" "" "0000692506" "00000039" "30" "28020" "0" "28020" "0" "c.*26511C>T" "r.(=)" "p.(=)" "" "0000692507" "00000039" "30" "19338" "0" "19338" "0" "c.*17829G>A" "r.(=)" "p.(=)" "" "0000692508" "00000039" "30" "1089" "0" "1089" "0" "c.1089C>T" "r.(?)" "p.(Gly363=)" "" "0000692509" "00000039" "50" "163" "0" "163" "0" "c.163C>T" "r.(?)" "p.(Arg55Cys)" "" "0000692510" "00000039" "50" "88" "0" "88" "0" "c.88G>A" "r.(?)" "p.(Ala30Thr)" "" "0000693913" "00000039" "50" "220" "0" "220" "0" "c.220C>T" "r.(?)" "p.(Arg74Cys)" "" "0000726748" "00000039" "30" "27949" "0" "27949" "0" "c.*26440A>C" "r.(=)" "p.(=)" "" "0000726749" "00000039" "30" "27918" "0" "27918" "0" "c.*26409C>T" "r.(=)" "p.(=)" "" "0000726750" "00000039" "50" "20530" "0" "20530" "0" "c.*19021G>A" "r.(=)" "p.(=)" "" "0000726751" "00000039" "30" "6849" "0" "6849" "0" "c.*5340G>A" "r.(=)" "p.(=)" "" "0000726752" "00000039" "30" "4908" "0" "4908" "0" "c.*3399G>A" "r.(=)" "p.(=)" "" "0000726753" "00000039" "50" "3747" "0" "3747" "0" "c.*2238G>A" "r.(=)" "p.(=)" "" "0000726754" "00000039" "50" "1322" "0" "1322" "0" "c.1322G>A" "r.(?)" "p.(Arg441Gln)" "" "0000726755" "00000039" "50" "950" "-75" "950" "-75" "c.950-75G>A" "r.(=)" "p.(=)" "" "0000726756" "00000039" "50" "752" "0" "752" "0" "c.752G>C" "r.(?)" "p.(Gly251Ala)" "" "0000726757" "00000039" "50" "701" "0" "701" "0" "c.701C>G" "r.(?)" "p.(Ala234Gly)" "" "0000726758" "00000039" "30" "617" "0" "617" "0" "c.617G>A" "r.(?)" "p.(Arg206His)" "" "0000726759" "00000039" "10" "522" "0" "522" "0" "c.522C>T" "r.(?)" "p.(Tyr174=)" "" "0000726760" "00000039" "30" "177" "0" "177" "0" "c.177C>T" "r.(?)" "p.(Leu59=)" "" "0000726761" "00000039" "30" "-2434" "0" "-2434" "0" "c.-2434G>T" "r.(?)" "p.(=)" "" "0000730065" "00000039" "90" "1103" "0" "1103" "0" "c.1103A>G" "r.(?)" "p.(His368Arg)" "" "0000763558" "00000039" "90" "111" "0" "111" "0" "c.111T>A" "r.(?)" "p.(Ser37Arg)" "" "0000787032" "00000039" "50" "83" "0" "83" "0" "c.83T>C" "r.(?)" "p.(Leu28Pro)" "1" "0000787526" "00000039" "70" "571" "0" "571" "0" "c.571G>A" "r.(?)" "p.(Gly191Arg)" "5" "0000793847" "00000039" "90" "2" "0" "2" "0" "c.2T>C" "r.?" "p.?" "1" "0000793848" "00000039" "90" "2" "0" "2" "0" "c.2T>C" "r.?" "p.?" "1" "0000793849" "00000039" "90" "1129" "0" "1129" "0" "c.1129C>T" "r.(?)" "p.(Arg377Cys)" "8" "0000793851" "00000039" "90" "1093" "0" "1093" "0" "c.1093C>T" "r.(?)" "p.(Gln365*)" "8" "0000793852" "00000039" "90" "1093" "0" "1093" "0" "c.1093C>T" "r.(?)" "p.(Gln365*)" "8" "0000793853" "00000039" "90" "29" "0" "29" "0" "c.29dup" "r.(?)" "p.(Leu11Alafs*22)" "1" "0000793854" "00000039" "90" "29" "0" "29" "0" "c.29dup" "r.(?)" "p.(Leu11Alafs*22)" "1" "0000793855" "00000039" "90" "197" "0" "197" "0" "c.197C>G" "r.(?)" "p.(Ser66Trp)" "2" "0000793856" "00000039" "90" "197" "0" "197" "0" "c.197C>G" "r.(?)" "p.(Ser66Trp)" "2" "0000793857" "00000039" "90" "1080" "0" "1080" "0" "c.1080del" "r.(?)" "p.(Val361Serfs*52)" "8" "0000793858" "00000039" "90" "1080" "0" "1080" "0" "c.1080del" "r.(?)" "p.(Val361Serfs*52)" "8" "0000808317" "00000039" "50" "27902" "0" "27902" "0" "c.*26393G>A" "r.(=)" "p.(=)" "" "0000808318" "00000039" "30" "13796" "0" "13796" "0" "c.*12287T>C" "r.(=)" "p.(=)" "" "0000808319" "00000039" "50" "13518" "0" "13518" "0" "c.*12009T>G" "r.(=)" "p.(=)" "" "0000808320" "00000039" "30" "13449" "0" "13449" "0" "c.*11940G>A" "r.(=)" "p.(=)" "" "0000808321" "00000039" "30" "6786" "0" "6786" "0" "c.*5277G>A" "r.(=)" "p.(=)" "" "0000808322" "00000039" "30" "6295" "0" "6295" "0" "c.*4786G>C" "r.(=)" "p.(=)" "" "0000808323" "00000039" "30" "4948" "0" "4948" "0" "c.*3439G>C" "r.(=)" "p.(=)" "" "0000808324" "00000039" "50" "1308" "0" "1308" "0" "c.1308G>C" "r.(?)" "p.(Trp436Cys)" "" "0000808325" "00000039" "90" "1167" "0" "1167" "0" "c.1167C>A" "r.(?)" "p.(Asn389Lys)" "" "0000808326" "00000039" "50" "950" "-93" "950" "-93" "c.950-93G>A" "r.(=)" "p.(=)" "" "0000808327" "00000039" "70" "221" "0" "221" "0" "c.221G>A" "r.(?)" "p.(Arg74His)" "" "0000855145" "00000039" "30" "23591" "0" "23591" "0" "c.*22082G>A" "r.(=)" "p.(=)" "" "0000855146" "00000039" "30" "23401" "0" "23401" "0" "c.*21892G>A" "r.(=)" "p.(=)" "" "0000855147" "00000039" "50" "13416" "0" "13416" "0" "c.*11907G>A" "r.(=)" "p.(=)" "" "0000855148" "00000039" "50" "10092" "0" "10092" "0" "c.*8583G>A" "r.(=)" "p.(=)" "" "0000855149" "00000039" "10" "9716" "0" "9716" "0" "c.*8207G>A" "r.(=)" "p.(=)" "" "0000855150" "00000039" "10" "1081" "0" "1081" "0" "c.1081G>A" "r.(?)" "p.(Val361Ile)" "" "0000855151" "00000039" "50" "1049" "0" "1049" "0" "c.1049C>T" "r.(?)" "p.(Pro350Leu)" "" "0000855152" "00000039" "50" "751" "0" "751" "0" "c.751G>A" "r.(?)" "p.(Gly251Arg)" "" "0000865541" "00000039" "30" "21086" "0" "21086" "0" "c.*19577G>A" "r.(=)" "p.(=)" "" "0000865542" "00000039" "30" "19372" "0" "19372" "0" "c.*17863G>C" "r.(=)" "p.(=)" "" "0000865543" "00000039" "50" "13354" "0" "13354" "0" "c.*11845G>A" "r.(=)" "p.(=)" "" "0000865544" "00000039" "30" "9567" "0" "9567" "0" "c.*8058C>T" "r.(=)" "p.(=)" "" "0000865545" "00000039" "30" "4920" "0" "4920" "0" "c.*3411G>A" "r.(=)" "p.(=)" "" "0000865546" "00000039" "30" "3802" "0" "3802" "0" "c.*2293G>A" "r.(=)" "p.(=)" "" "0000865547" "00000039" "10" "1367" "0" "1367" "0" "c.1367G>A" "r.(?)" "p.(Arg456His)" "" "0000865548" "00000039" "90" "1139" "0" "1139" "0" "c.1139A>G" "r.(?)" "p.(Gln380Arg)" "" "0000865549" "00000039" "90" "1105" "0" "1105" "0" "c.1105G>A" "r.(?)" "p.(Glu369Lys)" "" "0000865550" "00000039" "30" "494" "0" "494" "0" "c.494C>G" "r.(?)" "p.(Thr165Ser)" "" "0000865551" "00000039" "90" "220" "0" "220" "0" "c.220C>T" "r.(?)" "p.(Arg74Cys)" "" "0000894334" "00000039" "30" "30561" "0" "30561" "0" "c.*29052G>A" "r.(=)" "p.(=)" "" "0000894335" "00000039" "50" "30489" "0" "30489" "0" "c.*28980dup" "r.(?)" "p.(=)" "" "0000894336" "00000039" "90" "29170" "0" "29170" "0" "c.*27661C>T" "r.(=)" "p.(=)" "" "0000894337" "00000039" "30" "28020" "0" "28020" "0" "c.*26511C>T" "r.(=)" "p.(=)" "" "0000894338" "00000039" "30" "22092" "0" "22092" "0" "c.*20583C>T" "r.(=)" "p.(=)" "" "0000894339" "00000039" "30" "19324" "0" "19324" "0" "c.*17815C>T" "r.(=)" "p.(=)" "" "0000894340" "00000039" "10" "16615" "0" "16615" "0" "c.*15106C>T" "r.(=)" "p.(=)" "" "0000894341" "00000039" "30" "16305" "0" "16305" "0" "c.*14796T>C" "r.(=)" "p.(=)" "" "0000894342" "00000039" "50" "9559" "0" "9559" "0" "c.*8050G>A" "r.(=)" "p.(=)" "" "0000894343" "00000039" "30" "8092" "0" "8092" "0" "c.*6583C>T" "r.(=)" "p.(=)" "" "0000894344" "00000039" "30" "6359" "0" "6359" "0" "c.*4850C>T" "r.(=)" "p.(=)" "" "0000894345" "00000039" "30" "507" "-7" "507" "-7" "c.507-7C>T" "r.(=)" "p.(=)" "" "0000914992" "00000039" "90" "28042" "0" "28042" "0" "c.*26533A>G" "r.(=)" "p.(=)" "" "0000914993" "00000039" "30" "19337" "0" "19337" "0" "c.*17828C>T" "r.(=)" "p.(=)" "" "0000914994" "00000039" "10" "13559" "0" "13559" "0" "c.*12050G>A" "r.(=)" "p.(=)" "" "0000914995" "00000039" "30" "9722" "0" "9722" "0" "c.*8213A>G" "r.(=)" "p.(=)" "" "0000914996" "00000039" "30" "6852" "0" "6852" "0" "c.*5343C>T" "r.(=)" "p.(=)" "" "0000914997" "00000039" "10" "1367" "0" "1367" "0" "c.1367G>A" "r.(?)" "p.(Arg456His)" "" "0000914998" "00000039" "10" "663" "17" "663" "17" "c.663+17T>C" "r.(=)" "p.(=)" "" "0000926667" "00000039" "30" "27949" "0" "27949" "0" "c.*26440A>C" "r.(=)" "p.(=)" "" "0000926668" "00000039" "30" "27799" "0" "27799" "0" "c.*26290C>A" "r.(=)" "p.(=)" "" "0000926669" "00000039" "30" "6799" "0" "6799" "0" "c.*5290G>A" "r.(=)" "p.(=)" "" "0000926670" "00000039" "30" "4989" "0" "4989" "0" "c.*3480G>A" "r.(=)" "p.(=)" "" "0000926671" "00000039" "50" "1298" "0" "1298" "0" "c.1298G>A" "r.(?)" "p.(Arg433Gln)" "" "0000926672" "00000039" "10" "1081" "0" "1081" "0" "c.1081G>A" "r.(?)" "p.(Val361Ile)" "" "0000926673" "00000039" "70" "614" "0" "614" "0" "c.614G>T" "r.(?)" "p.(Gly205Val)" "" "0000930900" "00000039" "50" "16369" "0" "16369" "0" "c.*14860C>A" "r.(=)" "p.(=)" "" "0000930901" "00000039" "10" "13432" "0" "13432" "0" "c.*11923G>A" "r.(=)" "p.(=)" "" "0000930902" "00000039" "30" "9735" "0" "9735" "0" "c.*8226C>T" "r.(=)" "p.(=)" "" "0000930903" "00000039" "30" "4908" "0" "4908" "0" "c.*3399G>A" "r.(=)" "p.(=)" "" "0000930904" "00000039" "30" "4866" "0" "4866" "0" "c.*3357G>A" "r.(=)" "p.(=)" "" "0000930905" "00000039" "90" "197" "0" "197" "0" "c.197C>G" "r.(?)" "p.(Ser66Trp)" "" "0000951059" "00000039" "50" "27849" "0" "27849" "0" "c.*26340C>G" "r.(=)" "p.(=)" "" "0000951060" "00000039" "50" "22171" "0" "22171" "0" "c.*20662G>A" "r.(=)" "p.(=)" "" "0000951061" "00000039" "50" "22160" "0" "22160" "0" "c.*20651G>A" "r.(=)" "p.(=)" "" "0000951062" "00000039" "30" "7665" "0" "7665" "0" "c.*6156G>A" "r.(=)" "p.(=)" "" "0000951063" "00000039" "30" "6352" "0" "6352" "0" "c.*4843C>T" "r.(=)" "p.(=)" "" "0000969269" "00000039" "50" "16594" "0" "16622" "0" "c.*15085_*15113del" "r.(=)" "p.(=)" "" "0000969271" "00000039" "10" "746" "-4" "746" "-4" "c.746-4A>G" "r.spl?" "p.?" "" "0000969272" "00000039" "90" "376" "0" "376" "0" "c.376dup" "r.(?)" "p.(Val126GlyfsTer10)" "" "0000982866" "00000039" "30" "30318" "0" "30318" "0" "c.*28809G>T" "r.(=)" "p.(=)" "" "0000982867" "00000039" "30" "8101" "0" "8101" "0" "c.*6592G>T" "r.(=)" "p.(=)" "" "0000982868" "00000039" "10" "6867" "0" "6867" "0" "c.*5358G>A" "r.(=)" "p.(=)" "" "0000982869" "00000039" "50" "1462" "0" "1462" "0" "c.1462G>A" "r.(?)" "p.(Glu488Lys)" "" "0000982870" "00000039" "30" "950" "-65" "950" "-65" "c.950-65C>T" "r.(=)" "p.(=)" "" "0000982871" "00000039" "50" "950" "-75" "950" "-75" "c.950-75G>A" "r.(=)" "p.(=)" "" "0000982872" "00000039" "50" "950" "-131" "950" "-131" "c.950-131C>T" "r.(=)" "p.(=)" "" "0000982873" "00000039" "30" "522" "0" "522" "0" "c.522C>T" "r.(?)" "p.(Tyr174=)" "" "0000982874" "00000039" "50" "506" "3" "506" "3" "c.506+3A>G" "r.spl?" "p.?" "" "0000989165" "00000039" "50" "1231" "0" "1231" "0" "c.1231C>T" "r.(?)" "p.(Leu411Phe)" "" "0001003782" "00000039" "50" "13401" "0" "13401" "0" "c.*11892A>G" "r.(=)" "p.(=)" "" "0001003783" "00000039" "30" "6752" "0" "6752" "0" "c.*5243A>G" "r.(=)" "p.(=)" "" "0001003784" "00000039" "30" "1322" "0" "1322" "0" "c.1322G>A" "r.(?)" "p.(Arg441Gln)" "" "0001003785" "00000039" "50" "937" "0" "937" "0" "c.937G>A" "r.(?)" "p.(Val313Met)" "" "0001003786" "00000039" "90" "734" "0" "734" "0" "c.734G>A" "r.(?)" "p.(Arg245His)" "" "0001011286" "00000039" "70" "1" "0" "1" "0" "c.1A>G" "r.(?)" "p.(Met1?)" "" "0001011287" "00000039" "70" "88" "0" "88" "0" "c.88G>C" "r.(?)" "p.(Ala30Pro)" "" "0001011288" "00000039" "70" "97" "0" "97" "0" "c.97G>A" "r.(?)" "p.(Gly33Arg)" "" "0001011289" "00000039" "70" "149" "0" "169" "0" "c.149_169del" "r.(?)" "p.(Leu50_Ser57delinsArg)" "" "0001011290" "00000039" "70" "265" "0" "269" "0" "c.265_269del" "r.(?)" "p.(Tyr89AlafsTer45)" "" "0001011291" "00000039" "70" "301" "0" "303" "0" "c.301_303del" "r.(?)" "p.(Phe101del)" "" "0001011292" "00000039" "70" "408" "0" "444" "0" "c.408_444dup" "r.(?)" "p.(Gly149CysfsTer18)" "" "0001011293" "00000039" "70" "582" "0" "582" "0" "c.582T>A" "r.(?)" "p.(Cys194Ter)" "" "0001011294" "00000039" "70" "863" "0" "863" "0" "c.863C>T" "r.(?)" "p.(Pro288Leu)" "" "0001011295" "00000039" "90" "197" "0" "197" "0" "c.197C>G" "r.(?)" "p.(Ser66Trp)" "" "0001011296" "00000039" "50" "932" "0" "932" "0" "c.932C>A" "r.(?)" "p.(Ala311Asp)" "" "0001011297" "00000039" "70" "949" "0" "949" "0" "c.949G>C" "r.(?)" "p.(Asp317His)" "" "0001011298" "00000039" "70" "1130" "0" "1130" "0" "c.1130G>T" "r.(?)" "p.(Arg377Leu)" "" "0001011299" "00000039" "70" "1166" "0" "1166" "0" "c.1166A>G" "r.(?)" "p.(Asn389Ser)" "" "0001011300" "00000039" "70" "1209" "0" "1209" "0" "c.1209C>A" "r.(?)" "p.(Tyr403Ter)" "" "0001011301" "00000039" "70" "1243" "0" "1243" "0" "c.1243A>C" "r.(?)" "p.(Thr415Pro)" "" "0001011302" "00000039" "70" "1345" "0" "1345" "0" "c.1345del" "r.(?)" "p.(Gln449ArgfsTer142)" "" "0001011303" "00000039" "70" "1416" "0" "1416" "0" "c.1416G>C" "r.(?)" "p.(Gln472His)" "" "0001011304" "00000039" "70" "1429" "0" "1429" "0" "c.1429del" "r.(?)" "p.(Asp477ThrfsTer114)" "" "0001011305" "00000039" "70" "1166" "0" "1166" "0" "c.1166A>G" "r.(?)" "p.(Asn389Ser)" "" "0001011331" "00000039" "90" "364" "0" "364" "0" "c.364G>A" "r.(?)" "p.(Gly122Arg)" "" "0001011332" "00000039" "90" "734" "0" "734" "0" "c.734G>A" "r.(?)" "p.(Arg245His)" "" "0001011333" "00000039" "90" "892" "0" "892" "0" "c.892T>C" "r.(?)" "p.(Ser298Pro)" "" "0001011334" "00000039" "90" "1105" "0" "1105" "0" "c.1105G>A" "r.(?)" "p.(Glu369Lys)" "" "0001011335" "00000039" "90" "734" "0" "734" "0" "c.734G>A" "r.(?)" "p.(Arg245His)" "" "0001011336" "00000039" "90" "734" "0" "734" "0" "c.734G>A" "r.(?)" "p.(Arg245His)" "" "0001011337" "00000039" "50" "220" "0" "220" "0" "c.220C>T" "r.(?)" "p.(Arg74Cys)" "" "0001011338" "00000039" "90" "197" "0" "197" "0" "c.197C>G" "r.(?)" "p.(Ser66Trp)" "" "0001011339" "00000039" "90" "734" "0" "734" "0" "c.734G>A" "r.(?)" "p.(Arg245His)" "" "0001011340" "00000039" "70" "911" "0" "911" "0" "c.911G>T" "r.(?)" "p.(Arg304Leu)" "" "0001011341" "00000039" "90" "1080" "0" "1080" "0" "c.1080del" "r.(?)" "p.(Val361SerfsTer52)" "" "0001011342" "00000039" "90" "877" "0" "877" "0" "c.877C>T" "r.(?)" "p.(Pro293Ser)" "" "0001011343" "00000039" "90" "892" "0" "892" "0" "c.892T>C" "r.(?)" "p.(Ser298Pro)" "" "0001011344" "00000039" "50" "235" "0" "235" "0" "c.235A>C" "r.(?)" "p.(Thr79Pro)" "" "0001011345" "00000039" "90" "734" "0" "734" "0" "c.734G>A" "r.(?)" "p.(Arg245His)" "" "0001011346" "00000039" "90" "1080" "0" "1080" "0" "c.1080del" "r.(?)" "p.(Val361SerfsTer52)" "" "0001011347" "00000039" "90" "1080" "0" "1080" "0" "c.1080del" "r.(?)" "p.(Val361SerfsTer52)" "" "0001011348" "00000039" "90" "1297" "0" "1297" "0" "c.1297C>T" "r.(?)" "p.(Arg433Trp)" "" "0001011349" "00000039" "90" "734" "0" "734" "0" "c.734G>A" "r.(?)" "p.(Arg245His)" "" "0001011350" "00000039" "90" "734" "0" "734" "0" "c.734G>A" "r.(?)" "p.(Arg245His)" "" "0001012420" "00000039" "50" "308" "0" "308" "0" "c.308A>G" "r.(?)" "p.(Lys103Arg)" "" "0001012769" "00000039" "90" "544" "0" "544" "0" "c.544C>T" "r.(?)" "p.(Arg182Cys)" "5" "0001012770" "00000039" "90" "571" "0" "571" "0" "c.571G>A" "r.(?)" "p.(Gly191Arg)" "5" "0001012789" "00000039" "90" "1129" "0" "1129" "0" "c.1129C>T" "r.(?)" "p.(Arg377Cys)" "8" "0001012790" "00000039" "90" "1418" "0" "1418" "0" "c.1418G>A" "r.(?)" "p.(Trp473Ter)" "8" "0001015641" "00000039" "50" "6353" "0" "6353" "0" "c.*4844G>A" "r.(=)" "p.(=)" "" "0001042240" "00000039" "30" "16346" "0" "16346" "0" "c.*14837G>A" "r.(=)" "p.(=)" "" "0001042241" "00000039" "30" "10167" "0" "10167" "0" "c.*8658C>T" "r.(=)" "p.(=)" "" "0001042242" "00000039" "30" "950" "-149" "950" "-149" "c.950-149C>T" "r.(=)" "p.(=)" "" "0001042243" "00000039" "50" "563" "0" "563" "0" "c.563C>T" "r.(?)" "p.(Pro188Leu)" "" "0001042244" "00000039" "30" "356" "-6" "356" "-6" "c.356-6G>A" "r.(=)" "p.(=)" "" "0001042245" "00000039" "50" "349" "0" "349" "0" "c.349C>T" "r.(?)" "p.(Arg117Cys)" "" "0001042246" "00000039" "50" "276" "0" "276" "0" "c.276C>G" "r.(?)" "p.(His92Gln)" "" "0001042247" "00000039" "50" "90" "0" "90" "0" "c.90G>A" "r.(?)" "p.(=)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 86 "{{screeningid}}" "{{variantid}}" "0000000006" "0000000673" "0000000014" "0000000674" "0000000049" "0000000671" "0000000049" "0000000672" "0000000085" "0000000670" "0000000085" "0000000675" "0000103196" "0000166301" "0000103197" "0000166302" "0000103197" "0000166303" "0000144623" "0000235427" "0000144623" "0000235428" "0000144623" "0000235429" "0000227452" "0000467287" "0000227453" "0000467288" "0000227454" "0000467289" "0000227455" "0000467290" "0000227456" "0000467291" "0000227457" "0000467292" "0000227457" "0000467293" "0000227458" "0000467294" "0000293054" "0000649743" "0000293055" "0000649744" "0000293056" "0000649745" "0000305739" "0000669427" "0000305740" "0000669428" "0000312329" "0000693913" "0000332783" "0000730065" "0000363128" "0000763558" "0000375681" "0000787032" "0000375681" "0000787526" "0000380695" "0000793847" "0000380695" "0000793848" "0000380696" "0000793849" "0000380697" "0000793851" "0000380697" "0000793852" "0000380698" "0000793853" "0000380698" "0000793854" "0000380699" "0000793855" "0000380699" "0000793856" "0000380700" "0000793857" "0000380700" "0000793858" "0000456901" "0001011286" "0000456901" "0001011331" "0000456902" "0001011287" "0000456902" "0001011332" "0000456903" "0001011288" "0000456904" "0001011289" "0000456904" "0001011333" "0000456905" "0001011290" "0000456905" "0001011334" "0000456906" "0001011291" "0000456906" "0001011335" "0000456907" "0001011292" "0000456907" "0001011336" "0000456908" "0001011293" "0000456908" "0001011337" "0000456908" "0001011338" "0000456909" "0001011294" "0000456909" "0001011339" "0000456910" "0001011295" "0000456910" "0001011340" "0000456911" "0001011296" "0000456911" "0001011341" "0000456912" "0001011297" "0000456912" "0001011342" "0000456913" "0001011298" "0000456913" "0001011343" "0000456914" "0001011299" "0000456914" "0001011344" "0000456914" "0001011345" "0000456915" "0001011300" "0000456915" "0001011346" "0000456916" "0001011301" "0000456916" "0001011347" "0000456917" "0001011302" "0000456917" "0001011348" "0000456918" "0001011303" "0000456918" "0001011349" "0000456919" "0001011304" "0000456919" "0001011350" "0000456920" "0001011305" "0000457873" "0001012420" "0000458160" "0001012769" "0000458160" "0001012789" "0000458161" "0001012770" "0000458161" "0001012790"