### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = SLC12A3) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "SLC12A3" "solute carrier family 12 (sodium/chloride transporters), member 3" "16" "q13" "unknown" "NG_009386.2" "UD_132118210027" "" "https://www.LOVD.nl/SLC12A3" "" "1" "10912" "6559" "600968" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was performed by Johan den Dunnen, supported by Global Variome." "" "g" "https://databases.lovd.nl/shared/refseq/SLC12A3_codingDNA.html" "1" "" "" "-1" "" "-1" "00000" "2012-09-13 00:00:00" "00001" "2020-12-16 14:05:28" "00000" "2026-01-20 18:57:21" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00001220" "SLC12A3" "transcript variant 1" "001" "NM_000339.2" "" "NP_000330.2" "" "" "" "-29" "5538" "3093" "56899119" "56949762" "00000" "2012-09-13 13:19:24" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 6 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00994" "HMMS" "Hamamy syndrome (HMMS)" "AR" "611174" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "01157" "CHTE" "Hypothyroidism, central, testicular enlargement (CHTE)" "XLR" "300888" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "02027" "GTLMNS" "Gitelman syndrome (GTLMNS)" "AR" "263800" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "04214" "-" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00001" "2023-03-09 14:26:26" "04222" "PKD" "kidney disease, polycystic (PKD)" "" "" "" "" "" "00006" "2015-03-13 11:12:15" "00006" "2017-11-15 22:09:51" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 1 "{{geneid}}" "{{diseaseid}}" "SLC12A3" "02027" ## Individuals ## Do not remove or alter this header ## ## Count = 157 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00000208" "" "" "" "1" "" "00037" "{PMID:Sun 2011:23143598}, {DOI:Sun 2011:10.1038/ng.2453}" "" "M" "no" "Netherlands" "" "0" "" "" "" "" "00000209" "" "" "" "1" "" "00037" "{PMID:Sun 2011:23143598}, {DOI:Sun 2011:10.1038/ng.2453}" "" "M" "no" "Netherlands" "" "0" "" "" "" "" "00080875" "" "" "" "1" "" "01758" "{PMID:Trujillano 2017:27848944}" "unaffected parents" "" "" "" "" "0" "" "" "" "" "00107880" "" "" "" "3" "" "00006" "{PMID:Bonnard 2012:22581230}" "2-generation family, 3 affected sibs, unaffected heterozygous carrier parents/relatives (F, 2M)" "M" "yes" "Jordan" "" "0" "" "" "" "FamJorPatIII1" "00269921" "" "" "" "1" "" "01164" "" "" "M" "" "" "" "0" "" "" "" "" "00291494" "" "" "" "34" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00291495" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00291496" "" "" "" "72" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00291497" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00304520" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00308006" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" "" "00320250" "" "" "" "1" "" "03944" "" "" "" "" "Japan" "" "" "" "" "Asian" "PT274" "00320251" "" "" "" "1" "" "03944" "" "" "" "" "Japan" "" "" "" "" "Asian" "PT435" "00320252" "" "" "" "1" "" "03944" "" "" "" "" "Japan" "" "0" "" "" "Asian" "PT470" "00320253" "" "" "" "1" "" "03944" "" "" "" "" "Japan" "" "" "" "" "Asian" "PT491" "00320254" "" "" "" "1" "" "03944" "" "" "" "" "Japan" "" "0" "" "" "Asian" "PT552" "00320255" "" "" "" "1" "" "03944" "" "" "" "" "Japan" "" "" "" "" "Asian" "PT620" "00320271" "" "" "" "1" "" "03944" "" "" "" "" "Japan" "" "" "" "" "Asian" "PT635" "00320272" "" "" "" "1" "" "03944" "" "" "" "" "Japan" "" "" "" "" "Asian" "PT641" "00320273" "" "" "" "1" "" "03944" "" "" "" "" "Japan" "" "" "" "" "Asian" "PT662" "00320274" "" "" "" "1" "" "03944" "" "" "" "" "Japan" "" "" "" "" "Asian" "PT664" "00320275" "" "" "" "1" "" "03944" "" "" "" "" "Japan" "" "" "" "" "Asian" "PT665" "00320276" "" "" "" "1" "" "03944" "" "" "" "" "Japan" "" "" "" "" "Asian" "PT694" "00320277" "" "" "" "1" "" "03944" "" "" "" "" "Japan" "" "" "" "" "Asian" "PT861" "00320278" "" "" "" "1" "" "03944" "" "" "" "" "Japan" "" "" "" "" "Asian" "PT901" "00320279" "" "" "" "1" "" "03944" "" "" "" "" "Japan" "" "" "" "" "Asian" "PT928" "00320280" "" "" "" "1" "" "03944" "" "" "" "" "Japan" "" "" "" "" "Asian" "PT934" "00320281" "" "" "" "1" "" "03944" "" "" "" "" "Japan" "" "" "" "" "Asian" "PT936" "00320282" "" "" "" "1" "" "03944" "" "" "" "" "Japan" "" "" "" "" "Asian" "PT937" "00320283" "" "" "" "1" "" "03944" "" "" "" "" "Japan" "" "" "" "" "Asian" "PT944" "00320311" "" "" "" "1" "" "03944" "" "" "" "" "Japan" "" "" "" "" "Asian" "PT948" "00320312" "" "" "" "1" "" "03944" "" "" "" "" "Japan" "" "" "" "" "Asian" "PT1043" "00320313" "" "" "" "1" "" "03944" "" "" "" "" "Japan" "" "" "" "" "Asian" "PT1075" "00320314" "" "" "" "1" "" "03944" "" "" "" "" "Japan" "" "" "" "" "Asian" "PT1092" "00320315" "" "" "" "1" "" "03944" "" "" "" "" "Japan" "" "" "" "" "Asian" "PT1111" "00320316" "" "" "" "1" "" "03944" "" "" "" "" "Japan" "" "" "" "" "Asian" "PT1116" "00320317" "" "" "" "1" "" "03944" "" "" "" "" "Japan" "" "" "" "" "Asian" "PT1152" "00320318" "" "" "" "1" "" "03944" "" "" "" "" "Japan" "" "" "" "" "Asian" "PT1159" "00320319" "" "" "" "1" "" "03944" "" "" "" "" "Japan" "" "" "" "" "Asian" "PT547" "00320320" "" "" "" "1" "" "03944" "" "" "" "" "Japan" "" "" "" "" "Asian" "PT1031" "00331603" "" "" "" "1" "" "01164" "" "" "M" "?" "Germany" "" "0" "" "" "" "175691" "00362002" "" "" "" "1" "" "00000" "{PMID:Duvvari 2016:27007659}" "patient" "" "" "Netherlands" "" "0" "" "" "white" "Pat5AB" "00362011" "" "" "" "3" "" "00000" "{PMID:Duvvari 2016:27007659}" "2-generation family, 4 affected (3F, M)" "" "" "Netherlands" "" "0" "" "" "white" "Fam3" "00373352" "" "" "" "1" "" "01164" "" "" "M" "?" "Turkey" "" "0" "" "" "" "179285" "00395054" "" "" "" "1" "" "00000" "{PMID:Zacchia 2021:33964006}" "" "F" "" "(Italy)" "" "0" "" "" "" "K17" "00395055" "" "" "" "1" "" "00000" "{PMID:Zacchia 2021:33964006}" "" "" "" "(Italy)" "" "0" "" "" "" "K18" "00395056" "" "" "" "1" "" "00000" "{PMID:Zacchia 2021:33964006}" "" "F" "" "(Italy)" "" "0" "" "" "" "K19" "00395057" "" "" "" "1" "" "00000" "{PMID:Zacchia 2021:33964006}" "" "F" "" "(Italy)" "" "0" "" "" "" "K39" "00395059" "" "" "" "1" "" "00000" "{PMID:Zacchia 2021:33964006}" "" "?" "" "(Italy)" "" "0" "" "" "" "K106" "00414364" "" "" "" "1" "" "00000" "{PMID:Sun 2018:30076350}" "" "M" "" "China" "" "0" "" "" "" "WHP31" "00414410" "" "" "" "1" "" "00000" "{PMID:Sun 2018:30076350}" "" "M" "" "China" "" "0" "" "" "" "WHP77" "00414458" "" "" "" "1" "" "00000" "{PMID:Sun 2018:30076350}" "" "M" "" "China" "" "0" "" "" "" "WHP125" "00437029" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "F" "" "France" "" "0" "" "" "" "Pat86" "00437030" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "M" "" "Germany" "" "0" "" "" "" "Pat106" "00437031" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "patient, no family history" "M" "no" "France" "" "0" "" "" "" "Pat15" "00437032" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "M" "" "France" "" "0" "" "" "" "Pat12" "00437033" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "F" "" "France" "" "0" "" "" "" "Pat32" "00437034" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "F" "" "France" "" "0" "" "" "" "Pat59" "00437035" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "M" "" "Germany" "" "0" "" "" "" "Pat104" "00437036" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "2-generation family, 1 affected, unaffected parents" "M" "" "Germany" "" "0" "" "" "" "Pat112" "00437037" "" "" "" "3" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "2-generation family, patient and 2 affected sisters, unaffected parents" "M" "no" "France" "" "0" "" "" "" "Pat3" "00437038" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "patient, no family history" "M" "no" "France" "" "0" "" "" "" "Pat50" "00437039" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "2-generation family, 1 affected, unaffected parents" "F" "" "Germany" "" "0" "" "" "" "Pat120" "00437040" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "patient, no family history" "F" "no" "France" "" "0" "" "" "" "Pat30" "00437041" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "M" "" "Germany" "" "0" "" "" "" "Pat98" "00437042" "" "" "" "2" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "2-generation family, patient and affected sister, unaffected parents" "M" "" "Germany" "" "0" "" "" "" "Pat103" "00437043" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "patient, no family history" "F" "no" "France" "" "0" "" "" "" "Pat43" "00437044" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "patient, no family history" "F" "no" "France" "" "0" "" "" "" "Pat5" "00437045" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "M" "" "France" "" "0" "" "" "" "Pat27" "00437046" "" "" "" "3" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "2-generation family, patient and 2 affected sisters, unaffected parents" "F" "no" "France" "" "0" "" "" "" "Pat17" "00437047" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "patient, no family history" "M" "no" "France" "" "0" "" "" "" "Pat75" "00437048" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "patient, no family history" "F" "no" "France" "" "0" "" "" "" "Pat37" "00437049" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "patient, no family history" "F" "no" "France" "" "0" "" "" "" "Pat45" "00437050" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "patient, no family history" "F" "no" "France" "" "0" "" "" "" "Pat9" "00437051" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "2-generation family, 1 affected, unaffected parents" "F" "" "Germany" "" "0" "" "" "" "Pat111" "00437052" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "patient, no family history" "M" "no" "France" "" "0" "" "" "" "Pat21" "00437053" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "F" "" "Germany" "" "0" "" "" "" "Pat105" "00437054" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "M" "" "Germany" "" "0" "" "" "" "Pat118" "00437055" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "F" "" "Germany" "" "0" "" "" "" "Pat121" "00437056" "" "" "" "2" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "2-generation family, patient and affected sister, unaffected parents" "M" "" "Germany" "" "0" "" "" "" "Pat109" "00437057" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "F" "" "Germany" "" "0" "" "" "" "Pat122" "00437058" "" "" "" "2" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "2-generation family, patient and affected sister, unaffected parents" "F" "" "Germany" "" "0" "" "" "" "Pat100" "00437059" "" "" "" "2" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "2-generation family, patient and affected brother, unaffected parents" "F" "no" "France" "" "0" "" "" "" "Pat42" "00437060" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "F" "" "France" "" "0" "" "" "" "Pat31" "00437061" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "patient, no family history" "M" "no" "France" "" "0" "" "" "" "Pat88" "00437062" "" "" "" "2" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "2-generation family, patient and affected sister, unaffected parents" "F" "no" "France" "" "0" "" "" "" "Pat11" "00437063" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "patient, no family history" "F" "no" "France" "" "0" "" "" "" "Pat93" "00437064" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "patient, no family history" "M" "yes" "France" "" "0" "" "" "" "Pat47" "00437065" "" "" "" "2" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "2-generation family, patient and affected brother, unaffected parents" "F" "" "Germany" "" "0" "" "" "" "Pat99" "00437066" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "F" "" "France" "" "0" "" "" "" "Pat25" "00437067" "" "" "" "2" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "2-generation family, patient and affected sister, unaffected parents" "M" "no" "France" "" "0" "" "" "" "Pat64" "00437068" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "patient, no family history" "M" "no" "France" "" "0" "" "" "" "Pat34" "00437069" "" "" "" "2" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "2-generation family, patient and affected brother, unaffected parents" "F" "no" "France" "" "0" "" "" "" "Pat96" "00437070" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "patient, no family history" "F" "no" "France" "" "0" "" "" "" "Pat65" "00437071" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "M" "" "France" "" "0" "" "" "" "Pat36" "00437072" "" "" "" "2" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "2-generation family, patient and affected sister, unaffected parents" "M" "no" "France" "" "0" "" "" "" "Pat33" "00437073" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "F" "" "France" "" "0" "" "" "" "Pat58" "00437074" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "M" "" "Germany" "" "0" "" "" "" "Pat102" "00437075" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "F" "" "France" "" "0" "" "" "" "Pat60" "00437076" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "patient, no family history" "M" "no" "France" "" "0" "" "" "" "Pat87" "00437077" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "patient, no family history" "F" "no" "France" "" "0" "" "" "" "Pat54" "00437078" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "F" "" "France" "" "0" "" "" "" "Pat38" "00437079" "" "" "" "2" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "2-generation family, patient and affected brother, unaffected parents" "M" "no" "France" "" "0" "" "" "" "Pat94" "00437080" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "M" "" "France" "" "0" "" "" "" "Pat26" "00437081" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "patient, no family history" "M" "no" "France" "" "0" "" "" "" "Pat41" "00437082" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "patient, no family history" "M" "no" "France" "" "0" "" "" "" "Pat55" "00437083" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "M" "" "France" "" "0" "" "" "" "Pat23" "00437084" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "patient, no family history" "M" "no" "France" "" "0" "" "" "" "Pat57" "00437085" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "patient, no family history" "F" "no" "France" "" "0" "" "" "" "Pat7" "00437086" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "patient, no family history" "F" "no" "France" "" "0" "" "" "" "Pat18" "00437087" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "patient, no family history" "M" "no" "France" "" "0" "" "" "" "Pat95" "00437088" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "patient, no family history" "F" "no" "France" "" "0" "" "" "" "Pat83" "00437089" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "patient, no family history" "F" "no" "France" "" "0" "" "" "" "Pat2" "00437090" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "patient, no family history" "M" "no" "France" "" "0" "" "" "" "Pat62" "00437091" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "2-generation family, 1 affected, unaffected parents" "M" "" "Germany" "" "0" "" "" "" "Pat119" "00437092" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "F" "" "France" "" "0" "" "" "" "Pat28" "00437093" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "patient, no family history" "F" "no" "France" "" "0" "" "" "" "Pat6" "00437094" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "patient, no family history" "M" "no" "France" "" "0" "" "" "" "Pat85" "00437095" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "F" "" "France" "" "0" "" "" "" "Pat44" "00437096" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "patient, no family history" "M" "no" "France" "" "0" "" "" "" "Pat39" "00437097" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "patient, no family history" "F" "no" "France" "" "0" "" "" "" "Pat66" "00437098" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "M" "" "France" "" "0" "" "" "" "Pat16" "00437099" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "patient, no family history" "F" "no" "France" "" "0" "" "" "" "Pat52" "00437100" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "F" "" "France" "" "0" "" "" "" "Pat97" "00437101" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "M" "" "France" "" "0" "" "" "" "Pat35" "00437102" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "patient, no family history" "F" "no" "France" "" "0" "" "" "" "Pat24" "00437103" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "patient, no family history" "M" "no" "France" "" "0" "" "" "" "Pat46" "00437104" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "patient, no family history" "M" "no" "France" "" "0" "" "" "" "Pat40" "00437105" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "patient, no family history" "M" "no" "France" "" "0" "" "" "" "Pat20" "00437106" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "patient, no family history" "F" "no" "France" "" "0" "" "" "" "Pat84" "00437107" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "F" "" "France" "" "0" "" "" "" "Pat61" "00437108" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "F" "" "France" "" "0" "" "" "" "Pat14" "00437109" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "M" "" "France" "" "0" "" "" "" "Pat22" "00437110" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "M" "" "France" "" "0" "" "" "" "Pat29" "00437111" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "M" "" "France" "" "0" "" "" "" "Pat53" "00437112" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "F" "" "France" "" "0" "" "" "" "Pat67" "00437113" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "patient, no family history" "M" "no" "France" "" "0" "" "" "" "Pat68" "00437114" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "M" "" "France" "" "0" "" "" "" "Pat69" "00437115" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "M" "" "France" "" "0" "" "" "" "Pat70" "00437116" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "F" "" "France" "" "0" "" "" "" "Pat71" "00437117" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "F" "" "France" "" "0" "" "" "" "Pat73" "00437118" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "F" "" "France" "" "0" "" "" "" "Pat74" "00437119" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "M" "" "France" "" "0" "" "" "" "Pat76" "00437120" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "M" "" "France" "" "0" "" "" "" "Pat77" "00437121" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "F" "" "France" "" "0" "" "" "" "Pat78" "00437122" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "F" "" "France" "" "0" "" "" "" "Pat79" "00437123" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "M" "" "France" "" "0" "" "" "" "Pat82" "00437124" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "M" "" "France" "" "0" "" "" "" "Pat89" "00437125" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "F" "" "Germany" "" "0" "" "" "" "Pat101" "00437126" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "F" "" "Germany" "" "0" "" "" "" "Pat108" "00437127" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "F" "" "Germany" "" "0" "" "" "" "Pat114" "00437128" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "F" "" "Germany" "" "0" "" "" "" "Pat115" "00437129" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "M" "" "Germany" "" "0" "" "" "" "Pat116" "00437130" "" "" "" "1" "" "00006" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "M" "" "Germany" "" "0" "" "" "" "Pat117" "00449794" "" "" "" "1" "" "04689" "" "" "" "" "" "" "" "" "" "" "" "00453408" "" "" "" "1" "" "00006" "{PMID:Ozyavuz Cubuk 2024:38971859}" "" "M" "" "Turkey" "" "0" "" "" "" "Pat81" "00453446" "" "" "" "1" "" "03544" "" "" "F" "-" "- (not applicable)" "" "" "" "" "white" "" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 157 "{{individualid}}" "{{diseaseid}}" "00000208" "01157" "00000209" "01157" "00080875" "02027" "00107880" "00994" "00269921" "00198" "00291494" "00198" "00291495" "00198" "00291496" "00198" "00291497" "00198" "00304520" "00198" "00308006" "00198" "00320250" "02027" "00320251" "02027" "00320252" "02027" "00320253" "02027" "00320254" "02027" "00320255" "02027" "00320271" "02027" "00320272" "02027" "00320273" "02027" "00320274" "02027" "00320275" "02027" "00320276" "02027" "00320277" "02027" "00320278" "02027" "00320279" "02027" "00320280" "02027" "00320281" "02027" "00320282" "02027" "00320283" "02027" "00320311" "02027" "00320312" "02027" "00320313" "02027" "00320314" "02027" "00320315" "02027" "00320316" "02027" "00320317" "02027" "00320318" "02027" "00320319" "02027" "00320320" "02027" "00331603" "02027" "00362002" "04214" "00362011" "04214" "00373352" "02027" "00395054" "04214" "00395055" "04214" "00395056" "04214" "00395057" "04214" "00395059" "04214" "00414364" "00198" "00414410" "00198" "00414458" "00198" "00437029" "02027" "00437030" "02027" "00437031" "02027" "00437032" "02027" "00437033" "02027" "00437034" "02027" "00437035" "02027" "00437036" "02027" "00437037" "02027" "00437038" "02027" "00437039" "02027" "00437040" "02027" "00437041" "02027" "00437042" "02027" "00437043" "02027" "00437044" "02027" "00437045" "02027" "00437046" "02027" "00437047" "02027" "00437048" "02027" "00437049" "02027" "00437050" "02027" "00437051" "02027" "00437052" "02027" "00437053" "02027" "00437054" "02027" "00437055" "02027" "00437056" "02027" "00437057" "02027" "00437058" "02027" "00437059" "02027" "00437060" "02027" "00437061" "02027" "00437062" "02027" "00437063" "02027" "00437064" "02027" "00437065" "02027" "00437066" "02027" "00437067" "02027" "00437068" "02027" "00437069" "02027" "00437070" "02027" "00437071" "02027" "00437072" "02027" "00437073" "02027" "00437074" "02027" "00437075" "02027" "00437076" "02027" "00437077" "02027" "00437078" "02027" "00437079" "02027" "00437080" "02027" "00437081" "02027" "00437082" "02027" "00437083" "02027" "00437084" "02027" "00437085" "02027" "00437086" "02027" "00437087" "02027" "00437088" "02027" "00437089" "02027" "00437090" "02027" "00437091" "02027" "00437092" "02027" "00437093" "02027" "00437094" "02027" "00437095" "02027" "00437096" "02027" "00437097" "02027" "00437098" "02027" "00437099" "02027" "00437100" "02027" "00437101" "02027" "00437102" "02027" "00437103" "02027" "00437104" "02027" "00437105" "02027" "00437106" "02027" "00437107" "02027" "00437108" "02027" "00437109" "02027" "00437110" "02027" "00437111" "02027" "00437112" "02027" "00437113" "02027" "00437114" "02027" "00437115" "02027" "00437116" "02027" "00437117" "02027" "00437118" "02027" "00437119" "02027" "00437120" "02027" "00437121" "02027" "00437122" "02027" "00437123" "02027" "00437124" "02027" "00437125" "02027" "00437126" "02027" "00437127" "02027" "00437128" "02027" "00437129" "02027" "00437130" "02027" "00449794" "02027" "00453408" "04222" "00453446" "02027" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00198, 00994, 01157, 02027, 04214, 04222 ## Count = 123 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000038983" "01157" "00000208" "00006" "Familial, X-linked recessive" "" "central hypothyroidism (FT4 0.50-0.99of lower limit normal), no prolactin deficiency, age sonographic determination testicular volume 17.64y, testicular volume right/left 21/20 (7.3–16ml)" "" "3w" "" "" "" "" "" "" "" "" "" "0000038984" "01157" "00000209" "00006" "Familial, X-linked recessive" "" "central hypothyroidism (FT4 0.50-0.99of lower limit normal), prolactin deficiency, age sonographic determination testicular volume 21.36y, testicular volume right/left 30/26 (8.5–18.3ml)" "" "07y04m" "" "" "" "" "" "" "" "" "" "0000060444" "02027" "00080875" "01758" "Familial, autosomal recessive" "" "Gitelman syndrome (OMIM:263800)" "" "" "" "" "" "" "" "" "" "" "" "0000085634" "00994" "00107880" "00006" "Familial, autosomal recessive" "" "craniosynostosis; brachycephaly; bulging midface; laterally sparse eyebrows; severe telecanthus/hypertelorism; severe progressive myopia; absence/dysfunction of nasolacrimal structures; no dysfunction of parotid glands; broad nasal bridge/pointed nasal tips/anteverted nostrils; high arched palate; smooth/long philtrum; thin upper vermillion border/wide mouth; loss of lamina dura; thin enamel/enamel hypoplasia; low-set/ear abnormalities; no bilateral preauricular tags; sensori neural hearing impairment; mild micrognathia; low posterior hair line/extra frontal hair whorl; generalized osteopenia; long bone fractures; hip dysplasia; no pectus excavatum; pterygium colli/slopping shoulder; no syndactyly/tapering fingers/long toes/5th finger clinodactyly; thumb deviation/ectopic finger creases/long fingers/short index; tiny patent ductus arteriosus; no mild mitral regurgitation; no atrial septal defect; intraventricular conduction delay; no total A-V canal; inguinal hernia; no hypoparathyroidism; cryptorchidism and absence of gonad activity; microcytic hypochromic anemia; moderate psychomotor retardation; unclear speech" "" "" "" "" "" "" "" "" "HMMS" "" "" "0000207717" "00198" "00269921" "01164" "Unknown" "" "Abnormality of acetylcarnitine metabolism (HP:0012071); Periodic paralysis (HP:0003768); Rhabdomyolysis (HP:0003201); Exercise-induced myalgia (HP:0003738)" "" "" "" "" "" "" "" "" "" "" "" "0000233429" "00198" "00308006" "01164" "Unknown" "" "Hypokalemia (HP:0002900)" "" "" "" "" "" "" "" "" "" "" "" "0000249796" "02027" "00331603" "01164" "Unknown" "31y" "severe hypokalemia, clinical Gitelmann-syndrome" "" "" "" "" "" "" "" "" "" "" "" "0000257395" "04214" "00362002" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "age-related macular degeneration, cuticular drusen" "" "0000257404" "04214" "00362011" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "age-related macular degeneration, cuticular drusen" "" "0000268628" "02027" "00373352" "01164" "Familial, autosomal recessive" "" "clinically Gitelmann syndrome, cardiac arrhythmia, SA block" "" "" "" "" "" "" "" "" "" "" "" "0000288254" "04214" "00395054" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "Tubulopathy (hypokalemic metabolic acidosis)" "" "" "0000288255" "04214" "00395055" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "Tubulopathy (hypokalemic metabolic acidosis)" "" "" "0000288256" "04214" "00395056" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "Tubulopathy (hypokalemic metabolic acidosis)" "" "" "0000288257" "04214" "00395057" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "Tubulopathy (hypokalemic metabolic acidosis)" "" "" "0000288259" "04214" "00395059" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "Tubulopathy (hypokalemic metabolic alkalosis)" "" "" "0000306199" "00198" "00414364" "00000" "Familial, autosomal recessive" "3y" "" "" "" "" "" "" "" "" "" "Gitelman syndrome" "" "" "0000306245" "00198" "00414410" "00000" "Familial, autosomal recessive" "21y" "" "" "" "" "" "" "" "" "" "Gitelman syndrome" "" "" "0000306293" "00198" "00414458" "00000" "Familial, autosomal recessive" "8y" "" "" "" "" "" "" "" "" "" "Gitelman syndrome" "" "" "0000326948" "02027" "00437029" "00006" "Familial, autosomal recessive" "26y" "hypokalemia" "" "26y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326949" "02027" "00437030" "00006" "Familial, autosomal recessive" "9y" "incidental finding" "" "7y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326950" "02027" "00437031" "00006" "Familial, autosomal recessive" "9y10m" "hypokalemia; hypomagnesemia; hypocalciuria;" "" "9y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326951" "02027" "00437032" "00006" "Familial, autosomal recessive" "12y6m" "hypokalemia; chronic hyperaldosteronism; episode of gastroenteritis" "" "12y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326952" "02027" "00437033" "00006" "Familial, autosomal recessive" "33y6m8" "hypokalemia; hypomagnesemia; hypocalciuria" "" "33y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326953" "02027" "00437034" "00006" "Familial, autosomal recessive" "48y1m" "hypokalemia; hypomagnesemia; metabolic alkalosis; asthenia" "" "" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326954" "02027" "00437035" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326955" "02027" "00437036" "00006" "Familial, autosomal recessive" "" "" "" "5y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326956" "02027" "00437037" "00006" "Familial, autosomal recessive" "28y6m8" "hypokalemia; cramps; hypochloremia; hand and leg myoclonus; alkalosis" "" "14y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326957" "02027" "00437038" "00006" "Familial, autosomal recessive" "42y1m" "high blood pressure; hypokalemia; metabolic alkalosis" "" "42y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326958" "02027" "00437039" "00006" "Familial, autosomal recessive" "1y" "pyelonephritis" "" "1y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326959" "02027" "00437040" "00006" "Familial, autosomal recessive" "31y6m8" "hypokalemia" "" "31y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326960" "02027" "00437041" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326961" "02027" "00437042" "00006" "Familial, autosomal recessive" "32y" "" "" "" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326962" "02027" "00437043" "00006" "Familial, autosomal recessive" "18y2m" "hypokalemia; asthenia" "" "18y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326963" "02027" "00437044" "00006" "Familial, autosomal recessive" "53y6m" "hypokalemia; hypochloremia; alkalosis; asthenia" "" "53y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326964" "02027" "00437045" "00006" "Familial, autosomal recessive" "38y5m" "asymptomatic profound hypokalemia; metabolic alkalosis; hypomagnesemia" "" "38y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326965" "02027" "00437046" "00006" "Familial, autosomal recessive" "28y8m" "hypokalemia" "" "28y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326966" "02027" "00437047" "00006" "Familial, autosomal recessive" "39y2m" "hypokalemia; asthenia" "" "" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326967" "02027" "00437048" "00006" "Familial, autosomal recessive" "23y10m" "cramps; hypokalemia;" "" "23y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326968" "02027" "00437049" "00006" "Familial, autosomal recessive" "14y2m" "hypokalemia; faintness" "" "14y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326969" "02027" "00437050" "00006" "Familial, autosomal recessive" "11y3m" "deterioration of general condition; hypokalemia; polyphagia" "" "11y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326970" "02027" "00437051" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326971" "02027" "00437052" "00006" "Familial, autosomal recessive" "36y11m" "hypokalemia" "" "37y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326972" "02027" "00437053" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326973" "02027" "00437054" "00006" "Familial, autosomal recessive" "18y" "incidental finding" "" "18y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326974" "02027" "00437055" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326975" "02027" "00437056" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326976" "02027" "00437057" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326977" "02027" "00437058" "00006" "Familial, autosomal recessive" "32y" "tetany" "" "20y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326978" "02027" "00437059" "00006" "Familial, autosomal recessive" "61y6m" "hypokalemia" "" "20y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326979" "02027" "00437060" "00006" "Familial, autosomal recessive" "72y1m" "hypokalaemic tubular acidosis; hypomagnesemia; hypermagnesuria" "" "70y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326980" "02027" "00437061" "00006" "Familial, autosomal recessive" "18y" "malaise; hypokalemia" "" "18y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326981" "02027" "00437062" "00006" "Familial, autosomal recessive" "18y2m" "hypokalemia; faintness; hypomagnesemia; metabolic alkalosis;" "" "18y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326982" "02027" "00437063" "00006" "Familial, autosomal recessive" "16y4m" "fortuitous hypokalemia" "" "15y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326983" "02027" "00437064" "00006" "Familial, autosomal recessive" "39y5m" "hypokalemia; faintness" "" "18y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326984" "02027" "00437065" "00006" "Familial, autosomal recessive" "58y" "" "" "" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326985" "02027" "00437066" "00006" "Familial, autosomal recessive" "21y8m" "hypokalemia; metabolic alkalosis; hypomagnesemia; growth failure" "" "22y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326986" "02027" "00437067" "00006" "Familial, autosomal recessive" "35y" "hypokalemia" "" "30y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326987" "02027" "00437068" "00006" "Familial, autosomal recessive" "52y8m" "hypokalemia; polyarthralgia; asthenia" "" "52y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326988" "02027" "00437069" "00006" "Familial, autosomal recessive" "" "hypokalemia; asthenia; faintness; tetany" "" "17y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326989" "02027" "00437070" "00006" "Familial, autosomal recessive" "64y11m" "hypokalemia; tetany; abdominal pains; vomiting; convulsion; cardiac arrest" "" "64y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326990" "02027" "00437071" "00006" "Familial, autosomal recessive" "49y3m" "hypokalemia; alkalosis; hypomagnesemia; chondrocalcinosis" "" "49y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326991" "02027" "00437072" "00006" "Familial, autosomal recessive" "12y11m" "tingling of feet and hand; hypokalemia;" "" "12y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326992" "02027" "00437073" "00006" "Familial, autosomal recessive" "61y6m" "hypokalemia" "" "30y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326993" "02027" "00437074" "00006" "Familial, autosomal recessive" "" "growth retardation" "" "12y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326994" "02027" "00437075" "00006" "Familial, autosomal recessive" "44y9m" "hypokalemia" "" "44y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326995" "02027" "00437076" "00006" "Familial, autosomal recessive" "5y" "growth failure (-4SD); hypokalemia" "" "5y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326996" "02027" "00437077" "00006" "Familial, autosomal recessive" "37y11m" "hypokalemia" "" "37y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326997" "02027" "00437078" "00006" "Familial, autosomal recessive" "46y" "chronic hypokalemia; arterial hypotension" "" "45y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326998" "02027" "00437079" "00006" "Familial, autosomal recessive" "50y6m8" "ischemic cardiopathy; cramps" "" "22y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000326999" "02027" "00437080" "00006" "Familial, autosomal recessive" "50y9m" "hypokalemia; arterial hypertension; obesity" "" "52y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327000" "02027" "00437081" "00006" "Familial, autosomal recessive" "37y9m" "hypokalemia; asthenia" "" "37y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327001" "02027" "00437082" "00006" "Familial, autosomal recessive" "54y6m" "hypokalemia; cramps" "" "47y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327002" "02027" "00437083" "00006" "Familial, autosomal recessive" "42y6m8" "hypokalemia; heart palpitations" "" "43y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327003" "02027" "00437084" "00006" "Familial, autosomal recessive" "71y" "hypokalemia; cramps; major asthenia" "" "65y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327004" "02027" "00437085" "00006" "Familial, autosomal recessive" "51y3m" "hypokalemia; hypomagnesemia; knee chondrocalcinosis" "" "51y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327005" "02027" "00437086" "00006" "Familial, autosomal recessive" "47y11m" "hypokalemia" "" "48y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327006" "02027" "00437087" "00006" "Familial, autosomal recessive" "59y8m" "HTA hypokalemia" "" "54y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327007" "02027" "00437088" "00006" "Familial, autosomal recessive" "43y3m" "arythmia and hypokalemia" "" "43y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327008" "02027" "00437089" "00006" "Familial, autosomal recessive" "26y8m" "hypokalemia; asthenia" "" "27y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327009" "02027" "00437090" "00006" "Familial, autosomal recessive" "34y4m" "algodystrophy; hypokalemia" "" "34y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327010" "02027" "00437091" "00006" "Familial, autosomal recessive" "10y" "vomiting, diarrhea" "" "10y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327011" "02027" "00437092" "00006" "Familial, autosomal recessive" "48y6m8" "heart palpitations; faintness; chondrocalcinosis; hypokalemia" "" "44y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327012" "02027" "00437093" "00006" "Familial, autosomal recessive" "61y9m" "hypokalemia; hypochloremia; arterial hypertension" "" "49y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327013" "02027" "00437094" "00006" "Familial, autosomal recessive" "50y6m8" "HTA hypokalemia; nephrolithiasis" "" "50y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327014" "02027" "00437095" "00006" "Familial, autosomal recessive" "46y" "hypokalemia; tachyarrhythmia" "" "45y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327015" "02027" "00437096" "00006" "Familial, autosomal recessive" "15y3m" "hypokalemia; asthenia" "" "15y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327016" "02027" "00437097" "00006" "Familial, autosomal recessive" "17y6m" "hypokalemia; metabolic alkalosis" "" "16y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327017" "02027" "00437098" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327018" "02027" "00437099" "00006" "Familial, autosomal recessive" "32y5m" "hypokalemia; asthenia" "" "30y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327019" "02027" "00437100" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327020" "02027" "00437101" "00006" "Familial, autosomal recessive" "" "hypokalemia; hypomagnesemia" "" "41y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327021" "02027" "00437102" "00006" "Familial, autosomal recessive" "50y1m" "vomiting; hypokalemia; metabolic alkalosis; hypomagnesemia;" "" "50y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327022" "02027" "00437103" "00006" "Familial, autosomal recessive" "41y9m" "hypokalemia; acute leukemia; arrythemia" "" "40y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327023" "02027" "00437104" "00006" "Familial, autosomal recessive" "8y9m" "hypokalemia; asthenia; growth faltering" "" "8y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327024" "02027" "00437105" "00006" "Familial, autosomal recessive" "45y6m" "hypokalemia; faintness; hypomagnesemia; metabolic alkalosis; secondary hyperaldosteronism" "" "45y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327025" "02027" "00437106" "00006" "Familial, autosomal recessive" "55y6m" "fortuitous hypokalemia" "" "55y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327026" "02027" "00437107" "00006" "Familial, autosomal recessive" "49y1m" "hypokalemia" "" "40y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327027" "02027" "00437108" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327028" "02027" "00437109" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327029" "02027" "00437110" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327030" "02027" "00437111" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327031" "02027" "00437112" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327032" "02027" "00437113" "00006" "Familial, autosomal recessive" "69y" "hypomagnesemia" "" "68y" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327033" "02027" "00437114" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327034" "02027" "00437115" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327035" "02027" "00437116" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327036" "02027" "00437117" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327037" "02027" "00437118" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327038" "02027" "00437119" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327039" "02027" "00437120" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327040" "02027" "00437121" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327041" "02027" "00437122" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327042" "02027" "00437123" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327043" "02027" "00437124" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327044" "02027" "00437125" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327045" "02027" "00437126" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327046" "02027" "00437127" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327047" "02027" "00437128" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327048" "02027" "00437129" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000327049" "02027" "00437130" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Gitelman syndrome" "" "0000338939" "02027" "00449794" "04689" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000342071" "04222" "00453408" "00006" "Familial, autosomal recessive" "18y" "bilateral multiple corticomedullar cysts and microcalcifications" "" "" "" "" "" "" "" "" "" "polycystic kidney disease" "" "0000342111" "02027" "00453446" "03544" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "GTLMNS" "" "" ## Screenings ## Do not remove or alter this header ## ## Count = 157 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000000209" "00000208" "1" "00037" "00001" "2012-09-13 12:02:03" "" "" "SEQ-NG-I" "DNA" "" "" "0000000210" "00000209" "1" "00037" "00001" "2012-09-13 12:09:36" "" "" "SEQ-NG-I" "DNA" "" "" "0000080987" "00080875" "1" "01758" "00006" "2016-09-07 13:24:08" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000108349" "00107880" "1" "00006" "00002" "2012-06-01 14:01:15" "" "" "SEQ-NG-I" "DNA" "" "" "0000271074" "00269921" "1" "01164" "01164" "2019-12-10 12:33:39" "" "" "SEQ-NG-S" "DNA" "" "" "0000292662" "00291494" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000292663" "00291495" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000292664" "00291496" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000292665" "00291497" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000305649" "00304520" "1" "03575" "00006" "2020-06-24 11:55:42" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000309150" "00308006" "1" "01164" "01164" "2020-08-25 11:34:01" "" "" "SEQ-NG-S" "DNA" "" "" "0000321437" "00320250" "1" "03944" "03944" "2020-11-25 12:18:25" "" "" "SEQ-NG-I" "DNA" "" "" "0000321438" "00320251" "1" "03944" "03944" "2020-11-25 12:28:22" "" "" "SEQ-NG-I" "DNA" "" "" "0000321439" "00320252" "1" "03944" "03944" "2020-11-25 12:32:39" "" "" "SEQ-NG-I" "DNA" "" "" "0000321440" "00320253" "1" "03944" "03944" "2020-11-25 12:38:30" "" "" "SEQ-NG-I" "DNA" "" "" "0000321441" "00320254" "1" "03944" "03944" "2020-11-25 13:24:55" "" "" "SEQ-NG-I" "DNA" "" "" "0000321442" "00320255" "1" "03944" "03944" "2020-11-25 13:37:59" "" "" "SEQ-NG-I" "DNA" "" "" "0000321457" "00320271" "1" "03944" "03944" "2020-11-27 08:24:10" "" "" "SEQ-NG-I" "DNA" "" "" "0000321458" "00320272" "1" "03944" "03944" "2020-11-27 08:28:50" "" "" "SEQ-NG-I" "DNA" "" "" "0000321459" "00320273" "1" "03944" "03944" "2020-11-27 08:31:34" "" "" "SEQ-NG-I" "DNA" "" "" "0000321460" "00320274" "1" "03944" "03944" "2020-11-27 08:35:49" "" "" "SEQ-NG-I" "DNA" "" "" "0000321461" "00320275" "1" "03944" "03944" "2020-11-27 08:42:39" "" "" "SEQ-NG-I" "DNA" "" "" "0000321462" "00320276" "1" "03944" "03944" "2020-11-27 08:47:37" "" "" "SEQ-NG-I" "DNA" "" "" "0000321463" "00320277" "1" "03944" "03944" "2020-11-27 08:52:28" "" "" "SEQ-NG-I" "DNA" "" "" "0000321464" "00320278" "1" "03944" "03944" "2020-11-27 08:58:38" "" "" "SEQ-NG-I" "DNA" "" "" "0000321465" "00320279" "1" "03944" "03944" "2020-11-27 09:02:15" "" "" "SEQ-NG-I" "DNA" "" "" "0000321466" "00320280" "1" "03944" "03944" "2020-11-27 09:05:46" "" "" "SEQ-NG-I" "DNA" "" "" "0000321467" "00320281" "1" "03944" "03944" "2020-11-27 09:10:17" "" "" "SEQ-NG-I" "DNA" "" "" "0000321468" "00320282" "1" "03944" "03944" "2020-11-27 09:13:28" "" "" "SEQ-NG-I" "DNA" "" "" "0000321469" "00320283" "1" "03944" "03944" "2020-11-27 09:15:45" "" "" "SEQ-NG-I" "DNA" "" "" "0000321497" "00320311" "1" "03944" "03944" "2020-11-27 09:42:17" "" "" "SEQ-NG-I" "DNA" "" "" "0000321498" "00320312" "1" "03944" "03944" "2020-11-27 09:45:27" "" "" "SEQ-NG-I" "DNA" "" "" "0000321499" "00320313" "1" "03944" "03944" "2020-11-27 09:52:54" "" "" "SEQ-NG-I" "DNA" "" "" "0000321500" "00320314" "1" "03944" "03944" "2020-11-27 09:55:51" "" "" "SEQ-NG-I" "DNA" "" "" "0000321501" "00320315" "1" "03944" "03944" "2020-11-27 09:58:35" "" "" "SEQ-NG-I" "DNA" "" "" "0000321502" "00320316" "1" "03944" "03944" "2020-11-27 10:02:41" "" "" "SEQ-NG-I" "DNA" "" "" "0000321503" "00320317" "1" "03944" "03944" "2020-11-27 10:05:52" "" "" "SEQ-NG-I" "DNA" "" "" "0000321504" "00320318" "1" "03944" "03944" "2020-11-27 10:08:59" "" "" "SEQ-NG-I" "DNA" "" "" "0000321505" "00320319" "1" "03944" "03944" "2020-11-27 10:12:20" "" "" "SEQ-NG-I" "DNA" "" "" "0000321506" "00320320" "1" "03944" "03944" "2020-11-27 10:15:30" "" "" "SEQ-NG-I" "DNA" "" "" "0000332822" "00331603" "1" "01164" "01164" "2021-02-12 12:05:19" "" "" "SEQ-NG-I" "DNA" "" "" "0000363230" "00362002" "1" "00000" "00006" "2021-04-13 14:21:59" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000363239" "00362011" "1" "00000" "00006" "2021-04-13 14:21:59" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000374587" "00373352" "1" "01164" "01164" "2021-05-14 09:46:48" "" "" "SEQ-NG-I" "DNA" "" "" "0000396300" "00395054" "1" "00000" "03840" "2021-12-03 13:19:14" "" "" "SEQ-NG" "DNA" "blood" "115 genes causing different inherited kidney diseases" "0000396301" "00395055" "1" "00000" "03840" "2021-12-03 13:19:14" "" "" "SEQ-NG" "DNA" "blood" "115 genes causing different inherited kidney diseases" "0000396302" "00395056" "1" "00000" "03840" "2021-12-03 13:19:14" "" "" "SEQ-NG" "DNA" "blood" "115 genes causing different inherited kidney diseases" "0000396303" "00395057" "1" "00000" "03840" "2021-12-03 13:19:14" "" "" "SEQ-NG" "DNA" "blood" "115 genes causing different inherited kidney diseases" "0000396305" "00395059" "1" "00000" "03840" "2021-12-03 13:19:14" "" "" "SEQ-NG" "DNA" "blood" "115 genes causing different inherited kidney diseases" "0000415644" "00414364" "1" "00000" "03840" "2022-07-28 13:16:36" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000415690" "00414410" "1" "00000" "03840" "2022-07-28 13:16:36" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000415738" "00414458" "1" "00000" "03840" "2022-07-28 13:16:36" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000438513" "00437029" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "SEQ-NG;SEQ-PB" "DNA" "" "" "0000438514" "00437030" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "SSCA;SEQ-PB" "DNA" "" "" "0000438515" "00437031" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ;SEQ-PB" "DNA" "" "" "0000438516" "00437032" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "SEQ;SEQ-PB" "DNA" "" "" "0000438517" "00437033" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "SEQ;SEQ-PB" "DNA" "" "" "0000438518" "00437034" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "SEQ;SEQ-PB" "DNA" "" "gene panel" "0000438519" "00437035" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "SSCA;SEQ-PB" "DNA" "" "" "0000438520" "00437036" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "SSCA;SEQ-PB" "DNA" "" "" "0000438521" "00437037" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ;SEQ-PB" "DNA" "" "" "0000438522" "00437038" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "SEQ;SEQ-PB" "DNA" "" "" "0000438523" "00437039" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "SSCA;SEQ-PB" "DNA" "" "" "0000438524" "00437040" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ;SEQ-PB" "DNA" "" "" "0000438525" "00437041" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "SSCA;SEQ-PB" "DNA" "" "" "0000438526" "00437042" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "SSCA;SEQ-PB" "DNA" "" "" "0000438527" "00437043" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ;SEQ-PB" "DNA" "" "" "0000438528" "00437044" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ;SEQ-PB" "DNA" "" "" "0000438529" "00437045" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ;SEQ-PB" "DNA" "" "" "0000438530" "00437046" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ;SEQ-PB" "DNA" "" "" "0000438531" "00437047" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ;SEQ-PB" "DNA" "" "" "0000438532" "00437048" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ;SEQ-PB" "DNA" "" "" "0000438533" "00437049" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ;SEQ-PB" "DNA" "" "" "0000438534" "00437050" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ;SEQ-PB" "DNA" "" "" "0000438535" "00437051" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "SSCA;SEQ-PB" "DNA" "" "" "0000438536" "00437052" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "SEQ;SEQ-PB" "DNA" "" "" "0000438537" "00437053" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "SSCA;SEQ-PB" "DNA" "" "" "0000438538" "00437054" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "SSCA;SEQ-PB" "DNA" "" "" "0000438539" "00437055" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "SSCA;SEQ-PB" "DNA" "" "" "0000438540" "00437056" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "SSCA;SEQ-PB" "DNA" "" "" "0000438541" "00437057" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "SSCA;SEQ-PB" "DNA" "" "" "0000438542" "00437058" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "SSCA;SEQ-PB" "DNA" "" "" "0000438543" "00437059" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ;SEQ-PB" "DNA" "" "" "0000438544" "00437060" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ;SEQ-PB" "DNA" "" "" "0000438545" "00437061" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ-NG;SEQ-PB" "DNA" "" "" "0000438546" "00437062" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ;SEQ-PB" "DNA" "" "" "0000438547" "00437063" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ-NG;SEQ-PB" "DNA" "" "" "0000438548" "00437064" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ;SEQ-PB" "DNA" "" "" "0000438549" "00437065" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "SSCA;SEQ-PB" "DNA" "" "" "0000438550" "00437066" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ;SEQ-PB" "DNA" "" "" "0000438551" "00437067" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ;SEQ-PB" "DNA" "" "" "0000438552" "00437068" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ;SEQ-PB" "DNA" "" "" "0000438553" "00437069" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ;SEQ-PB" "DNA" "" "" "0000438554" "00437070" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ;SEQ-PB" "DNA" "" "gene panel" "0000438555" "00437071" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ;SEQ-PB" "DNA" "" "" "0000438556" "00437072" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ;SEQ-NG;SEQ-PB" "DNA" "" "" "0000438557" "00437073" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ;SEQ-PB" "DNA" "" "" "0000438558" "00437074" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "SSCA;SEQ-PB" "DNA" "" "" "0000438559" "00437075" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ;SEQ-PB" "DNA" "" "" "0000438560" "00437076" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ-NG;SEQ-PB" "DNA" "" "" "0000438561" "00437077" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ;SEQ-PB" "DNA" "" "" "0000438562" "00437078" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ;SEQ-PB" "DNA" "" "" "0000438563" "00437079" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ-NG;SEQ-PB" "DNA" "" "" "0000438564" "00437080" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "SEQ;SEQ-PB" "DNA" "" "" "0000438565" "00437081" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ;SEQ-PB" "DNA" "" "" "0000438566" "00437082" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ;SEQ-PB" "DNA" "" "" "0000438567" "00437083" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ;SEQ-PB" "DNA" "" "" "0000438568" "00437084" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ;SEQ-PB" "DNA" "" "" "0000438569" "00437085" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ;SEQ-NG;SEQ-PB" "DNA" "" "" "0000438570" "00437086" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ;SEQ-PB" "DNA" "" "" "0000438571" "00437087" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ-NG;SEQ-PB" "DNA" "" "" "0000438572" "00437088" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ-NG;SEQ-PB" "DNA" "" "" "0000438573" "00437089" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ;SEQ-PB" "DNA" "" "" "0000438574" "00437090" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ;SEQ-PB" "DNA" "" "" "0000438575" "00437091" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "SSCA;SEQ-PB" "DNA" "" "" "0000438576" "00437092" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ;SEQ-PB" "DNA" "" "" "0000438577" "00437093" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ;SEQ-PB" "DNA" "" "" "0000438578" "00437094" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ-NG;SEQ-PB" "DNA" "" "" "0000438579" "00437095" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ;SEQ-PB" "DNA" "" "" "0000438580" "00437096" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ;SEQ-PB" "DNA" "" "" "0000438581" "00437097" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ;SEQ-PB" "DNA" "" "" "0000438582" "00437098" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "SEQ;SEQ-PB" "DNA" "" "" "0000438583" "00437099" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ;SEQ-PB" "DNA" "" "" "0000438584" "00437100" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "SEQ-NG;SEQ-PB" "DNA" "" "WES" "0000438585" "00437101" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ;SEQ-PB" "DNA" "" "" "0000438586" "00437102" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "SEQ;SEQ-PB" "DNA" "" "" "0000438587" "00437103" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ;SEQ-PB" "DNA" "" "" "0000438588" "00437104" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "SEQ;SEQ-PB" "DNA" "" "" "0000438589" "00437105" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ;SEQ-PB" "DNA" "" "" "0000438590" "00437106" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ-NG;SEQ-PB" "DNA" "" "" "0000438591" "00437107" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ;SEQ-PB" "DNA" "" "" "0000438592" "00437108" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "SEQ" "DNA" "" "" "0000438593" "00437109" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ" "DNA" "" "" "0000438594" "00437110" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ" "DNA" "" "" "0000438595" "00437111" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ" "DNA" "" "" "0000438596" "00437112" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ" "DNA" "" "" "0000438597" "00437113" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ" "DNA" "" "" "0000438598" "00437114" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ" "DNA" "" "" "0000438599" "00437115" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ" "DNA" "" "" "0000438600" "00437116" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ" "DNA" "" "" "0000438601" "00437117" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ-NG" "DNA" "" "" "0000438602" "00437118" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ" "DNA" "" "" "0000438603" "00437119" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ-NG" "DNA" "" "" "0000438604" "00437120" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ-NG" "DNA" "" "" "0000438605" "00437121" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ-NG" "DNA" "" "" "0000438606" "00437122" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ" "DNA" "" "" "0000438607" "00437123" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "MLPA;SEQ" "DNA" "" "" "0000438608" "00437124" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "SEQ-NG" "DNA" "" "" "0000438609" "00437125" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "SSCA" "DNA" "" "" "0000438610" "00437126" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "SSCA" "DNA" "" "" "0000438611" "00437127" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "SSCA" "DNA" "" "" "0000438612" "00437128" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "SSCA" "DNA" "" "" "0000438613" "00437129" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "SSCA" "DNA" "" "" "0000438614" "00437130" "1" "00006" "00006" "2023-10-12 15:23:49" "" "" "SSCA" "DNA" "" "" "0000451389" "00449794" "1" "04689" "04689" "2024-05-15 10:00:33" "" "" "SEQ-NG" "DNA" "blood" "" "0000455019" "00453408" "1" "00006" "00006" "2024-08-21 10:09:38" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000455060" "00453446" "1" "03544" "03544" "2024-08-29 12:09:19" "" "" "SEQ-NG-I" "DNA" "peripheral blood" "CES" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 144 "{{screeningid}}" "{{geneid}}" "0000080987" "SLC12A3" "0000108349" "IRX5" "0000321437" "SLC12A3" "0000321438" "SLC12A3" "0000321439" "SLC12A3" "0000321440" "SLC12A3" "0000321441" "SLC12A3" "0000321442" "SLC12A3" "0000321457" "SLC12A3" "0000321458" "SLC12A3" "0000321459" "SLC12A3" "0000321460" "SLC12A3" "0000321461" "SLC12A3" "0000321462" "SLC12A3" "0000321463" "SLC12A3" "0000321464" "SLC12A3" "0000321465" "SLC12A3" "0000321466" "SLC12A3" "0000321467" "SLC12A3" "0000321468" "SLC12A3" "0000321469" "SLC12A3" "0000321497" "SLC12A3" "0000321498" "SLC12A3" "0000321499" "SLC12A3" "0000321500" "SLC12A3" "0000321501" "SLC12A3" "0000321502" "SLC12A3" "0000321503" "SLC12A3" "0000321504" "SLC12A3" "0000321505" "SLC12A3" "0000321506" "SLC12A3" "0000332822" "SLC12A3" "0000374587" "SLC12A3" "0000396300" "SLC12A3" "0000396301" "SLC12A3" "0000396302" "SLC12A3" "0000396303" "SLC12A3" "0000396305" "SLC12A3" "0000415644" "SLC12A3" "0000415690" "SLC12A3" "0000415738" "SLC12A3" "0000438513" "SLC12A3" "0000438514" "SLC12A3" "0000438515" "SLC12A3" "0000438516" "SLC12A3" "0000438517" "SLC12A3" "0000438518" "SLC12A3" "0000438519" "SLC12A3" "0000438520" "SLC12A3" "0000438521" "SLC12A3" "0000438522" "SLC12A3" "0000438523" "SLC12A3" "0000438524" "SLC12A3" "0000438525" "SLC12A3" "0000438526" "SLC12A3" "0000438527" "SLC12A3" "0000438528" "SLC12A3" "0000438529" "SLC12A3" "0000438530" "SLC12A3" "0000438531" "SLC12A3" "0000438532" "SLC12A3" "0000438533" "SLC12A3" "0000438534" "SLC12A3" "0000438535" "SLC12A3" "0000438536" "SLC12A3" "0000438537" "SLC12A3" "0000438538" "SLC12A3" "0000438539" "SLC12A3" "0000438540" "SLC12A3" "0000438541" "SLC12A3" "0000438542" "SLC12A3" "0000438543" "SLC12A3" "0000438544" "SLC12A3" "0000438545" "SLC12A3" "0000438546" "SLC12A3" "0000438547" "SLC12A3" "0000438548" "SLC12A3" "0000438549" "SLC12A3" "0000438550" "SLC12A3" "0000438551" "SLC12A3" "0000438552" "SLC12A3" "0000438553" "SLC12A3" "0000438554" "SLC12A3" "0000438555" "SLC12A3" "0000438556" "SLC12A3" "0000438557" "SLC12A3" "0000438558" "SLC12A3" "0000438559" "SLC12A3" "0000438560" "SLC12A3" "0000438561" "SLC12A3" "0000438562" "SLC12A3" "0000438563" "SLC12A3" "0000438564" "SLC12A3" "0000438565" "SLC12A3" "0000438566" "SLC12A3" "0000438567" "SLC12A3" "0000438568" "SLC12A3" "0000438569" "SLC12A3" "0000438570" "SLC12A3" "0000438571" "SLC12A3" "0000438572" "SLC12A3" "0000438573" "SLC12A3" "0000438574" "SLC12A3" "0000438575" "SLC12A3" "0000438576" "SLC12A3" "0000438577" "SLC12A3" "0000438578" "SLC12A3" "0000438579" "SLC12A3" "0000438580" "SLC12A3" "0000438581" "SLC12A3" "0000438582" "SLC12A3" "0000438583" "SLC12A3" "0000438584" "SLC12A3" "0000438585" "SLC12A3" "0000438586" "SLC12A3" "0000438587" "SLC12A3" "0000438588" "SLC12A3" "0000438589" "SLC12A3" "0000438590" "SLC12A3" "0000438591" "SLC12A3" "0000438592" "SLC12A3" "0000438593" "SLC12A3" "0000438594" "SLC12A3" "0000438595" "SLC12A3" "0000438596" "SLC12A3" "0000438597" "SLC12A3" "0000438598" "SLC12A3" "0000438599" "SLC12A3" "0000438600" "SLC12A3" "0000438601" "SLC12A3" "0000438602" "SLC12A3" "0000438603" "SLC12A3" "0000438604" "SLC12A3" "0000438605" "SLC12A3" "0000438606" "SLC12A3" "0000438607" "SLC12A3" "0000438608" "SLC12A3" "0000438609" "SLC12A3" "0000438610" "SLC12A3" "0000438611" "SLC12A3" "0000438612" "SLC12A3" "0000438613" "SLC12A3" "0000438614" "SLC12A3" "0000451389" "SLC12A3" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 474 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000005612" "3" "50" "16" "56926828" "56926828" "subst" "0.566112" "00037" "SLC12A3_000001" "g.56926828T>C" "" "" "" "" "" "Germline" "" "" "" "" "" "g.56892916T>C" "" "VUS" "" "0000013579" "3" "50" "16" "56926828" "56926828" "subst" "0.566112" "00037" "SLC12A3_000001" "g.56926828T>C" "" "" "" "" "" "Germline" "" "" "" "" "" "g.56892916T>C" "" "VUS" "" "0000130073" "3" "90" "16" "56913119" "56913119" "subst" "0.000158716" "01758" "SLC12A3_000002" "g.56913119G>A" "" "{PMID:Trujillano 2017:27848944}" "" "" "" "Germline" "" "" "0" "" "" "g.56879207G>A" "" "pathogenic" "ACMG" "0000251042" "0" "10" "16" "56901065" "56901065" "subst" "0.0956177" "02326" "SLC12A3_000006" "g.56901065A>G" "" "" "" "SLC12A3(NM_000339.3):c.366A>G (p.A122=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56867153A>G" "" "benign" "" "0000252423" "0" "70" "16" "56913128" "56913128" "subst" "0" "02326" "SLC12A3_000013" "g.56913128A>G" "" "" "" "SLC12A3(NM_000339.3):c.1324A>G (p.N442D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56879216A>G" "" "likely pathogenic" "" "0000298227" "0" "30" "16" "56906614" "56906614" "subst" "2.43641E-5" "02325" "SLC12A3_000010" "g.56906614T>C" "" "" "" "SLC12A3(NM_000339.3):c.1011T>C (p.D337=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56872702T>C" "" "likely benign" "" "0000298228" "0" "10" "16" "56917953" "56917953" "subst" "0.458874" "02325" "SLC12A3_000018" "g.56917953T>C" "" "" "" "SLC12A3(NM_000339.3):c.1670-8T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56884041T>C" "" "benign" "" "0000298229" "0" "10" "16" "56938387" "56938387" "subst" "0.282219" "02325" "SLC12A3_000033" "g.56938387C>T" "" "" "" "SLC12A3(NM_000339.3):c.2951+13C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56904475C>T" "" "benign" "" "0000298230" "0" "10" "16" "56904587" "56904587" "subst" "0.977965" "02325" "SLC12A3_000007" "g.56904587C>G" "" "" "" "SLC12A3(NM_000339.3):c.791C>G (p.A264G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56870675C>G" "" "benign" "" "0000302129" "0" "10" "16" "56911960" "56911983" "del" "0" "02326" "SLC12A3_000011" "g.56911960_56911983del" "" "" "" "SLC12A3(NM_000339.3):c.1096-29_1096-6delCTCCCTCCCTCTCTCCCTCCCTCC, SLC12A3(NM_001126108.2):c.1096-29_1096-6del" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56878048_56878071del" "" "benign" "" "0000302130" "0" "90" "16" "56913093" "56913093" "subst" "0" "02326" "SLC12A3_000012" "g.56913093G>A" "" "" "" "SLC12A3(NM_000339.3):c.1289G>A (p.C430Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56879181G>A" "" "pathogenic" "" "0000302131" "0" "90" "16" "56913119" "56913119" "subst" "0.000158716" "02326" "SLC12A3_000002" "g.56913119G>A" "" "" "" "SLC12A3(NM_000339.3):c.1315G>A (p.G439S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56879207G>A" "" "pathogenic" "" "0000302132" "0" "30" "16" "56913504" "56913504" "subst" "0.000959568" "02326" "SLC12A3_000014" "g.56913504C>T" "" "" "" "SLC12A3(NM_000339.3):c.1386C>T (p.F462=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56879592C>T" "" "likely benign" "" "0000302133" "0" "10" "16" "56913513" "56913513" "subst" "0.139687" "02326" "SLC12A3_000015" "g.56913513C>T" "" "" "" "SLC12A3(NM_000339.3):c.1395C>T (p.T465=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56879601C>T" "" "benign" "" "0000302134" "0" "10" "16" "56914011" "56914011" "subst" "0.00512006" "02326" "SLC12A3_000016" "g.56914011C>T" "" "" "" "SLC12A3(NM_000339.3):c.1444-31C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56880099C>T" "" "benign" "" "0000302135" "0" "90" "16" "56916404" "56916404" "subst" "6.49783E-5" "02326" "SLC12A3_000017" "g.56916404C>T" "" "" "" "SLC12A3(NM_000339.3):c.1664C>T (p.S555L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56882492C>T" "" "pathogenic" "" "0000302136" "0" "10" "16" "56917953" "56917953" "subst" "0.458874" "02326" "SLC12A3_000018" "g.56917953T>C" "" "" "" "SLC12A3(NM_000339.3):c.1670-8T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56884041T>C" "" "benign" "" "0000302137" "0" "10" "16" "56919235" "56919235" "subst" "0.0854583" "02326" "SLC12A3_000019" "g.56919235G>A" "" "" "" "SLC12A3(NM_000339.3):c.1884G>A (p.S628=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56885323G>A" "" "benign" "" "0000302138" "0" "90" "16" "56920278" "56920278" "subst" "0.000175477" "02326" "SLC12A3_000020" "g.56920278C>T" "" "" "" "SLC12A3(NM_000339.3):c.1928C>T (p.P643L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56886366C>T" "" "pathogenic" "" "0000302139" "0" "30" "16" "56920330" "56920330" "subst" "0.00203982" "02326" "SLC12A3_000021" "g.56920330C>T" "" "" "" "SLC12A3(NM_000339.3):c.1980C>T (p.D660=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56886418C>T" "" "likely benign" "" "0000302140" "0" "10" "16" "56920969" "56920969" "subst" "0.128269" "02326" "SLC12A3_000022" "g.56920969C>T" "" "" "" "SLC12A3(NM_000339.3):c.2142C>T (p.A714=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56887057C>T" "" "benign" "" "0000302141" "0" "10" "16" "56921829" "56921829" "subst" "0.127653" "02326" "SLC12A3_000023" "g.56921829C>T" "" "" "" "SLC12A3(NM_000339.3):c.2179-8C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56887917C>T" "" "benign" "" "0000302142" "0" "90" "16" "56921871" "56921871" "subst" "0" "02326" "SLC12A3_000024" "g.56921871T>G" "" "" "" "SLC12A3(NM_000339.3):c.2213T>G (p.L738R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56887959T>G" "" "pathogenic" "" "0000302143" "0" "10" "16" "56928519" "56928519" "subst" "0.125653" "02326" "SLC12A3_000025" "g.56928519C>T" "" "" "" "SLC12A3(NM_000339.3):c.2625C>T (p.G875=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56894607C>T" "" "benign" "" "0000302144" "0" "10" "16" "56933519" "56933519" "subst" "0.108903" "02326" "SLC12A3_000026" "g.56933519G>A" "" "" "" "SLC12A3(NM_000339.3):c.2738G>A (p.R913Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56899607G>A" "" "benign" "" "0000302145" "0" "10" "16" "56936272" "56936272" "subst" "0.131082" "02326" "SLC12A3_000027" "g.56936272T>C" "" "" "" "SLC12A3(NM_000339.3):c.2748-13T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56902360T>C" "" "benign" "" "0000302146" "0" "10" "16" "56936319" "56936319" "subst" "0.0310492" "02326" "SLC12A3_000028" "g.56936319C>T" "" "" "" "SLC12A3(NM_000339.3):c.2782C>T (p.R928C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56902407C>T" "" "benign" "" "0000302147" "0" "10" "16" "56899508" "56899508" "subst" "0" "02326" "SLC12A3_000005" "g.56899508T>G" "" "" "" "SLC12A3(NM_000339.3):c.282+79T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56865596T>G" "" "benign" "" "0000302148" "0" "90" "16" "56936421" "56936421" "subst" "0.000227853" "02326" "SLC12A3_000029" "g.56936421G>T" "" "" "" "SLC12A3(NM_000339.2):c.2883+1G>T, SLC12A3(NM_000339.3):c.2883+1G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56902509G>T" "" "pathogenic" "" "0000302149" "0" "10" "16" "56938134" "56938134" "subst" "0" "02326" "SLC12A3_000030" "g.56938134C>T" "" "" "" "SLC12A3(NM_000339.3):c.2884-173C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56904222C>T" "" "benign" "" "0000302150" "0" "10" "16" "56938290" "56938290" "subst" "0.121244" "02326" "SLC12A3_000031" "g.56938290G>A" "" "" "" "SLC12A3(NM_000339.3):c.2884-17G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56904378G>A" "" "benign" "" "0000302151" "0" "30" "16" "56938301" "56938301" "subst" "0.00502713" "02326" "SLC12A3_000032" "g.56938301G>A" "" "" "" "SLC12A3(NM_000339.3):c.2884-6G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56904389G>A" "" "likely benign" "" "0000302152" "0" "10" "16" "56938387" "56938387" "subst" "0.282219" "02326" "SLC12A3_000033" "g.56938387C>T" "" "" "" "SLC12A3(NM_000339.3):c.2951+13C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56904475C>T" "" "benign" "" "0000302153" "0" "90" "16" "56947189" "56947189" "subst" "5.28954E-5" "02326" "SLC12A3_000034" "g.56947189G>A" "" "" "" "SLC12A3(NM_000339.2):c.2965G>A (p.G989R), SLC12A3(NM_000339.3):c.2965G>A (p.G989R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56913277G>A" "" "pathogenic" "" "0000302154" "0" "90" "16" "56947294" "56947294" "subst" "1.2182E-5" "02326" "SLC12A3_000035" "g.56947294G>A" "" "" "" "SLC12A3(NM_000339.3):c.3070G>A (p.V1024M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56913382G>A" "" "pathogenic" "" "0000302156" "0" "10" "16" "56899183" "56899183" "subst" "0.000635966" "02326" "SLC12A3_000004" "g.56899183C>T" "" "" "" "SLC12A3(NM_000339.2):c.36C>T (p.D12=), SLC12A3(NM_000339.3):c.36C>T (p.D12=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56865271C>T" "" "benign" "" "0000302157" "0" "10" "16" "56904587" "56904587" "subst" "0.977965" "02326" "SLC12A3_000007" "g.56904587C>G" "" "" "" "SLC12A3(NM_000339.3):c.791C>G (p.A264G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56870675C>G" "" "benign" "" "0000302159" "0" "90" "16" "56904611" "56904611" "subst" "1.62459E-5" "02326" "SLC12A3_000009" "g.56904611T>C" "" "" "" "SLC12A3(NM_000339.3):c.815T>C (p.L272P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56870699T>C" "" "pathogenic" "" "0000338408" "0" "90" "16" "56903640" "56903640" "subst" "4.46922E-5" "02327" "SLC12A3_000041" "g.56903640G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56869728G>A" "" "pathogenic" "" "0000338409" "0" "90" "16" "56912074" "56912074" "subst" "2.87302E-5" "02327" "SLC12A3_000059" "g.56912074G>T" "" "" "" "SLC12A3(NM_000339.3):c.1180+1G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56878162G>T" "" "pathogenic" "" "0000338410" "0" "90" "16" "56913140" "56913140" "subst" "0" "02327" "SLC12A3_000066" "g.56913140G>A" "" "" "" "SLC12A3(NM_000339.2):c.1335+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56879228G>A" "" "pathogenic" "" "0000338411" "0" "10" "16" "56914025" "56914025" "subst" "0.0220195" "02327" "SLC12A3_000069" "g.56914025G>A" "" "" "" "SLC12A3(NM_000339.3):c.1444-17G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56880113G>A" "" "benign" "" "0000338412" "0" "90" "16" "56917770" "56917770" "subst" "0" "02327" "SLC12A3_000073" "g.56917770C>T" "" "" "" "SLC12A3(NM_000339.3):c.1670-191C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56883858C>T" "" "pathogenic" "" "0000338413" "0" "10" "16" "56917953" "56917953" "subst" "0.458874" "02327" "SLC12A3_000018" "g.56917953T>C" "" "" "" "SLC12A3(NM_000339.3):c.1670-8T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56884041T>C" "" "benign" "" "0000338414" "0" "10" "16" "56918125" "56918125" "subst" "0.0340709" "02327" "SLC12A3_000074" "g.56918125C>A" "" "" "" "SLC12A3(NM_000339.3):c.1825+9C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56884213C>A" "" "benign" "" "0000338415" "0" "90" "16" "56920388" "56920388" "subst" "1.62848E-5" "02327" "SLC12A3_000085" "g.56920388G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56886476G>A" "" "pathogenic" "" "0000338416" "0" "10" "16" "56921829" "56921829" "subst" "0.127653" "02327" "SLC12A3_000023" "g.56921829C>T" "" "" "" "SLC12A3(NM_000339.3):c.2179-8C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56887917C>T" "" "benign" "" "0000338417" "0" "90" "16" "56926967" "56926967" "subst" "0" "02327" "SLC12A3_000094" "g.56926967G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56893055G>T" "" "pathogenic" "" "0000338418" "0" "90" "16" "56927219" "56927219" "subst" "0" "02327" "SLC12A3_000095" "g.56927219C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56893307C>T" "" "pathogenic" "" "0000338419" "0" "10" "16" "56927244" "56927244" "subst" "0" "02327" "SLC12A3_000096" "g.56927244C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56893332C>T" "" "benign" "" "0000338420" "0" "10" "16" "56927296" "56927296" "subst" "0" "02327" "SLC12A3_000097" "g.56927296C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56893384C>T" "" "benign" "" "0000338421" "0" "10" "16" "56927323" "56927323" "subst" "0" "02327" "SLC12A3_000099" "g.56927323A>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56893411A>T" "" "benign" "" "0000338422" "0" "10" "16" "56927328" "56927328" "subst" "0" "02327" "SLC12A3_000100" "g.56927328A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56893416A>C" "" "benign" "" "0000338423" "0" "10" "16" "56936272" "56936272" "subst" "0.131082" "02327" "SLC12A3_000027" "g.56936272T>C" "" "" "" "SLC12A3(NM_000339.3):c.2748-13T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56902360T>C" "" "benign" "" "0000338424" "0" "90" "16" "56936421" "56936421" "subst" "0.000227853" "02327" "SLC12A3_000029" "g.56936421G>T" "" "" "" "SLC12A3(NM_000339.2):c.2883+1G>T, SLC12A3(NM_000339.3):c.2883+1G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56902509G>T" "" "pathogenic" "" "0000338425" "0" "10" "16" "56938289" "56938289" "subst" "0.00464542" "02327" "SLC12A3_000107" "g.56938289C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56904377C>T" "" "benign" "" "0000338426" "0" "10" "16" "56938290" "56938290" "subst" "0.121244" "02327" "SLC12A3_000031" "g.56938290G>A" "" "" "" "SLC12A3(NM_000339.3):c.2884-17G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56904378G>A" "" "benign" "" "0000338427" "0" "10" "16" "56938301" "56938301" "subst" "0.00502713" "02327" "SLC12A3_000032" "g.56938301G>A" "" "" "" "SLC12A3(NM_000339.3):c.2884-6G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56904389G>A" "" "benign" "" "0000338428" "0" "90" "16" "56938376" "56938376" "subst" "0" "02327" "SLC12A3_000110" "g.56938376T>G" "" "" "" "SLC12A3(NM_000339.3):c.2951+2T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56904464T>G" "" "pathogenic" "" "0000338429" "0" "10" "16" "56938387" "56938387" "subst" "0.282219" "02327" "SLC12A3_000033" "g.56938387C>T" "" "" "" "SLC12A3(NM_000339.3):c.2951+13C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56904475C>T" "" "benign" "" "0000340246" "0" "10" "16" "56906626" "56906626" "subst" "0.035122" "02327" "SLC12A3_000054" "g.56906626C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56872714C>T" "" "benign" "" "0000340621" "0" "10" "16" "56901065" "56901065" "subst" "0.0956177" "02327" "SLC12A3_000006" "g.56901065A>G" "" "" "" "SLC12A3(NM_000339.3):c.366A>G (p.A122=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56867153A>G" "" "benign" "" "0000340663" "0" "10" "16" "56920969" "56920969" "subst" "0.128269" "02327" "SLC12A3_000022" "g.56920969C>T" "" "" "" "SLC12A3(NM_000339.3):c.2142C>T (p.A714=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56887057C>T" "" "benign" "" "0000340795" "0" "10" "16" "56928519" "56928519" "subst" "0.125653" "02327" "SLC12A3_000025" "g.56928519C>T" "" "" "" "SLC12A3(NM_000339.3):c.2625C>T (p.G875=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56894607C>T" "" "benign" "" "0000340814" "0" "10" "16" "56947275" "56947275" "subst" "0.00764627" "02327" "SLC12A3_000114" "g.56947275C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56913363C>T" "" "benign" "" "0000340884" "0" "30" "16" "56913504" "56913504" "subst" "0.000959568" "02327" "SLC12A3_000014" "g.56913504C>T" "" "" "" "SLC12A3(NM_000339.3):c.1386C>T (p.F462=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56879592C>T" "" "likely benign" "" "0000340969" "0" "10" "16" "56919235" "56919235" "subst" "0.0854583" "02327" "SLC12A3_000019" "g.56919235G>A" "" "" "" "SLC12A3(NM_000339.3):c.1884G>A (p.S628=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56885323G>A" "" "benign" "" "0000340983" "0" "10" "16" "56947215" "56947215" "subst" "0.00179964" "02327" "SLC12A3_000113" "g.56947215G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56913303G>A" "" "benign" "" "0000341013" "0" "10" "16" "56913513" "56913513" "subst" "0.139687" "02327" "SLC12A3_000015" "g.56913513C>T" "" "" "" "SLC12A3(NM_000339.3):c.1395C>T (p.T465=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56879601C>T" "" "benign" "" "0000341043" "0" "10" "16" "56914137" "56914137" "subst" "0.00117619" "02327" "SLC12A3_000071" "g.56914137C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56880225C>T" "" "benign" "" "0000341280" "0" "50" "16" "56904082" "56904082" "subst" "8.12678E-6" "02327" "SLC12A3_000046" "g.56904082G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56870170G>A" "" "VUS" "" "0000341569" "0" "10" "16" "56921840" "56921840" "subst" "0.0121471" "02327" "SLC12A3_000089" "g.56921840G>A" "" "" "" "SLC12A3(NM_000339.3):c.2182G>A (p.A728T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56887928G>A" "" "benign" "" "0000342230" "0" "70" "16" "56904031" "56904031" "subst" "1.21977E-5" "02327" "SLC12A3_000045" "g.56904031C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56870119C>T" "" "likely pathogenic" "" "0000342633" "0" "90" "16" "56906371" "56906371" "subst" "8.13259E-5" "02327" "SLC12A3_000053" "g.56906371C>T" "" "" "" "SLC12A3(NM_000339.3):c.961C>T (p.R321W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56872459C>T" "" "pathogenic" "" "0000342812" "0" "90" "16" "56912999" "56912999" "subst" "1.23872E-5" "02327" "SLC12A3_000061" "g.56912999C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56879087C>T" "" "pathogenic" "" "0000342814" "0" "90" "16" "56912997" "56912998" "ins" "0" "02327" "SLC12A3_000060" "g.56912997_56912998insTGCGTGG" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56879085_56879086insTGCGTGG" "" "pathogenic" "" "0000343199" "0" "70" "16" "56919275" "56919275" "subst" "2.64002E-5" "02327" "SLC12A3_000079" "g.56919275C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56885363C>G" "" "likely pathogenic" "" "0000343214" "0" "70" "16" "56920314" "56920314" "subst" "7.72578E-5" "02327" "SLC12A3_000082" "g.56920314G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56886402G>A" "" "likely pathogenic" "" "0000343215" "0" "70" "16" "56920314" "56920314" "subst" "8.1324E-6" "02327" "SLC12A3_000083" "g.56920314G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56886402G>T" "" "likely pathogenic" "" "0000343434" "0" "70" "16" "56928475" "56928475" "subst" "9.75697E-5" "02327" "SLC12A3_000102" "g.56928475C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56894563C>T" "" "likely pathogenic" "" "0000343464" "0" "90" "16" "56933467" "56933467" "subst" "4.06065E-6" "02327" "SLC12A3_000103" "g.56933467C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56899555C>T" "" "pathogenic" "" "0000343478" "0" "30" "16" "56933519" "56933519" "subst" "0.108903" "02327" "SLC12A3_000026" "g.56933519G>A" "" "" "" "SLC12A3(NM_000339.3):c.2738G>A (p.R913Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56899607G>A" "" "likely benign" "" "0000343489" "0" "10" "16" "56936319" "56936319" "subst" "0.0310492" "02327" "SLC12A3_000028" "g.56936319C>T" "" "" "" "SLC12A3(NM_000339.3):c.2782C>T (p.R928C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56902407C>T" "" "benign" "" "0000343520" "0" "90" "16" "56938314" "56938314" "subst" "0.000158361" "02327" "SLC12A3_000108" "g.56938314G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56904402G>A" "" "pathogenic" "" "0000343533" "0" "90" "16" "56938352" "56938352" "subst" "1.21824E-5" "02327" "SLC12A3_000109" "g.56938352C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56904440C>T" "" "pathogenic" "" "0000343728" "0" "70" "16" "56906680" "56906680" "subst" "0" "02327" "SLC12A3_000055" "g.56906680C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56872768C>G" "" "likely pathogenic" "" "0000343804" "0" "10" "16" "56919216" "56919216" "subst" "0.00459005" "02327" "SLC12A3_000077" "g.56919216A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56885304A>G" "" "benign" "" "0000344479" "0" "90" "16" "56947205" "56947205" "subst" "0.000199137" "02327" "SLC12A3_000112" "g.56947205G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56913293G>A" "" "pathogenic" "" "0000345086" "0" "10" "16" "56901062" "56901062" "subst" "0.000896379" "02327" "SLC12A3_000039" "g.56901062G>C" "" "" "" "SLC12A3(NM_000339.2):c.363G>C (p.E121D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56867150G>C" "" "benign" "" "0000345597" "0" "90" "16" "56936358" "56936358" "subst" "0" "02327" "SLC12A3_000104" "g.56936358G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56902446G>T" "" "pathogenic" "" "0000346037" "0" "70" "16" "56912014" "56912014" "subst" "0" "02327" "SLC12A3_000057" "g.56912014G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56878102G>A" "" "likely pathogenic" "" "0000346076" "0" "90" "16" "56913119" "56913119" "subst" "0.000158716" "02327" "SLC12A3_000002" "g.56913119G>A" "" "" "" "SLC12A3(NM_000339.3):c.1315G>A (p.G439S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56879207G>A" "" "pathogenic" "" "0000346082" "0" "50" "16" "56913473" "56913473" "subst" "0" "02327" "SLC12A3_000067" "g.56913473G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56879561G>A" "" "VUS" "" "0000346093" "0" "70" "16" "56913505" "56913505" "subst" "2.84627E-5" "02327" "SLC12A3_000068" "g.56913505G>A" "" "" "" "SLC12A3(NM_000339.3):c.1387G>A (p.G463R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56879593G>A" "" "likely pathogenic" "" "0000346242" "0" "70" "16" "56921844" "56921844" "subst" "0.000101608" "02327" "SLC12A3_000090" "g.56921844G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56887932G>T" "" "likely pathogenic" "" "0000346244" "0" "70" "16" "56921849" "56921849" "subst" "2.03174E-5" "02327" "SLC12A3_000091" "g.56921849G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56887937G>A" "" "likely pathogenic" "" "0000346249" "0" "90" "16" "56921879" "56921879" "subst" "0.000381838" "02327" "SLC12A3_000092" "g.56921879G>A" "" "" "" "SLC12A3(NM_000339.2):c.2221G>A (p.G741R), SLC12A3(NM_000339.3):c.2221G>A (p.G741R), SLC12A3(NM_001126108.2):c.2221G>A (p.(Gly741Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56887967G>A" "" "pathogenic" "" "0000346300" "0" "70" "16" "56926966" "56926966" "subst" "0" "02327" "SLC12A3_000093" "g.56926966G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56893054G>C" "" "likely pathogenic" "" "0000346345" "0" "90" "16" "56947189" "56947189" "subst" "5.28954E-5" "02327" "SLC12A3_000034" "g.56947189G>A" "" "" "" "SLC12A3(NM_000339.2):c.2965G>A (p.G989R), SLC12A3(NM_000339.3):c.2965G>A (p.G989R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56913277G>A" "" "pathogenic" "" "0000346702" "0" "50" "16" "56906682" "56906682" "subst" "4.06111E-6" "02327" "SLC12A3_000056" "g.56906682T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56872770T>C" "" "VUS" "" "0000346832" "0" "50" "16" "56947187" "56947187" "subst" "0" "02327" "SLC12A3_000111" "g.56947187T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56913275T>C" "" "VUS" "" "0000347058" "0" "70" "16" "56904611" "56904611" "subst" "1.62459E-5" "02327" "SLC12A3_000009" "g.56904611T>C" "" "" "" "SLC12A3(NM_000339.3):c.815T>C (p.L272P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56870699T>C" "" "likely pathogenic" "" "0000347325" "0" "90" "16" "56928470" "56928470" "subst" "0.000121976" "02327" "SLC12A3_000101" "g.56928470T>C" "" "" "" "SLC12A3(NM_000339.3):c.2576T>C (p.L859P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56894558T>C" "" "pathogenic" "" "0000347780" "0" "50" "16" "56904104" "56904104" "subst" "0" "02327" "SLC12A3_000047" "g.56904104T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56870192T>C" "" "VUS" "" "0000348535" "0" "70" "16" "56920278" "56920278" "subst" "0.000175477" "02327" "SLC12A3_000020" "g.56920278C>T" "" "" "" "SLC12A3(NM_000339.3):c.1928C>T (p.P643L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56886366C>T" "" "likely pathogenic" "" "0000348988" "0" "90" "16" "56913007" "56913008" "ins" "0" "02327" "SLC12A3_000063" "g.56913007_56913008insGTGATGC" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56879095_56879096insGTGATGC" "" "pathogenic" "" "0000349120" "0" "70" "16" "56919191" "56919191" "subst" "0" "02327" "SLC12A3_000076" "g.56919191T>C" "" "" "" "SLC12A3(NM_000339.3):c.1840T>C (p.S614P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56885279T>C" "" "likely pathogenic" "" "0000349308" "0" "50" "16" "56902267" "56902267" "subst" "4.0995E-5" "02327" "SLC12A3_000040" "g.56902267C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56868355C>T" "" "VUS" "" "0000349432" "0" "90" "16" "56906321" "56906321" "subst" "1.62472E-5" "02327" "SLC12A3_000052" "g.56906321C>T" "" "" "" "SLC12A3(NM_000339.3):c.911C>T (p.T304M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56872409C>T" "" "pathogenic" "" "0000349433" "0" "70" "16" "56906320" "56906320" "subst" "2.84303E-5" "02327" "SLC12A3_000051" "g.56906320A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56872408A>C" "" "likely pathogenic" "" "0000349491" "0" "90" "16" "56912068" "56912068" "subst" "1.22811E-5" "02327" "SLC12A3_000058" "g.56912068C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56878156C>T" "" "pathogenic" "" "0000349582" "0" "90" "16" "56899326" "56899326" "subst" "6.09137E-5" "02327" "SLC12A3_000036" "g.56899326C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56865414C>T" "" "pathogenic" "" "0000349590" "0" "90" "16" "56920296" "56920296" "subst" "0" "02327" "SLC12A3_000081" "g.56920296C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56886384C>G" "" "pathogenic" "" "0000349607" "0" "90" "16" "56920916" "56920922" "del" "2.84398E-5" "02327" "SLC12A3_000086" "g.56920916_56920922del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56887004_56887010del" "" "pathogenic" "" "0000349716" "0" "90" "16" "56903649" "56903649" "subst" "4.06197E-6" "02327" "SLC12A3_000042" "g.56903649T>C" "" "" "" "SLC12A3(NM_000339.3):c.514T>C (p.W172R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56869737T>C" "" "pathogenic" "" "0000349834" "0" "90" "16" "56919186" "56919186" "subst" "0" "02327" "SLC12A3_000075" "g.56919186G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56885274G>A" "" "pathogenic" "" "0000350630" "0" "70" "16" "56920379" "56920379" "subst" "1.22037E-5" "02327" "SLC12A3_000084" "g.56920379G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56886467G>A" "" "likely pathogenic" "" "0000350761" "0" "90" "16" "56921007" "56921007" "subst" "0" "02327" "SLC12A3_000088" "g.56921007T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56887095T>C" "" "pathogenic" "" "0000351287" "0" "90" "16" "56903737" "56903737" "subst" "0" "02327" "SLC12A3_000043" "g.56903737G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56869825G>A" "" "pathogenic" "" "0000351288" "0" "70" "16" "56903992" "56903992" "subst" "6.13457E-5" "02327" "SLC12A3_000044" "g.56903992G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56870080G>A" "" "likely pathogenic" "" "0000351289" "0" "90" "16" "56904148" "56904148" "subst" "8.18545E-6" "02327" "SLC12A3_000048" "g.56904148G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56870236G>A" "" "pathogenic" "" "0000558512" "0" "90" "16" "56899182" "56899182" "dup" "0" "02326" "SLC12A3_000115" "g.56899182dup" "" "" "" "SLC12A3(NM_000339.3):c.35dupA (p.D12Efs*18)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56865270dup" "" "pathogenic" "" "0000558513" "0" "30" "16" "56899183" "56899183" "subst" "0.000635966" "01943" "SLC12A3_000004" "g.56899183C>T" "" "" "" "SLC12A3(NM_000339.2):c.36C>T (p.D12=), SLC12A3(NM_000339.3):c.36C>T (p.D12=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56865271C>T" "" "likely benign" "" "0000558514" "0" "90" "16" "56903649" "56903649" "subst" "4.06197E-6" "02326" "SLC12A3_000042" "g.56903649T>C" "" "" "" "SLC12A3(NM_000339.3):c.514T>C (p.W172R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56869737T>C" "" "pathogenic" "" "0000558515" "0" "90" "16" "56903668" "56903668" "subst" "1.62462E-5" "02327" "SLC12A3_000116" "g.56903668C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56869756C>T" "" "pathogenic" "" "0000558516" "0" "70" "16" "56906357" "56906357" "subst" "0" "02327" "SLC12A3_000117" "g.56906357G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56872445G>C" "" "likely pathogenic" "" "0000558517" "0" "50" "16" "56906568" "56906568" "subst" "0.00172181" "02325" "SLC12A3_000118" "g.56906568C>T" "" "" "" "SLC12A3(NM_000339.2):c.965C>T (p.A322V), SLC12A3(NM_000339.3):c.965C>T (p.A322V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56872656C>T" "" "VUS" "" "0000558518" "0" "50" "16" "56913128" "56913128" "subst" "0" "02327" "SLC12A3_000013" "g.56913128A>G" "" "" "" "SLC12A3(NM_000339.3):c.1324A>G (p.N442D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56879216A>G" "" "VUS" "" "0000558519" "0" "50" "16" "56913514" "56913514" "subst" "2.03275E-5" "02327" "SLC12A3_000119" "g.56913514C>G" "" "" "" "SLC12A3(NM_000339.2):c.1396C>G (p.L466V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56879602C>G" "" "VUS" "" "0000558520" "0" "10" "16" "56914025" "56914025" "subst" "0.0220195" "02326" "SLC12A3_000069" "g.56914025G>A" "" "" "" "SLC12A3(NM_000339.3):c.1444-17G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56880113G>A" "" "benign" "" "0000558521" "0" "10" "16" "56914455" "56914455" "subst" "0" "02327" "SLC12A3_000120" "g.56914455G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56880543G>A" "" "benign" "" "0000558522" "0" "50" "16" "56918072" "56918072" "subst" "0" "02327" "SLC12A3_000121" "g.56918072G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56884160G>A" "" "VUS" "" "0000558523" "0" "10" "16" "56918125" "56918125" "subst" "0.0340709" "02326" "SLC12A3_000074" "g.56918125C>A" "" "" "" "SLC12A3(NM_000339.3):c.1825+9C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56884213C>A" "" "benign" "" "0000558524" "0" "10" "16" "56921840" "56921840" "subst" "0.0121471" "02326" "SLC12A3_000089" "g.56921840G>A" "" "" "" "SLC12A3(NM_000339.3):c.2182G>A (p.A728T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56887928G>A" "" "benign" "" "0000558525" "0" "50" "16" "56921931" "56921931" "subst" "0.000195047" "02327" "SLC12A3_000122" "g.56921931T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56888019T>C" "" "VUS" "" "0000558526" "0" "50" "16" "56926960" "56926960" "subst" "0" "02327" "SLC12A3_000123" "g.56926960G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56893048G>A" "" "VUS" "" "0000558527" "0" "50" "16" "56936420" "56936420" "subst" "0" "02327" "SLC12A3_000124" "g.56936420G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56902508G>A" "" "VUS" "" "0000558528" "0" "50" "16" "56947214" "56947214" "subst" "3.65649E-5" "02325" "SLC12A3_000125" "g.56947214C>T" "" "" "" "SLC12A3(NM_000339.3):c.2990C>T (p.S997L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56913302C>T" "" "VUS" "" "0000616041" "0" "70" "16" "56902252" "56902252" "subst" "0" "02327" "SLC12A3_000127" "g.56902252G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56868340G>A" "" "likely pathogenic" "" "0000616042" "0" "70" "16" "56906678" "56906678" "subst" "0" "02327" "SLC12A3_000128" "g.56906678A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56872766A>C" "" "likely pathogenic" "" "0000616043" "0" "50" "16" "56913523" "56913523" "subst" "8.5404E-5" "02327" "SLC12A3_000129" "g.56913523G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56879611G>A" "" "VUS" "" "0000624926" "0" "70" "16" "56913119" "56913119" "subst" "0.000158716" "01164" "SLC12A3_000002" "g.56913119G>A" "" "" "" "" "ACMG: PM2,PM3,PP1,PP3; Mastroianni et al. 1996. Am J hum Genet 59: 1019; Brambilla et al. 2013. J Nephrol 26: 594; Bouchireb et al. 2014. BMC Pediatr 14: 201" "Germline" "" "rs759377924" "0" "" "" "g.56879207G>A" "" "likely pathogenic" "ACMG" "0000624927" "0" "50" "16" "56912038" "56912038" "subst" "5.32019E-5" "01164" "SLC12A3_000130" "g.56912038C>T" "" "" "" "" "ACMG: PM2,PP3; Colussi et al. 2007. Clin J Am Soc Nephrol 2: 454; Ji et al. 2008. Nat Genet 40: 592; Balavoine et al. 2011. Eur J Endocrinol 165: 665; Baldane et al. 2015. Indian J Nephrol 25: 103" "Germline" "" "rs187885782" "0" "" "" "g.56878126C>T" "" "VUS" "ACMG" "0000649351" "1" "10" "16" "56904587" "56904587" "subst" "0.977965" "03575" "SLC12A3_000007" "g.56904587C>G" "34/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "34 heterozygous; {DB:CLININrs1529927}\r\nVariant Error [EMISMATCH/EREF]: This transcript variant does not match the reference sequence. Please fix this entry and then remove this message." "Germline" "" "rs1529927" "0" "" "" "g.56870675C>G" "" "benign" "" "0000649352" "1" "90" "16" "56918054" "56918054" "subst" "2.43992E-5" "03575" "SLC12A3_000131" "g.56918054C>T" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs121909382}" "Germline" "" "rs121909382" "0" "" "" "g.56884142C>T" "" "pathogenic" "" "0000649353" "1" "30" "16" "56918125" "56918125" "subst" "0.0340709" "03575" "SLC12A3_000074" "g.56918125C>A" "72/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "72 heterozygous, no homozygous; {DB:CLININrs35797045}" "Germline" "" "rs35797045" "0" "" "" "g.56884213C>A" "" "likely benign" "" "0000649354" "1" "90" "16" "56947205" "56947205" "subst" "0.000199137" "03575" "SLC12A3_000112" "g.56947205G>A" "1/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs199849117}" "Germline" "" "rs199849117" "0" "" "" "g.56913293G>A" "" "pathogenic" "" "0000657876" "0" "30" "16" "56899174" "56899174" "subst" "0" "01943" "SLC12A3_000132" "g.56899174G>A" "" "" "" "SLC12A3(NM_000339.2):c.27G>A (p.T9=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56865262G>A" "" "likely benign" "" "0000657877" "0" "30" "16" "56901022" "56901022" "subst" "0.000162906" "01943" "SLC12A3_000133" "g.56901022G>A" "" "" "" "SLC12A3(NM_000339.2):c.323G>A (p.R108Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56867110G>A" "" "likely benign" "" "0000657878" "0" "70" "16" "56902236" "56902236" "subst" "6.10834E-5" "02327" "SLC12A3_000134" "g.56902236G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56868324G>A" "" "likely pathogenic" "" "0000657879" "0" "50" "16" "56913491" "56913491" "subst" "1.21924E-5" "01943" "SLC12A3_000135" "g.56913491C>T" "" "" "" "SLC12A3(NM_000339.2):c.1373C>T (p.T458M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56879579C>T" "" "VUS" "" "0000657880" "0" "50" "16" "56913514" "56913514" "subst" "2.03275E-5" "01943" "SLC12A3_000119" "g.56913514C>G" "" "" "" "SLC12A3(NM_000339.2):c.1396C>G (p.L466V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56879602C>G" "" "VUS" "" "0000657881" "0" "10" "16" "56914355" "56914355" "subst" "0" "02327" "SLC12A3_000136" "g.56914355C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56880443C>T" "" "benign" "" "0000657882" "0" "30" "16" "56926915" "56926915" "subst" "0.000374084" "01943" "SLC12A3_000137" "g.56926915T>A" "" "" "" "SLC12A3(NM_000339.2):c.2497T>A (p.S833T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56893003T>A" "" "likely benign" "" "0000657883" "0" "90" "16" "56928470" "56928470" "subst" "0.000121976" "02326" "SLC12A3_000101" "g.56928470T>C" "" "" "" "SLC12A3(NM_000339.3):c.2576T>C (p.L859P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56894558T>C" "" "pathogenic" "" "0000669337" "3" "10" "16" "56904587" "56904587" "subst" "0.977965" "03575" "SLC12A3_000007" "g.56904587C>G" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 homozygous; {DB:CLININrs1529927}\r\nVariant Error [EMISMATCH/EREF]: This transcript variant does not match the reference sequence. Please fix this entry and then remove this message." "Germline" "" "rs1529927" "0" "" "" "g.56870675C>G" "" "benign" "" "0000683629" "0" "90" "16" "56921879" "56921879" "subst" "0.000381838" "01164" "SLC12A3_000092" "g.56921879G>A" "" "Simon et al. 1996. Nat Genet 12: 24; Walsh et al. 2018. Clin Kidney J 3: 302; Zahed et al. 2017. J. Pediatr. 189: 222; De Jong et al. 2002. J Am Soc Nephrol 13: 1442" "" "" "ACMG grading: PS4,PM2,PM3,PP1,PP3" "Germline" "" "rs138977195" "0" "" "" "" "" "pathogenic" "ACMG" "0000683630" "0" "70" "16" "56904050" "56904050" "subst" "8.12579E-6" "01164" "SLC12A3_000138" "g.56904050T>C" "" "De Jong et al. 2002. J. Am. Soc. Nephrol. 6: 1442; De Jong et al. 2004. Nephrol. Dial. Transplant. 5: 1069; Lemmink et al. 1998. Kidney Int 54: 720; Yuan et al. 2017. Endocr Connect 4: 243" "" "" "ACMG grading: PM1,PM2,PM3,PP3" "Germline" "" "rs780594361" "0" "" "" "" "" "likely pathogenic" "ACMG" "0000692093" "0" "50" "16" "56906568" "56906568" "subst" "0.00172181" "01943" "SLC12A3_000118" "g.56906568C>T" "" "" "" "SLC12A3(NM_000339.2):c.965C>T (p.A322V), SLC12A3(NM_000339.3):c.965C>T (p.A322V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000692094" "0" "70" "16" "56913140" "56913140" "subst" "0" "01943" "SLC12A3_000066" "g.56913140G>A" "" "" "" "SLC12A3(NM_000339.2):c.1335+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000704279" "0" "90" "16" "56918023" "56918023" "subst" "0.000617756" "03944" "SLC12A3_000145" "g.56918023G>A" "" "" "" "" "" "Germline" "" "" "" "" "" "" "" "pathogenic" "" "0000704280" "0" "90" "16" "56926955" "56926956" "del" "0" "03944" "SLC12A3_000146" "g.56926955_56926956del" "" "" "" "" "" "Germline" "" "" "" "" "" "" "" "pathogenic" "" "0000704281" "3" "90" "16" "56919275" "56919275" "subst" "0.000125401" "03944" "SLC12A3_000144" "g.56919275C>T" "" "" "" "" "" "Germline" "" "" "" "" "" "" "" "pathogenic" "" "0000704282" "0" "90" "16" "56918054" "56918054" "subst" "2.43992E-5" "03944" "SLC12A3_000131" "g.56918054C>T" "" "" "" "" "" "Germline" "" "" "" "" "" "" "" "pathogenic" "" "0000704283" "0" "90" "16" "56920379" "56920379" "subst" "1.22037E-5" "03944" "SLC12A3_000084" "g.56920379G>A" "" "" "" "" "" "Germline" "" "" "" "" "" "" "" "pathogenic" "" "0000704284" "0" "90" "16" "56903674" "56903674" "subst" "0.000272132" "03944" "SLC12A3_000139" "g.56903674C>A" "" "" "" "" "" "Germline" "" "" "" "" "" "" "" "pathogenic" "" "0000704285" "0" "90" "16" "56919195" "56919195" "subst" "4.59173E-5" "03944" "SLC12A3_000143" "g.56919195C>T" "" "" "" "" "" "Germline" "" "" "" "" "" "" "" "pathogenic" "" "0000704286" "0" "90" "16" "56906357" "56906357" "subst" "1.62549E-5" "03944" "SLC12A3_000141" "g.56906357G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000704287" "0" "90" "16" "56928555" "56928555" "subst" "8.13392E-6" "03944" "SLC12A3_000142" "g.56928555G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000704288" "0" "90" "16" "56903674" "56903674" "subst" "0.000272132" "03944" "SLC12A3_000139" "g.56903674C>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000704289" "0" "50" "16" "56913039" "56913039" "subst" "0" "03944" "SLC12A3_000140" "g.56913039G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "" "" "VUS" "ACMG" "0000704290" "0" "90" "16" "56913119" "56913119" "subst" "0.000158716" "03944" "SLC12A3_000002" "g.56913119G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000704306" "0" "90" "16" "56899286" "56899286" "del" "0" "03944" "SLC12A3_000148" "g.56899286del" "" "" "" "139delC" "" "Germline" "" "" "0" "" "" "g.56865374del" "" "pathogenic" "" "0000704307" "0" "90" "16" "56919219" "56919219" "subst" "0" "03944" "SLC12A3_000147" "g.56919219T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000704308" "3" "90" "16" "56928467" "56928467" "subst" "6.50883E-5" "03944" "SLC12A3_000149" "g.56928467T>A" "" "" "" "" "" "Germline" "" "" "" "" "" "" "" "pathogenic" "" "0000704309" "0" "90" "16" "56903674" "56903674" "subst" "0.000272132" "03944" "SLC12A3_000139" "g.56903674C>A" "" "" "" "" "" "Germline" "" "" "" "" "" "" "" "pathogenic" "" "0000704310" "0" "90" "16" "56919195" "56919195" "subst" "4.59173E-5" "03944" "SLC12A3_000143" "g.56919195C>T" "" "" "" "" "" "Germline" "" "" "" "" "" "" "" "pathogenic" "" "0000704311" "0" "90" "16" "56917989" "56917989" "subst" "0.000487991" "03944" "SLC12A3_000150" "g.56917989C>A" "" "" "" "" "" "Germline" "" "" "" "" "" "" "" "pathogenic" "" "0000704312" "0" "50" "16" "56920362" "56920362" "subst" "0" "03944" "SLC12A3_000151" "g.56920362T>G" "" "" "" "" "" "Germline" "" "" "" "" "" "" "" "VUS" "" "0000704313" "0" "90" "16" "56928476" "56928476" "subst" "4.06702E-6" "03944" "SLC12A3_000152" "g.56928476G>A" "" "" "" "" "" "Germline" "" "" "" "" "" "" "" "pathogenic" "" "0000704314" "0" "90" "16" "56903674" "56903674" "subst" "0.000272132" "03944" "SLC12A3_000139" "g.56903674C>A" "" "" "" "" "" "Germline" "" "" "" "" "" "" "" "pathogenic" "" "0000704315" "0" "90" "16" "56926960" "56926960" "subst" "0" "03944" "SLC12A3_000123" "g.56926960G>A" "" "" "" "" "" "Germline" "" "" "" "" "" "" "" "pathogenic" "" "0000704316" "3" "90" "16" "56913452" "56913452" "subst" "0" "03944" "SLC12A3_000153" "g.56913452A>T" "" "" "" "" "" "Germline" "" "" "" "" "" "" "" "pathogenic" "" "0000704317" "0" "90" "16" "56917997" "56917997" "subst" "0.00012196" "03944" "SLC12A3_000154" "g.56917997C>T" "" "" "" "" "" "Germline" "" "" "" "" "" "" "" "pathogenic" "" "0000704318" "0" "90" "16" "56928467" "56928467" "subst" "6.50883E-5" "03944" "SLC12A3_000149" "g.56928467T>A" "" "" "" "" "" "Germline" "" "" "" "" "" "" "" "pathogenic" "" "0000704319" "0" "70" "16" "56947189" "56947189" "subst" "0" "03944" "SLC12A3_000155" "g.56947189G>T" "" "" "" "" "" "Germline" "" "" "" "" "" "" "" "likely pathogenic" "" "0000704320" "0" "90" "16" "56903674" "56903674" "subst" "0.000272132" "03944" "SLC12A3_000139" "g.56903674C>A" "" "" "" "" "" "Germline" "" "" "" "" "" "" "" "pathogenic" "" "0000704321" "0" "90" "16" "56912999" "56912999" "subst" "1.23872E-5" "03944" "SLC12A3_000061" "g.56912999C>T" "" "" "" "" "" "Germline" "" "" "" "" "" "" "" "pathogenic" "" "0000704322" "3" "90" "16" "56904584" "56904601" "dup" "0" "03944" "SLC12A3_000156" "g.56904584_56904601dup" "" "" "" "805_806insATTGGCGTGGTCTCGGTC" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000704323" "0" "90" "16" "56914154" "56914154" "del" "0" "03944" "SLC12A3_000157" "g.56914154del" "" "" "" "1555delT" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000704324" "0" "90" "16" "56928467" "56928467" "subst" "6.50883E-5" "03944" "SLC12A3_000149" "g.56928467T>A" "" "" "" "" "" "Germline" "" "" "" "" "" "" "" "pathogenic" "" "0000704325" "0" "90" "16" "56912999" "56912999" "subst" "1.23872E-5" "03944" "SLC12A3_000061" "g.56912999C>T" "" "" "" "" "" "Germline" "" "" "" "" "" "" "" "pathogenic" "" "0000704326" "0" "90" "16" "56928467" "56928467" "subst" "6.50883E-5" "03944" "SLC12A3_000149" "g.56928467T>A" "" "" "" "" "" "Germline" "" "" "" "" "" "" "" "pathogenic" "" "0000704327" "3" "90" "16" "56919219" "56919219" "subst" "0" "03944" "SLC12A3_000147" "g.56919219T>C" "" "" "" "" "" "Germline" "" "" "" "" "" "" "" "pathogenic" "" "0000704371" "0" "90" "16" "56920280" "56920280" "del" "0" "03944" "SLC12A3_000080" "g.56920280del" "" "" "" "1926delC" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000704372" "0" "90" "16" "56928467" "56928467" "subst" "6.50883E-5" "03944" "SLC12A3_000149" "g.56928467T>A" "" "" "" "" "" "Germline" "" "" "" "" "" "" "" "pathogenic" "" "0000704373" "0" "90" "16" "56903674" "56903674" "subst" "0.000272132" "03944" "SLC12A3_000139" "g.56903674C>A" "" "" "" "" "" "Germline" "" "" "" "" "" "" "" "pathogenic" "" "0000704374" "0" "90" "16" "56918054" "56918054" "subst" "2.43992E-5" "03944" "SLC12A3_000131" "g.56918054C>T" "" "" "" "" "" "Germline" "" "" "" "" "" "" "" "pathogenic" "" "0000704375" "0" "90" "16" "56920379" "56920379" "subst" "1.22037E-5" "03944" "SLC12A3_000084" "g.56920379G>A" "" "" "" "" "" "Germline" "" "" "" "" "" "" "" "pathogenic" "" "0000704376" "0" "90" "16" "56938350" "56938350" "subst" "0" "03944" "SLC12A3_000158" "g.56938350C>T" "" "" "" "" "" "Germline" "" "" "" "" "" "" "" "pathogenic" "" "0000704377" "3" "90" "16" "56928467" "56928467" "subst" "6.50883E-5" "03944" "SLC12A3_000149" "g.56928467T>A" "" "" "" "" "" "Germline" "" "" "" "" "" "" "" "pathogenic" "" "0000704378" "3" "90" "16" "56928467" "56928467" "subst" "6.50883E-5" "03944" "SLC12A3_000149" "g.56928467T>A" "" "" "" "" "" "Germline" "" "" "" "" "" "" "" "pathogenic" "" "0000704379" "0" "70" "16" "56911993" "56911993" "subst" "4.20052E-6" "03944" "SLC12A3_000159" "g.56911993C>T" "" "" "" "" "" "Germline" "" "" "" "" "" "" "" "likely pathogenic" "" "0000704380" "0" "90" "16" "56912999" "56912999" "subst" "1.23872E-5" "03944" "SLC12A3_000061" "g.56912999C>T" "" "" "" "" "" "Germline" "" "" "" "" "" "" "" "pathogenic" "" "0000704381" "0" "90" "16" "56928467" "56928467" "subst" "6.50883E-5" "03944" "SLC12A3_000149" "g.56928467T>A" "" "" "" "" "" "Germline" "" "" "" "" "" "" "" "pathogenic" "" "0000704382" "0" "90" "16" "56903674" "56903674" "subst" "0.000272132" "03944" "SLC12A3_000139" "g.56903674C>A" "" "" "" "" "" "Germline" "" "" "" "" "" "" "" "pathogenic" "" "0000704383" "0" "90" "16" "56933468" "56933468" "subst" "4.46671E-5" "03944" "SLC12A3_000160" "g.56933468G>A" "" "" "" "" "" "Germline" "" "" "" "" "" "" "" "pathogenic" "" "0000704384" "0" "90" "16" "56928467" "56928467" "subst" "6.50883E-5" "03944" "SLC12A3_000149" "g.56928467T>A" "" "" "" "" "" "Germline" "" "" "" "" "" "" "" "pathogenic" "" "0000704385" "0" "90" "16" "56947277" "56947277" "subst" "1.21822E-5" "03944" "SLC12A3_000161" "g.56947277G>A" "" "" "" "" "" "Germline" "" "" "" "" "" "" "" "pathogenic" "" "0000704386" "0" "90" "16" "56928467" "56928467" "subst" "6.50883E-5" "03944" "SLC12A3_000149" "g.56928467T>A" "" "" "" "" "" "Germline" "" "" "" "" "" "" "" "pathogenic" "" "0000704387" "0" "90" "16" "56938314" "56938314" "subst" "0.000158361" "03944" "SLC12A3_000108" "g.56938314G>A" "" "" "" "" "" "Germline" "" "" "" "" "" "" "" "pathogenic" "" "0000704388" "0" "70" "16" "56921849" "56921849" "subst" "2.03174E-5" "03944" "SLC12A3_000091" "g.56921849G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000704389" "0" "90" "16" "56928467" "56928467" "subst" "6.50883E-5" "03944" "SLC12A3_000149" "g.56928467T>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000715038" "3" "50" "16" "56899228" "56899228" "subst" "0.000398189" "00006" "SLC12A3_000162" "g.56899228C>G" "" "{PMID:Bonnard 2012:22581230}" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "VUS" "" "0000725856" "0" "10" "16" "56906568" "56906568" "subst" "0.00172181" "02327" "SLC12A3_000118" "g.56906568C>T" "" "" "" "SLC12A3(NM_000339.2):c.965C>T (p.A322V), SLC12A3(NM_000339.3):c.965C>T (p.A322V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000725857" "0" "70" "16" "56913451" "56913451" "subst" "0" "02326" "SLC12A3_000163" "g.56913451C>A" "" "" "" "SLC12A3(NM_000339.3):c.1336-3C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000725858" "0" "90" "16" "56921879" "56921879" "subst" "0.000381838" "01943" "SLC12A3_000092" "g.56921879G>A" "" "" "" "SLC12A3(NM_000339.2):c.2221G>A (p.G741R), SLC12A3(NM_000339.3):c.2221G>A (p.G741R), SLC12A3(NM_001126108.2):c.2221G>A (p.(Gly741Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000725859" "0" "90" "16" "56936421" "56936421" "subst" "0.000227853" "01943" "SLC12A3_000029" "g.56936421G>T" "" "" "" "SLC12A3(NM_000339.2):c.2883+1G>T, SLC12A3(NM_000339.3):c.2883+1G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000725860" "0" "70" "16" "56947276" "56947276" "subst" "8.12143E-6" "02329" "SLC12A3_000126" "g.56947276C>T" "" "" "" "SLC12A3(NM_000339.3):c.3052C>T (p.R1018*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000730109" "1" "70" "16" "56904148" "56904148" "subst" "8.18545E-6" "01164" "SLC12A3_000048" "g.56904148G>A" "" "PMID: 12772080, 18391953" "" "" "ACMG: PVS1, PM2_sup" "Germline" "?" "" "" "" "" "" "" "likely pathogenic (recessive)" "ACMG" "0000730110" "2" "70" "16" "56906357" "56906357" "subst" "1.62549E-5" "01164" "SLC12A3_000141" "g.56906357G>T" "" "PMID: 17329572, 26921350, 12112667" "" "" "ACMG: PS3, PM3, PM2_sup, PP3: class 4" "Germline" "?" "" "" "" "" "" "" "likely pathogenic (recessive)" "ACMG" "0000763738" "0" "50" "16" "56921837" "56921837" "subst" "0" "00000" "SLC12A3_000164" "g.56921837G>A" "" "{PMID:Duvvari 2016:27007659}" "" "2179G>A" "" "Germline" "" "rs36049418" "0" "" "" "g.56887925G>A" "" "VUS" "" "0000763805" "0" "50" "16" "56936421" "56936421" "subst" "0.000227853" "00000" "SLC12A3_000029" "g.56936421G>T" "2/3 affected, 1/1 unaffected" "{PMID:Duvvari 2016:27007659}" "" "c.2883+1G>T" "" "Germline" "" "rs199974259" "0" "" "" "g.56902509G>T" "" "VUS" "" "0000785378" "1" "90" "16" "56920916" "56920922" "del" "2.84398E-5" "01164" "SLC12A3_000086" "g.56920916_56920922del" "" "PMID: 12112667, 23328711,31672324" "" "2114_2120delACCAAGT" "ACMG: PVS1, PS4_MOD, PM3, PM2_SUP" "Germline" "?" "" "0" "" "" "g.56887004_56887010del" "VCV000448392.4" "pathogenic (recessive)" "ACMG" "0000785379" "2" "70" "16" "56906357" "56906357" "subst" "1.62549E-5" "01164" "SLC12A3_000141" "g.56906357G>T" "" "" "" "" "ACMG: PS3, PS4_MOD, PM2_SUP, PM3" "Germline" "?" "" "" "" "" "" "" "likely pathogenic (recessive)" "ACMG" "0000807456" "0" "30" "16" "56899396" "56899396" "subst" "0.00460465" "01943" "SLC12A3_000169" "g.56899396G>T" "" "" "" "SLC12A3(NM_000339.2):c.249G>T (p.R83=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000807457" "0" "30" "16" "56901062" "56901062" "subst" "0.000896379" "01943" "SLC12A3_000039" "g.56901062G>C" "" "" "" "SLC12A3(NM_000339.2):c.363G>C (p.E121D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000807458" "0" "30" "16" "56901137" "56901137" "subst" "0.00027828" "01943" "SLC12A3_000170" "g.56901137G>A" "" "" "" "SLC12A3(NM_000339.2):c.429+9G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000807459" "0" "30" "16" "56904057" "56904057" "subst" "7.31303E-5" "01943" "SLC12A3_000171" "g.56904057C>T" "" "" "" "SLC12A3(NM_000339.2):c.651C>T (p.G217=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000807460" "0" "70" "16" "56913505" "56913505" "subst" "2.84627E-5" "02326" "SLC12A3_000068" "g.56913505G>A" "" "" "" "SLC12A3(NM_000339.3):c.1387G>A (p.G463R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000807461" "0" "30" "16" "56918001" "56918001" "subst" "9.34891E-5" "02327" "SLC12A3_000172" "g.56918001G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000807462" "0" "50" "16" "56936320" "56936320" "subst" "4.46704E-5" "01943" "SLC12A3_000173" "g.56936320G>A" "" "" "" "SLC12A3(NM_000339.2):c.2783G>A (p.R928H), SLC12A3(NM_001126108.2):c.2756G>A (p.(Arg919His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000807463" "0" "70" "16" "56947189" "56947189" "subst" "5.28954E-5" "01943" "SLC12A3_000034" "g.56947189G>A" "" "" "" "SLC12A3(NM_000339.2):c.2965G>A (p.G989R), SLC12A3(NM_000339.3):c.2965G>A (p.G989R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000827869" "0" "70" "16" "56938322" "56938322" "subst" "3.24852E-5" "00000" "SLC12A3_000177" "g.56938322A>G" "" "{PMID:Zacchia 2021:33964006}" "" "SLC12A3 c.2899A>G, p.R967G" "homozygous; solved" "Unknown" "?" "" "0" "" "" "g.56904410A>G" "" "likely pathogenic" "ACMG" "0000827870" "0" "50" "16" "56933491" "56933491" "subst" "0" "00000" "SLC12A3_000176" "g.56933491A>T" "" "{PMID:Zacchia 2021:33964006}" "" "SLC12A3 c.2710A>T, p.I904F" "heterozygous; unsolved" "Unknown" "?" "" "0" "" "" "g.56899579A>T" "" "VUS" "ACMG" "0000827871" "0" "70" "16" "56933468" "56933468" "subst" "4.46671E-5" "00000" "SLC12A3_000160" "g.56933468G>A" "" "{PMID:Zacchia 2021:33964006}" "" "SLC12A3 G2687A, p.R896Q" "heterozygous; solved" "Unknown" "?" "" "0" "" "" "g.56899556G>A" "" "likely pathogenic" "ACMG" "0000827872" "0" "70" "16" "56916409" "56916409" "subst" "0" "00000" "SLC12A3_000175" "g.56916409G>C" "" "{PMID:Zacchia 2021:33964006}" "" "SLC12A3 c.1669G>C, p.G557R" "heterozygous; solved" "Unknown" "?" "" "0" "" "" "g.56882497G>C" "" "likely pathogenic" "ACMG" "0000827874" "0" "50" "16" "56913006" "56913006" "subst" "0" "00000" "SLC12A3_000174" "g.56913006C>T" "" "{PMID:Zacchia 2021:33964006}" "" "SLC12A3 c.1202C>T, p.A401V" "heterozygous; unsolved" "Unknown" "?" "" "0" "" "" "g.56879094C>T" "" "VUS" "ACMG" "0000827903" "0" "70" "16" "56933468" "56933468" "subst" "4.46671E-5" "00000" "SLC12A3_000160" "g.56933468G>A" "" "{PMID:Zacchia 2021:33964006}" "" "SLC12A3 c.2687G>A, p.R896Q" "heterozygous; solved" "Unknown" "?" "" "0" "" "" "g.56899556G>A" "" "likely pathogenic" "ACMG" "0000827904" "0" "50" "16" "56933491" "56933491" "subst" "0" "00000" "SLC12A3_000176" "g.56933491A>T" "" "{PMID:Zacchia 2021:33964006}" "" "SLC12A3 c.2710A>T, p.I904F" "heterozygous; unsolved" "Unknown" "?" "" "0" "" "" "g.56899579A>T" "" "VUS" "ACMG" "0000827905" "0" "90" "16" "56921879" "56921879" "subst" "0.000381838" "00000" "SLC12A3_000092" "g.56921879G>A" "" "{PMID:Zacchia 2021:33964006}" "" "SLC12A3 c.2221G>A, p.G741R" "heterozygous; unsolved" "Unknown" "?" "" "0" "" "" "g.56887967G>A" "" "pathogenic" "ACMG" "0000854562" "0" "50" "16" "56899164" "56899164" "subst" "4.09118E-6" "02327" "SLC12A3_000178" "g.56899164C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000854563" "0" "50" "16" "56902284" "56902284" "subst" "0" "02327" "SLC12A3_000180" "g.56902284G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000864855" "0" "30" "16" "56899183" "56899183" "subst" "0.000635966" "02327" "SLC12A3_000004" "g.56899183C>T" "" "" "" "SLC12A3(NM_000339.2):c.36C>T (p.D12=), SLC12A3(NM_000339.3):c.36C>T (p.D12=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000864856" "0" "90" "16" "56899384" "56899385" "dup" "0" "02326" "SLC12A3_000038" "g.56899384_56899385dup" "" "" "" "SLC12A3(NM_000339.3):c.237_238dupCC (p.R80Pfs*35)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000864857" "0" "90" "16" "56899394" "56899394" "subst" "2.8497E-5" "02326" "SLC12A3_000179" "g.56899394C>T" "" "" "" "SLC12A3(NM_000339.3):c.247C>T (p.R83W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000864858" "0" "90" "16" "56906371" "56906371" "subst" "8.13259E-5" "02326" "SLC12A3_000053" "g.56906371C>T" "" "" "" "SLC12A3(NM_000339.3):c.961C>T (p.R321W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000864859" "0" "30" "16" "56906568" "56906568" "subst" "0.00172181" "02326" "SLC12A3_000118" "g.56906568C>T" "" "" "" "SLC12A3(NM_000339.2):c.965C>T (p.A322V), SLC12A3(NM_000339.3):c.965C>T (p.A322V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000864860" "0" "50" "16" "56921894" "56921894" "subst" "0" "02327" "SLC12A3_000181" "g.56921894T>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000864861" "0" "70" "16" "56924209" "56924209" "subst" "0" "02326" "SLC12A3_000182" "g.56924209G>A" "" "" "" "SLC12A3(NM_000339.3):c.2309G>A (p.G770D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000873483" "0" "70" "16" "56913484" "56913484" "dup" "0" "00000" "SLC12A3_000184" "g.56913484dup" "131" "{PMID:Sun 2018:30076350}" "" "SLC12A3(NM_000339.2):c.1362_1363insC(p.L457Dfs*68)/c.2029G>A(p.V677M)" "" "Germline/De novo (untested)" "?" "" "0" "" "" "g.56879572dup" "" "likely pathogenic" "" "0000873484" "0" "70" "16" "56920379" "56920379" "subst" "1.22037E-5" "00000" "SLC12A3_000084" "g.56920379G>A" "131" "{PMID:Sun 2018:30076350}" "" "SLC12A3(NM_000339.2):c.1362_1363insC(p.L457Dfs*68)/c.2029G>A(p.V677M)" "" "Germline/De novo (untested)" "?" "" "0" "" "" "g.56886467G>A" "" "likely pathogenic" "" "0000873549" "3" "70" "16" "56902247" "56902247" "subst" "0" "00000" "SLC12A3_000183" "g.56902247C>A" "177" "{PMID:Sun 2018:30076350}" "" "SLC12A3(NM_000339.2):c.468C>A(p.Y156*)" "" "Germline/De novo (untested)" "?" "" "0" "" "" "g.56868335C>A" "" "likely pathogenic" "" "0000873618" "0" "70" "16" "56919207" "56919207" "subst" "0" "00000" "SLC12A3_000185" "g.56919207G>A" "225" "{PMID:Sun 2018:30076350}" "" "SLC12A3 (NM_000339.2):c.1856G>A (p.G619D)/c.2451_2458delCCCCAAGG(p.K819Gfs*26)" "" "Germline/De novo (untested)" "?" "" "0" "" "" "g.56885295G>A" "" "likely pathogenic" "" "0000873619" "0" "70" "16" "56926872" "56926879" "del" "0" "00000" "SLC12A3_000186" "g.56926872_56926879del" "225" "{PMID:Sun 2018:30076350}" "" "SLC12A3 (NM_000339.2):c.1856G>A (p.G619D)/c.2451_2458delCCCCAAGG(p.K819Gfs*26)" "" "Germline/De novo (untested)" "?" "" "0" "" "" "g.56892960_56892967del" "" "likely pathogenic" "" "0000893071" "0" "70" "16" "56899394" "56899394" "subst" "2.8497E-5" "02327" "SLC12A3_000179" "g.56899394C>T" "" "" "" "SLC12A3(NM_000339.3):c.247C>T (p.R83W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000893072" "0" "70" "16" "56901102" "56901102" "subst" "5.80951E-5" "02327" "SLC12A3_000187" "g.56901102C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000893073" "0" "70" "16" "56903674" "56903674" "subst" "0.000272132" "02327" "SLC12A3_000139" "g.56903674C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000893074" "0" "90" "16" "56906333" "56906333" "dup" "0" "02326" "SLC12A3_000188" "g.56906333dup" "" "" "" "SLC12A3(NM_000339.3):c.923dupC (p.S309Ifs*2)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000893075" "0" "70" "16" "56906652" "56906652" "subst" "2.03041E-5" "02327" "SLC12A3_000189" "g.56906652C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000893076" "0" "90" "16" "56912074" "56912074" "subst" "2.87302E-5" "02326" "SLC12A3_000059" "g.56912074G>T" "" "" "" "SLC12A3(NM_000339.3):c.1180+1G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000893077" "0" "10" "16" "56914558" "56914558" "subst" "0" "02327" "SLC12A3_000190" "g.56914558A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000893078" "0" "30" "16" "56916390" "56916390" "subst" "0" "02326" "SLC12A3_000191" "g.56916390C>T" "" "" "" "SLC12A3(NM_000339.3):c.1650C>T (p.A550=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000893079" "0" "70" "16" "56920942" "56920965" "dup" "0" "02326" "SLC12A3_000087" "g.56920942_56920965dup" "" "" "" "SLC12A3(NM_000339.3):c.2115_2138dupCAAGGCCTTCTACTCGGATGTCAT (p.K706_I713dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000893080" "0" "50" "16" "56921862" "56921862" "subst" "8.12513E-6" "02327" "SLC12A3_000192" "g.56921862C>G" "" "" "" "SLC12A3(NM_000339.3):c.2204C>G (p.P735R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000914648" "0" "30" "16" "56904570" "56904570" "subst" "0.00136446" "02326" "SLC12A3_000193" "g.56904570C>T" "" "" "" "SLC12A3(NM_000339.3):c.774C>T (p.N258=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000914649" "0" "30" "16" "56913510" "56913510" "subst" "0.00407337" "02326" "SLC12A3_000194" "g.56913510C>A" "" "" "" "SLC12A3(NM_000339.3):c.1392C>A (p.A464=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000914651" "0" "70" "16" "56933468" "56933468" "subst" "4.46671E-5" "02327" "SLC12A3_000160" "g.56933468G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000926305" "0" "50" "16" "56906647" "56906647" "subst" "4.06072E-6" "02327" "SLC12A3_000195" "g.56906647C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000926306" "0" "90" "16" "56913000" "56913006" "dup" "0" "02326" "SLC12A3_000062" "g.56913000_56913006dup" "" "" "" "SLC12A3(NM_000339.3):c.1196_1202dupGTGATGC (p.S402*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000926307" "0" "70" "16" "56919195" "56919195" "subst" "0" "02326" "SLC12A3_000196" "g.56919195C>G" "" "" "" "SLC12A3(NM_000339.3):c.1844C>G (p.S615W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000926308" "0" "90" "16" "56919195" "56919195" "subst" "4.59173E-5" "02326" "SLC12A3_000143" "g.56919195C>T" "" "" "" "SLC12A3(NM_000339.3):c.1844C>T (p.S615L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000926309" "0" "70" "16" "56938376" "56938376" "subst" "0" "02326" "SLC12A3_000110" "g.56938376T>G" "" "" "" "SLC12A3(NM_000339.3):c.2951+2T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000933851" "0" "90" "16" "56900547" "56900598" "dup" "0" "00006" "SLC12A3_000197" "g.56900547_56900598dup" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "in vitro midigene splicing assay; suggested clinical classification variant “likely pathogenic\"" "In vitro (cloned)" "" "" "0" "" "" "g.56866635_56866686dup" "" "NA" "" "0000933852" "0" "10" "16" "56901737" "56901748" "del" "0" "00006" "SLC12A3_000198" "g.56901737_56901748del" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "in vitro midigene splicing assay; suggested clinical classification variant “likely benign\"" "In vitro (cloned)" "" "" "0" "" "" "g.56867825_56867836del" "" "NA" "" "0000933853" "0" "90" "16" "56903992" "56903992" "subst" "6.13457E-5" "00006" "SLC12A3_000044" "g.56903992G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "in vitro midigene splicing assay; suggested clinical classification variant “likely pathogenic\"" "In vitro (cloned)" "" "" "0" "" "" "g.56870080G>A" "" "NA" "" "0000933854" "0" "90" "16" "56903997" "56903997" "subst" "0" "00006" "SLC12A3_000199" "g.56903997T>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "in vitro midigene splicing assay; suggested clinical classification variant “likely pathogenic\"" "In vitro (cloned)" "" "" "0" "" "" "g.56870085T>A" "" "NA" "" "0000933855" "0" "90" "16" "56904891" "56904891" "subst" "0" "00006" "SLC12A3_000200" "g.56904891C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "in vitro midigene splicing assay; suggested clinical classification variant “likely pathogenic\"" "In vitro (cloned)" "" "" "0" "" "" "g.56870979C>T" "" "NA" "" "0000933856" "0" "90" "16" "56906702" "56906702" "subst" "0" "00006" "SLC12A3_000201" "g.56906702A>G" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "in vitro midigene splicing assay; suggested clinical classification variant “likely pathogenic\"" "In vitro (cloned)" "" "" "0" "" "" "g.56872790A>G" "" "NA" "" "0000933857" "0" "90" "16" "56914462" "56914462" "subst" "0" "00006" "SLC12A3_000202" "g.56914462T>G" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "in vitro midigene splicing assay; suggested clinical classification variant “likely pathogenic\"" "In vitro (cloned)" "" "" "0" "" "" "g.56880550T>G" "" "NA" "" "0000933858" "0" "90" "16" "56917770" "56917770" "subst" "0" "00006" "SLC12A3_000073" "g.56917770C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "in vitro midigene splicing assay; suggested clinical classification variant “pathogenic\"" "In vitro (cloned)" "" "" "0" "" "" "g.56883858C>T" "" "NA" "" "0000933859" "0" "90" "16" "56920474" "56920474" "subst" "0" "00006" "SLC12A3_000203" "g.56920474A>G" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "in vitro midigene splicing assay; suggested clinical classification variant “likely pathogenic\"" "In vitro (cloned)" "" "" "0" "" "" "g.56886562A>G" "" "NA" "" "0000933860" "0" "10" "16" "56924453" "56924453" "subst" "0" "00006" "SLC12A3_000204" "g.56924453C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "in vitro midigene splicing assay; suggested clinical classification variant “likely benign\"" "In vitro (cloned)" "" "" "0" "" "" "g.56890541C>T" "" "NA" "" "0000933861" "0" "10" "16" "56925804" "56925804" "subst" "0" "00006" "SLC12A3_000205" "g.56925804C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "in vitro midigene splicing assay; suggested clinical classification variant “likely benign\"" "In vitro (cloned)" "" "" "0" "" "" "g.56891892C>T" "" "NA" "" "0000933862" "0" "90" "16" "56926828" "56926846" "del" "0" "00006" "SLC12A3_000206" "g.56926828_56926846del" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "in vitro midigene splicing assay; suggested clinical classification variant “likely pathogenic\"" "In vitro (cloned)" "" "" "0" "" "" "g.56892916_56892934del" "" "NA" "" "0000933863" "0" "90" "16" "56927219" "56927219" "subst" "0" "00006" "SLC12A3_000095" "g.56927219C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "in vitro midigene splicing assay; suggested clinical classification variant “likely pathogenic\"" "In vitro (cloned)" "" "" "0" "" "" "g.56893307C>T" "" "NA" "" "0000933864" "0" "90" "16" "56927221" "56927221" "subst" "0" "00006" "SLC12A3_000207" "g.56927221G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "in vitro midigene splicing assay; suggested clinical classification variant “likely pathogenic\"" "In vitro (cloned)" "" "" "0" "" "" "g.56893309G>A" "" "NA" "" "0000933865" "0" "10" "16" "56928225" "56928228" "del" "0" "00006" "SLC12A3_000208" "g.56928225_56928228del" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "in vitro midigene splicing assay; suggested clinical classification variant “likely benign\"" "In vitro (cloned)" "" "" "0" "" "" "g.56894313_56894316del" "" "NA" "" "0000933866" "0" "50" "16" "56939199" "56939199" "subst" "0" "00006" "SLC12A3_000209" "g.56939199C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "in vitro midigene splicing assay; suggested clinical classification variant “VUS\"" "In vitro (cloned)" "" "" "0" "" "" "g.56905287C>T" "" "NA" "" "0000934137" "1" "90" "16" "56913505" "56913505" "subst" "2.84627E-5" "00006" "SLC12A3_000068" "g.56913505G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS3, PS4, PM1, PM2,PM5, PP3, PP5; variant missed by SSCA" "Germline" "" "" "0" "" "" "g.56879593G>A" "" "pathogenic (recessive)" "ACMG" "0000934138" "1" "90" "16" "56936421" "56936421" "subst" "0.000227853" "00006" "SLC12A3_000029" "g.56936421G>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PVS1, PS4, PM1, PM2, PM3" "Germline" "" "" "0" "" "" "g.56902509G>T" "" "pathogenic (recessive)" "ACMG" "0000934139" "1" "90" "16" "56899384" "56899385" "dup" "0" "00006" "SLC12A3_000038" "g.56899384_56899385dup" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PVS1, PS4, PM1, PM2, PM3, PP5" "Germline" "" "" "0" "" "" "g.56865472_56865473dup" "" "pathogenic (recessive)" "ACMG" "0000934140" "1" "90" "16" "56928475" "56928475" "subst" "9.75697E-5" "00006" "SLC12A3_000102" "g.56928475C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS3, PS4, PM1, PM3, PM5, PP3, PP5" "Germline" "" "" "0" "" "" "g.56894563C>T" "" "pathogenic (recessive)" "ACMG" "0000934141" "1" "90" "16" "56928475" "56928475" "subst" "9.75697E-5" "00006" "SLC12A3_000102" "g.56928475C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS3, PS4, PM1, PM3, PM5, PP3, PP5" "Germline" "" "" "0" "" "" "g.56894563C>T" "" "pathogenic (recessive)" "ACMG" "0000934142" "1" "90" "16" "56947205" "56947205" "subst" "0.000199137" "00006" "SLC12A3_000112" "g.56947205G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS4, PS3, PM1, PM2, PM3, PP3, PP5" "Germline" "" "" "0" "" "" "g.56913293G>A" "" "pathogenic (recessive)" "ACMG" "0000934143" "1" "90" "16" "56913119" "56913119" "subst" "0.000158716" "00006" "SLC12A3_000002" "g.56913119G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PM1, PM2, PM3, PP3, PP5" "Germline" "" "" "0" "" "" "g.56879207G>A" "" "pathogenic (recessive)" "ACMG" "0000934144" "1" "90" "16" "56913505" "56913505" "subst" "2.84627E-5" "00006" "SLC12A3_000068" "g.56913505G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS3, PS4, PM1, PM2,PM5, PP3, PP5" "Germline" "" "" "0" "" "" "g.56879593G>A" "" "pathogenic (recessive)" "ACMG" "0000934145" "1" "90" "16" "56936421" "56936421" "subst" "0.000227853" "00006" "SLC12A3_000029" "g.56936421G>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PVS1, PS4, PM1, PM2, PM3" "Germline" "" "" "0" "" "" "g.56902509G>T" "" "pathogenic (recessive)" "ACMG" "0000934146" "1" "90" "16" "56902252" "56902252" "subst" "0" "00006" "SLC12A3_000127" "g.56902252G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS4, PM2, PM3, PM5, PP3, PP5" "Germline" "" "" "0" "" "" "g.56868340G>A" "" "pathogenic (recessive)" "ACMG" "0000934147" "1" "90" "16" "56913119" "56913119" "subst" "0.000158716" "00006" "SLC12A3_000002" "g.56913119G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PM1, PM2, PM3, PP3, PP5" "Germline" "" "" "0" "" "" "g.56879207G>A" "" "pathogenic (recessive)" "ACMG" "0000934148" "1" "90" "16" "56936283" "56936283" "subst" "0" "00006" "SLC12A3_000245" "g.56936283A>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PVS1, PS4, PM2, PP3, PP5" "Germline" "" "" "0" "" "" "g.56902371A>T" "" "pathogenic (recessive)" "ACMG" "0000934149" "1" "90" "16" "56899148" "56899148" "subst" "4.10061E-6" "00006" "SLC12A3_000210" "g.56899148A>G" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PVS1, PS1, PM1, PM2, PM5" "Germline" "" "" "0" "" "" "g.56865236A>G" "" "pathogenic (recessive)" "ACMG" "0000934150" "1" "90" "16" "56919275" "56919275" "subst" "2.64002E-5" "00006" "SLC12A3_000079" "g.56919275C>G" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS4, PM1, PM2, PM3, PM5, PP3, PP5" "Germline" "" "" "0" "" "" "g.56885363C>G" "" "pathogenic (recessive)" "ACMG" "0000934151" "1" "90" "16" "56928475" "56928475" "subst" "9.75697E-5" "00006" "SLC12A3_000102" "g.56928475C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS3, PS4, PM1, PM3, PM5, PP3, PP5" "Germline" "" "" "0" "" "" "g.56894563C>T" "" "pathogenic (recessive)" "ACMG" "0000934152" "1" "70" "16" "56906348" "56906348" "subst" "2.0313E-5" "00006" "SLC12A3_000225" "g.56906348C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS4, PM1, PM2, PP5" "Germline" "" "" "0" "" "" "g.56872436C>T" "" "likely pathogenic (recessive)" "ACMG" "0000934153" "1" "70" "16" "56906348" "56906348" "subst" "2.0313E-5" "00006" "SLC12A3_000225" "g.56906348C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS4, PM1, PM2, PP5" "Germline" "" "" "0" "" "" "g.56872436C>T" "" "likely pathogenic (recessive)" "ACMG" "0000934154" "1" "70" "16" "56926966" "56926966" "subst" "0" "00006" "SLC12A3_000093" "g.56926966G>C" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PVS1, PM1, PM2, PM3, PP5" "Germline" "" "" "0" "" "" "g.56893054G>C" "" "likely pathogenic (recessive)" "ACMG" "0000934155" "1" "70" "16" "56938322" "56938322" "subst" "0" "00006" "SLC12A3_000248" "g.56938322A>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PM1, PM2, PM5, PP3" "Germline" "" "" "0" "" "" "g.56904410A>T" "" "likely pathogenic (recessive)" "ACMG" "0000934156" "1" "70" "16" "56912068" "56912068" "subst" "1.22811E-5" "00006" "SLC12A3_000058" "g.56912068C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS4, PM1, PM2, PP5" "Germline" "" "" "0" "" "" "g.56878156C>T" "" "likely pathogenic (recessive)" "ACMG" "0000934157" "1" "70" "16" "56920314" "56920314" "subst" "7.72578E-5" "00006" "SLC12A3_000082" "g.56920314G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS4, PM1, PM2, PM5, PP3, PP5" "Germline" "" "" "0" "" "" "g.56886402G>A" "" "likely pathogenic (recessive)" "ACMG" "0000934158" "0" "90" "16" "56912074" "56912074" "subst" "2.87302E-5" "00006" "SLC12A3_000059" "g.56912074G>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS4, PM1, PM2, PM3, PP3, PP5" "Germline" "" "" "0" "" "" "g.56878162G>T" "" "pathogenic (recessive)" "ACMG" "0000934159" "0" "90" "16" "56928475" "56928475" "subst" "9.75697E-5" "00006" "SLC12A3_000102" "g.56928475C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS3, PS4, PM1, PM3, PM5, PP3, PP5" "Germline" "" "" "0" "" "" "g.56894563C>T" "" "pathogenic (recessive)" "ACMG" "0000934160" "0" "90" "16" "56947205" "56947205" "subst" "0.000199137" "00006" "SLC12A3_000112" "g.56947205G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS4, PS3, PM1, PM2, PM3, PP3, PP5" "Germline" "" "" "0" "" "" "g.56913293G>A" "" "pathogenic (recessive)" "ACMG" "0000934161" "0" "90" "16" "56947205" "56947205" "subst" "0.000199137" "00006" "SLC12A3_000112" "g.56947205G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS4, PS3, PM1, PM2, PM3, PP3, PP5" "Germline" "" "" "0" "" "" "g.56913293G>A" "" "pathogenic (recessive)" "ACMG" "0000934162" "0" "90" "16" "56947205" "56947205" "subst" "0.000199137" "00006" "SLC12A3_000112" "g.56947205G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS4, PS3, PM1, PM2, PM3, PP3, PP5" "Germline" "" "" "0" "" "" "g.56913293G>A" "" "pathogenic (recessive)" "ACMG" "0000934163" "0" "90" "16" "56947205" "56947205" "subst" "0.000199137" "00006" "SLC12A3_000112" "g.56947205G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS4, PS3, PM1, PM2, PM3, PP3, PP5" "Germline" "" "" "0" "" "" "g.56913293G>A" "" "pathogenic (recessive)" "ACMG" "0000934164" "0" "90" "16" "56947205" "56947205" "subst" "0.000199137" "00006" "SLC12A3_000112" "g.56947205G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS4, PS3, PM1, PM2, PM3, PP3, PP5" "Germline" "" "" "0" "" "" "g.56913293G>A" "" "pathogenic (recessive)" "ACMG" "0000934165" "0" "90" "16" "56913119" "56913119" "subst" "0.000158716" "00006" "SLC12A3_000002" "g.56913119G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PM1, PM2, PM3, PP3, PP5" "Germline" "" "" "0" "" "" "g.56879207G>A" "" "pathogenic (recessive)" "ACMG" "0000934166" "0" "90" "16" "56928470" "56928470" "subst" "0.000121976" "00006" "SLC12A3_000101" "g.56928470T>C" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS3, PS4, PM2, PM3, PP3, PP5" "Germline" "" "" "0" "" "" "g.56894558T>C" "" "pathogenic (recessive)" "ACMG" "0000934167" "0" "90" "16" "56928470" "56928470" "subst" "0.000121976" "00006" "SLC12A3_000101" "g.56928470T>C" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS3, PS4, PM2, PM3, PP3, PP5" "Germline" "" "" "0" "" "" "g.56894558T>C" "" "pathogenic (recessive)" "ACMG" "0000934168" "0" "90" "16" "56899348" "56899348" "subst" "0" "00006" "SLC12A3_000215" "g.56899348T>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PVS1, PM1, PM2" "Germline" "" "" "0" "" "" "g.56865436T>A" "" "pathogenic (recessive)" "ACMG" "0000934169" "0" "90" "16" "56947175" "56949762" "del" "0" "00006" "SLC12A3_000250" "g.(56938375_56947175)_(56949762_?)del" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "del ex26" "" "Germline" "" "" "0" "" "" "g.(56904463_56913263)_(56915850_?)del" "" "pathogenic (recessive)" "" "0000934170" "0" "90" "16" "56947205" "56947205" "subst" "0.000199137" "00006" "SLC12A3_000112" "g.56947205G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS4, PS3, PM1, PM2, PM3, PP3, PP5" "Germline" "" "" "0" "" "" "g.56913293G>A" "" "pathogenic (recessive)" "ACMG" "0000934171" "0" "90" "16" "56921849" "56921849" "subst" "2.03174E-5" "00006" "SLC12A3_000091" "g.56921849G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS3, PS4, PM1, PM2, PM3, PP3, PP5" "Germline" "" "" "0" "" "" "g.56887937G>A" "" "pathogenic (recessive)" "ACMG" "0000934172" "0" "90" "16" "56947189" "56947189" "subst" "5.28954E-5" "00006" "SLC12A3_000034" "g.56947189G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS3, PS4, PM1, PM2, PM3, PP1, PP5" "Germline" "" "" "0" "" "" "g.56913277G>A" "" "pathogenic (recessive)" "ACMG" "0000934173" "0" "90" "16" "56947189" "56947189" "subst" "5.28954E-5" "00006" "SLC12A3_000034" "g.56947189G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS3, PS4, PM1, PM2, PM3, PP1, PP5; variant missed by SSCA" "Germline" "" "" "0" "" "" "g.56913277G>A" "" "pathogenic (recessive)" "ACMG" "0000934174" "0" "90" "16" "56928470" "56928470" "subst" "0.000121976" "00006" "SLC12A3_000101" "g.56928470T>C" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS3, PS4, PM2, PM3, PP3, PP5" "Germline" "" "" "0" "" "" "g.56894558T>C" "" "pathogenic (recessive)" "ACMG" "0000934175" "0" "90" "16" "56928475" "56928475" "subst" "9.75697E-5" "00006" "SLC12A3_000102" "g.56928475C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS3, PS4, PM1, PM3, PM5, PP3, PP5" "Germline" "" "" "0" "" "" "g.56894563C>T" "" "pathogenic (recessive)" "ACMG" "0000934176" "0" "90" "16" "56947205" "56947205" "subst" "0.000199137" "00006" "SLC12A3_000112" "g.56947205G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS4, PS3, PM1, PM2, PM3, PP3, PP5" "Germline" "" "" "0" "" "" "g.56913293G>A" "" "pathogenic (recessive)" "ACMG" "0000934177" "0" "90" "16" "56928470" "56928470" "subst" "0.000121976" "00006" "SLC12A3_000101" "g.56928470T>C" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS3, PS4, PM2, PM3, PP3, PP5" "Germline" "" "" "0" "" "" "g.56894558T>C" "" "pathogenic (recessive)" "ACMG" "0000934178" "0" "90" "16" "56947205" "56947205" "subst" "0.000199137" "00006" "SLC12A3_000112" "g.56947205G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS4, PS3, PM1, PM2, PM3, PP3, PP5" "Germline" "" "" "0" "" "" "g.56913293G>A" "" "pathogenic (recessive)" "ACMG" "0000934179" "0" "70" "16" "56914040" "56914060" "dup" "0" "00006" "SLC12A3_000070" "g.56914040_56914060dup" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PM1, PM2, PM4" "Germline" "" "" "0" "" "" "g.56880128_56880148dup" "" "likely pathogenic (recessive)" "ACMG" "0000934180" "1" "90" "16" "56921879" "56921879" "subst" "0.000381838" "00006" "SLC12A3_000092" "g.56921879G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS3, PS4, PM1, PM2, PM3, PP3, PP5" "Germline" "" "" "0" "" "" "g.56887967G>A" "" "pathogenic (recessive)" "ACMG" "0000934181" "0" "70" "16" "56913506" "56913506" "subst" "4.06517E-6" "00006" "SLC12A3_000230" "g.56913506G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PM1, PM2, PM5, PP3, PP5" "Germline" "" "" "0" "" "" "g.56879594G>A" "" "likely pathogenic (recessive)" "ACMG" "0000934182" "0" "70" "16" "56904077" "56904077" "subst" "0" "00006" "SLC12A3_000221" "g.56904077C>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PM1, PM2, PP3, PP5" "Germline" "" "" "0" "" "" "g.56870165C>A" "" "likely pathogenic (recessive)" "ACMG" "0000934183" "0" "90" "16" "56921879" "56921879" "subst" "0.000381838" "00006" "SLC12A3_000092" "g.56921879G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS3, PS4, PM1, PM2, PM3, PP3, PP5" "Germline" "" "" "0" "" "" "g.56887967G>A" "" "pathogenic (recessive)" "ACMG" "0000934184" "0" "90" "16" "56928470" "56928470" "subst" "0.000121976" "00006" "SLC12A3_000101" "g.56928470T>C" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS3, PS4, PM2, PM3, PP3, PP5" "Germline" "" "" "0" "" "" "g.56894558T>C" "" "pathogenic (recessive)" "ACMG" "0000934185" "0" "70" "16" "56920314" "56920314" "subst" "7.72578E-5" "00006" "SLC12A3_000082" "g.56920314G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS4, PM1, PM2, PM5, PP3, PP5" "Germline" "" "" "0" "" "" "g.56886402G>A" "" "likely pathogenic (recessive)" "ACMG" "0000934186" "1" "70" "16" "56913508" "56913508" "subst" "1.21989E-5" "00006" "SLC12A3_000231" "g.56913508G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS4, PM1, PM2, PP3, PP5" "Germline" "" "" "0" "" "" "g.56879596G>A" "" "likely pathogenic (recessive)" "ACMG" "0000934187" "0" "90" "16" "56947205" "56947205" "subst" "0.000199137" "00006" "SLC12A3_000112" "g.56947205G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS4, PS3, PM1, PM2, PM3, PP3, PP5" "Germline" "" "" "0" "" "" "g.56913293G>A" "" "pathogenic (recessive)" "ACMG" "0000934188" "0" "70" "16" "56899307" "56899307" "subst" "2.84271E-5" "00006" "SLC12A3_000213" "g.56899307C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PM1, PM2, PP3, PP5, PM3" "Germline" "" "" "0" "" "" "g.56865395C>T" "" "likely pathogenic (recessive)" "ACMG" "0000934189" "0" "90" "16" "56916307" "56916307" "subst" "1.21827E-5" "00006" "SLC12A3_000234" "g.56916307G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PVS1, PM1, PM2, PM3, PP5" "Germline" "" "" "0" "" "" "g.56882395G>A" "" "pathogenic (recessive)" "ACMG" "0000934190" "0" "90" "16" "56920388" "56920388" "subst" "1.62848E-5" "00006" "SLC12A3_000085" "g.56920388G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PVS1, PM1, PM2, PP3" "Germline" "" "" "0" "" "" "g.56886476G>A" "" "pathogenic (recessive)" "ACMG" "0000934191" "0" "90" "16" "56899150" "56899150" "subst" "0" "00006" "SLC12A3_000211" "g.56899150G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PVS1, PS1, PM1, PM2, PM5" "Germline" "" "" "0" "" "" "g.56865238G>A" "" "pathogenic (recessive)" "ACMG" "0000934192" "0" "90" "16" "56899394" "56899394" "subst" "2.8497E-5" "00006" "SLC12A3_000179" "g.56899394C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS3, PM1, PM2, PP3, PP5, PM3" "Germline" "" "" "0" "" "" "g.56865482C>T" "" "pathogenic (recessive)" "ACMG" "0000934193" "0" "90" "16" "56947205" "56947205" "subst" "0.000199137" "00006" "SLC12A3_000112" "g.56947205G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS4, PS3, PM1, PM2, PM3, PP3, PP5" "Germline" "" "" "0" "" "" "g.56913293G>A" "" "pathogenic (recessive)" "ACMG" "0000934194" "0" "90" "16" "56920280" "56920280" "del" "0" "00006" "SLC12A3_000080" "g.56920280del" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PVS1, PS4, PM1, PM2, PM3, PM4, PP5" "Germline" "" "" "0" "" "" "g.56886368del" "" "pathogenic (recessive)" "ACMG" "0000934195" "0" "90" "16" "56947189" "56947189" "subst" "5.28954E-5" "00006" "SLC12A3_000034" "g.56947189G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS3, PS4, PM1, PM2, PM3, PP1, PP5" "Germline" "" "" "0" "" "" "g.56913277G>A" "" "pathogenic (recessive)" "ACMG" "0000934196" "0" "90" "16" "56933471" "56933471" "subst" "0" "00006" "SLC12A3_000244" "g.56933471T>C" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS4, PM1, PM2,PM5, PP3, PP5" "Germline" "" "" "0" "" "" "g.56899559T>C" "" "pathogenic (recessive)" "ACMG" "0000934197" "0" "90" "16" "56913000" "56913006" "dup" "0" "00006" "SLC12A3_000062" "g.56913000_56913006dup" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PVS1, PM1, PM2, PM4, PP5" "Germline" "" "" "0" "" "" "g.56879088_56879094dup" "" "pathogenic (recessive)" "ACMG" "0000934198" "0" "90" "16" "56916404" "56916404" "subst" "6.49783E-5" "00006" "SLC12A3_000017" "g.56916404C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS3, PS4, PM1, PM2, PP3, PP5" "Germline" "" "" "0" "" "" "g.56882492C>T" "" "pathogenic (recessive)" "ACMG" "0000934199" "0" "90" "16" "56936381" "56936381" "subst" "0" "00006" "SLC12A3_000247" "g.56936381G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PVS1, PS1, PM1, PM2" "Germline" "" "" "0" "" "" "g.56902469G>A" "" "pathogenic (recessive)" "ACMG" "0000934200" "0" "70" "16" "56906348" "56906348" "subst" "2.0313E-5" "00006" "SLC12A3_000225" "g.56906348C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS4, PM1, PM2, PP5" "Germline" "" "" "0" "" "" "g.56872436C>T" "" "likely pathogenic (recessive)" "ACMG" "0000934201" "0" "70" "16" "56913508" "56913508" "subst" "1.21989E-5" "00006" "SLC12A3_000231" "g.56913508G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS4, PM1, PM2, PP3, PP5" "Germline" "" "" "0" "" "" "g.56879596G>A" "" "likely pathogenic (recessive)" "ACMG" "0000934202" "0" "70" "16" "56904008" "56904008" "subst" "0" "00006" "SLC12A3_000220" "g.56904008G>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PM1, PM2, PP3, PP5" "Germline" "" "" "0" "" "" "g.56870096G>T" "" "likely pathogenic (recessive)" "ACMG" "0000934203" "0" "70" "16" "56920278" "56920278" "subst" "0.000175477" "00006" "SLC12A3_000020" "g.56920278C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS4, PM1, PM2, PM3, PP3, PP5" "Germline" "" "" "0" "" "" "g.56886366C>T" "" "likely pathogenic (recessive)" "ACMG" "0000934204" "0" "70" "16" "56903649" "56903649" "subst" "4.06197E-6" "00006" "SLC12A3_000042" "g.56903649T>C" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS4, PM1, PM2, PM3, PP5" "Germline" "" "" "0" "" "" "g.56869737T>C" "" "likely pathogenic (recessive)" "ACMG" "0000934205" "1" "50" "16" "56913467" "56913467" "subst" "0" "00006" "SLC12A3_000229" "g.56913467T>G" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PM1, PM2, PP3" "Germline" "" "" "0" "" "" "g.56879555T>G" "" "VUS" "ACMG" "0000934206" "0" "50" "16" "56906568" "56906568" "subst" "0.00172181" "00006" "SLC12A3_000118" "g.56906568C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PM1, PM2, BS2, BP2" "Germline" "" "" "0" "" "" "g.56872656C>T" "" "VUS" "ACMG" "0000934207" "0" "50" "16" "56916388" "56916388" "subst" "0.000194921" "00006" "SLC12A3_000235" "g.56916388G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PM1, PM2, PP3" "Germline" "" "" "0" "" "" "g.56882476G>A" "" "VUS" "ACMG" "0000934208" "0" "50" "16" "56936310" "56936310" "subst" "0" "00006" "SLC12A3_000246" "g.56936310G>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PM2" "Germline" "" "" "0" "" "" "g.56902398G>T" "" "VUS" "ACMG" "0000934209" "0" "50" "16" "56904133" "56904133" "subst" "1.63046E-5" "00006" "SLC12A3_000222" "g.56904133C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PM1, PM2" "Germline" "" "" "0" "" "" "g.56870221C>T" "" "VUS" "ACMG" "0000934210" "0" "50" "16" "56901033" "56901033" "subst" "9.36192E-5" "00006" "SLC12A3_000216" "g.56901033G>C" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PM1, PM2" "Germline" "" "" "0" "" "" "g.56867121G>C" "" "VUS" "ACMG" "0000934211" "0" "50" "16" "56904587" "56904587" "subst" "0" "00006" "SLC12A3_000223" "g.56904587C>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PM2, BP4" "Germline" "" "" "0" "" "" "g.56870675C>A" "" "VUS" "ACMG" "0000934212" "0" "50" "16" "56924236" "56924236" "subst" "4.06068E-6" "00006" "SLC12A3_000241" "g.56924236G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PM2" "Germline" "" "" "0" "" "" "g.56890324G>A" "" "VUS" "ACMG" "0000934213" "0" "50" "16" "56906297" "56906297" "subst" "0" "00006" "SLC12A3_000224" "g.56906297C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PM1, PM2, PP3" "Germline" "" "" "0" "" "" "g.56872385C>T" "" "VUS" "ACMG" "0000934214" "0" "50" "16" "56947307" "56947307" "subst" "0" "00006" "SLC12A3_000251" "g.56947307A>G" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PM2, PP3" "Germline" "" "" "0" "" "" "g.56913395A>G" "" "VUS" "ACMG" "0000934215" "0" "30" "16" "56924453" "56924453" "subst" "0" "00006" "SLC12A3_000204" "g.56924453C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG BS3, PM2; effect on splicing predicted from midi-gene splicing assay" "Germline" "" "" "0" "" "" "g.56890541C>T" "" "likely benign" "ACMG" "0000934216" "0" "90" "16" "56928475" "56928475" "subst" "9.75697E-5" "00006" "SLC12A3_000102" "g.56928475C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS3, PS4, PM1, PM3, PM5, PP3, PP5" "Germline" "" "" "0" "" "" "g.56894563C>T" "" "pathogenic (recessive)" "ACMG" "0000934217" "0" "70" "16" "56906357" "56906357" "subst" "1.62549E-5" "00006" "SLC12A3_000141" "g.56906357G>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "" "Germline" "" "" "0" "" "" "g.56872445G>T" "" "likely pathogenic (recessive)" "" "0000934218" "0" "90" "16" "56928475" "56928475" "subst" "9.75697E-5" "00006" "SLC12A3_000102" "g.56928475C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS3, PS4, PM1, PM3, PM5, PP3, PP5" "Germline" "" "" "0" "" "" "g.56894563C>T" "" "pathogenic (recessive)" "ACMG" "0000934219" "0" "90" "16" "56899394" "56899394" "subst" "2.8497E-5" "00006" "SLC12A3_000179" "g.56899394C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS3, PM1, PM2, PP3, PP5, PM3" "Germline" "" "" "0" "" "" "g.56865482C>T" "" "pathogenic (recessive)" "ACMG" "0000934220" "0" "50" "16" "56913467" "56913467" "subst" "0" "00006" "SLC12A3_000229" "g.56913467T>G" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PM1, PM2, PP3" "Germline" "" "" "0" "" "" "g.56879555T>G" "" "VUS" "ACMG" "0000934221" "0" "90" "16" "56947205" "56947205" "subst" "0.000199137" "00006" "SLC12A3_000112" "g.56947205G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS4, PS3, PM1, PM2, PM3, PP3, PP5" "Germline" "" "" "0" "" "" "g.56913293G>A" "" "pathogenic (recessive)" "ACMG" "0000934222" "0" "90" "16" "56920280" "56920280" "del" "0" "00006" "SLC12A3_000080" "g.56920280del" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PVS1, PS4, PM1, PM2, PM3, PM4, PP5" "Germline" "" "" "0" "" "" "g.56886368del" "" "pathogenic (recessive)" "ACMG" "0000934223" "0" "90" "16" "56928475" "56928475" "subst" "9.75697E-5" "00006" "SLC12A3_000102" "g.56928475C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS3, PS4, PM1, PM3, PM5, PP3, PP5" "Germline" "" "" "0" "" "" "g.56894563C>T" "" "pathogenic (recessive)" "ACMG" "0000934224" "0" "50" "16" "56919183" "56919183" "subst" "0" "00006" "SLC12A3_000238" "g.56919183A>G" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "" "Germline" "" "" "0" "" "" "g.56885271A>G" "" "VUS" "" "0000934225" "0" "50" "16" "56914075" "56914075" "subst" "2.62089E-5" "00006" "SLC12A3_000232" "g.56914075G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "" "Germline" "" "" "0" "" "" "g.56880163G>A" "" "VUS" "" "0000934226" "0" "70" "16" "56899331" "56899331" "subst" "0" "00006" "SLC12A3_000214" "g.56899331G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "" "Germline" "" "" "0" "" "" "g.56865419G>A" "" "likely pathogenic (recessive)" "" "0000934227" "0" "90" "16" "56947205" "56947205" "subst" "0.000199137" "00006" "SLC12A3_000112" "g.56947205G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS4, PS3, PM1, PM2, PM3, PP3, PP5" "Germline" "" "" "0" "" "" "g.56913293G>A" "" "pathogenic (recessive)" "ACMG" "0000934228" "0" "70" "16" "56902242" "56902242" "subst" "8.14319E-6" "00006" "SLC12A3_000218" "g.56902242C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "" "Germline" "" "" "0" "" "" "g.56868330C>T" "" "likely pathogenic (recessive)" "" "0000934229" "0" "50" "16" "56924229" "56924229" "subst" "2.84257E-5" "00006" "SLC12A3_000240" "g.56924229C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "" "Germline" "" "" "0" "" "" "g.56890317C>T" "" "VUS" "" "0000934230" "0" "50" "16" "56914084" "56914084" "subst" "2.21991E-5" "00006" "SLC12A3_000233" "g.56914084G>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "" "Germline" "" "" "0" "" "" "g.56880172G>T" "" "VUS" "" "0000934231" "1" "90" "16" "56918096" "56918097" "del" "0" "00006" "SLC12A3_000237" "g.56918096_56918097del" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "1805_1806del;2660+1G>A" "" "Germline" "" "" "0" "" "" "g.56884184_56884185del" "" "pathogenic (recessive)" "" "0000934232" "0" "90" "16" "56928470" "56928470" "subst" "0.000121976" "00006" "SLC12A3_000101" "g.56928470T>C" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS3, PS4, PM2, PM3, PP3, PP5" "Germline" "" "" "0" "" "" "g.56894558T>C" "" "pathogenic (recessive)" "ACMG" "0000934233" "0" "90" "16" "56928470" "56928470" "subst" "0.000121976" "00006" "SLC12A3_000101" "g.56928470T>C" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS3, PS4, PM2, PM3, PP3, PP5" "Germline" "" "" "0" "" "" "g.56894558T>C" "" "pathogenic (recessive)" "ACMG" "0000934234" "0" "70" "16" "56904611" "56904611" "subst" "1.62459E-5" "00006" "SLC12A3_000009" "g.56904611T>C" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "p.Leu272Pro" "" "Germline" "" "" "0" "" "" "g.56870699T>C" "" "likely pathogenic (recessive)" "" "0000934235" "0" "90" "16" "56919276" "56919276" "subst" "0" "00006" "SLC12A3_000239" "g.56919276G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "p.Arg642His" "ACMG PS4,PM1, PM2, PM5,PP3, PP5" "Germline" "" "" "0" "" "" "g.56885364G>A" "" "pathogenic (recessive)" "ACMG" "0000934236" "0" "90" "16" "56928470" "56928470" "subst" "0.000121976" "00006" "SLC12A3_000101" "g.56928470T>C" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "p.Leu859Pro" "ACMG PS3, PS4, PM2, PM3, PP3, PP5" "Germline" "" "" "0" "" "" "g.56894558T>C" "" "pathogenic (recessive)" "ACMG" "0000934237" "0" "90" "16" "56913119" "56913119" "subst" "0.000158716" "00006" "SLC12A3_000002" "g.56913119G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "p.Gly439Ser" "ACMG PM1, PM2, PM3, PP3, PP5" "Germline" "" "" "0" "" "" "g.56879207G>A" "" "pathogenic (recessive)" "ACMG" "0000934238" "0" "50" "16" "56926915" "56926915" "subst" "0.000374084" "00006" "SLC12A3_000137" "g.56926915T>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "p.Ser833Thr" "" "Germline" "" "" "0" "" "" "g.56893003T>A" "" "VUS" "" "0000934239" "2" "70" "16" "56903692" "56903692" "subst" "8.12361E-6" "00006" "SLC12A3_000219" "g.56903692G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PM1, PM2, PM3, PP5" "Germline" "" "" "0" "" "" "g.56869780G>A" "" "likely pathogenic (recessive)" "ACMG" "0000934240" "2" "90" "16" "56899394" "56899394" "subst" "2.8497E-5" "00006" "SLC12A3_000179" "g.56899394C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS3, PM1, PM2, PP3, PP5, PM3" "Germline" "" "" "0" "" "" "g.56865482C>T" "" "pathogenic (recessive)" "ACMG" "0000934241" "2" "90" "16" "56904031" "56904031" "subst" "1.21977E-5" "00006" "SLC12A3_000045" "g.56904031C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS4, PM1, PM2, PM3, PP3: initially reported as 625C>A" "Germline" "" "" "0" "" "" "g.56870119C>T" "" "pathogenic (recessive)" "ACMG" "0000934242" "2" "90" "16" "56911449" "56912638" "del" "0" "00006" "SLC12A3_000227" "g.56911449_56912638del" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PVS1, PM2, PM3" "Germline" "" "" "0" "" "" "g.56877537_56878726del" "" "pathogenic (recessive)" "ACMG" "0000934243" "2" "90" "16" "56928555" "56928555" "subst" "8.13392E-6" "00006" "SLC12A3_000142" "g.56928555G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PVS1, PS4, PM2, PM3, PP1, PP3, PP5" "Germline" "" "" "0" "" "" "g.56894643G>A" "" "pathogenic (recessive)" "ACMG" "0000934244" "2" "90" "16" "56936421" "56936421" "subst" "0.000227853" "00006" "SLC12A3_000029" "g.56936421G>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PVS1, PS4, PM1, PM2, PM3" "Germline" "" "" "0" "" "" "g.56902509G>T" "" "pathogenic (recessive)" "ACMG" "0000934245" "2" "90" "16" "56917978" "56917978" "subst" "0" "00006" "SLC12A3_000236" "g.56917978C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PVS1, PM2, PM3, PM4, PP1; variant missed by SSCA" "Germline" "" "" "0" "" "" "g.56884066C>T" "" "pathogenic (recessive)" "ACMG" "0000934246" "2" "90" "16" "56899326" "56899326" "subst" "6.09137E-5" "00006" "SLC12A3_000036" "g.56899326C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS3, PS4, PM2, PP3, PP5; variant missed by SSCA" "Germline" "" "" "0" "" "" "g.56865414C>T" "" "pathogenic (recessive)" "ACMG" "0000934247" "2" "90" "16" "56917770" "56917770" "subst" "0" "00006" "SLC12A3_000073" "g.56917770C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS4, PS3, PM2, PM3, PP3, PP5; effect on splicing predicted from midi-gene splicing assay" "Germline" "" "" "0" "" "" "g.56883858C>T" "" "pathogenic (recessive)" "ACMG" "0000934248" "2" "90" "16" "56917770" "56917770" "subst" "0" "00006" "SLC12A3_000073" "g.56917770C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS4, PS3, PM2, PM3, PP3, PP5; effect on splicing predicted from midi-gene splicing assay" "Germline" "" "" "0" "" "" "g.56883858C>T" "" "pathogenic (recessive)" "ACMG" "0000934249" "2" "90" "16" "56904050" "56904050" "subst" "8.12579E-6" "00006" "SLC12A3_000138" "g.56904050T>C" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS3, PS4, PM2, PM3, PP3, PP5; variant missed by SSCA" "Germline" "" "" "0" "" "" "g.56870138T>C" "" "pathogenic (recessive)" "ACMG" "0000934250" "2" "70" "16" "56906348" "56906348" "subst" "2.0313E-5" "00006" "SLC12A3_000225" "g.56906348C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS4, PM1, PM2, PP5" "Germline" "" "" "0" "" "" "g.56872436C>T" "" "likely pathogenic (recessive)" "ACMG" "0000934251" "2" "90" "16" "56903992" "56903992" "subst" "6.13457E-5" "00006" "SLC12A3_000044" "g.56903992G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS3, PM2, PM3, PP3, PP5; effect on splicing predicted from midi-gene splicing assay" "Germline" "" "" "0" "" "" "g.56870080G>A" "" "pathogenic (recessive)" "ACMG" "0000934252" "2" "70" "16" "56928520" "56928520" "subst" "8.12407E-5" "00006" "SLC12A3_000242" "g.56928520G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PM1, PM2, PM3, PP5; variant missed by SSCA" "Germline" "" "" "0" "" "" "g.56894608G>A" "" "likely pathogenic (recessive)" "ACMG" "0000934253" "2" "70" "16" "56926828" "56926846" "del" "0" "00006" "SLC12A3_000206" "g.56926828_56926846del" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS3, PM2, PM3; effect on splicing predicted from midi-gene splicing assay" "Germline" "" "" "0" "" "" "g.56892916_56892934del" "" "likely pathogenic (recessive)" "ACMG" "0000934254" "2" "90" "16" "56917770" "56917770" "subst" "0" "00006" "SLC12A3_000073" "g.56917770C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS4, PS3, PM2, PM3, PP3, PP5; effect on splicing predicted from midi-gene splicing assay" "Germline" "" "" "0" "" "" "g.56883858C>T" "" "pathogenic (recessive)" "ACMG" "0000934255" "2" "90" "16" "56917770" "56917770" "subst" "0" "00006" "SLC12A3_000073" "g.56917770C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS4, PS3, PM2, PM3, PP3, PP5; effect on splicing predicted from midi-gene splicing assay" "Germline" "" "" "0" "" "" "g.56883858C>T" "" "pathogenic (recessive)" "ACMG" "0000934256" "2" "70" "16" "56900547" "56900598" "dup" "0" "00006" "SLC12A3_000197" "g.56900547_56900598dup" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS3, PM2, PM3; effect on splicing predicted from midi-gene splicing assay" "Germline" "" "" "0" "" "" "g.56866635_56866686dup" "" "likely pathogenic (recessive)" "ACMG" "0000934257" "2" "70" "16" "56936420" "56936420" "subst" "0" "00006" "SLC12A3_000124" "g.56936420G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PM1, PM2, PM3, PP3, PP5" "Germline" "" "" "0" "" "" "g.56902508G>A" "" "likely pathogenic (recessive)" "ACMG" "0000934258" "2" "70" "16" "56936420" "56936420" "subst" "0" "00006" "SLC12A3_000124" "g.56936420G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PM1, PM2, PM3, PP3, PP5" "Germline" "" "" "0" "" "" "g.56902508G>A" "" "likely pathogenic (recessive)" "ACMG" "0000934259" "2" "70" "16" "56899218" "56899218" "subst" "2.43863E-5" "00006" "SLC12A3_000212" "g.56899218C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PM1, PM2, PM3, BP4" "Germline" "" "" "0" "" "" "g.56865306C>T" "" "likely pathogenic (recessive)" "ACMG" "0000934260" "0" "90" "16" "56919276" "56919276" "subst" "0" "00006" "SLC12A3_000239" "g.56919276G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS4,PM1, PM2, PM5,PP3, PP5" "Germline" "" "" "0" "" "" "g.56885364G>A" "" "pathogenic (recessive)" "ACMG" "0000934261" "0" "90" "16" "56913119" "56913119" "subst" "0.000158716" "00006" "SLC12A3_000002" "g.56913119G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PM1, PM2, PM3, PP3, PP5" "Germline" "" "" "0" "" "" "g.56879207G>A" "" "pathogenic (recessive)" "ACMG" "0000934262" "0" "90" "16" "56919275" "56919275" "subst" "2.64002E-5" "00006" "SLC12A3_000079" "g.56919275C>G" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS4, PM1, PM2, PM3, PM5, PP3, PP5" "Germline" "" "" "0" "" "" "g.56885363C>G" "" "pathogenic (recessive)" "ACMG" "0000934263" "0" "90" "16" "56912074" "56912074" "subst" "2.87302E-5" "00006" "SLC12A3_000059" "g.56912074G>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS4, PM1, PM2, PM3, PP3, PP5; variant missed by SSCA" "Germline" "" "" "0" "" "" "g.56878162G>T" "" "pathogenic (recessive)" "ACMG" "0000934264" "0" "90" "16" "56912999" "56912999" "subst" "1.23872E-5" "00006" "SLC12A3_000061" "g.56912999C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS1, PS4, PM1, PM2, PP3, PP4, PP5; variant missed by SSCA" "Germline" "" "" "0" "" "" "g.56879087C>T" "" "pathogenic (recessive)" "ACMG" "0000934265" "0" "90" "16" "56933468" "56933468" "subst" "4.46671E-5" "00006" "SLC12A3_000160" "g.56933468G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS4, PM1, PM2, PP3, PP5; variant missed by SSCA" "Germline" "" "" "0" "" "" "g.56899556G>A" "" "pathogenic (recessive)" "ACMG" "0000934266" "0" "90" "16" "56906375" "56906375" "subst" "0" "00006" "SLC12A3_000226" "g.56906375G>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PVS1, PS4, PM1, PM2, PM3, PP3, PP5; variant missed by SSCA" "Germline" "" "" "0" "" "" "g.56872463G>T" "" "pathogenic (recessive)" "ACMG" "0000934267" "0" "90" "16" "56933468" "56933468" "subst" "4.46671E-5" "00006" "SLC12A3_000160" "g.56933468G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS4, PM1, PM2, PP3, PP5; variant missed by SEQ" "Germline" "" "" "0" "" "" "g.56899556G>A" "" "pathogenic (recessive)" "ACMG" "0000934268" "0" "90" "16" "56947205" "56947205" "subst" "0.000199137" "00006" "SLC12A3_000112" "g.56947205G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS4, PS3, PM1, PM2, PM3, PP3, PP5; variant missed by SSCA" "Germline" "" "" "0" "" "" "g.56913293G>A" "" "pathogenic (recessive)" "ACMG" "0000934269" "0" "90" "16" "56901129" "56901156" "del" "0" "00006" "SLC12A3_000217" "g.56901129_56901156del" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PVS1, PM1, PM2, PP3, PP5" "Germline" "" "" "0" "" "" "g.56867217_56867244del" "" "pathogenic (recessive)" "ACMG" "0000934270" "0" "90" "16" "56928470" "56928470" "subst" "0.000121976" "00006" "SLC12A3_000101" "g.56928470T>C" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS3, PS4, PM2, PM3, PP3, PP5" "Germline" "" "" "0" "" "" "g.56894558T>C" "" "pathogenic (recessive)" "ACMG" "0000934271" "0" "90" "16" "56917770" "56917770" "subst" "0" "00006" "SLC12A3_000073" "g.56917770C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS4, PS3, PM2, PM3, PP3, PP5; effect on splicing predicted from midi-gene splicing assay" "Germline" "" "" "0" "" "" "g.56883858C>T" "" "pathogenic (recessive)" "ACMG" "0000934272" "0" "90" "16" "56917770" "56917770" "subst" "0" "00006" "SLC12A3_000073" "g.56917770C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS4, PS3, PM2, PM3, PP3, PP5; effect on splicing predicted from midi-gene splicing assay" "Germline" "" "" "0" "" "" "g.56883858C>T" "" "pathogenic (recessive)" "ACMG" "0000934273" "0" "70" "16" "56904891" "56904891" "subst" "0" "00006" "SLC12A3_000200" "g.56904891C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS3, PM2, PP3; effect on splicing predicted from midi-gene splicing assay" "Germline" "" "" "0" "" "" "g.56870979C>T" "" "likely pathogenic (recessive)" "ACMG" "0000934274" "0" "70" "16" "56904891" "56904891" "subst" "0" "00006" "SLC12A3_000200" "g.56904891C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS3, PM2, PP3; effect on splicing predicted from midi-gene splicing assay" "Germline" "" "" "0" "" "" "g.56870979C>T" "" "likely pathogenic (recessive)" "ACMG" "0000934275" "0" "90" "16" "56921879" "56921879" "subst" "0.000381838" "00006" "SLC12A3_000092" "g.56921879G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS3, PS4, PM1, PM2, PM3, PP3, PP5" "Germline" "" "" "0" "" "" "g.56887967G>A" "" "pathogenic (recessive)" "ACMG" "0000934276" "0" "70" "16" "56906348" "56906348" "subst" "2.0313E-5" "00006" "SLC12A3_000225" "g.56906348C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS4, PM1, PM2, PP5" "Germline" "" "" "0" "" "" "g.56872436C>T" "" "likely pathogenic (recessive)" "ACMG" "0000934277" "0" "70" "16" "56920474" "56920474" "subst" "0" "00006" "SLC12A3_000203" "g.56920474A>G" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS3, PM2, PP3; effect on splicing predicted from midi-gene splicing assay" "Germline" "" "" "0" "" "" "g.56886562A>G" "" "likely pathogenic (recessive)" "ACMG" "0000934278" "0" "70" "16" "56903649" "56903649" "subst" "4.06197E-6" "00006" "SLC12A3_000042" "g.56903649T>C" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS4, PM1, PM2, PM3, PP5" "Germline" "" "" "0" "" "" "g.56869737T>C" "" "likely pathogenic (recessive)" "ACMG" "0000934279" "0" "90" "16" "56906702" "56906702" "subst" "0" "00006" "SLC12A3_000201" "g.56906702A>G" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS3, M2, PM3, PP1, PP3, PP5; effect on splicing predicted from midi-gene splicing assay" "Germline" "" "" "0" "" "" "g.56872790A>G" "" "pathogenic (recessive)" "ACMG" "0000934280" "0" "70" "16" "56927221" "56927221" "subst" "0" "00006" "SLC12A3_000207" "g.56927221G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS3, PM2; effect on splicing predicted from midi-gene splicing assay" "Germline" "" "" "0" "" "" "g.56893309G>A" "" "likely pathogenic (recessive)" "ACMG" "0000934281" "0" "90" "16" "56917770" "56917770" "subst" "0" "00006" "SLC12A3_000073" "g.56917770C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS4, PS3, PM2, PM3, PP3, PP5; effect on splicing predicted from midi-gene splicing assay" "Germline" "" "" "0" "" "" "g.56883858C>T" "" "pathogenic (recessive)" "ACMG" "0000934282" "1" "90" "16" "56903992" "56903992" "subst" "6.13457E-5" "00006" "SLC12A3_000044" "g.56903992G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS3, PM2, PM3, PP3, PP5; effect on splicing predicted from midi-gene splicing assay" "Germline" "" "" "0" "" "" "g.56870080G>A" "" "pathogenic (recessive)" "ACMG" "0000934283" "0" "70" "16" "56926960" "56926960" "subst" "0" "00006" "SLC12A3_000123" "g.56926960G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PM1, PM2, PM3, PP3, PP5" "Germline" "" "" "0" "" "" "g.56893048G>A" "" "likely pathogenic (recessive)" "ACMG" "0000934284" "0" "70" "16" "56921871" "56921871" "subst" "0" "00006" "SLC12A3_000024" "g.56921871T>G" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS4, PM1, PM2, PM3, PP5; variant missed by SSCA" "Germline" "" "" "0" "" "" "g.56887959T>G" "" "likely pathogenic (recessive)" "ACMG" "0000934285" "0" "50" "16" "56939199" "56939199" "subst" "0" "00006" "SLC12A3_000209" "g.56939199C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PM2" "Germline" "" "" "0" "" "" "g.56905287C>T" "" "VUS" "ACMG" "0000934286" "0" "50" "16" "56912041" "56912041" "subst" "0" "00006" "SLC12A3_000228" "g.56912041C>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PM1, PM2, PP3" "Germline" "" "" "0" "" "" "g.56878129C>A" "" "VUS" "ACMG" "0000934287" "0" "50" "16" "56947143" "56947143" "subst" "4.09333E-6" "00006" "SLC12A3_000249" "g.56947143A>G" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PM2" "Germline" "" "" "0" "" "" "g.56913231A>G" "" "VUS" "ACMG" "0000934288" "1" "30" "16" "56901737" "56901748" "del" "0" "00006" "SLC12A3_000198" "g.56901737_56901748del" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PM2, PM3, BS3; effect on splicing predicted from midi-gene splicing assay" "Germline" "" "" "0" "" "" "g.56867825_56867836del" "" "likely benign" "ACMG" "0000934289" "0" "30" "16" "56928225" "56928228" "del" "0" "00006" "SLC12A3_000208" "g.56928225_56928228del" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PM2, BS3; effect on splicing predicted from midi-gene splicing assay" "Germline" "" "" "0" "" "" "g.56894313_56894316del" "" "likely benign" "ACMG" "0000934290" "0" "30" "16" "56925804" "56925804" "subst" "0" "00006" "SLC12A3_000205" "g.56925804C>T" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG BS3, PM2; effect on splicing predicted from midi-gene splicing assay" "Germline" "" "" "0" "" "" "g.56891892C>T" "" "likely benign" "ACMG" "0000934291" "2" "90" "16" "56947205" "56947205" "subst" "0.000199137" "00006" "SLC12A3_000112" "g.56947205G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS4, PS3, PM1, PM2, PM3, PP3, PP5" "Germline" "" "" "0" "" "" "g.56913293G>A" "" "pathogenic (recessive)" "ACMG" "0000934292" "0" "70" "16" "56903997" "56903997" "subst" "0" "00006" "SLC12A3_000199" "g.56903997T>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "" "ACMG PS3, PM2, PP3; effect on splicing predicted from midi-gene splicing assay" "Germline" "" "" "0" "" "" "g.56870085T>A" "" "likely pathogenic (recessive)" "ACMG" "0000934295" "0" "70" "16" "56933441" "56933529" "del" "0" "00006" "SLC12A3_000243" "g.(56928555_56933441)_(56933529_56936284)del" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "del ex23" "" "Germline" "" "" "0" "" "" "g.(56894643_56899529)_(56899617_56902372)del" "" "likely pathogenic (recessive)" "" "0000934296" "0" "90" "16" "56947175" "56949762" "del" "0" "00006" "SLC12A3_000250" "g.(56938375_56947175)_(56949762_?)del" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "del ex26" "" "Germline" "" "" "0" "" "" "g.(56904463_56913263)_(56915850_?)del" "" "pathogenic (recessive)" "" "0000934297" "1" "90" "16" "56928555" "56928555" "subst" "8.13392E-6" "00006" "SLC12A3_000142" "g.56928555G>A" "" "{PMID:Viering 2023:36302598}, {DOI:Viering 2023:10.1681/ASN.2022050627}" "" "1806_1806del;2660+1G>A" "" "Germline" "" "" "0" "" "" "g.56894643G>A" "" "pathogenic (recessive)" "" "0000950682" "0" "90" "16" "56904050" "56904050" "subst" "8.12579E-6" "02326" "SLC12A3_000138" "g.56904050T>C" "" "" "" "SLC12A3(NM_000339.3):c.644T>C (p.L215P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000950684" "0" "70" "16" "56920986" "56920986" "subst" "0" "02326" "SLC12A3_000253" "g.56920986G>A" "" "" "" "SLC12A3(NM_000339.3):c.2159G>A (p.G720D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000950685" "0" "90" "16" "56921879" "56921879" "subst" "0.000381838" "02326" "SLC12A3_000092" "g.56921879G>A" "" "" "" "SLC12A3(NM_000339.2):c.2221G>A (p.G741R), SLC12A3(NM_000339.3):c.2221G>A (p.G741R), SLC12A3(NM_001126108.2):c.2221G>A (p.(Gly741Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000968408" "0" "10" "16" "56903325" "56903325" "subst" "0" "02326" "SLC12A3_000254" "g.56903325C>T" "" "" "" "SLC12A3(NM_000339.3):c.506-316C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000968409" "0" "30" "16" "56904655" "56904657" "del" "0" "02326" "SLC12A3_000255" "g.56904655_56904657del" "" "" "" "SLC12A3(NM_000339.3):c.852+7_852+9delAGG" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000968410" "0" "90" "16" "56919191" "56919191" "subst" "0" "02326" "SLC12A3_000076" "g.56919191T>C" "" "" "" "SLC12A3(NM_000339.3):c.1840T>C (p.S614P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000981954" "0" "50" "16" "56904110" "56904110" "subst" "6.50576E-5" "02327" "SLC12A3_000256" "g.56904110C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000981955" "0" "30" "16" "56904156" "56904156" "subst" "0" "02326" "SLC12A3_000257" "g.56904156G>A" "" "" "" "SLC12A3(NM_000339.3):c.741+9G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000981956" "0" "90" "16" "56917770" "56917770" "subst" "0" "02326" "SLC12A3_000073" "g.56917770C>T" "" "" "" "SLC12A3(NM_000339.3):c.1670-191C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000985254" "11" "70" "16" "56899326" "56899326" "subst" "6.09137E-5" "04689" "SLC12A3_000036" "g.56899326C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.56865414C>T" "" "pathogenic" "" "0000985255" "21" "70" "16" "56913120" "56913120" "subst" "0" "04689" "SLC12A3_000258" "g.56913120G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.56879208G>T" "" "likely pathogenic" "" "0000989988" "3" "90" "16" "56920916" "56920922" "del" "2.84398E-5" "00006" "SLC12A3_000086" "g.56920916_56920922del" "" "{PMID:Ozyavuz Cubuk 2024:38971859}" "" "" "ACMG PVS1,PM3,PM2,PP5" "Germline" "" "" "0" "" "" "g.56887004_56887010del" "" "pathogenic" "" "0001002432" "0" "70" "16" "56914056" "56914056" "subst" "0" "02326" "SLC12A3_000260" "g.56914056C>G" "" "" "" "SLC12A3(NM_000339.3):c.1458C>G (p.D486E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001007037" "0" "70" "16" "56913065" "56913065" "subst" "0" "03544" "SLC12A3_000259" "g.56913065T>C" "" "" "" "" "" "Germline" "yes" "rs28936387" "0" "" "" "g.56879153T>C" "{CV:8585}" "likely pathogenic" "ACMG" "0001015397" "0" "70" "16" "56921862" "56921862" "subst" "8.12513E-6" "02326" "SLC12A3_000192" "g.56921862C>G" "" "" "" "SLC12A3(NM_000339.3):c.2204C>G (p.P735R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001026723" "0" "90" "16" "56906321" "56906321" "subst" "1.62472E-5" "02326" "SLC12A3_000052" "g.56906321C>T" "" "" "" "SLC12A3(NM_000339.3):c.911C>T (p.T304M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001026724" "0" "90" "16" "56947230" "56947230" "subst" "0" "02326" "SLC12A3_000261" "g.56947230G>C" "" "" "" "SLC12A3(NM_000339.3):c.3006G>C (p.W1002C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001041206" "0" "50" "16" "56901021" "56901021" "subst" "0.000105966" "02327" "SLC12A3_000262" "g.56901021C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001041207" "0" "50" "16" "56911960" "56911983" "del" "0" "01804" "SLC12A3_000011" "g.56911960_56911983del" "" "" "" "SLC12A3(NM_000339.3):c.1096-29_1096-6delCTCCCTCCCTCTCTCCCTCCCTCC, SLC12A3(NM_001126108.2):c.1096-29_1096-6del" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001041208" "0" "70" "16" "56913508" "56913508" "subst" "1.21989E-5" "02327" "SLC12A3_000231" "g.56913508G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001041209" "0" "50" "16" "56914117" "56914117" "subst" "7.18026E-5" "02327" "SLC12A3_000263" "g.56914117C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001055604" "0" "50" "16" "56920979" "56920979" "subst" "2.03212E-5" "02327" "SLC12A3_000264" "g.56920979C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001055605" "0" "90" "16" "56921879" "56921879" "subst" "0.000381838" "01804" "SLC12A3_000092" "g.56921879G>A" "" "" "" "SLC12A3(NM_000339.2):c.2221G>A (p.G741R), SLC12A3(NM_000339.3):c.2221G>A (p.G741R), SLC12A3(NM_001126108.2):c.2221G>A (p.(Gly741Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001055606" "0" "50" "16" "56921894" "56921894" "subst" "0" "02327" "SLC12A3_000265" "g.56921894T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001066500" "0" "70" "16" "56920391" "56920391" "subst" "8.14617E-6" "02327" "SLC12A3_000266" "g.56920391A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001066501" "0" "50" "16" "56936320" "56936320" "subst" "4.46704E-5" "01804" "SLC12A3_000173" "g.56936320G>A" "" "" "" "SLC12A3(NM_000339.2):c.2783G>A (p.R928H), SLC12A3(NM_001126108.2):c.2756G>A (p.(Arg919His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes SLC12A3 ## Count = 474 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000005612" "00001220" "50" "2447" "-37" "2447" "-37" "c.2447-37T>C" "r.(=)" "p.(=)" "" "0000013579" "00001220" "50" "2447" "-37" "2447" "-37" "c.2447-37T>C" "r.(=)" "p.(=)" "" "0000130073" "00001220" "90" "1315" "0" "1315" "0" "c.1315G>A" "r.(?)" "p.(Gly439Ser)" "" "0000251042" "00001220" "10" "366" "0" "366" "0" "c.366A>G" "r.(?)" "p.(Ala122=)" "" "0000252423" "00001220" "70" "1324" "0" "1324" "0" "c.1324A>G" "r.(?)" "p.(Asn442Asp)" "" "0000298227" "00001220" "30" "1011" "0" "1011" "0" "c.1011T>C" "r.(?)" "p.(Asp337=)" "" "0000298228" "00001220" "10" "1670" "-8" "1670" "-8" "c.1670-8T>C" "r.(=)" "p.(=)" "" "0000298229" "00001220" "10" "2951" "13" "2951" "13" "c.2951+13C>T" "r.(=)" "p.(=)" "" "0000298230" "00001220" "10" "791" "0" "791" "0" "c.791=" "r.(=)" "p.(Gly264=)" "" "0000302129" "00001220" "10" "1096" "-29" "1096" "-6" "c.1096-29_1096-6del" "r.(=)" "p.(=)" "" "0000302130" "00001220" "90" "1289" "0" "1289" "0" "c.1289G>A" "r.(?)" "p.(Cys430Tyr)" "" "0000302131" "00001220" "90" "1315" "0" "1315" "0" "c.1315G>A" "r.(?)" "p.(Gly439Ser)" "" "0000302132" "00001220" "30" "1386" "0" "1386" "0" "c.1386C>T" "r.(?)" "p.(Phe462=)" "" "0000302133" "00001220" "10" "1395" "0" "1395" "0" "c.1395C>T" "r.(?)" "p.(Thr465=)" "" "0000302134" "00001220" "10" "1444" "-31" "1444" "-31" "c.1444-31C>T" "r.(=)" "p.(=)" "" "0000302135" "00001220" "90" "1664" "0" "1664" "0" "c.1664C>T" "r.(?)" "p.(Ser555Leu)" "" "0000302136" "00001220" "10" "1670" "-8" "1670" "-8" "c.1670-8T>C" "r.(=)" "p.(=)" "" "0000302137" "00001220" "10" "1884" "0" "1884" "0" "c.1884G>A" "r.(?)" "p.(Ser628=)" "" "0000302138" "00001220" "90" "1928" "0" "1928" "0" "c.1928C>T" "r.(?)" "p.(Pro643Leu)" "" "0000302139" "00001220" "30" "1980" "0" "1980" "0" "c.1980C>T" "r.(?)" "p.(Asp660=)" "" "0000302140" "00001220" "10" "2142" "0" "2142" "0" "c.2142C>T" "r.(?)" "p.(Ala714=)" "" "0000302141" "00001220" "10" "2179" "-8" "2179" "-8" "c.2179-8C>T" "r.(=)" "p.(=)" "" "0000302142" "00001220" "90" "2213" "0" "2213" "0" "c.2213T>G" "r.(?)" "p.(Leu738Arg)" "" "0000302143" "00001220" "10" "2625" "0" "2625" "0" "c.2625C>T" "r.(?)" "p.(Gly875=)" "" "0000302144" "00001220" "10" "2738" "0" "2738" "0" "c.2738G>A" "r.(?)" "p.(Arg913Gln)" "" "0000302145" "00001220" "10" "2748" "-13" "2748" "-13" "c.2748-13T>C" "r.(=)" "p.(=)" "" "0000302146" "00001220" "10" "2782" "0" "2782" "0" "c.2782C>T" "r.(?)" "p.(Arg928Cys)" "" "0000302147" "00001220" "10" "282" "79" "282" "79" "c.282+79T>G" "r.(=)" "p.(=)" "" "0000302148" "00001220" "90" "2883" "1" "2883" "1" "c.2883+1G>T" "r.spl?" "p.?" "" "0000302149" "00001220" "10" "2884" "-173" "2884" "-173" "c.2884-173C>T" "r.(=)" "p.(=)" "" "0000302150" "00001220" "10" "2884" "-17" "2884" "-17" "c.2884-17G>A" "r.(=)" "p.(=)" "" "0000302151" "00001220" "30" "2884" "-6" "2884" "-6" "c.2884-6G>A" "r.(=)" "p.(=)" "" "0000302152" "00001220" "10" "2951" "13" "2951" "13" "c.2951+13C>T" "r.(=)" "p.(=)" "" "0000302153" "00001220" "90" "2965" "0" "2965" "0" "c.2965G>A" "r.(?)" "p.(Gly989Arg)" "" "0000302154" "00001220" "90" "3070" "0" "3070" "0" "c.3070G>A" "r.(?)" "p.(Val1024Met)" "" "0000302156" "00001220" "10" "36" "0" "36" "0" "c.36C>T" "r.(?)" "p.(Asp12=)" "" "0000302157" "00001220" "10" "791" "0" "791" "0" "c.791=" "r.(=)" "p.(Gly264=)" "" "0000302159" "00001220" "90" "815" "0" "815" "0" "c.815T>C" "r.(?)" "p.(Leu272Pro)" "" "0000338408" "00001220" "90" "506" "-1" "506" "-1" "c.506-1G>A" "r.spl?" "p.?" "" "0000338409" "00001220" "90" "1180" "1" "1180" "1" "c.1180+1G>T" "r.spl?" "p.?" "" "0000338410" "00001220" "90" "1335" "1" "1335" "1" "c.1335+1G>A" "r.spl?" "p.?" "" "0000338411" "00001220" "10" "1444" "-17" "1444" "-17" "c.1444-17G>A" "r.(=)" "p.(=)" "" "0000338412" "00001220" "90" "1670" "-191" "1670" "-191" "c.1670-191C>T" "r.(=)" "p.(=)" "" "0000338413" "00001220" "10" "1670" "-8" "1670" "-8" "c.1670-8T>C" "r.(=)" "p.(=)" "" "0000338414" "00001220" "10" "1825" "9" "1825" "9" "c.1825+9C>A" "r.(=)" "p.(=)" "" "0000338415" "00001220" "90" "2037" "1" "2037" "1" "c.2037+1G>A" "r.spl?" "p.?" "" "0000338416" "00001220" "10" "2179" "-8" "2179" "-8" "c.2179-8C>T" "r.(=)" "p.(=)" "" "0000338417" "00001220" "90" "2548" "1" "2548" "1" "c.2548+1G>T" "r.spl?" "p.?" "" "0000338418" "00001220" "90" "2548" "253" "2548" "253" "c.2548+253C>T" "r.(=)" "p.(=)" "" "0000338419" "00001220" "10" "2548" "278" "2548" "278" "c.2548+278C>T" "r.(=)" "p.(=)" "" "0000338420" "00001220" "10" "2548" "330" "2548" "330" "c.2548+330C>T" "r.(=)" "p.(=)" "" "0000338421" "00001220" "10" "2548" "357" "2548" "357" "c.2548+357A>T" "r.(=)" "p.(=)" "" "0000338422" "00001220" "10" "2548" "362" "2548" "362" "c.2548+362A>C" "r.(=)" "p.(=)" "" "0000338423" "00001220" "10" "2748" "-13" "2748" "-13" "c.2748-13T>C" "r.(=)" "p.(=)" "" "0000338424" "00001220" "90" "2883" "1" "2883" "1" "c.2883+1G>T" "r.spl?" "p.?" "" "0000338425" "00001220" "10" "2884" "-18" "2884" "-18" "c.2884-18C>T" "r.(=)" "p.(=)" "" "0000338426" "00001220" "10" "2884" "-17" "2884" "-17" "c.2884-17G>A" "r.(=)" "p.(=)" "" "0000338427" "00001220" "10" "2884" "-6" "2884" "-6" "c.2884-6G>A" "r.(=)" "p.(=)" "" "0000338428" "00001220" "90" "2951" "2" "2951" "2" "c.2951+2T>G" "r.spl?" "p.?" "" "0000338429" "00001220" "10" "2951" "13" "2951" "13" "c.2951+13C>T" "r.(=)" "p.(=)" "" "0000340246" "00001220" "10" "1023" "0" "1023" "0" "c.1023C>T" "r.(?)" "p.(Phe341=)" "" "0000340621" "00001220" "10" "366" "0" "366" "0" "c.366A>G" "r.(?)" "p.(Ala122=)" "" "0000340663" "00001220" "10" "2142" "0" "2142" "0" "c.2142C>T" "r.(?)" "p.(Ala714=)" "" "0000340795" "00001220" "10" "2625" "0" "2625" "0" "c.2625C>T" "r.(?)" "p.(Gly875=)" "" "0000340814" "00001220" "10" "3051" "0" "3051" "0" "c.3051C>T" "r.(?)" "p.(Ile1017=)" "" "0000340884" "00001220" "30" "1386" "0" "1386" "0" "c.1386C>T" "r.(?)" "p.(Phe462=)" "" "0000340969" "00001220" "10" "1884" "0" "1884" "0" "c.1884G>A" "r.(?)" "p.(Ser628=)" "" "0000340983" "00001220" "10" "2991" "0" "2991" "0" "c.2991G>A" "r.(?)" "p.(Ser997=)" "" "0000341013" "00001220" "10" "1395" "0" "1395" "0" "c.1395C>T" "r.(?)" "p.(Thr465=)" "" "0000341043" "00001220" "10" "1539" "0" "1539" "0" "c.1539C>T" "r.(?)" "p.(Tyr513=)" "" "0000341280" "00001220" "50" "676" "0" "676" "0" "c.676G>A" "r.(?)" "p.(Ala226Thr)" "" "0000341569" "00001220" "10" "2182" "0" "2182" "0" "c.2182G>A" "r.(?)" "p.(Ala728Thr)" "" "0000342230" "00001220" "70" "625" "0" "625" "0" "c.625C>T" "r.(?)" "p.(Arg209Trp)" "" "0000342633" "00001220" "90" "961" "0" "961" "0" "c.961C>T" "r.(?)" "p.(Arg321Trp)" "" "0000342812" "00001220" "90" "1195" "0" "1195" "0" "c.1195C>T" "r.(?)" "p.(Arg399Cys)" "" "0000342814" "00001220" "90" "1193" "0" "1194" "0" "c.1193_1194insTGCGTGG" "r.(?)" "p.(Arg399AlafsTer4)" "" "0000343199" "00001220" "70" "1924" "0" "1924" "0" "c.1924C>G" "r.(?)" "p.(Arg642Gly)" "" "0000343214" "00001220" "70" "1964" "0" "1964" "0" "c.1964G>A" "r.(?)" "p.(Arg655His)" "" "0000343215" "00001220" "70" "1964" "0" "1964" "0" "c.1964G>T" "r.(?)" "p.(Arg655Leu)" "" "0000343434" "00001220" "70" "2581" "0" "2581" "0" "c.2581C>T" "r.(?)" "p.(Arg861Cys)" "" "0000343464" "00001220" "90" "2686" "0" "2686" "0" "c.2686C>T" "r.(?)" "p.(Arg896Ter)" "" "0000343478" "00001220" "30" "2738" "0" "2738" "0" "c.2738G>A" "r.(?)" "p.(Arg913Gln)" "" "0000343489" "00001220" "10" "2782" "0" "2782" "0" "c.2782C>T" "r.(?)" "p.(Arg928Cys)" "" "0000343520" "00001220" "90" "2891" "0" "2891" "0" "c.2891G>A" "r.(?)" "p.(Arg964Gln)" "" "0000343533" "00001220" "90" "2929" "0" "2929" "0" "c.2929C>T" "r.(?)" "p.(Arg977Ter)" "" "0000343728" "00001220" "70" "1077" "0" "1077" "0" "c.1077C>G" "r.(?)" "p.(Asn359Lys)" "" "0000343804" "00001220" "10" "1865" "0" "1865" "0" "c.1865A>G" "r.(?)" "p.(Asn622Ser)" "" "0000344479" "00001220" "90" "2981" "0" "2981" "0" "c.2981G>A" "r.(?)" "p.(Cys994Tyr)" "" "0000345086" "00001220" "10" "363" "0" "363" "0" "c.363G>C" "r.(?)" "p.(Glu121Asp)" "" "0000345597" "00001220" "90" "2821" "0" "2821" "0" "c.2821G>T" "r.(?)" "p.(Glu941Ter)" "" "0000346037" "00001220" "70" "1121" "0" "1121" "0" "c.1121G>A" "r.(?)" "p.(Gly374Glu)" "" "0000346076" "00001220" "90" "1315" "0" "1315" "0" "c.1315G>A" "r.(?)" "p.(Gly439Ser)" "" "0000346082" "00001220" "50" "1355" "0" "1355" "0" "c.1355G>A" "r.(?)" "p.(Gly452Asp)" "" "0000346093" "00001220" "70" "1387" "0" "1387" "0" "c.1387G>A" "r.(?)" "p.(Gly463Arg)" "" "0000346242" "00001220" "70" "2186" "0" "2186" "0" "c.2186G>T" "r.(?)" "p.(Gly729Val)" "" "0000346244" "00001220" "70" "2191" "0" "2191" "0" "c.2191G>A" "r.(?)" "p.(Gly731Arg)" "" "0000346249" "00001220" "90" "2221" "0" "2221" "0" "c.2221G>A" "r.(?)" "p.(Gly741Arg)" "" "0000346300" "00001220" "70" "2548" "0" "2548" "0" "c.2548G>C" "r.(?)" "p.(Gly850Arg)" "" "0000346345" "00001220" "90" "2965" "0" "2965" "0" "c.2965G>A" "r.(?)" "p.(Gly989Arg)" "" "0000346702" "00001220" "50" "1079" "0" "1079" "0" "c.1079T>C" "r.(?)" "p.(Ile360Thr)" "" "0000346832" "00001220" "50" "2963" "0" "2963" "0" "c.2963T>C" "r.(?)" "p.(Ile988Thr)" "" "0000347058" "00001220" "70" "815" "0" "815" "0" "c.815T>C" "r.(?)" "p.(Leu272Pro)" "" "0000347325" "00001220" "90" "2576" "0" "2576" "0" "c.2576T>C" "r.(?)" "p.(Leu859Pro)" "" "0000347780" "00001220" "50" "698" "0" "698" "0" "c.698T>C" "r.(?)" "p.(Met233Thr)" "" "0000348535" "00001220" "70" "1928" "0" "1928" "0" "c.1928C>T" "r.(?)" "p.(Pro643Leu)" "" "0000348988" "00001220" "90" "1203" "0" "1204" "0" "c.1203_1204insGTGATGC" "r.(?)" "p.(Ser402ValfsTer8)" "" "0000349120" "00001220" "70" "1840" "0" "1840" "0" "c.1840T>C" "r.(?)" "p.(Ser614Pro)" "" "0000349308" "00001220" "50" "488" "0" "488" "0" "c.488C>T" "r.(?)" "p.(Thr163Met)" "" "0000349432" "00001220" "90" "911" "0" "911" "0" "c.911C>T" "r.(?)" "p.(Thr304Met)" "" "0000349433" "00001220" "70" "910" "0" "910" "0" "c.910A>C" "r.(?)" "p.(Thr304Pro)" "" "0000349491" "00001220" "90" "1175" "0" "1175" "0" "c.1175C>T" "r.(?)" "p.(Thr392Ile)" "" "0000349582" "00001220" "90" "179" "0" "179" "0" "c.179C>T" "r.(?)" "p.(Thr60Met)" "" "0000349590" "00001220" "90" "1946" "0" "1946" "0" "c.1946C>G" "r.(?)" "p.(Thr649Arg)" "" "0000349607" "00001220" "90" "2089" "0" "2095" "0" "c.2089_2095del" "r.(?)" "p.(Thr697GlyfsTer2)" "" "0000349716" "00001220" "90" "514" "0" "514" "0" "c.514T>C" "r.(?)" "p.(Trp172Arg)" "" "0000349834" "00001220" "90" "1835" "0" "1835" "0" "c.1835G>A" "r.(?)" "p.(Trp612Ter)" "" "0000350630" "00001220" "70" "2029" "0" "2029" "0" "c.2029G>A" "r.(?)" "p.(Val677Met)" "" "0000350761" "00001220" "90" "2178" "2" "2178" "2" "c.2178+2T>C" "r.spl?" "p.?" "" "0000351287" "00001220" "90" "601" "1" "601" "1" "c.601+1G>A" "r.spl?" "p.?" "" "0000351288" "00001220" "70" "602" "-16" "602" "-16" "c.602-16G>A" "r.(=)" "p.(=)" "" "0000351289" "00001220" "90" "741" "1" "741" "1" "c.741+1G>A" "r.spl?" "p.?" "" "0000558512" "00001220" "90" "35" "0" "35" "0" "c.35dup" "r.(?)" "p.(Asp12GlufsTer18)" "" "0000558513" "00001220" "30" "36" "0" "36" "0" "c.36C>T" "r.(?)" "p.(Asp12=)" "" "0000558514" "00001220" "90" "514" "0" "514" "0" "c.514T>C" "r.(?)" "p.(Trp172Arg)" "" "0000558515" "00001220" "90" "533" "0" "533" "0" "c.533C>T" "r.(?)" "p.(Ser178Leu)" "" "0000558516" "00001220" "70" "947" "0" "947" "0" "c.947G>C" "r.(?)" "p.(Gly316Ala)" "" "0000558517" "00001220" "50" "965" "0" "965" "0" "c.965C>T" "r.(?)" "p.(Ala322Val)" "" "0000558518" "00001220" "50" "1324" "0" "1324" "0" "c.1324A>G" "r.(?)" "p.(Asn442Asp)" "" "0000558519" "00001220" "50" "1396" "0" "1396" "0" "c.1396C>G" "r.(?)" "p.(Leu466Val)" "" "0000558520" "00001220" "10" "1444" "-17" "1444" "-17" "c.1444-17G>A" "r.(=)" "p.(=)" "" "0000558521" "00001220" "10" "1567" "290" "1567" "290" "c.1567+290G>A" "r.(=)" "p.(=)" "" "0000558522" "00001220" "50" "1781" "0" "1781" "0" "c.1781G>A" "r.(?)" "p.(Gly594Asp)" "" "0000558523" "00001220" "10" "1825" "9" "1825" "9" "c.1825+9C>A" "r.(=)" "p.(=)" "" "0000558524" "00001220" "10" "2182" "0" "2182" "0" "c.2182G>A" "r.(?)" "p.(Ala728Thr)" "" "0000558525" "00001220" "50" "2273" "0" "2273" "0" "c.2273T>C" "r.(?)" "p.(Ile758Thr)" "" "0000558526" "00001220" "50" "2542" "0" "2542" "0" "c.2542G>A" "r.(?)" "p.(Asp848Asn)" "" "0000558527" "00001220" "50" "2883" "0" "2883" "0" "c.2883G>A" "r.(?)" "p.(Lys961=)" "" "0000558528" "00001220" "50" "2990" "0" "2990" "0" "c.2990C>T" "r.(?)" "p.(Ser997Leu)" "" "0000616041" "00001220" "70" "473" "0" "473" "0" "c.473G>A" "r.(?)" "p.(Arg158Gln)" "" "0000616042" "00001220" "70" "1075" "0" "1075" "0" "c.1075A>C" "r.(?)" "p.(Asn359His)" "" "0000616043" "00001220" "50" "1405" "0" "1405" "0" "c.1405G>A" "r.(?)" "p.(Ala469Thr)" "" "0000624926" "00001220" "70" "1315" "0" "1315" "0" "c.1315G>A" "r.(?)" "p.(Gly439Ser)" "" "0000624927" "00001220" "50" "1145" "0" "1145" "0" "c.1145C>T" "r.(?)" "p.(Thr382Met)" "" "0000649351" "00001220" "10" "791" "0" "791" "0" "c.791C>G" "r.(?)" "p.(Ala264Gly)" "" "0000649352" "00001220" "90" "1763" "0" "1763" "0" "c.1763C>T" "r.(?)" "p.(Ala588Val)" "" "0000649353" "00001220" "30" "1825" "9" "1825" "9" "c.1825+9C>A" "r.(=)" "p.(=)" "" "0000649354" "00001220" "90" "2981" "0" "2981" "0" "c.2981G>A" "r.(?)" "p.(Cys994Tyr)" "" "0000657876" "00001220" "30" "27" "0" "27" "0" "c.27G>A" "r.(?)" "p.(Thr9=)" "" "0000657877" "00001220" "30" "323" "0" "323" "0" "c.323G>A" "r.(?)" "p.(Arg108Gln)" "" "0000657878" "00001220" "70" "457" "0" "457" "0" "c.457G>A" "r.(?)" "p.(Val153Met)" "" "0000657879" "00001220" "50" "1373" "0" "1373" "0" "c.1373C>T" "r.(?)" "p.(Thr458Met)" "" "0000657880" "00001220" "50" "1396" "0" "1396" "0" "c.1396C>G" "r.(?)" "p.(Leu466Val)" "" "0000657881" "00001220" "10" "1567" "190" "1567" "190" "c.1567+190C>T" "r.(=)" "p.(=)" "" "0000657882" "00001220" "30" "2497" "0" "2497" "0" "c.2497T>A" "r.(?)" "p.(Ser833Thr)" "" "0000657883" "00001220" "90" "2576" "0" "2576" "0" "c.2576T>C" "r.(?)" "p.(Leu859Pro)" "" "0000669337" "00001220" "10" "791" "0" "791" "0" "c.791C>G" "r.(?)" "p.(Ala264Gly)" "" "0000683629" "00001220" "90" "2221" "0" "2221" "0" "c.2221G>A" "r.(?)" "p.(Gly741Arg)" "" "0000683630" "00001220" "70" "644" "0" "644" "0" "c.644T>C" "r.(?)" "p.(Leu215Pro)" "" "0000692093" "00001220" "50" "965" "0" "965" "0" "c.965C>T" "r.(?)" "p.(Ala322Val)" "" "0000692094" "00001220" "70" "1335" "1" "1335" "1" "c.1335+1G>A" "r.spl?" "p.?" "" "0000704279" "00001220" "90" "1732" "0" "1732" "0" "c.1732G>A" "r.(?)" "p.(Val578Met)" "" "0000704280" "00001220" "90" "2537" "0" "2538" "0" "c.2537_2538del" "r.(?)" "p.(Phe846*)" "" "0000704281" "00001220" "90" "1924" "0" "1924" "0" "c.1924C>T" "r.(?)" "p.(Arg642Cys)" "" "0000704282" "00001220" "90" "1763" "0" "1763" "0" "c.1763C>T" "r.(?)" "p.(Ala588Val)" "" "0000704283" "00001220" "90" "2029" "0" "2029" "0" "c.2029G>A" "r.(?)" "p.(Val677Met)" "" "0000704284" "00001220" "90" "539" "0" "539" "0" "c.539C>A" "r.(?)" "p.(Thr180Lys)" "" "0000704285" "00001220" "90" "1844" "0" "1844" "0" "c.1844C>T" "r.(?)" "p.(Ser615Leu)" "" "0000704286" "00001220" "90" "947" "0" "947" "0" "c.947G>T" "r.(?)" "p.(Gly316Val)" "" "0000704287" "00001220" "90" "2660" "1" "2660" "1" "c.2660+1G>A" "r.spl?" "p.?" "" "0000704288" "00001220" "90" "539" "0" "539" "0" "c.539C>A" "r.(?)" "p.(Thr180Lys)" "" "0000704289" "00001220" "50" "1235" "0" "1235" "0" "c.1235G>C" "r.(?)" "p.(Gly412Ala)" "" "0000704290" "00001220" "90" "1315" "0" "1315" "0" "c.1315G>A" "r.(?)" "p.(Gly439Ser)" "" "0000704306" "00001220" "90" "139" "0" "139" "0" "c.139del" "r.(?)" "p.(His47Thrfs*67)" "" "0000704307" "00001220" "90" "1868" "0" "1868" "0" "c.1868T>C" "r.(?)" "p.(Leu623Pro)" "" "0000704308" "00001220" "90" "2573" "0" "2573" "0" "c.2573T>A" "r.(?)" "p.(Leu858His)" "" "0000704309" "00001220" "90" "539" "0" "539" "0" "c.539C>A" "r.(?)" "p.(Thr180Lys)" "" "0000704310" "00001220" "90" "1844" "0" "1844" "0" "c.1844C>T" "r.(?)" "p.(Ser615Leu)" "" "0000704311" "00001220" "90" "1698" "0" "1698" "0" "c.1698C>A" "r.(?)" "p.(Asn566Lys)" "" "0000704312" "00001220" "50" "2012" "0" "2012" "0" "c.2012T>G" "r.(?)" "p.(Leu671Arg)" "" "0000704313" "00001220" "90" "2582" "0" "2582" "0" "c.2582G>A" "r.(?)" "p.(Arg861His)" "" "0000704314" "00001220" "90" "539" "0" "539" "0" "c.539C>A" "r.(?)" "p.(Thr180Lys)" "" "0000704315" "00001220" "90" "2542" "0" "2542" "0" "c.2542G>A" "r.(?)" "p.(Asp848Asn)" "" "0000704316" "00001220" "90" "1336" "-2" "1336" "-2" "c.1336-2A>T" "r.spl?" "p.?" "" "0000704317" "00001220" "90" "1706" "0" "1706" "0" "c.1706C>T" "r.(?)" "p.(Ala569Val)" "" "0000704318" "00001220" "90" "2573" "0" "2573" "0" "c.2573T>A" "r.(?)" "p.(Leu858His)" "" "0000704319" "00001220" "70" "2965" "0" "2965" "0" "c.2965G>T" "r.(?)" "p.(Gly989Trp)" "" "0000704320" "00001220" "90" "539" "0" "539" "0" "c.539C>A" "r.(?)" "p.(Thr180Lys)" "" "0000704321" "00001220" "90" "1195" "0" "1195" "0" "c.1195C>T" "r.(?)" "p.(Arg399Cys)" "" "0000704322" "00001220" "90" "788" "0" "805" "0" "c.788_805dup" "r.(?)" "p.(Ile263_Val268dup)" "" "0000704323" "00001220" "90" "1556" "0" "1556" "0" "c.1556del" "r.(?)" "p.(Phe519Serfs*10)" "" "0000704324" "00001220" "90" "2573" "0" "2573" "0" "c.2573T>A" "r.(?)" "p.(Leu858His)" "" "0000704325" "00001220" "90" "1195" "0" "1195" "0" "c.1195C>T" "r.(?)" "p.(Arg399Cys)" "" "0000704326" "00001220" "90" "2573" "0" "2573" "0" "c.2573T>A" "r.(?)" "p.(Leu858His)" "" "0000704327" "00001220" "90" "1868" "0" "1868" "0" "c.1868T>C" "r.(?)" "p.(Leu623Pro)" "" "0000704371" "00001220" "90" "1930" "0" "1930" "0" "c.1930del" "r.(?)" "p.(Gln644Serfs*28)" "" "0000704372" "00001220" "90" "2573" "0" "2573" "0" "c.2573T>A" "r.(?)" "p.(Leu858His)" "" "0000704373" "00001220" "90" "539" "0" "539" "0" "c.539C>A" "r.(?)" "p.(Thr180Lys)" "" "0000704374" "00001220" "90" "1763" "0" "1763" "0" "c.1763C>T" "r.(?)" "p.(Ala588Val)" "" "0000704375" "00001220" "90" "2029" "0" "2029" "0" "c.2029G>A" "r.(?)" "p.(Val677Met)" "" "0000704376" "00001220" "90" "2927" "0" "2927" "0" "c.2927C>T" "r.(?)" "p.(Ser976Phe)" "" "0000704377" "00001220" "90" "2573" "0" "2573" "0" "c.2573T>A" "r.(?)" "p.(Leu858His)" "" "0000704378" "00001220" "90" "2573" "0" "2573" "0" "c.2573T>A" "r.(?)" "p.(Leu858His)" "" "0000704379" "00001220" "70" "1100" "0" "1100" "0" "c.1100C>T" "r.(?)" "p.(Pro367Leu)" "" "0000704380" "00001220" "90" "1195" "0" "1195" "0" "c.1195C>T" "r.(?)" "p.(Arg399Cys)" "" "0000704381" "00001220" "90" "2573" "0" "2573" "0" "c.2573T>A" "r.(?)" "p.(Leu858His)" "" "0000704382" "00001220" "90" "539" "0" "539" "0" "c.539C>A" "r.(?)" "p.(Thr180Lys)" "" "0000704383" "00001220" "90" "2687" "0" "2687" "0" "c.2687G>A" "r.(?)" "p.(Arg896Gln)" "" "0000704384" "00001220" "90" "2573" "0" "2573" "0" "c.2573T>A" "r.(?)" "p.(Leu858His)" "" "0000704385" "00001220" "90" "3053" "0" "3053" "0" "c.3053G>A" "r.(?)" "p.(Arg1018Gln)" "" "0000704386" "00001220" "90" "2573" "0" "2573" "0" "c.2573T>A" "r.(?)" "p.(Leu858His)" "" "0000704387" "00001220" "90" "2891" "0" "2891" "0" "c.2891G>A" "r.(?)" "p.(Arg964Gln)" "" "0000704388" "00001220" "70" "2191" "0" "2191" "0" "c.2191G>A" "r.(?)" "p.(Gly731Arg)" "" "0000704389" "00001220" "90" "2573" "0" "2573" "0" "c.2573T>A" "r.(?)" "p.(Leu858His)" "" "0000715038" "00001220" "50" "81" "0" "81" "0" "c.81C>G" "r.(?)" "p.(Ser27Arg)" "" "0000725856" "00001220" "10" "965" "0" "965" "0" "c.965C>T" "r.(?)" "p.(Ala322Val)" "" "0000725857" "00001220" "70" "1336" "-3" "1336" "-3" "c.1336-3C>A" "r.spl?" "p.?" "" "0000725858" "00001220" "90" "2221" "0" "2221" "0" "c.2221G>A" "r.(?)" "p.(Gly741Arg)" "" "0000725859" "00001220" "90" "2883" "1" "2883" "1" "c.2883+1G>T" "r.spl?" "p.?" "" "0000725860" "00001220" "70" "3052" "0" "3052" "0" "c.3052C>T" "r.(?)" "p.(Arg1018Ter)" "" "0000730109" "00001220" "70" "741" "1" "741" "1" "c.741+1G>A" "r.spl?" "p.?" "" "0000730110" "00001220" "70" "947" "0" "947" "0" "c.947G>T" "r.(?)" "p.(Gly316Val)" "" "0000763738" "00001220" "50" "2179" "0" "2179" "0" "c.2179G>A" "r.(?)" "p.(Ala727Thr)" "" "0000763805" "00001220" "50" "2883" "1" "2883" "1" "c.2883+1G>T" "r.spl" "p.?" "" "0000785378" "00001220" "90" "2089" "0" "2095" "0" "c.2089_2095del" "r.(?)" "p.(Thr697Glyfs*2)" "" "0000785379" "00001220" "70" "947" "0" "947" "0" "c.947G>T" "r.(?)" "p.(Gly316Val)" "" "0000807456" "00001220" "30" "249" "0" "249" "0" "c.249G>T" "r.(?)" "p.(Arg83=)" "" "0000807457" "00001220" "30" "363" "0" "363" "0" "c.363G>C" "r.(?)" "p.(Glu121Asp)" "" "0000807458" "00001220" "30" "429" "9" "429" "9" "c.429+9G>A" "r.(=)" "p.(=)" "" "0000807459" "00001220" "30" "651" "0" "651" "0" "c.651C>T" "r.(?)" "p.(Gly217=)" "" "0000807460" "00001220" "70" "1387" "0" "1387" "0" "c.1387G>A" "r.(?)" "p.(Gly463Arg)" "" "0000807461" "00001220" "30" "1710" "0" "1710" "0" "c.1710G>A" "r.(?)" "p.(Ala570=)" "" "0000807462" "00001220" "50" "2783" "0" "2783" "0" "c.2783G>A" "r.(?)" "p.(Arg928His)" "" "0000807463" "00001220" "70" "2965" "0" "2965" "0" "c.2965G>A" "r.(?)" "p.(Gly989Arg)" "" "0000827869" "00001220" "70" "2899" "0" "2899" "0" "c.2899A>G" "r.(?)" "p.(Arg967Gly)" "" "0000827870" "00001220" "50" "2710" "0" "2710" "0" "c.2710A>T" "r.(?)" "p.(Ile904Phe)" "" "0000827871" "00001220" "70" "2687" "0" "2687" "0" "c.2687G>A" "r.(?)" "p.(Arg896Gln)" "" "0000827872" "00001220" "70" "1669" "0" "1669" "0" "c.1669G>C" "r.(?)" "p.(Gly557Arg)" "" "0000827874" "00001220" "50" "1202" "0" "1202" "0" "c.1202C>T" "r.(?)" "p.(Ala401Val)" "" "0000827903" "00001220" "70" "2687" "0" "2687" "0" "c.2687G>A" "r.(?)" "p.(Arg896Gln)" "" "0000827904" "00001220" "50" "2710" "0" "2710" "0" "c.2710A>T" "r.(?)" "p.(Ile904Phe)" "" "0000827905" "00001220" "90" "2221" "0" "2221" "0" "c.2221G>A" "r.(?)" "p.(Gly741Arg)" "" "0000854562" "00001220" "50" "17" "0" "17" "0" "c.17C>T" "r.(?)" "p.(Thr6Ile)" "" "0000854563" "00001220" "50" "505" "0" "505" "0" "c.505G>T" "r.(?)" "p.(Val169Phe)" "" "0000864855" "00001220" "30" "36" "0" "36" "0" "c.36C>T" "r.(?)" "p.(Asp12=)" "" "0000864856" "00001220" "90" "237" "0" "238" "0" "c.237_238dup" "r.(?)" "p.(Arg80ProfsTer35)" "" "0000864857" "00001220" "90" "247" "0" "247" "0" "c.247C>T" "r.(?)" "p.(Arg83Trp)" "" "0000864858" "00001220" "90" "961" "0" "961" "0" "c.961C>T" "r.(?)" "p.(Arg321Trp)" "" "0000864859" "00001220" "30" "965" "0" "965" "0" "c.965C>T" "r.(?)" "p.(Ala322Val)" "" "0000864860" "00001220" "50" "2236" "0" "2236" "0" "c.2236T>A" "r.(?)" "p.(Trp746Arg)" "" "0000864861" "00001220" "70" "2309" "0" "2309" "0" "c.2309G>A" "r.(?)" "p.(Gly770Asp)" "" "0000873483" "00001220" "70" "1366" "0" "1366" "0" "c.1366dup" "r.(?)" "p.(Leu456Profs*69)" "" "0000873484" "00001220" "70" "2029" "0" "2029" "0" "c.2029G>A" "r.(?)" "p.(Val677Met)" "" "0000873549" "00001220" "70" "468" "0" "468" "0" "c.468C>A" "r.(?)" "p.(Tyr156*)" "" "0000873618" "00001220" "70" "1856" "0" "1856" "0" "c.1856G>A" "r.(?)" "p.(Gly619Asp)" "" "0000873619" "00001220" "70" "2454" "0" "2461" "0" "c.2454_2461del" "r.(?)" "p.(Lys819Glyfs*26)" "" "0000893071" "00001220" "70" "247" "0" "247" "0" "c.247C>T" "r.(?)" "p.(Arg83Trp)" "" "0000893072" "00001220" "70" "403" "0" "403" "0" "c.403C>T" "r.(?)" "p.(Arg135Cys)" "" "0000893073" "00001220" "70" "539" "0" "539" "0" "c.539C>A" "r.(?)" "p.(Thr180Lys)" "" "0000893074" "00001220" "90" "923" "0" "923" "0" "c.923dup" "r.(?)" "p.(Ser309Ilefs*2)" "" "0000893075" "00001220" "70" "1049" "0" "1049" "0" "c.1049C>T" "r.(?)" "p.(Ser350Leu)" "" "0000893076" "00001220" "90" "1180" "1" "1180" "1" "c.1180+1G>T" "r.spl?" "p.?" "" "0000893077" "00001220" "10" "1567" "393" "1567" "393" "c.1567+393A>G" "r.(=)" "p.(=)" "" "0000893078" "00001220" "30" "1650" "0" "1650" "0" "c.1650C>T" "r.(?)" "p.(Ala550=)" "" "0000893079" "00001220" "70" "2115" "0" "2138" "0" "c.2115_2138dup" "r.(?)" "p.(Lys706_Ile713dup)" "" "0000893080" "00001220" "50" "2204" "0" "2204" "0" "c.2204C>G" "r.(?)" "p.(Pro735Arg)" "" "0000914648" "00001220" "30" "774" "0" "774" "0" "c.774C>T" "r.(?)" "p.(Asn258=)" "" "0000914649" "00001220" "30" "1392" "0" "1392" "0" "c.1392C>A" "r.(?)" "p.(Ala464=)" "" "0000914651" "00001220" "70" "2687" "0" "2687" "0" "c.2687G>A" "r.(?)" "p.(Arg896Gln)" "" "0000926305" "00001220" "50" "1044" "0" "1044" "0" "c.1044C>G" "r.(?)" "p.(Phe348Leu)" "" "0000926306" "00001220" "90" "1196" "0" "1202" "0" "c.1196_1202dup" "r.(?)" "p.(Ser402Ter)" "" "0000926307" "00001220" "70" "1844" "0" "1844" "0" "c.1844C>G" "r.(?)" "p.(Ser615Trp)" "" "0000926308" "00001220" "90" "1844" "0" "1844" "0" "c.1844C>T" "r.(?)" "p.(Ser615Leu)" "" "0000926309" "00001220" "70" "2951" "2" "2951" "2" "c.2951+2T>G" "r.spl?" "p.?" "" "0000933851" "00001220" "90" "283" "-438" "283" "-387" "c.283-438_283-387dup" "r.[282_283ins283-385_283-74,282_283ins283-385_283-95]" "p.?" "1i" "0000933852" "00001220" "10" "430" "-472" "430" "-461" "c.430-472_430-461del" "r.=" "p.=" "2i" "0000933853" "00001220" "90" "602" "-16" "602" "-16" "c.602-16G>A" "r.[601_621ins602-14_601-1,601_602ins[601+1_602-17;a;602-15_602-1]]" "p.?" "4i" "0000933854" "00001220" "90" "602" "-11" "602" "-11" "c.602-11T>A" "r.[601_621ins602-9_601-1,601_602ins[601+1_602-11;a;602-9_602-1]]" "p.?" "4i" "0000933855" "00001220" "90" "852" "243" "852" "243" "c.852+243C>T" "r.[852_853ins852+121_852+241,=]" "p.?" "6i" "0000933856" "00001220" "90" "1095" "4" "1095" "4" "c.1095+4A>G" "r.[965_1095del,=]" "p.?" "8i" "0000933857" "00001220" "90" "1567" "297" "1567" "297" "c.1567+297T>G" "r.1567_1568ins1567+298_1567+405" "p.?" "12i" "0000933858" "00001220" "90" "1670" "-191" "1670" "-191" "c.1670-191C>T" "r.1669_1670ins1670-430_1670-193" "p.?" "13i" "0000933859" "00001220" "90" "2037" "87" "2037" "87" "c.2037+87A>G" "r.2037_2038ins2037+1_2037+82" "p.?" "16i" "0000933860" "00001220" "10" "2368" "185" "2368" "185" "c.2368+185C>T" "r.=" "p.=" "19i" "0000933861" "00001220" "10" "2369" "-191" "2369" "-191" "c.2369-191C>T" "r.=" "p.=" "19i" "0000933862" "00001220" "90" "2447" "-38" "2447" "-20" "c.2447-38_2447-20del" "r.2446_2447ins[2447-105_2447-39;2447-19_2447-1]" "p.?" "20i" "0000933863" "00001220" "90" "2548" "253" "2548" "253" "c.2548+253C>T" "r.[2548_2549ins2548+162_2548+251,=]" "p.?" "21i" "0000933864" "00001220" "90" "2548" "255" "2548" "255" "c.2548+255G>A" "r.[2548_2549ins2548+162_2548+251,2548_2549ins2548+1_2548+251,=]" "p.?" "21i" "0000933865" "00001220" "10" "2549" "-218" "2549" "-215" "c.2549-218_2549-215del" "r.=" "p.=" "21i" "0000933866" "00001220" "50" "2951" "825" "2951" "825" "c.2951+825C>T" "r.spl?" "p.?" "25i" "0000934137" "00001220" "90" "1387" "0" "1387" "0" "c.1387G>A" "r.(?)" "p.(Gly463Arg)" "" "0000934138" "00001220" "90" "2883" "1" "2883" "1" "c.2883+1G>T" "r.spl" "p.?" "" "0000934139" "00001220" "90" "237" "0" "238" "0" "c.237_238dup" "r.(?)" "p.(Arg80ProfsTer35)" "" "0000934140" "00001220" "90" "2581" "0" "2581" "0" "c.2581C>T" "r.(?)" "p.(Arg861Cys)" "" "0000934141" "00001220" "90" "2581" "0" "2581" "0" "c.2581C>T" "r.(?)" "p.(Arg861Cys)" "" "0000934142" "00001220" "90" "2981" "0" "2981" "0" "c.2981G>A" "r.(?)" "p.(Cys994Tyr)" "" "0000934143" "00001220" "90" "1315" "0" "1315" "0" "c.1315G>A" "r.(?)" "p.(Gly439Ser)" "" "0000934144" "00001220" "90" "1387" "0" "1387" "0" "c.1387G>A" "r.(?)" "p.(Gly463Arg)" "" "0000934145" "00001220" "90" "2883" "1" "2883" "1" "c.2883+1G>T" "r.spl" "p.?" "" "0000934146" "00001220" "90" "473" "0" "473" "0" "c.473G>A" "r.(?)" "p.(Arg158Gln)" "" "0000934147" "00001220" "90" "1315" "0" "1315" "0" "c.1315G>A" "r.(?)" "p.(Gly439Ser)" "" "0000934148" "00001220" "90" "2748" "-2" "2748" "-2" "c.2748-2A>T" "r.spl" "p.?" "" "0000934149" "00001220" "90" "1" "0" "1" "0" "c.1A>G" "r.(?)" "p.(Ala2_Met53del)" "" "0000934150" "00001220" "90" "1924" "0" "1924" "0" "c.1924C>G" "r.(?)" "p.(Arg642Gly)" "" "0000934151" "00001220" "90" "2581" "0" "2581" "0" "c.2581C>T" "r.(?)" "p.(Arg861Cys)" "" "0000934152" "00001220" "70" "938" "0" "938" "0" "c.938C>T" "r.(?)" "p.(Ala313Val)" "" "0000934153" "00001220" "70" "938" "0" "938" "0" "c.938C>T" "r.(?)" "p.(Ala313Val)" "" "0000934154" "00001220" "70" "2548" "0" "2548" "0" "c.2548G>C" "r.(?)" "p.(Gly850Arg)" "" "0000934155" "00001220" "70" "2899" "0" "2899" "0" "c.2899A>T" "r.(?)" "p.(Arg967Trp)" "" "0000934156" "00001220" "70" "1175" "0" "1175" "0" "c.1175C>T" "r.(?)" "p.(Thr392Ile)" "" "0000934157" "00001220" "70" "1964" "0" "1964" "0" "c.1964G>A" "r.(?)" "p.(Arg655His)" "" "0000934158" "00001220" "90" "1180" "1" "1180" "1" "c.1180+1G>T" "r.spl" "p.?" "" "0000934159" "00001220" "90" "2581" "0" "2581" "0" "c.2581C>T" "r.(?)" "p.(Arg861Cys)" "" "0000934160" "00001220" "90" "2981" "0" "2981" "0" "c.2981G>A" "r.(?)" "p.(Cys994Tyr)" "" "0000934161" "00001220" "90" "2981" "0" "2981" "0" "c.2981G>A" "r.(?)" "p.(Cys994Tyr)" "" "0000934162" "00001220" "90" "2981" "0" "2981" "0" "c.2981G>A" "r.(?)" "p.(Cys994Tyr)" "" "0000934163" "00001220" "90" "2981" "0" "2981" "0" "c.2981G>A" "r.(?)" "p.(Cys994Tyr)" "" "0000934164" "00001220" "90" "2981" "0" "2981" "0" "c.2981G>A" "r.(?)" "p.(Cys994Tyr)" "" "0000934165" "00001220" "90" "1315" "0" "1315" "0" "c.1315G>A" "r.(?)" "p.(Gly439Ser)" "" "0000934166" "00001220" "90" "2576" "0" "2576" "0" "c.2576T>C" "r.(?)" "p.(Leu859Pro)" "" "0000934167" "00001220" "90" "2576" "0" "2576" "0" "c.2576T>C" "r.(?)" "p.(Leu859Pro)" "" "0000934168" "00001220" "90" "201" "0" "201" "0" "c.201T>A" "r.(?)" "p.(Tyr67Ter)" "" "0000934169" "00001220" "90" "" "0" "" "0" "c.(2951+1_2952-1)_*2445{0}" "r.?" "p.?" "25i_26_" "0000934170" "00001220" "90" "2981" "0" "2981" "0" "c.2981G>A" "r.(?)" "p.(Cys994Tyr)" "" "0000934171" "00001220" "90" "2191" "0" "2191" "0" "c.2191G>A" "r.(?)" "p.(Gly731Arg)" "" "0000934172" "00001220" "90" "2965" "0" "2965" "0" "c.2965G>A" "r.(?)" "p.(Gly989Arg)" "" "0000934173" "00001220" "90" "2965" "0" "2965" "0" "c.2965G>A" "r.(?)" "p.(Gly989Arg)" "" "0000934174" "00001220" "90" "2576" "0" "2576" "0" "c.2576T>C" "r.(?)" "p.(Leu859Pro)" "" "0000934175" "00001220" "90" "2581" "0" "2581" "0" "c.2581C>T" "r.(?)" "p.(Arg861Cys)" "" "0000934176" "00001220" "90" "2981" "0" "2981" "0" "c.2981G>A" "r.(?)" "p.(Cys994Tyr)" "" "0000934177" "00001220" "90" "2576" "0" "2576" "0" "c.2576T>C" "r.(?)" "p.(Leu859Pro)" "" "0000934178" "00001220" "90" "2981" "0" "2981" "0" "c.2981G>A" "r.(?)" "p.(Cys994Tyr)" "" "0000934179" "00001220" "70" "1444" "-2" "1462" "0" "c.1444-2_1462dup" "r.spl" "p.(Gln481_Gln487dup)" "" "0000934180" "00001220" "90" "2221" "0" "2221" "0" "c.2221G>A" "r.(?)" "p.(Gly741Arg)" "" "0000934181" "00001220" "70" "1388" "0" "1388" "0" "c.1388G>A" "r.(?)" "p.(Gly463Glu)" "" "0000934182" "00001220" "70" "671" "0" "671" "0" "c.671C>A" "r.(?)" "p.(Ala224Asp)" "" "0000934183" "00001220" "90" "2221" "0" "2221" "0" "c.2221G>A" "r.(?)" "p.(Gly741Arg)" "" "0000934184" "00001220" "90" "2576" "0" "2576" "0" "c.2576T>C" "r.(?)" "p.(Leu859Pro)" "" "0000934185" "00001220" "70" "1964" "0" "1964" "0" "c.1964G>A" "r.(?)" "p.(Arg655His)" "" "0000934186" "00001220" "70" "1390" "0" "1390" "0" "c.1390G>A" "r.(?)" "p.(Ala464Thr)" "" "0000934187" "00001220" "90" "2981" "0" "2981" "0" "c.2981G>A" "r.(?)" "p.(Cys994Tyr)" "" "0000934188" "00001220" "70" "160" "0" "160" "0" "c.160C>T" "r.(?)" "p.(Arg54Cys)" "" "0000934189" "00001220" "90" "1568" "-1" "1568" "-1" "c.1568-1G>A" "r.spl" "p.?" "" "0000934190" "00001220" "90" "2037" "1" "2037" "1" "c.2037+1G>A" "r.spl" "p.?" "" "0000934191" "00001220" "90" "3" "0" "3" "0" "c.3G>A" "r.(?)" "p.(Ala2_Met53del)" "" "0000934192" "00001220" "90" "247" "0" "247" "0" "c.247C>T" "r.(?)" "p.(Arg83Trp)" "" "0000934193" "00001220" "90" "2981" "0" "2981" "0" "c.2981G>A" "r.(?)" "p.(Cys994Tyr)" "" "0000934194" "00001220" "90" "1930" "0" "1930" "0" "c.1930del" "r.(?)" "p.(Gln644SerfsTer28)" "" "0000934195" "00001220" "90" "2965" "0" "2965" "0" "c.2965G>A" "r.(?)" "p.(Gly989Arg)" "" "0000934196" "00001220" "90" "2690" "0" "2690" "0" "c.2690T>C" "r.(?)" "p.(Leu897Pro)" "" "0000934197" "00001220" "90" "1196" "0" "1202" "0" "c.1196_1202dup" "r.(?)" "p.(Ser402Ter)" "" "0000934198" "00001220" "90" "1664" "0" "1664" "0" "c.1664C>T" "r.(?)" "p.(Ser555Leu)" "" "0000934199" "00001220" "90" "2844" "0" "2844" "0" "c.2844G>A" "r.(?)" "p.(Trp948Ter)" "" "0000934200" "00001220" "70" "938" "0" "938" "0" "c.938C>T" "r.(?)" "p.(Ala313Val)" "" "0000934201" "00001220" "70" "1390" "0" "1390" "0" "c.1390G>A" "r.(?)" "p.(Ala464Thr)" "" "0000934202" "00001220" "70" "602" "0" "602" "0" "c.602G>T" "r.(?)" "p.(Gly201Val)" "" "0000934203" "00001220" "70" "1928" "0" "1928" "0" "c.1928C>T" "r.(?)" "p.(Pro643Leu)" "" "0000934204" "00001220" "70" "514" "0" "514" "0" "c.514T>C" "r.(?)" "p.(Trp172Arg)" "" "0000934205" "00001220" "50" "1349" "0" "1349" "0" "c.1349T>G" "r.(?)" "p.(Val450Gly)" "" "0000934206" "00001220" "50" "965" "0" "965" "0" "c.965C>T" "r.(?)" "p.(Ala322Val)" "" "0000934207" "00001220" "50" "1648" "0" "1648" "0" "c.1648G>A" "r.(?)" "p.(Ala550Thr)" "" "0000934208" "00001220" "50" "2773" "0" "2773" "0" "c.2773G>T" "r.(?)" "p.(Ala925Ser)" "" "0000934209" "00001220" "50" "727" "0" "727" "0" "c.727C>T" "r.(?)" "p.(Arg243Trp)" "" "0000934210" "00001220" "50" "334" "0" "334" "0" "c.334G>C" "r.(?)" "p.(Glu112Gln)" "" "0000934211" "00001220" "50" "791" "0" "791" "0" "c.791G>A" "r.(?)" "p.(Gly264Asp)" "" "0000934212" "00001220" "50" "2336" "0" "2336" "0" "c.2336G>A" "r.(?)" "p.(Gly779Glu)" "" "0000934213" "00001220" "50" "887" "0" "887" "0" "c.887C>T" "r.(?)" "p.(Ser296Phe)" "" "0000934214" "00001220" "50" "3083" "0" "3083" "0" "c.3083A>G" "r.(?)" "p.(Tyr1028Cys)" "" "0000934215" "00001220" "30" "2368" "185" "2368" "185" "c.2368+185C>T" "r.=" "p.=" "" "0000934216" "00001220" "90" "2581" "0" "2581" "0" "c.2581C>T" "r.(?)" "p.(Arg861Cys)" "" "0000934217" "00001220" "70" "947" "0" "947" "0" "c.947G>T" "r.(?)" "p.(Gly316Val)" "" "0000934218" "00001220" "90" "2581" "0" "2581" "0" "c.2581C>T" "r.(?)" "p.(Arg861Cys)" "" "0000934219" "00001220" "90" "247" "0" "247" "0" "c.247C>T" "r.(?)" "p.(Arg83Trp)" "" "0000934220" "00001220" "50" "1349" "0" "1349" "0" "c.1349T>G" "r.(?)" "p.(Val450Gly)" "" "0000934221" "00001220" "90" "2981" "0" "2981" "0" "c.2981G>A" "r.(?)" "p.(Cys994Tyr)" "" "0000934222" "00001220" "90" "1930" "0" "1930" "0" "c.1930del" "r.(?)" "p.(Gln644SerfsTer28)" "" "0000934223" "00001220" "90" "2581" "0" "2581" "0" "c.2581C>T" "r.(?)" "p.(Arg861Cys)" "" "0000934224" "00001220" "50" "1832" "0" "1832" "0" "c.1832A>G" "r.(?)" "p.(Asn611Ser)" "" "0000934225" "00001220" "50" "1477" "0" "1477" "0" "c.1477G>A" "r.(?)" "p.(Gly493Ser)" "" "0000934226" "00001220" "70" "184" "0" "184" "0" "c.184G>A" "r.(?)" "p.(Asp62Asn)" "" "0000934227" "00001220" "90" "2981" "0" "2981" "0" "c.2981G>A" "r.(?)" "p.(Cys994Tyr)" "" "0000934228" "00001220" "70" "463" "0" "463" "0" "c.463C>T" "r.(?)" "p.(Leu155Phe)" "" "0000934229" "00001220" "50" "2329" "0" "2329" "0" "c.2329C>T" "r.(?)" "p.(Arg777Trp)" "" "0000934230" "00001220" "50" "1486" "0" "1486" "0" "c.1486G>T" "r.(?)" "p.(Gly496Cys)" "" "0000934231" "00001220" "90" "1805" "0" "1806" "0" "c.1805_1806del" "r.(?)" "p.(Tyr602CysfsTer31)" "" "0000934232" "00001220" "90" "2576" "0" "2576" "0" "c.2576T>C" "r.(?)" "p.(Leu859Pro)" "" "0000934233" "00001220" "90" "2576" "0" "2576" "0" "c.2576T>C" "r.(?)" "p.(Leu859Pro)" "" "0000934234" "00001220" "70" "815" "0" "815" "0" "c.815T>C" "r.(?)" "p.(Leu272Pro)" "" "0000934235" "00001220" "90" "1925" "0" "1925" "0" "c.1925G>A" "r.(?)" "p.(Arg642His)" "" "0000934236" "00001220" "90" "2576" "0" "2576" "0" "c.2576T>C" "r.(?)" "p.(Leu859Pro)" "" "0000934237" "00001220" "90" "1315" "0" "1315" "0" "c.1315G>A" "r.(?)" "p.(Gly439Ser)" "" "0000934238" "00001220" "50" "2497" "0" "2497" "0" "c.2497T>A" "r.(?)" "p.(Ser833Thr)" "" "0000934239" "00001220" "70" "557" "0" "557" "0" "c.557G>A" "r.(?)" "p.(Gly186Asp)" "" "0000934240" "00001220" "90" "247" "0" "247" "0" "c.247C>T" "r.(?)" "p.(Arg83Trp)" "" "0000934241" "00001220" "90" "625" "0" "625" "0" "c.625C>T" "r.(?)" "p.(Arg209Trp)" "" "0000934242" "00001220" "90" "1096" "-540" "1181" "-347" "c.1096-540_1181-347del" "r.(1096_1180del)" "p.(Asp366Alafs*12)" "" "0000934243" "00001220" "90" "2660" "1" "2660" "1" "c.2660+1G>A" "r.spl" "p.?" "" "0000934244" "00001220" "90" "2883" "1" "2883" "1" "c.2883+1G>T" "r.spl" "p.?" "" "0000934245" "00001220" "90" "1687" "0" "1687" "0" "c.1687C>T" "r.(?)" "p.(Gln563Ter)" "" "0000934246" "00001220" "90" "179" "0" "179" "0" "c.179C>T" "r.(?)" "p.(Thr60Met)" "" "0000934247" "00001220" "90" "1670" "-191" "1670" "-191" "c.1670-191C>T" "r.(1669_1670ins1670-430_1670-193)" "p.(Gly557_Trp558insHisLeuHisArgSerGlnCysVal*)" "" "0000934248" "00001220" "90" "1670" "-191" "1670" "-191" "c.1670-191C>T" "r.(1669_1670ins1670-430_1670-193)" "p.(Gly557_Trp558insHisLeuHisArgSerGlnCysVal*)" "" "0000934249" "00001220" "90" "644" "0" "644" "0" "c.644T>C" "r.(?)" "p.(Leu215Pro)" "" "0000934250" "00001220" "70" "938" "0" "938" "0" "c.938C>T" "r.(?)" "p.(Ala313Val)" "" "0000934251" "00001220" "90" "602" "-16" "602" "-16" "c.602-16G>A" "r.[(601_621ins602-14_601-1,601_602ins[601+1_602-17;a;602-15_602-1])]" "p.(Ser200_Gly201insAlaLeuPro*)" "" "0000934252" "00001220" "70" "2626" "0" "2626" "0" "c.2626G>A" "r.(?)" "p.(Gly876Ser)" "" "0000934253" "00001220" "70" "2447" "-38" "2447" "-20" "c.2447-38_2447-20del" "r.(2446_2447ins[2447-105_2447-39;2447-19_2447-1])" "p.(Ala815_Leu816ins*)" "" "0000934254" "00001220" "90" "1670" "-191" "1670" "-191" "c.1670-191C>T" "r.(1669_1670ins1670-430_1670-193)" "p.(Gly557_Trp558insHisLeuHisArgSerGlnCysVal*)" "" "0000934255" "00001220" "90" "1670" "-191" "1670" "-191" "c.1670-191C>T" "r.(1669_1670ins1670-430_1670-193)" "p.(Gly557_Trp558insHisLeuHisArgSerGlnCysVal*)" "" "0000934256" "00001220" "70" "283" "-435" "283" "-384" "c.283-435_283-384dup" "r.[(282_283ins283-385_283-74,282_283ins283-385_283-95)]" "p.?" "" "0000934257" "00001220" "70" "2883" "0" "2883" "0" "c.2883G>A" "r.spl" "p.?" "" "0000934258" "00001220" "70" "2883" "0" "2883" "0" "c.2883G>A" "r.spl" "p.?" "" "0000934259" "00001220" "70" "71" "0" "71" "0" "c.71C>T" "r.(?)" "p.(Thr24Ile)" "" "0000934260" "00001220" "90" "1925" "0" "1925" "0" "c.1925G>A" "r.(?)" "p.(Arg642His)" "" "0000934261" "00001220" "90" "1315" "0" "1315" "0" "c.1315G>A" "r.(?)" "p.(Gly439Ser)" "" "0000934262" "00001220" "90" "1924" "0" "1924" "0" "c.1924C>G" "r.(?)" "p.(Arg642Gly)" "" "0000934263" "00001220" "90" "1180" "1" "1180" "1" "c.1180+1G>T" "r.spl" "p.?" "" "0000934264" "00001220" "90" "1195" "0" "1195" "0" "c.1195C>T" "r.(?)" "p.(Arg399Cys)" "" "0000934265" "00001220" "90" "2687" "0" "2687" "0" "c.2687G>A" "r.(?)" "p.(Arg896Gln)" "" "0000934266" "00001220" "90" "964" "1" "964" "1" "c.964+1G>T" "r.spl" "p.?" "" "0000934267" "00001220" "90" "2687" "0" "2687" "0" "c.2687G>A" "r.(?)" "p.(Arg896Gln)" "" "0000934268" "00001220" "90" "2981" "0" "2981" "0" "c.2981G>A" "r.(?)" "p.(Cys994Tyr)" "" "0000934269" "00001220" "90" "429" "1" "429" "28" "c.429+1_429+28del" "r.spl" "p.?" "" "0000934270" "00001220" "90" "2576" "0" "2576" "0" "c.2576T>C" "r.(?)" "p.(Leu859Pro)" "" "0000934271" "00001220" "90" "1670" "-191" "1670" "-191" "c.1670-191C>T" "r.(1669_1670ins1670-430_1670-193)" "p.(Gly557_Trp558insHisLeuHisArgSerGlnCysVal*)" "" "0000934272" "00001220" "90" "1670" "-191" "1670" "-191" "c.1670-191C>T" "r.(1669_1670ins1670-430_1670-193)" "p.(Gly557_Trp558insHisLeuHisArgSerGlnCysVal*)" "" "0000934273" "00001220" "70" "852" "243" "852" "243" "c.852+243C>T" "r.[(852_853ins852+121_852+241,=)]" "p.?" "" "0000934274" "00001220" "70" "852" "243" "852" "243" "c.852+243C>T" "r.[(852_853ins852+121_852+241,=)]" "p.?" "" "0000934275" "00001220" "90" "2221" "0" "2221" "0" "c.2221G>A" "r.(?)" "p.(Gly741Arg)" "" "0000934276" "00001220" "70" "938" "0" "938" "0" "c.938C>T" "r.(?)" "p.(Ala313Val)" "" "0000934277" "00001220" "70" "2037" "87" "2037" "87" "c.2037+87A>G" "r.(2037_2038ins2037+1_2037+82)" "p.(Gly680Valfs*36)" "" "0000934278" "00001220" "70" "514" "0" "514" "0" "c.514T>C" "r.(?)" "p.(Trp172Arg)" "" "0000934279" "00001220" "90" "1095" "4" "1095" "4" "c.1095+4A>G" "r.[(965_1095del,=)]" "p.(Ala322Glyfs*35)" "" "0000934280" "00001220" "70" "2548" "255" "2548" "255" "c.2548+255G>A" "r.[(2548_2549ins2548+162_2548+251,2548_2549ins2548+1_2548+251,=)]" "p.(Gly849_Gly850insValPheTrpLeu*)" "" "0000934281" "00001220" "90" "1670" "-191" "1670" "-191" "c.1670-191C>T" "r.(1669_1670ins1670-430_1670-193)" "p.(Gly557_Trp558insHisLeuHisArgSerGlnCysVal*)" "" "0000934282" "00001220" "90" "602" "-16" "602" "-16" "c.602-16G>A" "r.[(601_621ins602-14_601-1,601_602ins[601+1_602-17;a;602-15_602-1])]" "p.(Ser200_Gly201insAlaLeuPro*)" "" "0000934283" "00001220" "70" "2542" "0" "2542" "0" "c.2542G>A" "r.(?)" "p.(Asp848Asn)" "" "0000934284" "00001220" "70" "2213" "0" "2213" "0" "c.2213T>G" "r.(?)" "p.(Leu738Arg)" "" "0000934285" "00001220" "50" "2951" "825" "2951" "825" "c.2951+825C>T" "r.spl?" "p.(?)" "" "0000934286" "00001220" "50" "1148" "0" "1148" "0" "c.1148C>A" "r.(?)" "p.(Thr383Asn)" "" "0000934287" "00001220" "50" "2952" "-33" "2952" "-33" "c.2952-33A>G" "r.spl?" "p.?" "" "0000934288" "00001220" "30" "430" "-472" "430" "-461" "c.430-472_430-461del" "r.=" "p.=" "" "0000934289" "00001220" "30" "2549" "-218" "2549" "-215" "c.2549-218_2549-215del" "r.=" "p.=" "" "0000934290" "00001220" "30" "2369" "-191" "2369" "-191" "c.2369-191C>T" "r.=" "p.(=)" "" "0000934291" "00001220" "90" "2981" "0" "2981" "0" "c.2981G>A" "r.(?)" "p.(Cys994Tyr)" "" "0000934292" "00001220" "70" "602" "-11" "602" "-11" "c.602-11T>A" "r.[(601_621ins602-9_601-1,601_602ins[601+1_602-11;a;602-9_602-1])]" "p.(Ser200_Gly201insAlaLeuIle)" "" "0000934295" "00001220" "70" "2661" "-1" "2747" "1" "c.(2660+1_2661-1)_(2747+1_2748-1)del" "r.?" "p.?" "22i_23i" "0000934296" "00001220" "90" "" "0" "" "0" "c.(2951+1_2952-1)_*2445{0}" "r.?" "p.?" "25i_26_" "0000934297" "00001220" "90" "2660" "1" "2660" "1" "c.2660+1G>A" "r.?" "-" "" "0000950682" "00001220" "90" "644" "0" "644" "0" "c.644T>C" "r.(?)" "p.(Leu215Pro)" "" "0000950684" "00001220" "70" "2159" "0" "2159" "0" "c.2159G>A" "r.(?)" "p.(Gly720Asp)" "" "0000950685" "00001220" "90" "2221" "0" "2221" "0" "c.2221G>A" "r.(?)" "p.(Gly741Arg)" "" "0000968408" "00001220" "10" "506" "-316" "506" "-316" "c.506-316C>T" "r.(=)" "p.(=)" "" "0000968409" "00001220" "30" "852" "7" "852" "9" "c.852+7_852+9del" "r.(=)" "p.(=)" "" "0000968410" "00001220" "90" "1840" "0" "1840" "0" "c.1840T>C" "r.(?)" "p.(Ser614Pro)" "" "0000981954" "00001220" "50" "704" "0" "704" "0" "c.704C>T" "r.(?)" "p.(Thr235Met)" "" "0000981955" "00001220" "30" "741" "9" "741" "9" "c.741+9G>A" "r.(=)" "p.(=)" "" "0000981956" "00001220" "90" "1670" "-191" "1670" "-191" "c.1670-191C>T" "r.(=)" "p.(=)" "" "0000985254" "00001220" "70" "179" "0" "179" "0" "c.179C>T" "r.(?)" "p.(Thr60Met)" "" "0000985255" "00001220" "70" "1316" "0" "1316" "0" "c.1316G>T" "r.(?)" "p.(Gly439Val)" "" "0000989988" "00001220" "90" "2089" "0" "2095" "0" "c.2089_2095del" "r.(?)" "p.(Thr697GlyfsTer2)" "" "0001002432" "00001220" "70" "1458" "0" "1458" "0" "c.1458C>G" "r.(?)" "p.(Asp486Glu)" "" "0001007037" "00001220" "70" "1261" "0" "1261" "0" "c.1261T>C" "r.(?)" "p.(Cys421Arg)" "10" "0001015397" "00001220" "70" "2204" "0" "2204" "0" "c.2204C>G" "r.(?)" "p.(Pro735Arg)" "" "0001026723" "00001220" "90" "911" "0" "911" "0" "c.911C>T" "r.(?)" "p.(Thr304Met)" "" "0001026724" "00001220" "90" "3006" "0" "3006" "0" "c.3006G>C" "r.(?)" "p.(Trp1002Cys)" "" "0001041206" "00001220" "50" "322" "0" "322" "0" "c.322C>T" "r.(?)" "p.(Arg108Trp)" "" "0001041207" "00001220" "50" "1096" "-29" "1096" "-6" "c.1096-29_1096-6del" "r.(=)" "p.(=)" "" "0001041208" "00001220" "70" "1390" "0" "1390" "0" "c.1390G>A" "r.(?)" "p.(Ala464Thr)" "" "0001041209" "00001220" "50" "1519" "0" "1519" "0" "c.1519C>T" "r.(?)" "p.(Arg507Cys)" "" "0001055604" "00001220" "50" "2152" "0" "2152" "0" "c.2152C>T" "r.(?)" "p.(Arg718Cys)" "" "0001055605" "00001220" "90" "2221" "0" "2221" "0" "c.2221G>A" "r.(?)" "p.(Gly741Arg)" "" "0001055606" "00001220" "50" "2236" "0" "2236" "0" "c.2236T>C" "r.(?)" "p.(Trp746Arg)" "" "0001066500" "00001220" "70" "2037" "4" "2037" "4" "c.2037+4A>G" "r.spl?" "p.?" "" "0001066501" "00001220" "50" "2783" "0" "2783" "0" "c.2783G>A" "r.(?)" "p.(Arg928His)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 248 "{{screeningid}}" "{{variantid}}" "0000000209" "0000005612" "0000000210" "0000013579" "0000080987" "0000130073" "0000108349" "0000715038" "0000271074" "0000624926" "0000271074" "0000624927" "0000292662" "0000649351" "0000292663" "0000649352" "0000292664" "0000649353" "0000292665" "0000649354" "0000305649" "0000669337" "0000309150" "0000683629" "0000309150" "0000683630" "0000321437" "0000704279" "0000321437" "0000704280" "0000321438" "0000704281" "0000321439" "0000704282" "0000321439" "0000704283" "0000321440" "0000704284" "0000321440" "0000704285" "0000321441" "0000704286" "0000321441" "0000704287" "0000321442" "0000704288" "0000321442" "0000704289" "0000321442" "0000704290" "0000321457" "0000704306" "0000321457" "0000704307" "0000321458" "0000704308" "0000321459" "0000704309" "0000321459" "0000704310" "0000321460" "0000704311" "0000321460" "0000704312" "0000321460" "0000704313" "0000321461" "0000704314" "0000321461" "0000704315" "0000321462" "0000704316" "0000321463" "0000704317" "0000321463" "0000704318" "0000321463" "0000704319" "0000321464" "0000704320" "0000321464" "0000704321" "0000321465" "0000704322" "0000321466" "0000704323" "0000321466" "0000704324" "0000321467" "0000704325" "0000321467" "0000704326" "0000321468" "0000704327" "0000321469" "0000704371" "0000321469" "0000704372" "0000321497" "0000704373" "0000321497" "0000704374" "0000321498" "0000704375" "0000321498" "0000704376" "0000321499" "0000704377" "0000321500" "0000704378" "0000321501" "0000704379" "0000321501" "0000704380" "0000321501" "0000704381" "0000321502" "0000704382" "0000321502" "0000704383" "0000321503" "0000704384" "0000321503" "0000704385" "0000321504" "0000704386" "0000321504" "0000704387" "0000321505" "0000704388" "0000321506" "0000704389" "0000332822" "0000730109" "0000332822" "0000730110" "0000363230" "0000763738" "0000363239" "0000763805" "0000374587" "0000785378" "0000374587" "0000785379" "0000396300" "0000827869" "0000396301" "0000827870" "0000396301" "0000827903" "0000396302" "0000827871" "0000396302" "0000827904" "0000396303" "0000827872" "0000396303" "0000827905" "0000396305" "0000827874" "0000415644" "0000873483" "0000415644" "0000873484" "0000415690" "0000873549" "0000415738" "0000873618" "0000415738" "0000873619" "0000438513" "0000934137" "0000438513" "0000934239" "0000438514" "0000934138" "0000438514" "0000934240" "0000438515" "0000934139" "0000438515" "0000934241" "0000438516" "0000934140" "0000438516" "0000934242" "0000438517" "0000934141" "0000438517" "0000934243" "0000438518" "0000934142" "0000438518" "0000934244" "0000438519" "0000934143" "0000438519" "0000934245" "0000438520" "0000934144" "0000438520" "0000934246" "0000438521" "0000934145" "0000438521" "0000934247" "0000438522" "0000934146" "0000438522" "0000934248" "0000438523" "0000934147" "0000438523" "0000934249" "0000438524" "0000934148" "0000438524" "0000934250" "0000438525" "0000934149" "0000438525" "0000934251" "0000438526" "0000934150" "0000438526" "0000934252" "0000438527" "0000934151" "0000438527" "0000934253" "0000438528" "0000934152" "0000438528" "0000934254" "0000438529" "0000934153" "0000438529" "0000934255" "0000438530" "0000934154" "0000438530" "0000934256" "0000438531" "0000934155" "0000438531" "0000934257" "0000438532" "0000934156" "0000438532" "0000934258" "0000438533" "0000934157" "0000438533" "0000934259" "0000438534" "0000934158" "0000438534" "0000934260" "0000438535" "0000934159" "0000438535" "0000934261" "0000438536" "0000934160" "0000438536" "0000934262" "0000438537" "0000934161" "0000438537" "0000934263" "0000438538" "0000934162" "0000438538" "0000934264" "0000438539" "0000934163" "0000438539" "0000934265" "0000438540" "0000934164" "0000438540" "0000934266" "0000438541" "0000934165" "0000438541" "0000934267" "0000438542" "0000934166" "0000438542" "0000934268" "0000438543" "0000934167" "0000438543" "0000934269" "0000438544" "0000934168" "0000438544" "0000934270" "0000438545" "0000934169" "0000438545" "0000934271" "0000438546" "0000934170" "0000438546" "0000934272" "0000438547" "0000934171" "0000438547" "0000934273" "0000438548" "0000934172" "0000438548" "0000934274" "0000438549" "0000934173" "0000438549" "0000934275" "0000438550" "0000934174" "0000438550" "0000934276" "0000438551" "0000934175" "0000438551" "0000934277" "0000438552" "0000934176" "0000438552" "0000934278" "0000438553" "0000934177" "0000438553" "0000934279" "0000438554" "0000934178" "0000438554" "0000934280" "0000438555" "0000934179" "0000438555" "0000934281" "0000438556" "0000934180" "0000438556" "0000934282" "0000438557" "0000934181" "0000438557" "0000934283" "0000438558" "0000934182" "0000438558" "0000934284" "0000438559" "0000934183" "0000438559" "0000934285" "0000438560" "0000934184" "0000438560" "0000934286" "0000438561" "0000934185" "0000438561" "0000934287" "0000438562" "0000934186" "0000438562" "0000934288" "0000438563" "0000934187" "0000438563" "0000934289" "0000438564" "0000934188" "0000438564" "0000934290" "0000438565" "0000934189" "0000438566" "0000934190" "0000438567" "0000934191" "0000438568" "0000934192" "0000438569" "0000934193" "0000438570" "0000934194" "0000438571" "0000934195" "0000438572" "0000934196" "0000438572" "0000934295" "0000438573" "0000934197" "0000438574" "0000934198" "0000438575" "0000934199" "0000438576" "0000934200" "0000438577" "0000934201" "0000438578" "0000934202" "0000438579" "0000934203" "0000438580" "0000934204" "0000438581" "0000934205" "0000438581" "0000934291" "0000438582" "0000934206" "0000438583" "0000934207" "0000438584" "0000934208" "0000438585" "0000934209" "0000438586" "0000934210" "0000438587" "0000934211" "0000438588" "0000934212" "0000438589" "0000934213" "0000438590" "0000934214" "0000438590" "0000934296" "0000438591" "0000934215" "0000438592" "0000934216" "0000438593" "0000934217" "0000438594" "0000934218" "0000438595" "0000934219" "0000438596" "0000934220" "0000438597" "0000934221" "0000438598" "0000934222" "0000438599" "0000934223" "0000438600" "0000934224" "0000438601" "0000934225" "0000438602" "0000934226" "0000438603" "0000934227" "0000438604" "0000934228" "0000438605" "0000934229" "0000438606" "0000934230" "0000438607" "0000934231" "0000438607" "0000934297" "0000438608" "0000934232" "0000438608" "0000934292" "0000438609" "0000934233" "0000438610" "0000934234" "0000438611" "0000934235" "0000438612" "0000934236" "0000438613" "0000934237" "0000438614" "0000934238" "0000451389" "0000985254" "0000451389" "0000985255" "0000455019" "0000989988" "0000455060" "0001007037"