### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = SLC24A1) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "SLC24A1" "solute carrier family 24 (sodium/potassium/calcium exchanger), member 1" "15" "q22" "unknown" "NG_031968.2" "UD_134408325454" "" "https://www.LOVD.nl/SLC24A1" "" "1" "10975" "9187" "603617" "1" "1" "1" "1" "This database is one of the \"Eye disease\" gene variant databases.\r\nEstablishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "" "g" "https://databases.lovd.nl/shared/refseq/SLC24A1_codingDNA.html" "1" "" "This database is one of the \"Eye disease\" gene variant databases." "-1" "" "-1" "00001" "2012-07-13 00:00:00" "00006" "2020-11-26 19:18:29" "00000" "2025-11-01 13:22:20" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00019178" "SLC24A1" "transcript variant 1" "001" "NM_004727.2" "" "NP_004718.1" "" "" "" "-287" "5481" "3300" "65914270" "65948598" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 5 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00112" "RP" "retinitis pigmentosa (RP)" "" "268000" "" "" "" "00001" "2013-02-21 17:12:36" "00006" "2021-01-18 09:53:26" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "03453" "CSNB1D" "blindness, night, stationary, congenital, type 1D (CSNB-1D)" "" "613830" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "04214" "-" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00001" "2023-03-09 14:26:26" "05130" "CSNB" "blindness, night, stationary, congenital (CSNB)" "" "" "" "" "" "00006" "2016-02-03 23:24:36" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 1 "{{geneid}}" "{{diseaseid}}" "SLC24A1" "03453" ## Individuals ## Do not remove or alter this header ## ## Count = 51 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00058628" "" "" "" "1" "" "00228" "{PMID:Neuillé 2016:26822852}" "" "" "" "" "" "0" "" "" "" "" "00058629" "" "" "" "1" "" "00228" "{PMID:Neuillé 2016:26822852}" "" "" "" "" "" "0" "" "" "" "" "00058630" "" "" "" "1" "" "00228" "{PMID:Neuillé 2016:26822852}" "" "" "yes" "" "" "0" "" "" "" "" "00095957" "" "" "" "1" "" "01769" "{PMID:Li 2017:28418496}" "" "M" "yes" "Pakistan" "" "0" "" "" "Pakistani" "61070" "00100087" "" "" "" "1" "" "01769" "{PMID:Maranha 2015:26352687}, {DOI:Maranhao 2015:10.1371/journal.pone.0136561}, {PMID:Li 2017:28418496}" "" "F" "yes" "Pakistan" "" "0" "" "" "Pakistani" "PKRD138;61138" "00291278" "" "" "" "7" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00299641" "" "" "" "1" "" "00006" "{PMID:Arno 2017:28132693}" "2-generation family, 1 affeted" "M" "" "" "" "0" "" "" "" "FamGC3626Pat2" "00333364" "" "" "" "1" "" "00000" "{PMID:Costa 2017:28912962}" "" "F" "" "Brazil" "" "0" "" "" "" "Pat4" "00333858" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "M" "" "(United States)" "" "0" "" "" "" "78" "00335169" "" "" "" "1" "" "00000" "{PMID:Haer-Wigman 2017:28224992}" "family" "" "no" "Netherlands" "" "0" "" "" "" "7909" "00335994" "" "" "" "1" "" "00000" "{PMID:Sergouniotis 2016:27628848}" "analysis 486 cases" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00335995" "" "" "" "2" "" "00000" "{PMID:Sergouniotis 2016:27628848}" "analysis 486 cases" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00358748" "" "" "" "1" "" "00000" "{PMID:Carrigan 2016:27624628}" "" "" "" "Ireland" "" "0" "" "" "" "" "00358947" "" "" "" "1" "" "00000" "{PMID:Tiwari 2016:27353947}" "see paper" "F" "" "Switzerland" "" "0" "" "" "" "Case71472" "00383926" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-0553" "00384158" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-2782" "00414118" "" "" "" "1" "" "00000" "{PMID:Sharon 2002:12037007}" "" "?" "" "" "" "0" "" "" "" "243-002" "00414119" "" "" "" "1" "" "00000" "{PMID:Sharon 2002:12037007}" "" "?" "" "" "" "0" "" "" "" "088-005" "00414120" "" "" "" "1" "" "00000" "{PMID:Sharon 2002:12037007}" "" "?" "" "" "" "0" "" "" "" "003-185" "00414121" "" "" "" "1" "" "00000" "{PMID:Sharon 2002:12037007}" "" "?" "" "" "" "0" "" "" "" "233-010" "00414122" "" "" "" "1" "" "00000" "{PMID:Sharon 2002:12037007}" "" "?" "" "" "" "0" "" "" "" "038-051" "00414123" "" "" "" "1" "" "00000" "{PMID:Sharon 2002:12037007}" "" "?" "" "" "" "0" "" "" "" "263 patients" "00414124" "" "" "" "1" "" "00000" "{PMID:Sharon 2002:12037007}" "" "?" "" "" "" "0" "" "" "" "187-001" "00414125" "" "" "" "1" "" "00000" "{PMID:Sharon 2002:12037007}" "" "?" "" "" "" "0" "" "" "" "3 patients: 001-346, 088-004, 099-026" "00414126" "" "" "" "1" "" "00000" "{PMID:Sharon 2002:12037007}" "" "?" "" "" "" "0" "" "" "" "92 patients" "00414127" "" "" "" "1" "" "00000" "{PMID:Sharon 2002:12037007}" "" "?" "" "" "" "0" "" "" "" "048-036" "00414128" "" "" "" "1" "" "00000" "{PMID:Sharon 2002:12037007}" "" "?" "" "" "" "0" "" "" "" "2 patients: 003-112, 003-114" "00414129" "" "" "" "1" "" "00000" "{PMID:Sharon 2002:12037007}" "" "?" "" "" "" "0" "" "" "" "001-217" "00414130" "" "" "" "1" "" "00000" "{PMID:Sharon 2002:12037007}" "" "?" "" "" "" "0" "" "" "" "?" "00414131" "" "" "" "1" "" "00000" "{PMID:Sharon 2002:12037007}" "" "?" "" "" "" "0" "" "" "" "048-069" "00414132" "" "" "" "1" "" "00000" "{PMID:Sharon 2002:12037007}" "" "?" "" "" "" "0" "" "" "" "063-008" "00414133" "" "" "" "1" "" "00000" "{PMID:Sharon 2002:12037007}" "" "?" "" "" "" "0" "" "" "" "?" "00414134" "" "" "" "1" "" "00000" "{PMID:Sharon 2002:12037007}" "" "?" "" "" "" "0" "" "" "" "121-245" "00414135" "" "" "" "1" "" "00000" "{PMID:Sharon 2002:12037007}" "" "?" "" "" "" "0" "" "" "" "274-011" "00414136" "" "" "" "1" "" "00000" "{PMID:Sharon 2002:12037007}" "" "?" "" "" "" "0" "" "" "" "121-067" "00414137" "" "" "" "1" "" "00000" "{PMID:Sharon 2002:12037007}" "" "?" "" "" "" "0" "" "" "" "041-001" "00414138" "" "" "" "1" "" "00000" "{PMID:Sharon 2002:12037007}" "" "?" "" "" "" "0" "" "" "" "003-128" "00414139" "" "" "" "1" "" "00000" "{PMID:Sharon 2002:12037007}" "" "?" "" "" "" "0" "" "" "" "2 patients: 001-412, 001-459" "00414140" "" "" "" "1" "" "00000" "{PMID:Sharon 2002:12037007}" "" "?" "" "" "" "0" "" "" "" "?" "00414141" "" "" "" "1" "" "00000" "{PMID:Sharon 2002:12037007}" "" "?" "" "" "" "0" "" "" "" "?" "00414142" "" "" "" "1" "" "00000" "{PMID:Sharon 2002:12037007}" "" "?" "" "" "" "0" "" "" "" "003-156" "00414143" "" "" "" "1" "" "00000" "{PMID:Sharon 2002:12037007}" "" "?" "" "" "" "0" "" "" "" "?" "00414144" "" "" "" "1" "" "00000" "{PMID:Sharon 2002:12037007}" "" "?" "" "" "" "0" "" "" "" "2 patients: 003-147, 274-008" "00414145" "" "" "" "1" "" "00000" "{PMID:Sharon 2002:12037007}" "" "?" "" "" "" "0" "" "" "" "009-012" "00414160" "" "" "" "1" "" "00000" "{PMID:Riazuddin 2010:20850105}" "Family PKRP070" "F" "yes" "Pakistan" "" "0" "" "" "Punjab" "14" "00414161" "" "" "" "1" "" "00000" "{PMID:Riazuddin 2010:20850105}" "Family PKRP070" "M" "yes" "Pakistan" "" "0" "" "" "Punjab" "18" "00414162" "" "" "" "1" "" "00000" "{PMID:Riazuddin 2010:20850105}" "Family PKRP070" "F" "yes" "Pakistan" "" "0" "" "" "Punjab" "25" "00414163" "" "" "" "1" "" "00000" "{PMID:Riazuddin 2010:20850105}" "Family PKRP070" "M" "yes" "Pakistan" "" "0" "" "" "Punjab" "28" "00414164" "" "" "" "1" "" "00000" "{PMID:Riazuddin 2010:20850105}" "Family PKRP070" "F" "yes" "Pakistan" "" "0" "" "" "Punjab" "34" "00429762" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00447014" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "F" "" "Germany" "" "0" "" "" "" "ARRP-482" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 51 "{{individualid}}" "{{diseaseid}}" "00058628" "05130" "00058629" "05130" "00058630" "05130" "00095957" "05130" "00100087" "04214" "00291278" "00198" "00299641" "04214" "00333364" "04214" "00333858" "04214" "00335169" "00198" "00335994" "04214" "00335995" "04214" "00358748" "04214" "00358947" "04214" "00383926" "04214" "00384158" "04214" "00414118" "04214" "00414119" "04214" "00414120" "04214" "00414121" "04214" "00414122" "04214" "00414123" "04214" "00414124" "04214" "00414125" "04214" "00414126" "04214" "00414127" "04214" "00414128" "04214" "00414129" "04214" "00414130" "04214" "00414131" "04214" "00414132" "04214" "00414133" "04214" "00414134" "04214" "00414135" "04214" "00414136" "04214" "00414137" "04214" "00414138" "04214" "00414139" "04214" "00414140" "04214" "00414141" "04214" "00414142" "04214" "00414143" "04214" "00414144" "04214" "00414145" "04214" "00414160" "04214" "00414161" "04214" "00414162" "04214" "00414163" "04214" "00414164" "04214" "00429762" "00112" "00447014" "00198" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00112, 00198, 03453, 04214, 05130 ## Count = 49 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000045220" "05130" "00058628" "00228" "Familial, autosomal recessive" "" "Riggs type of electroretinogram" "" "" "" "" "" "" "" "" "" "" "" "0000045221" "05130" "00058629" "00228" "Familial, autosomal recessive" "" "Riggs type of electroretinogram" "" "" "" "" "" "" "" "" "" "" "" "0000074237" "05130" "00095957" "01769" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000078326" "04214" "00100087" "01769" "Familial, autosomal recessive" "" "RP, deafness" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000226951" "04214" "00299641" "00006" "Familial, autosomal recessive" "51y" "see paper; ..., 29y-photopsia (HP:0030786), slightly reduced acuity (HP:0007663), mild nyctalopia (HP:0000662); irregular pigmented lesions in periphery(HP:0007703), pale discs (HP:0000543), cystoid macular edema (HP:0011505), peripheral telangiectasia (HP:0007763) with some retinal edema (HP:0020120) and vitreous cells (HP:0004327), possible para-arteriolar sparing; 29y-ERG no identifiable responses other than a minimal, delayed response to 30Hz flicker (PERG, EOG and ERG tested), severe photoreceptor dysfunction; 29y-colour vision Ishihara 15/15 each eye; 29y-Goldmann visual fields ring scotoma at 30 degrees, binocular Esterman age 36: central 20 degrees only retained; presenting VA logMAR (Snellen) R 0.48 (20/60), L 0.3 (20/40); latest VA logMAR R 1.8 (20/1250), L 1.5 (20/630); latest refractive error, dioptres R -1.00/-1.00x5, L +0.75/-1.00x90" "29y" "" "" "" "" "" "" "" "RP78" "retinitis pigmentosa" "" "0000251551" "04214" "00333364" "00000" "Unknown" "17y" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000252043" "04214" "00333858" "00000" "Familial, autosomal recessive" "51y" "clinical category IA1a" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000252884" "00198" "00335169" "00000" "Familial, autosomal recessive" "" "43y-diagnosis visual impairment" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253909" "04214" "00335994" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000253910" "04214" "00335995" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000253963" "04214" "00358748" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000254245" "04214" "00358947" "00000" "Familial" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000277711" "04214" "00383926" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Congenital stationary night blindness" "" "0000277943" "04214" "00384158" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Congenital stationary night blindness" "" "0000306019" "04214" "00414118" "00000" "Unknown" "" "" "" "" "" "protein function: probably null; protein region conservation: conserved protein region" "" "" "" "" "age-related macular degeneration" "" "" "0000306020" "04214" "00414119" "00000" "Unknown" "" "" "" "" "" "protein function: probably null; protein region conservation: conserved protein region" "" "" "" "" "optic atrophy" "" "" "0000306021" "04214" "00414120" "00000" "Unknown" "" "" "" "" "" "protein function: not studied in vivo; protein region conservation: non-conserved protein region" "" "" "" "" "retinal disease" "" "" "0000306022" "04214" "00414121" "00000" "Unknown" "" "" "" "" "" "protein function: not studied in vivo; protein region conservation: non-conserved protein region" "" "" "" "" "retinal disease" "" "" "0000306023" "04214" "00414122" "00000" "Unknown" "" "" "" "" "" "protein function: not studied in vivo; protein region conservation: not determined" "" "" "" "" "retinitis pigmentosa" "" "" "0000306024" "04214" "00414123" "00000" "Unknown" "" "" "" "" "" "protein function: not studied in vivo; protein region conservation: non-conserved protein region" "" "" "" "" "retinal disease" "" "" "0000306025" "04214" "00414124" "00000" "Unknown" "" "" "" "" "" "protein function: not studied in vivo; protein region conservation: non-conserved protein region" "" "" "" "" "retinal disease" "" "" "0000306026" "04214" "00414125" "00000" "Unknown" "" "" "" "" "" "protein function: not studied in vivo; protein region conservation: non-conserved protein region" "" "" "" "" "retinal disease" "" "" "0000306027" "04214" "00414126" "00000" "Unknown" "" "" "" "" "" "protein function: not studied in vivo; protein region conservation: non-conserved protein region" "" "" "" "" "retinal disease" "" "" "0000306028" "04214" "00414127" "00000" "Unknown" "" "" "" "" "" "protein function: not studied in vivo; protein region conservation: non-conserved protein region" "" "" "" "" "retinal disease" "" "" "0000306029" "04214" "00414128" "00000" "Unknown" "" "" "" "" "" "protein function: not studied in vivo; protein region conservation: non-conserved protein region" "" "" "" "" "retinal disease" "" "" "0000306030" "04214" "00414129" "00000" "Unknown" "" "" "" "" "" "protein function: not studied in vivo; protein region conservation: non-conserved protein region" "" "" "" "" "retinal disease" "" "" "0000306031" "04214" "00414130" "00000" "Unknown" "" "" "" "" "" "protein function: not studied in vivo; protein region conservation: non-conserved protein region" "" "" "" "" "retinal disease" "" "" "0000306032" "04214" "00414131" "00000" "Unknown" "" "" "" "" "" "protein function: not studied in vivo; protein region conservation: non-conserved protein region" "" "" "" "" "retinal disease" "" "" "0000306033" "04214" "00414132" "00000" "Unknown" "" "" "" "" "" "protein function: studied and does not to differ from wild-type; protein region conservation: conserved protein region" "" "" "" "" "congenital stationary night blindness" "" "" "0000306034" "04214" "00414133" "00000" "Unknown" "" "" "" "" "" "protein function: not studied in vivo; protein region conservation: non-conserved protein region" "" "" "" "" "retinal disease" "" "" "0000306035" "04214" "00414134" "00000" "Unknown" "" "" "" "" "" "protein function: not studied in vivo; protein region conservation: non-conserved protein region" "" "" "" "" "retinal disease" "" "" "0000306036" "04214" "00414135" "00000" "Unknown" "" "" "" "" "" "protein function: studied and has substantially reduced function; protein region conservation: conserved protein region" "" "" "" "" "congenital stationary night blindness" "" "" "0000306037" "04214" "00414136" "00000" "Unknown" "" "" "" "" "" "protein function: studied and has substantially reduced function; protein region conservation: conserved protein region" "" "" "" "" "congenital stationary night blindness" "" "" "0000306038" "04214" "00414137" "00000" "Unknown" "" "" "" "" "" "protein function: studied and does not to differ from wild-type; protein region conservation: conserved protein region" "" "" "" "" "retinitis pigmentosa" "" "" "0000306039" "04214" "00414138" "00000" "Unknown" "" "" "" "" "" "protein function: not studied in vivo; protein region conservation: non-conserved protein region" "" "" "" "" "retinal disease" "" "" "0000306040" "04214" "00414139" "00000" "Unknown" "" "" "" "" "" "protein function: not applicable; protein region conservation: not applicable" "" "" "" "" "retinal disease" "" "" "0000306041" "04214" "00414140" "00000" "Unknown" "" "" "" "" "" "protein function: not applicable; protein region conservation: not applicable" "" "" "" "" "retinal disease" "" "" "0000306042" "04214" "00414141" "00000" "Unknown" "" "" "" "" "" "protein function: not applicable; protein region conservation: not applicable" "" "" "" "" "retinal disease" "" "" "0000306043" "04214" "00414142" "00000" "Unknown" "" "" "" "" "" "protein function: not applicable; protein region conservation: not applicable" "" "" "" "" "retinal disease" "" "" "0000306044" "04214" "00414143" "00000" "Unknown" "" "" "" "" "" "protein function: not applicable; protein region conservation: not applicable" "" "" "" "" "retinal disease" "" "" "0000306045" "04214" "00414144" "00000" "Unknown" "" "" "" "" "" "protein function: not applicable; protein region conservation: not applicable" "" "" "" "" "retinal disease" "" "" "0000306046" "04214" "00414145" "00000" "Unknown" "" "" "" "" "" "protein function: not applicable; protein region conservation: not applicable" "" "" "" "" "retinal disease" "" "" "0000306061" "04214" "00414160" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right, left eye: 6/6, 6/6; fundus findings: no macular atrophy, no pigment deposition, and no vascular attenuation; electroretinographic characteristics: a- and b-waves absent under the scotopic condition, whereas the cone responses somewhat reduced under the photopic condition" "" "" "night blindness since early childhood" "" "" "" "" "" "congenital stationary night blindness" "" "" "0000306062" "04214" "00414161" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right, left eye: 6/6, 6/24; fundus findings: no macular atrophy, no pigment deposition, and no vascular attenuation; electroretinographic characteristics: a- and b-waves absent under the scotopic condition, whereas the cone responses somewhat reduced under the photopic condition" "" "" "night blindness since early childhood" "" "" "" "" "" "congenital stationary night blindness" "" "" "0000306063" "04214" "00414162" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "congenital stationary night blindness" "" "" "0000306064" "04214" "00414163" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right, left eye: 6/18, 6/9; fundus findings: no macular atrophy, no pigment deposition, and no vascular attenuation; electroretinographic characteristics: a- and b-waves absent under the scotopic condition, with normal cone responses under the photopic condition" "" "" "night blindness since early childhood" "" "" "" "" "" "congenital stationary night blindness" "" "" "0000306065" "04214" "00414164" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right, left eye: 6/6, 6/6; fundus findings: no macular atrophy, no pigment deposition, and no vascular attenuation; electroretinographic characteristics: a- and b-waves absent under the scotopic condition, with normal cone responses under the photopic condition" "" "" "night blindness since early childhood" "" "" "" "" "" "congenital stationary night blindness" "" "" "0000320634" "00112" "00429762" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000336213" "00198" "00447014" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, autosomal recessive" "" ## Screenings ## Do not remove or alter this header ## ## Count = 51 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000058590" "00058628" "1" "00228" "00228" "2016-02-03 17:18:59" "" "" "SEQ-NG-I" "DNA" "" "" "0000058591" "00058629" "1" "00228" "00228" "2016-02-03 17:28:28" "" "" "SEQ-NG-I" "DNA" "" "" "0000058592" "00058630" "1" "00228" "00228" "2016-02-03 17:32:37" "" "" "SEQ-NG-I" "DNA" "" "" "0000096361" "00095957" "1" "01769" "01769" "2017-01-26 22:52:55" "" "" "SEQ" "DNA" "WBC" "" "0000100490" "00100087" "1" "01769" "01769" "2017-01-30 17:00:20" "" "" "SEQ" "DNA" "WBC" "" "0000292446" "00291278" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000300751" "00299641" "1" "00006" "00006" "2020-04-18 08:53:03" "00006" "2020-04-18 09:16:58" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "" "WGS" "0000334589" "00333364" "1" "00000" "00006" "2021-02-25 10:13:46" "" "" "SEQ-NG" "DNA" "" "132-gene panel" "0000335084" "00333858" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000336398" "00335169" "1" "00000" "00006" "2021-03-04 11:06:46" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000337224" "00335994" "1" "00000" "00006" "2021-03-10 17:05:56" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000337225" "00335995" "1" "00000" "00006" "2021-03-10 17:05:56" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000359978" "00358748" "1" "00000" "00006" "2021-03-11 13:59:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000360184" "00358947" "1" "00000" "00006" "2021-03-18 12:15:00" "" "" "SEQ-NG" "DNA" "" "WES" "0000385151" "00383926" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "SEQ-NG-I" "DNA" "" "" "0000385383" "00384158" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "SEQ-NG-I" "DNA" "" "" "0000415397" "00414118" "1" "00000" "03840" "2022-07-27 11:13:13" "" "" "SSCA;RFLP;SEQ" "DNA" "blood" "" "0000415398" "00414119" "1" "00000" "03840" "2022-07-27 11:13:13" "" "" "SSCA;RFLP;SEQ" "DNA" "blood" "" "0000415399" "00414120" "1" "00000" "03840" "2022-07-27 11:13:13" "" "" "SSCA;RFLP;SEQ" "DNA" "blood" "" "0000415400" "00414121" "1" "00000" "03840" "2022-07-27 11:13:13" "" "" "SSCA;RFLP;SEQ" "DNA" "blood" "" "0000415401" "00414122" "1" "00000" "03840" "2022-07-27 11:13:13" "" "" "SSCA;RFLP;SEQ" "DNA" "blood" "" "0000415402" "00414123" "1" "00000" "03840" "2022-07-27 11:13:13" "" "" "SSCA;RFLP;SEQ" "DNA" "blood" "" "0000415403" "00414124" "1" "00000" "03840" "2022-07-27 11:13:13" "" "" "SSCA;RFLP;SEQ" "DNA" "blood" "" "0000415404" "00414125" "1" "00000" "03840" "2022-07-27 11:13:13" "" "" "SSCA;RFLP;SEQ" "DNA" "blood" "" "0000415405" "00414126" "1" "00000" "03840" "2022-07-27 11:13:13" "" "" "SSCA;RFLP;SEQ" "DNA" "blood" "" "0000415406" "00414127" "1" "00000" "03840" "2022-07-27 11:13:13" "" "" "SSCA;RFLP;SEQ" "DNA" "blood" "" "0000415407" "00414128" "1" "00000" "03840" "2022-07-27 11:13:13" "" "" "SSCA;RFLP;SEQ" "DNA" "blood" "" "0000415408" "00414129" "1" "00000" "03840" "2022-07-27 11:13:13" "" "" "SSCA;RFLP;SEQ" "DNA" "blood" "" "0000415409" "00414130" "1" "00000" "03840" "2022-07-27 11:13:13" "" "" "SSCA;RFLP;SEQ" "DNA" "blood" "" "0000415410" "00414131" "1" "00000" "03840" "2022-07-27 11:13:13" "" "" "SSCA;RFLP;SEQ" "DNA" "blood" "" "0000415411" "00414132" "1" "00000" "03840" "2022-07-27 11:13:13" "" "" "SSCA;RFLP;SEQ" "DNA" "blood" "" "0000415412" "00414133" "1" "00000" "03840" "2022-07-27 11:13:13" "" "" "SSCA;RFLP;SEQ" "DNA" "blood" "" "0000415413" "00414134" "1" "00000" "03840" "2022-07-27 11:13:13" "" "" "SSCA;RFLP;SEQ" "DNA" "blood" "" "0000415414" "00414135" "1" "00000" "03840" "2022-07-27 11:13:13" "" "" "SSCA;RFLP;SEQ" "DNA" "blood" "" "0000415415" "00414136" "1" "00000" "03840" "2022-07-27 11:13:13" "" "" "SSCA;RFLP;SEQ" "DNA" "blood" "" "0000415416" "00414137" "1" "00000" "03840" "2022-07-27 11:13:13" "" "" "SSCA;RFLP;SEQ" "DNA" "blood" "" "0000415417" "00414138" "1" "00000" "03840" "2022-07-27 11:13:13" "" "" "SSCA;RFLP;SEQ" "DNA" "blood" "" "0000415418" "00414139" "1" "00000" "03840" "2022-07-27 11:13:13" "" "" "SSCA;RFLP;SEQ" "DNA" "blood" "" "0000415419" "00414140" "1" "00000" "03840" "2022-07-27 11:13:13" "" "" "SSCA;RFLP;SEQ" "DNA" "blood" "" "0000415420" "00414141" "1" "00000" "03840" "2022-07-27 11:13:13" "" "" "SSCA;RFLP;SEQ" "DNA" "blood" "" "0000415421" "00414142" "1" "00000" "03840" "2022-07-27 11:13:13" "" "" "SSCA;RFLP;SEQ" "DNA" "blood" "" "0000415422" "00414143" "1" "00000" "03840" "2022-07-27 11:13:13" "" "" "SSCA;RFLP;SEQ" "DNA" "blood" "" "0000415423" "00414144" "1" "00000" "03840" "2022-07-27 11:13:13" "" "" "SSCA;RFLP;SEQ" "DNA" "blood" "" "0000415424" "00414145" "1" "00000" "03840" "2022-07-27 11:13:13" "" "" "SSCA;RFLP;SEQ" "DNA" "blood" "" "0000415439" "00414160" "1" "00000" "03840" "2022-07-27 11:31:24" "" "" "STR;SEQ" "DNA" "blood" "" "0000415440" "00414161" "1" "00000" "03840" "2022-07-27 11:31:24" "" "" "STR;SEQ" "DNA" "blood" "" "0000415441" "00414162" "1" "00000" "03840" "2022-07-27 11:31:24" "" "" "STR;SEQ" "DNA" "blood" "" "0000415442" "00414163" "1" "00000" "03840" "2022-07-27 11:31:24" "" "" "STR;SEQ" "DNA" "blood" "" "0000415443" "00414164" "1" "00000" "03840" "2022-07-27 11:31:24" "" "" "STR;SEQ" "DNA" "blood" "" "0000431175" "00429762" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000448591" "00447014" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 47 "{{screeningid}}" "{{geneid}}" "0000058590" "SLC24A1" "0000058591" "SLC24A1" "0000058592" "SLC24A1" "0000096361" "SLC24A1" "0000100490" "USH2A" "0000300751" "ARHGEF18" "0000335084" "SLC24A1" "0000336398" "SLC24A1" "0000337224" "SLC24A1" "0000337225" "SLC24A1" "0000359978" "SLC24A1" "0000385151" "SLC24A1" "0000385383" "SLC24A1" "0000415397" "SLC24A1" "0000415398" "SLC24A1" "0000415399" "SLC24A1" "0000415400" "SLC24A1" "0000415401" "SLC24A1" "0000415402" "SLC24A1" "0000415403" "SLC24A1" "0000415404" "SLC24A1" "0000415405" "SLC24A1" "0000415406" "SLC24A1" "0000415407" "SLC24A1" "0000415408" "SLC24A1" "0000415409" "SLC24A1" "0000415410" "SLC24A1" "0000415411" "SLC24A1" "0000415412" "SLC24A1" "0000415413" "SLC24A1" "0000415414" "SLC24A1" "0000415415" "SLC24A1" "0000415416" "SLC24A1" "0000415417" "SLC24A1" "0000415418" "SLC24A1" "0000415419" "SLC24A1" "0000415420" "SLC24A1" "0000415421" "SLC24A1" "0000415422" "SLC24A1" "0000415423" "SLC24A1" "0000415424" "SLC24A1" "0000415439" "SLC24A1" "0000415440" "SLC24A1" "0000415441" "SLC24A1" "0000415442" "SLC24A1" "0000415443" "SLC24A1" "0000431175" "SLC24A1" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 125 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000089186" "10" "90" "15" "65942888" "65942888" "subst" "6.65026E-6" "00228" "SLC24A1_000002" "g.65942888G>T" "" "{PMID:Neuillé 2016:26822852}" "" "" "" "Germline" "yes" "" "0" "" "" "g.65650550G>T" "" "pathogenic" "" "0000089187" "10" "90" "15" "65918109" "65918111" "del" "0" "00228" "SLC24A1_000003" "g.65918109_65918111del" "" "{PMID:Neuillé 2016:26822852}" "" "1691_1693delTCT" "" "Unknown" "" "" "0" "" "" "g.65625771_65625773del" "" "pathogenic" "" "0000089188" "10" "90" "15" "65945064" "65945064" "subst" "0" "00228" "SLC24A1_000005" "g.65945064A>C" "" "{PMID:Neuillé 2016:26822852}" "" "" "" "Unknown" "" "" "0" "" "" "g.65652726A>C" "" "pathogenic" "" "0000089190" "20" "90" "15" "65942888" "65942888" "subst" "6.65026E-6" "00228" "SLC24A1_000002" "g.65942888G>T" "" "{PMID:Neuillé 2016:26822852}" "" "" "" "Germline" "yes" "" "0" "" "" "g.65650550G>T" "" "pathogenic" "" "0000089191" "21" "90" "15" "65946408" "65946411" "del" "0" "00228" "SLC24A1_000004" "g.65946408_65946411del" "" "{PMID:Neuillé 2016:26822852}" "" "3291_3294delATCT" "" "Germline" "yes" "" "0" "" "" "g.65654070_65654073del" "" "pathogenic" "" "0000089192" "21" "90" "15" "65945064" "65945064" "subst" "0" "00228" "SLC24A1_000005" "g.65945064A>C" "" "{PMID:Neuillé 2016:26822852}" "" "" "" "Germline" "yes" "" "0" "" "" "g.65652726A>C" "" "pathogenic" "" "0000158353" "3" "90" "15" "65918031" "65918032" "del" "0" "01769" "SLC24A1_000001" "g.65918031_65918032del" "" "{PMID:Li 2017:28418496}" "" "1613_1614delTT" "" "Germline" "yes" "" "0" "" "" "g.65625693_65625694del" "" "pathogenic" "" "0000247301" "0" "10" "15" "65943081" "65943081" "subst" "0" "02330" "SLC24A1_000023" "g.65943081A>G" "" "" "" "SLC24A1(NM_004727.2):c.2594A>G (p.E865G), SLC24A1(NM_004727.3):c.2594A>G (p.E865G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65650743A>G" "" "benign" "" "0000247344" "0" "10" "15" "65952673" "65952673" "subst" "3.25304E-5" "02330" "SLC24A1_000029" "g.65952673A>G" "" "" "" "SLC24A1(NM_001301033.2):c.*14A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65660335A>G" "" "benign" "" "0000247358" "0" "50" "15" "65917190" "65917190" "subst" "8.12275E-6" "02330" "SLC24A1_000008" "g.65917190A>G" "" "" "" "SLC24A1(NM_004727.3):c.772A>G (p.T258A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65624852A>G" "" "VUS" "" "0000248926" "0" "10" "15" "65916527" "65916527" "subst" "0.254449" "02325" "SLC24A1_000006" "g.65916527A>T" "" "" "" "SLC24A1(NM_004727.3):c.109A>T (p.T37S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65624189A>T" "" "benign" "" "0000253369" "0" "10" "15" "65943081" "65943081" "subst" "0" "01943" "SLC24A1_000023" "g.65943081A>G" "" "" "" "SLC24A1(NM_004727.2):c.2594A>G (p.E865G), SLC24A1(NM_004727.3):c.2594A>G (p.E865G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65650743A>G" "" "benign" "" "0000295874" "0" "10" "15" "65917872" "65917872" "subst" "0.000215279" "02330" "SLC24A1_000011" "g.65917872C>T" "" "" "" "SLC24A1(NM_004727.2):c.1454C>T (p.T485I), SLC24A1(NM_004727.3):c.1454C>T (p.T485I, p.(Thr485Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65625534C>T" "" "benign" "" "0000295875" "0" "10" "15" "65935364" "65935364" "subst" "0" "02330" "SLC24A1_000014" "g.65935364C>T" "" "" "" "SLC24A1(NM_004727.3):c.2054-1401C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65643026C>T" "" "benign" "" "0000295876" "0" "30" "15" "65942932" "65942932" "subst" "0.000953339" "02330" "SLC24A1_000018" "g.65942932C>T" "" "" "" "SLC24A1(NM_004727.2):c.2445C>T (p.H815=), SLC24A1(NM_004727.3):c.2445C>T (p.H815=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65650594C>T" "" "likely benign" "" "0000295877" "0" "10" "15" "65943265" "65943265" "subst" "0.00189661" "02330" "SLC24A1_000026" "g.65943265C>T" "" "" "" "SLC24A1(NM_004727.2):c.2778C>T (p.P926=), SLC24A1(NM_004727.3):c.2778C>T (p.P926=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65650927C>T" "" "benign" "" "0000295878" "0" "10" "15" "65946155" "65946155" "subst" "0" "02330" "SLC24A1_000027" "g.65946155T>C" "" "" "" "SLC24A1(NM_004727.3):c.3051-13T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65653817T>C" "" "benign" "" "0000295879" "0" "30" "15" "65946398" "65946398" "subst" "0" "02330" "SLC24A1_000028" "g.65946398C>T" "" "" "" "SLC24A1(NM_004727.3):c.3281C>T (p.S1094F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65654060C>T" "" "likely benign" "" "0000295880" "0" "30" "15" "65916949" "65916949" "subst" "0.000175507" "02330" "SLC24A1_000007" "g.65916949C>T" "" "" "" "SLC24A1(NM_004727.3):c.531C>T (p.Y177=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65624611C>T" "" "likely benign" "" "0000295881" "0" "10" "15" "65917357" "65917357" "subst" "0.000474158" "02330" "SLC24A1_000009" "g.65917357G>A" "" "" "" "SLC24A1(NM_004727.3):c.939G>A (p.L313=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65625019G>A" "" "benign" "" "0000308290" "0" "30" "15" "65917584" "65917584" "subst" "8.13551E-5" "01943" "SLC24A1_000010" "g.65917584T>A" "" "" "" "SLC24A1(NM_004727.2):c.1166T>A (p.M389K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65625246T>A" "" "likely benign" "" "0000308291" "0" "30" "15" "65930468" "65930468" "subst" "0.000179358" "01943" "SLC24A1_000012" "g.65930468G>A" "" "" "" "SLC24A1(NM_004727.2):c.1893G>A (p.P631=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65638130G>A" "" "likely benign" "" "0000308292" "0" "50" "15" "65937980" "65937980" "subst" "0.0015412" "01943" "SLC24A1_000015" "g.65937980C>T" "" "" "" "SLC24A1(NM_004727.2):c.2171C>T (p.T724M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65645642C>T" "" "VUS" "" "0000308293" "0" "50" "15" "65937992" "65937992" "subst" "0.000460165" "01943" "SLC24A1_000016" "g.65937992C>T" "" "" "" "SLC24A1(NM_004727.2):c.2183C>T (p.A728V), SLC24A1(NM_004727.3):c.2183C>T (p.A728V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65645654C>T" "" "VUS" "" "0000308294" "0" "30" "15" "65942836" "65942836" "subst" "2.00672E-5" "01943" "SLC24A1_000017" "g.65942836T>C" "" "" "" "SLC24A1(NM_004727.2):c.2349T>C (p.G783=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65650498T>C" "" "likely benign" "" "0000308295" "0" "30" "15" "65942932" "65942932" "subst" "0.000953339" "01943" "SLC24A1_000018" "g.65942932C>T" "" "" "" "SLC24A1(NM_004727.2):c.2445C>T (p.H815=), SLC24A1(NM_004727.3):c.2445C>T (p.H815=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65650594C>T" "" "likely benign" "" "0000308297" "0" "50" "15" "65943251" "65943251" "subst" "0.00256095" "01943" "SLC24A1_000025" "g.65943251T>C" "" "" "" "SLC24A1(NM_004727.2):c.2764T>C (p.W922R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65650913T>C" "" "VUS" "" "0000308298" "0" "30" "15" "65943265" "65943265" "subst" "0.00189661" "01943" "SLC24A1_000026" "g.65943265C>T" "" "" "" "SLC24A1(NM_004727.2):c.2778C>T (p.P926=), SLC24A1(NM_004727.3):c.2778C>T (p.P926=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65650927C>T" "" "likely benign" "" "0000350100" "0" "90" "15" "65917738" "65917738" "subst" "0" "02327" "SLC24A1_000019" "g.65917738C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65625400C>G" "" "pathogenic" "" "0000555153" "0" "30" "15" "65916538" "65916538" "subst" "0" "02330" "DENND4A_000001" "g.65916538C>T" "" "" "" "SLC24A1(NM_004727.2):c.120C>T (p.H40=), SLC24A1(NM_004727.3):c.120C>T (p.H40=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65624200C>T" "" "likely benign" "" "0000555154" "0" "30" "15" "65916671" "65916671" "subst" "2.8487E-5" "01943" "DENND4A_000002" "g.65916671G>A" "" "" "" "SLC24A1(NM_004727.2):c.253G>A (p.E85K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65624333G>A" "" "likely benign" "" "0000555155" "0" "30" "15" "65917220" "65917220" "subst" "8.1242E-6" "02330" "DENND4A_000003" "g.65917220G>A" "" "" "" "SLC24A1(NM_004727.3):c.802G>A (p.V268I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65624882G>A" "" "likely benign" "" "0000555156" "0" "30" "15" "65917349" "65917349" "subst" "0.00964149" "01804" "DENND4A_000004" "g.65917349G>C" "" "" "" "SLC24A1(NM_004727.2):c.931G>C (p.(Val311Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65625011G>C" "" "likely benign" "" "0000555157" "0" "30" "15" "65917549" "65917549" "subst" "0.0004189" "01943" "DENND4A_000005" "g.65917549C>T" "" "" "" "SLC24A1(NM_004727.2):c.1131C>T (p.T377=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65625211C>T" "" "likely benign" "" "0000555158" "0" "10" "15" "65917660" "65917660" "subst" "0" "02330" "DENND4A_000006" "g.65917660C>G" "" "" "" "SLC24A1(NM_004727.2):c.1242C>G (p.A414=), SLC24A1(NM_004727.3):c.1242C>G (p.A414=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65625322C>G" "" "benign" "" "0000555159" "0" "50" "15" "65917872" "65917872" "subst" "0.000215279" "01943" "SLC24A1_000011" "g.65917872C>T" "" "" "" "SLC24A1(NM_004727.2):c.1454C>T (p.T485I), SLC24A1(NM_004727.3):c.1454C>T (p.T485I, p.(Thr485Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65625534C>T" "" "VUS" "" "0000555160" "0" "10" "15" "65917906" "65917906" "subst" "0.00221728" "01943" "DENND4A_000007" "g.65917906C>T" "" "" "" "SLC24A1(NM_004727.2):c.1488C>T (p.G496=), SLC24A1(NM_004727.3):c.1488C>T (p.G496=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65625568C>T" "" "benign" "" "0000555161" "0" "30" "15" "65918277" "65918277" "subst" "0.000610054" "01804" "DENND4A_000008" "g.65918277C>T" "" "" "" "SLC24A1(NM_004727.2):c.1859C>T (p.(Ala620Val)), SLC24A1(NM_004727.3):c.1859C>T (p.A620V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65625939C>T" "" "likely benign" "" "0000555162" "0" "30" "15" "65930467" "65930467" "subst" "0" "01804" "DENND4A_000009" "g.65930467C>T" "" "" "" "SLC24A1(NM_001254740.1):c.-4844C>T (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65638129C>T" "" "likely benign" "" "0000555163" "0" "10" "15" "65931911" "65931912" "ins" "0" "02325" "DENND4A_000010" "g.65931911_65931912insAGGCCTG" "" "" "" "SLC24A1(NM_004727.3):c.1945-22_1945-21insAGGCCTG" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65639573_65639574insAGGCCTG" "" "benign" "" "0000555164" "0" "50" "15" "65931990" "65931990" "subst" "0.000114502" "02330" "DENND4A_000011" "g.65931990C>T" "" "" "" "SLC24A1(NM_004727.3):c.2002C>T (p.R668C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65639652C>T" "" "VUS" "" "0000555165" "0" "50" "15" "65936759" "65936759" "subst" "2.01609E-5" "01943" "DENND4A_000012" "g.65936759T>C" "" "" "" "SLC24A1(NM_004727.2):c.2054-6T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65644421T>C" "" "VUS" "" "0000555167" "0" "50" "15" "65942939" "65942939" "subst" "0" "02330" "DENND4A_000013" "g.65942939G>A" "" "" "" "SLC24A1(NM_004727.3):c.2452G>A (p.D818N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65650601G>A" "" "VUS" "" "0000555168" "0" "50" "15" "65943119" "65943130" "dup" "0" "01943" "DENND4A_000014" "g.65943119_65943130dup" "" "" "" "SLC24A1(NM_004727.2):c.2632_2643dupCAGGAGGAAGAG (p.Q878_E881dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65650781_65650792dup" "" "VUS" "" "0000555169" "0" "10" "15" "65943145" "65943147" "del" "0" "02330" "DENND4A_000015" "g.65943145_65943147del" "" "" "" "SLC24A1(NM_004727.3):c.2658_2660delGGA (p.E890del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65650807_65650809del" "" "benign" "" "0000555170" "0" "30" "15" "65944011" "65944011" "subst" "0" "02330" "DENND4A_000016" "g.65944011T>G" "" "" "" "SLC24A1(NM_004727.3):c.2797T>G (p.S933A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65651673T>G" "" "likely benign" "" "0000555171" "0" "50" "15" "65945059" "65945061" "del" "0" "02330" "DENND4A_000017" "g.65945059_65945061del" "" "" "" "SLC24A1(NM_004727.3):c.2963_2965delTCA (p.I988del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65652721_65652723del" "" "VUS" "" "0000555172" "0" "50" "15" "65945134" "65945134" "subst" "0" "01943" "DENND4A_000018" "g.65945134A>G" "" "" "" "SLC24A1(NM_004727.2):c.3038A>G (p.D1013G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65652796A>G" "" "VUS" "" "0000555173" "0" "50" "15" "65946173" "65946173" "subst" "0" "01804" "DENND4A_000019" "g.65946173C>A" "" "" "" "SLC24A1(NM_001254740.1):c.1037C>A (p.(Pro346His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65653835C>A" "" "VUS" "" "0000615448" "0" "30" "15" "65917019" "65917019" "subst" "0.000111288" "01943" "DENND4A_000020" "g.65917019G>A" "" "" "" "SLC24A1(NM_004727.2):c.601G>A (p.V201M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65624681G>A" "" "likely benign" "" "0000615449" "0" "30" "15" "65917660" "65917660" "subst" "0" "01943" "DENND4A_000006" "g.65917660C>G" "" "" "" "SLC24A1(NM_004727.2):c.1242C>G (p.A414=), SLC24A1(NM_004727.3):c.1242C>G (p.A414=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65625322C>G" "" "likely benign" "" "0000649135" "1" "30" "15" "65943251" "65943251" "subst" "0.00256095" "03575" "SLC24A1_000025" "g.65943251T>C" "7/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "7 heterozygous, no homozygous; {DB:CLININrs146253044}" "Germline" "" "rs146253044" "0" "" "" "g.65650913T>C" "" "likely benign" "" "0000657634" "0" "50" "15" "65946296" "65946296" "subst" "6.09226E-5" "01943" "DENND4A_000022" "g.65946296C>T" "" "" "" "SLC24A1(NM_004727.2):c.3179C>T (p.A1060V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65653958C>T" "" "VUS" "" "0000663582" "1" "50" "15" "65944027" "65944027" "subst" "3.259E-5" "00006" "SLC24A1_000030" "g.65944027T>G" "" "{PMID:Arno 2017:28132693}" "" "" "heterozygous variant only, does not fit phenotype" "Germline" "" "" "0" "" "" "g.65651689T>G" "" "VUS" "" "0000680259" "0" "30" "15" "65916610" "65916610" "subst" "0" "01943" "DENND4A_000023" "g.65916610T>C" "" "" "" "SLC24A1(NM_004727.2):c.192T>C (p.S64=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000680260" "0" "30" "15" "65935342" "65935342" "subst" "0" "01804" "DENND4A_000024" "g.65935342C>G" "" "" "" "SLC24A1(NM_001254740.1):c.32C>G (p.(Pro11Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000725253" "0" "50" "15" "65917793" "65917793" "subst" "3.24944E-5" "01943" "DENND4A_000027" "g.65917793G>A" "" "" "" "SLC24A1(NM_004727.2):c.1375G>A (p.V459I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000725254" "0" "50" "15" "65937992" "65937992" "subst" "0.000460165" "02329" "SLC24A1_000016" "g.65937992C>T" "" "" "" "SLC24A1(NM_004727.2):c.2183C>T (p.A728V), SLC24A1(NM_004727.3):c.2183C>T (p.A728V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000732510" "0" "90" "15" "65931990" "65931990" "subst" "0.000114502" "00000" "DENND4A_000011" "g.65931990C>T" "" "{PMID:Costa 2017:28912962}" "" "" "" "Germline" "" "" "0" "" "" "g.65639652C>T" "" "pathogenic" "" "0000733093" "1" "70" "15" "65917172" "65917173" "del" "0.000101534" "00000" "SLC24A1_000031" "g.65917172_65917173del" "" "{PMID:Stone 2017:28559085}" "" "754_755delAT" "" "Germline" "" "" "0" "" "" "g.65624834_65624835del" "" "likely pathogenic" "" "0000733547" "2" "70" "15" "65946274" "65946275" "del" "0" "00000" "SLC24A1_000032" "g.65946274_65946275del" "" "{PMID:Stone 2017:28559085}" "" "3156_3157delTC" "" "Germline" "" "" "0" "" "" "g.65653936_65653937del" "" "likely pathogenic" "" "0000735180" "3" "50" "15" "65918189" "65918191" "del" "0" "00000" "SLC24A1_000034" "g.65918189_65918191del" "" "{PMID:Maranha 2015:26352687}, {DOI:Maranhao 2015:10.1371/journal.pone.0136561}" "" "1759_1761CTG[4]" "" "Germline" "" "rs370680044" "0" "" "" "g.65625851_65625853del" "" "VUS" "" "0000735673" "0" "90" "15" "65916513" "65916513" "subst" "0" "00000" "SLC24A1_000033" "g.65916513T>A" "" "{PMID:Haer-Wigman 2017:28224992}" "" "" "" "Germline" "" "" "0" "" "" "g.65624175T>A" "" "pathogenic" "" "0000735771" "0" "90" "15" "65917172" "65917173" "del" "0.000101534" "00000" "SLC24A1_000031" "g.65917172_65917173del" "" "{PMID:Haer-Wigman 2017:28224992}" "" "" "" "Germline" "" "" "0" "" "" "g.65624834_65624835del" "" "pathogenic" "" "0000736854" "0" "50" "15" "65936782" "65936784" "del" "0" "00000" "SLC24A1_000035" "g.65936782_65936784del" "1/486 individuals" "{PMID:Sergouniotis 2016:27628848}" "" "" "no genotypes reported" "Germline" "" "rs748047300" "0" "" "" "g.65644444_65644446del" "" "VUS" "" "0000736855" "0" "50" "15" "65943145" "65943147" "del" "0" "00000" "DENND4A_000015" "g.65943145_65943147del" "2/486 individuals" "{PMID:Sergouniotis 2016:27628848}" "" "" "no genotypes reported" "Germline" "" "rs765607758" "0" "" "" "g.65650807_65650809del" "" "VUS" "" "0000759609" "3" "90" "15" "65943166" "65943166" "del" "8.21598E-6" "00000" "SLC24A1_000036" "g.65943166del" "" "{PMID:Carrigan 2016:27624628}" "" "2679delT" "" "Germline" "" "" "0" "" "" "g.65650828del" "" "pathogenic" "" "0000759973" "0" "50" "15" "65931964" "65931964" "subst" "8.25123E-6" "00000" "SLC24A1_000037" "g.65931964C>T" "" "{PMID:Tiwari 2016:27353947}" "" "" "" "Germline" "" "" "0" "" "" "g.65639626C>T" "" "VUS" "" "0000806870" "0" "50" "15" "65917554" "65917554" "subst" "2.84724E-5" "01943" "DENND4A_000028" "g.65917554C>T" "" "" "" "SLC24A1(NM_004727.2):c.1136C>T (p.T379I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000806871" "0" "30" "15" "65918277" "65918277" "subst" "0.000610054" "02330" "DENND4A_000008" "g.65918277C>T" "" "" "" "SLC24A1(NM_004727.2):c.1859C>T (p.(Ala620Val)), SLC24A1(NM_004727.3):c.1859C>T (p.A620V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000812038" "3" "70" "15" "65931951" "65931951" "subst" "0.000120962" "00000" "SLC24A1_000039" "g.65931951C>T" "" "{PMID:Martin Merida 2019:30902645}" "" "SLC24A1 Ex4 c.1963C>T p.(Arg655*), Ex4 c.1963C>T p.(Arg655*)" "homozygous" "Germline" "yes" "" "0" "" "" "g.65639613C>T" "" "likely pathogenic" "" "0000812417" "3" "70" "15" "65918133" "65918133" "subst" "8.12552E-6" "00000" "SLC24A1_000038" "g.65918133T>C" "" "{PMID:Martin Merida 2019:30902645}" "" "SLC24A1 Ex.2 c.1715T>C p.(Leu572Pro), Ex.2 c.1715T>C p.(Leu572Pro)" "homozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.65625795T>C" "" "likely pathogenic" "" "0000854129" "0" "30" "15" "65916538" "65916538" "subst" "0" "01943" "DENND4A_000001" "g.65916538C>T" "" "" "" "SLC24A1(NM_004727.2):c.120C>T (p.H40=), SLC24A1(NM_004727.3):c.120C>T (p.H40=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000854130" "0" "50" "15" "65917221" "65917221" "subst" "0.00030463" "01943" "DENND4A_000029" "g.65917221T>C" "" "" "" "SLC24A1(NM_004727.2):c.803T>C (p.V268A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000854131" "0" "30" "15" "65943115" "65943141" "del" "0" "01943" "DENND4A_000031" "g.65943115_65943141del" "" "" "" "SLC24A1(NM_004727.2):c.2628_2654delAGAGCAGGAGGAAGAGGAGGAGGAGGA (p.Q878_E886del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000863935" "0" "50" "15" "65917868" "65917868" "subst" "0" "01943" "DENND4A_000030" "g.65917868A>T" "" "" "" "SLC24A1(NM_004727.2):c.1450A>T (p.I484F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000863936" "0" "30" "15" "65952653" "65952653" "subst" "0" "02330" "DENND4A_000032" "g.65952653T>A" "" "" "" "SLC24A1(NM_001301033.2):c.3033T>A (p.I1011=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000873180" "0" "70" "15" "65917172" "65917173" "del" "0.000101534" "00000" "SLC24A1_000031" "g.65917172_65917173del" "1/1630 patient alleles" "{PMID:Sharon 2002:12037007}" "" "Rod NCKX Gene 754-5delAT, Met252; Ter@253" "no second allele; heterozygous" "Unknown" "?" "" "0" "" "" "g.65624834_65624835del" "" "likely pathogenic" "" "0000873181" "0" "70" "15" "65937995" "65937995" "del" "0" "00000" "SLC24A1_000049" "g.65937995del" "1/1630 patient alleles" "{PMID:Sharon 2002:12037007}" "" "Rod NCKX Gene 2186delC, Pro729; Ter@821" "no second allele; heterozygous" "Unknown" "?" "" "0" "" "" "g.65645657del" "" "likely pathogenic" "" "0000873182" "0" "10" "15" "65943115" "65943141" "del" "0" "00000" "DENND4A_000031" "g.65943115_65943141del" "1/1630 patient alleles" "{PMID:Sharon 2002:12037007}" "" "Rod NCKX Gene 2626-52del27bp, 876-884del" "" "Germline" "no" "" "0" "" "" "g.65650777_65650803del" "" "benign" "" "0000873183" "0" "10" "15" "65943145" "65943147" "dup" "0" "00000" "SLC24A1_000051" "g.65943145_65943147dup" "1/1630 patient alleles" "{PMID:Sharon 2002:12037007}" "" "Rod NCKX Gene 2658-9ins3bp, Glu887insGlu" "error in annotation, this mutation is actually c.2658_2660dup, Glu890dup; heterozygous" "Unknown" "?" "" "0" "" "" "g.65650807_65650809dup" "" "benign" "" "0000873184" "0" "70" "15" "65916505" "65916505" "subst" "0" "00000" "SLC24A1_000040" "g.65916505G>A" "1/1630 patient alleles" "{PMID:Sharon 2002:12037007}" "" "Rod NCKX Gene G87A, Leu29Leu" "no second allele; heterozygous" "Unknown" "?" "" "0" "" "" "g.65624167G>A" "" "likely pathogenic" "" "0000873185" "0" "10" "15" "65916527" "65916527" "subst" "0.254449" "00000" "SLC24A1_000006" "g.65916527A>T" "263/1630 patient alleles" "{PMID:Sharon 2002:12037007}" "" "Rod NCKX Gene A109T, Thr37Ser" "" "Unknown" "?" "" "0" "" "" "g.65624189A>T" "" "benign" "" "0000873186" "0" "10" "15" "65917134" "65917134" "subst" "0" "00000" "SLC24A1_000041" "g.65917134G>C" "1/1630 patient alleles" "{PMID:Sharon 2002:12037007}" "" "Rod NCKX Gene G676C, Arg239Thr" "error in annotation; Arg239Thr is actually caused by c.716G>C" "Unknown" "?" "" "0" "" "" "g.65624796G>C" "" "benign" "" "0000873187" "0" "30" "15" "65917349" "65917349" "subst" "0.00964149" "00000" "DENND4A_000004" "g.65917349G>C" "3/1630 patient alleles" "{PMID:Sharon 2002:12037007}" "" "Rod NCKX Gene G931C, Val311Leu" "" "Germline" "no" "" "0" "" "" "g.65625011G>C" "" "likely benign" "" "0000873188" "0" "10" "15" "65917355" "65917355" "subst" "0.0517436" "00000" "SLC24A1_000042" "g.65917355T>G" "92/1630 patient alleles" "{PMID:Sharon 2002:12037007}" "" "Rod NCKX Gene T937G, Leu313Val" "" "Germline" "no" "" "0" "" "" "g.65625017T>G" "" "benign" "" "0000873189" "0" "10" "15" "65917409" "65917409" "subst" "5.3063E-5" "00000" "SLC24A1_000043" "g.65917409A>T" "1/1630 patient alleles" "{PMID:Sharon 2002:12037007}" "" "Rod NCKX Gene A991T, Ser331Cys" "" "Unknown" "?" "" "0" "" "" "g.65625071A>T" "" "benign" "" "0000873190" "0" "30" "15" "65917584" "65917584" "subst" "8.13551E-5" "00000" "SLC24A1_000010" "g.65917584T>A" "2/1630 patient alleles" "{PMID:Sharon 2002:12037007}" "" "Rod NCKX Gene T1166A, Met389Lys" "" "Unknown" "?" "" "0" "" "" "g.65625246T>A" "" "likely benign" "" "0000873191" "0" "50" "15" "65917793" "65917793" "subst" "3.24944E-5" "00000" "DENND4A_000027" "g.65917793G>A" "1/1630 patient alleles" "{PMID:Sharon 2002:12037007}" "" "Rod NCKX Gene G1375A, Val459Ile" "" "Germline" "yes" "" "0" "" "" "g.65625455G>A" "" "VUS" "" "0000873192" "0" "30" "15" "65918240" "65918240" "subst" "0.00390203" "00000" "SLC24A1_000045" "g.65918240G>A" "7/1630 patient alleles" "{PMID:Sharon 2002:12037007}" "" "Rod NCKX Gene G1822A, Val608Ile" "" "Unknown" "?" "" "0" "" "" "g.65625902G>A" "" "likely benign" "" "0000873193" "0" "30" "15" "65942813" "65942813" "subst" "0.000503113" "00000" "SLC24A1_000050" "g.65942813G>C" "1/1630 patient alleles" "{PMID:Sharon 2002:12037007}" "" "Rod NCKX Gene G2326C, Glu776Gln" "" "Germline" "no" "" "0" "" "" "g.65650475G>C" "" "likely benign" "" "0000873194" "0" "30" "15" "65943236" "65943236" "subst" "6.15561E-5" "00000" "SLC24A1_000052" "g.65943236A>G" "1/1630 patient alleles" "{PMID:Sharon 2002:12037007}" "" "Rod NCKX Gene A2749G, Ile917Val" "no second allele; heterozygous" "Germline" "yes" "" "0" "" "" "g.65650898A>G" "" "likely benign" "" "0000873195" "0" "30" "15" "65943251" "65943251" "subst" "0.00256095" "00000" "SLC24A1_000025" "g.65943251T>C" "7/1630 patient alleles" "{PMID:Sharon 2002:12037007}" "" "Rod NCKX Gene T2764C, Trp922Arg" "" "Unknown" "?" "" "0" "" "" "g.65650913T>C" "" "likely benign" "" "0000873196" "0" "30" "15" "65944981" "65944981" "subst" "2.03146E-5" "00000" "SLC24A1_000053" "g.65944981T>C" "1/1630 patient alleles" "{PMID:Sharon 2002:12037007}" "" "Rod NCKX Gene T2885C, Val962Ala" "" "Unknown" "?" "" "0" "" "" "g.65652643T>C" "" "likely benign" "" "0000873197" "0" "70" "15" "65945071" "65945071" "subst" "4.46846E-5" "00000" "SLC24A1_000054" "g.65945071T>C" "2/1630 patient alleles" "{PMID:Sharon 2002:12037007}" "" "Rod NCKX Gene T2975C, Ile992Thr" "" "Germline" "yes" "" "0" "" "" "g.65652733T>C" "" "likely pathogenic" "" "0000873198" "0" "70" "15" "65945071" "65945071" "subst" "4.46846E-5" "00000" "SLC24A1_000054" "g.65945071T>C" "2/1630 patient alleles" "{PMID:Sharon 2002:12037007}" "" "Rod NCKX Gene T2975C, Ile992Thr" "" "Germline" "yes" "" "0" "" "" "g.65652733T>C" "" "likely pathogenic" "" "0000873199" "0" "30" "15" "65945076" "65945076" "subst" "4.06266E-5" "00000" "SLC24A1_000055" "g.65945076G>A" "1/1630 patient alleles" "{PMID:Sharon 2002:12037007}" "" "Rod NCKX Gene G2980A, Ala994Thr" "" "Unknown" "?" "" "0" "" "" "g.65652738G>A" "" "likely benign" "" "0000873200" "0" "30" "15" "65946277" "65946277" "subst" "2.84303E-5" "00000" "SLC24A1_000056" "g.65946277T>G" "1/1630 patient alleles" "{PMID:Sharon 2002:12037007}" "" "Rod NCKX Gene T3160G, Phe1054Val" "" "Germline" "no" "" "0" "" "" "g.65653939T>G" "" "likely benign" "" "0000873201" "0" "30" "15" "65918071" "65918071" "subst" "0.000381785" "00000" "SLC24A1_000044" "g.65918071C>T" "2/1630 patient alleles" "{PMID:Sharon 2002:12037007}" "" "Rod NCKX Gene C1653T, Leu551" "" "Unknown" "?" "" "0" "" "" "g.65625733C>T" "" "likely benign" "" "0000873202" "0" "30" "15" "65943265" "65943265" "subst" "0.00189661" "00000" "SLC24A1_000026" "g.65943265C>T" "10/1630 patient alleles" "{PMID:Sharon 2002:12037007}" "" "Rod NCKX Gene C2778T, Pro926" "" "Unknown" "?" "" "0" "" "" "g.65650927C>T" "" "likely benign" "" "0000873203" "0" "30" "15" "65946297" "65946297" "subst" "8.12302E-5" "00000" "SLC24A1_000057" "g.65946297G>A" "1/1630 patient alleles" "{PMID:Sharon 2002:12037007}" "" "Rod NCKX Gene G3180A, Ala1062" "" "Unknown" "?" "" "0" "" "" "g.65653959G>A" "" "likely benign" "" "0000873204" "0" "30" "15" "65930460" "65930460" "subst" "0.000117341" "00000" "SLC24A1_000046" "g.65930460T>C" "1/1630 patient alleles" "{PMID:Sharon 2002:12037007}" "" "Rod NCKX Gene IVS2-6T3C, tgtctgc" "obsolete annotation, probably should be c.1891-6T>C" "Unknown" "?" "" "0" "" "" "g.65638122T>C" "" "likely benign" "" "0000873205" "0" "30" "15" "65931911" "65931912" "ins" "0" "00000" "SLC24A1_000048" "g.65931911_65931912insAGGACTG" "424/1630 patient alleles" "{PMID:Sharon 2002:12037007}" "" "Rod NCKX Gene IVS3-22ins7bp, aggcctg" "obsolete annotation, probably should be c.1945-22_1945-21insAGGACTG" "Unknown" "?" "" "0" "" "" "g.65639573_65639574insAGGACTG" "" "likely benign" "" "0000873206" "0" "30" "15" "65931875" "65931875" "subst" "0" "00000" "SLC24A1_000047" "g.65931875G>A" "2/1630 patient alleles" "{PMID:Sharon 2002:12037007}" "" "Rod NCKX Gene IVS3-58G3A, ctcatgt" "obsolete annotation, should be c.1945-58G>A" "Unknown" "?" "" "0" "" "" "g.65639537G>A" "" "likely benign" "" "0000873207" "0" "30" "15" "65936759" "65936759" "subst" "2.01609E-5" "00000" "DENND4A_000012" "g.65936759T>C" "1/1630 patient alleles" "{PMID:Sharon 2002:12037007}" "" "Rod NCKX Gene IVS4-6T3C, catctgc" "obsolete annotation, should be c.2054-6T>C" "Unknown" "?" "" "0" "" "" "g.65644421T>C" "" "likely benign" "" "0000873222" "3" "70" "15" "65918031" "65918032" "del" "0" "00000" "SLC24A1_000001" "g.65918031_65918032del" "" "{PMID:Riazuddin 2010:20850105}" "" "SLC24A1 c.1613_1614del (p.F538CfsX23)" "homozygous" "Germline" "yes" "" "0" "" "" "g.65625693_65625694del" "" "likely pathogenic (recessive)" "" "0000873223" "3" "70" "15" "65918031" "65918032" "del" "0" "00000" "SLC24A1_000001" "g.65918031_65918032del" "" "{PMID:Riazuddin 2010:20850105}" "" "SLC24A1 c.1613_1614del (p.F538CfsX23)" "homozygous" "Germline" "yes" "" "0" "" "" "g.65625693_65625694del" "" "likely pathogenic (recessive)" "" "0000873224" "3" "70" "15" "65918031" "65918032" "del" "0" "00000" "SLC24A1_000001" "g.65918031_65918032del" "" "{PMID:Riazuddin 2010:20850105}" "" "SLC24A1 c.1613_1614del (p.F538CfsX23)" "homozygous" "Germline" "yes" "" "0" "" "" "g.65625693_65625694del" "" "likely pathogenic (recessive)" "" "0000873225" "3" "70" "15" "65918031" "65918032" "del" "0" "00000" "SLC24A1_000001" "g.65918031_65918032del" "" "{PMID:Riazuddin 2010:20850105}" "" "SLC24A1 c.1613_1614del (p.F538CfsX23)" "homozygous" "Germline" "yes" "" "0" "" "" "g.65625693_65625694del" "" "likely pathogenic (recessive)" "" "0000873226" "3" "70" "15" "65918031" "65918032" "del" "0" "00000" "SLC24A1_000001" "g.65918031_65918032del" "" "{PMID:Riazuddin 2010:20850105}" "" "SLC24A1 c.1613_1614del (p.F538CfsX23)" "homozygous" "Germline" "yes" "" "0" "" "" "g.65625693_65625694del" "" "likely pathogenic (recessive)" "" "0000892212" "0" "90" "15" "65917098" "65917098" "del" "0" "02327" "DENND4A_000033" "g.65917098del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000892213" "0" "10" "15" "65917906" "65917906" "subst" "0.00221728" "02330" "DENND4A_000007" "g.65917906C>T" "" "" "" "SLC24A1(NM_004727.2):c.1488C>T (p.G496=), SLC24A1(NM_004727.3):c.1488C>T (p.G496=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000914345" "0" "30" "15" "65952598" "65952598" "subst" "0" "02330" "DENND4A_000034" "g.65952598T>C" "" "" "" "SLC24A1(NM_001301033.2):c.2997-19T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000916179" "1" "90" "15" "65944031" "65944031" "del" "2.03583E-5" "04436" "SLC24A1_000058" "g.65944031del" "" "{PMID:Panneman 2023:36819107}" "" "c.2817del" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916180" "2" "70" "15" "65946211" "65946211" "subst" "0" "04436" "SLC24A1_000059" "g.65946211C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.3094C>T" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000958077" "3" "90" "15" "65916590" "65916590" "subst" "4.0659E-6" "00006" "SLC24A1_000060" "g.65916590C>T" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1, PP5" "Germline" "" "" "0" "" "" "g.65624252C>T" "962672" "pathogenic (recessive)" "ACMG" "0000981360" "0" "50" "15" "65943076" "65943084" "del" "0" "01804" "DENND4A_000035" "g.65943076_65943084del" "" "" "" "SLC24A1(NM_004727.3):c.2589_2597del (p.(Glu866_Glu868del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000981361" "0" "50" "15" "65946293" "65946293" "subst" "2.03075E-5" "01804" "DENND4A_000036" "g.65946293T>C" "" "" "" "SLC24A1(NM_004727.3):c.3176T>C (p.(Ile1059Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000981362" "0" "50" "15" "65952633" "65952633" "dup" "0" "01804" "DENND4A_000037" "g.65952633dup" "" "" "" "SLC24A1(NM_001301033.2):c.3013dup (p.(Met1005Asnfs*12))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001040508" "0" "50" "15" "65917872" "65917872" "subst" "0.000215279" "01804" "SLC24A1_000011" "g.65917872C>T" "" "" "" "SLC24A1(NM_004727.2):c.1454C>T (p.T485I), SLC24A1(NM_004727.3):c.1454C>T (p.T485I, p.(Thr485Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001040509" "0" "30" "15" "65930500" "65930500" "subst" "9.56834E-5" "01804" "DENND4A_000038" "g.65930500A>G" "" "" "" "SLC24A1(NM_004727.3):c.1925A>G (p.(Gln642Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001040510" "0" "30" "15" "65935315" "65935315" "subst" "3.24018E-5" "01804" "DENND4A_000039" "g.65935315C>T" "" "" "" "SLC24A1(NM_001254740.2):c.5C>T (p.(Pro2Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001040511" "0" "50" "15" "65944033" "65944033" "subst" "0" "01804" "DENND4A_000040" "g.65944033C>T" "" "" "" "SLC24A1(NM_004727.3):c.2819C>T (p.(Thr940Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001040512" "0" "50" "15" "65944053" "65944053" "subst" "4.06759E-6" "01804" "DENND4A_000041" "g.65944053T>C" "" "" "" "SLC24A1(NM_004727.3):c.2839T>C (p.(Trp947Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001055166" "0" "90" "15" "65917172" "65917173" "del" "0.000101534" "01804" "SLC24A1_000031" "g.65917172_65917173del" "" "" "" "SLC24A1(NM_004727.3):c.754_755del (p.(Met252ValfsTer2))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes SLC24A1 ## Count = 125 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000089186" "00019178" "90" "2401" "0" "2401" "0" "c.2401G>T" "r.(?)" "p.(Glu801*)" "7" "0000089187" "00019178" "90" "1691" "0" "1693" "0" "c.1691_1693del" "r.(?)" "p.(Phe564del)" "2" "0000089188" "00019178" "90" "2968" "0" "2968" "0" "c.2968A>C" "r.(?)" "p.(Ser990Arg)" "9" "0000089190" "00019178" "90" "2401" "0" "2401" "0" "c.2401G>T" "r.(?)" "p.(Glu801*)" "7" "0000089191" "00019178" "90" "3291" "0" "3294" "0" "c.3291_3294del" "r.(?)" "p.(Val1099Glufs*31)" "10" "0000089192" "00019178" "90" "2968" "0" "2968" "0" "c.2968A>C" "r.(?)" "p.(Ser990Arg)" "9" "0000158353" "00019178" "90" "1613" "0" "1614" "0" "c.1613_1614del" "r.(?)" "p.(Phe538Cysfs*23)" "2" "0000247301" "00019178" "10" "2594" "0" "2594" "0" "c.2594A>G" "r.(?)" "p.(Glu865Gly)" "" "0000247344" "00019178" "10" "9556" "0" "9556" "0" "c.*6256A>G" "r.(=)" "p.(=)" "" "0000247358" "00019178" "50" "772" "0" "772" "0" "c.772A>G" "r.(?)" "p.(Thr258Ala)" "" "0000248926" "00019178" "10" "109" "0" "109" "0" "c.109A>T" "r.(?)" "p.(Thr37Ser)" "" "0000253369" "00019178" "10" "2594" "0" "2594" "0" "c.2594A>G" "r.(?)" "p.(Glu865Gly)" "" "0000295874" "00019178" "10" "1454" "0" "1454" "0" "c.1454C>T" "r.(?)" "p.(Thr485Ile)" "" "0000295875" "00019178" "10" "2054" "-1401" "2054" "-1401" "c.2054-1401C>T" "r.(=)" "p.(=)" "" "0000295876" "00019178" "30" "2445" "0" "2445" "0" "c.2445C>T" "r.(?)" "p.(His815=)" "" "0000295877" "00019178" "10" "2778" "0" "2778" "0" "c.2778C>T" "r.(?)" "p.(Pro926=)" "" "0000295878" "00019178" "10" "3051" "-13" "3051" "-13" "c.3051-13T>C" "r.(=)" "p.(=)" "" "0000295879" "00019178" "30" "3281" "0" "3281" "0" "c.3281C>T" "r.(?)" "p.(Ser1094Phe)" "" "0000295880" "00019178" "30" "531" "0" "531" "0" "c.531C>T" "r.(?)" "p.(Tyr177=)" "" "0000295881" "00019178" "10" "939" "0" "939" "0" "c.939G>A" "r.(?)" "p.(Leu313=)" "" "0000308290" "00019178" "30" "1166" "0" "1166" "0" "c.1166T>A" "r.(?)" "p.(Met389Lys)" "" "0000308291" "00019178" "30" "1893" "0" "1893" "0" "c.1893G>A" "r.(?)" "p.(Pro631=)" "" "0000308292" "00019178" "50" "2171" "0" "2171" "0" "c.2171C>T" "r.(?)" "p.(Thr724Met)" "" "0000308293" "00019178" "50" "2183" "0" "2183" "0" "c.2183C>T" "r.(?)" "p.(Ala728Val)" "" "0000308294" "00019178" "30" "2349" "0" "2349" "0" "c.2349T>C" "r.(?)" "p.(Gly783=)" "" "0000308295" "00019178" "30" "2445" "0" "2445" "0" "c.2445C>T" "r.(?)" "p.(His815=)" "" "0000308297" "00019178" "50" "2764" "0" "2764" "0" "c.2764T>C" "r.(?)" "p.(Trp922Arg)" "" "0000308298" "00019178" "30" "2778" "0" "2778" "0" "c.2778C>T" "r.(?)" "p.(Pro926=)" "" "0000350100" "00019178" "90" "1320" "0" "1320" "0" "c.1320C>G" "r.(?)" "p.(Tyr440Ter)" "" "0000555153" "00019178" "30" "120" "0" "120" "0" "c.120C>T" "r.(?)" "p.(His40=)" "" "0000555154" "00019178" "30" "253" "0" "253" "0" "c.253G>A" "r.(?)" "p.(Glu85Lys)" "" "0000555155" "00019178" "30" "802" "0" "802" "0" "c.802G>A" "r.(?)" "p.(Val268Ile)" "" "0000555156" "00019178" "30" "931" "0" "931" "0" "c.931G>C" "r.(?)" "p.(Val311Leu)" "" "0000555157" "00019178" "30" "1131" "0" "1131" "0" "c.1131C>T" "r.(?)" "p.(Thr377=)" "" "0000555158" "00019178" "10" "1242" "0" "1242" "0" "c.1242C>G" "r.(?)" "p.(Ala414=)" "" "0000555159" "00019178" "50" "1454" "0" "1454" "0" "c.1454C>T" "r.(?)" "p.(Thr485Ile)" "" "0000555160" "00019178" "10" "1488" "0" "1488" "0" "c.1488C>T" "r.(?)" "p.(Gly496=)" "" "0000555161" "00019178" "30" "1859" "0" "1859" "0" "c.1859C>T" "r.(?)" "p.(Ala620Val)" "" "0000555162" "00019178" "30" "1892" "0" "1892" "0" "c.1892C>T" "r.(?)" "p.(Pro631Leu)" "" "0000555163" "00019178" "10" "1945" "-22" "1945" "-21" "c.1945-22_1945-21insAGGCCTG" "r.(=)" "p.(=)" "" "0000555164" "00019178" "50" "2002" "0" "2002" "0" "c.2002C>T" "r.(?)" "p.(Arg668Cys)" "" "0000555165" "00019178" "50" "2054" "-6" "2054" "-6" "c.2054-6T>C" "r.(=)" "p.(=)" "" "0000555167" "00019178" "50" "2452" "0" "2452" "0" "c.2452G>A" "r.(?)" "p.(Asp818Asn)" "" "0000555168" "00019178" "50" "2632" "0" "2643" "0" "c.2632_2643dup" "r.(?)" "p.(Gln878_Glu881dup)" "" "0000555169" "00019178" "10" "2658" "0" "2660" "0" "c.2658_2660del" "r.(?)" "p.(Glu890del)" "" "0000555170" "00019178" "30" "2797" "0" "2797" "0" "c.2797T>G" "r.(?)" "p.(Ser933Ala)" "" "0000555171" "00019178" "50" "2963" "0" "2965" "0" "c.2963_2965del" "r.(?)" "p.(Ile988del)" "" "0000555172" "00019178" "50" "3038" "0" "3038" "0" "c.3038A>G" "r.(?)" "p.(Asp1013Gly)" "" "0000555173" "00019178" "50" "3056" "0" "3056" "0" "c.3056C>A" "r.(?)" "p.(Pro1019His)" "" "0000615448" "00019178" "30" "601" "0" "601" "0" "c.601G>A" "r.(?)" "p.(Val201Met)" "" "0000615449" "00019178" "30" "1242" "0" "1242" "0" "c.1242C>G" "r.(?)" "p.(Ala414=)" "" "0000649135" "00019178" "30" "2764" "0" "2764" "0" "c.2764T>C" "r.(?)" "p.(Trp922Arg)" "" "0000657634" "00019178" "50" "3179" "0" "3179" "0" "c.3179C>T" "r.(?)" "p.(Ala1060Val)" "" "0000663582" "00019178" "50" "2813" "0" "2813" "0" "c.2813T>G" "r.(?)" "p.(Val938Gly)" "" "0000680259" "00019178" "30" "192" "0" "192" "0" "c.192T>C" "r.(?)" "p.(Ser64=)" "" "0000680260" "00019178" "30" "2054" "-1423" "2054" "-1423" "c.2054-1423C>G" "r.(=)" "p.(=)" "" "0000725253" "00019178" "50" "1375" "0" "1375" "0" "c.1375G>A" "r.(?)" "p.(Val459Ile)" "" "0000725254" "00019178" "50" "2183" "0" "2183" "0" "c.2183C>T" "r.(?)" "p.(Ala728Val)" "" "0000732510" "00019178" "90" "2002" "0" "2002" "0" "c.2002C>T" "r.(?)" "p.(Arg668Cys)" "" "0000733093" "00019178" "70" "754" "0" "755" "0" "c.754_755del" "r.(?)" "p.(Met252Valfs*2)" "" "0000733547" "00019178" "70" "3157" "0" "3158" "0" "c.3157_3158del" "r.(?)" "p.(Leu1053Valfs*10)" "" "0000735180" "00019178" "50" "1771" "0" "1773" "0" "c.1771_1773del" "r.(?)" "p.(Leu591del)" "" "0000735673" "00019178" "90" "95" "0" "95" "0" "c.95T>A" "r.(?)" "p.(Leu32*)" "" "0000735771" "00019178" "90" "754" "0" "755" "0" "c.754_755del" "r.(?)" "p.(Met252Valfs*2)" "" "0000736854" "00019178" "50" "2071" "0" "2073" "0" "c.2071_2073del" "r.(?)" "p.(Lys691del)" "" "0000736855" "00019178" "50" "2658" "0" "2660" "0" "c.2658_2660del" "r.(?)" "p.(Glu890del)" "" "0000759609" "00019178" "90" "2679" "0" "2679" "0" "c.2679del" "r.(?)" "p.(Asn893Lysfs*31)" "" "0000759973" "00019178" "50" "1976" "0" "1976" "0" "c.1976C>T" "r.(?)" "p.(Ser659Leu)" "" "0000806870" "00019178" "50" "1136" "0" "1136" "0" "c.1136C>T" "r.(?)" "p.(Thr379Ile)" "" "0000806871" "00019178" "30" "1859" "0" "1859" "0" "c.1859C>T" "r.(?)" "p.(Ala620Val)" "" "0000812038" "00019178" "70" "1963" "0" "1963" "0" "c.1963C>T" "r.(?)" "p.(Arg655*)" "Ex4" "0000812417" "00019178" "70" "1715" "0" "1715" "0" "c.1715T>C" "r.(?)" "p.(Leu572Pro)" "2" "0000854129" "00019178" "30" "120" "0" "120" "0" "c.120C>T" "r.(?)" "p.(His40=)" "" "0000854130" "00019178" "50" "803" "0" "803" "0" "c.803T>C" "r.(?)" "p.(Val268Ala)" "" "0000854131" "00019178" "30" "2628" "0" "2654" "0" "c.2628_2654del" "r.(?)" "p.(Gln878_Glu886del)" "" "0000863935" "00019178" "50" "1450" "0" "1450" "0" "c.1450A>T" "r.(?)" "p.(Ile484Phe)" "" "0000863936" "00019178" "30" "9536" "0" "9536" "0" "c.*6236T>A" "r.(=)" "p.(=)" "" "0000873180" "00019178" "70" "754" "0" "755" "0" "c.754_755del" "r.(?)" "p.(Met252Valfs*2)" "2" "0000873181" "00019178" "70" "2186" "0" "2186" "0" "c.2186del" "r.(?)" "p.(Pro729Leufs*93)" "6" "0000873182" "00019178" "10" "2628" "0" "2654" "0" "c.2628_2654del" "r.(?)" "p.(Gln878_Glu886del)" "7" "0000873183" "00019178" "10" "2658" "0" "2660" "0" "c.2658_2660dup" "r.(?)" "p.(Glu890dup)" "7" "0000873184" "00019178" "70" "87" "0" "87" "0" "c.87G>A" "r.spl" "p.(Leu29=)" "2" "0000873185" "00019178" "10" "109" "0" "109" "0" "c.109A>T" "r.(?)" "p.(Thr37Ser)" "2" "0000873186" "00019178" "10" "716" "0" "716" "0" "c.716G>C" "r.(?)" "p.(Arg239Thr)" "2" "0000873187" "00019178" "30" "931" "0" "931" "0" "c.931G>C" "r.(?)" "p.(Val311Leu)" "2" "0000873188" "00019178" "10" "937" "0" "937" "0" "c.937T>G" "r.(?)" "p.(Leu313Val)" "2" "0000873189" "00019178" "10" "991" "0" "991" "0" "c.991A>T" "r.(?)" "p.(Ser331Cys)" "2" "0000873190" "00019178" "30" "1166" "0" "1166" "0" "c.1166T>A" "r.(?)" "p.(Met389Lys)" "2" "0000873191" "00019178" "50" "1375" "0" "1375" "0" "c.1375G>A" "r.(?)" "p.(Val459Ile)" "2" "0000873192" "00019178" "30" "1822" "0" "1822" "0" "c.1822G>A" "r.(?)" "p.(Val608Ile)" "2" "0000873193" "00019178" "30" "2326" "0" "2326" "0" "c.2326G>C" "r.(?)" "p.(Glu776Gln)" "7" "0000873194" "00019178" "30" "2749" "0" "2749" "0" "c.2749A>G" "r.(?)" "p.(Ile917Val)" "7" "0000873195" "00019178" "30" "2764" "0" "2764" "0" "c.2764T>C" "r.(?)" "p.(Trp922Arg)" "7" "0000873196" "00019178" "30" "2885" "0" "2885" "0" "c.2885T>C" "r.(?)" "p.(Val962Ala)" "9" "0000873197" "00019178" "70" "2975" "0" "2975" "0" "c.2975T>C" "r.(?)" "p.(Ile992Thr)" "9" "0000873198" "00019178" "70" "2975" "0" "2975" "0" "c.2975T>C" "r.(?)" "p.(Ile992Thr)" "9" "0000873199" "00019178" "30" "2980" "0" "2980" "0" "c.2980G>A" "r.(?)" "p.(Ala994Thr)" "9" "0000873200" "00019178" "30" "3160" "0" "3160" "0" "c.3160T>G" "r.(?)" "p.(Phe1054Val)" "10" "0000873201" "00019178" "30" "1653" "0" "1653" "0" "c.1653C>T" "r.(?)" "p.(Leu551=)" "2" "0000873202" "00019178" "30" "2778" "0" "2778" "0" "c.2778C>T" "r.(?)" "p.(Pro926=)" "7" "0000873203" "00019178" "30" "3180" "0" "3180" "0" "c.3180G>A" "r.(?)" "p.(Ala1060=)" "10" "0000873204" "00019178" "30" "1891" "-6" "1891" "-6" "c.1891-6T>C" "r.spl?" "p.?" "2i" "0000873205" "00019178" "30" "1945" "-22" "1945" "-21" "c.1945-22_1945-21insAGGACTG" "r.(?)" "p.?" "3i" "0000873206" "00019178" "30" "1945" "-58" "1945" "-58" "c.1945-58G>A" "r.(?)" "p.?" "3i" "0000873207" "00019178" "30" "2054" "-6" "2054" "-6" "c.2054-6T>C" "r.spl?" "p.?" "4i" "0000873222" "00019178" "70" "1613" "0" "1614" "0" "c.1613_1614del" "r.(?)" "p.(Phe538Cysfs*23)" "" "0000873223" "00019178" "70" "1613" "0" "1614" "0" "c.1613_1614del" "r.(?)" "p.(Phe538Cysfs*23)" "" "0000873224" "00019178" "70" "1613" "0" "1614" "0" "c.1613_1614del" "r.(?)" "p.(Phe538Cysfs*23)" "" "0000873225" "00019178" "70" "1613" "0" "1614" "0" "c.1613_1614del" "r.(?)" "p.(Phe538Cysfs*23)" "" "0000873226" "00019178" "70" "1613" "0" "1614" "0" "c.1613_1614del" "r.(?)" "p.(Phe538Cysfs*23)" "" "0000892212" "00019178" "90" "680" "0" "680" "0" "c.680del" "r.(?)" "p.(Ala227Glufs*14)" "" "0000892213" "00019178" "10" "1488" "0" "1488" "0" "c.1488C>T" "r.(?)" "p.(Gly496=)" "" "0000914345" "00019178" "30" "9481" "0" "9481" "0" "c.*6181T>C" "r.(=)" "p.(=)" "" "0000916179" "00019178" "90" "2817" "0" "2817" "0" "c.2817del" "r.(?)" "p.(Phe939Leufs*10)" "0" "0000916180" "00019178" "70" "3094" "0" "3094" "0" "c.3094C>T" "r.(?)" "p.(Gln1032*)" "0" "0000958077" "00019178" "90" "172" "0" "172" "0" "c.172C>T" "r.(?)" "p.(Gln58Ter)" "" "0000981360" "00019178" "50" "2589" "0" "2597" "0" "c.2589_2597del" "r.(?)" "p.(Glu866_Glu868del)" "" "0000981361" "00019178" "50" "3176" "0" "3176" "0" "c.3176T>C" "r.(?)" "p.(Ile1059Thr)" "" "0000981362" "00019178" "50" "9516" "0" "9516" "0" "c.*6216dup" "r.(?)" "p.(=)" "" "0001040508" "00019178" "50" "1454" "0" "1454" "0" "c.1454C>T" "r.(?)" "p.(Thr485Ile)" "" "0001040509" "00019178" "30" "1925" "0" "1925" "0" "c.1925A>G" "r.(?)" "p.(Gln642Arg)" "" "0001040510" "00019178" "30" "2054" "-1450" "2054" "-1450" "c.2054-1450C>T" "r.(=)" "p.(=)" "" "0001040511" "00019178" "50" "2819" "0" "2819" "0" "c.2819C>T" "r.(?)" "p.(Thr940Ile)" "" "0001040512" "00019178" "50" "2839" "0" "2839" "0" "c.2839T>C" "r.(?)" "p.(Trp947Arg)" "" "0001055166" "00019178" "90" "754" "0" "755" "0" "c.754_755del" "r.(?)" "p.(Met252Valfs*2)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 57 "{{screeningid}}" "{{variantid}}" "0000058590" "0000089186" "0000058590" "0000089190" "0000058591" "0000089187" "0000058591" "0000089191" "0000058592" "0000089188" "0000058592" "0000089192" "0000096361" "0000158353" "0000100490" "0000735180" "0000292446" "0000649135" "0000300751" "0000663582" "0000334589" "0000732510" "0000335084" "0000733093" "0000335084" "0000733547" "0000336398" "0000735673" "0000336398" "0000735771" "0000337224" "0000736854" "0000337225" "0000736855" "0000359978" "0000759609" "0000360184" "0000759973" "0000385151" "0000812038" "0000385383" "0000812417" "0000415397" "0000873180" "0000415398" "0000873181" "0000415399" "0000873182" "0000415400" "0000873183" "0000415401" "0000873184" "0000415402" "0000873185" "0000415403" "0000873186" "0000415404" "0000873187" "0000415405" "0000873188" "0000415406" "0000873189" "0000415407" "0000873190" "0000415408" "0000873191" "0000415409" "0000873192" "0000415410" "0000873193" "0000415411" "0000873194" "0000415412" "0000873195" "0000415413" "0000873196" "0000415414" "0000873197" "0000415415" "0000873198" "0000415416" "0000873199" "0000415417" "0000873200" "0000415418" "0000873201" "0000415419" "0000873202" "0000415420" "0000873203" "0000415421" "0000873204" "0000415422" "0000873205" "0000415423" "0000873206" "0000415424" "0000873207" "0000415439" "0000873222" "0000415440" "0000873223" "0000415441" "0000873224" "0000415442" "0000873225" "0000415443" "0000873226" "0000431175" "0000916179" "0000431175" "0000916180" "0000448591" "0000958077"