### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = SLC34A1) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "SLC34A1" "solute carrier family 34 (sodium phosphate), member 1" "5" "q35.3" "unknown" "NG_016223.1" "UD_132118776711" "" "https://www.LOVD.nl/SLC34A1" "" "1" "11019" "6569" "182309" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "" "g" "http://databases.lovd.nl/shared/refseq/SLC34A1_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2017-01-06 22:31:36" "00006" "2025-09-24 08:32:36" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00019273" "SLC34A1" "transcript variant 1" "001" "NM_003052.4" "" "NP_003043.3" "" "" "" "-104" "2482" "1920" "176811432" "176825849" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 7 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00000" "Healthy/Control" "Healthy individual / control" "" "" "" "" "" "00000" "2012-07-26 17:29:43" "" "" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00909" "NPHLOP1" "nephrolithiasis/osteoporosis, hypophosphatemic, type 1 (NPHLOP-1)" "AD" "612286" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "00910" "FRTS2" "Fanconi renotubular syndrome, type 2 (FRTS-2)" "AR" "613388" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "04214" "-" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00001" "2023-03-09 14:26:26" "05195" "HCINF2" "hypercalcemia, infantile, type 2 (HCINF-2)" "AR" "616963" "" "" "" "00006" "2016-10-11 12:16:28" "00006" "2021-12-10 21:51:32" "05296" "OI" "osteogenesis imperfecta" "" "" "" "" "" "00006" "2017-06-26 22:59:16" "00006" "2025-09-23 21:54:31" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 3 "{{geneid}}" "{{diseaseid}}" "SLC34A1" "00909" "SLC34A1" "00910" "SLC34A1" "05195" ## Individuals ## Do not remove or alter this header ## ## Count = 22 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00074402" "" "" "" "2" "" "01606" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}" "6-generation family, affected niece/nephew, unaffected heterozygous carrier parents, Pat1" "F" "yes" "Turkey" ">01y06m" "0" "" "" "" "26047794-Fam1Pat1" "00074403" "" "" "00074402" "1" "" "01606" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}" "Pat2" "M" "yes" "Turkey" ">07y" "0" "" "Rehydration (acute phase); oral phosphate, hydrochlorothiazide (long term)" "" "26047794-Fam1Pat2" "00074404" "" "" "" "1" "" "01606" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}" "5-generation family, 1 affected, unaffected heterozygous carrier parents" "" "yes" "Turkey" ">06y" "0" "" "" "" "26047794-Fam2Pat1" "00074405" "" "" "" "1" "" "01606" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}" "4-generation family, 1 affected, unaffected heterozygous carrier parents" "" "yes" "Turkey" ">01y06m" "0" "" "" "" "26047794-Fam3Pat1" "00095160" "" "" "" "8" "" "00006" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}" "" "" "" "" "" "0" "" "" "" "" "00095161" "" "" "" "1" "" "00006" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "" "Netherlands" "" "0" "" "" "" "" "00095162" "" "" "" "1" "" "00006" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "" "Poland" "" "0" "" "" "" "" "00095163" "" "" "" "1" "" "00006" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "" "Poland" "" "0" "" "" "" "" "00095164" "" "" "" "1" "" "00006" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "" "Poland" "" "0" "" "" "" "" "00095165" "" "" "" "1" "" "00006" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "" "Germany" "" "0" "" "" "" "" "00095166" "" "" "" "1" "" "00006" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "" "Germany" "" "0" "" "" "" "" "00095167" "" "" "" "1" "" "00006" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "" "Turkey" "" "0" "" "" "" "" "00095168" "" "" "" "1" "" "00006" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "" "Bulgaria" "" "0" "" "" "" "" "00095169" "" "" "" "1" "" "00006" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}" "4-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "yes" "Israel" "" "0" "" "" "" "" "00095170" "" "" "" "1" "" "00006" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "yes" "Belgium" "" "0" "" "" "" "" "00095171" "" "" "" "1" "" "00006" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "yes" "Italy" "" "0" "" "" "" "" "00095172" "" "" "" "1" "" "00006" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "" "Poland" "" "0" "" "" "" "" "00248174" "" "" "" "1" "" "03367" "" "" "F" "" "Russia" ">00y06m" "0" "" "" "" "" "00293821" "" "" "" "21" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00293822" "" "" "" "49" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00395063" "" "" "" "1" "" "00000" "{PMID:Zacchia 2021:33964006}" "" "F" "" "(Italy)" "" "0" "" "" "" "K53" "00466837" "" "" "" "1" "" "00006" "{PMID:Tuysuz 2022:34902613}" "" "" "" "Turkey" "" "0" "" "" "" "Pat124" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 23 "{{individualid}}" "{{diseaseid}}" "00074402" "05195" "00074403" "05195" "00074404" "05195" "00074405" "05195" "00095160" "00000" "00095161" "05195" "00095162" "05195" "00095163" "05195" "00095164" "05195" "00095165" "05195" "00095166" "05195" "00095167" "05195" "00095168" "05195" "00095169" "05195" "00095170" "05195" "00095171" "05195" "00095172" "05195" "00248174" "00910" "00248174" "05195" "00293821" "00198" "00293822" "00198" "00395063" "04214" "00466837" "05296" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00000, 00198, 00909, 00910, 04214, 05195, 05296 ## Count = 20 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000061011" "00198" "00074404" "01606" "Familial, autosomal recessive" "00y02m" "ephrocalcinosis (HP:0000121), Hypercalciuria (HP:0002150), Hypercalcemia (HP:0003072), Hypophosphatemia (HP:0002148), Hypoparathyroidism (HP:0000829), Increased serum 1,25-dihydroxyvitamin D3 (HP:0003152)" "" "" "" "" "" "" "" "" "" "infantile hypercalcemia" "" "0000073558" "05195" "00074404" "01606" "Familial, autosomal recessive" "00y02m" "diagnosis infantile hypercalcemia; ephrocalcinosis (HP:0000121), Hypercalciuria (HP:0002150), Hypercalcemia (HP:0003072), Hypophosphatemia (HP:0002148), Hypoparathyroidism (HP:0000829), Increased serum 1,25-dihydroxyvitamin D3 (HP:0003152)" "" "" "" "" "" "" "" "" "" "" "" "0000073559" "05195" "00074405" "00006" "Familial, autosomal recessive" "00y02m" "diagnosis infantile hypercalcemia; failure to thrive (HP:0001508), Polyuria (HP:0000103), Dehydration (HP:0001944), no muscular hypotonia (-HP:0001252), Nephrocalcinosis (HP:0000121), Hypercalciuria (HP:0002150), Hypercalcemia (HP:0003072), Hypophosphatemia (HP:0002148)" "" "" "" "" "" "" "" "" "" "" "" "0000073560" "05195" "00074402" "01606" "Familial, autosomal recessive" "<00y01m" "Failure to thrive (HP:0001508), Polyuria (HP:0000103), Dehydration (HP:0001944), Muscular hypotonia (HP:0001252), Nephrocalcinosis (HP:0000121), Hypercalciuria (HP:0002150), Hypercalcemia (HP:0003072), Hypophosphatemia (HP:0002148), Hypoparathyroidism (HP:0000829), Increased serum 1,25-dihydroxyvitamin D3 (HP:0003152)," "<00y01m" "" "failure to thrive (HP:0001508)" "" "" "" "" "" "" "" "" "0000073561" "05195" "00074403" "01606" "Familial, autosomal recessive" "00y01m" "failure to thrive (HP:0001508), Polyuria (HP:0000103), Dehydration (HP:0001944), no muscular hypotonia (-HP:0001252), Nephrocalcinosis (HP:0000121), Hypercalciuria (HP:0002150), Hypercalcemia (HP:0003072), Hypophosphatemia (HP:0002148)" "00y01m" "" "failure to thrive (HP:0001508)" "" "" "" "" "" "" "" "" "0000073562" "05195" "00095161" "00006" "Familial, autosomal recessive" "14y" "see paper; …" "2m" "" "" "" "" "" "" "" "" "" "" "0000073563" "05195" "00095162" "00006" "Unknown" "10y" "see paper; …" "4m" "" "" "" "" "" "" "" "" "" "" "0000073564" "05195" "00095163" "00006" "Unknown" "17y" "see paper; …" "9m" "" "" "" "" "" "" "" "" "" "" "0000073565" "05195" "00095164" "00006" "Familial, autosomal recessive" "3y" "see paper; …" "10m" "" "" "" "" "" "" "" "" "" "" "0000073566" "05195" "00095165" "00006" "Familial, autosomal recessive" "3y" "see paper; …" "1m" "" "" "" "" "" "" "" "" "" "" "0000073567" "05195" "00095166" "00006" "Familial, autosomal recessive" "11m" "see paper; …" "3m" "" "" "" "" "" "" "" "" "" "" "0000073568" "05195" "00095167" "00006" "Familial, autosomal recessive" "1y" "see paper; …" "3m" "" "" "" "" "" "" "" "" "" "" "0000073569" "05195" "00095168" "00006" "Familial, autosomal recessive" "11m" "see paper; …" "4m" "" "" "" "" "" "" "" "" "" "" "0000073570" "05195" "00095169" "00006" "Familial, autosomal recessive" "11y" "see paper; …" "7m" "" "" "" "" "" "" "" "" "" "" "0000073571" "05195" "00095170" "00006" "Unknown" "6y" "see paper; …" "6m" "" "" "" "" "" "" "" "" "" "" "0000073572" "05195" "00095171" "00006" "Familial, autosomal recessive" "1y" "see paper; …" "3m" "" "" "" "" "" "" "" "" "" "" "0000073573" "05195" "00095172" "00006" "Familial, autosomal recessive" "3y6m" "see paper; …" "1y6m" "" "" "" "" "" "" "" "" "" "" "0000187182" "05195" "00248174" "03367" "Familial, autosomal recessive" "" "Nephrocalcinosis, Muscular hypotonia, Failure to thrive" "" "" "" "" "" "" "" "" "" "" "" "0000288263" "04214" "00395063" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "Tubulopathy (hypercalciuria)" "" "" "0000352200" "05296" "00466837" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "osteogenesis imperfecta" "" ## Screenings ## Do not remove or alter this header ## ## Count = 22 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000074563" "00074402" "1" "01606" "01606" "2016-06-27 14:21:32" "" "" "SEQ" "DNA" "" "" "0000074564" "00074403" "1" "01606" "01606" "2016-06-27 14:47:28" "" "" "SEQ" "DNA" "" "" "0000074565" "00074404" "1" "01606" "01606" "2016-06-27 15:02:41" "" "" "SEQ" "DNA" "" "" "0000074566" "00074405" "1" "01606" "01606" "2016-06-27 15:08:22" "" "" "SEQ" "DNA" "" "" "0000095558" "00095160" "1" "00006" "00006" "2017-01-06 22:34:14" "" "" "SEQ" "DNA" "" "" "0000095559" "00095161" "1" "00006" "00006" "2017-01-07 11:15:15" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000095560" "00095162" "1" "00006" "00006" "2017-01-07 11:15:15" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000095561" "00095163" "1" "00006" "00006" "2017-01-07 11:15:15" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000095562" "00095164" "1" "00006" "00006" "2017-01-07 11:15:15" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000095563" "00095165" "1" "00006" "00006" "2017-01-07 11:15:15" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000095564" "00095166" "1" "00006" "00006" "2017-01-07 11:15:15" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000095565" "00095167" "1" "00006" "00006" "2017-01-07 11:15:15" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000095566" "00095168" "1" "00006" "00006" "2017-01-07 11:15:15" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000095567" "00095169" "1" "00006" "00006" "2017-01-07 11:15:15" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000095568" "00095170" "1" "00006" "00006" "2017-01-07 11:15:15" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000095569" "00095171" "1" "00006" "00006" "2017-01-07 11:15:15" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000095570" "00095172" "1" "00006" "00006" "2017-01-07 11:15:15" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000249279" "00248174" "1" "03367" "03367" "2019-07-19 14:53:33" "" "" "SEQ-NG-I" "DNA" "Blood" "WES" "0000294989" "00293821" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000294990" "00293822" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000396309" "00395063" "1" "00000" "03840" "2021-12-03 13:19:14" "" "" "SEQ-NG" "DNA" "blood" "115 genes causing different inherited kidney diseases" "0000468501" "00466837" "1" "00006" "00006" "2025-09-24 08:32:06" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 18 "{{screeningid}}" "{{geneid}}" "0000074563" "SLC34A1" "0000074564" "SLC34A1" "0000074565" "SLC34A1" "0000074566" "SLC34A1" "0000095558" "SLC34A1" "0000095559" "SLC34A1" "0000095560" "SLC34A1" "0000095561" "SLC34A1" "0000095562" "SLC34A1" "0000095563" "SLC34A1" "0000095564" "SLC34A1" "0000095565" "SLC34A1" "0000095566" "SLC34A1" "0000095567" "SLC34A1" "0000095568" "SLC34A1" "0000095569" "SLC34A1" "0000095570" "SLC34A1" "0000396309" "SLC34A1" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 86 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000118941" "3" "90" "5" "176814875" "176814875" "subst" "8.31746E-5" "01606" "SLC34A1_000002" "g.176814875G>A" "" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}, {OMIM182309:0004}" "" "" "" "Germline" "yes" "rs201304511" "0" "" "" "g.177387874G>A" "" "pathogenic" "" "0000118942" "3" "90" "5" "176814875" "176814875" "subst" "8.31746E-5" "01606" "SLC34A1_000002" "g.176814875G>A" "" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}, {OMIM182309:0004}" "" "" "" "Germline" "yes" "rs201304511" "0" "" "" "g.177387874G>A" "" "pathogenic" "" "0000118943" "3" "90" "5" "176813493" "176813493" "subst" "2.03084E-5" "01606" "SLC34A1_000001" "g.176813493G>T" "" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}, {OMIM182309:0005}" "" "" "" "Germline" "yes" "rs769409705" "0" "" "" "g.177386492G>T" "" "pathogenic" "" "0000118944" "3" "90" "5" "176820765" "176820765" "subst" "6.49905E-5" "01606" "SLC34A1_000003" "g.176820765G>A" "" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}, {OMIM182309:0006}" "" "" "" "Germline" "yes" "rs200095793" "0" "" "" "g.177393764G>A" "" "pathogenic" "" "0000154128" "1" "70" "5" "176813234" "176813254" "del" "0" "00006" "SLC34A1_000004" "g.176813234_176813254del" "8/512 chromosomes" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}, {OMIM182309:0009}" "" "p.91del7" "" "Germline" "" "rs876661296" "0" "" "" "g.177386233_177386253del" "" "likely pathogenic" "" "0000154129" "1" "90" "5" "176813493" "176813493" "subst" "4.06167E-6" "00006" "SLC34A1_000005" "g.176813493G>C" "" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}, {OMIM182309:0007}" "" "" "" "Germline" "yes" "rs769409705" "0" "" "" "g.177386492G>C" "" "pathogenic" "" "0000154130" "1" "90" "5" "176824792" "176824793" "del" "0" "00006" "SLC34A1_000006" "g.176824792_176824793del" "" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}" "" "1425_26del" "" "Germline" "yes" "rs769409705" "0" "" "" "g.177397791_177397792del" "" "pathogenic" "" "0000154131" "1" "70" "5" "176813234" "176813254" "del" "0" "00006" "SLC34A1_000004" "g.176813234_176813254del" "" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}, {OMIM182309:0009}" "" "p.91del7" "" "Germline" "yes" "rs876661296" "0" "" "" "g.177386233_177386253del" "" "likely pathogenic" "" "0000154132" "1" "90" "5" "176813493" "176813493" "subst" "4.06167E-6" "00006" "SLC34A1_000005" "g.176813493G>C" "" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}, {OMIM182309:0007}" "" "" "" "Germline" "yes" "rs769409705" "0" "" "" "g.177386492G>C" "" "pathogenic" "" "0000154133" "1" "70" "5" "176813234" "176813254" "del" "0" "00006" "SLC34A1_000004" "g.176813234_176813254del" "" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}, {OMIM182309:0009}" "" "p.91del7" "" "Germline" "yes" "rs876661296" "0" "" "" "g.177386233_177386253del" "" "likely pathogenic" "" "0000154134" "1" "90" "5" "176813493" "176813493" "subst" "4.06167E-6" "00006" "SLC34A1_000005" "g.176813493G>C" "" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}, {OMIM182309:0007}" "" "" "" "Germline" "yes" "rs769409705" "0" "" "" "g.177386492G>C" "" "pathogenic" "" "0000154135" "1" "90" "5" "176813493" "176813493" "subst" "2.03084E-5" "00006" "SLC34A1_000001" "g.176813493G>T" "" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}, {OMIM182309:0005}" "" "" "" "Germline" "yes" "rs769409705" "0" "" "" "g.177386492G>T" "" "pathogenic" "" "0000154136" "1" "90" "5" "176820767" "176820770" "del" "0" "00006" "SLC34A1_000007" "g.176820767_176820770del" "" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}" "" "IVS9+3_+6del" "" "Germline" "yes" "" "0" "" "" "g.177393766_177393769del" "" "pathogenic" "" "0000154137" "3" "90" "5" "176814874" "176814874" "subst" "3.32914E-5" "00006" "SLC34A1_000009" "g.176814874G>A" "" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}" "" "" "" "Germline" "yes" "" "0" "" "" "g.177387873G>A" "" "pathogenic" "" "0000154138" "1" "70" "5" "176813234" "176813254" "del" "0" "00006" "SLC34A1_000004" "g.176813234_176813254del" "" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}, {OMIM182309:0009}" "" "p.91del7" "" "Germline" "yes" "rs876661296" "0" "" "" "g.177386233_177386253del" "" "likely pathogenic" "" "0000154139" "1" "90" "5" "176814787" "176814788" "del" "0" "00006" "SLC34A1_000010" "g.176814787_176814788del" "" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}" "" "555_556del" "" "Germline" "yes" "" "0" "" "" "g.177387786_177387787del" "" "pathogenic" "" "0000154140" "3" "70" "5" "176813234" "176813254" "del" "0" "00006" "SLC34A1_000004" "g.176813234_176813254del" "" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}, {OMIM182309:0009}" "" "p.91del7" "" "Germline" "yes" "rs876661296" "0" "" "" "g.177386233_177386253del" "" "likely pathogenic" "" "0000154141" "2" "90" "5" "176820764" "176820764" "subst" "0" "00006" "SLC34A1_000011" "g.176820764T>G" "" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}, {OMIM182309:0008}" "" "" "" "Germline" "yes" "rs876661338" "0" "" "" "g.177393763T>G" "" "pathogenic" "" "0000154142" "2" "90" "5" "176813499" "176813499" "subst" "1.6247E-5" "00006" "SLC34A1_000012" "g.176813499T>C" "" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}" "" "" "" "Germline" "yes" "" "0" "" "" "g.177386498T>C" "" "pathogenic" "" "0000154143" "2" "90" "5" "176824080" "176824080" "subst" "0.000523672" "00006" "SLC34A1_000008" "g.176824080G>A" "" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}" "" "IVS12+5g>a" "" "Germline" "yes" "" "0" "" "" "g.177397079G>A" "" "pathogenic" "" "0000154144" "2" "90" "5" "176815351" "176815351" "subst" "0" "00006" "SLC34A1_000013" "g.176815351G>A" "" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}" "" "" "" "Germline" "yes" "" "0" "" "" "g.177388350G>A" "" "pathogenic" "" "0000154145" "2" "90" "5" "176823782" "176823782" "subst" "0.00010153" "00006" "SLC34A1_000014" "g.176823782T>A" "" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}" "" "" "" "Germline" "yes" "" "0" "" "" "g.177396781T>A" "" "pathogenic" "" "0000154146" "2" "90" "5" "176824829" "176824829" "subst" "0" "00006" "SLC34A1_000015" "g.176824829T>C" "" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}" "" "" "" "Germline" "yes" "" "0" "" "" "g.177397828T>C" "" "pathogenic" "" "0000154147" "2" "90" "5" "176824981" "176824981" "subst" "8.12612E-6" "00006" "SLC34A1_000016" "g.176824981G>A" "" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}" "" "" "" "Germline" "yes" "" "0" "" "" "g.177397980G>A" "" "pathogenic" "" "0000154148" "2" "90" "5" "176823782" "176823782" "subst" "0.00010153" "00006" "SLC34A1_000014" "g.176823782T>A" "" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}" "" "" "" "Germline" "yes" "" "0" "" "" "g.177396781T>A" "" "pathogenic" "" "0000154149" "2" "90" "5" "176824080" "176824080" "subst" "0.000523672" "00006" "SLC34A1_000008" "g.176824080G>A" "" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}" "" "IVS12+5g>a" "" "Germline" "yes" "" "0" "" "" "g.177397079G>A" "" "pathogenic" "" "0000154150" "0" "70" "5" "176813234" "176813254" "del" "0" "00006" "SLC34A1_000004" "g.176813234_176813254del" "" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}" "" "" "cDNA expression cloning in Xenopus oocytes showed induced P-uptake/in Opossum kidney cells showed partial intra-cellular retention but no actin co-localisation" "In vitro (cloned)" "-" "" "0" "" "" "g.177386233_177386253del" "" "NA" "" "0000154151" "0" "90" "5" "176813493" "176813493" "subst" "4.06167E-6" "00006" "SLC34A1_000005" "g.176813493G>C" "" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}" "" "" "cDNA expression cloning in Xenopus oocytes showed no induced P-uptake/in Opossum kidney cells showed complete intra-cellular retention and no actin co-localisation" "In vitro (cloned)" "-" "" "0" "" "" "g.177386492G>C" "" "NA" "" "0000154152" "0" "90" "5" "176813493" "176813493" "subst" "2.03084E-5" "00006" "SLC34A1_000001" "g.176813493G>T" "" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}" "" "" "cDNA expression cloning in Xenopus oocytes showed no induced P-uptake/in Opossum kidney cells showed complete intra-cellular retention and no actin co-localisation" "In vitro (cloned)" "-" "" "0" "" "" "g.177386492G>T" "" "NA" "" "0000154153" "0" "90" "5" "176813499" "176813499" "subst" "1.6247E-5" "00006" "SLC34A1_000012" "g.176813499T>C" "" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}" "" "" "cDNA expression cloning in Xenopus oocytes showed no induced P-uptake/in Opossum kidney cells showed complete intra-cellular retention and no actin co-localisation" "In vitro (cloned)" "-" "" "0" "" "" "g.177386498T>C" "" "NA" "" "0000154154" "0" "90" "5" "176820764" "176820764" "subst" "0" "00006" "SLC34A1_000011" "g.176820764T>G" "" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}" "" "" "cDNA expression cloning in Xenopus oocytes showed no induced P-uptake/in Opossum kidney cells showed complete intra-cellular retention and no actin co-localisation" "In vitro (cloned)" "-" "" "0" "" "" "g.177393763T>G" "" "NA" "" "0000154155" "0" "90" "5" "176823782" "176823782" "subst" "0.00010153" "00006" "SLC34A1_000014" "g.176823782T>A" "" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}" "" "" "cDNA expression cloning in Xenopus oocytes showed no induced P-uptake/in Opossum kidney cells showed complete intra-cellular retention and no actin co-localisation" "In vitro (cloned)" "-" "" "0" "" "" "g.177396781T>A" "" "NA" "" "0000154156" "0" "90" "5" "176824792" "176824793" "del" "0" "00006" "SLC34A1_000006" "g.176824792_176824793del" "" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}" "" "" "cDNA expression cloning in Xenopus oocytes showed no induced P-uptake/in Opossum kidney cells showed complete intra-cellular retention and no actin co-localisation" "In vitro (cloned)" "-" "" "0" "" "" "g.177397791_177397792del" "" "NA" "" "0000154157" "0" "90" "5" "176824829" "176824829" "subst" "0" "00006" "SLC34A1_000015" "g.176824829T>C" "" "{PMID:Schlingmann 2016:26047794}, {DOI:Schlingmann 2016:10.1681/ASN.2014101025}" "" "" "cDNA expression cloning in Xenopus oocytes showed no induced P-uptake/in Opossum kidney cells showed complete intra-cellular retention and no actin co-localisation" "In vitro (cloned)" "-" "" "0" "" "" "g.177397828T>C" "" "NA" "" "0000267942" "0" "10" "5" "176830627" "176830627" "subst" "0.518421" "02325" "F12_000002" "g.176830627G>A" "" "" "" "F12(NM_000505.4):c.1251-9C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.177403626G>A" "" "benign" "" "0000298297" "0" "10" "5" "176813404" "176813404" "subst" "0.228944" "02325" "SLC34A1_000018" "g.176813404C>T" "" "" "" "SLC34A1(NM_003052.5):c.389-20C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.177386403C>T" "" "benign" "" "0000298298" "0" "10" "5" "176815124" "176815124" "subst" "0.296133" "02325" "SLC34A1_000020" "g.176815124T>C" "" "" "" "SLC34A1(NM_003052.5):c.774T>C (p.H258=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.177388123T>C" "" "benign" "" "0000299539" "0" "70" "5" "176815132" "176815160" "del" "0" "02329" "SLC34A1_000021" "g.176815132_176815160del" "" "" "" "SLC34A1(NM_003052.5):c.782_810delGTGATGCTCCTGACCTGCTCAAGATCATC (p.R261Hfs*23)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.177388131_177388159del" "" "likely pathogenic" "" "0000302225" "0" "90" "5" "176820765" "176820765" "subst" "6.49905E-5" "02326" "SLC34A1_000003" "g.176820765G>A" "" "" "" "SLC34A1(NM_003052.5):c.1006+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.177393764G>A" "" "pathogenic" "" "0000302226" "0" "10" "5" "176825069" "176825069" "subst" "0.0222172" "02326" "SLC34A1_000022" "g.176825069C>T" "" "" "" "SLC34A1(NM_003052.5):c.1702C>T (p.H568Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.177398068C>T" "" "benign" "" "0000302227" "0" "10" "5" "176813234" "176813254" "del" "0" "02326" "SLC34A1_000017" "g.176813234_176813254del" "" "" "" "SLC34A1(NM_003052.4):c.272_292delTCCCCAAGCTGCGCCAGGCTG (p.(Val91_Ala97del)), SLC34A1(NM_003052.5):c.272_292delTCCCCAAGCTGCGCCAGGCTG (p.V91_A97del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.177386233_177386253del" "" "benign" "" "0000302228" "0" "30" "5" "176813433" "176813433" "subst" "0.00375216" "02326" "SLC34A1_000019" "g.176813433C>T" "" "" "" "SLC34A1(NM_003052.4):c.398C>T (p.A133V), SLC34A1(NM_003052.5):c.398C>T (p.(Ala133Val), p.A133V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.177386432C>T" "" "likely benign" "" "0000337363" "0" "10" "5" "176813404" "176813404" "subst" "0.228944" "02327" "SLC34A1_000018" "g.176813404C>T" "" "" "" "SLC34A1(NM_003052.5):c.389-20C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.177386403C>T" "" "benign" "" "0000337364" "0" "10" "5" "176830627" "176830627" "subst" "0.518421" "02327" "F12_000002" "g.176830627G>A" "" "" "" "F12(NM_000505.4):c.1251-9C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.177403626G>A" "" "benign" "" "0000340684" "0" "50" "5" "176824864" "176824864" "subst" "0" "02327" "SLC34A1_000024" "g.176824864C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.177397863C>T" "" "VUS" "" "0000340805" "0" "10" "5" "176815124" "176815124" "subst" "0.296133" "02327" "SLC34A1_000020" "g.176815124T>C" "" "" "" "SLC34A1(NM_003052.5):c.774T>C (p.H258=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.177388123T>C" "" "benign" "" "0000346501" "0" "10" "5" "176825069" "176825069" "subst" "0.0222172" "02327" "SLC34A1_000022" "g.176825069C>T" "" "" "" "SLC34A1(NM_003052.5):c.1702C>T (p.H568Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.177398068C>T" "" "benign" "" "0000348200" "0" "50" "5" "176813472" "176813472" "subst" "4.87337E-5" "02327" "SLC34A1_000023" "g.176813472C>T" "" "" "" "SLC34A1(NM_003052.4):c.437C>T (p.P146L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.177386471C>T" "" "VUS" "" "0000350981" "0" "90" "5" "176820765" "176820765" "subst" "6.49905E-5" "02327" "SLC34A1_000003" "g.176820765G>A" "" "" "" "SLC34A1(NM_003052.5):c.1006+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.177393764G>A" "" "pathogenic" "" "0000525306" "0" "50" "5" "176814862" "176814862" "subst" "8.19659E-6" "02327" "SLC34A1_000025" "g.176814862C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.177387861C>A" "" "VUS" "" "0000525307" "0" "30" "5" "176830451" "176830451" "subst" "0.0025852" "02327" "F12_000011" "g.176830451C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.177403450C>T" "" "likely benign" "" "0000525308" "0" "30" "5" "176830627" "176830627" "subst" "0.000619096" "01943" "F12_000012" "g.176830627G>C" "" "" "" "F12(NM_000505.3):c.1251-9C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.177403626G>C" "" "likely benign" "" "0000578026" "0" "70" "5" "176820765" "176820765" "subst" "6.49905E-5" "03367" "SLC34A1_000003" "g.176820765G>A" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.177393764G>A" "" "likely pathogenic (recessive)" "" "0000578027" "0" "50" "5" "176821038" "176821038" "subst" "0" "03367" "SLC34A1_000026" "g.176821038T>C" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.177394037T>C" "" "VUS" "" "0000609645" "0" "30" "5" "176830570" "176830570" "subst" "0.000850598" "01943" "F12_000026" "g.176830570G>A" "" "" "" "F12(NM_000505.3):c.1299C>T (p.N433=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.177403569G>A" "" "likely benign" "" "0000651678" "1" "30" "5" "176813433" "176813433" "subst" "0.00375216" "03575" "SLC34A1_000019" "g.176813433C>T" "21/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "21 heterozygous, no homozygous; {DB:CLININrs148976897}" "Germline" "" "rs148976897" "0" "" "" "g.177386432C>T" "" "likely benign" "" "0000651679" "1" "30" "5" "176825069" "176825069" "subst" "0.0222172" "03575" "SLC34A1_000022" "g.176825069C>T" "49/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "49 heterozygous, no homozygous; {DB:CLININrs34225933}" "Germline" "" "rs34225933" "0" "" "" "g.177398068C>T" "" "likely benign" "" "0000655355" "0" "10" "5" "176813234" "176813254" "del" "0" "02325" "SLC34A1_000004" "g.176813234_176813254del" "" "" "" "SLC34A1(NM_003052.4):c.272_292delTCCCCAAGCTGCGCCAGGCTG (p.(Val91_Ala97del)), SLC34A1(NM_003052.5):c.272_292delTCCCCAAGCTGCGCCAGGCTG (p.V91_A97del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.177386233_177386253del" "" "benign" "" "0000655356" "0" "30" "5" "176829467" "176829467" "subst" "0.000496955" "01943" "F12_000029" "g.176829467C>T" "" "" "" "F12(NM_000505.3):c.1681-7G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.177402466C>T" "" "likely benign" "" "0000677480" "0" "50" "5" "176813433" "176813433" "subst" "0.00375216" "02325" "SLC34A1_000019" "g.176813433C>T" "" "" "" "SLC34A1(NM_003052.4):c.398C>T (p.A133V), SLC34A1(NM_003052.5):c.398C>T (p.(Ala133Val), p.A133V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000677481" "0" "50" "5" "176813484" "176813484" "subst" "4.06131E-6" "02325" "SLC34A1_000027" "g.176813484T>A" "" "" "" "SLC34A1(NM_003052.5):c.449T>A (p.L150Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000689488" "0" "90" "5" "176830619" "176830619" "subst" "0" "01943" "F12_000031" "g.176830619C>T" "" "" "" "F12(NM_000505.3):c.1251-1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "pathogenic" "" "0000720351" "0" "50" "5" "176813433" "176813433" "subst" "0.00375216" "01943" "SLC34A1_000019" "g.176813433C>T" "" "" "" "SLC34A1(NM_003052.4):c.398C>T (p.A133V), SLC34A1(NM_003052.5):c.398C>T (p.(Ala133Val), p.A133V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000720352" "0" "50" "5" "176813472" "176813472" "subst" "4.87337E-5" "01943" "SLC34A1_000023" "g.176813472C>T" "" "" "" "SLC34A1(NM_003052.4):c.437C>T (p.P146L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000720354" "0" "70" "5" "176823984" "176823984" "subst" "1.62522E-5" "02326" "PFN3_000001" "g.176823984C>T" "" "" "" "SLC34A1(NM_003052.5):c.1325C>T (p.P442L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000720355" "0" "30" "5" "176830588" "176830588" "subst" "1.71935E-5" "01943" "F12_000033" "g.176830588G>A" "" "" "" "F12(NM_000505.3):c.1281C>T (p.L427=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000827878" "0" "50" "5" "176812822" "176812822" "subst" "2.47881E-5" "00000" "SLC34A1_000029" "g.176812822C>T" "" "{PMID:Zacchia 2021:33964006}" "" "SLC34A1 c.80C>T, p.T27M" "heterozygous; unsolved" "Unknown" "?" "" "0" "" "" "g.177385821C>T" "" "VUS" "ACMG" "0000850877" "0" "50" "5" "176821059" "176821059" "subst" "8.12506E-6" "01943" "SLC34A1_000030" "g.176821059C>T" "" "" "" "SLC34A1(NM_003052.4):c.1037C>T (p.P346L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000886766" "0" "50" "5" "176812798" "176812798" "subst" "7.86443E-5" "02327" "SLC34A1_000031" "g.176812798G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000886767" "0" "90" "5" "176812815" "176812815" "subst" "5.78986E-5" "02327" "SLC34A1_000032" "g.176812815C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000886768" "0" "50" "5" "176814822" "176814822" "subst" "8.12499E-6" "02326" "SLC34A1_000033" "g.176814822A>C" "" "" "" "SLC34A1(NM_003052.5):c.592A>C (p.T198P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000886769" "0" "50" "5" "176814834" "176814834" "subst" "9.3499E-5" "02326" "SLC34A1_000034" "g.176814834G>A" "" "" "" "SLC34A1(NM_003052.5):c.604G>A (p.V202M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000912291" "0" "30" "5" "176830413" "176830413" "subst" "4.95462E-6" "02326" "F12_000053" "g.176830413G>C" "" "" "" "F12(NM_000505.3):c.1388-15C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000912292" "0" "30" "5" "176830627" "176830627" "subst" "0.000619096" "02326" "F12_000012" "g.176830627G>C" "" "" "" "F12(NM_000505.3):c.1251-9C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000929055" "0" "30" "5" "176813246" "176813246" "subst" "0.0025203" "02326" "SLC34A1_000035" "g.176813246G>A" "" "" "" "SLC34A1(NM_003052.5):c.284G>A (p.R95H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000948531" "0" "90" "5" "176813493" "176813493" "subst" "2.03084E-5" "02326" "SLC34A1_000001" "g.176813493G>T" "" "" "" "SLC34A1(NM_003052.5):c.458G>T (p.G153V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000948532" "0" "50" "5" "176821016" "176821024" "del" "0" "02326" "SLC34A1_000036" "g.176821016_176821024del" "" "" "" "SLC34A1(NM_003052.5):c.1007-13_1007-5delCCACCCCCT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000963561" "0" "50" "5" "176815012" "176815012" "subst" "1.62701E-5" "02327" "SLC34A1_000037" "g.176815012C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000976741" "0" "30" "5" "176815091" "176815091" "subst" "0.000251889" "02326" "SLC34A1_000038" "g.176815091C>A" "" "" "" "SLC34A1(NM_003052.5):c.741C>A (p.I247=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000994943" "0" "30" "5" "176813234" "176813254" "del" "0" "01804" "SLC34A1_000004" "g.176813234_176813254del" "" "" "" "SLC34A1(NM_003052.4):c.272_292delTCCCCAAGCTGCGCCAGGCTG (p.(Val91_Ala97del)), SLC34A1(NM_003052.5):c.272_292delTCCCCAAGCTGCGCCAGGCTG (p.V91_A97del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001025070" "0" "30" "5" "176824078" "176824078" "subst" "0.000353752" "02325" "PFN3_000004" "g.176824078G>A" "" "" "" "SLC34A1(NM_003052.5):c.1416+3G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001025071" "0" "90" "5" "176829461" "176829461" "subst" "0.000412216" "02325" "F12_000041" "g.176829461C>T" "" "" "" "F12(NM_000505.4):c.1681-1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001035122" "0" "30" "5" "176813433" "176813433" "subst" "0.00375216" "01804" "SLC34A1_000019" "g.176813433C>T" "" "" "" "SLC34A1(NM_003052.4):c.398C>T (p.A133V), SLC34A1(NM_003052.5):c.398C>T (p.(Ala133Val), p.A133V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001035123" "0" "70" "5" "176813499" "176813499" "subst" "1.6247E-5" "01804" "SLC34A1_000012" "g.176813499T>C" "" "" "" "SLC34A1(NM_003052.5):c.464T>C (p.(Leu155Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001045277" "0" "70" "5" "176820687" "176820687" "subst" "9.74627E-5" "03779" "SLC34A1_000039" "g.176820687T>A" "" "" "" "" "" "Unknown" "" "rs148615663" "0" "" "" "" "" "likely pathogenic" "" "0001048335" "0" "70" "5" "176813234" "176813254" "del" "0" "00006" "SLC34A1_000004" "g.176813234_176813254del" "" "{PMID:Tuysuz 2022:34902613}" "" "" "ACMG" "Germline/De novo (untested)" "" "" "0" "" "" "g.177386233_177386253del" "" "likely pathogenic" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes SLC34A1 ## Count = 86 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000118941" "00019273" "90" "644" "1" "644" "1" "c.644+1G>A" "r.spl" "p.?" "6i" "0000118942" "00019273" "90" "644" "1" "644" "1" "c.644+1G>A" "r.spl" "p.?" "6i" "0000118943" "00019273" "90" "458" "0" "458" "0" "c.458G>T" "r.(?)" "p.(Gly153Val)" "5" "0000118944" "00019273" "90" "1006" "1" "1006" "1" "c.1006+1G>A" "r.spl" "p.?" "9i" "0000154128" "00019273" "70" "272" "0" "292" "0" "c.272_292del" "r.(?)" "p.(Val91_Ala97del)" "4" "0000154129" "00019273" "90" "458" "0" "458" "0" "c.458G>C" "r.(?)" "p.(Gly153Ala)" "5" "0000154130" "00019273" "90" "1425" "0" "1426" "0" "c.1425_1426del" "r.(?)" "p.(Cys476Serfs*128)" "13" "0000154131" "00019273" "70" "272" "0" "292" "0" "c.272_292del" "r.(?)" "p.(Val91_Ala97del)" "4" "0000154132" "00019273" "90" "458" "0" "458" "0" "c.458G>C" "r.(?)" "p.(Gly153Ala)" "5" "0000154133" "00019273" "70" "272" "0" "292" "0" "c.272_292del" "r.(?)" "p.(Val91_Ala97del)" "4" "0000154134" "00019273" "90" "458" "0" "458" "0" "c.458G>C" "r.(?)" "p.(Gly153Ala)" "5" "0000154135" "00019273" "90" "458" "0" "458" "0" "c.458G>T" "r.(?)" "p.(Gly153Val)" "5" "0000154136" "00019273" "90" "1006" "3" "1006" "6" "c.1006+3_1006+6del" "r.spl" "p.?" "9i" "0000154137" "00019273" "90" "644" "0" "644" "0" "c.644G>A" "r.spl?" "p.(Arg215Gln)" "6" "0000154138" "00019273" "70" "272" "0" "292" "0" "c.272_292del" "r.(?)" "p.(Val91_Ala97del)" "4" "0000154139" "00019273" "90" "557" "0" "558" "0" "c.557_558del" "r.(?)" "p.(Pro186Hisfs*26)" "6" "0000154140" "00019273" "70" "272" "0" "292" "0" "c.272_292del" "r.(?)" "p.(Val91_Ala97del)" "4" "0000154141" "00019273" "90" "1006" "0" "1006" "0" "c.1006T>G" "r.(?)" "p.(Cys336Gly)" "9" "0000154142" "00019273" "90" "464" "0" "464" "0" "c.464T>C" "r.(?)" "p.(Leu155Pro)" "5" "0000154143" "00019273" "90" "1416" "5" "1416" "5" "c.1416+5G>A" "r.spl" "p.?" "12i" "0000154144" "00019273" "90" "914" "0" "914" "0" "c.914G>A" "r.(?)" "p.(Trp305*)" "8" "0000154145" "00019273" "90" "1223" "0" "1223" "0" "c.1223T>A" "r.(?)" "p.(Val408Glu)" "11" "0000154146" "00019273" "90" "1462" "0" "1462" "0" "c.1462T>C" "r.(?)" "p.(Trp488Arg)" "13" "0000154147" "00019273" "90" "1614" "0" "1614" "0" "c.1614G>A" "r.(?)" "p.(Trp538*)" "13" "0000154148" "00019273" "90" "1223" "0" "1223" "0" "c.1223T>A" "r.(?)" "p.(Val408Glu)" "11" "0000154149" "00019273" "90" "1416" "5" "1416" "5" "c.1416+5G>A" "r.spl" "p.?" "12i" "0000154150" "00019273" "70" "272" "0" "292" "0" "c.272_292del" "r.(?)" "p.Val91_Ala97del" "4" "0000154151" "00019273" "90" "458" "0" "458" "0" "c.458G>C" "r.(?)" "p.Gly153Ala" "5" "0000154152" "00019273" "90" "458" "0" "458" "0" "c.458G>T" "r.(?)" "p.Gly153Val" "5" "0000154153" "00019273" "90" "464" "0" "464" "0" "c.464T>C" "r.(?)" "p.Leu155Pro" "5" "0000154154" "00019273" "90" "1006" "0" "1006" "0" "c.1006T>G" "r.(?)" "p.Cys336Gly" "9" "0000154155" "00019273" "90" "1223" "0" "1223" "0" "c.1223T>A" "r.(?)" "p.Val408Glu" "11" "0000154156" "00019273" "90" "1425" "0" "1426" "0" "c.1425_1426del" "r.(?)" "p.Cys476Serfs*128" "13" "0000154157" "00019273" "90" "1462" "0" "1462" "0" "c.1462T>C" "r.(?)" "p.Trp488Arg" "13" "0000267942" "00019273" "10" "7260" "0" "7260" "0" "c.*5340G>A" "r.(=)" "p.(=)" "" "0000298297" "00019273" "10" "389" "-20" "389" "-20" "c.389-20C>T" "r.(=)" "p.(=)" "" "0000298298" "00019273" "10" "774" "0" "774" "0" "c.774T>C" "r.(?)" "p.(His258=)" "" "0000299539" "00019273" "70" "782" "0" "810" "0" "c.782_810del" "r.(?)" "p.(Arg261HisfsTer23)" "" "0000302225" "00019273" "90" "1006" "1" "1006" "1" "c.1006+1G>A" "r.spl?" "p.?" "" "0000302226" "00019273" "10" "1702" "0" "1702" "0" "c.1702C>T" "r.(?)" "p.(His568Tyr)" "" "0000302227" "00019273" "10" "272" "0" "292" "0" "c.272_292del" "r.(?)" "p.(Val91_Ala97del)" "" "0000302228" "00019273" "30" "398" "0" "398" "0" "c.398C>T" "r.(?)" "p.(Ala133Val)" "" "0000337363" "00019273" "10" "389" "-20" "389" "-20" "c.389-20C>T" "r.(=)" "p.(=)" "" "0000337364" "00019273" "10" "7260" "0" "7260" "0" "c.*5340G>A" "r.(=)" "p.(=)" "" "0000340684" "00019273" "50" "1497" "0" "1497" "0" "c.1497C>T" "r.(?)" "p.(Arg499=)" "" "0000340805" "00019273" "10" "774" "0" "774" "0" "c.774T>C" "r.(?)" "p.(His258=)" "" "0000346501" "00019273" "10" "1702" "0" "1702" "0" "c.1702C>T" "r.(?)" "p.(His568Tyr)" "" "0000348200" "00019273" "50" "437" "0" "437" "0" "c.437C>T" "r.(?)" "p.(Pro146Leu)" "" "0000350981" "00019273" "90" "1006" "1" "1006" "1" "c.1006+1G>A" "r.spl?" "p.?" "" "0000525306" "00019273" "50" "632" "0" "632" "0" "c.632C>A" "r.(?)" "p.(Thr211Asn)" "" "0000525307" "00019273" "30" "7084" "0" "7084" "0" "c.*5164C>T" "r.(=)" "p.(=)" "" "0000525308" "00019273" "30" "7260" "0" "7260" "0" "c.*5340G>C" "r.(=)" "p.(=)" "" "0000578026" "00019273" "70" "1006" "1" "1006" "1" "c.1006+1G>A" "r.spl" "p.?" "" "0000578027" "00019273" "50" "1016" "0" "1016" "0" "c.1016T>C" "r.(?)" "p.(Ile339Thr)" "10" "0000609645" "00019273" "30" "7203" "0" "7203" "0" "c.*5283G>A" "r.(=)" "p.(=)" "" "0000651678" "00019273" "30" "398" "0" "398" "0" "c.398C>T" "r.(?)" "p.(Ala133Val)" "" "0000651679" "00019273" "30" "1702" "0" "1702" "0" "c.1702C>T" "r.(?)" "p.(His568Tyr)" "" "0000655355" "00019273" "10" "272" "0" "292" "0" "c.272_292del" "r.(?)" "p.(Val91_Ala97del)" "" "0000655356" "00019273" "30" "6100" "0" "6100" "0" "c.*4180C>T" "r.(=)" "p.(=)" "" "0000677480" "00019273" "50" "398" "0" "398" "0" "c.398C>T" "r.(?)" "p.(Ala133Val)" "" "0000677481" "00019273" "50" "449" "0" "449" "0" "c.449T>A" "r.(?)" "p.(Leu150Gln)" "" "0000689488" "00019273" "90" "7252" "0" "7252" "0" "c.*5332C>T" "r.(=)" "p.(=)" "" "0000720351" "00019273" "50" "398" "0" "398" "0" "c.398C>T" "r.(?)" "p.(Ala133Val)" "" "0000720352" "00019273" "50" "437" "0" "437" "0" "c.437C>T" "r.(?)" "p.(Pro146Leu)" "" "0000720354" "00019273" "70" "1325" "0" "1325" "0" "c.1325C>T" "r.(?)" "p.(Pro442Leu)" "" "0000720355" "00019273" "30" "7221" "0" "7221" "0" "c.*5301G>A" "r.(=)" "p.(=)" "" "0000827878" "00019273" "50" "80" "0" "80" "0" "c.80C>T" "r.(?)" "p.(Thr27Met)" "" "0000850877" "00019273" "50" "1037" "0" "1037" "0" "c.1037C>T" "r.(?)" "p.(Pro346Leu)" "" "0000886766" "00019273" "50" "56" "0" "56" "0" "c.56G>A" "r.(?)" "p.(Arg19His)" "" "0000886767" "00019273" "90" "73" "0" "73" "0" "c.73C>T" "r.(?)" "p.(Arg25*)" "" "0000886768" "00019273" "50" "592" "0" "592" "0" "c.592A>C" "r.(?)" "p.(Thr198Pro)" "" "0000886769" "00019273" "50" "604" "0" "604" "0" "c.604G>A" "r.(?)" "p.(Val202Met)" "" "0000912291" "00019273" "30" "7046" "0" "7046" "0" "c.*5126G>C" "r.(=)" "p.(=)" "" "0000912292" "00019273" "30" "7260" "0" "7260" "0" "c.*5340G>C" "r.(=)" "p.(=)" "" "0000929055" "00019273" "30" "284" "0" "284" "0" "c.284G>A" "r.(?)" "p.(Arg95His)" "" "0000948531" "00019273" "90" "458" "0" "458" "0" "c.458G>T" "r.(?)" "p.(Gly153Val)" "" "0000948532" "00019273" "50" "1007" "-13" "1007" "-5" "c.1007-13_1007-5del" "r.spl?" "p.?" "" "0000963561" "00019273" "50" "662" "0" "662" "0" "c.662C>T" "r.(?)" "p.(Thr221Met)" "" "0000976741" "00019273" "30" "741" "0" "741" "0" "c.741C>A" "r.(?)" "p.(=)" "" "0000994943" "00019273" "30" "272" "0" "292" "0" "c.272_292del" "r.(?)" "p.(Val91_Ala97del)" "" "0001025070" "00019273" "30" "1416" "3" "1416" "3" "c.1416+3G>A" "r.spl?" "p.?" "" "0001025071" "00019273" "90" "6094" "0" "6094" "0" "c.*4174C>T" "r.(=)" "p.(=)" "" "0001035122" "00019273" "30" "398" "0" "398" "0" "c.398C>T" "r.(?)" "p.(Ala133Val)" "" "0001035123" "00019273" "70" "464" "0" "464" "0" "c.464T>C" "r.(?)" "p.(Leu155Pro)" "" "0001045277" "00019273" "70" "937" "-8" "937" "-8" "c.937-8T>A" "r.(?)" "p.(?)" "" "0001048335" "00019273" "70" "272" "0" "292" "0" "c.272_292del" "r.(?)" "p.(Val91_Ala97del)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 32 "{{screeningid}}" "{{variantid}}" "0000074563" "0000118941" "0000074564" "0000118942" "0000074565" "0000118943" "0000074566" "0000118944" "0000095558" "0000154128" "0000095559" "0000154129" "0000095559" "0000154141" "0000095560" "0000154130" "0000095561" "0000154131" "0000095561" "0000154142" "0000095562" "0000154132" "0000095562" "0000154143" "0000095563" "0000154133" "0000095563" "0000154144" "0000095564" "0000154134" "0000095564" "0000154145" "0000095565" "0000154135" "0000095565" "0000154146" "0000095566" "0000154136" "0000095566" "0000154147" "0000095567" "0000154137" "0000095568" "0000154138" "0000095568" "0000154148" "0000095569" "0000154139" "0000095569" "0000154149" "0000095570" "0000154140" "0000249279" "0000578026" "0000249279" "0000578027" "0000294989" "0000651678" "0000294990" "0000651679" "0000396309" "0000827878" "0000468501" "0001048335"