### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = SLC34A3) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "SLC34A3" "solute carrier family 34 (sodium phosphate), member 3" "9" "q34.3" "unknown" "NC_000009.11" "UD_132118944187" "" "https://www.LOVD.nl/SLC34A3" "" "1" "20305" "142680" "609826" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was performed by Johan den Dunnen, supported by Global Variome." "" "g" "https://databases.lovd.nl/shared/refseq/SLC34A3_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2026-04-26 10:23:01" "00006" "2026-04-26 13:40:26" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00019275" "SLC34A3" "transcript variant 3" "003" "NM_080877.2" "" "NP_543153.1" "" "" "" "-186" "1938" "1800" "140125385" "140131006" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 3 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "01868" "HHRH" "hypophosphatemic rickets with hypercalciuria" "AR" "241530" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "06886" "hypophosphatemia" "hypophosphatemia" "" "" "" "" "" "00006" "2021-12-18 20:30:38" "00006" "2026-04-26 13:37:16" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 1 "{{geneid}}" "{{diseaseid}}" "SLC34A3" "01868" ## Individuals ## Do not remove or alter this header ## ## Count = 25 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00294820" "" "" "" "9" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294821" "" "" "" "3" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00395131" "" "" "" "2" "" "00006" "{PMID:Acar 2018:29505567}" "2-generation family, 2 affected sibs, unaffected heterozygous carrier parents" "" "" "Turkey" "" "0" "" "" "" "FamXPat3" "00395132" "" "" "00395131" "1" "" "00006" "{PMID:Acar 2018:29505567}" "sib" "F" "" "Turkey" "" "0" "" "" "" "FamXPat4" "00401654" "" "" "" "1" "" "00006" "{PMID:Thiele 2020:33107440}" "" "F" "" "Germany" "" "0" "" "" "" "Pat3" "00469926" "" "" "" "1" "" "00006" "{PMID:Jacob 2023:36692815}" "2-generation family, 1 affected, unaffected parents" "M" "yes" "India" "" "0" "" "" "Asia" "Pat9" "00477370" "" "" "" "2" "" "00006" "{PMID:Rush 2022:34633109}" "analysis 312 PHEX-negative hypophosphatemia cases" "" "" "United States" "" "0" "" "" "" "" "00477371" "" "" "" "1" "" "00006" "{PMID:Rush 2022:34633109}" "analysis 312 PHEX-negative hypophosphatemia cases" "" "" "United States" "" "0" "" "" "" "" "00477372" "" "" "" "1" "" "00006" "{PMID:Rush 2022:34633109}" "analysis 312 PHEX-negative hypophosphatemia cases" "" "" "United States" "" "0" "" "" "" "" "00477373" "" "" "" "2" "" "00006" "{PMID:Rush 2022:34633109}" "analysis 312 PHEX-negative hypophosphatemia cases" "" "" "United States" "" "0" "" "" "" "" "00477374" "" "" "" "1" "" "00006" "{PMID:Rush 2022:34633109}" "analysis 312 PHEX-negative hypophosphatemia cases" "" "" "United States" "" "0" "" "" "" "" "00477375" "" "" "" "1" "" "00006" "{PMID:Rush 2022:34633109}" "analysis 312 PHEX-negative hypophosphatemia cases" "" "" "United States" "" "0" "" "" "" "" "00477376" "" "" "" "2" "" "00006" "{PMID:Rush 2022:34633109}" "analysis 312 PHEX-negative hypophosphatemia cases" "" "" "United States" "" "0" "" "" "" "" "00477377" "" "" "" "1" "" "00006" "{PMID:Rush 2022:34633109}" "analysis 312 PHEX-negative hypophosphatemia cases" "" "" "United States" "" "0" "" "" "" "" "00477378" "" "" "" "1" "" "00006" "{PMID:Rush 2022:34633109}" "analysis 312 PHEX-negative hypophosphatemia cases" "" "" "United States" "" "0" "" "" "" "" "00477379" "" "" "" "1" "" "00006" "{PMID:Rush 2022:34633109}" "analysis 312 PHEX-negative hypophosphatemia cases" "" "" "United States" "" "0" "" "" "" "" "00477380" "" "" "" "1" "" "00006" "{PMID:Rush 2022:34633109}" "analysis 312 PHEX-negative hypophosphatemia cases" "" "" "United States" "" "0" "" "" "" "" "00477381" "" "" "" "1" "" "00006" "{PMID:Rush 2022:34633109}" "analysis 312 PHEX-negative hypophosphatemia cases" "" "" "United States" "" "0" "" "" "" "" "00477382" "" "" "" "1" "" "00006" "{PMID:Rush 2022:34633109}" "analysis 312 PHEX-negative hypophosphatemia cases" "" "" "United States" "" "0" "" "" "" "" "00477383" "" "" "" "2" "" "00006" "{PMID:Rush 2022:34633109}" "analysis 312 PHEX-negative hypophosphatemia cases" "" "" "United States" "" "0" "" "" "" "" "00477384" "" "" "" "1" "" "00006" "{PMID:Rush 2022:34633109}" "analysis 312 PHEX-negative hypophosphatemia cases" "" "" "United States" "" "0" "" "" "" "" "00477385" "" "" "" "1" "" "00006" "{PMID:Rush 2022:34633109}" "analysis 312 PHEX-negative hypophosphatemia cases" "" "" "United States" "" "0" "" "" "" "" "00477386" "" "" "" "1" "" "00006" "{PMID:Rush 2022:34633109}" "analysis 312 PHEX-negative hypophosphatemia cases" "" "" "United States" "" "0" "" "" "" "" "00477387" "" "" "" "1" "" "00006" "{PMID:Rush 2022:34633109}" "analysis 312 PHEX-negative hypophosphatemia cases" "" "" "United States" "" "0" "" "" "" "" "00477388" "" "" "" "1" "" "00006" "{PMID:Rush 2022:34633109}" "analysis 312 PHEX-negative hypophosphatemia cases" "" "" "United States" "" "0" "" "" "" "" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 25 "{{individualid}}" "{{diseaseid}}" "00294820" "00198" "00294821" "00198" "00395131" "00198" "00395132" "00198" "00401654" "06886" "00469926" "00198" "00477370" "06886" "00477371" "06886" "00477372" "06886" "00477373" "06886" "00477374" "06886" "00477375" "06886" "00477376" "06886" "00477377" "06886" "00477378" "06886" "00477379" "06886" "00477380" "06886" "00477381" "06886" "00477382" "06886" "00477383" "06886" "00477384" "06886" "00477385" "06886" "00477386" "06886" "00477387" "06886" "00477388" "06886" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00198, 01868, 06886 ## Count = 23 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000288331" "00198" "00395131" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "HHRH" "hypophosphatemic rickets" "" "0000288332" "00198" "00395132" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "HHRH" "hypophosphatemic rickets" "" "0000311025" "06886" "00401654" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "ARHR2" "hypophosphatemic rickets" "" "0000355071" "00198" "00469926" "00006" "Familial, autosomal recessive" "13y" "see paper; ..., height 128cm (SD−3.5), weight 30kg (SD−4), OFC 50.5cm (SD−3); wrist widening; no pectus carinatum; no pigeon chest; no harisson sulcus; no rachitic rosary; no pot belly; no double malleoli; no genu varum; genu valgum; pes planus; osteopenia; no delayed carpal bone ossification; no small epiphyses; frayed and/or irregular metaphyses; bowing lower limbs; no bowing upper limbs" "" "" "" "" "" "" "" "HHRH" "rickets" "" "0000361980" "06886" "00477370" "00006" "Unknown" "" "not specified" "" "" "" "" "" "" "" "" "hypophosphatemia" "" "0000361981" "06886" "00477371" "00006" "Unknown" "" "not specified" "" "" "" "" "" "" "" "" "hypophosphatemia" "" "0000361982" "06886" "00477372" "00006" "Unknown" "" "not specified" "" "" "" "" "" "" "" "" "hypophosphatemia" "" "0000361983" "06886" "00477373" "00006" "Unknown" "" "not specified" "" "" "" "" "" "" "" "HHRH" "hypophosphatemia" "" "0000361984" "06886" "00477374" "00006" "Unknown" "" "not specified" "" "" "" "" "" "" "" "" "hypophosphatemia" "" "0000361985" "06886" "00477375" "00006" "Unknown" "" "not specified" "" "" "" "" "" "" "" "" "hypophosphatemia" "" "0000361986" "06886" "00477376" "00006" "Unknown" "" "not specified" "" "" "" "" "" "" "" "" "hypophosphatemia" "" "0000361987" "06886" "00477377" "00006" "Unknown" "" "not specified" "" "" "" "" "" "" "" "" "hypophosphatemia" "" "0000361988" "06886" "00477378" "00006" "Unknown" "" "not specified" "" "" "" "" "" "" "" "HHRH" "hypophosphatemia" "" "0000361989" "06886" "00477379" "00006" "Unknown" "" "not specified" "" "" "" "" "" "" "" "" "hypophosphatemia" "" "0000361990" "06886" "00477380" "00006" "Unknown" "" "not specified" "" "" "" "" "" "" "" "" "hypophosphatemia" "" "0000361991" "06886" "00477381" "00006" "Unknown" "" "not specified" "" "" "" "" "" "" "" "" "hypophosphatemia" "" "0000361992" "06886" "00477382" "00006" "Unknown" "" "not specified" "" "" "" "" "" "" "" "" "hypophosphatemia" "" "0000361993" "06886" "00477383" "00006" "Unknown" "" "not specified" "" "" "" "" "" "" "" "" "hypophosphatemia" "" "0000361994" "06886" "00477384" "00006" "Unknown" "" "not specified" "" "" "" "" "" "" "" "" "hypophosphatemia" "" "0000361995" "06886" "00477385" "00006" "Unknown" "" "not specified" "" "" "" "" "" "" "" "HHRH" "hypophosphatemia" "" "0000361996" "06886" "00477386" "00006" "Unknown" "" "not specified" "" "" "" "" "" "" "" "" "hypophosphatemia" "" "0000361997" "06886" "00477387" "00006" "Unknown" "" "not specified" "" "" "" "" "" "" "" "" "hypophosphatemia" "" "0000361998" "06886" "00477388" "00006" "Unknown" "" "not specified" "" "" "" "" "" "" "" "" "hypophosphatemia" "" ## Screenings ## Do not remove or alter this header ## ## Count = 25 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000295988" "00294820" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295989" "00294821" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000396377" "00395131" "1" "00006" "00006" "2021-12-03 17:48:52" "" "" "SEQ" "DNA" "" "" "0000396378" "00395132" "1" "00006" "00006" "2021-12-03 17:48:52" "" "" "SEQ" "DNA" "" "" "0000402897" "00401654" "1" "00006" "00006" "2022-02-01 15:04:43" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000471594" "00469926" "1" "00006" "00006" "2025-11-23 13:32:02" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000479017" "00477370" "1" "00006" "00006" "2026-04-26 13:40:05" "" "" "SEQ;SEQ-NG" "DNA" "" "13-gene panel" "0000479018" "00477371" "1" "00006" "00006" "2026-04-26 13:40:05" "" "" "SEQ;SEQ-NG" "DNA" "" "13-gene panel" "0000479019" "00477372" "1" "00006" "00006" "2026-04-26 13:40:05" "" "" "SEQ;SEQ-NG" "DNA" "" "13-gene panel" "0000479020" "00477373" "1" "00006" "00006" "2026-04-26 13:40:05" "" "" "SEQ;SEQ-NG" "DNA" "" "13-gene panel" "0000479021" "00477374" "1" "00006" "00006" "2026-04-26 13:40:05" "" "" "SEQ;SEQ-NG" "DNA" "" "13-gene panel" "0000479022" "00477375" "1" "00006" "00006" "2026-04-26 13:40:05" "" "" "SEQ;SEQ-NG" "DNA" "" "13-gene panel" "0000479023" "00477376" "1" "00006" "00006" "2026-04-26 13:40:05" "" "" "SEQ;SEQ-NG" "DNA" "" "13-gene panel" "0000479024" "00477377" "1" "00006" "00006" "2026-04-26 13:40:05" "" "" "SEQ;SEQ-NG" "DNA" "" "13-gene panel" "0000479025" "00477378" "1" "00006" "00006" "2026-04-26 13:40:05" "" "" "SEQ;SEQ-NG" "DNA" "" "13-gene panel" "0000479026" "00477379" "1" "00006" "00006" "2026-04-26 13:40:05" "" "" "SEQ;SEQ-NG" "DNA" "" "13-gene panel" "0000479027" "00477380" "1" "00006" "00006" "2026-04-26 13:40:05" "" "" "SEQ;SEQ-NG" "DNA" "" "13-gene panel" "0000479028" "00477381" "1" "00006" "00006" "2026-04-26 13:40:05" "" "" "SEQ;SEQ-NG" "DNA" "" "13-gene panel" "0000479029" "00477382" "1" "00006" "00006" "2026-04-26 13:40:05" "" "" "SEQ;SEQ-NG" "DNA" "" "13-gene panel" "0000479030" "00477383" "1" "00006" "00006" "2026-04-26 13:40:05" "" "" "SEQ;SEQ-NG" "DNA" "" "13-gene panel" "0000479031" "00477384" "1" "00006" "00006" "2026-04-26 13:40:05" "" "" "SEQ;SEQ-NG" "DNA" "" "13-gene panel" "0000479032" "00477385" "1" "00006" "00006" "2026-04-26 13:40:05" "" "" "SEQ;SEQ-NG" "DNA" "" "13-gene panel" "0000479033" "00477386" "1" "00006" "00006" "2026-04-26 13:40:05" "" "" "SEQ;SEQ-NG" "DNA" "" "13-gene panel" "0000479034" "00477387" "1" "00006" "00006" "2026-04-26 13:40:05" "" "" "SEQ;SEQ-NG" "DNA" "" "13-gene panel" "0000479035" "00477388" "1" "00006" "00006" "2026-04-26 13:40:05" "" "" "SEQ;SEQ-NG" "DNA" "" "13-gene panel" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 2 "{{screeningid}}" "{{geneid}}" "0000396377" "SLC34A3" "0000396378" "SLC34A3" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 113 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000248212" "0" "10" "9" "140130606" "140130606" "subst" "0.880583" "02325" "SLC34A3_000013" "g.140130606A>T" "" "" "" "SLC34A3(NM_001177317.2):c.1538A>T (p.E513V), SLC34A3(NM_080877.2):c.1538A>T (p.E513V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.137236154A>T" "" "benign" "" "0000249132" "0" "10" "9" "140130882" "140130882" "subst" "0.380387" "02325" "SLC34A3_000015" "g.140130882A>C" "" "" "" "SLC34A3(NM_001177317.2):c.*14A>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.137236430A>C" "" "benign" "" "0000250915" "0" "10" "9" "140130606" "140130606" "subst" "0.880583" "02326" "SLC34A3_000013" "g.140130606A>T" "" "" "" "SLC34A3(NM_001177317.2):c.1538A>T (p.E513V), SLC34A3(NM_080877.2):c.1538A>T (p.E513V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.137236154A>T" "" "benign" "" "0000298299" "0" "10" "9" "140128085" "140128085" "subst" "0.451021" "02325" "SLC34A3_000008" "g.140128085T>C" "" "" "" "SLC34A3(NM_001177317.1):c.757T>C (p.L253=), SLC34A3(NM_001177317.2):c.757T>C (p.L253=), SLC34A3(NM_080877.2):c.757T>C (p.L253=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.137233633T>C" "" "benign" "" "0000302229" "0" "10" "9" "140127124" "140127124" "subst" "0.00431702" "02326" "SLC34A3_000002" "g.140127124C>T" "" "" "" "SLC34A3(NM_080877.2):c.273C>T (p.D91=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.137232672C>T" "" "benign" "" "0000302230" "0" "10" "9" "140127725" "140127725" "subst" "0.00368032" "02326" "SLC34A3_000004" "g.140127725C>T" "" "" "" "SLC34A3(NM_080877.2):c.625C>T (p.L209=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.137233273C>T" "" "benign" "" "0000302231" "0" "10" "9" "140127865" "140127865" "subst" "0.0308669" "02326" "SLC34A3_000007" "g.140127865G>A" "" "" "" "SLC34A3(NM_080877.2):c.756+9G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.137233413G>A" "" "benign" "" "0000302232" "0" "30" "9" "140127856" "140127856" "subst" "0.00243445" "02326" "SLC34A3_000006" "g.140127856G>A" "" "" "" "SLC34A3(NM_001177316.1):c.756G>A (p.(Gln252=)), SLC34A3(NM_001177317.1):c.756G>A (p.Q252=), SLC34A3(NM_080877.2):c.756G>A (p.Q252=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.137233404G>A" "" "likely benign" "" "0000302233" "0" "10" "9" "140128085" "140128085" "subst" "0.451021" "02326" "SLC34A3_000008" "g.140128085T>C" "" "" "" "SLC34A3(NM_001177317.1):c.757T>C (p.L253=), SLC34A3(NM_001177317.2):c.757T>C (p.L253=), SLC34A3(NM_080877.2):c.757T>C (p.L253=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.137233633T>C" "" "benign" "" "0000302234" "0" "10" "9" "140126404" "140126404" "subst" "0" "02326" "SLC34A3_000001" "g.140126404C>T" "" "" "" "SLC34A3(NM_080877.2):c.86-120C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.137231952C>T" "" "benign" "" "0000308418" "0" "30" "9" "140128971" "140128971" "subst" "0.000348741" "01943" "SLC34A3_000011" "g.140128971C>G" "" "" "" "SLC34A3(NM_001177317.1):c.1197C>G (p.V399=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.137234519C>G" "" "likely benign" "" "0000308419" "0" "30" "9" "140130580" "140130580" "subst" "0.0036497" "01943" "SLC34A3_000012" "g.140130580C>T" "" "" "" "SLC34A3(NM_001177317.1):c.1512C>T (p.F504=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.137236128C>T" "" "likely benign" "" "0000308420" "0" "30" "9" "140127241" "140127241" "subst" "0" "01943" "SLC34A3_000003" "g.140127241G>C" "" "" "" "SLC34A3(NM_001177317.1):c.310G>C (p.V104L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.137232789G>C" "" "likely benign" "" "0000308421" "0" "30" "9" "140128118" "140128118" "subst" "0.00100942" "01943" "SLC34A3_000009" "g.140128118G>A" "" "" "" "SLC34A3(NM_001177317.1):c.790G>A (p.G264S), SLC34A3(NM_080877.2):c.790G>A (p.G264S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.137233666G>A" "" "likely benign" "" "0000332952" "0" "50" "9" "140127809" "140127809" "subst" "0.00160659" "01804" "SLC34A3_000005" "g.140127809G>A" "" "" "" "SLC34A3(NM_001177316.1):c.709G>A (p.(Asp237Asn)), SLC34A3(NM_001177317.1):c.709G>A (p.D237N), SLC34A3(NM_080877.2):c.709G>A (p.D237N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.137233357G>A" "" "VUS" "" "0000332953" "0" "50" "9" "140128864" "140128864" "subst" "1.74918E-5" "01804" "SLC34A3_000010" "g.140128864A>C" "" "" "" "SLC34A3(NM_001177316.1):c.1094-4A>C (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.137234412A>C" "" "VUS" "" "0000337198" "0" "10" "9" "140130882" "140130882" "subst" "0.380387" "02327" "SLC34A3_000015" "g.140130882A>C" "" "" "" "SLC34A3(NM_001177317.2):c.*14A>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.137236430A>C" "" "benign" "" "0000339424" "0" "10" "9" "140128085" "140128085" "subst" "0.451021" "02327" "SLC34A3_000008" "g.140128085T>C" "" "" "" "SLC34A3(NM_001177317.1):c.757T>C (p.L253=), SLC34A3(NM_001177317.2):c.757T>C (p.L253=), SLC34A3(NM_080877.2):c.757T>C (p.L253=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.137233633T>C" "" "benign" "" "0000348806" "0" "90" "9" "140127675" "140127675" "subst" "0.000441047" "02327" "SLC34A3_000014" "g.140127675C>T" "" "" "" "SLC34A3(NM_001177316.2):c.575C>T (p.(Ser192Leu)), SLC34A3(NM_080877.2):c.575C>T (p.S192L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.137233223C>T" "" "pathogenic" "" "0000537563" "0" "30" "9" "140126110" "140126110" "subst" "1.22512E-5" "01804" "RNF224_000001" "g.140126110C>T" "" "" "" "SLC34A3(NM_001177316.1):c.-39-6C>T (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.137231658C>T" "" "likely benign" "" "0000537565" "0" "30" "9" "140127546" "140127546" "subst" "0.0129851" "01804" "RNF224_000003" "g.140127546G>C" "" "" "" "SLC34A3(NM_001177316.1):c.539G>C (p.(Gly180Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.137233094G>C" "" "likely benign" "" "0000537566" "0" "50" "9" "140127809" "140127809" "subst" "0.00160659" "01943" "SLC34A3_000005" "g.140127809G>A" "" "" "" "SLC34A3(NM_001177316.1):c.709G>A (p.(Asp237Asn)), SLC34A3(NM_001177317.1):c.709G>A (p.D237N), SLC34A3(NM_080877.2):c.709G>A (p.D237N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.137233357G>A" "" "VUS" "" "0000537567" "0" "30" "9" "140127856" "140127856" "subst" "0.00243445" "01804" "SLC34A3_000006" "g.140127856G>A" "" "" "" "SLC34A3(NM_001177316.1):c.756G>A (p.(Gln252=)), SLC34A3(NM_001177317.1):c.756G>A (p.Q252=), SLC34A3(NM_080877.2):c.756G>A (p.Q252=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.137233404G>A" "" "likely benign" "" "0000537568" "0" "10" "9" "140128118" "140128118" "subst" "0.00100942" "02326" "SLC34A3_000009" "g.140128118G>A" "" "" "" "SLC34A3(NM_001177317.1):c.790G>A (p.G264S), SLC34A3(NM_080877.2):c.790G>A (p.G264S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.137233666G>A" "" "benign" "" "0000537569" "0" "50" "9" "140128588" "140128588" "subst" "0" "01804" "RNF224_000004" "g.140128588T>C" "" "" "" "SLC34A3(NM_001177316.1):c.953T>C (p.(Leu318Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.137234136T>C" "" "VUS" "" "0000537570" "0" "30" "9" "140128644" "140128644" "subst" "0.0203283" "01804" "RNF224_000005" "g.140128644G>A" "" "" "" "SLC34A3(NM_001177316.1):c.1009G>A (p.(Gly337Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.137234192G>A" "" "likely benign" "" "0000537571" "0" "30" "9" "140128938" "140128938" "subst" "4.78702E-5" "01943" "RNF224_000006" "g.140128938A>G" "" "" "" "SLC34A3(NM_001177317.1):c.1164A>G (p.A388=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.137234486A>G" "" "likely benign" "" "0000537572" "0" "30" "9" "140128944" "140128944" "subst" "1.29642E-5" "01943" "RNF224_000007" "g.140128944G>A" "" "" "" "SLC34A3(NM_001177317.1):c.1170G>A (p.Q390=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.137234492G>A" "" "likely benign" "" "0000537573" "0" "30" "9" "140129157" "140129157" "subst" "4.1134E-5" "01943" "SLC34A3_000016" "g.140129157G>A" "" "" "" "SLC34A3(NM_001177317.1):c.1309G>A (p.A437T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.137234705G>A" "" "likely benign" "" "0000537574" "0" "10" "9" "140130580" "140130580" "subst" "0.0036497" "02327" "SLC34A3_000012" "g.140130580C>T" "" "" "" "SLC34A3(NM_001177317.1):c.1512C>T (p.F504=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.137236128C>T" "" "benign" "" "0000612039" "0" "30" "9" "140127231" "140127231" "subst" "4.07179E-6" "01804" "RNF224_000008" "g.140127231T>C" "" "" "" "SLC34A3(NM_001177316.1):c.305-5T>C (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.137232779T>C" "" "likely benign" "" "0000612040" "0" "30" "9" "140127779" "140127779" "subst" "0.000539967" "01804" "RNF224_000010" "g.140127779G>A" "" "" "" "SLC34A3(NM_001177316.1):c.679G>A (p.(Ala227Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.137233327G>A" "" "likely benign" "" "0000622235" "0" "30" "9" "140127237" "140127237" "subst" "2.03595E-5" "01943" "RNF224_000009" "g.140127237C>T" "" "" "" "SLC34A3(NM_001177317.1):c.306C>T (p.S102=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.137232785C>T" "" "likely benign" "" "0000652677" "1" "30" "9" "140127809" "140127809" "subst" "0.00160659" "03575" "SLC34A3_000005" "g.140127809G>A" "9/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "9 heterozygous, no homozygous; {DB:CLININrs145877051}" "Germline" "" "rs145877051" "0" "" "" "g.137233357G>A" "" "likely benign" "" "0000652678" "1" "10" "9" "140130522" "140130522" "subst" "0.00246507" "03575" "SLC34A3_000017" "g.140130522G>A" "3/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "3 heterozygous, no homozygous; {DB:CLININrs138872455}" "Germline" "" "rs138872455" "0" "" "" "g.137236070G>A" "" "benign" "" "0000656314" "0" "10" "9" "140127051" "140127051" "subst" "0.0987661" "02326" "RNF224_000011" "g.140127051G>A" "" "" "" "SLC34A3(NM_080877.2):c.200G>A (p.R67H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.137232599G>A" "" "benign" "" "0000656315" "0" "90" "9" "140127675" "140127675" "subst" "0.000441047" "02326" "SLC34A3_000014" "g.140127675C>T" "" "" "" "SLC34A3(NM_001177316.2):c.575C>T (p.(Ser192Leu)), SLC34A3(NM_080877.2):c.575C>T (p.S192L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.137233223C>T" "" "pathogenic" "" "0000678625" "0" "30" "9" "140128085" "140128085" "subst" "0.451021" "01943" "SLC34A3_000008" "g.140128085T>C" "" "" "" "SLC34A3(NM_001177317.1):c.757T>C (p.L253=), SLC34A3(NM_001177317.2):c.757T>C (p.L253=), SLC34A3(NM_080877.2):c.757T>C (p.L253=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000678626" "0" "50" "9" "140130522" "140130522" "subst" "0.00246507" "01943" "SLC34A3_000017" "g.140130522G>A" "" "" "" "SLC34A3(NM_001177316.1):c.1454G>A (p.(Arg485His)), SLC34A3(NM_001177317.1):c.1454G>A (p.R485H), SLC34A3(NM_080877.2):c.1454G>A (p.R485H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000690488" "0" "30" "9" "140127327" "140127327" "subst" "4.12817E-6" "01943" "RNF224_000012" "g.140127327G>A" "" "" "" "SLC34A3(NM_001177317.1):c.396G>A (p.V132=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000690489" "0" "30" "9" "140130580" "140130580" "subst" "0.0036497" "02326" "SLC34A3_000012" "g.140130580C>T" "" "" "" "SLC34A3(NM_001177317.1):c.1512C>T (p.F504=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000722431" "0" "50" "9" "140127856" "140127856" "subst" "0.00243445" "01943" "SLC34A3_000006" "g.140127856G>A" "" "" "" "SLC34A3(NM_001177316.1):c.756G>A (p.(Gln252=)), SLC34A3(NM_001177317.1):c.756G>A (p.Q252=), SLC34A3(NM_080877.2):c.756G>A (p.Q252=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000722432" "0" "50" "9" "140130521" "140130521" "subst" "0.000575065" "02325" "SLC34A3_000018" "g.140130521C>T" "" "" "" "SLC34A3(NM_001177316.1):c.1453C>T (p.(Arg485Cys)), SLC34A3(NM_080877.3):c.1453C>T (p.R485C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000722433" "0" "30" "9" "140130680" "140130680" "subst" "0.000156671" "01804" "SLC34A3_000019" "g.140130680C>T" "" "" "" "SLC34A3(NM_001177316.1):c.1612C>T (p.(Arg538Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000722434" "0" "50" "9" "140130758" "140130758" "subst" "0" "02325" "FAM166A_000008" "g.140130758C>A" "" "" "" "SLC34A3(NM_080877.3):c.1690C>A (p.R564S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000804020" "0" "30" "9" "140128164" "140128164" "subst" "0.000551556" "01804" "RNF224_000013" "g.140128164C>T" "" "" "" "SLC34A3(NM_001177316.1):c.836C>T (p.(Thr279Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000804021" "0" "90" "9" "140128413" "140128513" "del" "0" "02326" "RNF224_000014" "g.140128413_140128513del" "" "" "" "SLC34A3(NM_080877.2):c.894_925+69del" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000804022" "0" "70" "9" "140128688" "140128695" "del" "0" "01943" "RNF224_000015" "g.140128688_140128695del" "" "" "" "SLC34A3(NM_001177317.1):c.1053_1060delCGGCCGCG (p.R353Pfs*237)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000804023" "0" "70" "9" "140129115" "140129115" "subst" "0" "02326" "SLC34A3_000020" "g.140129115G>T" "" "" "" "SLC34A3(NM_080877.2):c.1267G>T (p.G423C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000804024" "0" "30" "9" "140130522" "140130522" "subst" "0.00246507" "01804" "SLC34A3_000017" "g.140130522G>A" "" "" "" "SLC34A3(NM_001177316.1):c.1454G>A (p.(Arg485His)), SLC34A3(NM_001177317.1):c.1454G>A (p.R485H), SLC34A3(NM_080877.2):c.1454G>A (p.R485H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000804025" "0" "30" "9" "140130653" "140130653" "subst" "0.00237894" "01804" "SLC34A3_000021" "g.140130653A>T" "" "" "" "SLC34A3(NM_001177316.1):c.1585A>T (p.(Ile529Phe)), SLC34A3(NM_080877.2):c.1585A>T (p.I529F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000827976" "11" "90" "9" "140129185" "140129185" "subst" "4.17261E-5" "00006" "SLC34A3_000022" "g.140129185T>A" "" "{PMID:Acar 2018:29505567}" "" "" "" "Germline" "" "" "0" "" "" "g.137234733T>A" "" "pathogenic (recessive)" "" "0000827977" "11" "90" "9" "140129185" "140129185" "subst" "4.17261E-5" "00006" "SLC34A3_000022" "g.140129185T>A" "" "{PMID:Acar 2018:29505567}" "" "" "" "Germline" "" "" "0" "" "" "g.137234733T>A" "" "pathogenic (recessive)" "" "0000827984" "21" "90" "9" "140130707" "140130720" "del" "0" "00006" "SLC34A3_000023" "g.140130707_140130720del" "" "{PMID:Acar 2018:29505567}" "" "" "" "Germline" "" "" "0" "" "" "g.137236255_137236268del" "" "pathogenic (recessive)" "" "0000827985" "21" "90" "9" "140130707" "140130720" "del" "0" "00006" "SLC34A3_000023" "g.140130707_140130720del" "" "{PMID:Acar 2018:29505567}" "" "" "" "Germline" "" "" "0" "" "" "g.137236255_137236268del" "" "pathogenic (recessive)" "" "0000837187" "0" "30" "9" "140130606" "140130606" "subst" "0.880583" "00006" "SLC34A3_000013" "g.140130606A>T" "" "{PMID:Thiele 2020:33107440}" "" "1538A>T (Glu513Val)" "" "Germline" "" "" "0" "" "" "g.137236154A>T" "" "likely benign" "" "0000852198" "0" "90" "9" "140127082" "140127082" "subst" "0" "02326" "RNF224_000016" "g.140127082C>A" "" "" "" "SLC34A3(NM_080877.2):c.231C>A (p.C77*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000852199" "0" "50" "9" "140127840" "140127840" "subst" "0" "02326" "RNF224_000017" "g.140127840C>G" "" "" "" "SLC34A3(NM_080877.2):c.740C>G (p.T247R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000852200" "0" "30" "9" "140128965" "140128965" "subst" "0.000349584" "02326" "RNF224_000021" "g.140128965G>A" "" "" "" "SLC34A3(NM_080877.2):c.1191G>A (p.A397=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000861581" "0" "30" "9" "140128107" "140128107" "subst" "0.00476935" "01943" "RNF224_000018" "g.140128107G>A" "" "" "" "SLC34A3(NM_001177316.1):c.779G>A (p.(Ser260Asn)), SLC34A3(NM_001177317.1):c.779G>A (p.S260N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000861582" "0" "30" "9" "140128564" "140128564" "subst" "0.00149205" "01804" "RNF224_000019" "g.140128564G>A" "" "" "" "SLC34A3(NM_001177316.1):c.929G>A (p.(Arg310His)), SLC34A3(NM_080877.2):c.929G>A (p.R310H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000861583" "0" "30" "9" "140128914" "140128914" "subst" "0.0037672" "01943" "RNF224_000020" "g.140128914C>T" "" "" "" "SLC34A3(NM_001177317.1):c.1140C>T (p.L380=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000888756" "0" "30" "9" "140127809" "140127809" "subst" "0.00160659" "02326" "SLC34A3_000005" "g.140127809G>A" "" "" "" "SLC34A3(NM_001177316.1):c.709G>A (p.(Asp237Asn)), SLC34A3(NM_001177317.1):c.709G>A (p.D237N), SLC34A3(NM_080877.2):c.709G>A (p.D237N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000888757" "0" "30" "9" "140128387" "140128387" "subst" "0.000513645" "01804" "RNF224_000022" "g.140128387C>A" "" "" "" "SLC34A3(NM_001177316.1):c.919C>A (p.(Leu307Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000888758" "0" "50" "9" "140130521" "140130521" "subst" "0.000575065" "01804" "SLC34A3_000018" "g.140130521C>T" "" "" "" "SLC34A3(NM_001177316.1):c.1453C>T (p.(Arg485Cys)), SLC34A3(NM_080877.3):c.1453C>T (p.R485C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000888759" "0" "30" "9" "140130522" "140130522" "subst" "0.00246507" "02326" "SLC34A3_000017" "g.140130522G>A" "" "" "" "SLC34A3(NM_001177316.1):c.1454G>A (p.(Arg485His)), SLC34A3(NM_001177317.1):c.1454G>A (p.R485H), SLC34A3(NM_080877.2):c.1454G>A (p.R485H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000888760" "0" "30" "9" "140130653" "140130653" "subst" "0.00237894" "02326" "SLC34A3_000021" "g.140130653A>T" "" "" "" "SLC34A3(NM_001177316.1):c.1585A>T (p.(Ile529Phe)), SLC34A3(NM_080877.2):c.1585A>T (p.I529F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000913132" "0" "30" "9" "140127062" "140127062" "subst" "0.000148074" "01804" "RNF224_000023" "g.140127062G>A" "" "" "" "SLC34A3(NM_001177316.1):c.211G>A (p.(Gly71Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000913133" "0" "30" "9" "140128107" "140128107" "subst" "0.00476935" "01804" "RNF224_000018" "g.140128107G>A" "" "" "" "SLC34A3(NM_001177316.1):c.779G>A (p.(Ser260Asn)), SLC34A3(NM_001177317.1):c.779G>A (p.S260N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000913134" "0" "30" "9" "140130701" "140130701" "subst" "2.0487E-5" "01804" "SLC34A3_000024" "g.140130701C>T" "" "" "" "SLC34A3(NM_001177316.1):c.1633C>T (p.(Arg545Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000925021" "0" "30" "9" "140128564" "140128564" "subst" "0.00149205" "02326" "RNF224_000019" "g.140128564G>A" "" "" "" "SLC34A3(NM_001177316.1):c.929G>A (p.(Arg310His)), SLC34A3(NM_080877.2):c.929G>A (p.R310H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000949253" "0" "90" "9" "140127157" "140127157" "subst" "3.66554E-5" "02327" "RNF224_000024" "g.140127157T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000965322" "0" "90" "9" "140128579" "140128579" "del" "0" "02326" "SLC34A3_000025" "g.140128579del" "" "" "" "SLC34A3(NM_080877.2):c.944delG (p.G315Afs*28)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000978591" "0" "50" "9" "140127137" "140127137" "subst" "7.73779E-5" "02327" "RNF224_000025" "g.140127137G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000978592" "0" "50" "9" "140128917" "140128917" "subst" "0.000142975" "01804" "RNF224_000026" "g.140128917G>A" "" "" "" "SLC34A3(NM_001177316.2):c.1143G>A (p.(Ala381=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000997731" "0" "50" "9" "140120390" "140120390" "subst" "1.41187E-5" "01804" "C9orf169_000001" "g.140120390C>T" "" "" "" "C9ORF169(NM_199001.2):c.317C>T (p.(Pro106Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000997732" "0" "30" "9" "140127125" "140127125" "subst" "0.000138474" "02327" "RNF224_000027" "g.140127125G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000997733" "0" "30" "9" "140127330" "140127330" "subst" "0" "02327" "RNF224_000028" "g.140127330G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000997734" "0" "70" "9" "140130521" "140130521" "subst" "0.000575065" "02327" "SLC34A3_000018" "g.140130521C>T" "" "" "" "SLC34A3(NM_001177316.1):c.1453C>T (p.(Arg485Cys)), SLC34A3(NM_080877.3):c.1453C>T (p.R485C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001014522" "0" "70" "9" "140127594" "140127623" "del" "0" "02326" "RNF224_000029" "g.140127594_140127623del" "" "" "" "SLC34A3(NM_080877.2):c.560+27_561-38delTGGGGCTGCAGTGGCAGCCCCAGCCCGGGC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001025645" "0" "50" "9" "140123299" "140123299" "subst" "7.93311E-6" "02325" "C9orf169_000002" "g.140123299C>T" "" "" "" "RNF224(NM_001190228.2):c.232C>T (p.R78C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001037376" "0" "50" "9" "140127302" "140127302" "subst" "5.71989E-5" "01804" "RNF224_000030" "g.140127302T>C" "" "" "" "SLC34A3(NM_001177316.2):c.371T>C (p.(Ile124Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001037377" "0" "90" "9" "140127675" "140127675" "subst" "0.000441047" "01804" "SLC34A3_000014" "g.140127675C>T" "" "" "" "SLC34A3(NM_001177316.2):c.575C>T (p.(Ser192Leu)), SLC34A3(NM_080877.2):c.575C>T (p.S192L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001037378" "0" "50" "9" "140128123" "140128123" "subst" "5.29157E-5" "01804" "RNF224_000031" "g.140128123C>T" "" "" "" "SLC34A3(NM_001177316.2):c.795C>T (p.(Asn265=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001037379" "0" "50" "9" "140128584" "140128602" "dup" "0" "01804" "RNF224_000032" "g.140128584_140128602dup" "" "" "" "SLC34A3(NM_001177316.2):c.949_967dup (p.(Val323Glyfs*276))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001037380" "0" "30" "9" "140128709" "140128709" "subst" "0.00028322" "01804" "RNF224_000033" "g.140128709G>A" "" "" "" "SLC34A3(NM_001177316.2):c.1074G>A (p.(Val358=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001037381" "0" "30" "9" "140128737" "140128737" "subst" "2.09779E-5" "01804" "RNF224_000034" "g.140128737G>A" "" "" "" "SLC34A3(NM_001177316.2):c.1093+9G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001046190" "0" "10" "9" "140128923" "140128923" "subst" "0.00236122" "02326" "RNF224_000035" "g.140128923C>T" "" "" "" "SLC34A3(NM_080877.2):c.1149C>T (p.A383=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001053469" "0" "50" "9" "140126116" "140126116" "subst" "4.07644E-5" "01804" "RNF224_000036" "g.140126116A>C" "" "" "" "SLC34A3(NM_001177316.2):c.-39A>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001053470" "0" "90" "9" "140127686" "140127686" "subst" "6.68941E-5" "01804" "RNF224_000037" "g.140127686G>A" "" "" "" "SLC34A3(NM_001177316.2):c.586G>A (p.(Gly196Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001053471" "0" "90" "9" "140129152" "140129152" "del" "0.000266796" "01804" "SLC34A3_000026" "g.140129152del" "" "" "" "SLC34A3(NM_001177316.2):c.1304del (p.(Ser435ThrfsTer46))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001053472" "0" "50" "9" "140130379" "140130404" "del" "0" "01804" "SLC34A3_000027" "g.140130379_140130404del" "" "" "" "SLC34A3(NM_001177316.2):c.1336-25_1336del" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001059809" "3" "90" "9" "140130393" "140130403" "del" "0" "00006" "SLC34A3_000028" "g.140130393_140130403del" "" "{PMID:Jacob 2023:36692815}" "" "" "ACMG PVS1, PM2, PP4" "Germline" "" "" "0" "" "" "g.137235941_137235951del" "" "pathogenic (recessive)" "ACMG" "0001065184" "0" "30" "9" "140127856" "140127856" "subst" "0.00243445" "02325" "SLC34A3_000006" "g.140127856G>A" "" "" "" "SLC34A3(NM_001177316.1):c.756G>A (p.(Gln252=)), SLC34A3(NM_001177317.1):c.756G>A (p.Q252=), SLC34A3(NM_080877.2):c.756G>A (p.Q252=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001074878" "0" "50" "9" "140128660" "140128660" "subst" "2.12739E-5" "00006" "SLC34A3_000039" "g.140128660T>C" "2/312 cases" "{PMID:Rush 2022:34633109}" "" "" "combination of variants not reported" "Germline/De novo (untested)" "" "" "0" "" "" "g.137234208T>C" "" "VUS" "" "0001074879" "0" "50" "9" "140128909" "140128909" "subst" "4.47535E-5" "00006" "SLC34A3_000040" "g.140128909G>A" "1/312 cases" "{PMID:Rush 2022:34633109}" "" "" "combination of variants not reported" "Germline/De novo (untested)" "" "" "0" "" "" "g.137234457G>A" "" "VUS" "" "0001074880" "0" "50" "9" "140129172" "140129172" "subst" "2.48655E-5" "00006" "SLC34A3_000041" "g.140129172A>G" "1/312 cases" "{PMID:Rush 2022:34633109}" "" "" "combination of variants not reported" "Germline/De novo (untested)" "" "" "0" "" "" "g.137234720A>G" "" "VUS" "" "0001074881" "0" "90" "9" "140130629" "140130629" "dup" "0" "00006" "SLC34A3_000043" "g.140130629dup" "2/312 cases" "{PMID:Rush 2022:34633109}" "" "" "combination of variants not reported" "Germline/De novo (untested)" "" "" "0" "" "" "g.137236177dup" "" "pathogenic" "" "0001074882" "0" "50" "9" "140130684" "140130684" "subst" "6.44347E-5" "00006" "SLC34A3_000044" "g.140130684C>T" "1/312 cases" "{PMID:Rush 2022:34633109}" "" "" "combination of variants not reported" "Germline/De novo (untested)" "" "" "0" "" "" "g.137236232C>T" "" "VUS" "" "0001074883" "0" "50" "9" "140130795" "140130795" "subst" "0.000601013" "00006" "SLC34A3_000045" "g.140130795G>T" "1/312 cases" "{PMID:Rush 2022:34633109}" "" "" "combination of variants not reported" "Germline/De novo (untested)" "" "" "0" "" "" "g.137236343G>T" "" "VUS" "" "0001074884" "0" "50" "9" "140130833" "140130833" "subst" "0.000380343" "00006" "SLC34A3_000046" "g.140130833G>A" "2/312 cases" "{PMID:Rush 2022:34633109}" "" "" "combination of variants not reported" "Germline/De novo (untested)" "" "" "0" "" "" "g.137236381G>A" "" "VUS" "" "0001074885" "0" "50" "9" "140127030" "140127050" "del" "0" "00006" "SLC34A3_000029" "g.140127030_140127050del" "1/312 cases" "{PMID:Rush 2022:34633109}" "" "" "combination of variants not reported" "Germline/De novo (untested)" "" "" "0" "" "" "g.137232578_137232598del" "" "VUS" "" "0001074886" "0" "70" "9" "140127380" "140127380" "subst" "0.000151503" "00006" "SLC34A3_000030" "g.140127380G>A" "1/312 cases" "{PMID:Rush 2022:34633109}" "" "" "combination of variants not reported" "Germline/De novo (untested)" "" "" "0" "" "" "g.137232928G>A" "" "likely pathogenic" "" "0001074887" "0" "50" "9" "140127453" "140127453" "subst" "0.000131588" "00006" "SLC34A3_000031" "g.140127453C>T" "1/312 cases" "{PMID:Rush 2022:34633109}" "" "" "combination of variants not reported" "Germline/De novo (untested)" "" "" "0" "" "" "g.137233001C>T" "" "VUS" "" "0001074888" "0" "50" "9" "140127783" "140127783" "subst" "6.76938E-5" "00006" "SLC34A3_000032" "g.140127783G>A" "1/312 cases" "{PMID:Rush 2022:34633109}" "" "" "combination of variants not reported" "Germline/De novo (untested)" "" "" "0" "" "" "g.137233331G>A" "" "VUS" "" "0001074889" "0" "50" "9" "140127788" "140127788" "subst" "0.000156973" "00006" "SLC34A3_000033" "g.140127788A>C" "1/312 cases" "{PMID:Rush 2022:34633109}" "" "" "combination of variants not reported" "Germline/De novo (untested)" "" "" "0" "" "" "g.137233336A>C" "" "VUS" "" "0001074890" "0" "50" "9" "140127851" "140127851" "subst" "1.82598E-5" "00006" "SLC34A3_000034" "g.140127851G>C" "1/312 cases" "{PMID:Rush 2022:34633109}" "" "" "combination of variants not reported" "Germline/De novo (untested)" "" "" "0" "" "" "g.137233399G>C" "" "VUS" "" "0001074891" "0" "50" "9" "140128127" "140128127" "subst" "9.77055E-5" "00006" "SLC34A3_000035" "g.140128127A>C" "2/312 cases" "{PMID:Rush 2022:34633109}" "" "" "combination of variants not reported" "Germline/De novo (untested)" "" "" "0" "" "" "g.137233675A>C" "" "VUS" "" "0001074892" "0" "50" "9" "140128362" "140128364" "del" "0" "00006" "SLC34A3_000036" "g.140128362_140128364del" "1/312 cases" "{PMID:Rush 2022:34633109}" "" "" "combination of variants not reported" "Germline/De novo (untested)" "" "" "0" "" "" "g.137233910_137233912del" "" "VUS" "" "0001074893" "0" "90" "9" "140128413" "140128513" "del" "0" "00006" "RNF224_000014" "g.140128413_140128513del" "1/312 cases" "{PMID:Rush 2022:34633109}" "" "" "combination of variants not reported" "Germline/De novo (untested)" "" "" "0" "" "" "g.137233961_137234061del" "" "pathogenic" "" "0001074894" "0" "50" "9" "140128558" "140128558" "subst" "0" "00006" "SLC34A3_000037" "g.140128558C>T" "1/312 cases" "{PMID:Rush 2022:34633109}" "" "" "combination of variants not reported" "Germline/De novo (untested)" "" "" "0" "" "" "g.137234106C>T" "" "VUS" "" "0001074895" "0" "50" "9" "140128630" "140128630" "subst" "5.15703E-5" "00006" "SLC34A3_000038" "g.140128630T>C" "1/312 cases" "{PMID:Rush 2022:34633109}" "" "" "combination of variants not reported" "Germline/De novo (untested)" "" "" "0" "" "" "g.137234178T>C" "" "VUS" "" "0001074896" "0" "50" "9" "140130403" "140131006" "del" "0" "00006" "SLC34A3_000042" "g.(140129184_140131006)_(140130403_?)del" "1/312 cases" "{PMID:Rush 2022:34633109}" "" "partial deletion ex13" "combination of variants not reported" "Germline/De novo (untested)" "" "" "0" "" "" "g.(137234732_137236554)_(137235951_?)del" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes SLC34A3 ## Count = 113 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000248212" "00019275" "10" "1538" "0" "1538" "0" "c.1538=" "r.(=)" "p.(Val513=)" "" "0000249132" "00019275" "10" "1814" "0" "1814" "0" "c.*14A>C" "r.(=)" "p.(=)" "" "0000250915" "00019275" "10" "1538" "0" "1538" "0" "c.1538=" "r.(=)" "p.(Val513=)" "" "0000298299" "00019275" "10" "757" "0" "757" "0" "c.757T>C" "r.(?)" "p.(Leu253=)" "" "0000302229" "00019275" "10" "273" "0" "273" "0" "c.273C>T" "r.(?)" "p.(Asp91=)" "" "0000302230" "00019275" "10" "625" "0" "625" "0" "c.625C>T" "r.(?)" "p.(Leu209=)" "" "0000302231" "00019275" "10" "756" "9" "756" "9" "c.756+9G>A" "r.(=)" "p.(=)" "" "0000302232" "00019275" "30" "756" "0" "756" "0" "c.756G>A" "r.(?)" "p.(Gln252=)" "" "0000302233" "00019275" "10" "757" "0" "757" "0" "c.757T>C" "r.(?)" "p.(Leu253=)" "" "0000302234" "00019275" "10" "86" "-120" "86" "-120" "c.86-120C>T" "r.(=)" "p.(=)" "" "0000308418" "00019275" "30" "1197" "0" "1197" "0" "c.1197C>G" "r.(?)" "p.(Val399=)" "" "0000308419" "00019275" "30" "1512" "0" "1512" "0" "c.1512C>T" "r.(?)" "p.(Phe504=)" "" "0000308420" "00019275" "30" "310" "0" "310" "0" "c.310G>C" "r.(?)" "p.(Val104Leu)" "" "0000308421" "00019275" "30" "790" "0" "790" "0" "c.790G>A" "r.(?)" "p.(Gly264Ser)" "" "0000332952" "00019275" "50" "709" "0" "709" "0" "c.709G>A" "r.(?)" "p.(Asp237Asn)" "" "0000332953" "00019275" "50" "1094" "-4" "1094" "-4" "c.1094-4A>C" "r.spl?" "p.?" "" "0000337198" "00019275" "10" "1814" "0" "1814" "0" "c.*14A>C" "r.(=)" "p.(=)" "" "0000339424" "00019275" "10" "757" "0" "757" "0" "c.757T>C" "r.(?)" "p.(Leu253=)" "" "0000348806" "00019275" "90" "575" "0" "575" "0" "c.575C>T" "r.(?)" "p.(Ser192Leu)" "" "0000537563" "00019275" "30" "-39" "-6" "-39" "-6" "c.-39-6C>T" "r.(=)" "p.(=)" "" "0000537565" "00019275" "30" "539" "0" "539" "0" "c.539G>C" "r.(?)" "p.(Gly180Ala)" "" "0000537566" "00019275" "50" "709" "0" "709" "0" "c.709G>A" "r.(?)" "p.(Asp237Asn)" "" "0000537567" "00019275" "30" "756" "0" "756" "0" "c.756G>A" "r.(?)" "p.(Gln252=)" "" "0000537568" "00019275" "10" "790" "0" "790" "0" "c.790G>A" "r.(?)" "p.(Gly264Ser)" "" "0000537569" "00019275" "50" "953" "0" "953" "0" "c.953T>C" "r.(?)" "p.(Leu318Pro)" "" "0000537570" "00019275" "30" "1009" "0" "1009" "0" "c.1009G>A" "r.(?)" "p.(Gly337Ser)" "" "0000537571" "00019275" "30" "1164" "0" "1164" "0" "c.1164A>G" "r.(?)" "p.(Ala388=)" "" "0000537572" "00019275" "30" "1170" "0" "1170" "0" "c.1170G>A" "r.(?)" "p.(Gln390=)" "" "0000537573" "00019275" "30" "1309" "0" "1309" "0" "c.1309G>A" "r.(?)" "p.(Ala437Thr)" "" "0000537574" "00019275" "10" "1512" "0" "1512" "0" "c.1512C>T" "r.(?)" "p.(Phe504=)" "" "0000612039" "00019275" "30" "305" "-5" "305" "-5" "c.305-5T>C" "r.spl?" "p.?" "" "0000612040" "00019275" "30" "679" "0" "679" "0" "c.679G>A" "r.(?)" "p.(Ala227Thr)" "" "0000622235" "00019275" "30" "306" "0" "306" "0" "c.306C>T" "r.(?)" "p.(Ser102=)" "" "0000652677" "00019275" "30" "709" "0" "709" "0" "c.709G>A" "r.(?)" "p.(Asp237Asn)" "" "0000652678" "00019275" "10" "1454" "0" "1454" "0" "c.1454G>A" "r.(?)" "p.(Arg485His)" "" "0000656314" "00019275" "10" "200" "0" "200" "0" "c.200G>A" "r.(?)" "p.(Arg67His)" "" "0000656315" "00019275" "90" "575" "0" "575" "0" "c.575C>T" "r.(?)" "p.(Ser192Leu)" "" "0000678625" "00019275" "30" "757" "0" "757" "0" "c.757T>C" "r.(?)" "p.(Leu253=)" "" "0000678626" "00019275" "50" "1454" "0" "1454" "0" "c.1454G>A" "r.(?)" "p.(Arg485His)" "" "0000690488" "00019275" "30" "396" "0" "396" "0" "c.396G>A" "r.(?)" "p.(Val132=)" "" "0000690489" "00019275" "30" "1512" "0" "1512" "0" "c.1512C>T" "r.(?)" "p.(Phe504=)" "" "0000722431" "00019275" "50" "756" "0" "756" "0" "c.756G>A" "r.(?)" "p.(Gln252=)" "" "0000722432" "00019275" "50" "1453" "0" "1453" "0" "c.1453C>T" "r.(?)" "p.(Arg485Cys)" "" "0000722433" "00019275" "30" "1612" "0" "1612" "0" "c.1612C>T" "r.(?)" "p.(Arg538Trp)" "" "0000722434" "00019275" "50" "1690" "0" "1690" "0" "c.1690C>A" "r.(?)" "p.(Arg564Ser)" "" "0000804020" "00019275" "30" "836" "0" "836" "0" "c.836C>T" "r.(?)" "p.(Thr279Met)" "" "0000804021" "00019275" "90" "925" "20" "926" "-48" "c.925+20_926-48del" "r.(?)" "p.(=)" "" "0000804022" "00019275" "70" "1053" "0" "1060" "0" "c.1053_1060del" "r.(?)" "p.(Arg353Profs*237)" "" "0000804023" "00019275" "70" "1267" "0" "1267" "0" "c.1267G>T" "r.(?)" "p.(Gly423Cys)" "" "0000804024" "00019275" "30" "1454" "0" "1454" "0" "c.1454G>A" "r.(?)" "p.(Arg485His)" "" "0000804025" "00019275" "30" "1585" "0" "1585" "0" "c.1585A>T" "r.(?)" "p.(Ile529Phe)" "" "0000827976" "00019275" "90" "1335" "2" "1335" "2" "c.1335+2T>A" "r.spl" "p.?" "12i" "0000827977" "00019275" "90" "1335" "2" "1335" "2" "c.1335+2T>A" "r.spl" "p.?" "12i" "0000827984" "00019275" "90" "1639" "0" "1652" "0" "c.1639_1652del" "r.(?)" "p.(Arg547Alafs*41)" "13" "0000827985" "00019275" "90" "1639" "0" "1652" "0" "c.1639_1652del" "r.(?)" "p.(Arg547Alafs*41)" "13" "0000837187" "00019275" "30" "1538" "0" "1538" "0" "c.1538=" "r.(?)" "p.(Val513=)" "" "0000852198" "00019275" "90" "231" "0" "231" "0" "c.231C>A" "r.(?)" "p.(Cys77*)" "" "0000852199" "00019275" "50" "740" "0" "740" "0" "c.740C>G" "r.(?)" "p.(Thr247Arg)" "" "0000852200" "00019275" "30" "1191" "0" "1191" "0" "c.1191G>A" "r.(?)" "p.(Ala397=)" "" "0000861581" "00019275" "30" "779" "0" "779" "0" "c.779G>A" "r.(?)" "p.(Ser260Asn)" "" "0000861582" "00019275" "30" "929" "0" "929" "0" "c.929G>A" "r.(?)" "p.(Arg310His)" "" "0000861583" "00019275" "30" "1140" "0" "1140" "0" "c.1140C>T" "r.(?)" "p.(Leu380=)" "" "0000888756" "00019275" "30" "709" "0" "709" "0" "c.709G>A" "r.(?)" "p.(Asp237Asn)" "" "0000888757" "00019275" "30" "919" "0" "919" "0" "c.919C>A" "r.(?)" "p.(Leu307Met)" "" "0000888758" "00019275" "50" "1453" "0" "1453" "0" "c.1453C>T" "r.(?)" "p.(Arg485Cys)" "" "0000888759" "00019275" "30" "1454" "0" "1454" "0" "c.1454G>A" "r.(?)" "p.(Arg485His)" "" "0000888760" "00019275" "30" "1585" "0" "1585" "0" "c.1585A>T" "r.(?)" "p.(Ile529Phe)" "" "0000913132" "00019275" "30" "211" "0" "211" "0" "c.211G>A" "r.(?)" "p.(Gly71Ser)" "" "0000913133" "00019275" "30" "779" "0" "779" "0" "c.779G>A" "r.(?)" "p.(Ser260Asn)" "" "0000913134" "00019275" "30" "1633" "0" "1633" "0" "c.1633C>T" "r.(?)" "p.(Arg545Cys)" "" "0000925021" "00019275" "30" "929" "0" "929" "0" "c.929G>A" "r.(?)" "p.(Arg310His)" "" "0000949253" "00019275" "90" "304" "2" "304" "2" "c.304+2T>C" "r.spl?" "p.?" "" "0000965322" "00019275" "90" "944" "0" "944" "0" "c.944del" "r.(?)" "p.(Gly315AlafsTer28)" "" "0000978591" "00019275" "50" "286" "0" "286" "0" "c.286G>A" "r.(?)" "p.(Ala96Thr)" "" "0000978592" "00019275" "50" "1143" "0" "1143" "0" "c.1143G>A" "r.(?)" "p.(=)" "" "0000997731" "00019275" "50" "-5181" "0" "-5181" "0" "c.-5181C>T" "r.(?)" "p.(=)" "" "0000997732" "00019275" "30" "274" "0" "274" "0" "c.274G>A" "r.(?)" "p.(Val92Ile)" "" "0000997733" "00019275" "30" "399" "0" "399" "0" "c.399G>A" "r.(?)" "p.(=)" "" "0000997734" "00019275" "70" "1453" "0" "1453" "0" "c.1453C>T" "r.(?)" "p.(Arg485Cys)" "" "0001014522" "00019275" "70" "560" "27" "561" "-38" "c.560+27_561-38del" "r.(?)" "p.(=)" "" "0001025645" "00019275" "50" "-2272" "0" "-2272" "0" "c.-2272C>T" "r.(?)" "p.(=)" "" "0001037376" "00019275" "50" "371" "0" "371" "0" "c.371T>C" "r.(?)" "p.(Ile124Thr)" "" "0001037377" "00019275" "90" "575" "0" "575" "0" "c.575C>T" "r.(?)" "p.(Ser192Leu)" "" "0001037378" "00019275" "50" "795" "0" "795" "0" "c.795C>T" "r.(?)" "p.(=)" "" "0001037379" "00019275" "50" "949" "0" "967" "0" "c.949_967dup" "r.(?)" "p.(Val323Glyfs*276)" "" "0001037380" "00019275" "30" "1074" "0" "1074" "0" "c.1074G>A" "r.(?)" "p.(=)" "" "0001037381" "00019275" "30" "1093" "9" "1093" "9" "c.1093+9G>A" "r.(=)" "p.(=)" "" "0001046190" "00019275" "10" "1149" "0" "1149" "0" "c.1149C>T" "r.(?)" "p.(=)" "" "0001053469" "00019275" "50" "-39" "0" "-39" "0" "c.-39A>C" "r.(?)" "p.(=)" "" "0001053470" "00019275" "90" "586" "0" "586" "0" "c.586G>A" "r.(?)" "p.(Gly196Arg)" "" "0001053471" "00019275" "90" "1304" "0" "1304" "0" "c.1304del" "r.(?)" "p.(Ser435Thrfs*46)" "" "0001053472" "00019275" "50" "1336" "-25" "1336" "0" "c.1336-25_1336del" "r.spl?" "p.?" "" "0001059809" "00019275" "90" "1336" "-11" "1336" "-1" "c.1336-11_1336-1del" "r.spl" "p.?" "12i" "0001065184" "00019275" "30" "756" "0" "756" "0" "c.756G>A" "r.(?)" "p.(Gln252=)" "" "0001074878" "00019275" "50" "1025" "0" "1025" "0" "c.1025T>C" "r.(?)" "p.(Ile342Thr)" "" "0001074879" "00019275" "50" "1135" "0" "1135" "0" "c.1135G>A" "r.(?)" "p.(Val379Ile)" "" "0001074880" "00019275" "50" "1324" "0" "1324" "0" "c.1324A>G" "r.(?)" "p.(Ser442Gly)" "" "0001074881" "00019275" "90" "1561" "0" "1561" "0" "c.1561dup" "r.(?)" "p.(Leu521ProfsTer72)" "" "0001074882" "00019275" "50" "1616" "0" "1616" "0" "c.1616C>T" "r.(?)" "p.(Pro539Leu)" "" "0001074883" "00019275" "50" "1727" "0" "1727" "0" "c.1727G>T" "r.(?)" "p.(Ser576Ile)" "" "0001074884" "00019275" "50" "1765" "0" "1765" "0" "c.1765G>A" "r.(?)" "p.(Glu589Lys)" "" "0001074885" "00019275" "50" "179" "0" "199" "0" "c.179_199del" "r.(?)" "p.(Leu60_Leu66del)" "" "0001074886" "00019275" "70" "448" "1" "448" "1" "c.448+1G>A" "r.spl" "p.?" "" "0001074887" "00019275" "50" "449" "-3" "449" "-3" "c.449-3C>T" "r.(?)" "p.(=)" "" "0001074888" "00019275" "50" "683" "0" "683" "0" "c.683G>A" "r.(?)" "p.(Ser228Asn)" "" "0001074889" "00019275" "50" "688" "0" "688" "0" "c.688A>C" "r.(?)" "p.(Thr230Pro)" "" "0001074890" "00019275" "50" "751" "0" "751" "0" "c.751G>C" "r.(?)" "p.(Val251Leu)" "" "0001074891" "00019275" "50" "799" "0" "799" "0" "c.799A>C" "r.(?)" "p.(Thr267Pro)" "" "0001074892" "00019275" "50" "894" "0" "896" "0" "c.894_896del" "r.(?)" "p.(Lys298del)" "" "0001074893" "00019275" "90" "925" "20" "926" "-48" "c.925+20_926-48del" "r.spl" "p.?" "" "0001074894" "00019275" "50" "926" "-3" "926" "-3" "c.926-3C>T" "r.(?)" "p.(=)" "" "0001074895" "00019275" "50" "995" "0" "995" "0" "c.995T>C" "r.(?)" "p.(Leu332Pro)" "" "0001074896" "00019275" "50" "" "0" "" "0" "c.(1335+1_*138)_(1336-1_?)del" "r.?" "p.?" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 27 "{{screeningid}}" "{{variantid}}" "0000295988" "0000652677" "0000295989" "0000652678" "0000396377" "0000827976" "0000396377" "0000827984" "0000396378" "0000827977" "0000396378" "0000827985" "0000402897" "0000837187" "0000471594" "0001059809" "0000479017" "0001074878" "0000479018" "0001074879" "0000479019" "0001074880" "0000479020" "0001074881" "0000479021" "0001074882" "0000479022" "0001074883" "0000479023" "0001074884" "0000479024" "0001074885" "0000479025" "0001074886" "0000479026" "0001074887" "0000479027" "0001074888" "0000479028" "0001074889" "0000479029" "0001074890" "0000479030" "0001074891" "0000479031" "0001074892" "0000479032" "0001074893" "0000479033" "0001074894" "0000479034" "0001074895" "0000479035" "0001074896"