### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = SLC37A4) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "SLC37A4" "solute carrier family 37 (glucose-6-phosphate transporter), member 4" "11" "q23.3" "unknown" "LRG_187" "UD_132118804756" "" "https://www.LOVD.nl/SLC37A4" "" "1" "4061" "2542" "602671" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was performed by Johan den Dunnen, supported by Global Variome." "" "g" "https://databases.lovd.nl/shared/refseq/SLC37A4_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2021-02-03 14:31:13" "00000" "2025-07-08 13:22:38" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00025341" "SLC37A4" "transcript variant 1" "004" "NM_001164277.1" "" "NP_001157749.1" "" "" "" "-757" "1850" "1291" "118901616" "118895061" "00008" "2018-11-13 14:20:33" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 8 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00138" "autism" "autism" "" "209850" "" "" "" "00084" "2013-06-04 18:17:33" "00006" "2015-12-08 23:54:35" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "01820" "GSD1B" "glycogen storage disease, type Ib (GSD1B)" "AR" "232220" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-02-03 14:20:19" "01821" "GSD1C" "glycogen storage disease, type IC (GSD1C)" "AR" "232240" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-02-03 14:20:40" "04214" "-" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00001" "2023-03-09 14:26:26" "04216" "GSD" "storage disease, glycogen (GSD)" "" "" "" "" "" "00006" "2015-03-05 15:32:25" "" "" "05166" "SUD" "death, sudden, unexplained (SUD)" "" "" "" "" "" "00006" "2016-05-19 16:34:23" "00006" "2018-09-11 12:14:13" "05378" "BMD/DMD" "dystrophinopathy (BMD or DMD)" "" "" "" "" "" "00006" "2018-01-13 20:18:25" "00006" "2019-03-26 16:49:54" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 3 "{{geneid}}" "{{diseaseid}}" "SLC37A4" "01820" "SLC37A4" "01821" "SLC37A4" "04216" ## Individuals ## Do not remove or alter this header ## ## Count = 55 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00000014" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "0" "" "" "" "" "00081070" "" "" "" "1" "" "01758" "{PMID:Trujillano 2017:27848944}" "unaffected parents" "" "" "" "" "0" "" "" "" "" "00206432" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00206433" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00206434" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00206435" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00206436" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00206437" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00206438" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00206439" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00206440" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00206441" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00206442" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00206443" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00206444" "" "" "" "1" "" "02976" "" "" "F" "" "Australia" "" "0" "" "" "" "" "00206445" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00206446" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00206447" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00206448" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00206449" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00206450" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00206451" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00206452" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00206453" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00206454" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00206455" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00206456" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00206457" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00206458" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00206459" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00206460" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00206461" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00206462" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00206463" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00206464" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00206465" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00206466" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00206467" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00290257" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00290258" "" "" "" "155" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00290259" "" "" "" "5" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00290260" "" "" "" "4" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00290261" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00304288" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00324656" "" "" "" "1" "" "01602" "{PMID:Neubauer 2021:33895855}" "" "F" "" "Switzerland" "34y" "" "" "" "Europe" "SUDS030" "00329075" "" "" "" "1" "" "00000" "{PMID:Wang 2013:22899091}" "" "M" "" "United States" "" "0" "" "" "" "P3" "00329079" "" "" "" "1" "" "00000" "{PMID:Wang 2013:22899091}" "" "F" "" "United States" "" "0" "" "" "" "P8" "00329080" "" "" "" "1" "" "00000" "{PMID:Wang 2013:22899091}" "" "F" "" "United States" "" "0" "" "" "" "P9" "00329081" "" "" "" "1" "" "00000" "{PMID:Wang 2013:22899091}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "" "United States" "" "0" "" "" "" "P10" "00362742" "" "" "" "1" "" "00006" "{PMID:Tsangaris 2011:21659346}" "" "" "" "Canada" "" "0" "" "" "" "" "00362743" "" "" "" "1" "" "00006" "{PMID:Tsangaris 2011:21659346}" "" "" "" "Canada" "" "0" "" "" "" "" "00415181" "" "" "" "1" "" "00000" "{PMID:Mameesh 2017:28511025}" "sibling 1: co-occurrence of two rare recessive conditions, the membrane frizzled-related protein (MFRP)-related ocular phenotype and glycogen storage disease type 1b (GSD-1b), in three siblings" "M" "" "Oman" "" "0" "" "" "Omani" "patient 1" "00415182" "" "" "" "1" "" "00000" "{PMID:Mameesh 2017:28511025}" "sibling 2: co-occurrence of two rare recessive conditions, the membrane frizzled-related protein (MFRP)-related ocular phenotype and glycogen storage disease type 1b (GSD-1b), in three siblings" "F" "" "Oman" "" "0" "" "" "Omani" "patient 2" "00415183" "" "" "" "1" "" "00000" "{PMID:Mameesh 2017:28511025}" "sibling 3: co-occurrence of two rare recessive conditions, the membrane frizzled-related protein (MFRP)-related ocular phenotype and glycogen storage disease type 1b (GSD-1b), in three siblings" "F" "" "Oman" "" "0" "" "" "Omani" "patient 3" "00451655" "" "" "" "1" "" "04221" "{PMID:Vela-Amieva 2024:39519275}" "" "F" "no" "Mexico" "" "" "" "" "Mexican" "3bINP-097" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 56 "{{individualid}}" "{{diseaseid}}" "00000014" "00138" "00000014" "05378" "00081070" "01820" "00206432" "01820" "00206433" "01820" "00206434" "01820" "00206435" "01820" "00206436" "01820" "00206437" "01820" "00206438" "01820" "00206439" "01820" "00206440" "01820" "00206441" "01820" "00206442" "01820" "00206443" "01820" "00206444" "01820" "00206445" "01820" "00206446" "01821" "00206447" "01820" "00206448" "01820" "00206449" "01820" "00206450" "01820" "00206451" "01820" "00206452" "01820" "00206453" "01820" "00206454" "01820" "00206455" "01820" "00206456" "01820" "00206457" "01820" "00206458" "01820" "00206459" "01820" "00206460" "01820" "00206461" "01820" "00206462" "01820" "00206463" "01820" "00206464" "01820" "00206465" "01820" "00206466" "01820" "00206467" "01821" "00290257" "00198" "00290258" "00198" "00290259" "00198" "00290260" "00198" "00290261" "00198" "00304288" "00198" "00324656" "05166" "00329075" "04216" "00329079" "04216" "00329080" "04216" "00329081" "04216" "00362742" "00198" "00362743" "00198" "00415181" "04214" "00415182" "04214" "00415183" "04214" "00451655" "01820" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00138, 00198, 01820, 01821, 04214, 04216, 05166, 05378 ## Count = 12 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000060639" "01820" "00081070" "01758" "Familial, autosomal recessive" "" "Glycogen storage disease Ib (OMIM:232220)" "" "" "" "" "" "" "" "" "" "" "" "0000247272" "04216" "00329075" "00000" "Familial, autosomal recessive" "38y" "see paper; ..., high cholesterol, gout, liver adenoma, low WBC" "" "" "" "" "" "" "" "" "" "glycogen storage disease" "" "0000247276" "04216" "00329079" "00000" "Familial, autosomal recessive" "10m" "see paper; ..., hypoglycemia, hepatomegaly" "" "" "" "" "" "" "" "" "" "glycogen storage disease" "" "0000247277" "04216" "00329080" "00000" "Familial, autosomal recessive" "1y6m" "see paper; ..., hyperlipidemia, hyperlactatemia, failure to thrive, hepatomegaly" "" "" "" "" "" "" "" "" "" "glycogen storage disease" "" "0000247278" "04216" "00329081" "00000" "Familial, autosomal recessive" "13y" "see paper; ..., clinically diagnosed as GSDIa?; 6y-liver transplant; psychomotor retardation, urinary infection" "" "" "" "" "" "" "" "" "" "glycogen storage disease" "" "0000258112" "00198" "00362742" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Glycogen storage 1b" "" "0000258113" "00198" "00362743" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Glycogen storage 1b" "" "0000306980" "04214" "00415181" "00000" "Familial, autosomal recessive" "18y" "best corrected visual acuity right, left eye: 20/35, 20/40; refractive error (D) right, left eye: +12.50/-1.00 x 175deg, +13.50/-0.75 x 10deg; fundus: mild optic disc pallor mild arteriolar attenuation; absent macular and foveal reflexes; subretinal yellowish white flecks from perifoveal area to mid periphery, grayish appearance of background retina except at the center of posterior pole; axial length right/left eye (mm):16.3,16.3; B-scan: bilateral optic disc drusen; optical coherence tomography: bilateral foveoschisis; full field electroretinogram: moderate rod-cone dysfunction; recurrent hypoglycemia: present; hepatomegaly: present; recurrent cutaneous abscess: severe; pulmonary stenosis: present; gastroenterology symptoms: recurrent diarrhea; height: 164 cm (10th percentile); neutrophils ref. range (1.0-5.0) x 109/l: 0.2-1.2 (median 0.3); lactate ref. range (0.5-2.2) mmol/l: 1.6-6.6 (median 2.3); uric acid ref. range (0.20-0.45) mmol/l: 0.34-0.65 (median 0.45); triglycerides ref. range (0.0-2.3) mmol/l: 2.0-7.2 (median 2.5); cholesterol ref. range (3.5-5.2) mmol/l: 3.3-4.6 (median 3.6); aspartate aminotransferase ref. range (0-40) U/l: 28-52 (median 26); alanine aminotransferase ref. range (0-40) U/l: 15-68 (median 24); alkaline phosphatase ref. range (40-129) U/l: 139-263 (median 204); estimated gfr normal > 60 ml/min/1.73 m2: > 90; urine albumin/creatinine ratio ref. range less than or equal to 2.5 mg/mmol in males or less than or equal to 3.5 mg/ mmol in females): 0.6-1.9 (median 0.8); alfa fetoprotein ref. range (0-7) kiU/l: < 1; findings on latest abdominal ultrasound: enlarged liver with hyperechoic parenchymal appearance, possible focal adenoma in segment VII ; findings on latest magnetic resonance imaging abdomen: overall stationary two focal lesions of the liver which are most probably adenomas" "" "" "" "" "" "" "" "" "glycogen storage disease type Ib; nanophthalmos-retinitis pigmentosa-foveoschisis-optic disc drusen syndrome" "" "" "0000306981" "04214" "00415182" "00000" "Familial, autosomal recessive" "17y" "best corrected visual acuity right, left eye: 20/40, 20/50; refractive error (D) right, left eye: +15.25-1.25 x 160deg, +15.62-1.00 x 10deg; fundus: mild optic disc pallor mild arteriolar attenuation; absent macular and foveal reflexes; subretinal yellowish white flecks from perifoveal area to mid periphery, grayish appearance of background retina except at the center of posterior pole; axial length right/left eye (mm):15.8,16.0; B-scan: bilateral optic disc drusen; optical coherence tomography: bilateral foveoschisis; full field electroretinogram: moderate rod-cone dysfunction; recurrent hypoglycemia: present; hepatomegaly: present; recurrent cutaneous abscess: mild; pulmonary stenosis: absent; gastroenterology symptoms: absent; height: 139 cm (��4 SD for age); neutrophils ref. range (1.0-5.0) x 109/l: 0.3-1.6 (median 0.7); lactate ref. range (0.5-2.2) mmol/l: 2.4-8.3 (median 4.4); uric acid ref. range (0.20-0.45) mmol/l: 0.27-1.05 (median 0.82) on allopurinol; triglycerides ref. range (0.0-2.3) mmol/2.9 (median 7.5); cholesterol ref. range (3.5-5.2) mmol/l: 4.9-9.6 (median 5.9); aspartate aminotransferase ref. range (0-40) U/l: 31-87 (median 40); alanine aminotransferase ref. range (0-40) U/l: 22-84 (median 40); alkaline phosphatase ref. range (40-129) U/l: 130-350 (median 211); estimated gfr normal > 60 ml/min/1.73 m2: > 90; urine albumin/creatinine ratio ref. range less than or equal to 2.5 mg/mmol in males or less than or equal to 3.5 mg/ mmol in females): 5.0-105 (median 15) Overt nephropathy/Heavy Proteinuria > or = 70 mg/mmol, now on Lisinopril; alfa fetoprotein ref. range (0-7) kiU/l: < 1; findings on latest abdominal ultrasound: hepatomegaly, fatty liver, small hypoechoic lesion in the right lobe, hyperechogenic kidneys; findings on latest magnetic resonance imaging abdomen: not done yet" "" "" "" "" "" "" "" "" "glycogen storage disease type Ib; nanophthalmos-retinitis pigmentosa-foveoschisis-optic disc drusen syndrome" "" "" "0000306982" "04214" "00415183" "00000" "Familial, autosomal recessive" "13y" "best corrected visual acuity right, left eye: 20/60, 20/50; refractive error (D) right, left eye: +12.00/-2.62 x 180deg, +12.12/-2.00 x 175deg; fundus: mild optic disc pallor mild arteriolar attenuation; absent macular and foveal reflexes; subretinal yellowish white flecks from perifoveal area to mid periphery, grayish appearance of background retina except at the center of posterior pole; axial length right/left eye (mm):17.2,17.5; B-scan: bilateral optic disc drusen; optical coherence tomography: bilateral foveoschisis; full field electroretinogram: moderate rod-cone dysfunction; recurrent hypoglycemia: present; hepatomegaly: present; recurrent cutaneous abscess: mild; pulmonary stenosis: present; gastroenterology symptoms: absent; height: 149 cm (just above the 3rd percentile); neutrophils ref. range (1.0-5.0) x 109/l: 0.2-1.11 (median 0.5); lactate ref. range (0.5-2.2) mmol/l: 1.5-5.2 (median 2.6); uric acid ref. range (0.20-0.45) mmol/l: 0.38-0.59 (median 0.4); triglycerides ref. range (0.0-2.3) mmol/l: 1.8-11.6 (median 3.0); cholesterol ref. range (3.5-5.2) mmol/l: 3.2-4.6 (median 3.8); aspartate aminotransferase ref. range (0-40) U/l: 22-105 (median 33); alanine aminotransferase ref. range (0-40) U/l: 19-82 (median 31); alkaline phosphatase ref. range (40-129) U/l: 159-224 (median 195); estimated gfr normal > 60 ml/min/1.73 m2: Normal; urine albumin/creatinine ratio ref. range less than or equal to 2.5 mg/mmol in males or less than or equal to 3.5 mg/ mmol in females): Normal; alfa fetoprotein ref. range (0-7) kiU/l: < 1; findings on latest abdominal ultrasound: Hepatomegaly with fatty liver changes; findings on latest magnetic resonance imaging abdomen: not done yet" "" "" "" "" "" "" "" "" "glycogen storage disease type Ib; nanophthalmos-retinitis pigmentosa-foveoschisis-optic disc drusen syndrome" "" "" "0000322115" "05166" "00324656" "01602" "Unknown" "" "SUD" "" "" "" "" "" "" "" "" "" "" "" "0000340316" "01820" "00451655" "04221" "Familial, autosomal recessive" "" "Intellectual disability, Microcephaly, Abnormal hepatic glycogen storage, Pancreatitis" "" "11y" "" "" "" "" "" "" "Glycogen storage disease Ib" "Glycogen storage disease" "" ## Screenings ## Do not remove or alter this header ## ## Count = 55 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000000014" "00000014" "1" "00004" "" "2012-05-11 13:18:39" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000081182" "00081070" "1" "01758" "00006" "2016-09-07 13:24:08" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000207464" "00206432" "1" "00233" "00233" "2012-01-04 12:13:17" "" "" "SEQ" "DNA" "" "" "0000207465" "00206433" "1" "00233" "00233" "2012-01-04 12:13:18" "" "" "SEQ" "DNA" "" "" "0000207466" "00206434" "1" "00233" "00233" "2012-01-04 12:13:18" "" "" "SEQ" "DNA" "" "" "0000207467" "00206435" "1" "00233" "00233" "2012-01-04 12:13:17" "" "" "SEQ" "DNA" "" "" "0000207468" "00206436" "1" "00233" "00233" "2012-01-04 12:13:18" "" "" "SEQ" "DNA" "" "" "0000207469" "00206437" "1" "00233" "00233" "2012-01-04 12:13:18" "" "" "SEQ" "DNA" "" "" "0000207470" "00206438" "1" "00233" "00233" "2012-01-04 12:13:17" "" "" "SEQ" "DNA" "" "" "0000207471" "00206439" "1" "00233" "00233" "2012-01-04 12:13:18" "" "" "SEQ" "DNA" "" "" "0000207472" "00206440" "1" "00233" "00233" "2012-01-04 12:13:18" "" "" "SEQ" "DNA" "" "" "0000207473" "00206441" "1" "00233" "00233" "2012-01-04 12:13:18" "" "" "SEQ" "DNA" "" "" "0000207474" "00206442" "1" "00233" "00233" "2012-01-04 12:13:18" "" "" "SEQ" "DNA" "" "" "0000207475" "00206443" "1" "00233" "00233" "2012-01-04 12:13:18" "" "" "SEQ" "DNA" "" "" "0000207476" "00206444" "1" "02976" "02976" "2012-01-21 14:16:04" "" "" "SEQ-NG-I;SEQ" "DNA" "" "" "0000207477" "00206445" "1" "00233" "00233" "2012-01-04 12:13:18" "" "" "SEQ" "DNA" "" "" "0000207478" "00206446" "1" "00233" "00233" "2012-01-04 12:13:18" "00006" "2012-01-05 15:41:40" "SEQ" "DNA" "" "" "0000207479" "00206447" "1" "00233" "00233" "2012-01-04 12:13:17" "" "" "SEQ" "DNA" "" "" "0000207480" "00206448" "1" "00233" "00233" "2012-01-04 12:13:18" "" "" "SEQ" "DNA" "" "" "0000207481" "00206449" "1" "00233" "00233" "2012-01-04 12:13:18" "" "" "SEQ" "DNA" "" "" "0000207482" "00206450" "1" "00233" "00233" "2012-01-04 12:13:18" "" "" "SEQ" "DNA" "" "" "0000207483" "00206451" "1" "00233" "00233" "2012-01-04 12:13:18" "" "" "SEQ" "DNA" "" "" "0000207484" "00206452" "1" "00233" "00233" "2012-01-04 12:13:18" "" "" "SEQ" "DNA" "" "" "0000207485" "00206453" "1" "00233" "00233" "2012-01-04 12:13:18" "" "" "SEQ" "DNA" "" "" "0000207486" "00206454" "1" "00233" "00233" "2012-01-04 12:13:18" "" "" "SEQ" "DNA" "" "" "0000207487" "00206455" "1" "00233" "00233" "2012-01-04 12:13:18" "" "" "SEQ" "DNA" "" "" "0000207488" "00206456" "1" "00233" "00233" "2012-01-04 12:13:18" "" "" "SEQ" "DNA" "" "" "0000207489" "00206457" "1" "00233" "00233" "2012-01-04 12:13:17" "" "" "SEQ" "DNA" "" "" "0000207490" "00206458" "1" "00233" "00233" "2012-01-04 12:13:18" "" "" "SEQ" "DNA" "" "" "0000207491" "00206459" "1" "00233" "00233" "2012-01-04 12:13:17" "" "" "SEQ" "DNA" "" "" "0000207492" "00206460" "1" "00233" "00233" "2012-01-04 12:13:18" "" "" "SEQ" "DNA" "" "" "0000207493" "00206461" "1" "00233" "00233" "2012-01-04 12:13:18" "" "" "SEQ" "DNA" "" "" "0000207494" "00206462" "1" "00233" "00233" "2012-01-04 12:13:18" "" "" "SEQ" "DNA" "" "" "0000207495" "00206463" "1" "00233" "00233" "2012-01-04 12:13:18" "" "" "SEQ" "DNA" "" "" "0000207496" "00206464" "1" "00233" "00233" "2012-01-04 12:13:18" "" "" "SEQ" "DNA" "" "" "0000207497" "00206465" "1" "00233" "00233" "2012-01-04 12:13:18" "" "" "SEQ" "DNA" "" "" "0000207498" "00206466" "1" "00233" "00233" "2012-01-04 12:13:18" "" "" "SEQ" "DNA" "" "" "0000207499" "00206467" "1" "00233" "00233" "2012-01-04 12:13:18" "00006" "2012-01-05 15:42:15" "SEQ" "DNA" "" "" "0000291425" "00290257" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000291426" "00290258" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000291427" "00290259" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000291428" "00290260" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000291429" "00290261" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000305417" "00304288" "1" "03575" "00006" "2020-06-24 11:55:42" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000325864" "00324656" "1" "01602" "01602" "2020-12-21 14:19:54" "" "" "SEQ-NG-I" "DNA" "" "" "0000330292" "00329075" "1" "00000" "00006" "2021-02-03 15:44:42" "" "" "SEQ" "DNA" "" "" "0000330296" "00329079" "1" "00000" "00006" "2021-02-03 15:44:42" "" "" "SEQ" "DNA" "" "" "0000330297" "00329080" "1" "00000" "00006" "2021-02-03 15:44:42" "" "" "SEQ" "DNA" "" "" "0000330298" "00329081" "1" "00000" "00006" "2021-02-03 15:44:42" "" "" "SEQ" "DNA" "" "" "0000363970" "00362742" "1" "00006" "00006" "2021-04-23 13:33:15" "" "" "SEQ" "DNA" "" "" "0000363971" "00362743" "1" "00006" "00006" "2021-04-23 13:33:15" "" "" "SEQ" "DNA" "" "" "0000416463" "00415181" "1" "00000" "03840" "2022-08-09 14:23:32" "" "" "SEQ" "DNA" "blood" "" "0000416464" "00415182" "1" "00000" "03840" "2022-08-09 14:23:32" "" "" "SEQ" "DNA" "blood" "" "0000416465" "00415183" "1" "00000" "03840" "2022-08-09 14:23:32" "" "" "SEQ" "DNA" "blood" "" "0000453259" "00451655" "1" "04221" "04221" "2024-06-21 21:34:37" "" "" "SEQ-NG-I" "DNA" "gDNA from peripheral blood" "whole exome sequencing" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 65 "{{screeningid}}" "{{geneid}}" "0000000014" "ALG6" "0000000014" "ATP7B" "0000000014" "CFTR" "0000000014" "DPYD" "0000000014" "ETFB" "0000000014" "GLB1" "0000000014" "GNPTAB" "0000000014" "HEXB" "0000000014" "IGHMBP2" "0000000014" "MYO5A" "0000000014" "NHLRC1" "0000000014" "NPHP4" "0000000014" "NPHS1" "0000000014" "PKHD1" "0000000014" "SERPINA1" "0000000014" "SFTPB" "0000000014" "SGSH" "0000000014" "TSFM" "0000081182" "SLC37A4" "0000207464" "SLC37A4" "0000207465" "SLC37A4" "0000207466" "SLC37A4" "0000207467" "SLC37A4" "0000207468" "SLC37A4" "0000207469" "SLC37A4" "0000207470" "SLC37A4" "0000207471" "SLC37A4" "0000207472" "SLC37A4" "0000207473" "SLC37A4" "0000207474" "SLC37A4" "0000207475" "SLC37A4" "0000207476" "SLC37A4" "0000207477" "SLC37A4" "0000207478" "SLC37A4" "0000207479" "SLC37A4" "0000207480" "SLC37A4" "0000207481" "SLC37A4" "0000207482" "SLC37A4" "0000207483" "SLC37A4" "0000207484" "SLC37A4" "0000207485" "SLC37A4" "0000207486" "SLC37A4" "0000207487" "SLC37A4" "0000207488" "SLC37A4" "0000207489" "SLC37A4" "0000207490" "SLC37A4" "0000207491" "SLC37A4" "0000207492" "SLC37A4" "0000207493" "SLC37A4" "0000207494" "SLC37A4" "0000207495" "SLC37A4" "0000207496" "SLC37A4" "0000207497" "SLC37A4" "0000207498" "SLC37A4" "0000207499" "SLC37A4" "0000330292" "SLC37A4" "0000330296" "SLC37A4" "0000330297" "SLC37A4" "0000330298" "SLC37A4" "0000363970" "SLC37A4" "0000363971" "SLC37A4" "0000416463" "MFRP" "0000416464" "MFRP" "0000416465" "MFRP" "0000453259" "SLC37A4" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 110 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000130268" "3" "90" "11" "118896763" "118896763" "subst" "0" "01758" "SLC37A4_000001" "g.118896763G>A" "" "{PMID:Trujillano 2017:27848944}" "" "" "" "Germline" "" "" "0" "" "" "g.119026054G>A" "" "pathogenic" "ACMG" "0000298305" "0" "30" "11" "118895962" "118895962" "subst" "0.00923969" "02325" "SLC37A4_000042" "g.118895962G>A" "" "" "" "SLC37A4(NM_001164277.1):c.1062C>T (p.(Asn354=), p.N354=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.119025252G>A" "" "likely benign" "" "0000298306" "0" "10" "11" "118898437" "118898437" "del" "0" "02325" "SLC37A4_000045" "g.118898437del" "" "" "" "SLC37A4(NM_001164277.1):c.527delG (p.C176Lfs*36), SLC37A4(NM_001164278.2):c.528delG (p.C176Wfs*36)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.119027727del" "" "benign" "" "0000302236" "0" "10" "11" "118895962" "118895962" "subst" "0.00923969" "02326" "SLC37A4_000042" "g.118895962G>A" "" "" "" "SLC37A4(NM_001164277.1):c.1062C>T (p.(Asn354=), p.N354=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.119025252G>A" "" "benign" "" "0000302237" "0" "10" "11" "118899150" "118899150" "subst" "0.0179009" "02326" "SLC37A4_000047" "g.118899150T>C" "" "" "" "SLC37A4(NM_001164278.2):c.149-14A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.119028440T>C" "" "benign" "" "0000302238" "0" "10" "11" "118898324" "118898324" "subst" "0.0179436" "02326" "SLC37A4_000044" "g.118898324G>A" "" "" "" "SLC37A4(NM_001164278.2):c.626+14C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.119027614G>A" "" "benign" "" "0000308434" "0" "50" "11" "118896449" "118896449" "subst" "0.000712769" "01943" "SLC37A4_000043" "g.118896449G>C" "" "" "" "SLC37A4(NM_001164278.2):c.1004C>G (p.P335R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.119025739G>C" "" "VUS" "" "0000308435" "0" "30" "11" "118899135" "118899135" "subst" "9.29449E-5" "01943" "SLC37A4_000046" "g.118899135C>A" "" "" "" "SLC37A4(NM_001164277.1):c.150G>T (p.G50=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.119028425C>A" "" "likely benign" "" "0000346458" "0" "50" "11" "118896407" "118896407" "subst" "5.70524E-5" "02327" "SLC37A4_000048" "g.118896407G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.119025697G>A" "" "VUS" "" "0000437119" "0" "95" "11" "118900021" "118900021" "subst" "1.21973E-5" "00233" "SLC37A4_000005" "g.118900021C>T" "" "{PMID: Veiga-da-Cunha 1998:09758626}" "" "" "submitted through SIB; {EXP:025581}" "Unknown" "" "" "0" "" "" "g.119029311C>T" "" "pathogenic" "" "0000437120" "0" "95" "11" "118900010" "118900010" "subst" "0" "00233" "SLC37A4_000012" "g.118900010A>G" "" "{PMID:Yuen 2002:12409273}" "" "" "submitted through SIB; {EXP:025582}" "Unknown" "" "" "0" "" "" "g.119029300A>G" "" "pathogenic" "" "0000437121" "0" "95" "11" "118899999" "118899999" "subst" "8.12896E-6" "00233" "SLC37A4_000014" "g.118899999A>T" "" "{PMID:Santer 2000:10923042}" "" "" "submitted through SIB; {EXP:025583}" "Unknown" "" "" "0" "" "" "g.119029289A>T" "" "pathogenic" "" "0000437122" "0" "95" "11" "118899998" "118899998" "subst" "4.0657E-6" "00233" "SLC37A4_000006" "g.118899998G>A" "" "{PMID: Veiga-da-Cunha 1998:09758626}" "" "" "submitted through SIB; {EXP:025584}" "Unknown" "" "" "0" "" "" "g.119029288G>A" "" "pathogenic" "" "0000437123" "0" "95" "11" "118899997" "118899997" "subst" "1.2199E-5" "00233" "SLC37A4_000018" "g.118899997C>T" "" "{PMID:Hiraiwa 1999:10026167}" "" "" "submitted through SIB; {EXP:016840}" "Unknown" "" "" "0" "" "" "g.119029287C>T" "" "pathogenic" "" "0000437124" "0" "95" "11" "118899932" "118899932" "subst" "0" "00233" "SLC37A4_000021" "g.118899932C>G" "" "{PMID:Veiga-da-Cunha 1999:10482962}" "" "" "submitted through SIB; {EXP:025585}" "Unknown" "" "" "0" "" "" "g.119029222C>G" "" "pathogenic" "" "0000437125" "0" "95" "11" "118899136" "118899136" "subst" "5.50449E-6" "00233" "SLC37A4_000034" "g.118899136C>T" "" "{PMID:Dissanayake 2011:21629566}" "" "" "submitted through SIB; {EXP:066394}" "Unknown" "" "" "0" "" "" "g.119028426C>T" "" "pathogenic" "" "0000437126" "0" "95" "11" "118899123" "118899123" "subst" "0" "00233" "SLC37A4_000025" "g.118899123G>T" "" "{PMID:Janecke 2000:11071391}" "" "" "submitted through SIB; {EXP:025586}" "Unknown" "" "" "0" "" "" "g.119028413G>T" "" "pathogenic" "" "0000437127" "0" "95" "11" "118899122" "118899122" "subst" "0" "00233" "SLC37A4_000008" "g.118899122T>G" "" "{PMID: Veiga-da-Cunha 1998:09758626}" "" "" "submitted through SIB; {EXP:025587}" "Unknown" "" "" "0" "" "" "g.119028412T>G" "" "pathogenic" "" "0000437128" "0" "95" "11" "118899083" "118899083" "subst" "0" "00233" "SLC37A4_000009" "g.118899083C>T" "" "{PMID: Veiga-da-Cunha 1998:09758626}" "" "" "submitted through SIB; {EXP:025588}" "Unknown" "" "" "0" "" "" "g.119028373C>T" "" "pathogenic" "" "0000437129" "0" "95" "11" "118899031" "118899031" "subst" "0" "00233" "SLC37A4_000026" "g.118899031A>G" "" "{PMID:Chou 2002:11949931}" "" "" "submitted through SIB; {EXP:025589}" "Unknown" "" "" "0" "" "" "g.119028321A>G" "" "pathogenic" "" "0000437130" "0" "95" "11" "118899022" "118899022" "subst" "0" "00233" "SLC37A4_000010" "g.118899022C>T" "" "{PMID: Veiga-da-Cunha 1998:09758626}" "" "" "submitted through SIB; {EXP:025590}" "Unknown" "" "" "0" "" "" "g.119028312C>T" "" "pathogenic" "" "0000437131" "0" "95" "11" "118898998" "118898998" "subst" "0" "02976" "SLC37A4_000033" "g.118898998C>T" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.119028288C>T" "" "pathogenic" "" "0000437132" "0" "55" "11" "118898998" "118898998" "subst" "0" "00000" "SLC37A4_000033" "g.118898998C>T" "" "" "" "" "" "Unknown" "" "rs121908976" "0" "" "" "g.119028288C>T" "" "VUS" "" "0000437133" "0" "95" "11" "118898933" "118898933" "subst" "0" "00233" "SLC37A4_000029" "g.118898933A>G" "" "{PMID: Kure 1998:09675154}" "" "" "submitted through SIB; {EXP:007850}" "Unknown" "" "" "0" "" "" "g.119028223A>G" "" "pathogenic" "" "0000437134" "0" "95" "11" "118898566" "118898566" "subst" "0" "00233" "SLC37A4_000023" "g.118898566T>G" "" "{PMID:Veiga-da-Cunha 1999:10482962}" "" "" "submitted through SIB; {EXP:025591}" "Unknown" "" "" "0" "" "" "g.119027856T>G" "" "pathogenic" "" "0000437135" "0" "95" "11" "118898521" "118898521" "subst" "8.44423E-6" "00233" "SLC37A4_000003" "g.118898521G>A" "" "{PMID:Han 2005:15953877}" "" "" "submitted through SIB; {EXP:066395}" "Unknown" "" "" "0" "" "" "g.119027811G>A" "" "pathogenic" "" "0000437136" "0" "95" "11" "118898518" "118898518" "subst" "2.53248E-5" "00233" "SLC37A4_000019" "g.118898518C>T" "" "{PMID:Hiraiwa 1999:10026167}" "" "" "submitted through SIB; {EXP:003184}" "Unknown" "" "" "0" "" "" "g.119027808C>T" "" "pathogenic" "" "0000437137" "0" "95" "11" "118898516" "118898516" "subst" "0" "00233" "SLC37A4_000007" "g.118898516C>T" "" "{PMID: Veiga-da-Cunha 1998:09758626}" "" "" "submitted through SIB; {EXP:025592}" "Unknown" "" "" "0" "" "" "g.119027806C>T" "" "pathogenic" "" "0000437138" "0" "95" "11" "118898506" "118898506" "subst" "0" "00233" "SLC37A4_000015" "g.118898506G>A" "" "{PMID:Santer 2000:10923042}" "" "" "submitted through SIB; {EXP:025593}" "Unknown" "" "" "0" "" "" "g.119027796G>A" "" "pathogenic" "" "0000437139" "0" "95" "11" "118898438" "118898438" "subst" "0" "00233" "SLC37A4_000022" "g.118898438A>G" "" "{PMID:Veiga-da-Cunha 1999:10482962}" "" "" "submitted through SIB; {EXP:025594}" "Unknown" "" "" "0" "" "" "g.119027728A>G" "" "pathogenic" "" "0000437140" "0" "95" "11" "118898416" "118898416" "subst" "4.19794E-6" "00233" "SLC37A4_000020" "g.118898416A>G" "" "{PMID:Hiraiwa 1999:10026167}" "" "" "submitted through SIB; {EXP:025595}" "Unknown" "" "" "0" "" "" "g.119027706A>G" "" "pathogenic" "" "0000437141" "0" "95" "11" "118898416" "118898416" "subst" "4.19794E-6" "00233" "SLC37A4_000020" "g.118898416A>G" "" "{PMID:Veiga-da-Cunha 1999:10482962}" "" "" "submitted through SIB; {EXP:025595}" "Unknown" "" "" "0" "" "" "g.119027706A>G" "" "pathogenic" "" "0000437142" "0" "95" "11" "118898392" "118898392" "subst" "0" "00233" "SLC37A4_000013" "g.118898392G>A" "" "{PMID:Yuen 2002:12409273}" "" "" "submitted through SIB; {EXP:032113}\r\nVariant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message." "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000437143" "0" "95" "11" "118898392" "118898392" "subst" "0" "00233" "SLC37A4_000013" "g.118898392G>A" "" "{PMID:Lam 2000:10874322}" "" "" "submitted through SIB; {EXP:032113}\r\nVariant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message." "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000437144" "0" "95" "11" "118897745" "118897745" "subst" "0" "00233" "SLC37A4_000030" "g.118897745A>G" "" "{PMID:Trioche 2004:15669677}" "" "" "submitted through SIB; {EXP:025597}" "Unknown" "" "" "0" "" "" "g.119027035A>G" "" "pathogenic" "" "0000437145" "0" "95" "11" "118897695" "118897695" "subst" "0" "00233" "SLC37A4_000002" "g.118897695A>G" "" "{PMID:Hsiao 2009:19579760}" "" "" "submitted through SIB; {EXP:066396}" "Unknown" "" "" "0" "" "" "g.119026985A>G" "" "pathogenic" "" "0000437146" "0" "95" "11" "118897350" "118897350" "subst" "0" "00233" "SLC37A4_000027" "g.118897350A>T" "" "{PMID:Chou 2002:11949931}" "" "" "submitted through SIB; {EXP:025598}" "Unknown" "" "" "0" "" "" "g.119026640A>T" "" "pathogenic" "" "0000437147" "0" "95" "11" "118896763" "118896763" "subst" "0" "00233" "SLC37A4_000001" "g.118896763G>A" "" "{PMID:Veiga-da-Cunha 1999:10482962}" "" "" "submitted through SIB; {EXP:066397}" "Unknown" "" "" "0" "" "" "g.119026053G>A" "" "pathogenic" "" "0000437148" "0" "95" "11" "118896762" "118896762" "subst" "0" "00233" "SLC37A4_000031" "g.118896762C>T" "" "{PMID: Marcolongo 1998:09781688}" "" "" "submitted through SIB; {EXP:025599}" "Unknown" "" "" "0" "" "" "g.119026052C>T" "" "pathogenic" "" "0000437149" "0" "95" "11" "118896759" "118896759" "subst" "4.39279E-6" "00233" "SLC37A4_000016" "g.118896759T>G" "" "{PMID:Santer 2000:10923042}" "" "" "submitted through SIB; {EXP:025600}" "Unknown" "" "" "0" "" "" "g.119026049T>G" "" "pathogenic" "" "0000437150" "0" "95" "11" "118896009" "118896009" "subst" "7.46479E-5" "00233" "SLC37A4_000011" "g.118896009C>A" "" "{PMID: Veiga-da-Cunha 1998:09758626}" "" "" "submitted through SIB; {EXP:003185}" "Unknown" "" "" "0" "" "" "g.119025299C>A" "" "pathogenic" "" "0000437151" "0" "95" "11" "118896009" "118896009" "subst" "7.46479E-5" "02976" "SLC37A4_000011" "g.118896009C>A" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.119025299C>A" "" "pathogenic" "" "0000437152" "0" "55" "11" "118896009" "118896009" "subst" "7.46479E-5" "00000" "SLC37A4_000011" "g.118896009C>A" "" "" "" "" "" "Unknown" "" "rs80356490" "0" "" "" "g.119025299C>A" "" "VUS" "" "0000437153" "0" "95" "11" "118896009" "118896009" "subst" "0" "00233" "SLC37A4_000032" "g.118896009C>T" "" "{PMID:Kure 2000:10931421}" "" "" "submitted through SIB; {EXP:025601}\r\nVariant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message." "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000437154" "0" "95" "11" "118895925" "118895925" "subst" "4.89201E-5" "00233" "SLC37A4_000017" "g.118895925C>T" "" "{PMID:Galli 1999:10518030}" "" "" "submitted through SIB; {EXP:025602}" "Unknown" "" "" "0" "" "" "g.119025215C>T" "" "pathogenic" "" "0000437155" "0" "95" "11" "118895925" "118895925" "subst" "4.89201E-5" "00233" "SLC37A4_000017" "g.118895925C>T" "" "{PMID:Santer 2000:10923042}" "" "" "submitted through SIB; {EXP:025602}" "Unknown" "" "" "0" "" "" "g.119025215C>T" "" "pathogenic" "" "0000437156" "0" "95" "11" "118895906" "118895906" "subst" "4.0777E-6" "00233" "SLC37A4_000028" "g.118895906G>T" "" "{PMID:Chou 2002:11949931}" "" "" "submitted through SIB; {EXP:025603}" "Unknown" "" "" "0" "" "" "g.119025196G>T" "" "pathogenic" "" "0000437157" "0" "95" "11" "118895785" "118895785" "subst" "0" "00233" "SLC37A4_000024" "g.118895785C>T" "" "{PMID:Veiga-da-Cunha 1999:10482962}" "" "" "submitted through SIB; {EXP:025604}\r\nVariant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message." "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000542621" "0" "30" "11" "118895670" "118895670" "subst" "0.0002275" "01943" "SLC37A4_000049" "g.118895670G>A" "" "" "" "SLC37A4(NM_001164278.2):c.1307C>T (p.P436L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.119024960G>A" "" "likely benign" "" "0000542622" "0" "30" "11" "118895670" "118895670" "subst" "0.0002275" "02326" "SLC37A4_000049" "g.118895670G>A" "" "" "" "SLC37A4(NM_001164278.2):c.1307C>T (p.P436L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.119024960G>A" "" "likely benign" "" "0000542623" "0" "10" "11" "118896087" "118896087" "subst" "0.00307134" "02326" "SLC37A4_000050" "g.118896087G>A" "" "" "" "SLC37A4(NM_001164277.1):c.985-48C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.119025377G>A" "" "benign" "" "0000542624" "0" "50" "11" "118897326" "118897326" "subst" "0.000225637" "02325" "SLC37A4_000051" "g.118897326C>T" "" "" "" "SLC37A4(NM_001164277.1):c.857G>A (p.R286Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.119026616C>T" "" "VUS" "" "0000542625" "0" "30" "11" "118898370" "118898370" "subst" "0.00361609" "01943" "SLC37A4_000052" "g.118898370T>A" "" "" "" "SLC37A4(NM_001164277.1):c.593A>T (p.N198I, p.(Asn198Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.119027660T>A" "" "likely benign" "" "0000542626" "0" "30" "11" "118898370" "118898370" "subst" "0.00361609" "02325" "SLC37A4_000052" "g.118898370T>A" "" "" "" "SLC37A4(NM_001164277.1):c.593A>T (p.N198I, p.(Asn198Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.119027660T>A" "" "likely benign" "" "0000542627" "0" "30" "11" "118898370" "118898370" "subst" "0.00361609" "02326" "SLC37A4_000052" "g.118898370T>A" "" "" "" "SLC37A4(NM_001164277.1):c.593A>T (p.N198I, p.(Asn198Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.119027660T>A" "" "likely benign" "" "0000542628" "0" "30" "11" "118898407" "118898407" "subst" "0.00015466" "01943" "SLC37A4_000053" "g.118898407G>A" "" "" "" "SLC37A4(NM_001164277.1):c.556C>T (p.L186F), SLC37A4(NM_001164277.2):c.556C>T (p.(Leu186Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.119027697G>A" "" "likely benign" "" "0000613086" "0" "30" "11" "118898472" "118898472" "subst" "6.14925E-5" "01943" "SLC37A4_000055" "g.118898472G>A" "" "" "" "SLC37A4(NM_001164277.1):c.492C>T (p.S164=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.119027762G>A" "" "likely benign" "" "0000613087" "0" "50" "11" "118899043" "118899043" "subst" "7.64442E-5" "01943" "SLC37A4_000057" "g.118899043G>A" "" "" "" "SLC37A4(NM_001164277.1):c.242C>T (p.S81F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.119028333G>A" "" "VUS" "" "0000622566" "0" "50" "11" "118895957" "118895957" "subst" "0.00110372" "01943" "SLC37A4_000054" "g.118895957C>G" "" "" "" "SLC37A4(NM_001164277.1):c.1067G>C (p.S356T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.119025247C>G" "" "VUS" "" "0000622567" "0" "50" "11" "118898497" "118898497" "subst" "0.00163562" "01943" "SLC37A4_000056" "g.118898497G>A" "" "" "" "SLC37A4(NM_001164277.1):c.467C>T (p.A156V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.119027787G>A" "" "VUS" "" "0000648114" "1" "10" "11" "118895632" "118895632" "subst" "0.00398118" "03575" "SLC37A4_000058" "g.118895632C>T" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs34871377}\r\nVariant Error [EMISMATCH/EREF]: This transcript variant does not match the reference sequence. Please fix this entry and then remove this message." "Germline" "" "rs34871377" "0" "" "" "g.119024922C>T" "" "benign" "" "0000648115" "1" "30" "11" "118895635" "118895635" "subst" "0.00570254" "03575" "SLC37A4_000059" "g.118895635G>A" "155/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "155 heterozygous; {DB:CLININrs35010541}\r\nVariant Error [EMISMATCH/EREF]: This transcript variant does not match the reference sequence. Please fix this entry and then remove this message." "Germline" "" "rs35010541" "0" "" "" "g.119024925G>A" "" "likely benign" "" "0000648116" "1" "10" "11" "118895962" "118895962" "subst" "0.00923969" "03575" "SLC37A4_000042" "g.118895962G>A" "5/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "5 heterozygous, no homozygous; {DB:CLININrs61730035}\r\nVariant Error [EMISMATCH/EREF]: This transcript variant does not match the reference sequence. Please fix this entry and then remove this message." "Germline" "" "rs61730035" "0" "" "" "g.119025252G>A" "" "benign" "" "0000648117" "1" "50" "11" "118898467" "118898467" "subst" "0.000520338" "03575" "SLC37A4_000060" "g.118898467C>T" "4/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 4 heterozygous, no homozygous; {DB:CLININrs186476316}" "Germline" "" "rs186476316" "0" "" "" "g.119027757C>T" "" "VUS" "" "0000648118" "1" "70" "11" "118900010" "118900010" "subst" "0" "03575" "SLC37A4_000012" "g.118900010A>G" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs193302887}" "Germline" "" "rs193302887" "0" "" "" "g.119029300A>G" "" "likely pathogenic" "" "0000669105" "3" "30" "11" "118895635" "118895635" "subst" "0.00570254" "03575" "SLC37A4_000059" "g.118895635G>A" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 homozygous; {DB:CLININrs35010541}\r\nVariant Error [EMISMATCH/EREF]: This transcript variant does not match the reference sequence. Please fix this entry and then remove this message." "Germline" "" "rs35010541" "0" "" "" "g.119024925G>A" "" "likely benign" "" "0000679073" "0" "30" "11" "118899102" "118899102" "subst" "0.0109887" "01804" "SLC37A4_000061" "g.118899102A>G" "" "" "" "SLC37A4(NM_001164277.1):c.183T>C (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000690958" "0" "10" "11" "118895632" "118895632" "subst" "0.00398118" "01804" "SLC37A4_000058" "g.118895632C>T" "" "" "" "SLC37A4(NM_001164277.1):c.1278G>A (p.(Lys426=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000690959" "0" "10" "11" "118895962" "118895962" "subst" "0.00923969" "01804" "SLC37A4_000042" "g.118895962G>A" "" "" "" "SLC37A4(NM_001164277.1):c.1062C>T (p.(Asn354=), p.N354=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000690960" "0" "30" "11" "118898370" "118898370" "subst" "0.00361609" "01804" "SLC37A4_000052" "g.118898370T>A" "" "" "" "SLC37A4(NM_001164277.1):c.593A>T (p.N198I, p.(Asn198Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000709018" "0" "70" "11" "118898435" "118898435" "del" "0" "01602" "SLC37A4_000062" "g.118898435del" "" "{PMID:Neubauer 2021:33895855}" "" "" "" "Unknown" "" "" "0" "" "" "g.119027725del" "" "likely pathogenic" "" "0000714823" "1" "50" "11" "118898497" "118898497" "subst" "0.00163562" "00000" "SLC37A4_000056" "g.118898497G>A" "" "{PMID:Wang 2013:22899091}" "" "[467C>T;572C>G]" "" "Germline" "" "" "0" "" "" "g.119027787G>A" "" "VUS" "" "0000714827" "3" "90" "11" "118897397" "118897401" "del" "0" "00000" "SLC37A4_000068" "g.118897397_118897401del" "" "{PMID:Wang 2013:22899091}" "" "785-3_786del5" "" "Germline" "" "" "0" "" "" "g.119026687_119026691del" "" "pathogenic (recessive)" "" "0000714828" "1" "90" "11" "118897366" "118897366" "subst" "0" "00000" "SLC37A4_000067" "g.118897366C>T" "" "{PMID:Wang 2013:22899091}" "" "" "" "Germline" "" "" "0" "" "" "g.119026656C>T" "" "pathogenic (recessive)" "" "0000714829" "1" "90" "11" "118898369" "118898369" "del" "0" "00000" "SLC37A4_000069" "g.118898369del" "" "{PMID:Wang 2013:22899091}" "" "595delC" "" "Germline" "" "" "0" "" "" "g.119027659del" "" "pathogenic (recessive)" "" "0000714868" "2" "90" "11" "118896000" "118896000" "subst" "0" "00000" "SLC37A4_000066" "g.118896000A>G" "" "{PMID:Wang 2013:22899091}" "" "" "" "Germline" "" "" "0" "" "" "g.119025290A>G" "" "pathogenic (recessive)" "" "0000714869" "2" "90" "11" "118895981" "118895982" "del" "0.000176678" "00000" "SLC37A4_000065" "g.118895981_118895982del" "" "{PMID:Wang 2013:22899091}" "" "1042_1043delCT" "" "Germline" "" "" "0" "" "" "g.119025271_119025272del" "" "pathogenic (recessive)" "" "0000714870" "2" "90" "11" "118895981" "118895981" "subst" "0" "00000" "SLC37A4_000064" "g.118895981A>G" "" "{PMID:Wang 2013:22899091}" "" "" "" "Germline" "" "" "0" "" "" "g.119025271A>G" "" "pathogenic (recessive)" "" "0000714876" "1" "50" "11" "118898391" "118898391" "subst" "0" "00000" "SLC37A4_000063" "g.118898391G>C" "" "{PMID:Wang 2013:22899091}" "" "[467C>T;572C>G]" "" "Germline" "" "" "0" "" "" "g.119027681G>C" "" "VUS" "" "0000723254" "0" "50" "11" "118895687" "118895687" "subst" "0" "01943" "TRAPPC4_000003" "g.118895687G>A" "" "" "" "SLC37A4(NM_001164277.1):c.1223C>T (p.T408M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000764680" "1" "70" "11" "118895981" "118895982" "del" "0.000176678" "00006" "SLC37A4_000065" "g.118895981_118895982del" "" "{PMID:Tsangaris 2011:21659346}" "" "1042_1043delCT" "" "Germline" "" "" "0" "" "" "g.119025271_119025272del" "" "likely pathogenic (recessive)" "" "0000764681" "1" "70" "11" "118898491" "118898500" "delins" "0" "00006" "SLC37A4_000071" "g.118898491_118898500delinsGGG" "" "{PMID:Tsangaris 2011:21659346}" "" "464del10ins3C" "" "Germline" "" "" "0" "" "" "g.119027781_119027790delinsGGG" "" "likely pathogenic (recessive)" "" "0000764759" "2" "70" "11" "118895988" "118896007" "del" "0" "00006" "SLC37A4_000070" "g.118895988_118896007del" "" "{PMID:Tsangaris 2011:21659346}" "" "1019_1038delTCTCCTCGTATGGCCCCATT" "" "Germline" "" "" "0" "" "" "g.119025278_119025297del" "" "likely pathogenic (recessive)" "" "0000764760" "2" "70" "11" "0" "0" "" "0" "00006" "DRD4_000002" "g.?" "" "{PMID:Tsangaris 2011:21659346}" "" "1211delCT (A400X)" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000804921" "0" "30" "11" "118894023" "118894023" "subst" "0.00190077" "01943" "CCDC84_000002" "g.118894023C>T" "" "" "" "TRAPPC4(NM_001318492.1):c.267-8C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000804922" "0" "50" "11" "118897644" "118897644" "subst" "4.07425E-6" "01943" "TRAPPC4_000004" "g.118897644T>C" "" "" "" "SLC37A4(NM_001164277.1):c.784+3A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000852786" "0" "50" "11" "118897326" "118897326" "subst" "0.000225637" "01943" "SLC37A4_000051" "g.118897326C>T" "" "" "" "SLC37A4(NM_001164277.1):c.857G>A (p.R286Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000862331" "0" "10" "11" "118895635" "118895635" "subst" "0.00570254" "02326" "SLC37A4_000059" "g.118895635G>A" "" "" "" "SLC37A4(NM_001164277.1):c.1275C>T (p.S425=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000862332" "0" "30" "11" "118898497" "118898497" "subst" "0.00163562" "02326" "SLC37A4_000056" "g.118898497G>A" "" "" "" "SLC37A4(NM_001164277.1):c.467C>T (p.A156V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000874563" "3" "70" "11" "118897679" "118897679" "subst" "0" "00000" "SLC37A4_000072" "g.118897679A>G" "" "{PMID:Mameesh 2017:28511025}" "" "SLC37A4 c.752T>C, p.(Leu251Pro)" "homozygous" "Germline" "yes" "" "0" "" "" "g.119026969A>G" "" "likely pathogenic" "" "0000874564" "3" "70" "11" "118897679" "118897679" "subst" "0" "00000" "SLC37A4_000072" "g.118897679A>G" "" "{PMID:Mameesh 2017:28511025}" "" "SLC37A4 c.752T>C, p.(Leu251Pro)" "homozygous" "Germline" "yes" "" "0" "" "" "g.119026969A>G" "" "likely pathogenic" "" "0000874565" "3" "70" "11" "118897679" "118897679" "subst" "0" "00000" "SLC37A4_000072" "g.118897679A>G" "" "{PMID:Mameesh 2017:28511025}" "" "SLC37A4 c.752T>C, p.(Leu251Pro)" "homozygous" "Germline" "yes" "" "0" "" "" "g.119026969A>G" "" "likely pathogenic" "" "0000889655" "0" "30" "11" "118895957" "118895957" "subst" "0.00110372" "02326" "SLC37A4_000054" "g.118895957C>G" "" "" "" "SLC37A4(NM_001164277.1):c.1067G>C (p.S356T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000889656" "0" "10" "11" "118896430" "118896430" "subst" "0.0029455" "02327" "TRAPPC4_000005" "g.118896430G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000889657" "0" "50" "11" "118897719" "118897719" "subst" "0" "02327" "TRAPPC4_000006" "g.118897719C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000925328" "0" "50" "11" "118901448" "118901448" "subst" "0" "02326" "SLC37A4_000073" "g.118901448G>T" "" "" "" "SLC37A4(NM_001164277.1):c.-699-3C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000929807" "0" "50" "11" "118895624" "118895624" "subst" "0.000114096" "02325" "TRAPPC4_000007" "g.118895624T>G" "" "" "" "SLC37A4(NM_001164277.1):c.1286A>C (p.E429A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000949599" "0" "90" "11" "118895981" "118895982" "del" "0.000176678" "02329" "SLC37A4_000065" "g.118895981_118895982del" "" "" "" "SLC37A4(NM_001164277.1):c.1042_1043delCT (p.(Leu348fs)), SLC37A4(NM_001164277.1):c.1042_1043delCT (p.L348Vfs*53)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000949600" "0" "30" "11" "118898497" "118898497" "subst" "0.00163562" "02325" "SLC37A4_000056" "g.118898497G>A" "" "" "" "SLC37A4(NM_001164277.1):c.467C>T (p.A156V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000966196" "0" "30" "11" "118898437" "118898437" "del" "0" "02326" "SLC37A4_000045" "g.118898437del" "" "" "" "SLC37A4(NM_001164277.1):c.527delG (p.C176Lfs*36), SLC37A4(NM_001164278.2):c.528delG (p.C176Wfs*36)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000979389" "0" "70" "11" "118895925" "118895925" "subst" "4.89201E-5" "01804" "SLC37A4_000017" "g.118895925C>T" "" "" "" "SLC37A4(NM_001164277.2):c.1099G>A (p.(Ala367Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000979390" "0" "50" "11" "118898407" "118898407" "subst" "0.00015466" "01804" "SLC37A4_000053" "g.118898407G>A" "" "" "" "SLC37A4(NM_001164277.1):c.556C>T (p.L186F), SLC37A4(NM_001164277.2):c.556C>T (p.(Leu186Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000987816" "1" "90" "11" "118899998" "118899998" "subst" "4.0657E-6" "04221" "SLC37A4_000006" "g.118899998G>A" "" "" "" "" "Kishnani 2014:25356975, Jun 2014:24565827, Dissanayake 2011:21629566" "Germline" "yes" "rs193302882" "0" "" "" "g.119029288G>A" "{CV:68291}" "pathogenic (recessive)" "ACMG" "0000987817" "2" "70" "11" "118895780" "118895780" "subst" "8.12632E-6" "04221" "SLC37A4_000074" "g.118895780C>T" "" "" "" "" "This variant was classified as per ACMG guidelines (Richards et al 2015) and the recently developed ACMG scoring system (Tavtigian et al 2020). ClinVar contains an entry for this variant (Variation ID: 947435), this missense change has been observed in individuals with clinical features of glycogen storage disease (Invitae)." "Germline" "yes" "rs782665493" "0" "" "" "g.119025070C>T" "{CV:947435}" "likely pathogenic (recessive)" "ACMG" "0000998806" "0" "50" "11" "118895751" "118895751" "subst" "8.12341E-5" "01804" "TRAPPC4_000009" "g.118895751T>C" "" "" "" "SLC37A4(NM_001164277.1):c.1159A>G (p.(Ile387Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000998807" "0" "70" "11" "118895981" "118895982" "del" "0.000176678" "01804" "SLC37A4_000065" "g.118895981_118895982del" "" "" "" "SLC37A4(NM_001164277.1):c.1042_1043delCT (p.(Leu348fs)), SLC37A4(NM_001164277.1):c.1042_1043delCT (p.L348Vfs*53)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000998808" "0" "70" "11" "118896009" "118896009" "subst" "7.46479E-5" "01804" "SLC37A4_000011" "g.118896009C>A" "" "" "" "SLC37A4(NM_001164278.1):c.1081G>T (p.(Gly361Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001038267" "0" "50" "11" "118898975" "118898975" "subst" "8.45616E-6" "01804" "TRAPPC4_000010" "g.118898975C>T" "" "" "" "SLC37A4(NM_001164277.2):c.310G>A (p.(Ala104Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001046288" "0" "50" "11" "118896012" "118896012" "subst" "0.000418757" "02325" "TRAPPC4_000011" "g.118896012A>G" "" "" "" "SLC37A4(NM_001164277.1):c.1012T>C (p.F338L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001046289" "0" "30" "11" "118898370" "118898370" "subst" "0.00361609" "02327" "SLC37A4_000052" "g.118898370T>A" "" "" "" "SLC37A4(NM_001164277.1):c.593A>T (p.N198I, p.(Asn198Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes SLC37A4 ## Count = 110 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000130268" "00025341" "00" "898" "0" "898" "0" "c.898C>T" "r.(?)" "p.(Arg300Cys)" "" "0000298305" "00025341" "30" "1062" "0" "1062" "0" "c.1062C>T" "r.(?)" "p.(Asn354=)" "" "0000298306" "00025341" "10" "525" "0" "527" "0" "c.525_527=" "r.(=)" "p.(Leu175=)" "" "0000302236" "00025341" "10" "1062" "0" "1062" "0" "c.1062C>T" "r.(?)" "p.(Asn354=)" "" "0000302237" "00025341" "10" "149" "-14" "149" "-14" "c.149-14A>G" "r.(=)" "p.(=)" "" "0000302238" "00025341" "10" "625" "14" "625" "14" "c.625+14C>T" "r.(=)" "p.(=)" "" "0000308434" "00025341" "50" "984" "228" "984" "228" "c.984+228C>G" "r.(=)" "p.(=)" "" "0000308435" "00025341" "30" "150" "0" "150" "0" "c.150G>T" "r.(?)" "p.(Gly50=)" "" "0000346458" "00025341" "50" "984" "270" "984" "270" "c.984+270C>T" "r.(=)" "p.(=)" "" "0000437119" "00025341" "95" "59" "0" "59" "0" "c.59G>A" "r.(?)" "p.(Gly20Asp)" "3" "0000437120" "00025341" "95" "70" "0" "70" "0" "c.70T>C" "r.(?)" "p.(Tyr24His)" "3" "0000437121" "00025341" "95" "81" "0" "81" "0" "c.81T>A" "r.(?)" "p.(Asn27Lys)" "3" "0000437122" "00025341" "95" "82" "0" "82" "0" "c.82C>T" "r.(?)" "p.(Arg28Cys)" "3" "0000437123" "00025341" "95" "83" "0" "83" "0" "c.83G>A" "r.(?)" "p.(Arg28His)" "3" "0000437124" "00025341" "95" "148" "0" "148" "0" "c.148G>C" "r.(spl?)" "p.(Gly50Arg)" "3" "0000437125" "00025341" "95" "149" "0" "149" "0" "c.149G>A" "r.(spl?)" "p.(Gly50Glu)" "4" "0000437126" "00025341" "95" "162" "0" "162" "0" "c.162C>A" "r.(?)" "p.(Ser54Arg)" "4" "0000437127" "00025341" "95" "163" "0" "163" "0" "c.163A>C" "r.(?)" "p.(Ser55Arg)" "4" "0000437128" "00025341" "95" "202" "0" "202" "0" "c.202G>A" "r.(?)" "p.(Gly68Arg)" "4" "0000437129" "00025341" "95" "254" "0" "254" "0" "c.254T>C" "r.(?)" "p.(Leu85Pro)" "4" "0000437130" "00025341" "95" "263" "0" "263" "0" "c.263G>A" "r.(?)" "p.(Gly88Asp)" "4" "0000437131" "00025341" "95" "287" "0" "287" "0" "c.287G>A" "r.(?)" "p.(Trp96*)" "4" "0000437132" "00025341" "55" "287" "0" "287" "0" "c.287G>A" "r.(?)" "p.(Trp96*)" "4" "0000437133" "00025341" "95" "352" "0" "352" "0" "c.352T>C" "r.(?)" "p.(Trp118Arg)" "4" "0000437134" "00025341" "95" "398" "0" "398" "0" "c.398A>C" "r.(?)" "p.(Gln133Pro)" "5" "0000437135" "00025341" "95" "443" "0" "443" "0" "c.443C>T" "r.(?)" "p.(Ala148Val)" "5" "0000437136" "00025341" "95" "446" "0" "446" "0" "c.446G>A" "r.(?)" "p.(Gly149Glu)" "5" "0000437137" "00025341" "95" "448" "0" "448" "0" "c.448G>A" "r.(?)" "p.(Gly150Arg)" "5" "0000437138" "00025341" "95" "458" "0" "458" "0" "c.458C>T" "r.(?)" "p.(Pro153Leu)" "5" "0000437139" "00025341" "95" "526" "0" "526" "0" "c.526T>C" "r.(?)" "p.(Cys176Arg)" "5" "0000437140" "00025341" "95" "547" "0" "547" "0" "c.547T>C" "r.(?)" "p.(Cys183Arg)" "5" "0000437141" "00025341" "95" "547" "0" "547" "0" "c.547T>C" "r.(?)" "p.(Cys183Arg)" "5" "0000437142" "00025341" "95" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Pro191Leu)" "5" "0000437143" "00025341" "95" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Pro191Leu)" "5" "0000437144" "00025341" "95" "686" "0" "686" "0" "c.686T>C" "r.(?)" "p.(Leu229Pro)" "6" "0000437145" "00025341" "95" "736" "0" "736" "0" "c.736T>C" "r.(?)" "p.(Trp246Arg)" "6" "0000437146" "00025341" "95" "833" "0" "833" "0" "c.833T>A" "r.(?)" "p.(Ile278Asn)" "7" "0000437147" "00025341" "95" "898" "0" "898" "0" "c.898C>T" "r.(?)" "p.(Arg300Cys)" "8" "0000437148" "00025341" "95" "899" "0" "899" "0" "c.899G>A" "r.(?)" "p.(Arg300His)" "8" "0000437149" "00025341" "95" "902" "0" "902" "0" "c.902A>C" "r.(?)" "p.(His301Pro)" "8" "0000437150" "00025341" "95" "1015" "0" "1015" "0" "c.1015G>T" "r.(?)" "p.(Gly339Cys)" "9" "0000437151" "00025341" "95" "1015" "0" "1015" "0" "c.1015G>T" "r.(?)" "p.(Gly339Cys)" "9" "0000437152" "00025341" "55" "1015" "0" "1015" "0" "c.1015G>T" "r.(?)" "p.(Gly339Cys)" "9" "0000437153" "00025341" "95" "1016" "0" "1016" "0" "c.1016G>A" "r.(?)" "p.(Gly339Asp)" "9" "0000437154" "00025341" "95" "1099" "0" "1099" "0" "c.1099G>A" "r.(?)" "p.(Ala367Thr)" "9" "0000437155" "00025341" "95" "1099" "0" "1099" "0" "c.1099G>A" "r.(?)" "p.(Ala367Thr)" "9" "0000437156" "00025341" "95" "1118" "0" "1118" "0" "c.1118C>A" "r.(?)" "p.(Ala373Asp)" "9" "0000437157" "00025341" "95" "1126" "0" "1126" "0" "c.1126G>A" "r.(?)" "p.(Gly376Ser)" "10" "0000542621" "00025341" "30" "1240" "0" "1240" "0" "c.1240C>T" "r.(?)" "p.(Leu414=)" "" "0000542622" "00025341" "30" "1240" "0" "1240" "0" "c.1240C>T" "r.(?)" "p.(Leu414=)" "" "0000542623" "00025341" "10" "985" "-48" "985" "-48" "c.985-48C>T" "r.(=)" "p.(=)" "" "0000542624" "00025341" "50" "857" "0" "857" "0" "c.857G>A" "r.(?)" "p.(Arg286Gln)" "" "0000542625" "00025341" "30" "593" "0" "593" "0" "c.593A>T" "r.(?)" "p.(Asn198Ile)" "" "0000542626" "00025341" "30" "593" "0" "593" "0" "c.593A>T" "r.(?)" "p.(Asn198Ile)" "" "0000542627" "00025341" "30" "593" "0" "593" "0" "c.593A>T" "r.(?)" "p.(Asn198Ile)" "" "0000542628" "00025341" "30" "556" "0" "556" "0" "c.556C>T" "r.(?)" "p.(Leu186Phe)" "" "0000613086" "00025341" "30" "492" "0" "492" "0" "c.492C>T" "r.(?)" "p.(Ser164=)" "" "0000613087" "00025341" "50" "242" "0" "242" "0" "c.242C>T" "r.(?)" "p.(Ser81Phe)" "" "0000622566" "00025341" "50" "1067" "0" "1067" "0" "c.1067G>C" "r.(?)" "p.(Ser356Thr)" "" "0000622567" "00025341" "50" "467" "0" "467" "0" "c.467C>T" "r.(?)" "p.(Ala156Val)" "" "0000648114" "00025341" "10" "1279" "0" "1279" "0" "c.1279G>A" "" "p.?" "" "0000648115" "00025341" "30" "1276" "0" "1276" "0" "c.1276C>T" "" "p.?" "" "0000648116" "00025341" "10" "1063" "0" "1063" "0" "c.1063C>T" "" "p.?" "" "0000648117" "00025341" "50" "497" "0" "497" "0" "c.497G>A" "r.(?)" "p.(Arg166His)" "" "0000648118" "00025341" "70" "70" "0" "70" "0" "c.70T>C" "r.(?)" "p.(Tyr24His)" "" "0000669105" "00025341" "30" "1276" "0" "1276" "0" "c.1276C>T" "" "p.?" "" "0000679073" "00025341" "30" "183" "0" "183" "0" "c.183T>C" "r.(?)" "p.(Ala61=)" "" "0000690958" "00025341" "10" "1278" "0" "1278" "0" "c.1278G>A" "r.(?)" "p.(Lys426=)" "" "0000690959" "00025341" "10" "1062" "0" "1062" "0" "c.1062C>T" "r.(?)" "p.(Asn354=)" "" "0000690960" "00025341" "30" "593" "0" "593" "0" "c.593A>T" "r.(?)" "p.(Asn198Ile)" "" "0000709018" "00025341" "70" "528" "0" "528" "0" "c.528del" "r.(?)" "p.(Cys176Trpfs*36)" "" "0000714823" "00025341" "50" "467" "0" "467" "0" "c.467C>T" "r.(?)" "p.(Ala156Val)" "" "0000714827" "00025341" "90" "785" "-3" "786" "0" "c.785-3_786del" "r.spl" "p.?" "" "0000714828" "00025341" "90" "817" "0" "817" "0" "c.817G>A" "r.(?)" "p.(Gly273Ser)" "" "0000714829" "00025341" "90" "595" "0" "595" "0" "c.595del" "r.(?)" "p.(Leu199Trpfs*13)" "" "0000714868" "00025341" "90" "1024" "0" "1024" "0" "c.1024T>C" "r.(?)" "p.(Ser342Pro)" "" "0000714869" "00025341" "90" "1042" "0" "1043" "0" "c.1042_1043del" "r.(?)" "p.(Leu348Valfs*53)" "" "0000714870" "00025341" "90" "1043" "0" "1043" "0" "c.1043T>C" "r.(?)" "p.(Leu348Pro)" "" "0000714876" "00025341" "50" "572" "0" "572" "0" "c.572C>G" "r.(?)" "p.(Pro191Arg)" "" "0000723254" "00025341" "50" "1223" "0" "1223" "0" "c.1223C>T" "r.(?)" "p.(Thr408Met)" "" "0000764680" "00025341" "70" "1042" "0" "1043" "0" "c.1042_1043del" "r.(?)" "p.(Leu348ValfsTer53)" "" "0000764681" "00025341" "70" "464" "0" "473" "0" "c.464_473delinsCCC" "r.(?)" "p.(Leu155ProfsTer55)" "" "0000764759" "00025341" "70" "1019" "0" "1038" "0" "c.1019_1038del" "r.(?)" "p.(Phe340CysfsTer55)" "" "0000764760" "00025341" "70" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000804921" "00025341" "30" "2888" "0" "2888" "0" "c.*1597G>A" "r.(=)" "p.(=)" "" "0000804922" "00025341" "50" "784" "3" "784" "3" "c.784+3A>G" "r.spl?" "p.?" "" "0000852786" "00025341" "50" "857" "0" "857" "0" "c.857G>A" "r.(?)" "p.(Arg286Gln)" "" "0000862331" "00025341" "10" "1275" "0" "1275" "0" "c.1275C>T" "r.(?)" "p.(Ser425=)" "" "0000862332" "00025341" "30" "467" "0" "467" "0" "c.467C>T" "r.(?)" "p.(Ala156Val)" "" "0000874563" "00025341" "70" "752" "0" "752" "0" "c.752T>C" "r.(?)" "p.(Leu251Pro)" "" "0000874564" "00025341" "70" "752" "0" "752" "0" "c.752T>C" "r.(?)" "p.(Leu251Pro)" "" "0000874565" "00025341" "70" "752" "0" "752" "0" "c.752T>C" "r.(?)" "p.(Leu251Pro)" "" "0000889655" "00025341" "30" "1067" "0" "1067" "0" "c.1067G>C" "r.(?)" "p.(Ser356Thr)" "" "0000889656" "00025341" "10" "984" "247" "984" "247" "c.984+247C>T" "r.(=)" "p.(=)" "" "0000889657" "00025341" "50" "712" "0" "712" "0" "c.712G>C" "r.(?)" "p.(Gly238Arg)" "" "0000925328" "00025341" "50" "-699" "-3" "-699" "-3" "c.-699-3C>A" "r.spl?" "p.?" "" "0000929807" "00025341" "50" "1287" "0" "1287" "0" "c.1287A>C" "r.(?)" "p.?" "" "0000949599" "00025341" "90" "1043" "0" "1044" "0" "c.1043_1044del" "r.?" "p.?" "" "0000949600" "00025341" "30" "467" "0" "467" "0" "c.467C>T" "r.(?)" "p.(Ala156Val)" "" "0000966196" "00025341" "30" "525" "0" "527" "0" "c.525_527=" "r.(=)" "p.(Leu175=)" "" "0000979389" "00025341" "70" "1100" "0" "1100" "0" "c.1100G>A" "r.(?)" "p.?" "" "0000979390" "00025341" "50" "556" "0" "556" "0" "c.556C>T" "r.(?)" "p.(Leu186Phe)" "" "0000987816" "00025341" "90" "82" "0" "82" "0" "c.82C>T" "r.(?)" "p.(Arg28Cys)" "3" "0000987817" "00025341" "70" "1130" "0" "1130" "0" "c.1130G>A" "r.(?)" "p.(Gly377Asp)" "10" "0000998806" "00025341" "50" "1160" "0" "1160" "0" "c.1160A>G" "r.(?)" "p.?" "" "0000998807" "00025341" "70" "1043" "0" "1044" "0" "c.1043_1044del" "r.?" "p.?" "" "0000998808" "00025341" "70" "1016" "0" "1016" "0" "c.1016G>T" "r.(?)" "p.?" "" "0001038267" "00025341" "50" "310" "0" "310" "0" "c.310G>A" "r.(?)" "p.?" "" "0001046288" "00025341" "50" "1013" "0" "1013" "0" "c.1013T>C" "r.(?)" "p.?" "" "0001046289" "00025341" "30" "593" "0" "593" "0" "c.593A>T" "r.(?)" "p.(Asn198Ile)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 63 "{{screeningid}}" "{{variantid}}" "0000000014" "0000437152" "0000081182" "0000130268" "0000207464" "0000437119" "0000207465" "0000437120" "0000207466" "0000437121" "0000207467" "0000437122" "0000207468" "0000437123" "0000207469" "0000437124" "0000207470" "0000437125" "0000207471" "0000437126" "0000207472" "0000437127" "0000207473" "0000437128" "0000207474" "0000437129" "0000207475" "0000437130" "0000207476" "0000437131" "0000207476" "0000437151" "0000207477" "0000437133" "0000207478" "0000437134" "0000207479" "0000437135" "0000207480" "0000437136" "0000207481" "0000437137" "0000207482" "0000437138" "0000207483" "0000437139" "0000207484" "0000437140" "0000207485" "0000437141" "0000207486" "0000437142" "0000207487" "0000437143" "0000207488" "0000437144" "0000207489" "0000437145" "0000207490" "0000437146" "0000207491" "0000437147" "0000207492" "0000437148" "0000207493" "0000437149" "0000207494" "0000437150" "0000207495" "0000437153" "0000207496" "0000437154" "0000207497" "0000437155" "0000207498" "0000437156" "0000207499" "0000437157" "0000291425" "0000648114" "0000291426" "0000648115" "0000291427" "0000648116" "0000291428" "0000648117" "0000291429" "0000648118" "0000305417" "0000669105" "0000325864" "0000709018" "0000330292" "0000714823" "0000330292" "0000714868" "0000330292" "0000714876" "0000330296" "0000714827" "0000330297" "0000714828" "0000330297" "0000714869" "0000330298" "0000714829" "0000330298" "0000714870" "0000363970" "0000764680" "0000363970" "0000764759" "0000363971" "0000764681" "0000363971" "0000764760" "0000416463" "0000874563" "0000416464" "0000874564" "0000416465" "0000874565" "0000453259" "0000987816" "0000453259" "0000987817"