### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = SMARCA2) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "SMARCA2" "SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2" "9" "p24.3" "unknown" "NG_032162.2" "UD_132437292703" "" "https://www.LOVD.nl/SMARCA2" "" "1" "11098" "6595" "600014" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was supported by the European Community\'s Seventh Framework Programme (FP7/2007-2013) under grant agreement No 200754 - the GEN2PHEN project." "" "g" "https://databases.lovd.nl/shared/refseq/SMARCA2_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2012-03-20 00:00:00" "00006" "2020-11-26 19:21:59" "00000" "2025-11-01 13:22:20" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00019417" "SMARCA2" "transcript variant 1" "001" "NM_003070.3" "" "NP_003061.3" "" "" "" "-99" "5658" "4773" "2015342" "2193624" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 20 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00001" "JBS" "Johanson-Blizzard syndrome (JBS)" "AR" "243800" "" "" "" "00001" "2012-05-16 14:39:33" "00006" "2021-12-10 21:51:32" "00002" "JBTS1" "Joubert syndrome, type 1 (JBTS1)" "AR" "213300" "" "" "" "00006" "2012-05-17 22:47:36" "00006" "2021-12-10 21:51:32" "00003" "JBTS13" "Joubert syndrome, type 13 (JBTS13)" "AR" "614173" "" "" "" "00006" "2012-05-17 22:48:47" "00006" "2021-12-10 21:51:32" "00004" "KTZS" "Kohlschutter-Tonz syndrome" "AR" "226750" "" "" "" "00002" "2012-05-23 08:55:16" "00006" "2021-12-10 21:51:32" "00005" "MDDGC5;LGMDR9;LGMD2I" "dystrophy-dystroglycanopathy, muscular, (limb-girdle), type C5 (LGMDR9, LGMD2I)" "AR" "607155" "" "" "" "00006" "2012-06-11 11:22:53" "00006" "2024-01-12 21:52:26" "00006" "IVA" "isovaleric acidemia (IVA)" "AR" "243500" "" "" "" "00001" "2012-06-15 15:58:49" "00001" "2021-07-01 15:09:07" "00007" "LCCS1" "contracture syndrome, lethal, congenital, type 1" "AR" "253310" "" "" "" "00006" "2012-06-29 14:23:06" "00006" "2023-08-06 22:40:03" "00008" "CAAHD" "arthrogryposis, lethal, with anterior horn cell, congenital (CAAHD)" "AR" "611890" "" "" "" "00006" "2012-06-29 14:23:57" "00006" "2020-07-21 21:34:09" "00009" "EPM1A" "epilepsy, myoclonic, progressive, type 1A (EPM1A, Unverricht and Lundborg)" "AR" "254800" "" "" "" "00006" "2012-06-29 14:54:52" "00006" "2020-11-13 09:46:33" "00010" "MCLMR" "microcephaly with/without chorioretinopathy, lymphedema, or mental retardation (MCLMR)" "AD" "152950" "" "" "" "00006" "2012-06-29 16:51:23" "00006" "2020-02-10 09:10:25" "00011" "USH3B" "Usher syndrome, type 3B (USH-3B)" "AR" "614504" "" "" "" "00006" "2012-06-29 17:09:32" "00006" "2021-12-10 21:51:32" "00012" "PSORS" "psoriasis, pustular, generalized (PSORS)" "" "" "" "" "" "00006" "2012-07-06 21:50:32" "00006" "2019-08-12 13:38:21" "00139" "ID" "intellectual disability (ID)" "" "" "" "" "" "00084" "2013-06-04 18:18:07" "00006" "2015-02-09 10:02:49" "00156" "CSS" "Coffin-Siris syndrome (CSS)" "" "" "" "" "" "00001" "2013-06-27 15:22:30" "00006" "2021-12-10 21:51:32" "00157" "NCBRS" "Nicolaides-Baraitser syndrome (NCBRS)" "AD" "601358" "" "" "" "00001" "2013-06-27 15:22:58" "00006" "2021-12-10 21:51:32" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00669" "USH2C" "Usher syndrome,, type IIC (USH2C, GPR98/PDZD7 digenic)" "AR;DD" "605472" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "04270" "epilepsy" "epilepsy" "" "" "" "" "" "00006" "2015-05-14 16:00:06" "00006" "2017-09-07 14:25:59" "05517" "skeletal dysplasia" "dysplasia, skeletal" "" "" "" "" "" "00006" "2018-11-16 16:43:21" "" "" "05611" "NDD" "neurodevelopmental disorder (NDD)" "" "" "" "" "" "00006" "2019-06-19 12:27:20" "00006" "2024-12-13 11:12:21" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 2 "{{geneid}}" "{{diseaseid}}" "SMARCA2" "00139" "SMARCA2" "00157" ## Individuals ## Do not remove or alter this header ## ## Count = 152 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00001503" "" "" "" "1" "" "00074" "{PMID:Santen 2013:23929686}" "" "M" "" "" "" "0" "" "" "" "Pat2" "00001504" "" "" "" "1" "" "00074" "{PMID:Santen 2013:23929686}" "" "F" "" "" "" "0" "" "" "" "Pat5" "00001505" "" "" "" "1" "" "00074" "{PMID:Santen 2013:23929686}, {PMID:van der Sluijs 2019:30349098}, van der Sluijs 2024 (submitted)" "" "F" "" "" "" "0" "" "" "" "Pat10;Pat1;Pat256" "00001508" "" "" "" "1" "" "00074" "{PMID:Santen 2013:23929686}" "" "F" "" "" "" "0" "" "" "" "Pat13" "00001510" "" "" "" "1" "" "00074" "{PMID:Santen 2013:23929686}, {PMID:van der Sluijs 2019:30349098}" "" "M" "" "" "" "0" "" "" "" "Pat16;Pat5" "00001511" "" "" "" "1" "" "00074" "{PMID:Santen 2013:23929686}" "" "F" "" "" "" "0" "" "" "" "Pat18" "00001513" "" "" "" "1" "" "00074" "{PMID:Santen 2013:23929686}, {PMID:van der Sluijs 2019:30349098}, van der Sluijs 2024 (submitted)" "" "F" "" "" "" "0" "" "" "" "Pat20;Pat7;Pat317" "00001514" "" "" "" "1" "" "00074" "" "" "F" "" "" "" "" "" "" "" "" "00001515" "" "" "" "1" "" "00074" "{PMID:Santen 2013:23929686}" "" "F" "" "" "" "0" "" "" "" "Pat22" "00001516" "" "" "" "1" "" "00074" "" "" "F" "" "" "" "" "" "" "" "" "00001517" "" "" "" "1" "" "00074" "{PMID:Santen 2013:23929686}, van der Sluijs 2024 (submitted)" "" "F" "" "" "" "0" "" "" "" "Pat24;Pat9" "00001519" "" "" "" "1" "" "00074" "{PMID:Santen 2013:23929686}" "" "F" "" "" "" "0" "" "" "" "Pat26" "00001520" "" "" "" "1" "" "00074" "" "" "F" "" "" "" "" "" "" "" "" "00001521" "" "" "" "1" "" "00074" "{PMID:Santen 2013:23929686}, {PMID:van der Sluijs 2019:30349098}" "" "M" "" "" "" "0" "" "" "" "Pat28;Pat10" "00001524" "" "" "" "1" "" "00074" "{PMID:Santen 2013:23929686}, {PMID:van der Sluijs 2019:30349098}" "" "M" "" "" "" "0" "" "" "" "Pat31;Pat25" "00001525" "" "" "" "1" "" "00074" "" "" "M" "" "" "" "" "" "" "" "" "00001526" "" "" "" "1" "" "00074" "{PMID:Santen 2013:23929686}" "" "M" "" "" "" "0" "" "" "" "Pat33" "00001529" "" "" "" "1" "" "00074" "{PMID:Santen 2013:23929686}" "" "M" "" "" "" "0" "" "" "" "Pat37" "00001530" "" "" "" "1" "" "00074" "" "" "F" "" "" "" "" "" "" "" "" "00001531" "" "" "" "1" "" "00074" "{PMID:Santen 2013:23929686}, {PMID:van der Sluijs 2019:30349098}, van der Sluijs 2024 (submitted)" "" "M" "" "" "" "0" "" "" "" "Pat39;Pat27;Pat324" "00001532" "" "" "" "1" "" "00074" "" "" "F" "" "" "" "" "" "" "" "" "00001533" "" "" "" "1" "" "00074" "" "" "F" "" "" "" "" "" "" "" "" "00001534" "" "" "" "1" "" "00074" "{PMID:Santen 2013:23929686}" "" "F" "" "" "" "0" "" "" "" "Pat42" "00001535" "" "" "" "1" "" "00074" "{PMID:Santen 2013:23929686}" "" "F" "" "" "" "0" "" "" "" "Pat43" "00001536" "" "" "" "1" "" "00074" "" "" "F" "" "" "" "" "" "" "" "" "00001537" "" "" "" "1" "" "00074" "" "" "F" "" "" "" "" "" "" "" "" "00001538" "" "" "" "1" "" "00074" "{PMID:Santen 2013:23929686}" "" "M" "" "" "" "0" "" "" "" "Pat46" "00001541" "" "" "" "1" "" "00074" "{PMID:Santen 2013:23929686}, {PMID:van der Sluijs 2019:30349098}" "" "F" "" "" "" "0" "" "" "" "Pat49;Pat32" "00001542" "" "" "" "1" "" "00074" "{PMID:Santen 2013:23929686}, {PMID:van der Sluijs 2019:30349098}" "" "F" "" "" "" "0" "" "" "" "Pat50;Pat33" "00001544" "" "" "" "1" "" "00074" "{PMID:Santen 2013:23929686}" "" "M" "" "" "" "0" "" "" "" "Pat52" "00001545" "" "" "" "1" "" "00074" "{PMID:Santen 2013:23929686}" "" "F" "" "" "" "0" "" "" "" "Pat53" "00001546" "" "" "" "1" "" "00074" "{PMID:Santen 2013:23929686}, {PMID:van der Sluijs 2019:30349098}, van der Sluijs 2024 (submitted)" "" "F" "" "" "" "0" "" "" "" "Pat55;Pat39;Pat329" "00001549" "" "" "" "1" "" "00074" "" "" "F" "" "" "" "" "" "" "" "" "00001558" "" "" "" "1" "" "00074" "{PMID:Santen 2013:23929686}" "" "M" "" "" "" "0" "" "" "" "Pat70" "00047976" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00047977" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00047978" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00047979" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00047980" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00047981" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00047982" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00047983" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00047984" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00047985" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00047986" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00047987" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00047988" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00047989" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00047990" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00047991" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00047992" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00047993" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00047994" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00047995" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00047996" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00047997" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00047998" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00047999" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00048000" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00048001" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00048002" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00048003" "" "" "" "1" "" "00233" "" "" "" "" "" "" "0" "" "" "" "" "00050399" "" "" "" "1" "" "00006" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "family, 1 affected" "F" "" "United Kingdom (Great Britain)" "" "0" "Decipher" "" "" "" "00050469" "" "" "" "1" "" "00006" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "family, 1 affected" "M" "" "United Kingdom (Great Britain)" "" "0" "Decipher" "" "" "" "00050559" "" "" "" "2" "" "00006" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "family, affected mother/child" "F" "" "United Kingdom (Great Britain)" "" "0" "Decipher" "" "" "" "00050605" "" "" "" "1" "" "00006" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "family, 1 affected" "M" "" "United Kingdom (Great Britain)" "" "0" "Decipher" "" "" "" "00050647" "" "" "" "1" "" "00006" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "family, 1 affected" "F" "" "United Kingdom (Great Britain)" "" "0" "Decipher" "" "" "" "00087097" "" "" "" "1" "" "00006" "{PMID:Wieczorek 2013:23906836}" "" "F" "" "" "" "0" "" "" "" "K2703" "00087098" "" "" "" "1" "" "00006" "{PMID:Wieczorek 2013:23906836}" "" "F" "" "" "" "0" "" "" "" "K2704" "00087099" "" "" "" "1" "" "00006" "{PMID:Wieczorek 2013:23906836}" "" "M" "" "" "" "0" "" "" "" "K2706" "00163915" "" "" "" "1" "" "01807" "" "" "F" "" "(Germany)" "" "0" "" "" "" "" "00174119" "" "" "" "1" "" "00008" "{PMID:Tsurusaki 2012:22426308}, {PMID:Sousa 2014:25169058}" "" "" "" "Japan" "" "0" "" "" "" "Pat19" "00174120" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174121" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174122" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174123" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174124" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174125" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174126" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174127" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174128" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174129" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174131" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174132" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174133" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174134" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174135" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174136" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174137" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174138" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174139" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174140" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174141" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174142" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174143" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174144" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174145" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174146" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174147" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174148" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174149" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174150" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174151" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174152" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174153" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174154" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174155" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174156" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174157" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174158" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174159" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174160" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174161" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174162" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174163" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174164" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174165" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174166" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174167" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174168" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174169" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174170" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174171" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174172" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174173" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174174" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174175" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174176" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174177" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174178" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00174179" "" "" "" "1" "" "00008" "{PMID:Sousa SB 2014:25169058}" "" "" "" "" "" "0" "" "" "" "" "00294830" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294832" "" "" "" "12" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00315020" "" "" "" "1" "" "00006" "{PMID:Squeo 2020:32170002}" "analysis 263 cases chromatin-related disorder" "" "" "Italy" "" "0" "" "" "" "GDB1455" "00315021" "" "" "" "1" "" "00006" "{PMID:Squeo 2020:32170002}" "analysis 263 cases chromatin-related disorder" "" "" "Italy" "" "0" "" "" "" "GDB1413" "00315022" "" "" "" "1" "" "00006" "{PMID:Squeo 2020:32170002}" "analysis 263 cases chromatin-related disorder" "" "" "Italy" "" "0" "" "" "" "GDB1414" "00318130" "" "" "" "1" "" "01164" "" "" "F" "" "Germany" "" "0" "" "" "" "171343" "00319919" "" "" "" "1" "" "00006" "{PMID:Tang 2017:27665729}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "Ghana" "" "0" "" "" "" "patient" "00433657" "" "" "" "1" "" "03544" "" "" "" "" "" "" "" "" "" "" "" "00434752" "" "" "" "1" "" "00006" "{PMID:Chen 2022:34906496}" "" "" "" "" "" "0" "" "" "" "Pat94" "00434753" "" "" "" "1" "" "00006" "{PMID:Chen 2022:34906496}" "" "" "" "" "" "0" "" "" "" "Pat95" "00434754" "" "" "" "1" "" "00006" "{PMID:Chen 2022:34906496}" "" "" "" "" "" "0" "" "" "" "Pat96" "00434755" "" "" "" "1" "" "00006" "{PMID:Chen 2022:34906496}" "" "" "" "" "" "0" "" "" "" "Pat97" "00434756" "" "" "" "1" "" "00006" "{PMID:Chen 2022:34906496}" "" "" "" "" "" "0" "" "" "" "Pat98" "00434757" "" "" "" "1" "" "00006" "{PMID:Chen 2022:34906496}" "" "" "" "" "" "0" "" "" "" "Pat99" "00434758" "" "" "" "1" "" "00006" "{PMID:Chen 2022:34906496}" "" "" "" "" "" "0" "" "" "" "Pat100" "00434759" "" "" "" "1" "" "00006" "{PMID:Chen 2022:34906496}" "" "" "" "" "" "0" "" "" "" "Pat101" "00434760" "" "" "" "1" "" "00006" "{PMID:Chen 2022:34906496}" "" "" "" "" "" "0" "" "" "" "Pat102" "00435600" "" "" "" "1" "" "00006" "{PMID:Niggl 2023:37541189}" "2-generation family, 1 affected" "M" "" "" "" "0" "" "" "" "Pat6" "00449857" "" "" "" "1" "" "03544" "" "" "M" "-" "- (not applicable)" "" "" "" "" "white" "" "00453457" "" "" "" "1" "" "03544" "" "" "F" "-" "- (not applicable)" "" "" "" "" "white" "" "00464547" "" "" "" "1" "" "04333" "" "" "F" "yes" "Israel" "" "" "" "" "Muslim Arab" "" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 166 "{{individualid}}" "{{diseaseid}}" "00001503" "00001" "00001503" "00002" "00001503" "00003" "00001503" "00004" "00001503" "00005" "00001503" "00006" "00001503" "00007" "00001503" "00008" "00001503" "00009" "00001503" "00010" "00001503" "00011" "00001503" "00012" "00001503" "00156" "00001504" "00156" "00001505" "00156" "00001508" "00157" "00001510" "00156" "00001511" "00156" "00001513" "00156" "00001514" "00156" "00001515" "00157" "00001516" "00156" "00001517" "00156" "00001519" "00156" "00001520" "00156" "00001521" "00156" "00001524" "00156" "00001525" "00156" "00001526" "00156" "00001529" "00156" "00001530" "00156" "00001531" "00156" "00001532" "00156" "00001533" "00156" "00001534" "00156" "00001535" "00156" "00001536" "00156" "00001537" "00156" "00001538" "00156" "00001541" "00156" "00001542" "00156" "00001544" "00157" "00001545" "00157" "00001546" "00156" "00001549" "00156" "00001558" "00156" "00047976" "00157" "00047977" "00157" "00047978" "00157" "00047979" "00157" "00047980" "00157" "00047981" "00157" "00047982" "00157" "00047983" "00157" "00047984" "00157" "00047985" "00157" "00047986" "00157" "00047987" "00157" "00047988" "00157" "00047989" "00157" "00047990" "00157" "00047991" "00157" "00047992" "00157" "00047993" "00157" "00047994" "00157" "00047995" "00157" "00047996" "00157" "00047997" "00157" "00047998" "00157" "00047999" "00157" "00048000" "00157" "00048001" "00157" "00048002" "00157" "00048003" "00157" "00050399" "00198" "00050469" "00198" "00050559" "00198" "00050605" "00198" "00050647" "00198" "00087097" "00198" "00087098" "00198" "00087099" "00198" "00163915" "00198" "00174119" "00157" "00174120" "00157" "00174121" "00157" "00174122" "00157" "00174123" "00157" "00174124" "00157" "00174125" "00157" "00174126" "00157" "00174127" "00157" "00174128" "00157" "00174129" "00157" "00174131" "00157" "00174132" "00157" "00174133" "00157" "00174134" "00157" "00174135" "00157" "00174136" "00157" "00174137" "00157" "00174138" "00157" "00174139" "00157" "00174140" "00157" "00174141" "00157" "00174142" "00157" "00174143" "00157" "00174144" "00157" "00174145" "00157" "00174146" "00157" "00174147" "00157" "00174148" "00157" "00174149" "00157" "00174150" "00157" "00174151" "00157" "00174152" "00157" "00174153" "00157" "00174154" "00157" "00174155" "00157" "00174156" "00157" "00174157" "00157" "00174158" "00157" "00174159" "00157" "00174160" "00157" "00174161" "00157" "00174162" "00157" "00174163" "00157" "00174164" "00157" "00174165" "00157" "00174166" "00157" "00174167" "00157" "00174168" "00157" "00174169" "00157" "00174170" "00157" "00174171" "00157" "00174172" "00157" "00174173" "00157" "00174174" "00157" "00174175" "00157" "00174176" "00157" "00174177" "00157" "00174178" "00157" "00174179" "00157" "00294830" "00198" "00294832" "00198" "00315020" "00198" "00315021" "00198" "00315022" "00198" "00318130" "00157" "00319919" "04270" "00433657" "00198" "00434752" "05611" "00434753" "05611" "00434754" "05611" "00434755" "05611" "00434756" "05611" "00434757" "05611" "00434758" "05611" "00434759" "05611" "00434760" "05611" "00435600" "05611" "00449857" "00157" "00453457" "05611" "00464547" "00139" "00464547" "00669" "00464547" "05517" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00001, 00002, 00003, 00004, 00005, 00006, 00007, 00008, 00009, 00010, 00011, 00012, 00139, 00156, 00157, 00198, 00669, 04270, 05517, 05611 ## Count = 121 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000000685" "00156" "00001503" "00074" "Isolated (sporadic)" "40y" "brith a term, weight SD 0.5; inguinal hernia bilateral, 3 hypomelanitic maculae.; no hypotonia; birth feeding problems; eczema (HP:0000964); no cutis marmorata (-HP:0000965); no seizures (-HP:0001250); delayed growth (HP:00001510); moderate speech delay (HP:0000750); moderate intellectual disability; normal scalp hair (-HP:0100037); normal eyebrow (-HP:0000534); normal eylashes (-HP:0000499); delayed gross motor skills (HP:0002194), delayed fine motor skills (HP:0010862); abnormal lacrimal duct (HP:0011481); ptosis (HP:0000520); no choanal stenosis (-HP:0000452); normal nasal bridge (-HP:0000422), no anteverted nares (-HP:0000463); short philtrum (HP:0000322); wide mouth (HP:0000154); cleft palate (HP:0000175); ear abnormality (HP:0000598), no ear tags (-HP:0000384); hypertrichosis (HP:0000998); no wrinkling skin (-HP:0007392); no scoliosis (-HP:0002650); pectus excavatum (HP:0000767); no dislocated elbows (-HP:0003042); brachydactyly (HP:000156); small nails 5th only;; ;; inguinal hernia; ventricular septal defect; no kidney abnormality (-HP:0000077); recurrent infections (HP:0002719); inguinal hernia (HP:0000023);" "" "" "" "" "" "" "" "" "CSS" "" "" "0000000686" "00156" "00001504" "00074" "Isolated (sporadic)" "06y" "brith 34w+1, weight SD -1.8, OFC 27.3 cm; afwijkend ribskelet (vertaling), bifid xyphoid, hypoplastic midface, coarse facial features, low hairlines, horseshoe kidney; seizures onset 5y, low frequency; spherophakia, optic pits, alacrimia, myopia severe -9D (HP:0011003); no hypotonia; birth feeding problems ongoing; multifocal seizures (HP:0031165); abnormal vision (HP:0000504); hearing loss (HP:0000365); severe speech delay (HP:0000750); severe intellectual disability; normal scalp hair (-HP:0100037); thick eyebrow (HP:0000574); long eyelashes (HP:0000527); delayed gross motor skills (HP:0002194), delayed fine motor skills (HP:0010862); no ptosis (-HP:0000520); no choanal stenosis (-HP:0000452); abnormality nasal bridge (HP:0000422), anteverted nares (HP:0000463), thick alae (HP:0009928); long philtrum (HP:0000343), wide philtrum (HP:0000289); no wide mouth (-HP:0000154); no cleft palate (-HP:0000175); ear abnormality (HP:0000598), no ear tags (-HP:0000384); hypertrichosis (HP:0000998); no wrinkling skin (-HP:0007392); no pectus excavatum (-HP:0000767); no brachydactyly (-HP:000156); small nails 5th only; markedly delayed bone age (HP:0003799), no prominent interphalangeal joints (-HP:0006237); no cone shaped epiphyses (-HP:0010579), hypoplastic phalanges fingers/toes; pyloric hypertrophy; dextrocardia; kidney abnormality (HP:0000077); corpus callosum agenesis partial (HP:0001388), dysgenesis corpus callosum; severe myopia (HP:0011003);" "" "" "" "" "" "" "" "" "CSS" "" "" "0000000687" "00156" "00001505" "00074" "Isolated (sporadic)" "10y" "brith 37w, weight SD -1; Psoriasis, twin brother; myopia severe -18D (HP:0011003); hypotonia; birth feeding problems; no eczema (-HP:0000964); no cutis marmorata (-HP:0000965); no seizures (-HP:0001250); delayed growth (HP:00001510); abnormal vision (HP:0000504); no hearing loss (-HP:0000365); mild-moderate speech delay (HP:0000750); mild-moderate intellectual disability; normal scalp hair (-HP:0100037); thick eyebrow (HP:0000574); normal gross motor skills (-HP:0002194); normal lacrimal duct (-HP:0011481); no ptosis (-HP:0000520); no choanal stenosis (-HP:0000452); abnormality nasal bridge (HP:0000422), no anteverted nares (-HP:0000463); short philtrum (HP:0000322); wide mouth (HP:0000154); thick lower lip vermillion (HP:0000179), thick upper lip vermillion (HP:0000215); no cleft palate (-HP:0000175); normal ears (-HP:0000598), no ear tags (-HP:0000384); hypertrichosis (HP:0000998); no wrinkling skin (-HP:0007392); no scoliosis (-HP:0002650); no pectus excavatum (-HP:0000767); no dislocated elbows (-HP:0003042); partial 5th distal phalanx; no small nails (-HP:0001792); no delayed bone age (-HP:0003799), no prominent interphalangeal joints (-HP:0006237) , no prominent distal phalange, cone shaped epiphyses (HP:0010579), hypoplastic phalanges fingers/toes; no joint laxity (-HP:0001388); no intestinal anomalies (-HP:0002242); no cardiac abnormality (-HP:0001627); no kidney abnormality (-HP:0000077); no recurrent infections (-HP:0002719); MRI brain normal, no agenesis corpus callosum (-HP:0001274); severe myopia (HP:0011003);" "" "" "" "" "" "" "" "" "CSS" "" "" "0000000690" "00156" "00001508" "00074" "Isolated (sporadic)" "03y" "brith 38w, weight SD -2.5, OFC 30 cm; villous atrophy on intestinal biopsy (7m) with no celiac disease antibodies; MRI-brain TAC reported as normal; myopia 2D (HP:0000545); generalized hypotonia; feeding problems 6m; no eczema (-HP:0000964); no seizures (-HP:0001250); delayed growth (HP:00001510); no hearing loss (-HP:0000365); moderate speech delay (HP:0000750); moderate intellectual disability; sparse scalp hair (HP:0002209); thick eyebrow (HP:0000574); long eyelashes (HP:0000527); delayed gross motor skills (HP:0002194), delayed fine motor skills (HP:0010862); abnormality nasal bridge (HP:0000422), anteverted nares (HP:0000463), thick alae (HP:0009928); wide philtrum (HP:0000289); no cleft palate (-HP:0000175); ear abnormality (HP:0000598), no ear tags (-HP:0000384); hypertrichosis (HP:0000998); wrinkling skin (HP:0007392); no scoliosis (-HP:0002650); no pectus excavatum (-HP:0000767); no dislocated elbows (-HP:0003042); no small nails (-HP:0001792); no delayed bone age (-HP:0003799); prominent distal phalanges;; joint laxity (HP:0001388); villous atrophy; no cardiac abnormality (-HP:0001627); no kidney abnormality (-HP:0000077); no recurrent infections (-HP:0002719); myopia (HP:0000545);" "" "" "" "" "" "" "" "" "CSS" "" "" "0000000692" "00156" "00001510" "00074" "Isolated (sporadic)" "04y06m" "no baby teeth lost by 6y; feeding problems 3y; no seizures (-HP:0001250); moderate speech delay (HP:0000750); mild intellectual disability; difficulties with social cues, loving, happy, some problems with processing; no anteverted nares (-HP:0000463); pectus excavatum (HP:0000767); no small patella (-HP:0003065);;; gastro-esophoegal reflux (HP:0002020); no cardiac abnormality (-HP:0001627); no kidney abnormality (-HP:0000077); delayed permanent teeth (HP:0000696); recurrent infections (HP:0002719); MRI brain normal;" "" "" "" "" "" "" "" "" "CSS" "" "" "0000000693" "00156" "00001511" "00074" "Isolated (sporadic)" "09y09m" "brith 37w, weight SD -2.5, OFC SD; haemangioma (in sacral area); death from seizures, status epilepticus; myopia severe -10D (HP:0011003); generalized hypotonia; birth feeding problems ongoing; no eczema (-HP:0000964); seizures (HP:0001250); delayed growth (HP:00001510); severe speech delay (HP:0000750); severe intellectual disability; hyperactivity (HP:0000752); sparse scalp hair (HP:0002209); thick eyebrow (HP:0000574); long eyelashes (HP:0000527); delayed gross motor skills (HP:0002194); ptosis (HP:0000520); no choanal stenosis (-HP:0000452); normal nasal bridge (-HP:0000422), anteverted nares (HP:0000463), thick alae (HP:0009928); long philtrum (HP:0000343), wide philtrum (HP:0000289); wide mouth (HP:0000154); cleft palate (HP:0000175); ear abnormality (HP:0000598), ear tags (HP:0000384); hypertrichosis (HP:0000998); no wrinkling skin (-HP:0007392); pectus excavatum (HP:0000767); no dislocated elbows (-HP:0003042); small patella (HP:0003065); brachydactyly (HP:000156); multiple small nails; prominent interphalangeal joints (HP:0006237), prominent distal phalanges;; joint laxity (HP:0001388); no intestinal anomalies (-HP:0002242); atrial septal defect; no kidney abnormality (-HP:0000077); no recurrent infections (-HP:0002719); corpus callosum agenesis partial (HP:0001388), colpocephaly (HP:0030048), partial agenesis corpus callosum; myopia (HP:0000545);" "" "" "" "" "" "" "" "" "CSS" "" "" "0000000695" "00156" "00001513" "00074" "Isolated (sporadic)" "22y" "brith 38w, weight SD 1, OFC 35.5 cm; Umbilical hernia delayed puberty, menarche > 18Y, irregular menses; MRI-brain 10y multiple hypointense T1 and hyperintense T2 focal lesions in the peritrigonal regions. Enlarged Virchow-Robin spaces, malformation of left hypocampus); seizures TCG and partial motor; seizures onset 2y; hypotonia; no eczema (-HP:0000964); no cutis marmorata (-HP:0000965); seizures (HP:0001250); delayed growth (HP:00001510); no hearing loss (-HP:0000365); moderate speech delay (HP:0000750); moderate-severe intellectual disability; agitatiom, fobias, coprolalia responds to Risperidone; normal scalp hair (-HP:0100037); thick eyebrow (HP:0000574); long eyelashes (HP:0000527); delayed gross motor skills (HP:0002194), delayed fine motor skills (HP:0010862); normal lacrimal duct (-HP:0011481); no ptosis (-HP:0000520); no choanal stenosis (-HP:0000452); abnormality nasal bridge (HP:0000422), anteverted nares (HP:0000463), thick alae (HP:0009928); long philtrum (HP:0000343), wide philtrum (HP:0000289); wide mouth (HP:0000154); thick lower lip vermillion (HP:0000179); no cleft palate (-HP:0000175); ear abnormality (HP:0000598), no ear tags (-HP:0000384); hypertrichosis (HP:0000998); no wrinkling skin (-HP:0007392); no scoliosis (-HP:0002650); no pectus excavatum (-HP:0000767); no dislocated elbows (-HP:0003042); no small patella (-HP:0003065); no brachydactyly (-HP:000156); no absent 5th distal phalanx; small nails 5th only; markedly delayed bone age (HP:0003799), prominent interphalangeal joints (HP:0006237), prominent distal phalanges; no hypoplastic phalanges fingers/toes; joint laxity (HP:0001388); no intestinal anomalies (-HP:0002242); no cardiac abnormality (-HP:0001627); no kidney abnormality (-HP:0000077); no recurrent infections (-HP:0002719); no agenesis corpus callosum (-HP:0001274); myopia (HP:0000545);" "" "" "" "" "" "" "" "" "CSS" "" "" "0000000696" "00156" "00001514" "00074" "Isolated (sporadic)" "20y06m" "brith 40w, weight SD 0.5, OFC SD 0; camptodactyly 5th fingers & 2nd-3rd toes, fan-shaped toes arrangement, sandal gap, short 5th metatarsal, - ,fan-shaped toes arrangement, + (very wide), +; social unripeness; 20y-Ca colli uteri (clear cell adenocarcionoma); generalized hypotonia; birth feeding problems 3y; no eczema (-HP:0000964); no seizures (-HP:0001250); no growth abnormality (-HP:0001507); no hearing loss (-HP:0000365); mild speech delay (HP:0000750); borderline intellectual disability; hyperactivity (HP:0000752); sparse scalp hair (HP:0002209); thick eyebrow (HP:0000574); long eyelashes (HP:0000527); normal gross motor skills (-HP:0002194); ptosis (HP:0000520); no choanal stenosis (-HP:0000452); normal nasal bridge (-HP:0000422), no anteverted nares (-HP:0000463), thick alae (HP:0009928); long philtrum (HP:0000343), wide philtrum (HP:0000289); wide mouth (HP:0000154); no cleft palate (-HP:0000175); ear abnormality (HP:0000598), no ear tags (-HP:0000384); hypertrichosis (HP:0000998); wrinkling skin (HP:0007392); scoliosis (HP:0002650); pectus excavatum (HP:0000767); no dislocated elbows (-HP:0003042); no brachydactyly (-HP:000156); multiple small nails; prominent interphalangeal joints (HP:0006237), prominent distal phalanges; hypoplastic phalanges fingers/toes; joint laxity (HP:0001388); no intestinal anomalies (-HP:0002242); no cardiac abnormality (-HP:0001627); no kidney abnormality (-HP:0000077); no recurrent infections (-HP:0002719); corpus callosum agenesis partial (HP:0001388), colpocephaly (HP:0030048), partial agenesis corpus callosum;" "" "" "" "" "" "" "" "" "CSS" "" "" "0000000697" "00156" "00001515" "00074" "Isolated (sporadic)" "06y03m" "brith 40w, weight SD -1.8, OFC 34 cm; advanced paternal age IVF pregnancy; seizures low frequency; generalized hypotonia; birth feeding problems brief; no eczema (-HP:0000964); no vascular skin abnormality (-HP:0011276); febrile seizures (HP:0002373); no hearing loss (-HP:0000365); mild speech delay (HP:0000750); mild intellectual disability; sparse scalp hair (HP:0002209); abnormal eyebrow (HP:0000534); long eyelashes (HP:0000527); delayed gross motor skills (HP:0002194), delayed fine motor skills (HP:0010862); normal lacrimal duct (-HP:0011481); no ptosis (-HP:0000520); no choanal stenosis (-HP:0000452); abnormality nasal bridge (HP:0000422), anteverted nares (HP:0000463), thick alae (HP:0009928); long philtrum (HP:0000343), wide philtrum (HP:0000289); wide mouth (HP:0000154); no cleft palate (-HP:0000175); ear abnormality (HP:0000598), no ear tags (-HP:0000384); hypertrichosis (HP:0000998); no wrinkling skin (-HP:0007392); no scoliosis (-HP:0002650); no pectus excavatum (-HP:0000767); no dislocated elbows (-HP:0003042); no small patella (-HP:0003065); brachydactyly (HP:000156); no small nails (-HP:0001792); no delayed bone age (-HP:0003799), prominent interphalangeal joints (HP:0006237), prominent distal phalanges, no cone shaped epiphyses (-HP:0010579), no hypoplastic phalanges fingers/toes; no joint laxity (-HP:0001388); no intestinal anomalies (-HP:0002242); no cardiac abnormality (-HP:0001627); no kidney abnormality (-HP:0000077); delayed permanent teeth (HP:0000696); no recurrent infections (-HP:0002719); corpus callosum agenesis (HP:0001274); myopia (HP:0000545);" "" "" "" "" "" "" "" "" "CSS" "" "" "0000000698" "00156" "00001516" "00074" "Isolated (sporadic)" "01y10m" "brith 40w, weight SD -0.5, OFC SD; self mutilation; MRI-brain hypoplasia of occipital lobes,arachnoid cysts; no eczema (-HP:0000964); no growth abnormality (-HP:0001507); no hearing loss (-HP:0000365); moderate intellectual disability; hyperactivity (HP:0000752); sparse scalp hair (HP:0002209); thick eyebrow (HP:0000574); long eyelashes (HP:0000527); no ptosis (-HP:0000520); no choanal stenosis (-HP:0000452); flat (depressed/low) nasal bridge (HP:0005280), no anteverted nares (-HP:0000463); short philtrum (HP:0000322), wide philtrum (HP:0000289); no wide mouth (-HP:0000154); no cleft palate (-HP:0000175); normal ears (-HP:0000598), no ear tags (-HP:0000384); hypertrichosis (HP:0000998); no wrinkling skin (-HP:0007392); no pectus excavatum (-HP:0000767); no dislocated elbows (-HP:0003042); no brachydactyly (-HP:000156); small nails 5th only; no prominent interphalangeal joints (-HP:0006237) , no prominent distal phalange;; no joint laxity (-HP:0001388); no intestinal anomalies (-HP:0002242); no cardiac abnormality (-HP:0001627); no kidney abnormality (-HP:0000077); recurrent infections (HP:0002719); hypermetropia (HP:000540);" "" "" "" "" "" "" "" "" "CSS" "" "" "0000000699" "00156" "00001517" "00074" "Isolated (sporadic)" "12y" "brith 39w, weight SD 0, OFC SD 2; camptodactyly 5th fingers, single palmar crease right, narrow, short feet, + (right), narrow, short,+,+; 10m first primary tooth; MRI-brain pachygyria (frontal lobes); seizures onset 7y, low frequency; no hypotonia; birth feeding problems 3y; no eczema (-HP:0000964); generalized tonic-clonic seizures (HP:0002069); no growth abnormality (-HP:0001507); no hearing loss (-HP:0000365); severe speech delay (HP:0000750); severe intellectual disability; hyperactivity (HP:0000752); sparse scalp hair (HP:0002209); thick eyebrow (HP:0000574); long eyelashes (HP:0000527); delayed gross motor skills (HP:0002194); ptosis (HP:0000520); no choanal stenosis (-HP:0000452); flat (depressed/low) nasal bridge (HP:0005280), anteverted nares (HP:0000463), thick alae (HP:0009928); short philtrum (HP:0000322), wide philtrum (HP:0000289); wide mouth (HP:0000154); no cleft palate (-HP:0000175); ear abnormality (HP:0000598), no ear tags (-HP:0000384); hypertrichosis (HP:0000998); no wrinkling skin (-HP:0007392); scoliosis (HP:0002650); pectus excavatum (HP:0000767); no dislocated elbows (-HP:0003042); no brachydactyly (-HP:000156); multiple small nails; no prominent interphalangeal joints (-HP:0006237) , no prominent distal phalange;; joint laxity (HP:0001388); no intestinal anomalies (-HP:0002242); no cardiac abnormality (-HP:0001627); no kidney abnormality (-HP:0000077); recurrent infections (HP:0002719); strabismus (HP:0000486)" "" "" "" "" "" "" "" "" "CSS" "" "" "0000000701" "00156" "00001519" "00074" "Isolated (sporadic)" "08y09m" "brith 39w+5, weight SD -0.2; Pierre Robin sequence,Microphthalmia,Hypertelorism,Bitemporal narrowing,Asymmetric facies,Short 4th/5th metacarpals hand,Dense aspect metaphysis radius, ulna and femur,Narrow auditory canals,Fetal finger pads,Knee pain,Asymmetric facies,High pain tolerance; tilted papils with surrounding hyperpigmentation, myopia -2.5D (HP:0000545); generalized hypotonia; birth feeding problems 2.5y; no eczema (-HP:0000964); no seizures (-HP:0001250); delayed growth (HP:00001510); severe speech delay (HP:0000750); mild intellectual disability; anxiety (HP:0000739); normal scalp hair (-HP:0100037); normal eyebrow (-HP:0000534); long eyelashes (HP:0000527); delayed gross motor skills (HP:0002194), delayed fine motor skills (HP:0010862); normal lacrimal duct (-HP:0011481); ptosis (HP:0000520); no choanal stenosis (-HP:0000452); flat (depressed/low) nasal bridge (HP:0005280), anteverted nares (HP:0000463), thick alae (HP:0009928); long philtrum (HP:0000343), wide philtrum (HP:0000289); wide mouth (HP:0000154); cleft palate (HP:0000175); ear abnormality (HP:0000598), no ear tags (-HP:0000384); hypertrichosis (HP:0000998); no wrinkling skin (-HP:0007392); no scoliosis (-HP:0002650); no pectus excavatum (-HP:0000767); no dislocated elbows (-HP:0003042); no small patella (-HP:0003065); brachydactyly (HP:000156); small nails 5th only; no prominent interphalangeal joints (-HP:0006237) , no prominent distal phalange, no cone shaped epiphyses (-HP:0010579), no hypoplastic phalanges fingers/toes; joint laxity (HP:0001388); no intestinal anomalies (-HP:0002242); no cardiac abnormality (-HP:0001627); no kidney abnormality (-HP:0000077); delayed permanent teeth (HP:0000696); recurrent infections (HP:0002719); no agenesis corpus callosum (-HP:0001274); myopia (HP:0000545); strabismus (HP:0000486)" "" "" "" "" "" "" "" "" "CSS" "" "" "0000000702" "00156" "00001520" "00074" "Isolated (sporadic)" "06y07m" "brith 37w, weight SD -0.8; Laryngotracheomalacia,Umbilical hernia,Hyperpigmentation axillae and groins; small teeth; photophobia, dysplastic optic discs; <6m-feeding problems 3y; no seizures (-HP:0001250); severe speech delay (HP:0000750); moderate intellectual disability; repetitive movts, hyperphagia from 5y, very dependent on routine, no sense of danger; no anteverted nares (-HP:0000463); long philtrum (HP:0000343), wide philtrum (HP:0000289); no pectus excavatum (-HP:0000767); no small patella (-HP:0003065); brachydactyly (HP:000156);; hypoplastic phalanges fingers/toes; no intestinal anomalies (-HP:0002242); no cardiac abnormality (-HP:0001627); no kidney abnormality (-HP:0000077); MRI brain normal, no agenesis corpus callosum (-HP:0001274);" "" "" "" "" "" "" "" "" "CSS" "" "" "0000000703" "00156" "00001521" "00074" "Isolated (sporadic)" "11y" "brith 40w, weight SD -1.9; Cryptorchidism,Hernia umbilicus; MRI-brain delayed myelinisation; no hypotonia; no eczema (-HP:0000964); no cutis marmorata (-HP:0000965); no seizures (-HP:0001250); no growth abnormality (-HP:0001507); normal vision (-HP:0000504); no hearing loss (-HP:0000365); severe speech delay (HP:0000750); severe intellectual disability; anger outbursts; sparse scalp hair (HP:0002209); thick eyebrow (HP:0000574); long eyelashes (HP:0000527); delayed gross motor skills (HP:0002194); normal lacrimal duct (-HP:0011481); ptosis (HP:0000520); no choanal stenosis (-HP:0000452); normal nasal bridge (-HP:0000422), anteverted nares (HP:0000463), thick alae (HP:0009928); wide philtrum (HP:0000289); wide mouth (HP:0000154); thick lower lip vermillion (HP:0000179); no cleft palate (-HP:0000175); ear abnormality (HP:0000598), no ear tags (-HP:0000384); no hypertrichosis (-HP:0000998); no wrinkling skin (-HP:0007392); no scoliosis (-HP:0002650); no pectus excavatum (-HP:0000767); no dislocated elbows (-HP:0003042); no small patella (-HP:0003065); no brachydactyly (-HP:000156); absent 5th distal phalanx; multiple small nails (incl. 5th);; ; hypoplastic phalanges fingers/toes; no intestinal anomalies (-HP:0002242); no cardiac abnormality (-HP:0001627); no kidney abnormality (-HP:0000077); recurrent infections (HP:0002719); no agenesis corpus callosum (-HP:0001274);" "" "" "" "" "" "" "" "" "CSS" "" "" "0000000706" "00156" "00001524" "00074" "Isolated (sporadic)" "11y" "brith 40w, weight SD -0.8; MRI-brain Mild delayed myelinisation; generalized hypotonia; birth feeding problems; no eczema (-HP:0000964); no vascular skin abnormality (-HP:0011276); no seizures (-HP:0001250); delayed growth (HP:00001510); no hearing loss (-HP:0000365); moderate speech delay (HP:0000750); moderate intellectual disability; autism (HP:0000717); sparse scalp hair (HP:0002209); thick eyebrow (HP:0000574); long eyelashes (HP:0000527); delayed gross motor skills (HP:0002194), delayed fine motor skills (HP:0010862); normal lacrimal duct (-HP:0011481); no ptosis (-HP:0000520); no choanal stenosis (-HP:0000452); normal nasal bridge (-HP:0000422), anteverted nares (HP:0000463), thick alae (HP:0009928); long philtrum (HP:0000343), wide philtrum (HP:0000289); wide mouth (HP:0000154); no cleft palate (-HP:0000175); normal ears (-HP:0000598), no ear tags (-HP:0000384); hypertrichosis (HP:0000998); no wrinkling skin (-HP:0007392); no scoliosis (-HP:0002650); no pectus excavatum (-HP:0000767); no dislocated elbows (-HP:0003042); no small patella (-HP:0003065); no brachydactyly (-HP:000156); small nails 5th only; no delayed bone age (-HP:0003799), no prominent interphalangeal joints (-HP:0006237) , no prominent distal phalange, no cone shaped epiphyses (-HP:0010579), hypoplastic phalanges fingers/toes; joint laxity (HP:0001388); constipation; mild mitral valve insufficiency; no kidney abnormality (-HP:0000077); delayed permanent teeth (HP:0000696); recurrent infections (HP:0002719); no agenesis corpus callosum (-HP:0001274);" "" "" "" "" "" "" "" "" "CSS" "" "" "0000000707" "00156" "00001525" "00074" "Isolated (sporadic)" "05y06m" "hyperpigmented macule left shoulder, tight hip flexors with mild spasticity. Truncal hypotonia; seizures onset 2y, 2 per month; hypotonia; no eczema (-HP:0000964); no cutis marmorata (-HP:0000965); focal seizures (HP:0007359); no growth abnormality (-HP:0001507); no hearing loss (-HP:0000365); apneas secondary to tonsil and adnoid hypertrophy; moderate speech delay (HP:0000750); moderate intellectual disability; normal behaviour (-HP:0000708); sparse scalp hair (HP:0002209); normal eyebrow (-HP:0000534); delayed gross motor skills (HP:0002194), delayed fine motor skills (HP:0010862); normal lacrimal duct (-HP:0011481); no ptosis (-HP:0000520); no choanal stenosis (-HP:0000452); normal nasal bridge (-HP:0000422), anteverted nares (HP:0000463); long philtrum (HP:0000343), wide philtrum (HP:0000289); wide mouth (HP:0000154); thick lower lip vermillion (HP:0000179); no cleft palate (-HP:0000175); normal ears (-HP:0000598), no ear tags (-HP:0000384); no hypertrichosis (-HP:0000998); no scoliosis (-HP:0002650); no pectus excavatum (-HP:0000767); no dislocated elbows (-HP:0003042); no small patella (-HP:0003065); no brachydactyly (-HP:000156); no absent 5th distal phalanx; no small nails (-HP:0001792); no prominent interphalangeal joints (-HP:0006237) , no prominent distal phalange, no cone shaped epiphyses (-HP:0010579); joint laxity (HP:0001388); no intestinal anomalies (-HP:0002242); no cardiac abnormality (-HP:0001627); no kidney abnormality (-HP:0000077); no recurrent infections (-HP:0002719); MRI brain normal, no agenesis corpus callosum (-HP:0001274);" "" "" "" "" "" "" "" "" "CSS" "" "" "0000000708" "00156" "00001526" "00074" "Isolated (sporadic)" "10y" "brith 40w, weight SD 0; no seizures (-HP:0001250); severe speech delay (HP:0000750); severe intellectual disability; friendly personality; anteverted nares (HP:0000463); small nails (HP:0001792); markedly delayed bone age (HP:0003799);; ; joint laxity (HP:0001388); congenital hirschprung disease; no cardiac abnormality (-HP:0001627); corpus callosum agenesis (HP:0001274);" "" "" "" "" "" "" "" "" "CSS" "" "" "0000000711" "00156" "00001529" "00074" "Isolated (sporadic)" "10y11m" "brith 38w, weight SD -3, microcephaly; neonatal breathing diffiuclites, gastroesophageal reflux, fundoplication, chronic lung disease and bronchiectasis and lots of respiratory secretions, with secondary pulmonary hypertension, Oxygen dependent,Cryporchidism,Pubic hair since age 6y,Nasal obstruction, bilateral coax vara, no crying, dry fragile skin in infancy, asthma/hayfever, gynaecomastia, brachycephaly, thick guns, small down-slanting palpebral fissures, small chin, prominent fetal finger pads when younger, optic nerve hypoplasia; seizures onset 10y; anisometropic amblyopia, nr optic nerve hypoplasia (too unwell to be investigated); generalized hypotonia; birth feeding problems ongoing; no eczema (-HP:0000964); no vascular skin abnormality (-HP:0011276); seizures (HP:0001250); delayed growth (HP:00001510); no hearing loss (-HP:0000365); severe speech delay (HP:0000750); severe intellectual disability; sparse scalp hair (HP:0002209); thick eyebrow (HP:0000574); long eyelashes (HP:0000527); delayed gross motor skills (HP:0002194), delayed fine motor skills (HP:0010862); normal lacrimal duct (-HP:0011481); ptosis (HP:0000520); no choanal stenosis (-HP:0000452); flat (depressed/low) nasal bridge (HP:0005280), anteverted nares (HP:0000463), thick alae (HP:0009928); wide philtrum (HP:0000289); wide mouth (HP:0000154); no cleft palate (-HP:0000175); ear abnormality (HP:0000598), no ear tags (-HP:0000384); hypertrichosis (HP:0000998); no wrinkling skin (-HP:0007392); scoliosis (HP:0002650); no pectus excavatum (-HP:0000767); no brachydactyly (-HP:000156); multiple small nails; no prominent interphalangeal joints (-HP:0006237) , prominent distal phalanges; hypoplastic phalanges fingers/toes; joint laxity (HP:0001388); pyloric stenosis and inguinal hernia; dextrocardia; no kidney abnormality (-HP:0000077); delayed permanent teeth (HP:0000696); recurrent infections (HP:0002719); corpus callosum hypoplasia (HP:0002079), partial agenesis corpus callosum; pyloric stenosis (HP:0002021); inguinal hernia (HP:0000023); myopia (HP:0000545);" "" "" "" "" "" "" "" "" "CSS" "" "" "0000000712" "00156" "00001530" "00074" "Isolated (sporadic)" "09y01m" "brith 37w, weight SD -1.2; high pain threshold, pulls out hair; laryngomalacia, 3-4 café-au-lait patches, sacral dimple, right single plamer crease, tongue tie, cold hands and feet, optic nerve hypoplasia; seizures onset 3y; optic nerve hypoplasia; generalized hypotonia; birth feeding problems ongoing; eczema (HP:0000964); no vascular skin abnormality (-HP:0011276); generalized tonic-clonic seizures (HP:0002069); delayed growth (HP:00001510); no hearing loss (-HP:0000365), sensitive hearing; severe speech delay (HP:0000750); severe intellectual disability; autism (HP:0000717); normal scalp hair (-HP:0100037); thick eyebrow (HP:0000574); long eyelashes (HP:0000527); delayed gross motor skills (HP:0002194), delayed fine motor skills (HP:0010862); no ptosis (-HP:0000520); no choanal stenosis (-HP:0000452); flat (depressed/low) nasal bridge (HP:0005280), anteverted nares (HP:0000463), thick alae (HP:0009928); long philtrum (HP:0000343), wide philtrum (HP:0000289); wide mouth (HP:0000154); no cleft palate (-HP:0000175); ear abnormality (HP:0000598), no ear tags (-HP:0000384); hypertrichosis (HP:0000998); no wrinkling skin (-HP:0007392); scoliosis (HP:0002650); pectus excavatum (HP:0000767); no dislocated elbows (-HP:0003042); no small patella (-HP:0003065); brachydactyly (HP:000156); multiple small nails; no prominent interphalangeal joints (-HP:0006237) , no prominent distal phalange, cone shaped epiphyses (HP:0010579), hypoplastic phalanges fingers/toes; joint laxity (HP:0001388); no intestinal anomalies (-HP:0002242); no cardiac abnormality (-HP:0001627); no kidney abnormality (-HP:0000077); recurrent infections (HP:0002719); corpus callosum agenesis (HP:0001274), colpocephaly (HP:0030048), Dandy-Walker malformation (HP:0001305), agenesis corpus callosum (HP:0001274); umbilical hernia (HP:0001537); astigmatism (HP:0000483);" "" "" "" "" "" "" "" "" "CSS" "" "" "0000000713" "00156" "00001531" "00074" "Isolated (sporadic)" "24y" "brith 41w, weight SD -2; Central Obestity and thin limbs,Diabetes mellitus and Hypertension,Died suddenly, renal absesses,Cryptorchidism,Pes planus,Long columella,Laryngomalacia,Incomplete puberty,Constipation,High pain threshold,Gynaecomatsia,Prognathia,Lots moles; hypotonia; birth feeding problems 2y; no eczema (-HP:0000964); no cutis marmorata (-HP:0000965); no seizures (-HP:0001250); delayed growth (HP:00001510); abnormal vision (HP:0000504); bilateral hearing loss (HP:0000365); severe speech delay (HP:0000750); severe intellectual disability; likes routine, poor eye contact, poor sleep; sparse scalp hair (HP:0002209); thick eyebrow (HP:0000574); long eyelashes (HP:0000527); normal gross motor skills (-HP:0002194), delayed fine motor skills (HP:0010862); normal lacrimal duct (-HP:0011481); no ptosis (-HP:0000520); no choanal stenosis (-HP:0000452); normal nasal bridge (-HP:0000422), no anteverted nares (-HP:0000463), thick alae (HP:0009928); short philtrum (HP:0000322), wide philtrum (HP:0000289); wide mouth (HP:0000154); thick lower lip vermillion (HP:0000179), thick upper lip vermillion (HP:0000215); no cleft palate (-HP:0000175); normal ears (-HP:0000598), no ear tags (-HP:0000384); hypertrichosis (HP:0000998); no wrinkling skin (-HP:0007392); scoliosis (HP:0002650); no pectus excavatum (-HP:0000767); no brachydactyly (-HP:000156); small nails 5th only; prominent interphalangeal joints (HP:0006237), prominent distal phalanges;; joint laxity (HP:0001388); no intestinal anomalies (-HP:0002242); no cardiac abnormality (-HP:0001627); no kidney abnormality (-HP:0000077); delayed permanent teeth (HP:0000696); recurrent infections (HP:0002719); MRI brain normal, no agenesis corpus callosum (-HP:0001274); strabismus (HP:0000486)" "" "" "" "" "" "" "" "" "CSS" "" "" "0000000714" "00156" "00001532" "00074" "Isolated (sporadic)" "06y06m" "brith 40w+5, weight SD -1; hypopigmented patch, triangular face, pointed chin, mild knee contractures, broad thumbs/halluces, squared off fingers/toes, tight Achilles, excitable, short concentration; normal vision; no hypotonia; birth feeding problems ongoing; no eczema (-HP:0000964); no vascular skin abnormality (-HP:0011276); febrile seizures (HP:0002373); delayed growth (HP:00001510); no hearing loss (-HP:0000365); glue ear; severe speech delay (HP:0000750); severe intellectual disability; hyperactivity (HP:0000752); sparse scalp hair (HP:0002209); thick eyebrow (HP:0000574); long eyelashes (HP:0000527); normal gross motor skills (-HP:0002194), delayed fine motor skills (HP:0010862); no ptosis (-HP:0000520); no choanal stenosis (-HP:0000452); flat (depressed/low) nasal bridge (HP:0005280), no anteverted nares (-HP:0000463), thick alae (HP:0009928); wide philtrum (HP:0000289); wide mouth (HP:0000154); no cleft palate (-HP:0000175); ear abnormality (HP:0000598), no ear tags (-HP:0000384); hypertrichosis (HP:0000998); no wrinkling skin (-HP:0007392); no scoliosis (-HP:0002650); no pectus excavatum (-HP:0000767); no dislocated elbows (-HP:0003042); no brachydactyly (-HP:000156); no small nails (-HP:0001792); accelerated bone age (HP:0002805), no prominent interphalangeal joints (-HP:0006237) , no prominent distal phalange, no cone shaped epiphyses (-HP:0010579), no hypoplastic phalanges fingers/toes; no joint laxity (-HP:0001388); no intestinal anomalies (-HP:0002242); atrial septal defect; no kidney abnormality (-HP:0000077); recurrent infections (HP:0002719); MRI brain normal, no agenesis corpus callosum (-HP:0001274);" "" "" "" "" "" "" "" "" "CSS" "" "" "0000000715" "00156" "00001533" "00074" "Isolated (sporadic)" "09y" "brith 41w, weight SD 1; mid face hypoplasia, hypertelorism, dental decay, mild lumbar lordosis, Shoret halluces, GOR, constipation; episodes of eye rolling; birth feeding problems; glue ear; mild speech delay (HP:0000750); mild intellectual disability; lashes out, poor sleep; anteverted nares (HP:0000463); long philtrum (HP:0000343); no pectus excavatum (-HP:0000767); no small patella (-HP:0003065); brachydactyly (HP:000156); markedly delayed bone age (HP:0003799); no cone shaped epiphyses (-HP:0010579), no hypoplastic phalanges fingers/toes; no intestinal anomalies (-HP:0002242); recurrent infections (HP:0002719); MRI brain normal;" "" "" "" "" "" "" "" "" "CSS" "" "" "0000000716" "00156" "00001534" "00074" "Isolated (sporadic)" "12y01m" "brith 36w+1, weight SD -1; Ataxia and involuntary movement,Joint contractures at birth,Laryngomalacia,Tongue tie,Constipation,No crying when hurt,Early breast development,2 blind ending sacral pits,Pes planvalgus,Down slanting palpebral fissures,Stiff ankles,Long straight nose,Tuberculosis age 1.5y; hypotonia; birth feeding problems; eczema (HP:0000964); no cutis marmorata (-HP:0000965); no seizures (-HP:0001250); delayed growth (HP:00001510); normal vision (-HP:0000504); no hearing loss (-HP:0000365); moderate speech delay (HP:0000750); moderate intellectual disability; picks nails, some obsessive behaviours; normal scalp hair (-HP:0100037); thick eyebrow (HP:0000574); delayed gross motor skills (HP:0002194), delayed fine motor skills (HP:0010862); normal lacrimal duct (-HP:0011481); ptosis (HP:0000520); no choanal stenosis (-HP:0000452); normal nasal bridge (-HP:0000422), anteverted nares (HP:0000463), thick alae (HP:0009928); long philtrum (HP:0000343), wide philtrum (HP:0000289); wide mouth (HP:0000154); no cleft palate (-HP:0000175); normal ears (-HP:0000598), no ear tags (-HP:0000384); hypertrichosis (HP:0000998); no wrinkling skin (-HP:0007392); scoliosis (HP:0002650); no pectus excavatum (-HP:0000767); no brachydactyly (-HP:000156); hypoplastic 5th distal phalanx; small nails 5th only; no prominent interphalangeal joints (-HP:0006237) , no prominent distal phalange; hypoplastic phalanges fingers/toes; joint laxity (HP:0001388); inguinal hernia; no cardiac abnormality (-HP:0001627); no kidney abnormality (-HP:0000077); delayed permanent teeth (HP:0000696); recurrent infections (HP:0002719); corpus callosum abnormality (HP:001273), partial agenesis corpus callosum; inguinal hernia (HP:0000023);" "" "" "" "" "" "" "" "" "CSS" "" "" "0000000717" "00156" "00001535" "00074" "Isolated (sporadic)" "13y04m" "brith 39w, weight SD -1.3, OFC 49 cm; tantrums, long hands and feet,Sacral dimple,Stridor in first week,Extra front tooth,Enlarged labia,Gluten sensitivity,Lactose intolerance,Sllep difficulties,Plaigocephaly,Brachycephaly,Bulbous nasal tip,Long nose,Pointed chin; sensitive to light; generalized hypotonia; birth feeding problems; eczema (HP:0000964); no vascular skin abnormality (-HP:0011276); no seizures (-HP:0001250); delayed growth (HP:00001510); no hearing loss (-HP:0000365); moderate speech delay (HP:0000750); moderate-severe intellectual disability; autism (HP:0000717); sparse scalp hair (HP:0002209); thick eyebrow (HP:0000574); long eyelashes (HP:0000527); delayed gross motor skills (HP:0002194), delayed fine motor skills (HP:0010862); normal lacrimal duct (-HP:0011481); no ptosis (-HP:0000520); no choanal stenosis (-HP:0000452); normal nasal bridge (-HP:0000422), no anteverted nares (-HP:0000463), thick alae (HP:0009928); normal philtrum (-HP:0000288); wide mouth (HP:0000154); no cleft palate (-HP:0000175); ear abnormality (HP:0000598), no ear tags (-HP:0000384); hypertrichosis (HP:0000998); no wrinkling skin (-HP:0007392); scoliosis (HP:0002650); pectus excavatum (HP:0000767); no brachydactyly (-HP:000156); no small nails (-HP:0001792); markedly delayed bone age (HP:0003799), prominent interphalangeal joints (HP:0006237), prominent distal phalanges;; joint laxity (HP:0001388); umbilical hernia; no cardiac abnormality (-HP:0001627); no kidney abnormality (-HP:0000077); MRI brain normal;" "" "" "" "" "" "" "" "" "CSS" "" "" "0000000718" "00156" "00001536" "00074" "Isolated (sporadic)" "06y11m" "brith 39w, weight SD 0; Pointed chin,Strawberry naevus,Droolinmg,Night seats,Cold hands and feet,Tires easily; hypotonia; birth feeding problems ongoing; eczema (HP:0000964); no cutis marmorata (-HP:0000965); no seizures (-HP:0001250); no growth abnormality (-HP:0001507); abnormal vision (HP:0000504); no hearing loss (-HP:0000365); severe speech delay (HP:0000750); severe intellectual disability; panic attacks, difficult to manage; sparse scalp hair (HP:0002209); normal eyebrow (-HP:0000534); long eyelashes (HP:0000527); normal gross motor skills (-HP:0002194), delayed fine motor skills (HP:0010862); no ptosis (-HP:0000520); no choanal stenosis (-HP:0000452); abnormality nasal bridge (HP:0000422), anteverted nares (HP:0000463), thick alae (HP:0009928); long philtrum (HP:0000343), wide philtrum (HP:0000289); wide mouth (HP:0000154); thick lower lip vermillion (HP:0000179); no cleft palate (-HP:0000175); ear abnormality (HP:0000598), no ear tags (-HP:0000384); hypertrichosis (HP:0000998); no wrinkling skin (-HP:0007392); no scoliosis (-HP:0002650); no pectus excavatum (-HP:0000767); no dislocated elbows (-HP:0003042); no brachydactyly (-HP:000156); no absent 5th distal phalanx; small nails 5th only; no prominent interphalangeal joints (-HP:0006237) , no prominent distal phalange, no cone shaped epiphyses (-HP:0010579); joint laxity (HP:0001388); no intestinal anomalies (-HP:0002242); no cardiac abnormality (-HP:0001627); recurrent infections (HP:0002719); corpus callosum hypoplasia (HP:0002079), partial agenesis corpus callosum; strabismus (HP:0000486)" "" "" "" "" "" "" "" "" "CSS" "" "" "0000000719" "00156" "00001537" "00074" "Isolated (sporadic)" "17y" "brith 40w, weight SD 2.3; short neck, small teeth with gaps, hypopigmented patch, small hands and feet, long fingers, minor leg length discrepancy, no axilliary hair, constipation, high pain threshold; delayed visual maturation; generalized hypotonia; no eczema (-HP:0000964); no vascular skin abnormality (-HP:0011276); no seizures (-HP:0001250); no growth abnormality (-HP:0001507); no hearing loss (-HP:0000365); glue ear, sensitive to sounds; severe speech delay (HP:0000750); severe intellectual disability; anxiety (HP:0000739), autism (HP:0000717); normal scalp hair (-HP:0100037); normal eyebrow (-HP:0000534); long eyelashes (HP:0000527); delayed gross motor skills (HP:0002194), delayed fine motor skills (HP:0010862); no ptosis (-HP:0000520); choanal stenosis (HP:0000452); flat (depressed/low) nasal bridge (HP:0005280), no anteverted nares (-HP:0000463), thick alae (HP:0009928); normal philtrum (-HP:0000288); wide mouth (HP:0000154); no cleft palate (-HP:0000175); normal ears (-HP:0000598), no ear tags (-HP:0000384); hypertrichosis (HP:0000998); no wrinkling skin (-HP:0007392); scoliosis (HP:0002650); no pectus excavatum (-HP:0000767); no dislocated elbows (-HP:0003042); no small patella (-HP:0003065); no brachydactyly (-HP:000156); no small nails (-HP:0001792); markedly delayed bone age (HP:0003799), no prominent interphalangeal joints (-HP:0006237) , no prominent distal phalange, no cone shaped epiphyses (-HP:0010579), no hypoplastic phalanges fingers/toes; joint laxity (HP:0001388); no intestinal anomalies (-HP:0002242); no cardiac abnormality (-HP:0001627); recurrent infections (HP:0002719); MRI brain normal, no agenesis corpus callosum (-HP:0001274); umbilical hernia (HP:0001537); strabismus (HP:0000486), nystagmus (HP:0000639)" "" "" "" "" "" "" "" "" "CSS" "" "" "0000000720" "00156" "00001538" "00074" "Isolated (sporadic)" "04y11m" "brith 39w, weight SD -1.3; Mirror movements,Ridged palate,Down-slanting palpebral fissures,Plaigocephaly,Gaps in lower teeth,Sloping shoulders,Prominent sternum,Cryptorchidism,No crying,Gastroesophageal reflux,Laryngomalacia,Lactose intolerance,Poor facial expression,Pes planus,Prominent heels,Long halluces; hypotonia; birth feeding problems ongoing; no eczema (-HP:0000964); no cutis marmorata (-HP:0000965); no seizures (-HP:0001250); normal vision (-HP:0000504); no hearing loss (-HP:0000365); moderate speech delay (HP:0000750); severe intellectual disability; poor danger awareness, short attention span; normal scalp hair (-HP:0100037); normal eyebrow (-HP:0000534); long eyelashes (HP:0000527); delayed gross motor skills (HP:0002194), delayed fine motor skills (HP:0010862); ptosis (HP:0000520); no choanal stenosis (-HP:0000452); abnormality nasal bridge (HP:0000422), no anteverted nares (-HP:0000463); long philtrum (HP:0000343); wide mouth (HP:0000154); thick lower lip vermillion (HP:0000179); no cleft palate (-HP:0000175); ear abnormality (HP:0000598), no ear tags (-HP:0000384); hypertrichosis (HP:0000998); no wrinkling skin (-HP:0007392); no pectus excavatum (-HP:0000767); no dislocated elbows (-HP:0003042); no brachydactyly (-HP:000156); small nails 5th only; no prominent interphalangeal joints (-HP:0006237) , no prominent distal phalange;; joint laxity (HP:0001388); pyloric stenosis; no cardiac abnormality (-HP:0001627); mild calyceal fullness kidney; recurrent infections (HP:0002719); corpus callosum agenesis partial (HP:0001388), Dandy-Walker malformation (HP:0001305), partial agenesis corpus callosum; pyloric stenosis (HP:0002021);" "" "" "" "" "" "" "" "" "CSS" "" "" "0000000723" "00156" "00001541" "00074" "Isolated (sporadic)" "15y" "brith 42w, weight SD -3; Tracheomalacia in infancy; birth feeding problems; no seizures (-HP:0001250); mild speech delay (HP:0000750); moderate intellectual disability; normal behaviour (-HP:0000708); anteverted nares (HP:0000463); long philtrum (HP:0000343), wide philtrum (HP:0000289); no pectus excavatum (-HP:0000767); no small patella (-HP:0003065); brachydactyly (HP:000156); no delayed bone age (-HP:0003799); no cone shaped epiphyses (-HP:0010579), no hypoplastic phalanges fingers/toes; no intestinal anomalies (-HP:0002242); no cardiac abnormality (-HP:0001627); no kidney abnormality (-HP:0000077); no recurrent infections (-HP:0002719); no agenesis corpus callosum (-HP:0001274); myopia (HP:0000545);" "" "" "" "" "" "" "" "" "CSS" "" "" "0000000724" "00156" "00001542" "00074" "Isolated (sporadic)" "04y" "brith 42w, weight SD -1.2; myopia -4.5D (HP:0000545); hypotonia; birth feeding problems; no eczema (-HP:0000964); no cutis marmorata (-HP:0000965); no seizures (-HP:0001250); delayed growth (HP:00001510); abnormal vision (HP:0000504); no hearing loss (-HP:0000365); mild-moderate speech delay (HP:0000750); moderate intellectual disability; normal behaviour (-HP:0000708); sparse scalp hair (HP:0002209); thick eyebrow (HP:0000574); long eyelashes (HP:0000527); delayed gross motor skills (HP:0002194), delayed fine motor skills (HP:0010862); normal lacrimal duct (-HP:0011481); ptosis (HP:0000520); no choanal stenosis (-HP:0000452); abnormality nasal bridge (HP:0000422), anteverted nares (HP:0000463), thick alae (HP:0009928); long philtrum (HP:0000343), wide philtrum (HP:0000289); wide mouth (HP:0000154); thick lower lip vermillion (HP:0000179); no cleft palate (-HP:0000175); normal ears (-HP:0000598), no ear tags (-HP:0000384); hypertrichosis (HP:0000998); no wrinkling skin (-HP:0007392); no scoliosis (-HP:0002650); no pectus excavatum (-HP:0000767); no dislocated elbows (-HP:0003042); no small patella (-HP:0003065); brachydactyly (HP:000156); no absent 5th distal phalanx; small nails 5th only; no delayed bone age (-HP:0003799), no prominent interphalangeal joints (-HP:0006237) , no prominent distal phalange, cone shaped epiphyses (HP:0010579), no hypoplastic phalanges fingers/toes; joint laxity (HP:0001388); no intestinal anomalies (-HP:0002242); no cardiac abnormality (-HP:0001627); no kidney abnormality (-HP:0000077); recurrent infections (HP:0002719); no agenesis corpus callosum (-HP:0001274); myopia (HP:0000545);" "" "" "" "" "" "" "" "" "CSS" "" "" "0000000726" "00156" "00001544" "00074" "Isolated (sporadic)" "10y" "brith post term, weight SD 1; hair microscopy normal,Rarely sweats,Never had nails cut.,Reduced subcutaneous fat,Fetal pads,Long toes with bulbous tips,Coarse face; MRI-brain Increased perivascular spaces; seizures, initially just loss of consciousness, 2y6m 1st generalised tonic-clonic seizure; seizures onset 2y, 1 per 2m; no hypotonia; no eczema (-HP:0000964); no cutis marmorata (-HP:0000965); seizures (HP:0001250), generalized tonic-clonic seizures (HP:0002069); normal vision (-HP:0000504); no hearing loss (-HP:0000365); severe speech delay (HP:0000750); moderate-severe intellectual disability; active, tries to escape, erratic, no sense of danger, 8y-eating excessively, sleeps little, 10y-obsessive, does not like clothes; sparse scalp hair (HP:0002209); thick eyebrow (HP:0000574); long eyelashes (HP:0000527); delayed gross motor skills (HP:0002194); no ptosis (-HP:0000520); no choanal stenosis (-HP:0000452); normal nasal bridge (-HP:0000422), anteverted nares (HP:0000463), thick alae (HP:0009928); long philtrum (HP:0000343); wide mouth (HP:0000154); thick lower lip vermillion (HP:0000179); no cleft palate (-HP:0000175); ear abnormality (HP:0000598), no ear tags (-HP:0000384); hypertrichosis (HP:0000998); no wrinkling skin (-HP:0007392); no scoliosis (-HP:0002650); no pectus excavatum (-HP:0000767); no dislocated elbows (-HP:0003042); no brachydactyly (-HP:000156); no absent 5th distal phalanx; no small nails (-HP:0001792); prominent interphalangeal joints (HP:0006237), no prominent distal phalange, no cone shaped epiphyses (-HP:0010579), no hypoplastic phalanges fingers/toes; no joint laxity (-HP:0001388); diarrhoea,umbilical hernia; no cardiac abnormality (-HP:0001627); no kidney abnormality (-HP:0000077); no agenesis corpus callosum (-HP:0001274);" "" "" "" "" "" "" "" "" "CSS" "" "" "0000000727" "00156" "00001545" "00074" "Isolated (sporadic)" "06y" "brith 38w, weight SD -2.3, OFC 31.8 cm (9th centile); Hair microscopy normal, short anagen cycle,Sensitive to the sun. reduced sweating. Overheats.,Skin biopsy normal ie not cockayne,Reduced subcutaneous fat,Family history of x-linked ichthyosis,STS normal,Fetal pads on feet,Long fingers and toes,Red palms,Coarse face,EEG normal / west syndrome; one fused canine; MRI-brain Normal / reduced white matter / immature myelin; seizures onset 9m; generalized tonic-clonic seizures (HP:0002069); severe speech delay (HP:0000750); moderate intellectual disability; stubborn; anteverted nares (HP:0000463); wide philtrum (HP:0000289); no pectus excavatum (-HP:0000767); no brachydactyly (-HP:000156);; no hypoplastic phalanges fingers/toes; constipation; no cardiac abnormality (-HP:0001627); no kidney abnormality (-HP:0000077); recurrent infections (HP:0002719); no agenesis corpus callosum (-HP:0001274); astigmatism (HP:0000483);" "" "" "" "" "" "" "" "" "CSS" "" "" "0000000728" "00156" "00001546" "00074" "Isolated (sporadic)" "13y" "brith 38w, weight SD -0.3, OFC 34 cm; myopia severe -11D (HP:0011003); hypotonia; birth feeding problems brief; no eczema (-HP:0000964); no cutis marmorata (-HP:0000965); no seizures (-HP:0001250); no growth abnormality (-HP:0001507); abnormal vision (HP:0000504); no hearing loss (-HP:0000365); mild speech delay (HP:0000750); moderate intellectual disability; hypersociablility; normal scalp hair (-HP:0100037); thick eyebrow (HP:0000574); long eyelashes (HP:0000527); delayed gross motor skills (HP:0002194), normal fine motor skills (-HP:0010862); abnormal lacrimal duct (HP:0011481); no ptosis (-HP:0000520); no choanal stenosis (-HP:0000452); normal nasal bridge (-HP:0000422), no anteverted nares (-HP:0000463), thick alae (HP:0009928); long philtrum (HP:0000343), wide philtrum (HP:0000289); wide mouth (HP:0000154); thick lower lip vermillion (HP:0000179); no cleft palate (-HP:0000175); ear abnormality (HP:0000598), no ear tags (-HP:0000384); hypertrichosis (HP:0000998); no wrinkling skin (-HP:0007392); no scoliosis (-HP:0002650); no pectus excavatum (-HP:0000767); no dislocated elbows (-HP:0003042); small patella (HP:0003065); hypoplastic 5th distal phalanx; small nails 5th only;; ; hypoplastic phalanges fingers/toes; partial agenesis corpus callosum; severe myopia (HP:0011003);" "" "" "" "" "" "" "" "" "CSS" "" "" "0000000731" "00156" "00001549" "00074" "Isolated (sporadic)" "04y" "brith 38w/40w, weight SD -0.5; slight squint; hypotonia; no cutis marmorata (-HP:0000965); no seizures (-HP:0001250); no growth abnormality (-HP:0001507); abnormal vision (HP:0000504); no hearing loss (-HP:0000365); moderate speech delay (HP:0000750); moderate intellectual disability; tantrums, aggressive outbursts, difficulty socialising; sparse scalp hair (HP:0002209); thick eyebrow (HP:0000574); long eyelashes (HP:0000527); delayed gross motor skills (HP:0002194), delayed fine motor skills (HP:0010862); no choanal stenosis (-HP:0000452); normal nasal bridge (-HP:0000422), no anteverted nares (-HP:0000463), thick alae (HP:0009928); thick lower lip vermillion (HP:0000179); no cleft palate (-HP:0000175); normal ears (-HP:0000598), no ear tags (-HP:0000384); hypertrichosis (HP:0000998); no wrinkling skin (-HP:0007392); no scoliosis (-HP:0002650); pectus carinatum; no dislocated elbows (-HP:0003042); no small patella (-HP:0003065); brachydactyly (HP:000156); no absent 5th distal phalanx; multiple small nails (incl. 5th); no prominent interphalangeal joints (-HP:0006237);; joint laxity (HP:0001388); no intestinal anomalies (-HP:0002242); no cardiac abnormality (-HP:0001627); no kidney abnormality (-HP:0000077); recurrent infections (HP:0002719); MRI brain normal; myopia (HP:0000545); strabismus (HP:0000486)" "" "" "" "" "" "" "" "" "CSS" "" "" "0000000740" "00156" "00001558" "00074" "Isolated (sporadic)" "04y" "brith 41w, weight SD 0.2, OFC 36 cm; high narrow palate, two café au lait spots (2x1 cm) on trunk; generalized hypotonia; birth feeding problems; no eczema (-HP:0000964); no vascular skin abnormality (-HP:0011276); no seizures (-HP:0001250); no growth abnormality (-HP:0001507); no hearing loss (-HP:0000365); severe speech delay (HP:0000750); severe intellectual disability; attention span short;hyperactivity; sparse scalp hair (HP:0002209); normal eyebrow (-HP:0000534); long eyelashes (HP:0000527); delayed gross motor skills (HP:0002194); normal lacrimal duct (-HP:0011481); no ptosis (-HP:0000520); no choanal stenosis (-HP:0000452); normal nasal bridge (-HP:0000422), no anteverted nares (-HP:0000463), thick alae (HP:0009928); long philtrum (HP:0000343); no wide mouth (-HP:0000154); no cleft palate (-HP:0000175); ear abnormality (HP:0000598), no ear tags (-HP:0000384); hypertrichosis (HP:0000998); no wrinkling skin (-HP:0007392); pectus excavatum (HP:0000767); brachydactyly (HP:000156); multiple small nails; prominent interphalangeal joints (HP:0006237), no prominent distal phalange;; no intestinal anomalies (-HP:0002242); ventricular septal defect; no kidney abnormality (-HP:0000077);" "" "" "" "" "" "" "" "" "CSS" "" "" "0000037011" "00198" "00050399" "00006" "Isolated (sporadic)" "" "flat forehead, abnormality of the eye, prominent nasal bridge, flat forehead, epicanthus, lambdoidal craniosynostosis, craniosynostosis, global developmental delay, aggressive behavior, telecanthus, dental malocclusion, tapered finger, low anterior hairline, narrow nasal ridge, abnormality of the eye, fifth toe clinodactyly, clinodactyly of the 5th finger, deeply set eye, abnormality of the nail, cutis marmorata" "" "" "" "" "" "" "" "" "" "" "" "0000037081" "00198" "00050469" "00006" "Isolated (sporadic)" "" "progressive pes cavus, intellectual disability, peripheral axonal neuropathy" "" "" "" "" "" "" "" "" "" "" "" "0000037171" "00198" "00050559" "00006" "Unknown" "" "global developmental delay" "" "" "" "" "" "" "" "" "" "" "" "0000037217" "00198" "00050605" "00006" "Isolated (sporadic)" "" "intellectual disability profound, thick lower lip vermilion, macrotia, coarse facial features, hyperpigmented/hypopigmented macules, hypermelanotic macule, myopathic facies, diastema, generalized tonic-clonic seizures" "" "" "" "" "" "" "" "" "" "" "" "0000037259" "00198" "00050647" "00006" "Isolated (sporadic)" "" "specific learning disability, synophrys, frontal bossing, deeply set eye, depressed nasal bridge, decreased fetal movement, breech presentation, overlapping toe" "" "" "" "" "" "" "" "" "" "" "" "0000066696" "00198" "00087097" "00006" "Isolated (sporadic)" "" "see paper; ..., birth 40w; intellectual disability; 8m-sit, 12m-walk; 36m-first words; no hypotonia; 2y6m-seizures; no vision problem; no hearing loss; no frequent infections; feeding problems; aggressive; coarse face; low frontal hairline; synophrys; thick eyebrows; long eyelashes; ptosis; no narrow palpebral fissures; no flat nasal bridge; broad nose; no upturned nasal tip; no thick, anteverted alae nasi; large mouth; thin upper vermillion; thick lower vermillion; no macroglossia; short philtrum; no long philtrum; no abnormal ears; no cleft palate; no a/hypoplasia distal phalanges V; no short metacarpals/metatarsals; prominent interphalangeal joints; no prominent distal phalanges; sandal gap; spinal anomalies; normal bone age; no scoliosis; no cryptorchidism; no congenital heart disease; body hirsutism; no fetal finger pads; sparse scalp hair; no nail a/hypoplasia; no delayed dentition; no small cerebellum; no Dandy-Walker anomaly; normal corpus callosum; umibilical/inguinal hernia" "" "00y35m" "" "" "" "" "" "" "NCBRS" "Nicolaides-Baraitser syndrome" "" "0000066697" "00198" "00087098" "00006" "Isolated (sporadic)" "" "see paper; ..., birth 39w; intellectual disability; hypotonia; seizures; no vision problem; no hearing loss; no frequent infections; no feeding problems; autism; coarse face; low frontal hairline; no synophrys; no thick eyebrows; long eyelashes; no ptosis; no narrow palpebral fissures; no flat nasal bridge; broad nose; upturned nasal tip; thick, anteverted alae nasi; large mouth; thin upper vermillion; thick lower vermillion; no macroglossia; no short philtrum; no long philtrum; no abnormal ears; no cleft palate; short metacarpals/metatarsals; prominent interphalangeal joints; prominent distal phalanges; no sandal gap; scoliosis; no cryptorchidism; no congenital heart disease; no body hirsutism; no increased skin wrinkling; no fetal finger pads; sparse scalp hair; nail a/hypoplasia; no small cerebellum; no Dandy-Walker anomaly; normal corpus callosum; joint ankylosis, increased height of vertebral bodies, osteoporosis" "" "00y22m" "" "" "" "" "" "" "NCBRS" "Nicolaides-Baraitser syndrome" "" "0000066698" "00198" "00087099" "00006" "Isolated (sporadic)" "" "see paper; ..., birth 40w; intellectual disability; 11m-walk; 36m-first words; hypotonia; 1y6m-seizures; no vision problem; no hearing loss; frequent infections; no feeding problems; hyperactive; coarse face; low frontal hairline; no synophrys; no thick eyebrows; no long eyelashes; no ptosis; no narrow palpebral fissures; no flat nasal bridge; broad nose; no upturned nasal tip; no thick, anteverted alae nasi; large mouth; no thin upper vermillion; thick lower vermillion; no macroglossia; no short philtrum; long philtrum; no abnormal ears; no cleft palate; no a/hypoplasia distal phalanges V; no short metacarpals/metatarsals; prominent interphalangeal joints; no prominent distal phalanges; sandal gap; no spinal anomalies; no scoliosis; no cryptorchidism; no congenital heart disease; no body hirsutism; no fetal finger pads; sparse scalp hair; no nail a/hypoplasia; no delayed dentition; no small cerebellum; no Dandy-Walker anomaly; normal corpus callosum" "" "00y26m" "" "" "" "" "" "" "NCBRS" "Nicolaides-Baraitser syndrome" "" "0000129027" "00198" "00163915" "01807" "Unknown" "" "Cerebellar hypoplasia (HP:0001321); Abnormal enzyme/coenzyme activity (HP:0012379); Global developmental delay (HP:0001263); Seizures (HP:0001250)" "" "" "" "" "" "" "" "" "" "" "" "0000138839" "00157" "00174119" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138840" "00157" "00174120" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138841" "00157" "00174121" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138842" "00157" "00174122" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138843" "00157" "00174123" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138844" "00157" "00174124" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138845" "00157" "00174125" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138846" "00157" "00174126" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138847" "00157" "00174127" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138848" "00157" "00174128" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138849" "00157" "00174129" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138851" "00157" "00174131" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138852" "00157" "00174132" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138853" "00157" "00174133" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138854" "00157" "00174134" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138855" "00157" "00174135" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138856" "00157" "00174136" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138857" "00157" "00174137" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138858" "00157" "00174138" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138859" "00157" "00174139" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138860" "00157" "00174140" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138861" "00157" "00174141" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138862" "00157" "00174142" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138863" "00157" "00174143" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138864" "00157" "00174144" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138865" "00157" "00174145" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138866" "00157" "00174146" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138867" "00157" "00174147" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138868" "00157" "00174148" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138869" "00157" "00174149" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138870" "00157" "00174150" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138871" "00157" "00174151" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138872" "00157" "00174152" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138873" "00157" "00174153" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138874" "00157" "00174154" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138875" "00157" "00174155" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138876" "00157" "00174156" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138877" "00157" "00174157" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138878" "00157" "00174158" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138879" "00157" "00174159" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138880" "00157" "00174160" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138881" "00157" "00174161" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138882" "00157" "00174162" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138883" "00157" "00174163" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138884" "00157" "00174164" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138885" "00157" "00174165" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138886" "00157" "00174166" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138887" "00157" "00174167" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138888" "00157" "00174168" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138889" "00157" "00174169" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138890" "00157" "00174170" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138891" "00157" "00174171" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138892" "00157" "00174172" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138893" "00157" "00174173" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138894" "00157" "00174174" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138895" "00157" "00174175" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138896" "00157" "00174176" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138897" "00157" "00174177" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138898" "00157" "00174178" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000138899" "00157" "00174179" "00008" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000238772" "00198" "00315020" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "chromatinopathy" "" "0000238773" "00198" "00315021" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "chromatinopathy" "" "0000238774" "00198" "00315022" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "chromatinopathy" "" "0000241834" "00157" "00318130" "01164" "Unknown" "" "clinical suspicion of Nicolaides-Baraitser syndrome or Coffin-Siris syndrome, developmental delay, IQ between 63 and 71, microcephaly, facial dysmorphia, peripheral pulmonary stenosis, PDA, PFO, muscle hypotension" "" "10y" "" "" "" "" "" "" "" "" "" "0000242021" "04270" "00319919" "00006" "Isolated (sporadic)" "05y05m" "see paper; ..., myoclonic astatic epilepsy, skin wrinkling, frontal balding, broad and long philtrum, broad nasal base, upturned nasal tip, thick alae nasi, anterior projection upper lip over the premaxilla, thin upper vermillion, thick lower vermillion border, slightly thick distal phalanges hands; eczema particularly involving elbows and knees, reduced speech, intellectual disability, autism" "" "" "" "" "" "" "" "" "NCBRS" "epilepsy" "" "0000324080" "00198" "00433657" "03544" "Isolated (sporadic)" "" "intellectual disability, facial abnormalities, 5th finger clnodactyly" "" "" "" "" "" "" "" "" "" "" "" "0000325001" "05611" "00434752" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "neurodevelopmental dealy" "" "0000325002" "05611" "00434753" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "neurodevelopmental dealy" "" "0000325003" "05611" "00434754" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "neurodevelopmental dealy" "" "0000325004" "05611" "00434755" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "neurodevelopmental dealy" "" "0000325005" "05611" "00434756" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "neurodevelopmental dealy" "" "0000325006" "05611" "00434757" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "neurodevelopmental dealy" "" "0000325007" "05611" "00434758" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "neurodevelopmental dealy" "" "0000325008" "05611" "00434759" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "neurodevelopmental dealy" "" "0000325009" "05611" "00434760" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "neurodevelopmental dealy" "" "0000325785" "05611" "00435600" "00006" "Isolated (sporadic)" "4y" "see paper; ..., normal pregnancy, birth birth at term; 3y6m-first words; <2y6m-walk; 4y-can speak in sentences (received significant speech therapy); moderate intellectual disability; delayed gross motor skills; delayed fine motor skills; no seizures; hypotonia; no movement disorder; happy demeanor, poor concentration; rare apnea, sleep study, no intervention recommended; round face, cleft palate, small hands and feet, deep-set eyes, thin upper lip, smooth philtrum, slightly downslanting palpebral fissures; normal eyes/vision; middle ear disease, recurrent ear infections; no feeding problems, required G-tube; ear infections; joint laxity" "" "" "" "" "" "" "" "" "" "neurodevelopmental delay" "" "0000339004" "00157" "00449857" "03544" "Isolated (sporadic)" "" "HP:0008070, HP:0012758, HP:0011968, HP:0011297" "" "" "" "" "" "" "" "" "NCBRS" "developmental delay" "" "0000342121" "05611" "00453457" "03544" "Isolated (sporadic)" "" "HP:0100021, HP:0010864, HP:0001250, HP:0000717, HP:0000271, HP:0009906, HP:0001357, HP:0000348,HP:0000060, HP:0000431, HP:0000954" "" "" "" "" "" "" "" "" "BIS" "complex neurodevelopmental disorder" "" ## Screenings ## Do not remove or alter this header ## ## Count = 152 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000001274" "00001503" "1" "00074" "00074" "2013-06-28 17:52:20" "" "" "SEQ" "DNA" "" "" "0000001275" "00001504" "1" "00074" "00074" "2013-06-28 17:52:20" "" "" "SEQ" "DNA" "" "" "0000001276" "00001505" "1" "00074" "00074" "2013-06-28 17:52:20" "" "" "SEQ" "DNA" "" "" "0000001279" "00001508" "1" "00074" "00074" "2013-06-28 17:52:20" "" "" "SEQ" "DNA" "" "" "0000001281" "00001510" "1" "00074" "00074" "2013-06-28 17:52:20" "" "" "SEQ" "DNA" "" "" "0000001282" "00001511" "1" "00074" "00074" "2013-06-28 17:52:20" "" "" "SEQ" "DNA" "" "" "0000001284" "00001513" "1" "00074" "00074" "2013-06-28 17:52:20" "" "" "SEQ" "DNA" "" "" "0000001285" "00001514" "1" "00074" "00074" "2013-06-28 17:52:20" "" "" "SEQ" "DNA" "" "" "0000001286" "00001515" "1" "00074" "00074" "2013-06-28 17:52:20" "" "" "SEQ" "DNA" "" "" "0000001287" "00001516" "1" "00074" "00074" "2013-06-28 17:52:20" "" "" "SEQ" "DNA" "" "" "0000001288" "00001517" "1" "00074" "00074" "2013-06-28 17:52:20" "" "" "SEQ" "DNA" "" "" "0000001290" "00001519" "1" "00074" "00074" "2013-06-28 17:52:20" "" "" "SEQ" "DNA" "" "" "0000001291" "00001520" "1" "00074" "00074" "2013-06-28 17:52:20" "" "" "SEQ" "DNA" "" "" "0000001292" "00001521" "1" "00074" "00074" "2013-06-28 17:52:20" "" "" "SEQ" "DNA" "" "" "0000001295" "00001524" "1" "00074" "00074" "2013-06-28 17:52:20" "" "" "SEQ" "DNA" "" "" "0000001296" "00001525" "1" "00074" "00074" "2013-06-28 17:52:20" "" "" "SEQ" "DNA" "" "" "0000001297" "00001526" "1" "00074" "00074" "2013-06-28 17:52:20" "" "" "SEQ" "DNA" "" "" "0000001300" "00001529" "1" "00074" "00074" "2013-06-28 17:52:20" "" "" "SEQ" "DNA" "" "" "0000001301" "00001530" "1" "00074" "00074" "2013-06-28 17:52:20" "" "" "SEQ" "DNA" "" "" "0000001302" "00001531" "1" "00074" "00074" "2013-06-28 17:52:20" "" "" "SEQ" "DNA" "" "" "0000001303" "00001532" "1" "00074" "00074" "2013-06-28 17:52:20" "" "" "SEQ" "DNA" "" "" "0000001304" "00001533" "1" "00074" "00074" "2013-06-28 17:52:20" "" "" "SEQ" "DNA" "" "" "0000001305" "00001534" "1" "00074" "00074" "2013-06-28 17:52:20" "" "" "SEQ" "DNA" "" "" "0000001306" "00001535" "1" "00074" "00074" "2013-06-28 17:52:20" "" "" "SEQ" "DNA" "" "" "0000001307" "00001536" "1" "00074" "00074" "2013-06-28 17:52:20" "" "" "SEQ" "DNA" "" "" "0000001308" "00001537" "1" "00074" "00074" "2013-06-28 17:52:20" "" "" "SEQ" "DNA" "" "" "0000001309" "00001538" "1" "00074" "00074" "2013-06-28 17:52:20" "" "" "SEQ" "DNA" "" "" "0000001312" "00001541" "1" "00074" "00074" "2013-06-28 17:52:20" "" "" "SEQ" "DNA" "" "" "0000001313" "00001542" "1" "00074" "00074" "2013-06-28 17:52:20" "" "" "SEQ" "DNA" "" "" "0000001315" "00001544" "1" "00074" "00074" "2013-06-28 17:52:20" "" "" "SEQ" "DNA" "" "" "0000001316" "00001545" "1" "00074" "00074" "2013-06-28 17:52:20" "" "" "SEQ" "DNA" "" "" "0000001317" "00001546" "1" "00074" "00074" "2013-06-28 17:52:20" "" "" "SEQ" "DNA" "" "" "0000001320" "00001549" "1" "00074" "00074" "2013-06-28 17:52:20" "" "" "SEQ" "DNA" "" "" "0000001329" "00001558" "1" "00074" "00074" "2013-06-28 17:52:20" "" "" "SEQ" "DNA" "" "" "0000048102" "00047976" "1" "00233" "00233" "2012-07-09 11:08:22" "" "" "SEQ" "DNA" "" "" "0000048103" "00047977" "1" "00233" "00233" "2012-07-09 11:08:22" "" "" "SEQ" "DNA" "" "" "0000048104" "00047978" "1" "00233" "00233" "2012-07-09 11:08:22" "" "" "SEQ" "DNA" "" "" "0000048105" "00047979" "1" "00233" "00233" "2012-07-09 11:08:22" "" "" "SEQ" "DNA" "" "" "0000048106" "00047980" "1" "00233" "00233" "2012-07-09 11:08:22" "" "" "SEQ" "DNA" "" "" "0000048107" "00047981" "1" "00233" "00233" "2012-07-09 11:08:22" "" "" "SEQ" "DNA" "" "" "0000048108" "00047982" "1" "00233" "00233" "2012-07-09 11:08:22" "" "" "SEQ" "DNA" "" "" "0000048109" "00047983" "1" "00233" "00233" "2012-07-09 11:08:22" "" "" "SEQ" "DNA" "" "" "0000048110" "00047984" "1" "00233" "00233" "2012-07-09 11:08:22" "" "" "SEQ" "DNA" "" "" "0000048111" "00047985" "1" "00233" "00233" "2012-07-09 11:08:23" "" "" "SEQ" "DNA" "" "" "0000048112" "00047986" "1" "00233" "00233" "2012-07-09 11:08:23" "" "" "SEQ" "DNA" "" "" "0000048113" "00047987" "1" "00233" "00233" "2012-07-09 11:08:23" "" "" "SEQ" "DNA" "" "" "0000048114" "00047988" "1" "00233" "00233" "2012-07-09 11:08:23" "" "" "SEQ" "DNA" "" "" "0000048115" "00047989" "1" "00233" "00233" "2012-07-09 11:08:23" "" "" "SEQ" "DNA" "" "" "0000048116" "00047990" "1" "00233" "00233" "2012-07-09 11:08:23" "" "" "SEQ" "DNA" "" "" "0000048117" "00047991" "1" "00233" "00233" "2012-07-09 11:08:23" "" "" "SEQ" "DNA" "" "" "0000048118" "00047992" "1" "00233" "00233" "2012-07-09 11:08:23" "" "" "SEQ" "DNA" "" "" "0000048119" "00047993" "1" "00233" "00233" "2012-07-09 11:08:23" "" "" "SEQ" "DNA" "" "" "0000048120" "00047994" "1" "00233" "00233" "2012-07-09 11:08:23" "" "" "SEQ" "DNA" "" "" "0000048121" "00047995" "1" "00233" "00233" "2012-07-09 11:08:23" "" "" "SEQ" "DNA" "" "" "0000048122" "00047996" "1" "00233" "00233" "2012-07-09 11:08:23" "" "" "SEQ" "DNA" "" "" "0000048123" "00047997" "1" "00233" "00233" "2012-07-09 11:08:23" "" "" "SEQ" "DNA" "" "" "0000048124" "00047998" "1" "00233" "00233" "2012-07-09 11:08:23" "" "" "SEQ" "DNA" "" "" "0000048125" "00047999" "1" "00233" "00233" "2012-07-09 11:08:23" "" "" "SEQ" "DNA" "" "" "0000048126" "00048000" "1" "00233" "00233" "2012-07-09 11:08:23" "" "" "SEQ" "DNA" "" "" "0000048127" "00048001" "1" "00233" "00233" "2012-07-09 11:08:23" "" "" "SEQ" "DNA" "" "" "0000048128" "00048002" "1" "00233" "00233" "2012-07-09 11:08:23" "" "" "SEQ" "DNA" "" "" "0000048129" "00048003" "1" "00233" "00233" "2012-07-09 11:08:23" "" "" "SEQ" "DNA" "" "" "0000050344" "00050399" "1" "00006" "00006" "2015-09-27 16:16:40" "" "" "SEQ;SEQ-NG-I" "DNA" "" "" "0000050414" "00050469" "1" "00006" "00006" "2015-09-27 16:16:40" "" "" "SEQ;SEQ-NG-I" "DNA" "" "" "0000050504" "00050559" "1" "00006" "00006" "2015-09-27 16:16:40" "" "" "SEQ;SEQ-NG-I" "DNA" "" "" "0000050550" "00050605" "1" "00006" "00006" "2015-09-27 16:16:40" "" "" "SEQ;SEQ-NG-I" "DNA" "" "" "0000050592" "00050647" "1" "00006" "00006" "2015-09-27 16:16:40" "" "" "SEQ;SEQ-NG-I" "DNA" "" "" "0000087234" "00087097" "1" "00006" "00006" "2016-11-11 16:19:55" "" "" "SEQ" "DNA" "" "" "0000087235" "00087098" "1" "00006" "00006" "2016-11-11 16:22:47" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000087236" "00087099" "1" "00006" "00006" "2016-11-11 16:26:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000164779" "00163915" "1" "01807" "01807" "2018-04-23 08:51:23" "" "" "SEQ" "DNA" "" "" "0000175009" "00174119" "1" "00008" "00008" "2018-08-07 16:25:57" "00006" "2023-11-03 08:30:45" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000175010" "00174120" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175011" "00174121" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175012" "00174122" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175013" "00174123" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175014" "00174124" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175015" "00174125" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175016" "00174126" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175017" "00174127" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175018" "00174128" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175019" "00174129" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175021" "00174131" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175022" "00174132" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175023" "00174133" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175024" "00174134" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175025" "00174135" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175026" "00174136" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175027" "00174137" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175028" "00174138" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175029" "00174139" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175030" "00174140" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175031" "00174141" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175032" "00174142" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175033" "00174143" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175034" "00174144" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175035" "00174145" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175036" "00174146" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175037" "00174147" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175038" "00174148" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175039" "00174149" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175040" "00174150" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175041" "00174151" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175042" "00174152" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175043" "00174153" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175044" "00174154" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175045" "00174155" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175046" "00174156" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175047" "00174157" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175048" "00174158" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175049" "00174159" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175050" "00174160" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175051" "00174161" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175052" "00174162" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175053" "00174163" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175054" "00174164" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175055" "00174165" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175056" "00174166" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175057" "00174167" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175058" "00174168" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175059" "00174169" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175060" "00174170" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175061" "00174171" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175062" "00174172" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175063" "00174173" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175064" "00174174" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175065" "00174175" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175066" "00174176" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175067" "00174177" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175068" "00174178" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000175069" "00174179" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000295998" "00294830" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000296000" "00294832" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000316196" "00315020" "1" "00006" "00006" "2020-10-24 17:31:22" "" "" "SEQ;SEQ-NG" "DNA" "" "68-gene panel" "0000316197" "00315021" "1" "00006" "00006" "2020-10-24 17:31:22" "" "" "SEQ;SEQ-NG" "DNA" "" "68-gene panel" "0000316198" "00315022" "1" "00006" "00006" "2020-10-24 17:31:22" "" "" "SEQ;SEQ-NG" "DNA" "" "68-gene panel" "0000319312" "00318130" "1" "01164" "01164" "2020-11-06 10:48:14" "" "" "SEQ-NG-I" "DNA" "" "" "0000321100" "00319919" "1" "00006" "00006" "2020-11-10 15:47:34" "00006" "2020-11-10 15:49:53" "SEQ;SEQ-NG" "DNA" "" "WES" "0000435115" "00433657" "1" "03544" "03544" "2023-03-12 18:53:33" "" "" "SEQ-NG-I" "DNA" "" "" "0000436224" "00434752" "1" "00006" "00006" "2023-04-07 12:06:06" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000436225" "00434753" "1" "00006" "00006" "2023-04-07 12:06:06" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000436226" "00434754" "1" "00006" "00006" "2023-04-07 12:06:06" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000436227" "00434755" "1" "00006" "00006" "2023-04-07 12:06:06" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000436228" "00434756" "1" "00006" "00006" "2023-04-07 12:06:06" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000436229" "00434757" "1" "00006" "00006" "2023-04-07 12:06:06" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000436230" "00434758" "1" "00006" "00006" "2023-04-07 12:06:06" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000436231" "00434759" "1" "00006" "00006" "2023-04-07 12:06:06" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000436232" "00434760" "1" "00006" "00006" "2023-04-07 12:06:06" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000437081" "00435600" "1" "00006" "00006" "2023-08-05 19:25:13" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000451453" "00449857" "1" "03544" "03544" "2024-05-20 10:13:27" "" "" "SEQ-NG-I" "DNA" "peripheral blood" "CES" "0000455071" "00453457" "1" "03544" "03544" "2024-09-02 12:04:52" "" "" "SEQ-NG-I" "DNA" "peripheral blood" "CES" "0000466186" "00464547" "1" "04333" "04333" "2025-03-27 12:17:44" "" "" "SEQ-NG" "DNA" "" "" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 293 "{{screeningid}}" "{{geneid}}" "0000001274" "ARID1A" "0000001274" "ARID1B" "0000001274" "SMARCA2" "0000001274" "SMARCA4" "0000001274" "SMARCB1" "0000001274" "SMARCE1" "0000001275" "ARID1A" "0000001275" "ARID1B" "0000001275" "SMARCA2" "0000001275" "SMARCA4" "0000001275" "SMARCB1" "0000001275" "SMARCE1" "0000001276" "ARID1A" "0000001276" "ARID1B" "0000001276" "SMARCA2" "0000001276" "SMARCA4" "0000001276" "SMARCB1" "0000001276" "SMARCE1" "0000001279" "ARID1B" "0000001279" "SMARCA2" "0000001281" "ARID1A" "0000001281" "ARID1B" "0000001281" "SMARCA2" "0000001281" "SMARCA4" "0000001281" "SMARCB1" "0000001281" "SMARCE1" "0000001282" "ARID1A" "0000001282" "ARID1B" "0000001282" "SMARCA2" "0000001282" "SMARCA4" "0000001282" "SMARCB1" "0000001282" "SMARCE1" "0000001284" "ARID1A" "0000001284" "ARID1B" "0000001284" "SMARCA2" "0000001284" "SMARCA4" "0000001284" "SMARCB1" "0000001284" "SMARCE1" "0000001285" "ARID1A" "0000001285" "ARID1B" "0000001285" "SMARCA2" "0000001285" "SMARCA4" "0000001285" "SMARCB1" "0000001285" "SMARCE1" "0000001286" "ARID1B" "0000001286" "SMARCA2" "0000001287" "ARID1A" "0000001287" "ARID1B" "0000001287" "SMARCA2" "0000001287" "SMARCA4" "0000001287" "SMARCB1" "0000001287" "SMARCE1" "0000001288" "ARID1A" "0000001288" "ARID1B" "0000001288" "SMARCA2" "0000001288" "SMARCA4" "0000001288" "SMARCB1" "0000001288" "SMARCE1" "0000001290" "ARID1A" "0000001290" "ARID1B" "0000001290" "SMARCA2" "0000001290" "SMARCA4" "0000001290" "SMARCB1" "0000001290" "SMARCE1" "0000001291" "ARID1A" "0000001291" "ARID1B" "0000001291" "SMARCA2" "0000001291" "SMARCA4" "0000001291" "SMARCB1" "0000001291" "SMARCE1" "0000001292" "ARID1A" "0000001292" "ARID1B" "0000001292" "SMARCA2" "0000001292" "SMARCA4" "0000001292" "SMARCB1" "0000001292" "SMARCE1" "0000001295" "ARID1A" "0000001295" "ARID1B" "0000001295" "SMARCA2" "0000001295" "SMARCA4" "0000001295" "SMARCB1" "0000001295" "SMARCE1" "0000001296" "ARID1A" "0000001296" "ARID1B" "0000001296" "SMARCA2" "0000001296" "SMARCA4" "0000001296" "SMARCB1" "0000001296" "SMARCE1" "0000001297" "ARID1A" "0000001297" "ARID1B" "0000001297" "SMARCA2" "0000001297" "SMARCA4" "0000001297" "SMARCB1" "0000001297" "SMARCE1" "0000001300" "ARID1A" "0000001300" "ARID1B" "0000001300" "SMARCA2" "0000001300" "SMARCA4" "0000001300" "SMARCB1" "0000001300" "SMARCE1" "0000001301" "ARID1A" "0000001301" "ARID1B" "0000001301" "SMARCA2" "0000001301" "SMARCA4" "0000001301" "SMARCB1" "0000001301" "SMARCE1" "0000001302" "ARID1A" "0000001302" "ARID1B" "0000001302" "SMARCA2" "0000001302" "SMARCA4" "0000001302" "SMARCB1" "0000001302" "SMARCE1" "0000001303" "ARID1A" "0000001303" "ARID1B" "0000001303" "SMARCA2" "0000001303" "SMARCA4" "0000001303" "SMARCB1" "0000001303" "SMARCE1" "0000001304" "ARID1A" "0000001304" "ARID1B" "0000001304" "SMARCA2" "0000001304" "SMARCA4" "0000001304" "SMARCB1" "0000001304" "SMARCE1" "0000001305" "ARID1A" "0000001305" "ARID1B" "0000001305" "SMARCA2" "0000001305" "SMARCA4" "0000001305" "SMARCB1" "0000001305" "SMARCE1" "0000001306" "ARID1A" "0000001306" "ARID1B" "0000001306" "SMARCA2" "0000001306" "SMARCA4" "0000001306" "SMARCB1" "0000001306" "SMARCE1" "0000001307" "ARID1A" "0000001307" "ARID1B" "0000001307" "SMARCA2" "0000001307" "SMARCA4" "0000001307" "SMARCB1" "0000001307" "SMARCE1" "0000001308" "ARID1A" "0000001308" "ARID1B" "0000001308" "SMARCA2" "0000001308" "SMARCA4" "0000001308" "SMARCB1" "0000001308" "SMARCE1" "0000001309" "ARID1A" "0000001309" "ARID1B" "0000001309" "SMARCA2" "0000001309" "SMARCA4" "0000001309" "SMARCB1" "0000001309" "SMARCE1" "0000001312" "ARID1A" "0000001312" "ARID1B" "0000001312" "SMARCA2" "0000001312" "SMARCA4" "0000001312" "SMARCB1" "0000001312" "SMARCE1" "0000001313" "ARID1A" "0000001313" "ARID1B" "0000001313" "SMARCA2" "0000001313" "SMARCA4" "0000001313" "SMARCB1" "0000001313" "SMARCE1" "0000001315" "ARID1A" "0000001315" "ARID1B" "0000001315" "SMARCA2" "0000001315" "SMARCA4" "0000001315" "SMARCB1" "0000001315" "SMARCE1" "0000001316" "ARID1B" "0000001316" "SMARCA4" "0000001316" "SMARCB1" "0000001317" "ARID1A" "0000001317" "ARID1B" "0000001317" "SMARCA2" "0000001317" "SMARCA4" "0000001317" "SMARCB1" "0000001317" "SMARCE1" "0000001320" "ARID1A" "0000001320" "ARID1B" "0000001320" "SMARCA2" "0000001320" "SMARCA4" "0000001320" "SMARCB1" "0000001320" "SMARCE1" "0000001329" "ARID1A" "0000001329" "ARID1B" "0000001329" "SMARCA2" "0000001329" "SMARCA4" "0000001329" "SMARCB1" "0000001329" "SMARCE1" "0000048102" "SMARCA2" "0000048103" "SMARCA2" "0000048104" "SMARCA2" "0000048105" "SMARCA2" "0000048106" "SMARCA2" "0000048107" "SMARCA2" "0000048108" "SMARCA2" "0000048109" "SMARCA2" "0000048110" "SMARCA2" "0000048111" "SMARCA2" "0000048112" "SMARCA2" "0000048113" "SMARCA2" "0000048114" "SMARCA2" "0000048115" "SMARCA2" "0000048116" "SMARCA2" "0000048117" "SMARCA2" "0000048118" "SMARCA2" "0000048119" "SMARCA2" "0000048120" "SMARCA2" "0000048121" "SMARCA2" "0000048122" "SMARCA2" "0000048123" "SMARCA2" "0000048124" "SMARCA2" "0000048125" "SMARCA2" "0000048126" "SMARCA2" "0000048127" "SMARCA2" "0000048128" "SMARCA2" "0000048129" "SMARCA2" "0000050344" "SMARCA2" "0000050414" "SMARCA2" "0000050550" "SMARCA2" "0000050592" "SMARCA2" "0000087234" "SMARCA2" "0000087235" "SMARCA2" "0000087236" "SMARCA2" "0000175009" "SMARCA2" "0000175010" "SMARCA2" "0000175011" "SMARCA2" "0000175012" "SMARCA2" "0000175013" "SMARCA2" "0000175014" "SMARCA2" "0000175015" "SMARCA2" "0000175016" "SMARCA2" "0000175017" "SMARCA2" "0000175018" "SMARCA2" "0000175019" "SMARCA2" "0000175021" "SMARCA2" "0000175022" "SMARCA2" "0000175023" "SMARCA2" "0000175024" "SMARCA2" "0000175025" "SMARCA2" "0000175026" "SMARCA2" "0000175027" "SMARCA2" "0000175028" "SMARCA2" "0000175029" "SMARCA2" "0000175030" "SMARCA2" "0000175031" "SMARCA2" "0000175032" "SMARCA2" "0000175033" "SMARCA2" "0000175034" "SMARCA2" "0000175035" "SMARCA2" "0000175036" "SMARCA2" "0000175037" "SMARCA2" "0000175038" "SMARCA2" "0000175039" "SMARCA2" "0000175040" "SMARCA2" "0000175041" "SMARCA2" "0000175042" "SMARCA2" "0000175043" "SMARCA2" "0000175044" "SMARCA2" "0000175045" "SMARCA2" "0000175046" "SMARCA2" "0000175047" "SMARCA2" "0000175048" "SMARCA2" "0000175049" "SMARCA2" "0000175050" "SMARCA2" "0000175051" "SMARCA2" "0000175052" "SMARCA2" "0000175053" "SMARCA2" "0000175054" "SMARCA2" "0000175055" "SMARCA2" "0000175056" "SMARCA2" "0000175057" "SMARCA2" "0000175058" "SMARCA2" "0000175059" "SMARCA2" "0000175060" "SMARCA2" "0000175061" "SMARCA2" "0000175062" "SMARCA2" "0000175063" "SMARCA2" "0000175064" "SMARCA2" "0000175065" "SMARCA2" "0000175066" "SMARCA2" "0000175067" "SMARCA2" "0000175068" "SMARCA2" "0000175069" "SMARCA2" "0000316196" "SMARCA2" "0000316197" "SMARCA2" "0000316198" "SMARCA2" "0000319312" "SMARCA2" "0000321100" "SMARCA2" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 395 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000018682" "0" "90" "9" "2110254" "2110254" "subst" "0" "00074" "SMARCA2_000039" "g.2110254G>A" "" "{PMID:Santen 2013:23929686}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.2110254G>A" "" "pathogenic (dominant)" "" "0000018683" "0" "90" "9" "2086856" "2086856" "subst" "0" "00074" "SMARCA2_000044" "g.2086856G>C" "" "{PMID:Santen 2013:23929686}" "" "" "" "De novo" "" "" "0" "" "" "g.2086856G>C" "" "pathogenic (dominant)" "" "0000018684" "0" "90" "9" "2110275" "2110275" "subst" "0" "00074" "SMARCA2_000047" "g.2110275G>A" "" "{PMID:Santen 2013:23929686}" "" "" "" "De novo" "" "" "0" "" "" "g.2110275G>A" "" "pathogenic (dominant)" "" "0000018685" "0" "90" "9" "2088545" "2088545" "subst" "0" "00074" "SMARCA2_000045" "g.2088545C>T" "" "{PMID:Santen 2013:23929686}" "" "" "" "De novo" "" "" "0" "" "" "g.2088545C>T" "" "pathogenic (dominant)" "" "0000018841" "0" "55" "9" "2029018" "2029018" "subst" "0.11492" "00074" "SMARCA2_000054" "g.2029018G>A" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2029018G>A" "" "VUS" "" "0000018842" "0" "55" "9" "2029018" "2029018" "subst" "0.11492" "00074" "SMARCA2_000054" "g.2029018G>A" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2029018G>A" "" "VUS" "" "0000018843" "0" "55" "9" "2029018" "2029018" "subst" "0.11492" "00074" "SMARCA2_000054" "g.2029018G>A" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2029018G>A" "" "VUS" "" "0000018849" "0" "55" "9" "2060768" "2060768" "subst" "0.151653" "00074" "SMARCA2_000035" "g.2060768T>C" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2060768T>C" "" "VUS" "" "0000018850" "0" "55" "9" "2083337" "2083337" "del" "0" "00074" "SMARCA2_000036" "g.2083337del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2083337del" "" "VUS" "" "0000018851" "0" "55" "9" "2083337" "2083337" "del" "0" "00074" "SMARCA2_000036" "g.2083337del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2083337del" "" "VUS" "" "0000018852" "0" "55" "9" "2083337" "2083337" "del" "0" "00074" "SMARCA2_000036" "g.2083337del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2083337del" "" "VUS" "" "0000018853" "0" "55" "9" "2083337" "2083337" "del" "0" "00074" "SMARCA2_000036" "g.2083337del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2083337del" "" "VUS" "" "0000018854" "0" "55" "9" "2083337" "2083337" "del" "0" "00074" "SMARCA2_000036" "g.2083337del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2083337del" "" "VUS" "" "0000018855" "0" "55" "9" "2083337" "2083337" "del" "0" "00074" "SMARCA2_000036" "g.2083337del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2083337del" "" "VUS" "" "0000018856" "0" "55" "9" "2083337" "2083337" "del" "0" "00074" "SMARCA2_000036" "g.2083337del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2083337del" "" "VUS" "" "0000018857" "0" "55" "9" "2083337" "2083337" "del" "0" "00074" "SMARCA2_000036" "g.2083337del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2083337del" "" "VUS" "" "0000018858" "0" "55" "9" "2083337" "2083337" "del" "0" "00074" "SMARCA2_000036" "g.2083337del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2083337del" "" "VUS" "" "0000018859" "0" "55" "9" "2083337" "2083337" "del" "0" "00074" "SMARCA2_000036" "g.2083337del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2083337del" "" "VUS" "" "0000018860" "0" "55" "9" "2083337" "2083337" "del" "0" "00074" "SMARCA2_000036" "g.2083337del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2083337del" "" "VUS" "" "0000018861" "0" "55" "9" "2083337" "2083337" "del" "0" "00074" "SMARCA2_000036" "g.2083337del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2083337del" "" "VUS" "" "0000018862" "0" "55" "9" "2083337" "2083337" "del" "0" "00074" "SMARCA2_000036" "g.2083337del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2083337del" "" "VUS" "" "0000018863" "0" "55" "9" "2083337" "2083337" "del" "0" "00074" "SMARCA2_000036" "g.2083337del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2083337del" "" "VUS" "" "0000018864" "0" "55" "9" "2083337" "2083337" "del" "0" "00074" "SMARCA2_000036" "g.2083337del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2083337del" "" "VUS" "" "0000018865" "0" "55" "9" "2083337" "2083337" "del" "0" "00074" "SMARCA2_000036" "g.2083337del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2083337del" "" "VUS" "" "0000018866" "0" "55" "9" "2083337" "2083337" "del" "0" "00074" "SMARCA2_000036" "g.2083337del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2083337del" "" "VUS" "" "0000018867" "0" "55" "9" "2083337" "2083337" "del" "0" "00074" "SMARCA2_000036" "g.2083337del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2083337del" "" "VUS" "" "0000018868" "0" "55" "9" "2083337" "2083337" "del" "0" "00074" "SMARCA2_000036" "g.2083337del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2083337del" "" "VUS" "" "0000018869" "0" "55" "9" "2083337" "2083337" "del" "0" "00074" "SMARCA2_000036" "g.2083337del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2083337del" "" "VUS" "" "0000018870" "0" "55" "9" "2083337" "2083337" "del" "0" "00074" "SMARCA2_000036" "g.2083337del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2083337del" "" "VUS" "" "0000018871" "0" "55" "9" "2083337" "2083337" "del" "0" "00074" "SMARCA2_000036" "g.2083337del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2083337del" "" "VUS" "" "0000018872" "0" "55" "9" "2083337" "2083337" "del" "0" "00074" "SMARCA2_000036" "g.2083337del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2083337del" "" "VUS" "" "0000018873" "0" "55" "9" "2083337" "2083337" "del" "0" "00074" "SMARCA2_000036" "g.2083337del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2083337del" "" "VUS" "" "0000018874" "0" "55" "9" "2083337" "2083337" "del" "0" "00074" "SMARCA2_000036" "g.2083337del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2083337del" "" "VUS" "" "0000018875" "0" "55" "9" "2083337" "2083337" "del" "0" "00074" "SMARCA2_000036" "g.2083337del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2083337del" "" "VUS" "" "0000018876" "0" "55" "9" "2083338" "2083338" "del" "3.96267E-5" "00074" "SMARCA2_000042" "g.2083338del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2083338del" "" "VUS" "" "0000018877" "0" "55" "9" "2086804" "2086804" "subst" "0.0472871" "00074" "SMARCA2_000043" "g.2086804G>A" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2086804G>A" "" "VUS" "" "0000018878" "0" "55" "9" "2086804" "2086804" "subst" "0.0472871" "00074" "SMARCA2_000043" "g.2086804G>A" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2086804G>A" "" "VUS" "" "0000018879" "0" "55" "9" "2086804" "2086804" "subst" "0.0472871" "00074" "SMARCA2_000043" "g.2086804G>A" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2086804G>A" "" "VUS" "" "0000018880" "0" "55" "9" "2088633" "2088633" "del" "0" "00074" "SMARCA2_000046" "g.2088633del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2088633del" "" "VUS" "" "0000018881" "0" "55" "9" "2088650" "2088650" "del" "0" "00074" "SMARCA2_000037" "g.2088650del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2088650del" "" "VUS" "" "0000018882" "0" "55" "9" "2088650" "2088650" "del" "0" "00074" "SMARCA2_000037" "g.2088650del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2088650del" "" "VUS" "" "0000018883" "0" "55" "9" "2088650" "2088650" "del" "0" "00074" "SMARCA2_000037" "g.2088650del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2088650del" "" "VUS" "" "0000018884" "0" "55" "9" "2088650" "2088650" "del" "0" "00074" "SMARCA2_000037" "g.2088650del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2088650del" "" "VUS" "" "0000018885" "0" "55" "9" "2088650" "2088650" "del" "0" "00074" "SMARCA2_000037" "g.2088650del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2088650del" "" "VUS" "" "0000018886" "0" "55" "9" "2088650" "2088650" "del" "0" "00074" "SMARCA2_000037" "g.2088650del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2088650del" "" "VUS" "" "0000018887" "0" "55" "9" "2088650" "2088650" "del" "0" "00074" "SMARCA2_000037" "g.2088650del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2088650del" "" "VUS" "" "0000018888" "0" "55" "9" "2088650" "2088650" "del" "0" "00074" "SMARCA2_000037" "g.2088650del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2088650del" "" "VUS" "" "0000018889" "0" "55" "9" "2088650" "2088650" "del" "0" "00074" "SMARCA2_000037" "g.2088650del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2088650del" "" "VUS" "" "0000018890" "0" "55" "9" "2088650" "2088650" "del" "0" "00074" "SMARCA2_000037" "g.2088650del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2088650del" "" "VUS" "" "0000018891" "0" "55" "9" "2088650" "2088650" "del" "0" "00074" "SMARCA2_000037" "g.2088650del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2088650del" "" "VUS" "" "0000018892" "0" "55" "9" "2088650" "2088650" "del" "0" "00074" "SMARCA2_000037" "g.2088650del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2088650del" "" "VUS" "" "0000018893" "0" "55" "9" "2088650" "2088650" "del" "0" "00074" "SMARCA2_000037" "g.2088650del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2088650del" "" "VUS" "" "0000018894" "0" "55" "9" "2088650" "2088650" "del" "0" "00074" "SMARCA2_000037" "g.2088650del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2088650del" "" "VUS" "" "0000018895" "0" "55" "9" "2088650" "2088650" "del" "0" "00074" "SMARCA2_000037" "g.2088650del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2088650del" "" "VUS" "" "0000018896" "0" "55" "9" "2088650" "2088650" "del" "0" "00074" "SMARCA2_000037" "g.2088650del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2088650del" "" "VUS" "" "0000018897" "0" "55" "9" "2088650" "2088650" "del" "0" "00074" "SMARCA2_000037" "g.2088650del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2088650del" "" "VUS" "" "0000018898" "0" "55" "9" "2088650" "2088650" "del" "0" "00074" "SMARCA2_000037" "g.2088650del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2088650del" "" "VUS" "" "0000018899" "0" "55" "9" "2088650" "2088650" "del" "0" "00074" "SMARCA2_000037" "g.2088650del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2088650del" "" "VUS" "" "0000018900" "0" "55" "9" "2088650" "2088650" "del" "0" "00074" "SMARCA2_000037" "g.2088650del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2088650del" "" "VUS" "" "0000018901" "0" "55" "9" "2088650" "2088650" "del" "0" "00074" "SMARCA2_000037" "g.2088650del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2088650del" "" "VUS" "" "0000018902" "0" "55" "9" "2088650" "2088650" "del" "0" "00074" "SMARCA2_000037" "g.2088650del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2088650del" "" "VUS" "" "0000018903" "0" "55" "9" "2088650" "2088650" "del" "0" "00074" "SMARCA2_000029" "g.2088650del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2088650del" "" "VUS" "" "0000018904" "0" "55" "9" "2088650" "2088650" "del" "0" "00074" "SMARCA2_000029" "g.2088650del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2088650del" "" "VUS" "" "0000018905" "0" "55" "9" "2088650" "2088650" "del" "0" "00074" "SMARCA2_000029" "g.2088650del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2088650del" "" "VUS" "" "0000018906" "0" "55" "9" "2088650" "2088650" "del" "0" "00074" "SMARCA2_000029" "g.2088650del" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2088650del" "" "VUS" "" "0000018907" "0" "55" "9" "2096774" "2096774" "subst" "0.0260889" "00074" "SMARCA2_000030" "g.2096774G>A" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2096774G>A" "" "VUS" "" "0000018908" "0" "55" "9" "2096774" "2096774" "subst" "0.0260889" "00074" "SMARCA2_000030" "g.2096774G>A" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2096774G>A" "" "VUS" "" "0000018909" "0" "55" "9" "2096774" "2096774" "subst" "0.0260889" "00074" "SMARCA2_000030" "g.2096774G>A" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2096774G>A" "" "VUS" "" "0000018910" "0" "55" "9" "2096794" "2096794" "subst" "0.00828399" "00074" "SMARCA2_000031" "g.2096794G>A" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2096794G>A" "" "VUS" "" "0000018911" "0" "55" "9" "2096794" "2096794" "subst" "0.00828399" "00074" "SMARCA2_000031" "g.2096794G>A" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2096794G>A" "" "VUS" "" "0000018912" "0" "55" "9" "2096794" "2096794" "subst" "0.00828399" "00074" "SMARCA2_000031" "g.2096794G>A" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2096794G>A" "" "VUS" "" "0000018913" "0" "55" "9" "2096794" "2096794" "subst" "0.00828399" "00074" "SMARCA2_000031" "g.2096794G>A" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2096794G>A" "" "VUS" "" "0000018914" "0" "55" "9" "2101547" "2101547" "subst" "0" "00074" "SMARCA2_000038" "g.2101547C>T" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2101547C>T" "" "VUS" "" "0000018915" "0" "55" "9" "2101545" "2101545" "subst" "0.227534" "00074" "SMARCA2_000032" "g.2101545T>A" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2101545T>A" "" "VUS" "" "0000018916" "0" "55" "9" "2101545" "2101545" "subst" "0.227534" "00074" "SMARCA2_000032" "g.2101545T>A" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2101545T>A" "" "VUS" "" "0000018917" "0" "55" "9" "2101545" "2101545" "subst" "0.227534" "00074" "SMARCA2_000032" "g.2101545T>A" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2101545T>A" "" "VUS" "" "0000018918" "0" "55" "9" "2101545" "2101545" "subst" "0.227534" "00074" "SMARCA2_000032" "g.2101545T>A" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2101545T>A" "" "VUS" "" "0000018919" "0" "55" "9" "2101545" "2101545" "subst" "0.227534" "00074" "SMARCA2_000032" "g.2101545T>A" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2101545T>A" "" "VUS" "" "0000018920" "0" "55" "9" "2101545" "2101545" "subst" "0.227534" "00074" "SMARCA2_000032" "g.2101545T>A" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2101545T>A" "" "VUS" "" "0000018921" "0" "55" "9" "2101545" "2101545" "subst" "0.227534" "00074" "SMARCA2_000032" "g.2101545T>A" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2101545T>A" "" "VUS" "" "0000018922" "0" "55" "9" "2101545" "2101545" "subst" "0.227534" "00074" "SMARCA2_000032" "g.2101545T>A" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2101545T>A" "" "VUS" "" "0000018923" "0" "55" "9" "2101545" "2101545" "subst" "0.227534" "00074" "SMARCA2_000032" "g.2101545T>A" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2101545T>A" "" "VUS" "" "0000018924" "0" "55" "9" "2101545" "2101545" "subst" "0.227534" "00074" "SMARCA2_000032" "g.2101545T>A" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2101545T>A" "" "VUS" "" "0000018925" "0" "55" "9" "2101545" "2101545" "subst" "0.227534" "00074" "SMARCA2_000032" "g.2101545T>A" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2101545T>A" "" "VUS" "" "0000018926" "0" "55" "9" "2101545" "2101545" "subst" "0.227534" "00074" "SMARCA2_000032" "g.2101545T>A" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2101545T>A" "" "VUS" "" "0000018927" "0" "55" "9" "2101545" "2101545" "subst" "0.227534" "00074" "SMARCA2_000032" "g.2101545T>A" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2101545T>A" "" "VUS" "" "0000018928" "0" "55" "9" "2101545" "2101545" "subst" "0.227534" "00074" "SMARCA2_000032" "g.2101545T>A" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2101545T>A" "" "VUS" "" "0000018929" "0" "55" "9" "2101545" "2101545" "subst" "0.227534" "00074" "SMARCA2_000032" "g.2101545T>A" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2101545T>A" "" "VUS" "" "0000018930" "0" "55" "9" "2116037" "2116037" "subst" "0.121458" "00074" "SMARCA2_000048" "g.2116037G>A" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2116037G>A" "" "VUS" "" "0000018931" "0" "55" "9" "2116037" "2116037" "subst" "0.121458" "00074" "SMARCA2_000048" "g.2116037G>A" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2116037G>A" "" "VUS" "" "0000018932" "0" "55" "9" "2116037" "2116037" "subst" "0.121458" "00074" "SMARCA2_000048" "g.2116037G>A" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2116037G>A" "" "VUS" "" "0000018933" "0" "55" "9" "2116037" "2116037" "subst" "0.121458" "00074" "SMARCA2_000048" "g.2116037G>A" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2116037G>A" "" "VUS" "" "0000018934" "0" "55" "9" "2116037" "2116037" "subst" "0.121458" "00074" "SMARCA2_000048" "g.2116037G>A" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2116037G>A" "" "VUS" "" "0000018935" "0" "55" "9" "2116037" "2116037" "subst" "0.121458" "00074" "SMARCA2_000048" "g.2116037G>A" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2116037G>A" "" "VUS" "" "0000018936" "0" "55" "9" "2116037" "2116037" "subst" "0.121458" "00074" "SMARCA2_000048" "g.2116037G>A" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2116037G>A" "" "VUS" "" "0000018937" "0" "55" "9" "2116037" "2116037" "subst" "0.121458" "00074" "SMARCA2_000048" "g.2116037G>A" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2116037G>A" "" "VUS" "" "0000018938" "0" "55" "9" "2116037" "2116037" "subst" "0.121458" "00074" "SMARCA2_000048" "g.2116037G>A" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2116037G>A" "" "VUS" "" "0000018939" "0" "55" "9" "2161733" "2161733" "subst" "0.000544862" "00074" "SMARCA2_000049" "g.2161733T>G" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2161733T>G" "" "VUS" "" "0000018940" "0" "55" "9" "2161949" "2161949" "subst" "0.267507" "00074" "SMARCA2_000050" "g.2161949C>T" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2161949C>T" "" "VUS" "" "0000018941" "0" "55" "9" "2161949" "2161949" "subst" "0.267507" "00074" "SMARCA2_000050" "g.2161949C>T" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2161949C>T" "" "VUS" "" "0000018942" "0" "55" "9" "2161949" "2161949" "subst" "0.267507" "00074" "SMARCA2_000050" "g.2161949C>T" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2161949C>T" "" "VUS" "" "0000018943" "0" "55" "9" "2161949" "2161949" "subst" "0.267507" "00074" "SMARCA2_000050" "g.2161949C>T" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2161949C>T" "" "VUS" "" "0000018944" "0" "55" "9" "2161949" "2161949" "subst" "0.267507" "00074" "SMARCA2_000050" "g.2161949C>T" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2161949C>T" "" "VUS" "" "0000018945" "0" "55" "9" "2170512" "2170512" "subst" "0.506039" "00074" "SMARCA2_000051" "g.2170512G>C" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2170512G>C" "" "VUS" "" "0000018946" "0" "55" "9" "2170512" "2170512" "subst" "0.506039" "00074" "SMARCA2_000051" "g.2170512G>C" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2170512G>C" "" "VUS" "" "0000018947" "3" "55" "9" "2170512" "2170512" "subst" "0.506039" "00074" "SMARCA2_000051" "g.2170512G>C" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2170512G>C" "" "VUS" "" "0000018948" "0" "55" "9" "2170512" "2170512" "subst" "0.506039" "00074" "SMARCA2_000051" "g.2170512G>C" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2170512G>C" "" "VUS" "" "0000018949" "0" "55" "9" "2182290" "2182290" "subst" "0.104205" "00074" "SMARCA2_000052" "g.2182290G>A" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2182290G>A" "" "VUS" "" "0000018950" "0" "55" "9" "2182290" "2182290" "subst" "0.104205" "00074" "SMARCA2_000052" "g.2182290G>A" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2182290G>A" "" "VUS" "" "0000018951" "0" "55" "9" "2186224" "2186224" "subst" "0.0102443" "00074" "SMARCA2_000053" "g.2186224C>T" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2186224C>T" "" "VUS" "" "0000018952" "0" "55" "9" "2186224" "2186224" "subst" "0.0102443" "00074" "SMARCA2_000053" "g.2186224C>T" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2186224C>T" "" "VUS" "" "0000018953" "0" "55" "9" "2191246" "2191246" "subst" "0.0969258" "00074" "SMARCA2_000033" "g.2191246T>C" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2191246T>C" "" "VUS" "" "0000018954" "0" "55" "9" "2191246" "2191246" "subst" "0.0969258" "00074" "SMARCA2_000033" "g.2191246T>C" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2191246T>C" "" "VUS" "" "0000018955" "0" "55" "9" "2191309" "2191309" "subst" "0.168642" "00074" "SMARCA2_000034" "g.2191309C>G" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2191309C>G" "" "VUS" "" "0000018956" "0" "55" "9" "2191309" "2191309" "subst" "0.168642" "00074" "SMARCA2_000034" "g.2191309C>G" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2191309C>G" "" "VUS" "" "0000018957" "0" "55" "9" "2191309" "2191309" "subst" "0.168642" "00074" "SMARCA2_000034" "g.2191309C>G" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2191309C>G" "" "VUS" "" "0000018958" "0" "55" "9" "2039793" "2039793" "subst" "0" "00074" "SMARCA2_000040" "g.2039793A>C" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2039793A>C" "" "VUS" "" "0000018959" "0" "55" "9" "2039793" "2039793" "subst" "0" "00074" "SMARCA2_000040" "g.2039793A>C" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2039793A>C" "" "VUS" "" "0000018960" "0" "55" "9" "2039826" "2039834" "dup" "0" "00074" "SMARCA2_000041" "g.2039826_2039834dup" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2039826_2039834dup" "" "VUS" "" "0000076921" "0" "95" "9" "2116002" "2116002" "subst" "0" "00233" "SMARCA2_000001" "g.2116002C>T" "" "{PMID:Van Houdt et al 2012:22366787}" "" "" "" "Unknown" "" "" "0" "" "" "g.2116002C>T" "" "pathogenic" "" "0000076922" "0" "95" "9" "2115969" "2115969" "subst" "0" "00233" "SMARCA2_000002" "g.2115969G>T" "" "{PMID:Van Houdt et al 2012:22366787}" "" "" "" "Unknown" "" "" "0" "" "" "g.2115969G>T" "" "pathogenic" "" "0000076923" "0" "95" "9" "2115841" "2115841" "subst" "0" "00233" "SMARCA2_000003" "g.2115841G>A" "" "{PMID:Van Houdt et al 2012:22366787}" "" "" "" "Unknown" "" "" "0" "" "" "g.2115841G>A" "" "pathogenic" "" "0000076924" "0" "95" "9" "2115838" "2115838" "subst" "0" "00233" "SMARCA2_000004" "g.2115838A>T" "" "{PMID:Van Houdt et al 2012:22366787}" "" "" "" "Unknown" "" "" "0" "" "" "g.2115838A>T" "" "pathogenic" "" "0000076925" "0" "95" "9" "2115840" "2115840" "subst" "0" "00233" "SMARCA2_000005" "g.2115840C>G" "" "{PMID:Van Houdt et al 2012:22366787}" "" "" "" "Unknown" "" "" "0" "" "" "g.2115840C>G" "" "pathogenic" "" "0000076926" "0" "95" "9" "2086944" "2086944" "subst" "0" "00233" "SMARCA2_000006" "g.2086944G>T" "" "{PMID:Van Houdt et al 2012:22366787}" "" "" "" "Unknown" "" "" "0" "" "" "g.2086944G>T" "" "pathogenic" "" "0000076927" "0" "95" "9" "2115850" "2115850" "subst" "0" "00233" "SMARCA2_000007" "g.2115850G>A" "" "{PMID:Van Houdt et al 2012:22366787}" "" "" "" "Unknown" "" "" "0" "" "" "g.2115850G>A" "" "pathogenic" "" "0000076928" "0" "95" "9" "2115841" "2115841" "subst" "0" "00233" "SMARCA2_000008" "g.2115841G>T" "" "{PMID:Van Houdt et al 2012:22366787}" "" "" "" "Unknown" "" "" "0" "" "" "g.2115841G>T" "" "pathogenic" "" "0000076929" "0" "95" "9" "2086950" "2086950" "subst" "0" "00233" "SMARCA2_000009" "g.2086950C>T" "" "{PMID:Van Houdt et al 2012:22366787}" "" "" "" "Unknown" "" "" "0" "" "" "g.2086950C>T" "" "pathogenic" "" "0000076930" "0" "95" "9" "2115967" "2115967" "subst" "0" "00233" "SMARCA2_000010" "g.2115967C>T" "" "{PMID:Van Houdt et al 2012:22366787}" "" "" "" "Unknown" "" "" "0" "" "" "g.2115967C>T" "" "pathogenic" "" "0000076931" "0" "95" "9" "2088545" "2088545" "subst" "0" "00233" "SMARCA2_000011" "g.2088545C>T" "" "{PMID:Van Houdt et al 2012:22366787}" "" "" "" "Unknown" "" "" "0" "" "" "g.2088545C>T" "" "pathogenic" "" "0000076932" "0" "95" "9" "2081914" "2081914" "subst" "0" "00233" "SMARCA2_000012" "g.2081914C>T" "" "{PMID:Van Houdt et al 2012:22366787}" "" "" "" "Unknown" "" "" "0" "" "" "g.2081914C>T" "" "pathogenic" "" "0000076933" "0" "95" "9" "2110274" "2110274" "subst" "0" "00233" "SMARCA2_000013" "g.2110274C>T" "" "{PMID:Van Houdt et al 2012:22366787}" "" "" "" "Unknown" "" "" "0" "" "" "g.2110274C>T" "" "pathogenic" "" "0000076934" "0" "95" "9" "2086858" "2086858" "subst" "0" "00233" "SMARCA2_000014" "g.2086858A>C" "" "{PMID:Van Houdt et al 2012:22366787}" "" "" "" "Unknown" "" "" "0" "" "" "g.2086858A>C" "" "pathogenic" "" "0000076935" "0" "95" "9" "2086943" "2086943" "subst" "0" "00233" "SMARCA2_000015" "g.2086943G>C" "" "{PMID:Van Houdt et al 2012:22366787}" "" "" "" "Unknown" "" "" "0" "" "" "g.2086943G>C" "" "pathogenic" "" "0000076936" "0" "95" "9" "2110365" "2110365" "subst" "4.07349E-6" "00233" "SMARCA2_000016" "g.2110365T>C" "" "{PMID:Van Houdt et al 2012:22366787}" "" "" "" "Unknown" "" "" "0" "" "" "g.2110365T>C" "" "pathogenic" "" "0000076937" "0" "95" "9" "2115927" "2115927" "subst" "0" "00233" "SMARCA2_000017" "g.2115927G>C" "" "{PMID:Van Houdt et al 2012:22366787}" "" "" "" "Unknown" "" "" "0" "" "" "g.2115927G>C" "" "pathogenic" "" "0000076938" "0" "95" "9" "2110275" "2110275" "subst" "0" "00233" "SMARCA2_000018" "g.2110275G>C" "" "{PMID:Van Houdt et al 2012:22366787}" "" "" "" "Unknown" "" "" "0" "" "" "g.2110275G>C" "" "pathogenic" "" "0000076939" "0" "95" "9" "2081902" "2081902" "subst" "0" "00233" "SMARCA2_000019" "g.2081902G>C" "" "{PMID:Van Houdt et al 2012:22366787}" "" "" "" "Unknown" "" "" "0" "" "" "g.2081902G>C" "" "pathogenic" "" "0000076940" "0" "95" "9" "2086856" "2086856" "subst" "0" "00233" "SMARCA2_000020" "g.2086856G>A" "" "{PMID:Van Houdt et al 2012:22366787}" "" "" "" "Unknown" "" "" "0" "" "" "g.2086856G>A" "" "pathogenic" "" "0000076941" "0" "95" "9" "2088567" "2088567" "subst" "0" "00233" "SMARCA2_000021" "g.2088567T>C" "" "{PMID:Van Houdt et al 2012:22366787}" "" "" "" "Unknown" "" "" "0" "" "" "g.2088567T>C" "" "pathogenic" "" "0000076942" "0" "95" "9" "2115979" "2115979" "subst" "0" "00233" "SMARCA2_000022" "g.2115979A>G" "" "{PMID:Van Houdt et al 2012:22366787}" "" "" "" "Unknown" "" "" "0" "" "" "g.2115979A>G" "" "pathogenic" "" "0000076943" "0" "95" "9" "2086863" "2086863" "subst" "0" "00233" "SMARCA2_000023" "g.2086863A>G" "" "{PMID:Van Houdt et al 2012:22366787}" "" "" "" "Unknown" "" "" "0" "" "" "g.2086863A>G" "" "pathogenic" "" "0000076944" "0" "95" "9" "2081911" "2081911" "subst" "0" "00233" "SMARCA2_000024" "g.2081911A>G" "" "{PMID:Van Houdt et al 2012:22366787}" "" "" "" "Unknown" "" "" "0" "" "" "g.2081911A>G" "" "pathogenic" "" "0000076945" "0" "95" "9" "2110397" "2110397" "subst" "0" "00233" "SMARCA2_000025" "g.2110397A>C" "" "{PMID:Van Houdt et al 2012:22366787}" "" "" "" "Unknown" "" "" "0" "" "" "g.2110397A>C" "" "pathogenic" "" "0000076946" "0" "95" "9" "2088568" "2088568" "subst" "0" "00233" "SMARCA2_000026" "g.2088568A>T" "" "{PMID:Van Houdt et al 2012:22366787}" "" "" "" "Unknown" "" "" "0" "" "" "g.2088568A>T" "" "pathogenic" "" "0000076947" "0" "95" "9" "2086853" "2086853" "subst" "0" "00233" "SMARCA2_000027" "g.2086853G>C" "" "{PMID:Van Houdt et al 2012:22366787}" "" "" "" "Unknown" "" "" "0" "" "" "g.2086853G>C" "" "pathogenic" "" "0000076948" "0" "95" "9" "2086865" "2086865" "subst" "0" "00233" "SMARCA2_000028" "g.2086865C>G" "" "{PMID:Van Houdt et al 2012:22366787}" "" "" "" "Unknown" "" "" "0" "" "" "g.2086865C>G" "" "pathogenic" "" "0000079324" "0" "90" "9" "2060868" "2060868" "subst" "0" "00006" "SMARCA2_000056" "g.2060868G>A" "" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "" "" "" "De novo" "" "" "0" "" "" "g.2060868G>A" "" "pathogenic" "" "0000079394" "0" "90" "9" "2058457" "2058457" "subst" "0" "00006" "SMARCA2_000058" "g.2058457G>A" "" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "" "" "" "De novo" "" "" "0" "" "" "g.2058457G>A" "" "pathogenic" "" "0000079484" "0" "90" "9" "204104" "8198999" "del" "0" "00006" "GLDC_000111" "g.204104_8198999del" "" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "" "" "decreased gene dosage" "De novo" "" "" "0" "" "" "g.204104_8198999del" "" "pathogenic" "" "0000079530" "0" "90" "9" "2181575" "2181575" "subst" "0" "00006" "SMARCA2_000055" "g.2181575G>A" "" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "" "" "" "De novo" "" "" "0" "" "" "g.2181575G>A" "" "pathogenic" "" "0000079572" "0" "90" "9" "2060867" "2060867" "subst" "0" "00006" "SMARCA2_000057" "g.2060867C>T" "" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "" "" "" "De novo" "" "" "0" "" "" "g.2060867C>T" "" "pathogenic" "" "0000140360" "0" "90" "9" "2086856" "2086856" "subst" "0" "00006" "SMARCA2_000020" "g.2086856G>A" "" "{PMID:Wieczorek 2013:23906836}" "" "" "" "De novo" "" "" "0" "" "" "g.2086856G>A" "" "pathogenic" "" "0000140361" "0" "90" "9" "2086941" "2086941" "subst" "0" "00006" "SMARCA2_000059" "g.2086941C>T" "" "{PMID:Wieczorek 2013:23906836}" "" "" "" "De novo" "" "" "0" "" "" "g.2086941C>T" "" "pathogenic" "" "0000140362" "0" "90" "9" "2086866" "2086866" "subst" "0" "00006" "SMARCA2_000060" "g.2086866G>A" "" "{PMID:Wieczorek 2013:23906836}" "" "" "" "De novo" "" "" "0" "" "" "g.2086866G>A" "" "pathogenic" "" "0000248618" "0" "10" "9" "2073292" "2073292" "subst" "0.11998" "02325" "SMARCA2_000082" "g.2073292A>G" "" "" "" "SMARCA2(NM_003070.5):c.1827A>G (p.P609=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2073292A>G" "" "benign" "" "0000254906" "0" "30" "9" "2039818" "2039818" "subst" "0" "01943" "SMARCA2_000079" "g.2039818A>G" "" "" "" "SMARCA2(NM_003070.4):c.708A>G (p.Q236=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2039818A>G" "" "likely benign" "" "0000298380" "0" "50" "9" "2087046" "2087046" "subst" "0" "02325" "SMARCA2_000084" "g.2087046C>A" "" "" "" "SMARCA2(NM_003070.5):c.2744C>A (p.A915D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2087046C>A" "" "VUS" "" "0000298381" "0" "50" "9" "2039621" "2039621" "subst" "0" "02325" "SMARCA2_000061" "g.2039621C>A" "" "" "" "SMARCA2(NM_003070.5):c.511C>A (p.P171T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2039621C>A" "" "VUS" "" "0000298382" "0" "50" "9" "2039778" "2039779" "del" "0" "02325" "SMARCA2_000069" "g.2039778_2039779del" "" "" "" "SMARCA2(NM_003070.5):c.668_669delAG (p.Q223Pfs*35)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2039778_2039779del" "" "VUS" "" "0000298383" "0" "30" "9" "2039809" "2039817" "del" "0" "02325" "SMARCA2_000066" "g.2039809_2039817del" "" "" "" "SMARCA2(NM_003070.3):c.667_675del (p.(Gln226_Gln228del)), SMARCA2(NM_003070.4):c.699_707delGCAGCAGCA (p.Q236_Q238del), SMARCA2(NM_003070.5):c.699_7..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2039809_2039817del" "" "likely benign" "" "0000298385" "0" "10" "9" "2039815" "2039817" "del" "0" "02325" "SMARCA2_000065" "g.2039815_2039817del" "" "" "" "SMARCA2(NM_003070.3):c.667_669del (p.(Gln225del)), SMARCA2(NM_003070.4):c.705_707delGCA (p.Q238del), SMARCA2(NM_003070.5):c.705_707delGCA (p.Q238del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2039815_2039817del" "" "benign" "" "0000302332" "0" "10" "9" "2083337" "2083337" "dup" "0" "02326" "SMARCA2_000083" "g.2083337dup" "" "" "" "SMARCA2(NM_003070.5):c.2349-10dupT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2083337dup" "" "benign" "" "0000302333" "0" "70" "9" "2110398" "2110398" "subst" "0" "02326" "SMARCA2_000086" "g.2110398G>C" "" "" "" "SMARCA2(NM_003070.5):c.3437G>C (p.S1146T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2110398G>C" "" "likely pathogenic" "" "0000302335" "0" "30" "9" "2039815" "2039817" "del" "0" "02326" "SMARCA2_000065" "g.2039815_2039817del" "" "" "" "SMARCA2(NM_003070.3):c.667_669del (p.(Gln225del)), SMARCA2(NM_003070.4):c.705_707delGCA (p.Q238del), SMARCA2(NM_003070.5):c.705_707delGCA (p.Q238del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2039815_2039817del" "" "likely benign" "" "0000308581" "0" "50" "9" "2047456" "2047456" "subst" "0" "01943" "SMARCA2_000081" "g.2047456G>C" "" "" "" "SMARCA2(NM_003070.4):c.1018G>C (p.V340L), SMARCA2(NM_003070.5):c.1018G>C (p.(Val340Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2047456G>C" "" "VUS" "" "0000308582" "0" "30" "9" "2104069" "2104069" "subst" "2.43677E-5" "01943" "SMARCA2_000085" "g.2104069G>T" "" "" "" "SMARCA2(NM_003070.4):c.3192G>T (p.A1064=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2104069G>T" "" "likely benign" "" "0000308583" "0" "30" "9" "2110399" "2110399" "subst" "0.00119753" "01943" "SMARCA2_000087" "g.2110399C>T" "" "" "" "SMARCA2(NM_003070.4):c.3438C>T (p.S1146=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2110399C>T" "" "likely benign" "" "0000308584" "0" "30" "9" "2191259" "2191259" "subst" "0.000597459" "01943" "SMARCA2_000088" "g.2191259G>C" "" "" "" "SMARCA2(NM_003070.3):c.4595-7G>C (p.?), SMARCA2(NM_003070.4):c.4595-7G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2191259G>C" "" "likely benign" "" "0000308587" "0" "10" "9" "2039815" "2039817" "del" "0" "01943" "SMARCA2_000065" "g.2039815_2039817del" "" "" "" "SMARCA2(NM_003070.3):c.667_669del (p.(Gln225del)), SMARCA2(NM_003070.4):c.705_707delGCA (p.Q238del), SMARCA2(NM_003070.5):c.705_707delGCA (p.Q238del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2039815_2039817del" "" "benign" "" "0000332533" "0" "50" "9" "2029183" "2029183" "subst" "0" "01804" "SMARCA2_000111" "g.2029183C>T" "" "" "" "SMARCA2(NM_003070.3):c.161C>T (p.(Ser54Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2029183C>T" "" "VUS" "" "0000332534" "0" "50" "9" "2033036" "2033036" "subst" "0" "01804" "SMARCA2_000112" "g.2033036C>T" "" "" "" "SMARCA2(NM_003070.3):c.310C>T (p.(Pro104Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2033036C>T" "" "VUS" "" "0000332535" "0" "50" "9" "2033061" "2033061" "subst" "0" "01804" "SMARCA2_000113" "g.2033061C>A" "" "" "" "SMARCA2(NM_003070.3):c.335C>A (p.(Pro112Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2033061C>A" "" "VUS" "" "0000332536" "0" "30" "9" "2039809" "2039817" "dup" "0" "01804" "SMARCA2_000064" "g.2039809_2039817dup" "" "" "" "SMARCA2(NM_003070.3):c.669_670insCAGCAGCAG (p.(Gln221_Gln223dup)), SMARCA2(NM_003070.4):c.699_707dupGCAGCAGCA (p.Q236_Q238dup), SMARCA2(NM_003070....)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2039809_2039817dup" "" "likely benign" "" "0000332538" "0" "30" "9" "2039809" "2039817" "del" "0" "01804" "SMARCA2_000066" "g.2039809_2039817del" "" "" "" "SMARCA2(NM_003070.3):c.667_675del (p.(Gln226_Gln228del)), SMARCA2(NM_003070.4):c.699_707delGCAGCAGCA (p.Q236_Q238del), SMARCA2(NM_003070.5):c.699_7..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2039809_2039817del" "" "likely benign" "" "0000332539" "0" "30" "9" "2039806" "2039817" "del" "0" "01804" "SMARCA2_000067" "g.2039806_2039817del" "" "" "" "SMARCA2(NM_003070.3):c.667_678del (p.(Gln227_Gln230del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2039806_2039817del" "" "likely benign" "" "0000332540" "0" "30" "9" "2039803" "2039817" "del" "0" "01804" "SMARCA2_000068" "g.2039803_2039817del" "" "" "" "SMARCA2(NM_003070.3):c.667_681del (p.(Gln228_Gln232del)), SMARCA2(NM_003070.5):c.693_707delGCAGCAGCAGCAGCA (p.Q234_Q238del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2039803_2039817del" "" "likely benign" "" "0000332542" "0" "50" "9" "2039815" "2039817" "del" "0" "01804" "SMARCA2_000072" "g.2039815_2039817del" "" "" "" "SMARCA2(NM_003070.3):c.667_669del (p.(Gln225del)), SMARCA2(NM_003070.4):c.705_707delGCA (p.Q238del), SMARCA2(NM_003070.5):c.705_707delGCA (p.Q238del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2039815_2039817del" "" "VUS" "" "0000332547" "0" "50" "9" "2047282" "2047282" "subst" "0" "01804" "SMARCA2_000080" "g.2047282G>A" "" "" "" "SMARCA2(NM_003070.3):c.844G>A (p.(Ala282Thr)), SMARCA2(NM_003070.4):c.844G>A (p.A282T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2047282G>A" "" "VUS" "" "0000332548" "0" "30" "9" "2191259" "2191259" "subst" "0.000597459" "01804" "SMARCA2_000088" "g.2191259G>C" "" "" "" "SMARCA2(NM_003070.3):c.4595-7G>C (p.?), SMARCA2(NM_003070.4):c.4595-7G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2191259G>C" "" "likely benign" "" "0000341121" "0" "50" "9" "2110344" "2110344" "subst" "0" "02327" "SMARCA2_000090" "g.2110344C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2110344C>A" "" "VUS" "" "0000341716" "0" "90" "9" "2110275" "2110275" "subst" "0" "02327" "SMARCA2_000047" "g.2110275G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2110275G>A" "" "pathogenic" "" "0000343900" "0" "50" "9" "2123746" "2123746" "subst" "0" "02327" "SMARCA2_000092" "g.2123746G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2123746G>A" "" "VUS" "" "0000345654" "0" "70" "9" "2110355" "2110355" "subst" "0" "02327" "SMARCA2_000091" "g.2110355G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2110355G>C" "" "likely pathogenic" "" "0000346367" "0" "50" "9" "2039480" "2039480" "subst" "0" "02327" "SMARCA2_000089" "g.2039480C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2039480C>T" "" "VUS" "" "0000347416" "0" "50" "9" "2181669" "2181669" "subst" "0" "02327" "SMARCA2_000093" "g.2181669A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2181669A>C" "" "VUS" "" "0000368381" "0" "70" "9" "2081873" "2081878" "del" "0" "01807" "SMARCA2_000095" "g.2081873_2081878delinsT" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.2081873_2081878delinsT" "" "likely pathogenic" "" "0000394876" "0" "90" "9" "2094286" "2147059" "del" "0" "00008" "SMARCA2_000096" "g.2094286_2147059del" "" "{PMID:Tsurusaki 2012:22426308}, {PMID:Sousa2014:25169058}" "" "del ex20-26" "32kb in-frame deletion" "De novo" "" "" "0" "" "" "g.2094286_2147059del" "" "pathogenic (dominant)" "" "0000394877" "1" "50" "9" "2086863" "2086863" "subst" "0" "00008" "SMARCA2_000023" "g.2086863A>G" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(His854Arg), not specified" "" "Unknown" "" "" "0" "" "" "g.2086863A>G" "" "VUS" "" "0000394878" "1" "50" "9" "2086863" "2086863" "subst" "0" "00008" "SMARCA2_000098" "g.2086863A>T" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(His854Leu), not specified" "" "Unknown" "" "" "0" "" "" "g.2086863A>T" "" "VUS" "" "0000394879" "1" "50" "9" "2086856" "2086856" "subst" "0" "00008" "SMARCA2_000044" "g.2086856G>C" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Glu852Gln), not specified" "" "Unknown" "" "" "0" "" "" "g.2086856G>C" "" "VUS" "" "0000394880" "1" "50" "9" "0" "0" "" "0" "00008" "PTCH1_000000" "g.?" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Glu852Asp), not specified" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000394881" "1" "50" "9" "2086856" "2086856" "subst" "0" "00008" "SMARCA2_000020" "g.2086856G>A" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Glu852Lys), not specified" "" "Unknown" "" "" "0" "" "" "g.2086856G>A" "" "VUS" "" "0000394882" "1" "50" "9" "2086856" "2086856" "subst" "0" "00008" "SMARCA2_000020" "g.2086856G>A" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Glu852Lys), not specified" "" "Unknown" "" "" "0" "" "" "g.2086856G>A" "" "VUS" "" "0000394883" "1" "50" "9" "2086853" "2086853" "subst" "0" "00008" "SMARCA2_000027" "g.2086853G>C" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Asp851His), not specified" "" "Unknown" "" "" "0" "" "" "g.2086853G>C" "" "VUS" "" "0000394884" "1" "50" "9" "0" "0" "" "0" "00008" "PTCH1_000000" "g.?" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Phe903Leu), not specified" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000394885" "1" "50" "9" "2086950" "2086950" "subst" "0" "00008" "SMARCA2_000009" "g.2086950C>T" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Pro883Leu), not specified" "" "Unknown" "" "" "0" "" "" "g.2086950C>T" "" "VUS" "" "0000394886" "1" "50" "9" "2086950" "2086950" "subst" "0" "00008" "SMARCA2_000009" "g.2086950C>T" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Pro883Leu), not specified" "" "Unknown" "" "" "0" "" "" "g.2086950C>T" "" "VUS" "" "0000394888" "1" "50" "9" "2086950" "2086950" "subst" "0" "00008" "SMARCA2_000009" "g.2086950C>T" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Pro883Leu), not specified" "" "Unknown" "" "" "0" "" "" "g.2086950C>T" "" "VUS" "" "0000394889" "1" "50" "9" "0" "0" "" "0" "00008" "PTCH1_000000" "g.?" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Gly881Arg), not specified" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000394890" "1" "50" "9" "2086944" "2086944" "subst" "0" "00008" "SMARCA2_000006" "g.2086944G>T" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Gly881Val), not specified" "" "Unknown" "" "" "0" "" "" "g.2086944G>T" "" "VUS" "" "0000394891" "1" "50" "9" "2086941" "2086941" "subst" "0" "00008" "SMARCA2_000059" "g.2086941C>T" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Thr880Ile), not specified" "" "Unknown" "" "" "0" "" "" "g.2086941C>T" "" "VUS" "" "0000394892" "1" "50" "9" "0" "0" "" "0" "00008" "PTCH1_000000" "g.?" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Leu946Phe), not specified" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000394893" "1" "50" "9" "2088567" "2088567" "subst" "0" "00008" "SMARCA2_000021" "g.2088567T>C" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Leu946Ser), not specified" "" "Unknown" "" "" "0" "" "" "g.2088567T>C" "" "VUS" "" "0000394894" "1" "50" "9" "2088545" "2088545" "subst" "0" "00008" "SMARCA2_000011" "g.2088545C>T" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(His939tyr), not specified" "" "Unknown" "" "" "0" "" "" "g.2088545C>T" "" "VUS" "" "0000394895" "1" "50" "9" "2088545" "2088545" "subst" "0" "00008" "SMARCA2_000011" "g.2088545C>T" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(His939Tyr), not specified" "" "Unknown" "" "" "0" "" "" "g.2088545C>T" "" "VUS" "" "0000394896" "1" "50" "9" "2104097" "2104097" "subst" "0" "00008" "SMARCA2_000101" "g.2104097C>G" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Gln1074Glu), not specified" "" "Unknown" "" "" "0" "" "" "g.2104097C>G" "" "VUS" "" "0000394897" "1" "50" "9" "2104086" "2104086" "subst" "0" "00008" "SMARCA2_000100" "g.2104086T>A" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Leu1070Gln), not specified" "" "Unknown" "" "" "0" "" "" "g.2104086T>A" "" "VUS" "" "0000394898" "1" "50" "9" "2081995" "2081995" "subst" "0" "00008" "SMARCA2_000097" "g.2081995C>G" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Ser783Trp), not specified" "" "Unknown" "" "" "0" "" "" "g.2081995C>G" "" "VUS" "" "0000394899" "1" "50" "9" "2110254" "2110254" "subst" "0" "00008" "SMARCA2_000039" "g.2110254G>A" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Gly1098Asp), not specified" "" "Unknown" "" "" "0" "" "" "g.2110254G>A" "" "VUS" "" "0000394900" "1" "50" "9" "2110275" "2110275" "subst" "0" "00008" "SMARCA2_000047" "g.2110275G>A" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Arg1105His), not specified" "" "Unknown" "" "" "0" "" "" "g.2110275G>A" "" "VUS" "" "0000394901" "1" "50" "9" "2110275" "2110275" "subst" "0" "00008" "SMARCA2_000047" "g.2110275G>A" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Arg1105His), not specified" "" "Unknown" "" "" "0" "" "" "g.2110275G>A" "" "VUS" "" "0000394902" "1" "50" "9" "2110275" "2110275" "subst" "0" "00008" "SMARCA2_000018" "g.2110275G>C" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Arg1105Pro), not specified" "" "Unknown" "" "" "0" "" "" "g.2110275G>C" "" "VUS" "" "0000394903" "1" "50" "9" "2110274" "2110274" "subst" "0" "00008" "SMARCA2_000013" "g.2110274C>T" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Arg1105Cys), not specified" "" "Unknown" "" "" "0" "" "" "g.2110274C>T" "" "VUS" "" "0000394904" "1" "50" "9" "2110338" "2110338" "subst" "0" "00008" "SMARCA2_000102" "g.2110338C>G" "" "{PMID:Sousa SB 2014:25169058}" "" "(p.Thr1126Arg), not specified" "" "Unknown" "" "" "0" "" "" "g.2110338C>G" "" "VUS" "" "0000394905" "1" "50" "9" "2110346" "2110346" "subst" "0" "00008" "SMARCA2_000103" "g.2110346G>C" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Gly1129Arg), not specified" "" "Unknown" "" "" "0" "" "" "g.2110346G>C" "" "VUS" "" "0000394906" "1" "50" "9" "2110353" "2110353" "subst" "0" "00008" "SMARCA2_000104" "g.2110353T>C" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Leu1131Pro), not specified" "" "Unknown" "" "" "0" "" "" "g.2110353T>C" "" "VUS" "" "0000394907" "1" "50" "9" "2110356" "2110356" "subst" "0" "00008" "SMARCA2_000105" "g.2110356G>A" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Gly1132Asp), not specified" "" "Unknown" "" "" "0" "" "" "g.2110356G>A" "" "VUS" "" "0000394908" "1" "50" "9" "2110365" "2110365" "subst" "4.07349E-6" "00008" "SMARCA2_000016" "g.2110365T>C" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Leu1135Pro), not specified" "" "Unknown" "" "" "0" "" "" "g.2110365T>C" "" "VUS" "" "0000394909" "1" "50" "9" "2081914" "2081914" "subst" "0" "00008" "SMARCA2_000012" "g.2081914C>T" "" "{PMID:Sousa SB 2014:25169058}" "" "p(.T756I), not specified" "" "Unknown" "" "" "0" "" "" "g.2081914C>T" "" "VUS" "" "0000394910" "1" "50" "9" "0" "0" "" "0" "00008" "PTCH1_000000" "g.?" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Ser1146Arg), not specified" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000394911" "1" "50" "9" "2115831" "2115831" "subst" "0" "00008" "SMARCA2_000106" "g.2115831G>C" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Ala1156Pro), not specified" "" "Unknown" "" "" "0" "" "" "g.2115831G>C" "" "VUS" "" "0000394912" "1" "50" "9" "2115838" "2115838" "subst" "0" "00008" "SMARCA2_000004" "g.2115838A>T" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Asp1158Val), not specified" "" "Unknown" "" "" "0" "" "" "g.2115838A>T" "" "VUS" "" "0000394913" "1" "50" "9" "2115928" "2115928" "subst" "0" "00008" "SMARCA2_000108" "g.2115928C>A" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Ala1188Glu), not specified" "" "Unknown" "" "" "0" "" "" "g.2115928C>A" "" "VUS" "" "0000394914" "1" "50" "9" "2115927" "2115927" "subst" "0" "00008" "SMARCA2_000017" "g.2115927G>C" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Ala1188Pro), not specified" "" "Unknown" "" "" "0" "" "" "g.2115927G>C" "" "VUS" "" "0000394915" "1" "50" "9" "2115850" "2115850" "subst" "0" "00008" "SMARCA2_000007" "g.2115850G>A" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Arg1162His), not specified" "" "Unknown" "" "" "0" "" "" "g.2115850G>A" "" "VUS" "" "0000394916" "1" "50" "9" "2115850" "2115850" "subst" "0" "00008" "SMARCA2_000007" "g.2115850G>A" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Arg1162His), not specified" "" "Unknown" "" "" "0" "" "" "g.2115850G>A" "" "VUS" "" "0000394917" "1" "50" "9" "2115849" "2115849" "subst" "0" "00008" "SMARCA2_000107" "g.2115849C>A" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Arg1162Ser), not specified" "" "Unknown" "" "" "0" "" "" "g.2115849C>A" "" "VUS" "" "0000394918" "1" "50" "9" "2115840" "2115840" "subst" "0" "00008" "SMARCA2_000005" "g.2115840C>G" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Arg1159Gly), not specified" "" "Unknown" "" "" "0" "" "" "g.2115840C>G" "" "VUS" "" "0000394919" "1" "50" "9" "2115840" "2115840" "subst" "0" "00008" "SMARCA2_000005" "g.2115840C>G" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Arg1159Gly), not specified" "" "Unknown" "" "" "0" "" "" "g.2115840C>G" "" "VUS" "" "0000394920" "1" "50" "9" "2081911" "2081911" "subst" "0" "00008" "SMARCA2_000024" "g.2081911A>G" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Lys755Arg), not specified" "" "Unknown" "" "" "0" "" "" "g.2081911A>G" "" "VUS" "" "0000394921" "1" "50" "9" "2115840" "2115840" "subst" "0" "00008" "SMARCA2_000005" "g.2115840C>G" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Arg1159Gly), not specified" "" "Unknown" "" "" "0" "" "" "g.2115840C>G" "" "VUS" "" "0000394922" "1" "50" "9" "2115841" "2115841" "subst" "0" "00008" "SMARCA2_000003" "g.2115841G>A" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Arg1159Gln), not specified" "" "Unknown" "" "" "0" "" "" "g.2115841G>A" "" "VUS" "" "0000394923" "1" "50" "9" "2115841" "2115841" "subst" "0" "00008" "SMARCA2_000003" "g.2115841G>A" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Arg1159Gln), not specified" "" "Unknown" "" "" "0" "" "" "g.2115841G>A" "" "VUS" "" "0000394924" "1" "50" "9" "2115841" "2115841" "subst" "0" "00008" "SMARCA2_000008" "g.2115841G>T" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Arg1159Leu), not specified" "" "Unknown" "" "" "0" "" "" "g.2115841G>T" "" "VUS" "" "0000394925" "1" "50" "9" "2115958" "2115958" "subst" "0" "00008" "SMARCA2_000109" "g.2115958T>G" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Val1198Gly), not specified" "" "Unknown" "" "" "0" "" "" "g.2115958T>G" "" "VUS" "" "0000394926" "1" "50" "9" "2115967" "2115967" "subst" "0" "00008" "SMARCA2_000010" "g.2115967C>T" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Ala1201Val), not specified" "" "Unknown" "" "" "0" "" "" "g.2115967C>T" "" "VUS" "" "0000394927" "1" "50" "9" "2115967" "2115967" "subst" "0" "00008" "SMARCA2_000010" "g.2115967C>T" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Ala1201Val), not specified" "" "Unknown" "" "" "0" "" "" "g.2115967C>T" "" "VUS" "" "0000394928" "1" "50" "9" "2115967" "2115967" "subst" "0" "00008" "SMARCA2_000010" "g.2115967C>T" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Ala1201Val), not specified" "" "Unknown" "" "" "0" "" "" "g.2115967C>T" "" "VUS" "" "0000394929" "1" "50" "9" "2115967" "2115967" "subst" "0" "00008" "SMARCA2_000010" "g.2115967C>T" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Ala1201Val), not specified" "" "Unknown" "" "" "0" "" "" "g.2115967C>T" "" "VUS" "" "0000394930" "1" "50" "9" "2115969" "2115969" "subst" "0" "00008" "SMARCA2_000002" "g.2115969G>T" "" "{PMID:Sousa SB 2014:25169058}" "" "(p.Gly1202Cys), not specified" "" "Unknown" "" "" "0" "" "" "g.2115969G>T" "" "VUS" "" "0000394931" "1" "50" "9" "2081902" "2081902" "subst" "0" "00008" "SMARCA2_000019" "g.2081902G>C" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Gly752Ala), not specified" "" "Unknown" "" "" "0" "" "" "g.2081902G>C" "" "VUS" "" "0000394932" "1" "50" "9" "2115979" "2115979" "subst" "0" "00008" "SMARCA2_000022" "g.2115979A>G" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Asp1205Gly), not specified" "" "Unknown" "" "" "0" "" "" "g.2115979A>G" "" "VUS" "" "0000394933" "1" "50" "9" "2116002" "2116002" "subst" "0" "00008" "SMARCA2_000001" "g.2116002C>T" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Arg1213Trp), not specified" "" "Unknown" "" "" "0" "" "" "g.2116002C>T" "" "VUS" "" "0000394934" "1" "50" "9" "2081902" "2081902" "subst" "0" "00008" "SMARCA2_000019" "g.2081902G>C" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(G752A), not specified" "" "Unknown" "" "" "0" "" "" "g.2081902G>C" "" "VUS" "" "0000394935" "1" "50" "9" "2086865" "2086865" "subst" "0" "00008" "SMARCA2_000028" "g.2086865C>G" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Arg855Gly), not specified" "" "Unknown" "" "" "0" "" "" "g.2086865C>G" "" "VUS" "" "0000394936" "1" "50" "9" "2086866" "2086866" "subst" "0" "00008" "SMARCA2_000060" "g.2086866G>A" "" "{PMID:Sousa SB 2014:25169058}" "" "p.(Arg855Gln), not specified" "" "Unknown" "" "" "0" "" "" "g.2086866G>A" "" "VUS" "" "0000537752" "0" "50" "9" "2029069" "2029069" "subst" "0" "01804" "SMARCA2_000110" "g.2029069C>T" "" "" "" "SMARCA2(NM_003070.3):c.47C>T (p.(Ser16Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2029069C>T" "" "VUS" "" "0000537753" "0" "30" "9" "2039776" "2039776" "subst" "0" "01943" "SMARCA2_000114" "g.2039776A>G" "" "" "" "SMARCA2(NM_003070.4):c.666_669delACAGinsGCAG (p.Q222_Q223=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2039776A>G" "" "likely benign" "" "0000537758" "0" "30" "9" "2039793" "2039793" "subst" "0" "01804" "SMARCA2_000040" "g.2039793A>C" "" "" "" "SMARCA2(NM_003070.5):c.683A>C (p.(Gln228Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2039793A>C" "" "likely benign" "" "0000537759" "0" "10" "9" "2039795" "2039796" "ins" "0" "01943" "SMARCA2_000119" "g.2039795_2039796insCGC" "" "" "" "SMARCA2(NM_003070.4):c.685_686insCGC (p.Q228_Q229insP), SMARCA2(NM_003070.5):c.685_686insCGC (p.(Gln228_Gln229insPro)), SMARCA2(NM_003070.5):c.685_..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2039795_2039796insCGC" "" "benign" "" "0000537760" "0" "30" "9" "2039809" "2039817" "dup" "0" "02325" "SMARCA2_000064" "g.2039809_2039817dup" "" "" "" "SMARCA2(NM_003070.3):c.669_670insCAGCAGCAG (p.(Gln221_Gln223dup)), SMARCA2(NM_003070.4):c.699_707dupGCAGCAGCA (p.Q236_Q238dup), SMARCA2(NM_003070....)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2039809_2039817dup" "" "likely benign" "" "0000537762" "0" "10" "9" "2039809" "2039817" "dup" "0" "01943" "SMARCA2_000064" "g.2039809_2039817dup" "" "" "" "SMARCA2(NM_003070.3):c.669_670insCAGCAGCAG (p.(Gln221_Gln223dup)), SMARCA2(NM_003070.4):c.699_707dupGCAGCAGCA (p.Q236_Q238dup), SMARCA2(NM_003070....)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2039809_2039817dup" "" "benign" "" "0000537763" "0" "30" "9" "2039812" "2039817" "del" "0" "01804" "SMARCA2_000120" "g.2039812_2039817del" "" "" "" "SMARCA2(NM_003070.5):c.702_707del (p.(Gln237_Gln238del)), SMARCA2(NM_003070.5):c.702_707delGCAGCA (p.Q237_Q238del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2039812_2039817del" "" "likely benign" "" "0000537764" "0" "30" "9" "2039812" "2039817" "dup" "0" "02326" "SMARCA2_000121" "g.2039812_2039817dup" "" "" "" "SMARCA2(NM_003070.3):c.669_670insCAGCAG (p.(Gln222_Gln223dup)), SMARCA2(NM_003070.4):c.702_707dupGCAGCA (p.Q237_Q238dup), SMARCA2(NM_003070.5):c.70..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2039812_2039817dup" "" "likely benign" "" "0000537765" "0" "10" "9" "2039812" "2039817" "dup" "0" "01943" "SMARCA2_000121" "g.2039812_2039817dup" "" "" "" "SMARCA2(NM_003070.3):c.669_670insCAGCAG (p.(Gln222_Gln223dup)), SMARCA2(NM_003070.4):c.702_707dupGCAGCA (p.Q237_Q238dup), SMARCA2(NM_003070.5):c.70..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2039812_2039817dup" "" "benign" "" "0000537766" "0" "10" "9" "2039812" "2039817" "dup" "0" "02325" "SMARCA2_000121" "g.2039812_2039817dup" "" "" "" "SMARCA2(NM_003070.3):c.669_670insCAGCAG (p.(Gln222_Gln223dup)), SMARCA2(NM_003070.4):c.702_707dupGCAGCA (p.Q237_Q238dup), SMARCA2(NM_003070.5):c.70..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2039812_2039817dup" "" "benign" "" "0000537768" "0" "10" "9" "2039815" "2039817" "dup" "0" "01943" "SMARCA2_000122" "g.2039815_2039817dup" "" "" "" "SMARCA2(NM_003070.3):c.667_669dup (p.(Gln223dup)), SMARCA2(NM_003070.4):c.705_707dupGCA (p.Q238dup), SMARCA2(NM_003070.5):c.705_707dupGCA (p.Q238dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2039815_2039817dup" "" "benign" "" "0000537771" "0" "90" "9" "2060867" "2060867" "subst" "0" "02327" "SMARCA2_000057" "g.2060867C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2060867C>T" "" "pathogenic" "" "0000537772" "0" "30" "9" "2070479" "2070479" "subst" "6.91856E-5" "01804" "SMARCA2_000125" "g.2070479A>G" "" "" "" "SMARCA2(NM_003070.3):c.1746+8A>G (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2070479A>G" "" "likely benign" "" "0000537775" "0" "30" "9" "2077620" "2077620" "subst" "1.63953E-5" "01943" "SMARCA2_000126" "g.2077620C>T" "" "" "" "SMARCA2(NM_003070.4):c.2037-9C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2077620C>T" "" "likely benign" "" "0000537776" "0" "30" "9" "2083341" "2083341" "subst" "0" "01804" "SMARCA2_000127" "g.2083341C>T" "" "" "" "SMARCA2(NM_003070.3):c.2349-6C>T (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2083341C>T" "" "likely benign" "" "0000537779" "0" "70" "9" "2084101" "2084101" "subst" "0" "02327" "SMARCA2_000130" "g.2084101C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2084101C>T" "" "likely pathogenic" "" "0000537781" "0" "90" "9" "2086866" "2086866" "subst" "0" "01804" "SMARCA2_000060" "g.2086866G>A" "" "" "" "SMARCA2(NM_003070.3):c.2564G>A (p.(Arg855Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2086866G>A" "" "pathogenic" "" "0000537783" "0" "10" "9" "2087035" "2087035" "subst" "0.000914032" "01943" "SMARCA2_000132" "g.2087035A>G" "" "" "" "SMARCA2(NM_003070.4):c.2733A>G (p.Q911=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2087035A>G" "" "benign" "" "0000537784" "0" "70" "9" "2087066" "2087066" "subst" "0" "02327" "SMARCA2_000133" "g.2087066G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2087066G>A" "" "likely pathogenic" "" "0000537799" "0" "70" "9" "2104080" "2104080" "subst" "0" "02327" "SMARCA2_000135" "g.2104080G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2104080G>A" "" "likely pathogenic" "" "0000537800" "0" "70" "9" "2110275" "2110275" "subst" "0" "02327" "SMARCA2_000136" "g.2110275G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2110275G>T" "" "likely pathogenic" "" "0000537801" "0" "30" "9" "2115893" "2115893" "subst" "1.62629E-5" "02326" "SMARCA2_000137" "g.2115893C>T" "" "" "" "SMARCA2(NM_003070.5):c.3528C>T (p.T1176=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2115893C>T" "" "likely benign" "" "0000537802" "0" "10" "9" "2115920" "2115920" "subst" "0.00104903" "01943" "SMARCA2_000138" "g.2115920C>T" "" "" "" "SMARCA2(NM_003070.4):c.3555C>T (p.L1185=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2115920C>T" "" "benign" "" "0000537812" "0" "50" "9" "2170471" "2170471" "subst" "0" "01804" "SMARCA2_000140" "g.2170471A>G" "" "" "" "SMARCA2(NM_003070.5):c.4252A>G (p.(Ser1418Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2170471A>G" "" "VUS" "" "0000537816" "0" "50" "9" "2192726" "2192726" "subst" "2.43669E-5" "01943" "SMARCA2_000143" "g.2192726C>T" "" "" "" "SMARCA2(NM_003070.4):c.4760C>T (p.T1587M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2192726C>T" "" "VUS" "" "0000537817" "0" "30" "9" "2192727" "2192727" "subst" "0.000828514" "01804" "SMARCA2_000144" "g.2192727G>A" "" "" "" "SMARCA2(NM_003070.3):c.4761G>A (p.(=)), SMARCA2(NM_003070.4):c.4761G>A (p.T1587=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2192727G>A" "" "likely benign" "" "0000612052" "0" "30" "9" "2039812" "2039817" "dup" "0" "01804" "SMARCA2_000121" "g.2039812_2039817dup" "" "" "" "SMARCA2(NM_003070.3):c.669_670insCAGCAG (p.(Gln222_Gln223dup)), SMARCA2(NM_003070.4):c.702_707dupGCAGCA (p.Q237_Q238dup), SMARCA2(NM_003070.5):c.70..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2039812_2039817dup" "" "likely benign" "" "0000612053" "0" "30" "9" "2039815" "2039817" "dup" "0" "01804" "SMARCA2_000122" "g.2039815_2039817dup" "" "" "" "SMARCA2(NM_003070.3):c.667_669dup (p.(Gln223dup)), SMARCA2(NM_003070.4):c.705_707dupGCA (p.Q238dup), SMARCA2(NM_003070.5):c.705_707dupGCA (p.Q238dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2039815_2039817dup" "" "likely benign" "" "0000612054" "0" "50" "9" "2056780" "2056780" "subst" "0" "01943" "SMARCA2_000145" "g.2056780A>G" "" "" "" "SMARCA2(NM_003070.4):c.1282A>G (p.M428V), SMARCA2(NM_003070.5):c.1282A>G (p.(Met428Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2056780A>G" "" "VUS" "" "0000612055" "0" "30" "9" "2073286" "2073286" "subst" "5.27945E-5" "01943" "SMARCA2_000146" "g.2073286C>T" "" "" "" "SMARCA2(NM_003070.4):c.1821C>T (p.F607=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2073286C>T" "" "likely benign" "" "0000612056" "0" "30" "9" "2077728" "2077728" "subst" "0.000333523" "01943" "SMARCA2_000147" "g.2077728G>A" "" "" "" "SMARCA2(NM_003070.4):c.2136G>A (p.V712=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2077728G>A" "" "likely benign" "" "0000612059" "0" "50" "9" "2110308" "2110308" "subst" "0" "01943" "SMARCA2_000148" "g.2110308G>C" "" "" "" "SMARCA2(NM_003070.4):c.3347G>C (p.G1116A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2110308G>C" "" "VUS" "" "0000612061" "0" "30" "9" "2191388" "2191388" "subst" "0.000934109" "02325" "SMARCA2_000149" "g.2191388G>A" "" "" "" "SMARCA2(NM_003070.3):c.4717G>A (p.(Asp1573Asn)), SMARCA2(NM_003070.5):c.4717G>A (p.D1573N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2191388G>A" "" "likely benign" "" "0000622245" "0" "30" "9" "2039803" "2039817" "del" "0" "02325" "SMARCA2_000068" "g.2039803_2039817del" "" "" "" "SMARCA2(NM_003070.3):c.667_681del (p.(Gln228_Gln232del)), SMARCA2(NM_003070.5):c.693_707delGCAGCAGCAGCAGCA (p.Q234_Q238del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2039803_2039817del" "" "likely benign" "" "0000652687" "1" "70" "9" "2084156" "2084156" "subst" "0" "03575" "SMARCA2_000150" "g.2084156C>T" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs797045974}" "Germline" "" "rs797045974" "0" "" "" "g.2084156C>T" "" "likely pathogenic" "" "0000652689" "1" "30" "9" "2186224" "2186224" "subst" "0.0102443" "03575" "SMARCA2_000053" "g.2186224C>T" "12/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "12 heterozygous, no homozygous; {DB:CLININrs77070978}" "Germline" "" "rs77070978" "0" "" "" "g.2186224C>T" "" "likely benign" "" "0000656321" "0" "50" "9" "2029030" "2029030" "subst" "0" "01943" "SMARCA2_000151" "g.2029030C>T" "" "" "" "SMARCA2(NM_003070.3):c.8C>T (p.(Thr3Met)), SMARCA2(NM_003070.4):c.8C>T (p.T3M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2029030C>T" "" "VUS" "" "0000656322" "0" "30" "9" "2029030" "2029030" "subst" "0" "01804" "SMARCA2_000151" "g.2029030C>T" "" "" "" "SMARCA2(NM_003070.3):c.8C>T (p.(Thr3Met)), SMARCA2(NM_003070.4):c.8C>T (p.T3M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2029030C>T" "" "likely benign" "" "0000656323" "0" "10" "9" "2039795" "2039796" "ins" "0" "02325" "SMARCA2_000119" "g.2039795_2039796insCGC" "" "" "" "SMARCA2(NM_003070.4):c.685_686insCGC (p.Q228_Q229insP), SMARCA2(NM_003070.5):c.685_686insCGC (p.(Gln228_Gln229insPro)), SMARCA2(NM_003070.5):c.685_..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2039795_2039796insCGC" "" "benign" "" "0000656324" "0" "30" "9" "2039815" "2039817" "dup" "0" "02326" "SMARCA2_000122" "g.2039815_2039817dup" "" "" "" "SMARCA2(NM_003070.3):c.667_669dup (p.(Gln223dup)), SMARCA2(NM_003070.4):c.705_707dupGCA (p.Q238dup), SMARCA2(NM_003070.5):c.705_707dupGCA (p.Q238dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2039815_2039817dup" "" "likely benign" "" "0000656327" "0" "30" "9" "2192733" "2192733" "subst" "0" "01943" "SMARCA2_000153" "g.2192733T>C" "" "" "" "SMARCA2(NM_003070.4):c.4767T>C (p.D1589=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2192733T>C" "" "likely benign" "" "0000678645" "0" "50" "9" "2039797" "2039817" "del" "0" "01943" "SMARCA2_000154" "g.2039797_2039817del" "" "" "" "SMARCA2(NM_003070.4):c.687_707delGCAGCAGCAGCAGCAGCAGCA (p.Q232_Q238del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000678646" "0" "30" "9" "2039805" "2039805" "subst" "0" "01943" "SMARCA2_000077" "g.2039805A>C" "" "" "" "SMARCA2(NM_003070.4):c.695A>C (p.Q232P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000678647" "0" "30" "9" "2039809" "2039817" "del" "0" "01943" "SMARCA2_000066" "g.2039809_2039817del" "" "" "" "SMARCA2(NM_003070.3):c.667_675del (p.(Gln226_Gln228del)), SMARCA2(NM_003070.4):c.699_707delGCAGCAGCA (p.Q236_Q238del), SMARCA2(NM_003070.5):c.699_7..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000690507" "0" "50" "9" "2115966" "2115966" "subst" "0" "02325" "SMARCA2_000155" "g.2115966G>A" "" "" "" "SMARCA2(NM_003070.5):c.3601G>A (p.A1201T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000698346" "0" "90" "9" "2115829" "2115829" "subst" "0" "00006" "SMARCA2_000156" "g.2115829A>C" "" "{PMID:Squeo 2020:32170002}" "" "" "" "De novo" "" "" "0" "" "" "g.2115829A>C" "" "pathogenic (dominant)" "ACMG" "0000698347" "0" "70" "9" "2119506" "2119506" "subst" "0" "00006" "SMARCA2_000157" "g.2119506C>G" "" "{PMID:Squeo 2020:32170002}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.2119506C>G" "" "likely pathogenic" "ACMG" "0000698348" "0" "70" "9" "2119506" "2119506" "subst" "0" "00006" "SMARCA2_000157" "g.2119506C>G" "" "{PMID:Squeo 2020:32170002}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.2119506C>G" "" "likely pathogenic" "ACMG" "0000701994" "0" "70" "9" "2119494" "2119494" "subst" "0" "01164" "SMARCA2_000158" "g.2119494C>G" "" "" "" "" "ACMG: PS2, PM2, PP3" "Germline" "?" "" "0" "" "" "g.2119494C>G" "" "likely pathogenic" "ACMG" "0000703882" "0" "90" "9" "2119494" "2119494" "subst" "0" "00006" "SMARCA2_000158" "g.2119494C>G" "" "{PMID:Tang 2017:27665729}" "" "" "" "De novo" "" "" "0" "" "" "g.2119494C>G" "" "pathogenic (dominant)" "" "0000722464" "0" "30" "9" "2076261" "2076261" "subst" "3.65595E-5" "01943" "SMARCA2_000159" "g.2076261C>T" "" "" "" "SMARCA2(NM_003070.4):c.1968C>T (p.T656=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000722465" "0" "70" "9" "2086973" "2086973" "subst" "0" "02329" "SMARCA2_000131" "g.2086973C>T" "" "" "" "SMARCA2(NM_003070.5):c.2671C>T (p.L891F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000722466" "0" "70" "9" "2087027" "2087027" "subst" "0" "02329" "SMARCA2_000160" "g.2087027T>A" "" "" "" "SMARCA2(NM_003070.5):c.2725T>A (p.F909I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000722468" "0" "90" "9" "2115938" "2115938" "subst" "0" "02329" "SMARCA2_000152" "g.2115938G>C" "" "" "" "SMARCA2(NM_003070.5):c.3573G>C (p.K1191N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000722471" "0" "30" "9" "2170426" "2170426" "subst" "0.000844986" "01943" "SMARCA2_000139" "g.2170426G>A" "" "" "" "SMARCA2(NM_003070.4):c.4207G>A (p.V1403M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000804052" "0" "30" "9" "2039593" "2039593" "subst" "0.00417472" "01943" "SMARCA2_000161" "g.2039593G>T" "" "" "" "SMARCA2(NM_003070.4):c.483G>T (p.P161=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000804053" "0" "50" "9" "2039796" "2039825" "del" "0" "02325" "SMARCA2_000162" "g.2039796_2039825del" "" "" "" "SMARCA2(NM_003070.5):c.686_715delAGCAGCAGCAGCAGCAGCAGCAACAGCAGC (p.Q229_Q238del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000804054" "0" "30" "9" "2039872" "2039872" "subst" "3.28364E-5" "01943" "SMARCA2_000163" "g.2039872G>A" "" "" "" "SMARCA2(NM_003070.4):c.762G>A (p.P254=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000804055" "0" "30" "9" "2047282" "2047282" "subst" "0" "01943" "SMARCA2_000080" "g.2047282G>A" "" "" "" "SMARCA2(NM_003070.3):c.844G>A (p.(Ala282Thr)), SMARCA2(NM_003070.4):c.844G>A (p.A282T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000804056" "0" "30" "9" "2056667" "2056667" "subst" "0" "02325" "SMARCA2_000164" "g.2056667G>A" "" "" "" "SMARCA2(NM_003070.5):c.1174-5G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000804057" "0" "30" "9" "2086897" "2086897" "subst" "8.12493E-6" "01943" "SMARCA2_000165" "g.2086897G>A" "" "" "" "SMARCA2(NM_003070.4):c.2595G>A (p.Q865=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000804058" "0" "30" "9" "2096774" "2096774" "subst" "9.75285E-5" "01943" "SMARCA2_000166" "g.2096774G>T" "" "" "" "SMARCA2(NM_003070.4):c.2991+10G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000804059" "0" "30" "9" "2104159" "2104159" "subst" "0.000402576" "01943" "SMARCA2_000167" "g.2104159A>G" "" "" "" "SMARCA2(NM_003070.4):c.3282A>G (p.L1094=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000852224" "0" "30" "9" "2039776" "2039787" "del" "0" "01943" "SMARCA2_000169" "g.2039776_2039787del" "" "" "" "SMARCA2(NM_003070.4):c.666_677delACAGCAGCAGCA (p.Q235_Q238del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000852225" "0" "30" "9" "2039791" "2039791" "subst" "0" "01943" "SMARCA2_000170" "g.2039791G>A" "" "" "" "SMARCA2(NM_003070.4):c.681G>A (p.Q227=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000852226" "0" "30" "9" "2039799" "2039799" "subst" "0" "01943" "SMARCA2_000171" "g.2039799A>C" "" "" "" "SMARCA2(NM_003070.4):c.689A>C (p.Q230P), SMARCA2(NM_003070.5):c.689A>C (p.(Gln230Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000852227" "0" "90" "9" "2086950" "2086950" "subst" "0" "02327" "SMARCA2_000009" "g.2086950C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000861598" "0" "50" "9" "2029119" "2029119" "subst" "0.000327127" "01943" "SMARCA2_000168" "g.2029119C>T" "" "" "" "SMARCA2(NM_003070.4):c.97C>T (p.P33S), SMARCA2(NM_003070.5):c.97C>T (p.P33S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000861599" "0" "30" "9" "2029119" "2029119" "subst" "0.000327127" "02325" "SMARCA2_000168" "g.2029119C>T" "" "" "" "SMARCA2(NM_003070.4):c.97C>T (p.P33S), SMARCA2(NM_003070.5):c.97C>T (p.P33S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000861600" "0" "30" "9" "2039827" "2039827" "subst" "0" "01804" "SMARCA2_000172" "g.2039827G>A" "" "" "" "SMARCA2(NM_001289396.1):c.717G>A (p.(Pro239=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000861601" "0" "70" "9" "2056766" "2056767" "del" "0" "01804" "SMARCA2_000173" "g.2056766_2056767del" "" "" "" "SMARCA2(NM_003070.3):c.1268_1269del (p.(Leu423Glnfs*16))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000861602" "0" "30" "9" "2096774" "2096774" "subst" "0.0260889" "01804" "SMARCA2_000030" "g.2096774G>A" "" "" "" "SMARCA2(NM_001289396.1):c.2991+10G>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000861604" "0" "50" "9" "2161855" "2161855" "subst" "0" "01943" "SMARCA2_000174" "g.2161855C>G" "" "" "" "SMARCA2(NM_003070.4):c.4151C>G (p.T1384R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000861605" "0" "30" "9" "2192727" "2192727" "subst" "0.000828514" "01943" "SMARCA2_000144" "g.2192727G>A" "" "" "" "SMARCA2(NM_003070.3):c.4761G>A (p.(=)), SMARCA2(NM_003070.4):c.4761G>A (p.T1587=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000888779" "0" "50" "9" "2039791" "2039817" "dup" "0" "02325" "SMARCA2_000175" "g.2039791_2039817dup" "" "" "" "SMARCA2(NM_003070.5):c.681_707dupGCAGCAGCAGCAGCAGCAGCAGCAGCA (p.Q230_Q238dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000888780" "0" "30" "9" "2039805" "2039825" "del" "0" "02325" "SMARCA2_000176" "g.2039805_2039825del" "" "" "" "SMARCA2(NM_003070.5):c.695_715delAGCAGCAGCAGCAACAGCAGC (p.Q232_Q238del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000888781" "0" "50" "9" "2039806" "2039817" "dup" "0" "02325" "SMARCA2_000177" "g.2039806_2039817dup" "" "" "" "SMARCA2(NM_003070.5):c.696_707dup (p.(Gln235_Gln238dup)), SMARCA2(NM_003070.5):c.696_707dupGCAGCAGCAGCA (p.Q235_Q238dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000888782" "0" "70" "9" "2060894" "2060894" "subst" "0" "02329" "SMARCA2_000178" "g.2060894G>A" "" "" "" "SMARCA2(NM_003070.5):c.1600G>A (p.D534N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000913139" "0" "30" "9" "2039510" "2039510" "subst" "4.47064E-5" "02325" "SMARCA2_000179" "g.2039510G>A" "" "" "" "SMARCA2(NM_003070.5):c.400G>A (p.V134I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000913140" "0" "50" "9" "2039818" "2039820" "dup" "0" "02325" "SMARCA2_000180" "g.2039818_2039820dup" "" "" "" "SMARCA2(NM_003070.3):c.708_710dupACA (p.(Gln237dup)), SMARCA2(NM_003070.5):c.708_710dupACA (p.Q238dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000921052" "0" "70" "9" "2116038" "2116038" "subst" "0" "03544" "SMARCA2_000181" "g.2116038G>A" "" "" "" "" "" "De novo" "" "" "" "" "" "" "" "likely pathogenic" "ACMG" "0000922583" "0" "70" "9" "2081901" "2081901" "subst" "0" "00006" "SMARCA2_000182" "g.2081901G>A" "" "{PMID:Chen 2022:34906496}" "" "" "ACMG PS2, PM2, PM5, PP4" "De novo" "" "" "0" "" "" "g.2081901G>A" "" "likely pathogenic (dominant)" "ACMG" "0000922584" "0" "50" "9" "2081914" "2081914" "subst" "0" "00006" "SMARCA2_000012" "g.2081914C>T" "" "{PMID:Chen 2022:34906496}" "" "" "ACMG PS2, PM2" "De novo" "" "" "0" "" "" "g.2081914C>T" "" "VUS" "ACMG" "0000922585" "0" "70" "9" "2081995" "2081995" "subst" "0" "00006" "SMARCA2_000183" "g.2081995C>T" "" "{PMID:Chen 2022:34906496}" "" "" "ACMG PS2, PM2, PM5, PP3" "De novo" "" "" "0" "" "" "g.2081995C>T" "" "likely pathogenic (dominant)" "ACMG" "0000922586" "0" "50" "9" "2083359" "2083359" "subst" "0" "00006" "SMARCA2_000184" "g.2083359C>A" "" "{PMID:Chen 2022:34906496}" "" "" "ACMG PS2, PM2" "De novo" "" "" "0" "" "" "g.2083359C>A" "" "VUS" "ACMG" "0000922587" "0" "90" "9" "2086856" "2086856" "subst" "0" "00006" "SMARCA2_000044" "g.2086856G>C" "" "{PMID:Chen 2022:34906496}" "" "" "ACMG PS1, PS2, PM2, PM5" "De novo" "" "" "0" "" "" "g.2086856G>C" "" "pathogenic (dominant)" "ACMG" "0000922588" "0" "90" "9" "2086866" "2086866" "subst" "0" "00006" "SMARCA2_000060" "g.2086866G>A" "" "{PMID:Chen 2022:34906496}" "" "" "ACMG PS1, PS2, PM2, PP3" "Germline/De novo (untested)" "" "" "0" "" "" "g.2086866G>A" "" "pathogenic (dominant)" "ACMG" "0000922589" "0" "90" "9" "2086950" "2086950" "subst" "0" "00006" "SMARCA2_000009" "g.2086950C>T" "" "{PMID:Chen 2022:34906496}" "" "" "ACMG PS1, PS2, PM2, PP4" "De novo" "" "" "0" "" "" "g.2086950C>T" "" "pathogenic (dominant)" "ACMG" "0000922590" "0" "70" "9" "2088540" "2088540" "subst" "0" "00006" "SMARCA2_000185" "g.2088540G>A" "" "{PMID:Chen 2022:34906496}" "" "" "ACMG PS2, PM2, PP3, PP4" "De novo" "" "" "0" "" "" "g.2088540G>A" "" "likely pathogenic (dominant)" "ACMG" "0000922591" "0" "90" "9" "2115841" "2115841" "subst" "0" "00006" "SMARCA2_000003" "g.2115841G>A" "" "{PMID:Chen 2022:34906496}" "" "" "ACMG PS1, PS2, PM2, PP3, PP4" "De novo" "" "" "0" "" "" "g.2115841G>A" "" "pathogenic (dominant)" "ACMG" "0000925027" "0" "30" "9" "2039812" "2039817" "del" "0" "02325" "SMARCA2_000120" "g.2039812_2039817del" "" "" "" "SMARCA2(NM_003070.5):c.702_707del (p.(Gln237_Gln238del)), SMARCA2(NM_003070.5):c.702_707delGCAGCA (p.Q237_Q238del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000929580" "0" "50" "9" "2077714" "2077714" "subst" "1.21873E-5" "02325" "SMARCA2_000186" "g.2077714A>G" "" "" "" "SMARCA2(NM_003070.5):c.2122A>G (p.I708V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000931852" "0" "70" "9" "2084090" "2084090" "subst" "0" "00006" "SMARCA2_000187" "g.2084090C>T" "" "{PMID:Niggl 2023:37541189}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "VUS" "" "0000965351" "0" "70" "9" "2081900" "2081900" "subst" "0" "02329" "SMARCA2_000188" "g.2081900G>A" "" "" "" "SMARCA2(NM_001289396.1):c.2253G>A (p.M751I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000978641" "0" "50" "9" "2039546" "2039546" "subst" "0" "02325" "SMARCA2_000189" "g.2039546C>T" "" "" "" "SMARCA2(NM_003070.5):c.436C>T (p.P146S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000978642" "0" "30" "9" "2039784" "2039785" "del" "0" "01804" "SMARCA2_000190" "g.2039784_2039785del" "" "" "" "SMARCA2(NM_003070.5):c.674_675del (p.(Gln225Profs*33))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000978643" "0" "30" "9" "2039795" "2039796" "ins" "0" "01804" "SMARCA2_000119" "g.2039795_2039796insCGC" "" "" "" "SMARCA2(NM_003070.4):c.685_686insCGC (p.Q228_Q229insP), SMARCA2(NM_003070.5):c.685_686insCGC (p.(Gln228_Gln229insPro)), SMARCA2(NM_003070.5):c.685_..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000978644" "0" "50" "9" "2039796" "2039797" "del" "0" "01804" "SMARCA2_000191" "g.2039796_2039797del" "" "" "" "SMARCA2(NM_003070.5):c.686_687del (p.(Gln229ProfsTer29))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000978645" "0" "50" "9" "2039799" "2039799" "del" "0" "01804" "SMARCA2_000192" "g.2039799del" "" "" "" "SMARCA2(NM_003070.5):c.689del (p.(Gln230ArgfsTer40))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000978646" "0" "30" "9" "2052432" "2052432" "subst" "0" "01804" "SMARCA2_000193" "g.2052432T>C" "" "" "" "SMARCA2(NM_003070.5):c.1047-2165T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000978648" "0" "30" "9" "2083055" "2083055" "subst" "0" "01804" "SMARCA2_000195" "g.2083055G>T" "" "" "" "SMARCA2(NM_003070.5):c.2349-292G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000978652" "0" "50" "9" "2123724" "2123724" "subst" "0" "01804" "SMARCA2_000196" "g.2123724G>T" "" "" "" "SMARCA2(NM_003070.5):c.3768G>T (p.(Met1256Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000978653" "0" "50" "9" "2159864" "2159864" "subst" "0" "01804" "SMARCA2_000197" "g.2159864C>T" "" "" "" "SMARCA2(NM_001289399.1):c.48C>T (p.(Ser16=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000978654" "0" "30" "9" "2159872" "2159872" "subst" "0" "01804" "SMARCA2_000198" "g.2159872C>G" "" "" "" "SMARCA2(NM_001289399.1):c.56C>G (p.(Thr19Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000978655" "0" "50" "9" "2161713" "2161713" "subst" "0" "01804" "SMARCA2_000199" "g.2161713A>G" "" "" "" "SMARCA2(NM_003070.5):c.4009A>G (p.(Met1337Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000978657" "0" "10" "9" "2186224" "2186224" "subst" "0.0102443" "01804" "SMARCA2_000053" "g.2186224C>T" "" "" "" "SMARCA2(NM_003070.5):c.4590C>T (p.(Ser1530=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000985345" "0" "70" "9" "2086860" "2086860" "subst" "0" "03544" "SMARCA2_000201" "g.2086860G>A" "" "" "" "" "" "De novo" "-" "" "0" "" "" "g.2086860G>A" "{CV:3895529}" "pathogenic" "ACMG" "0000997799" "0" "50" "9" "2029113" "2029113" "subst" "0" "01804" "SMARCA2_000202" "g.2029113C>T" "" "" "" "SMARCA2(NM_003070.3):c.91C>T (p.(Pro31Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000997800" "0" "30" "9" "2029119" "2029119" "subst" "0" "01804" "SMARCA2_000203" "g.2029119C>G" "" "" "" "SMARCA2(NM_003070.3):c.97C>G (p.(Pro33Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000997801" "0" "30" "9" "2029197" "2029197" "subst" "3.67824E-5" "01804" "SMARCA2_000204" "g.2029197A>T" "" "" "" "SMARCA2(NM_003070.3):c.175A>T (p.(Thr59Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000997802" "0" "30" "9" "2039787" "2039787" "subst" "0" "01804" "SMARCA2_000205" "g.2039787A>C" "" "" "" "SMARCA2(NM_003070.3):c.677A>C (p.(Gln226Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000997803" "0" "50" "9" "2039792" "2039793" "ins" "0" "01804" "SMARCA2_000206" "g.2039792_2039793insCGC" "" "" "" "SMARCA2(NM_003070.3):c.682_683insCGC (p.(Gln227_Gln228insPro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000997804" "0" "30" "9" "2039808" "2039808" "subst" "0" "01804" "SMARCA2_000207" "g.2039808A>C" "" "" "" "SMARCA2(NM_003070.3):c.698A>C (p.(Gln233Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000997805" "0" "50" "9" "2039818" "2039818" "subst" "0" "01804" "SMARCA2_000208" "g.2039818A>T" "" "" "" "SMARCA2(NM_003070.3):c.708A>T (p.(Gln236His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000997806" "0" "30" "9" "2039818" "2039820" "dup" "0" "01804" "SMARCA2_000180" "g.2039818_2039820dup" "" "" "" "SMARCA2(NM_003070.3):c.708_710dupACA (p.(Gln237dup)), SMARCA2(NM_003070.5):c.708_710dupACA (p.Q238dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000997807" "0" "50" "9" "2047413" "2047413" "subst" "0" "01804" "SMARCA2_000209" "g.2047413G>C" "" "" "" "SMARCA2(NM_003070.3):c.975G>C (p.(Gln325His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000997808" "0" "30" "9" "2056810" "2056810" "subst" "0" "01804" "SMARCA2_000210" "g.2056810A>G" "" "" "" "SMARCA2(NM_003070.3):c.1312A>G (p.(Ile438Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000997809" "0" "50" "9" "2077625" "2077625" "subst" "1.22331E-5" "01804" "SMARCA2_000211" "g.2077625C>A" "" "" "" "SMARCA2(NM_003070.3):c.2037-4C>A (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000997812" "0" "30" "9" "2123755" "2123755" "subst" "4.06838E-6" "01804" "SMARCA2_000212" "g.2123755A>C" "" "" "" "SMARCA2(NM_003070.3):c.3799A>C (p.(Asn1267His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000997813" "0" "50" "9" "2123855" "2123855" "subst" "0" "01804" "SMARCA2_000213" "g.2123855A>G" "" "" "" "SMARCA2(NM_003070.3):c.3899A>G (p.(Glu1300Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000997814" "0" "30" "9" "2191388" "2191388" "subst" "0.000934109" "01804" "SMARCA2_000149" "g.2191388G>A" "" "" "" "SMARCA2(NM_003070.3):c.4717G>A (p.(Asp1573Asn)), SMARCA2(NM_003070.5):c.4717G>A (p.D1573N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000997815" "0" "50" "9" "2192731" "2192731" "subst" "1.2183E-5" "01804" "SMARCA2_000214" "g.2192731G>C" "" "" "" "SMARCA2(NM_003070.3):c.4765G>C (p.(Asp1589His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001007054" "0" "90" "9" "2060832" "2060832" "subst" "0" "03544" "SMARCA2_000215" "g.2060832G>T" "" "" "" "" "" "Germline" "yes" "rs1586660338" "0" "" "" "g.2060832G>T" "{CV:829812}" "pathogenic" "ACMG" "0001014525" "0" "90" "9" "2060890" "2060890" "subst" "0" "02329" "SMARCA2_000216" "g.2060890G>C" "" "" "" "SMARCA2(NM_003070.5):c.1596G>C (p.Q532H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001025650" "0" "30" "9" "2039776" "2039778" "del" "0" "02325" "SMARCA2_000217" "g.2039776_2039778del" "" "" "" "SMARCA2(NM_003070.5):c.666_668delACA (p.Q238del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001025651" "0" "50" "9" "2039800" "2039817" "del" "0" "02325" "SMARCA2_000218" "g.2039800_2039817del" "" "" "" "SMARCA2(NM_003070.5):c.690_707delGCAGCAGCAGCAGCAGCA (p.Q233_Q238del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001025652" "0" "30" "9" "2086826" "2086826" "subst" "1.22346E-5" "02325" "SMARCA2_000219" "g.2086826T>C" "" "" "" "SMARCA2(NM_003070.5):c.2527-3T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001025653" "0" "50" "9" "2181567" "2181567" "subst" "4.06656E-6" "02325" "SMARCA2_000220" "g.2181567A>G" "" "" "" "SMARCA2(NM_003070.5):c.4254-4A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001030083" "0" "70" "9" "2086959" "2086959" "subst" "0" "04333" "SMARCA2_000221" "g.2086959A>G" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.2086959A>G" "" "likely pathogenic" "" "0001037427" "0" "30" "9" "2033091" "2033091" "subst" "3.67743E-5" "01804" "SMARCA2_000222" "g.2033091C>T" "" "" "" "SMARCA2(NM_003070.5):c.355+10C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001037428" "0" "50" "9" "2039581" "2039581" "subst" "0" "01804" "SMARCA2_000223" "g.2039581C>G" "" "" "" "SMARCA2(NM_003070.5):c.471C>G (p.(Ile157Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001037429" "0" "30" "9" "2039806" "2039817" "dup" "0" "01804" "SMARCA2_000177" "g.2039806_2039817dup" "" "" "" "SMARCA2(NM_003070.5):c.696_707dup (p.(Gln235_Gln238dup)), SMARCA2(NM_003070.5):c.696_707dupGCAGCAGCAGCA (p.Q235_Q238dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001037430" "0" "50" "9" "2047456" "2047456" "subst" "0" "01804" "SMARCA2_000081" "g.2047456G>C" "" "" "" "SMARCA2(NM_003070.4):c.1018G>C (p.V340L), SMARCA2(NM_003070.5):c.1018G>C (p.(Val340Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001037432" "0" "50" "9" "2056780" "2056780" "subst" "0" "01804" "SMARCA2_000145" "g.2056780A>G" "" "" "" "SMARCA2(NM_003070.4):c.1282A>G (p.M428V), SMARCA2(NM_003070.5):c.1282A>G (p.(Met428Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001037433" "0" "30" "9" "2060993" "2060993" "subst" "0" "01804" "SMARCA2_000225" "g.2060993A>C" "" "" "" "SMARCA2(NM_003070.5):c.1692+7A>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001037434" "0" "30" "9" "2069986" "2069986" "subst" "0" "01804" "SMARCA2_000226" "g.2069986A>T" "" "" "" "SMARCA2(NM_003070.5):c.1693-432A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001037436" "0" "30" "9" "2077781" "2077781" "subst" "0" "01804" "SMARCA2_000227" "g.2077781T>G" "" "" "" "SMARCA2(NM_003070.5):c.2184+5T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001037438" "0" "30" "9" "2086660" "2086660" "subst" "0" "01804" "SMARCA2_000229" "g.2086660C>G" "" "" "" "SMARCA2(NM_003070.5):c.2527-169C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001037444" "0" "50" "9" "2104136" "2104136" "subst" "0" "02325" "SMARCA2_000231" "g.2104136G>C" "" "" "" "SMARCA2(NM_003070.5):c.3259G>C (p.A1087P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001037446" "0" "30" "9" "2116484" "2116484" "subst" "0" "01804" "SMARCA2_000233" "g.2116484A>T" "" "" "" "SMARCA2(NM_003070.5):c.3684+435A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001037451" "0" "30" "9" "2152356" "2152356" "subst" "0" "01804" "SMARCA2_000237" "g.2152356C>A" "" "" "" "SMARCA2(NM_003070.5):c.3982-9330C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001037454" "0" "50" "9" "2161752" "2161752" "subst" "0" "02325" "SMARCA2_000240" "g.2161752A>G" "" "" "" "SMARCA2(NM_003070.5):c.4048A>G (p.R1350G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001053192" "0" "30" "9" "2039799" "2039799" "subst" "0" "01804" "SMARCA2_000171" "g.2039799A>C" "" "" "" "SMARCA2(NM_003070.4):c.689A>C (p.Q230P), SMARCA2(NM_003070.5):c.689A>C (p.(Gln230Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001053193" "0" "50" "9" "2047318" "2047318" "subst" "0" "01804" "SMARCA2_000248" "g.2047318G>A" "" "" "" "SMARCA2(NM_003070.5):c.880G>A (p.(Ala294Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001053194" "0" "50" "9" "2081982" "2081982" "subst" "0" "01804" "SMARCA2_000249" "g.2081982A>G" "" "" "" "SMARCA2(NM_003070.5):c.2335A>G (p.(Ile779Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001053195" "0" "30" "9" "2084199" "2084199" "subst" "4.16275E-6" "01804" "SMARCA2_000250" "g.2084199A>T" "" "" "" "SMARCA2(NM_003070.5):c.2526+3A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001053196" "0" "30" "9" "2086604" "2086604" "subst" "0" "01804" "SMARCA2_000251" "g.2086604G>A" "" "" "" "SMARCA2(NM_003070.5):c.2527-225G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001053197" "0" "30" "9" "2191314" "2191314" "subst" "8.12328E-6" "01804" "SMARCA2_000252" "g.2191314G>T" "" "" "" "SMARCA2(NM_003070.5):c.4643G>T (p.(Gly1548Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes SMARCA2 ## Count = 395 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000018682" "00019417" "90" "3293" "0" "3293" "0" "c.3293G>A" "r.(?)" "p.(Gly1098Asp)" "" "0000018683" "00019417" "90" "2554" "0" "2554" "0" "c.2554G>C" "r.(?)" "p.(Glu852Gln)" "" "0000018684" "00019417" "90" "3314" "0" "3314" "0" "c.3314G>A" "r.(?)" "p.(Arg1105His)" "" "0000018685" "00019417" "90" "2815" "0" "2815" "0" "c.2815C>T" "r.(?)" "p.(His939Tyr)" "" "0000018841" "00019417" "55" "-5" "0" "-5" "0" "c.-5G>A" "r.(=)" "p.(=)" "" "0000018842" "00019417" "55" "-5" "0" "-5" "0" "c.-5G>A" "r.(=)" "p.(=)" "" "0000018843" "00019417" "55" "-5" "0" "-5" "0" "c.-5G>A" "r.(=)" "p.(=)" "" "0000018849" "00019417" "55" "1522" "-48" "1522" "-48" "c.1522-48T>C" "r.(=)" "p.(=)" "" "0000018850" "00019417" "55" "2349" "-10" "2349" "-10" "c.2349-10del" "r.(=)" "p.(=)" "" "0000018851" "00019417" "55" "2349" "-10" "2349" "-10" "c.2349-10del" "r.(=)" "p.(=)" "" "0000018852" "00019417" "55" "2349" "-10" "2349" "-10" "c.2349-10del" "r.(=)" "p.(=)" "" "0000018853" "00019417" "55" "2349" "-10" "2349" "-10" "c.2349-10del" "r.(=)" "p.(=)" "" "0000018854" "00019417" "55" "2349" "-10" "2349" "-10" "c.2349-10del" "r.(=)" "p.(=)" "" "0000018855" "00019417" "55" "2349" "-10" "2349" "-10" "c.2349-10del" "r.(=)" "p.(=)" "" "0000018856" "00019417" "55" "2349" "-10" "2349" "-10" "c.2349-10del" "r.(=)" "p.(=)" "" "0000018857" "00019417" "55" "2349" "-10" "2349" "-10" "c.2349-10del" "r.(=)" "p.(=)" "" "0000018858" "00019417" "55" "2349" "-10" "2349" "-10" "c.2349-10del" "r.(=)" "p.(=)" "" "0000018859" "00019417" "55" "2349" "-10" "2349" "-10" "c.2349-10del" "r.(=)" "p.(=)" "" "0000018860" "00019417" "55" "2349" "-10" "2349" "-10" "c.2349-10del" "r.(=)" "p.(=)" "" "0000018861" "00019417" "55" "2349" "-10" "2349" "-10" "c.2349-10del" "r.(=)" "p.(=)" "" "0000018862" "00019417" "55" "2349" "-10" "2349" "-10" "c.2349-10del" "r.(=)" "p.(=)" "" "0000018863" "00019417" "55" "2349" "-10" "2349" "-10" "c.2349-10del" "r.(=)" "p.(=)" "" "0000018864" "00019417" "55" "2349" "-10" "2349" "-10" "c.2349-10del" "r.(=)" "p.(=)" "" "0000018865" "00019417" "55" "2349" "-10" "2349" "-10" "c.2349-10del" "r.(=)" "p.(=)" "" "0000018866" "00019417" "55" "2349" "-10" "2349" "-10" "c.2349-10del" "r.(=)" "p.(=)" "" "0000018867" "00019417" "55" "2349" "-10" "2349" "-10" "c.2349-10del" "r.(=)" "p.(=)" "" "0000018868" "00019417" "55" "2349" "-10" "2349" "-10" "c.2349-10del" "r.(=)" "p.(=)" "" "0000018869" "00019417" "55" "2349" "-10" "2349" "-10" "c.2349-10del" "r.(=)" "p.(=)" "" "0000018870" "00019417" "55" "2349" "-10" "2349" "-10" "c.2349-10del" "r.(=)" "p.(=)" "" "0000018871" "00019417" "55" "2349" "-10" "2349" "-10" "c.2349-10del" "r.(=)" "p.(=)" "" "0000018872" "00019417" "55" "2349" "-10" "2349" "-10" "c.2349-10del" "r.(=)" "p.(=)" "" "0000018873" "00019417" "55" "2349" "-10" "2349" "-10" "c.2349-10del" "r.(=)" "p.(=)" "" "0000018874" "00019417" "55" "2349" "-10" "2349" "-10" "c.2349-10del" "r.(=)" "p.(=)" "" "0000018875" "00019417" "55" "2349" "-10" "2349" "-10" "c.2349-10del" "r.(=)" "p.(=)" "" "0000018876" "00019417" "55" "2349" "-9" "2349" "-9" "c.2349-9del" "r.(=)" "p.(=)" "" "0000018877" "00019417" "55" "2527" "-25" "2527" "-25" "c.2527-25G>A" "r.(=)" "p.(=)" "" "0000018878" "00019417" "55" "2527" "-25" "2527" "-25" "c.2527-25G>A" "r.(=)" "p.(=)" "" "0000018879" "00019417" "55" "2527" "-25" "2527" "-25" "c.2527-25G>A" "r.(=)" "p.(=)" "" "0000018880" "00019417" "55" "2883" "20" "2883" "20" "c.2883+20del" "r.(=)" "p.(=)" "" "0000018881" "00019417" "55" "2883" "37" "2883" "37" "c.2883+37del" "r.(=)" "p.(=)" "" "0000018882" "00019417" "55" "2883" "37" "2883" "37" "c.2883+37del" "r.(=)" "p.(=)" "" "0000018883" "00019417" "55" "2883" "37" "2883" "37" "c.2883+37del" "r.(=)" "p.(=)" "" "0000018884" "00019417" "55" "2883" "37" "2883" "37" "c.2883+37del" "r.(=)" "p.(=)" "" "0000018885" "00019417" "55" "2883" "37" "2883" "37" "c.2883+37del" "r.(=)" "p.(=)" "" "0000018886" "00019417" "55" "2883" "37" "2883" "37" "c.2883+37del" "r.(=)" "p.(=)" "" "0000018887" "00019417" "55" "2883" "37" "2883" "37" "c.2883+37del" "r.(=)" "p.(=)" "" "0000018888" "00019417" "55" "2883" "37" "2883" "37" "c.2883+37del" "r.(=)" "p.(=)" "" "0000018889" "00019417" "55" "2883" "37" "2883" "37" "c.2883+37del" "r.(=)" "p.(=)" "" "0000018890" "00019417" "55" "2883" "37" "2883" "37" "c.2883+37del" "r.(=)" "p.(=)" "" "0000018891" "00019417" "55" "2883" "37" "2883" "37" "c.2883+37del" "r.(=)" "p.(=)" "" "0000018892" "00019417" "55" "2883" "37" "2883" "37" "c.2883+37del" "r.(=)" "p.(=)" "" "0000018893" "00019417" "55" "2883" "37" "2883" "37" "c.2883+37del" "r.(=)" "p.(=)" "" "0000018894" "00019417" "55" "2883" "37" "2883" "37" "c.2883+37del" "r.(=)" "p.(=)" "" "0000018895" "00019417" "55" "2883" "37" "2883" "37" "c.2883+37del" "r.(=)" "p.(=)" "" "0000018896" "00019417" "55" "2883" "37" "2883" "37" "c.2883+37del" "r.(=)" "p.(=)" "" "0000018897" "00019417" "55" "2883" "37" "2883" "37" "c.2883+37del" "r.(=)" "p.(=)" "" "0000018898" "00019417" "55" "2883" "37" "2883" "37" "c.2883+37del" "r.(=)" "p.(=)" "" "0000018899" "00019417" "55" "2883" "37" "2883" "37" "c.2883+37del" "r.(=)" "p.(=)" "" "0000018900" "00019417" "55" "2883" "37" "2883" "37" "c.2883+37del" "r.(=)" "p.(=)" "" "0000018901" "00019417" "55" "2883" "37" "2883" "37" "c.2883+37del" "r.(=)" "p.(=)" "" "0000018902" "00019417" "55" "2883" "37" "2883" "37" "c.2883+37del" "r.(=)" "p.(=)" "" "0000018903" "00019417" "55" "2883" "37" "2883" "37" "c.2883+37del" "r.(=)" "p.(=)" "" "0000018904" "00019417" "55" "2883" "37" "2883" "37" "c.2883+37del" "r.(=)" "p.(=)" "" "0000018905" "00019417" "55" "2883" "37" "2883" "37" "c.2883+37del" "r.(=)" "p.(=)" "" "0000018906" "00019417" "55" "2883" "37" "2883" "37" "c.2883+37del" "r.(=)" "p.(=)" "" "0000018907" "00019417" "55" "2991" "10" "2991" "10" "c.2991+10G>A" "r.(=)" "p.(=)" "" "0000018908" "00019417" "55" "2991" "10" "2991" "10" "c.2991+10G>A" "r.(=)" "p.(=)" "" "0000018909" "00019417" "55" "2991" "10" "2991" "10" "c.2991+10G>A" "r.(=)" "p.(=)" "" "0000018910" "00019417" "55" "2991" "30" "2991" "30" "c.2991+30G>A" "r.(=)" "p.(=)" "" "0000018911" "00019417" "55" "2991" "30" "2991" "30" "c.2991+30G>A" "r.(=)" "p.(=)" "" "0000018912" "00019417" "55" "2991" "30" "2991" "30" "c.2991+30G>A" "r.(=)" "p.(=)" "" "0000018913" "00019417" "55" "2991" "30" "2991" "30" "c.2991+30G>A" "r.(=)" "p.(=)" "" "0000018914" "00019417" "55" "3079" "-23" "3079" "-23" "c.3079-23C>T" "r.(=)" "p.(=)" "" "0000018915" "00019417" "55" "3079" "-25" "3079" "-25" "c.3079-25T>A" "r.(=)" "p.(=)" "" "0000018916" "00019417" "55" "3079" "-25" "3079" "-25" "c.3079-25T>A" "r.(=)" "p.(=)" "" "0000018917" "00019417" "55" "3079" "-25" "3079" "-25" "c.3079-25T>A" "r.(=)" "p.(=)" "" "0000018918" "00019417" "55" "3079" "-25" "3079" "-25" "c.3079-25T>A" "r.(=)" "p.(=)" "" "0000018919" "00019417" "55" "3079" "-25" "3079" "-25" "c.3079-25T>A" "r.(=)" "p.(=)" "" "0000018920" "00019417" "55" "3079" "-25" "3079" "-25" "c.3079-25T>A" "r.(=)" "p.(=)" "" "0000018921" "00019417" "55" "3079" "-25" "3079" "-25" "c.3079-25T>A" "r.(=)" "p.(=)" "" "0000018922" "00019417" "55" "3079" "-25" "3079" "-25" "c.3079-25T>A" "r.(=)" "p.(=)" "" "0000018923" "00019417" "55" "3079" "-25" "3079" "-25" "c.3079-25T>A" "r.(=)" "p.(=)" "" "0000018924" "00019417" "55" "3079" "-25" "3079" "-25" "c.3079-25T>A" "r.(=)" "p.(=)" "" "0000018925" "00019417" "55" "3079" "-25" "3079" "-25" "c.3079-25T>A" "r.(=)" "p.(=)" "" "0000018926" "00019417" "55" "3079" "-25" "3079" "-25" "c.3079-25T>A" "r.(=)" "p.(=)" "" "0000018927" "00019417" "55" "3079" "-25" "3079" "-25" "c.3079-25T>A" "r.(=)" "p.(=)" "" "0000018928" "00019417" "55" "3079" "-25" "3079" "-25" "c.3079-25T>A" "r.(=)" "p.(=)" "" "0000018929" "00019417" "55" "3079" "-25" "3079" "-25" "c.3079-25T>A" "r.(=)" "p.(=)" "" "0000018930" "00019417" "55" "3672" "0" "3672" "0" "c.3672G>A" "r.(=)" "p.(=)" "" "0000018931" "00019417" "55" "3672" "0" "3672" "0" "c.3672G>A" "r.(=)" "p.(=)" "" "0000018932" "00019417" "55" "3672" "0" "3672" "0" "c.3672G>A" "r.(=)" "p.(=)" "" "0000018933" "00019417" "55" "3672" "0" "3672" "0" "c.3672G>A" "r.(=)" "p.(=)" "" "0000018934" "00019417" "55" "3672" "0" "3672" "0" "c.3672G>A" "r.(=)" "p.(=)" "" "0000018935" "00019417" "55" "3672" "0" "3672" "0" "c.3672G>A" "r.(=)" "p.(=)" "" "0000018936" "00019417" "55" "3672" "0" "3672" "0" "c.3672G>A" "r.(=)" "p.(=)" "" "0000018937" "00019417" "55" "3672" "0" "3672" "0" "c.3672G>A" "r.(=)" "p.(=)" "" "0000018938" "00019417" "55" "3672" "0" "3672" "0" "c.3672G>A" "r.(=)" "p.(=)" "" "0000018939" "00019417" "55" "4029" "0" "4029" "0" "c.4029T>G" "r.(=)" "p.(=)" "" "0000018940" "00019417" "55" "4199" "46" "4199" "46" "c.4199+46C>T" "r.(=)" "p.(=)" "" "0000018941" "00019417" "55" "4199" "46" "4199" "46" "c.4199+46C>T" "r.(=)" "p.(=)" "" "0000018942" "00019417" "55" "4199" "46" "4199" "46" "c.4199+46C>T" "r.(=)" "p.(=)" "" "0000018943" "00019417" "55" "4199" "46" "4199" "46" "c.4199+46C>T" "r.(=)" "p.(=)" "" "0000018944" "00019417" "55" "4199" "46" "4199" "46" "c.4199+46C>T" "r.(=)" "p.(=)" "" "0000018945" "00019417" "55" "4253" "40" "4253" "40" "c.4253+40G>C" "r.(=)" "p.(=)" "" "0000018946" "00019417" "55" "4253" "40" "4253" "40" "c.4253+40G>C" "r.(=)" "p.(=)" "" "0000018947" "00019417" "55" "4253" "40" "4253" "40" "c.4253+40G>C" "r.(=)" "p.(=)" "" "0000018948" "00019417" "55" "4253" "40" "4253" "40" "c.4253+40G>C" "r.(=)" "p.(=)" "" "0000018949" "00019417" "55" "4461" "48" "4461" "48" "c.4461+48G>A" "r.(=)" "p.(=)" "" "0000018950" "00019417" "55" "4461" "48" "4461" "48" "c.4461+48G>A" "r.(=)" "p.(=)" "" "0000018951" "00019417" "55" "4590" "0" "4590" "0" "c.4590C>T" "r.(=)" "p.(=)" "" "0000018952" "00019417" "55" "4590" "0" "4590" "0" "c.4590C>T" "r.(=)" "p.(=)" "" "0000018953" "00019417" "55" "4595" "-20" "4595" "-20" "c.4595-20T>C" "r.(=)" "p.(=)" "" "0000018954" "00019417" "55" "4595" "-20" "4595" "-20" "c.4595-20T>C" "r.(=)" "p.(=)" "" "0000018955" "00019417" "55" "4638" "0" "4638" "0" "c.4638C>G" "r.(?)" "p.(Asp1546Glu)" "" "0000018956" "00019417" "55" "4638" "0" "4638" "0" "c.4638C>G" "r.(?)" "p.(Asp1546Glu)" "" "0000018957" "00019417" "55" "4638" "0" "4638" "0" "c.4638C>G" "r.(?)" "p.(Asp1546Glu)" "" "0000018958" "00019417" "55" "683" "0" "683" "0" "c.683A>C" "r.(?)" "p.(Gln228Pro)" "" "0000018959" "00019417" "55" "683" "0" "683" "0" "c.683A>C" "r.(?)" "p.(Gln228Pro)" "" "0000018960" "00019417" "55" "716" "0" "724" "0" "c.716_724dup" "r.(?)" "p.(Pro239_Gln241dup)" "" "0000076921" "00019417" "95" "3637" "0" "3637" "0" "c.3637C>T" "r.(?)" "p.(Arg1213Trp)" "25" "0000076922" "00019417" "95" "3604" "0" "3604" "0" "c.3604G>T" "r.(?)" "p.(Gly1202Cys)" "25" "0000076923" "00019417" "95" "3476" "0" "3476" "0" "c.3476G>A" "r.(?)" "p.(Arg1159Gln)" "25" "0000076924" "00019417" "95" "3473" "0" "3473" "0" "c.3473A>T" "r.(?)" "p.(Asp1158Val)" "25" "0000076925" "00019417" "95" "3475" "0" "3475" "0" "c.3475C>G" "r.(?)" "p.(Arg1159Gly)" "25" "0000076926" "00019417" "95" "2642" "0" "2642" "0" "c.2642G>T" "r.(?)" "p.(Gly881Val)" "18" "0000076927" "00019417" "95" "3485" "0" "3485" "0" "c.3485G>A" "r.(?)" "p.(Arg1162His)" "25" "0000076928" "00019417" "95" "3476" "0" "3476" "0" "c.3476G>T" "r.(?)" "p.(Arg1159Leu)" "25" "0000076929" "00019417" "95" "2648" "0" "2648" "0" "c.2648C>T" "r.(?)" "p.(Pro883Leu)" "18" "0000076930" "00019417" "95" "3602" "0" "3602" "0" "c.3602C>T" "r.(?)" "p.(Ala1201Val)" "25" "0000076931" "00019417" "95" "2815" "0" "2815" "0" "c.2815C>T" "r.(?)" "p.(His939Tyr)" "19" "0000076932" "00019417" "95" "2267" "0" "2267" "0" "c.2267C>T" "r.(?)" "p.(Thr756Ile)" "15" "0000076933" "00019417" "95" "3313" "0" "3313" "0" "c.3313C>T" "r.(?)" "p.(Arg1105Cys)" "24" "0000076934" "00019417" "95" "2556" "0" "2556" "0" "c.2556A>C" "r.(?)" "p.(Glu852Asp)" "18" "0000076935" "00019417" "95" "2641" "0" "2641" "0" "c.2641G>C" "r.(?)" "p.(Gly881Arg)" "18" "0000076936" "00019417" "95" "3404" "0" "3404" "0" "c.3404T>C" "r.(?)" "p.(Leu1135Pro)" "24" "0000076937" "00019417" "95" "3562" "0" "3562" "0" "c.3562G>C" "r.(?)" "p.(Ala1188Pro)" "25" "0000076938" "00019417" "95" "3314" "0" "3314" "0" "c.3314G>C" "r.(?)" "p.(Arg1105Pro)" "24" "0000076939" "00019417" "95" "2255" "0" "2255" "0" "c.2255G>C" "r.(?)" "p.(Gly752Ala)" "15" "0000076940" "00019417" "95" "2554" "0" "2554" "0" "c.2554G>A" "r.(?)" "p.(Glu852Lys)" "18" "0000076941" "00019417" "95" "2837" "0" "2837" "0" "c.2837T>C" "r.(?)" "p.(Leu946Ser)" "19" "0000076942" "00019417" "95" "3614" "0" "3614" "0" "c.3614A>G" "r.(?)" "p.(Asp1205Gly)" "25" "0000076943" "00019417" "95" "2561" "0" "2561" "0" "c.2561A>G" "r.(?)" "p.(His854Arg)" "18" "0000076944" "00019417" "95" "2264" "0" "2264" "0" "c.2264A>G" "r.(?)" "p.(Lys755Arg)" "15" "0000076945" "00019417" "95" "3436" "0" "3436" "0" "c.3436A>C" "r.(?)" "p.(Ser1146Arg)" "24" "0000076946" "00019417" "95" "2838" "0" "2838" "0" "c.2838A>T" "r.(?)" "p.(Leu946Phe)" "19" "0000076947" "00019417" "95" "2551" "0" "2551" "0" "c.2551G>C" "r.(?)" "p.(Asp851His)" "18" "0000076948" "00019417" "95" "2563" "0" "2563" "0" "c.2563C>G" "r.(?)" "p.(Arg855Gly)" "18" "0000079324" "00019417" "00" "1574" "0" "1574" "0" "c.1574G>A" "r.(?)" "p.(Arg525His)" "" "0000079394" "00019417" "00" "1514" "0" "1514" "0" "c.1514G>A" "r.(?)" "p.(Arg505Gln)" "" "0000079484" "00019417" "00" "-1811337" "0" "6011033" "0" "c.-1811337_*6006260del" "r.0?" "p.0?" "" "0000079530" "00019417" "00" "4258" "0" "4258" "0" "c.4258G>A" "r.(?)" "p.(Gly1420Arg)" "" "0000079572" "00019417" "00" "1573" "0" "1573" "0" "c.1573C>T" "r.(?)" "p.(Arg525Cys)" "" "0000140360" "00019417" "90" "2554" "0" "2554" "0" "c.2554G>A" "r.(?)" "p.(Glu852Lys)" "18" "0000140361" "00019417" "90" "2639" "0" "2639" "0" "c.2639C>T" "r.(?)" "p.(Thr880Ile)" "18" "0000140362" "00019417" "90" "2564" "0" "2564" "0" "c.2564G>A" "r.(?)" "p.(Arg855Gln)" "18" "0000248618" "00019417" "10" "1827" "0" "1827" "0" "c.1827A>G" "r.(?)" "p.(Pro609=)" "" "0000254906" "00019417" "30" "708" "0" "708" "0" "c.708A>G" "r.(?)" "p.(Gln236=)" "" "0000298380" "00019417" "50" "2744" "0" "2744" "0" "c.2744C>A" "r.(?)" "p.(Ala915Asp)" "" "0000298381" "00019417" "50" "511" "0" "511" "0" "c.511C>A" "r.(?)" "p.(Pro171Thr)" "" "0000298382" "00019417" "50" "668" "0" "669" "0" "c.668_669del" "r.(?)" "p.(Gln223ProfsTer35)" "" "0000298383" "00019417" "30" "699" "0" "707" "0" "c.699_707del" "r.(?)" "p.(Gln236_Gln238del)" "" "0000298385" "00019417" "10" "705" "0" "707" "0" "c.705_707del" "r.(?)" "p.(Gln238del)" "" "0000302332" "00019417" "10" "2349" "-10" "2349" "-10" "c.2349-10dup" "r.(=)" "p.(=)" "" "0000302333" "00019417" "70" "3437" "0" "3437" "0" "c.3437G>C" "r.(?)" "p.(Ser1146Thr)" "" "0000302335" "00019417" "30" "705" "0" "707" "0" "c.705_707del" "r.(?)" "p.(Gln238del)" "" "0000308581" "00019417" "50" "1018" "0" "1018" "0" "c.1018G>C" "r.(?)" "p.(Val340Leu)" "" "0000308582" "00019417" "30" "3192" "0" "3192" "0" "c.3192G>T" "r.(?)" "p.(Ala1064=)" "" "0000308583" "00019417" "30" "3438" "0" "3438" "0" "c.3438C>T" "r.(?)" "p.(Ser1146=)" "" "0000308584" "00019417" "30" "4595" "-7" "4595" "-7" "c.4595-7G>C" "r.(=)" "p.(=)" "" "0000308587" "00019417" "10" "705" "0" "707" "0" "c.705_707del" "r.(?)" "p.(Gln238del)" "" "0000332533" "00019417" "50" "161" "0" "161" "0" "c.161C>T" "r.(?)" "p.(Ser54Phe)" "" "0000332534" "00019417" "50" "310" "0" "310" "0" "c.310C>T" "r.(?)" "p.(Pro104Ser)" "" "0000332535" "00019417" "50" "335" "0" "335" "0" "c.335C>A" "r.(?)" "p.(Pro112Gln)" "" "0000332536" "00019417" "30" "699" "0" "707" "0" "c.699_707dup" "r.(?)" "p.(Gln236_Gln238dup)" "" "0000332538" "00019417" "30" "699" "0" "707" "0" "c.699_707del" "r.(?)" "p.(Gln236_Gln238del)" "" "0000332539" "00019417" "30" "696" "0" "707" "0" "c.696_707del" "r.(?)" "p.(Gln235_Gln238del)" "" "0000332540" "00019417" "30" "693" "0" "707" "0" "c.693_707del" "r.(?)" "p.(Gln234_Gln238del)" "" "0000332542" "00019417" "50" "705" "0" "707" "0" "c.705_707del" "r.(?)" "p.(Gln238del)" "" "0000332547" "00019417" "50" "844" "0" "844" "0" "c.844G>A" "r.(?)" "p.(Ala282Thr)" "" "0000332548" "00019417" "30" "4595" "-7" "4595" "-7" "c.4595-7G>C" "r.(=)" "p.(=)" "" "0000341121" "00019417" "50" "3383" "0" "3383" "0" "c.3383C>A" "r.(?)" "p.(Ala1128Asp)" "" "0000341716" "00019417" "90" "3314" "0" "3314" "0" "c.3314G>A" "r.(?)" "p.(Arg1105His)" "" "0000343900" "00019417" "50" "3790" "0" "3790" "0" "c.3790G>A" "r.(?)" "p.(Asp1264Asn)" "" "0000345654" "00019417" "70" "3394" "0" "3394" "0" "c.3394G>C" "r.(?)" "p.(Gly1132Arg)" "" "0000346367" "00019417" "50" "370" "0" "370" "0" "c.370C>T" "r.(?)" "p.(His124Tyr)" "" "0000347416" "00019417" "50" "4352" "0" "4352" "0" "c.4352A>C" "r.(?)" "p.(Lys1451Thr)" "" "0000368381" "00019417" "70" "2226" "0" "2231" "0" "c.2226_2231delinsT" "r.(?)" "p.(Leu743Argfs*6)" "" "0000394876" "00019417" "90" "2884" "-2371" "3982" "-14627" "c.2884-2371_3982-14627del" "r.2884_3981del" "p.Val962_Arg1327del" "19i_27i" "0000394877" "00019417" "50" "2561" "0" "2561" "0" "c.2561A>G" "r.(?)" "p.(His854Arg)" "18" "0000394878" "00019417" "50" "2561" "0" "2561" "0" "c.2561A>T" "r.(?)" "p.(His854Leu)" "18" "0000394879" "00019417" "50" "2554" "0" "2554" "0" "c.2554G>C" "r.(?)" "p.(Glu852Gln)" "18" "0000394880" "00019417" "50" "0" "0" "0" "0" "c.?" "r.(?)" "p.(Glu852Asp)" "" "0000394881" "00019417" "50" "2554" "0" "2554" "0" "c.2554G>A" "r.(?)" "p.(Glu852Lys)" "18" "0000394882" "00019417" "50" "2554" "0" "2554" "0" "c.2554G>A" "r.(?)" "p.(Glu852Lys)" "18" "0000394883" "00019417" "50" "2551" "0" "2551" "0" "c.2551G>C" "r.(?)" "p.(Asp851His)" "18" "0000394884" "00019417" "50" "0" "0" "0" "0" "c.?" "r.(?)" "p.(Phe903Leu)" "" "0000394885" "00019417" "50" "2648" "0" "2648" "0" "c.2648C>T" "r.(?)" "p.(Pro883Leu)" "18" "0000394886" "00019417" "50" "2648" "0" "2648" "0" "c.2648C>T" "r.(?)" "p.(Pro883Leu)" "18" "0000394888" "00019417" "50" "2648" "0" "2648" "0" "c.2648C>T" "r.(?)" "p.(Pro883Leu)" "18" "0000394889" "00019417" "50" "0" "0" "0" "0" "c.?" "r.(?)" "p.(Gly881Arg)" "" "0000394890" "00019417" "50" "2642" "0" "2642" "0" "c.2642G>T" "r.(?)" "p.(Gly881Val)" "18" "0000394891" "00019417" "50" "2639" "0" "2639" "0" "c.2639C>T" "r.(?)" "p.(Thr880Ile)" "18" "0000394892" "00019417" "50" "0" "0" "0" "0" "c.?" "r.(?)" "p.(Leu946Phe)" "" "0000394893" "00019417" "50" "2837" "0" "2837" "0" "c.2837T>C" "r.(?)" "p.(Leu946Ser)" "19" "0000394894" "00019417" "50" "2815" "0" "2815" "0" "c.2815C>T" "r.(?)" "p.(His939Tyr)" "19" "0000394895" "00019417" "50" "2815" "0" "2815" "0" "c.2815C>T" "r.(?)" "p.(His939Tyr)" "19" "0000394896" "00019417" "50" "3220" "0" "3220" "0" "c.3220C>G" "r.(?)" "p.(Gln1074Glu)" "23" "0000394897" "00019417" "50" "3209" "0" "3209" "0" "c.3209T>A" "r.(?)" "p.(Leu1070Gln)" "23" "0000394898" "00019417" "50" "2348" "0" "2348" "0" "c.2348C>G" "r.(?)" "p.(Ser783Trp)" "15" "0000394899" "00019417" "50" "3293" "0" "3293" "0" "c.3293G>A" "r.(?)" "p.(Gly1098Asp)" "24" "0000394900" "00019417" "50" "3314" "0" "3314" "0" "c.3314G>A" "r.(?)" "p.(Arg1105His)" "24" "0000394901" "00019417" "50" "3314" "0" "3314" "0" "c.3314G>A" "r.(?)" "p.(Arg1105His)" "24" "0000394902" "00019417" "50" "3314" "0" "3314" "0" "c.3314G>C" "r.(?)" "p.(Arg1105Pro)" "24" "0000394903" "00019417" "50" "3313" "0" "3313" "0" "c.3313C>T" "r.(?)" "p.(Arg1105Cys)" "24" "0000394904" "00019417" "50" "3377" "0" "3377" "0" "c.3377C>G" "r.(?)" "p.(Thr1126Arg)" "24" "0000394905" "00019417" "50" "3385" "0" "3385" "0" "c.3385G>C" "r.(?)" "p.(Gly1129Arg)" "24" "0000394906" "00019417" "50" "3392" "0" "3392" "0" "c.3392T>C" "r.(?)" "p.(Leu1131Pro)" "24" "0000394907" "00019417" "50" "3395" "0" "3395" "0" "c.3395G>A" "r.(?)" "p.(Gly1132Asp)" "24" "0000394908" "00019417" "50" "3404" "0" "3404" "0" "c.3404T>C" "r.(?)" "p.(Leu1135Pro)" "24" "0000394909" "00019417" "50" "2267" "0" "2267" "0" "c.2267C>T" "r.(?)" "p.(Thr756Ile)" "15" "0000394910" "00019417" "50" "0" "0" "0" "0" "c.?" "r.(?)" "p.(Ser1146Arg)" "" "0000394911" "00019417" "50" "3466" "0" "3466" "0" "c.3466G>C" "r.(?)" "p.(Ala1156Pro)" "25" "0000394912" "00019417" "50" "3473" "0" "3473" "0" "c.3473A>T" "r.(?)" "p.(Asp1158Val)" "25" "0000394913" "00019417" "50" "3563" "0" "3563" "0" "c.3563C>A" "r.(?)" "p.(Ala1188Glu)" "25" "0000394914" "00019417" "50" "3562" "0" "3562" "0" "c.3562G>C" "r.(?)" "p.(Ala1188Pro)" "25" "0000394915" "00019417" "50" "3485" "0" "3485" "0" "c.3485G>A" "r.(?)" "p.(Arg1162His)" "25" "0000394916" "00019417" "50" "3485" "0" "3485" "0" "c.3485G>A" "r.(?)" "p.(Arg1162His)" "25" "0000394917" "00019417" "50" "3484" "0" "3484" "0" "c.3484C>A" "r.(?)" "p.(Arg1162Ser)" "25" "0000394918" "00019417" "50" "3475" "0" "3475" "0" "c.3475C>G" "r.(?)" "p.(Arg1159Gly)" "25" "0000394919" "00019417" "50" "3475" "0" "3475" "0" "c.3475C>G" "r.(?)" "p.(Arg1159Gly)" "25" "0000394920" "00019417" "50" "2264" "0" "2264" "0" "c.2264A>G" "r.(?)" "p.(Lys755Arg)" "15" "0000394921" "00019417" "50" "3475" "0" "3475" "0" "c.3475C>G" "r.(?)" "p.(Arg1159Gly)" "25" "0000394922" "00019417" "50" "3476" "0" "3476" "0" "c.3476G>A" "r.(?)" "p.(Arg1159Gln)" "25" "0000394923" "00019417" "50" "3476" "0" "3476" "0" "c.3476G>A" "r.(?)" "p.(Arg1159Gln)" "25" "0000394924" "00019417" "50" "3476" "0" "3476" "0" "c.3476G>T" "r.(?)" "p.(Arg1159Leu)" "25" "0000394925" "00019417" "50" "3593" "0" "3593" "0" "c.3593T>G" "r.(?)" "p.(Val1198Gly)" "25" "0000394926" "00019417" "50" "3602" "0" "3602" "0" "c.3602C>T" "r.(?)" "p.(Ala1201Val)" "25" "0000394927" "00019417" "50" "3602" "0" "3602" "0" "c.3602C>T" "r.(?)" "p.(Ala1201Val)" "25" "0000394928" "00019417" "50" "3602" "0" "3602" "0" "c.3602C>T" "r.(?)" "p.(Ala1201Val)" "25" "0000394929" "00019417" "50" "3602" "0" "3602" "0" "c.3602C>T" "r.(?)" "p.(Ala1201Val)" "25" "0000394930" "00019417" "50" "3604" "0" "3604" "0" "c.3604G>T" "r.(?)" "p.(Gly1202Cys)" "25" "0000394931" "00019417" "50" "2255" "0" "2255" "0" "c.2255G>C" "r.(?)" "p.(Gly752Ala)" "15" "0000394932" "00019417" "50" "3614" "0" "3614" "0" "c.3614A>G" "r.(?)" "p.(Asp1205Gly)" "25" "0000394933" "00019417" "50" "3637" "0" "3637" "0" "c.3637C>T" "r.(?)" "p.(Arg1213Trp)" "25" "0000394934" "00019417" "50" "2255" "0" "2255" "0" "c.2255G>C" "r.(?)" "p.(Gly752Ala)" "15" "0000394935" "00019417" "50" "2563" "0" "2563" "0" "c.2563C>G" "r.(?)" "p.(Arg855Gly)" "18" "0000394936" "00019417" "50" "2564" "0" "2564" "0" "c.2564G>A" "r.(?)" "p.(Arg855Gln)" "18" "0000537752" "00019417" "50" "47" "0" "47" "0" "c.47C>T" "r.(?)" "p.(Ser16Leu)" "" "0000537753" "00019417" "30" "666" "0" "666" "0" "c.666A>G" "r.(?)" "p.(Gln222=)" "" "0000537758" "00019417" "30" "683" "0" "683" "0" "c.683A>C" "r.(?)" "p.(Gln228Pro)" "" "0000537759" "00019417" "10" "685" "0" "686" "0" "c.685_686insCGC" "r.(?)" "p.(Gln228_Gln229insPro)" "" "0000537760" "00019417" "30" "699" "0" "707" "0" "c.699_707dup" "r.(?)" "p.(Gln236_Gln238dup)" "" "0000537762" "00019417" "10" "699" "0" "707" "0" "c.699_707dup" "r.(?)" "p.(Gln236_Gln238dup)" "" "0000537763" "00019417" "30" "702" "0" "707" "0" "c.702_707del" "r.(?)" "p.(Gln237_Gln238del)" "" "0000537764" "00019417" "30" "702" "0" "707" "0" "c.702_707dup" "r.(?)" "p.(Gln237_Gln238dup)" "" "0000537765" "00019417" "10" "702" "0" "707" "0" "c.702_707dup" "r.(?)" "p.(Gln237_Gln238dup)" "" "0000537766" "00019417" "10" "702" "0" "707" "0" "c.702_707dup" "r.(?)" "p.(Gln237_Gln238dup)" "" "0000537768" "00019417" "10" "705" "0" "707" "0" "c.705_707dup" "r.(?)" "p.(Gln238dup)" "" "0000537771" "00019417" "90" "1573" "0" "1573" "0" "c.1573C>T" "r.(?)" "p.(Arg525Cys)" "" "0000537772" "00019417" "30" "1746" "8" "1746" "8" "c.1746+8A>G" "r.(=)" "p.(=)" "" "0000537775" "00019417" "30" "2037" "-9" "2037" "-9" "c.2037-9C>T" "r.(=)" "p.(=)" "" "0000537776" "00019417" "30" "2349" "-6" "2349" "-6" "c.2349-6C>T" "r.(=)" "p.(=)" "" "0000537779" "00019417" "70" "2431" "0" "2431" "0" "c.2431C>T" "r.(?)" "p.(Arg811Cys)" "" "0000537781" "00019417" "90" "2564" "0" "2564" "0" "c.2564G>A" "r.(?)" "p.(Arg855Gln)" "" "0000537783" "00019417" "10" "2733" "0" "2733" "0" "c.2733A>G" "r.(?)" "p.(Gln911=)" "" "0000537784" "00019417" "70" "2764" "0" "2764" "0" "c.2764G>A" "r.(?)" "p.(Glu922Lys)" "" "0000537799" "00019417" "70" "3203" "0" "3203" "0" "c.3203G>A" "r.(?)" "p.(Arg1068Gln)" "" "0000537800" "00019417" "70" "3314" "0" "3314" "0" "c.3314G>T" "r.(?)" "p.(Arg1105Leu)" "" "0000537801" "00019417" "30" "3528" "0" "3528" "0" "c.3528C>T" "r.(?)" "p.(Thr1176=)" "" "0000537802" "00019417" "10" "3555" "0" "3555" "0" "c.3555C>T" "r.(?)" "p.(Leu1185=)" "" "0000537812" "00019417" "50" "4252" "0" "4252" "0" "c.4252A>G" "r.(?)" "p.(Ser1418Gly)" "" "0000537816" "00019417" "50" "4760" "0" "4760" "0" "c.4760C>T" "r.(?)" "p.(Thr1587Met)" "" "0000537817" "00019417" "30" "4761" "0" "4761" "0" "c.4761G>A" "r.(?)" "p.(Thr1587=)" "" "0000612052" "00019417" "30" "702" "0" "707" "0" "c.702_707dup" "r.(?)" "p.(Gln237_Gln238dup)" "" "0000612053" "00019417" "30" "705" "0" "707" "0" "c.705_707dup" "r.(?)" "p.(Gln238dup)" "" "0000612054" "00019417" "50" "1282" "0" "1282" "0" "c.1282A>G" "r.(?)" "p.(Met428Val)" "" "0000612055" "00019417" "30" "1821" "0" "1821" "0" "c.1821C>T" "r.(?)" "p.(Phe607=)" "" "0000612056" "00019417" "30" "2136" "0" "2136" "0" "c.2136G>A" "r.(?)" "p.(Val712=)" "" "0000612059" "00019417" "50" "3347" "0" "3347" "0" "c.3347G>C" "r.(?)" "p.(Gly1116Ala)" "" "0000612061" "00019417" "30" "4717" "0" "4717" "0" "c.4717G>A" "r.(?)" "p.(Asp1573Asn)" "" "0000622245" "00019417" "30" "693" "0" "707" "0" "c.693_707del" "r.(?)" "p.(Gln234_Gln238del)" "" "0000652687" "00019417" "70" "2486" "0" "2486" "0" "c.2486C>T" "r.(?)" "p.(Thr829Ile)" "" "0000652689" "00019417" "30" "4590" "0" "4590" "0" "c.4590C>T" "r.(=)" "p.(=)" "" "0000656321" "00019417" "50" "8" "0" "8" "0" "c.8C>T" "r.(?)" "p.(Thr3Met)" "" "0000656322" "00019417" "30" "8" "0" "8" "0" "c.8C>T" "r.(?)" "p.(Thr3Met)" "" "0000656323" "00019417" "10" "685" "0" "686" "0" "c.685_686insCGC" "r.(?)" "p.(Gln228_Gln229insPro)" "" "0000656324" "00019417" "30" "705" "0" "707" "0" "c.705_707dup" "r.(?)" "p.(Gln238dup)" "" "0000656327" "00019417" "30" "4767" "0" "4767" "0" "c.4767T>C" "r.(?)" "p.(Asp1589=)" "" "0000678645" "00019417" "50" "687" "0" "707" "0" "c.687_707del" "r.(?)" "p.(Gln232_Gln238del)" "" "0000678646" "00019417" "30" "695" "0" "695" "0" "c.695A>C" "r.(?)" "p.(Gln232Pro)" "" "0000678647" "00019417" "30" "699" "0" "707" "0" "c.699_707del" "r.(?)" "p.(Gln236_Gln238del)" "" "0000690507" "00019417" "50" "3601" "0" "3601" "0" "c.3601G>A" "r.(?)" "p.(Ala1201Thr)" "" "0000698346" "00019417" "90" "3464" "0" "3464" "0" "c.3464A>C" "r.(?)" "p.(Gln1155Pro)" "25" "0000698347" "00019417" "70" "3733" "0" "3733" "0" "c.3733C>G" "r.(?)" "p.(Arg1245Gly)" "26" "0000698348" "00019417" "70" "3733" "0" "3733" "0" "c.3733C>G" "r.(?)" "p.(Arg1245Gly)" "26" "0000701994" "00019417" "70" "3721" "0" "3721" "0" "c.3721C>G" "r.(?)" "p.(Gln1241Glu)" "26" "0000703882" "00019417" "90" "3721" "0" "3721" "0" "c.3721C>G" "r.(?)" "p.(Gln1241Glu)" "" "0000722464" "00019417" "30" "1968" "0" "1968" "0" "c.1968C>T" "r.(?)" "p.(Thr656=)" "" "0000722465" "00019417" "70" "2671" "0" "2671" "0" "c.2671C>T" "r.(?)" "p.(Leu891Phe)" "" "0000722466" "00019417" "70" "2725" "0" "2725" "0" "c.2725T>A" "r.(?)" "p.(Phe909Ile)" "" "0000722468" "00019417" "90" "3573" "0" "3573" "0" "c.3573G>C" "r.(?)" "p.(Lys1191Asn)" "" "0000722471" "00019417" "30" "4207" "0" "4207" "0" "c.4207G>A" "r.(?)" "p.(Val1403Met)" "" "0000804052" "00019417" "30" "483" "0" "483" "0" "c.483G>T" "r.(?)" "p.(Pro161=)" "" "0000804053" "00019417" "50" "686" "0" "715" "0" "c.686_715del" "r.(?)" "p.(Gln229_Gln238del)" "" "0000804054" "00019417" "30" "762" "0" "762" "0" "c.762G>A" "r.(?)" "p.(Pro254=)" "" "0000804055" "00019417" "30" "844" "0" "844" "0" "c.844G>A" "r.(?)" "p.(Ala282Thr)" "" "0000804056" "00019417" "30" "1174" "-5" "1174" "-5" "c.1174-5G>A" "r.spl?" "p.?" "" "0000804057" "00019417" "30" "2595" "0" "2595" "0" "c.2595G>A" "r.(?)" "p.(Gln865=)" "" "0000804058" "00019417" "30" "2991" "10" "2991" "10" "c.2991+10G>T" "r.(=)" "p.(=)" "" "0000804059" "00019417" "30" "3282" "0" "3282" "0" "c.3282A>G" "r.(?)" "p.(Leu1094=)" "" "0000852224" "00019417" "30" "666" "0" "677" "0" "c.666_677del" "r.(?)" "p.(Gln235_Gln238del)" "" "0000852225" "00019417" "30" "681" "0" "681" "0" "c.681G>A" "r.(?)" "p.(Gln227=)" "" "0000852226" "00019417" "30" "689" "0" "689" "0" "c.689A>C" "r.(?)" "p.(Gln230Pro)" "" "0000852227" "00019417" "90" "2648" "0" "2648" "0" "c.2648C>T" "r.(?)" "p.(Pro883Leu)" "" "0000861598" "00019417" "50" "97" "0" "97" "0" "c.97C>T" "r.(?)" "p.(Pro33Ser)" "" "0000861599" "00019417" "30" "97" "0" "97" "0" "c.97C>T" "r.(?)" "p.(Pro33Ser)" "" "0000861600" "00019417" "30" "717" "0" "717" "0" "c.717G>A" "r.(?)" "p.(Pro239=)" "" "0000861601" "00019417" "70" "1268" "0" "1269" "0" "c.1268_1269del" "r.(?)" "p.(Leu423Glnfs*16)" "" "0000861602" "00019417" "30" "2991" "10" "2991" "10" "c.2991+10G>A" "r.(=)" "p.(=)" "" "0000861604" "00019417" "50" "4151" "0" "4151" "0" "c.4151C>G" "r.(?)" "p.(Thr1384Arg)" "" "0000861605" "00019417" "30" "4761" "0" "4761" "0" "c.4761G>A" "r.(?)" "p.(Thr1587=)" "" "0000888779" "00019417" "50" "681" "0" "707" "0" "c.681_707dup" "r.(?)" "p.(Gln230_Gln238dup)" "" "0000888780" "00019417" "30" "695" "0" "715" "0" "c.695_715del" "r.(?)" "p.(Gln232_Gln238del)" "" "0000888781" "00019417" "50" "696" "0" "707" "0" "c.696_707dup" "r.(?)" "p.(Gln235_Gln238dup)" "" "0000888782" "00019417" "70" "1600" "0" "1600" "0" "c.1600G>A" "r.(?)" "p.(Asp534Asn)" "" "0000913139" "00019417" "30" "400" "0" "400" "0" "c.400G>A" "r.(?)" "p.(Val134Ile)" "" "0000913140" "00019417" "50" "708" "0" "710" "0" "c.708_710dup" "r.(?)" "p.(Gln238dup)" "" "0000921052" "00019417" "70" "3673" "0" "3673" "0" "c.3673G>A" "r.(?)" "p.(Glu1225Lys)" "" "0000922583" "00019417" "70" "2254" "0" "2254" "0" "c.2254G>A" "r.(?)" "p.(Gly752Arg)" "15" "0000922584" "00019417" "50" "2267" "0" "2267" "0" "c.2267C>T" "r.(?)" "p.(Thr756Ile)" "15" "0000922585" "00019417" "70" "2348" "0" "2348" "0" "c.2348C>T" "r.(?)" "p.(Ser783Leu)" "15" "0000922586" "00019417" "50" "2361" "0" "2361" "0" "c.2361C>A" "r.(?)" "p.(Asn787Lys)" "16" "0000922587" "00019417" "90" "2554" "0" "2554" "0" "c.2554G>C" "r.(?)" "p.(Glu852Gln)" "18" "0000922588" "00019417" "90" "2564" "0" "2564" "0" "c.2564G>A" "r.(?)" "p.(Arg855Gln)" "18" "0000922589" "00019417" "90" "2648" "0" "2648" "0" "c.2648C>T" "r.(?)" "p.(Pro883Leu)" "18" "0000922590" "00019417" "70" "2810" "0" "2810" "0" "c.2810G>A" "r.(?)" "p.(Arg937His)" "19" "0000922591" "00019417" "90" "3476" "0" "3476" "0" "c.3476G>A" "r.(?)" "p.(Arg1159Gln)" "25" "0000925027" "00019417" "30" "702" "0" "707" "0" "c.702_707del" "r.(?)" "p.(Gln237_Gln238del)" "" "0000929580" "00019417" "50" "2122" "0" "2122" "0" "c.2122A>G" "r.(?)" "p.(Ile708Val)" "" "0000931852" "00019417" "70" "2420" "0" "2420" "0" "c.2420C>T" "r.(?)" "p.(Thr807Ile)" "" "0000965351" "00019417" "70" "2253" "0" "2253" "0" "c.2253G>A" "r.(?)" "p.(Met751Ile)" "" "0000978641" "00019417" "50" "436" "0" "436" "0" "c.436C>T" "r.(?)" "p.(Pro146Ser)" "" "0000978642" "00019417" "30" "674" "0" "675" "0" "c.674_675del" "r.(?)" "p.(Gln225Profs*33)" "" "0000978643" "00019417" "30" "685" "0" "686" "0" "c.685_686insCGC" "r.(?)" "p.(Gln228_Gln229insPro)" "" "0000978644" "00019417" "50" "686" "0" "687" "0" "c.686_687del" "r.(?)" "p.(Gln229Profs*29)" "" "0000978645" "00019417" "50" "689" "0" "689" "0" "c.689del" "r.(?)" "p.(Gln230Argfs*40)" "" "0000978646" "00019417" "30" "1047" "-2165" "1047" "-2165" "c.1047-2165T>C" "r.(=)" "p.(=)" "" "0000978648" "00019417" "30" "2349" "-292" "2349" "-292" "c.2349-292G>T" "r.(=)" "p.(=)" "" "0000978652" "00019417" "50" "3768" "0" "3768" "0" "c.3768G>T" "r.(?)" "p.(Met1256Ile)" "" "0000978653" "00019417" "50" "3982" "-1822" "3982" "-1822" "c.3982-1822C>T" "r.(=)" "p.(=)" "" "0000978654" "00019417" "30" "3982" "-1814" "3982" "-1814" "c.3982-1814C>G" "r.(=)" "p.(=)" "" "0000978655" "00019417" "50" "4009" "0" "4009" "0" "c.4009A>G" "r.(?)" "p.(Met1337Val)" "" "0000978657" "00019417" "10" "4590" "0" "4590" "0" "c.4590C>T" "r.(?)" "p.(=)" "" "0000985345" "00019417" "70" "2558" "0" "2558" "0" "c.2558G>A" "r.(?)" "p.(Gly853Asp)" "18" "0000997799" "00019417" "50" "91" "0" "91" "0" "c.91C>T" "r.(?)" "p.(Pro31Ser)" "" "0000997800" "00019417" "30" "97" "0" "97" "0" "c.97C>G" "r.(?)" "p.(Pro33Ala)" "" "0000997801" "00019417" "30" "175" "0" "175" "0" "c.175A>T" "r.(?)" "p.(Thr59Ser)" "" "0000997802" "00019417" "30" "677" "0" "677" "0" "c.677A>C" "r.(?)" "p.(Gln226Pro)" "" "0000997803" "00019417" "50" "682" "0" "683" "0" "c.682_683insCGC" "r.(?)" "p.(Gln227_Gln228insPro)" "" "0000997804" "00019417" "30" "698" "0" "698" "0" "c.698A>C" "r.(?)" "p.(Gln233Pro)" "" "0000997805" "00019417" "50" "708" "0" "708" "0" "c.708A>T" "r.(?)" "p.(Gln236His)" "" "0000997806" "00019417" "30" "708" "0" "710" "0" "c.708_710dup" "r.(?)" "p.(Gln238dup)" "" "0000997807" "00019417" "50" "975" "0" "975" "0" "c.975G>C" "r.(?)" "p.(Gln325His)" "" "0000997808" "00019417" "30" "1312" "0" "1312" "0" "c.1312A>G" "r.(?)" "p.(Ile438Val)" "" "0000997809" "00019417" "50" "2037" "-4" "2037" "-4" "c.2037-4C>A" "r.spl?" "p.?" "" "0000997812" "00019417" "30" "3799" "0" "3799" "0" "c.3799A>C" "r.(?)" "p.(Asn1267His)" "" "0000997813" "00019417" "50" "3899" "0" "3899" "0" "c.3899A>G" "r.(?)" "p.(Glu1300Gly)" "" "0000997814" "00019417" "30" "4717" "0" "4717" "0" "c.4717G>A" "r.(?)" "p.(Asp1573Asn)" "" "0000997815" "00019417" "50" "4765" "0" "4765" "0" "c.4765G>C" "r.(?)" "p.(Asp1589His)" "" "0001007054" "00019417" "90" "1538" "0" "1538" "0" "c.1538G>T" "r.(?)" "p.(Gly513Val)" "9" "0001014525" "00019417" "90" "1596" "0" "1596" "0" "c.1596G>C" "r.(?)" "p.(Gln532His)" "" "0001025650" "00019417" "30" "666" "0" "668" "0" "c.666_668del" "r.(?)" "p.(Gln238del)" "" "0001025651" "00019417" "50" "690" "0" "707" "0" "c.690_707del" "r.(?)" "p.(Gln233_Gln238del)" "" "0001025652" "00019417" "30" "2527" "-3" "2527" "-3" "c.2527-3T>C" "r.spl?" "p.?" "" "0001025653" "00019417" "50" "4254" "-4" "4254" "-4" "c.4254-4A>G" "r.spl?" "p.?" "" "0001030083" "00019417" "70" "2657" "0" "2657" "0" "c.2657A>G" "r.(?)" "p.(Asn886Ser)" "" "0001037427" "00019417" "30" "355" "10" "355" "10" "c.355+10C>T" "r.(=)" "p.(=)" "" "0001037428" "00019417" "50" "471" "0" "471" "0" "c.471C>G" "r.(?)" "p.(Ile157Met)" "" "0001037429" "00019417" "30" "696" "0" "707" "0" "c.696_707dup" "r.(?)" "p.(Gln235_Gln238dup)" "" "0001037430" "00019417" "50" "1018" "0" "1018" "0" "c.1018G>C" "r.(?)" "p.(Val340Leu)" "" "0001037432" "00019417" "50" "1282" "0" "1282" "0" "c.1282A>G" "r.(?)" "p.(Met428Val)" "" "0001037433" "00019417" "30" "1692" "7" "1692" "7" "c.1692+7A>C" "r.(=)" "p.(=)" "" "0001037434" "00019417" "30" "1693" "-432" "1693" "-432" "c.1693-432A>T" "r.(=)" "p.(=)" "" "0001037436" "00019417" "30" "2184" "5" "2184" "5" "c.2184+5T>G" "r.spl?" "p.?" "" "0001037438" "00019417" "30" "2527" "-169" "2527" "-169" "c.2527-169C>G" "r.(=)" "p.(=)" "" "0001037444" "00019417" "50" "3259" "0" "3259" "0" "c.3259G>C" "r.(?)" "p.(Ala1087Pro)" "" "0001037446" "00019417" "30" "3684" "435" "3684" "435" "c.3684+435A>T" "r.(=)" "p.(=)" "" "0001037451" "00019417" "30" "3982" "-9330" "3982" "-9330" "c.3982-9330C>A" "r.(=)" "p.(=)" "" "0001037454" "00019417" "50" "4048" "0" "4048" "0" "c.4048A>G" "r.(?)" "p.(Arg1350Gly)" "" "0001053192" "00019417" "30" "689" "0" "689" "0" "c.689A>C" "r.(?)" "p.(Gln230Pro)" "" "0001053193" "00019417" "50" "880" "0" "880" "0" "c.880G>A" "r.(?)" "p.(Ala294Thr)" "" "0001053194" "00019417" "50" "2335" "0" "2335" "0" "c.2335A>G" "r.(?)" "p.(Ile779Val)" "" "0001053195" "00019417" "30" "2526" "3" "2526" "3" "c.2526+3A>T" "r.spl?" "p.?" "" "0001053196" "00019417" "30" "2527" "-225" "2527" "-225" "c.2527-225G>A" "r.(=)" "p.(=)" "" "0001053197" "00019417" "30" "4643" "0" "4643" "0" "c.4643G>T" "r.(?)" "p.(Gly1548Val)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 220 "{{screeningid}}" "{{variantid}}" "0000001274" "0000018842" "0000001274" "0000018851" "0000001274" "0000018904" "0000001274" "0000018907" "0000001274" "0000018946" "0000001274" "0000018960" "0000001275" "0000018951" "0000001275" "0000018953" "0000001276" "0000018881" "0000001276" "0000018931" "0000001279" "0000018683" "0000001281" "0000018853" "0000001281" "0000018882" "0000001282" "0000018854" "0000001282" "0000018916" "0000001282" "0000018932" "0000001282" "0000018939" "0000001282" "0000018942" "0000001282" "0000018958" "0000001284" "0000018883" "0000001284" "0000018917" "0000001285" "0000018855" "0000001285" "0000018880" "0000001285" "0000018910" "0000001285" "0000018943" "0000001285" "0000018949" "0000001285" "0000018955" "0000001286" "0000018685" "0000001286" "0000018856" "0000001286" "0000018884" "0000001287" "0000018857" "0000001287" "0000018905" "0000001287" "0000018950" "0000001287" "0000018956" "0000001287" "0000018959" "0000001288" "0000018876" "0000001288" "0000018885" "0000001288" "0000018918" "0000001288" "0000018933" "0000001288" "0000018944" "0000001288" "0000018947" "0000001288" "0000018957" "0000001290" "0000018858" "0000001291" "0000018859" "0000001291" "0000018886" "0000001292" "0000018919" "0000001292" "0000018934" "0000001295" "0000018887" "0000001295" "0000018914" "0000001295" "0000018920" "0000001296" "0000018843" "0000001296" "0000018860" "0000001296" "0000018911" "0000001296" "0000018948" "0000001296" "0000018952" "0000001297" "0000018861" "0000001297" "0000018888" "0000001297" "0000018921" "0000001300" "0000018863" "0000001300" "0000018890" "0000001301" "0000018864" "0000001301" "0000018891" "0000001302" "0000018865" "0000001302" "0000018892" "0000001302" "0000018922" "0000001302" "0000018935" "0000001303" "0000018866" "0000001303" "0000018893" "0000001304" "0000018894" "0000001304" "0000018909" "0000001304" "0000018923" "0000001304" "0000018936" "0000001305" "0000018878" "0000001305" "0000018895" "0000001305" "0000018906" "0000001305" "0000018924" "0000001306" "0000018867" "0000001306" "0000018896" "0000001306" "0000018912" "0000001307" "0000018868" "0000001307" "0000018897" "0000001307" "0000018925" "0000001307" "0000018937" "0000001308" "0000018898" "0000001308" "0000018926" "0000001308" "0000018938" "0000001309" "0000018879" "0000001309" "0000018927" "0000001312" "0000018869" "0000001312" "0000018899" "0000001313" "0000018870" "0000001315" "0000018684" "0000001315" "0000018871" "0000001315" "0000018900" "0000001315" "0000018928" "0000001316" "0000018682" "0000001317" "0000018872" "0000001317" "0000018913" "0000001320" "0000018874" "0000001320" "0000018902" "0000001329" "0000018875" "0000001329" "0000018929" "0000048102" "0000076921" "0000048103" "0000076922" "0000048104" "0000076923" "0000048105" "0000076924" "0000048106" "0000076925" "0000048107" "0000076926" "0000048108" "0000076927" "0000048109" "0000076928" "0000048110" "0000076929" "0000048111" "0000076930" "0000048112" "0000076931" "0000048113" "0000076932" "0000048114" "0000076933" "0000048115" "0000076934" "0000048116" "0000076935" "0000048117" "0000076936" "0000048118" "0000076937" "0000048119" "0000076938" "0000048120" "0000076939" "0000048121" "0000076940" "0000048122" "0000076941" "0000048123" "0000076942" "0000048124" "0000076943" "0000048125" "0000076944" "0000048126" "0000076945" "0000048127" "0000076946" "0000048128" "0000076947" "0000048129" "0000076948" "0000050344" "0000079324" "0000050414" "0000079394" "0000050504" "0000079484" "0000050550" "0000079530" "0000050592" "0000079572" "0000087234" "0000140360" "0000087235" "0000140361" "0000087236" "0000140362" "0000164779" "0000368381" "0000175009" "0000394876" "0000175010" "0000394877" "0000175011" "0000394878" "0000175012" "0000394879" "0000175013" "0000394880" "0000175014" "0000394881" "0000175015" "0000394882" "0000175016" "0000394883" "0000175017" "0000394884" "0000175018" "0000394885" "0000175019" "0000394886" "0000175021" "0000394888" "0000175022" "0000394889" "0000175023" "0000394890" "0000175024" "0000394891" "0000175025" "0000394892" "0000175026" "0000394893" "0000175027" "0000394894" "0000175028" "0000394895" "0000175029" "0000394896" "0000175030" "0000394897" "0000175031" "0000394898" "0000175032" "0000394899" "0000175033" "0000394900" "0000175034" "0000394901" "0000175035" "0000394902" "0000175036" "0000394903" "0000175037" "0000394904" "0000175038" "0000394905" "0000175039" "0000394906" "0000175040" "0000394907" "0000175041" "0000394908" "0000175042" "0000394909" "0000175043" "0000394910" "0000175044" "0000394911" "0000175045" "0000394912" "0000175046" "0000394913" "0000175047" "0000394914" "0000175048" "0000394915" "0000175049" "0000394916" "0000175050" "0000394917" "0000175051" "0000394918" "0000175052" "0000394919" "0000175053" "0000394920" "0000175054" "0000394921" "0000175055" "0000394922" "0000175056" "0000394923" "0000175057" "0000394924" "0000175058" "0000394925" "0000175059" "0000394926" "0000175060" "0000394927" "0000175061" "0000394928" "0000175062" "0000394929" "0000175063" "0000394930" "0000175064" "0000394931" "0000175065" "0000394932" "0000175066" "0000394933" "0000175067" "0000394934" "0000175068" "0000394935" "0000175069" "0000394936" "0000295998" "0000652687" "0000296000" "0000652689" "0000316196" "0000698346" "0000316197" "0000698347" "0000316198" "0000698348" "0000319312" "0000701994" "0000321100" "0000703882" "0000435115" "0000921052" "0000436224" "0000922583" "0000436225" "0000922584" "0000436226" "0000922585" "0000436227" "0000922586" "0000436228" "0000922587" "0000436229" "0000922588" "0000436230" "0000922589" "0000436231" "0000922590" "0000436232" "0000922591" "0000437081" "0000931852" "0000451453" "0000985345" "0000455071" "0001007054" "0000466186" "0001030083"