### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = SMARCC2) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "SMARCC2" "SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2" "12" "q13.2" "unknown" "NG_047081.1" "UD_132319637690" "" "https://www.LOVD.nl/SMARCC2" "" "1" "11105" "6601" "601734" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "" "g" "https://databases.lovd.nl/shared/refseq/SMARCC2_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2023-04-06 11:08:32" "00000" "2025-11-01 13:22:20" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00025357" "SMARCC2" "transcript variant 1" "001" "NM_003075.3" "" "NP_003066.2" "" "" "" "-106" "5482" "3645" "56583351" "56555636" "00006" "2018-12-28 13:49:15" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 6 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00138" "autism" "autism" "" "209850" "" "" "" "00084" "2013-06-04 18:17:33" "00006" "2015-12-08 23:54:35" "00139" "ID" "intellectual disability (ID)" "" "" "" "" "" "00084" "2013-06-04 18:18:07" "00006" "2015-02-09 10:02:49" "00156" "CSS" "Coffin-Siris syndrome (CSS)" "" "" "" "" "" "00001" "2013-06-27 15:22:30" "00006" "2021-12-10 21:51:32" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "05611" "NDD" "neurodevelopmental disorder (NDD)" "" "" "" "" "" "00006" "2019-06-19 12:27:20" "00006" "2024-12-13 11:12:21" "05795" "CSS8" "Coffin-Siris syndrome, type 8 (CSS8)" "AR" "618362" "" "neurodevelopmental delay, mild to severe intellectual disability, profound speech delay, behavioral abnormalities, muscular hypotonia, feeding disorders in infancy, dysmorphic facial features" "" "00006" "2020-07-25 09:01:59" "00006" "2023-04-06 11:08:17" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 2 "{{geneid}}" "{{diseaseid}}" "SMARCC2" "00156" "SMARCC2" "05795" ## Individuals ## Do not remove or alter this header ## ## Count = 61 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00183691" "" "" "" "1" "" "00006" "{PMID:Martinez 2017:27620904}, {DOI:Martinez 2017:10.1136/jmedgenet-2017-103964}" "" "" "" "Spain" "" "0" "" "" "" "27620904-Pat36" "00210696" "" "" "" "1" "" "00006" "{PMID:Machol 2018:30580808}" "" "M" "" "" "" "0" "" "" "" "30580808-Pat1" "00210697" "" "" "" "2" "" "00006" "{PMID:Machol 2018:30580808}" "affected father/son" "M" "" "" "" "0" "" "" "" "30580808-Pat2" "00210698" "" "" "" "1" "" "00006" "{PMID:Machol 2018:30580808}" "" "M" "" "" "" "0" "" "" "" "30580808-Pat3" "00210699" "" "" "" "1" "" "00006" "{PMID:Machol 2018:30580808}, {PMID:Chen 2022:34906496}" "" "M" "" "" "" "0" "" "" "" "Pat5;Pat125" "00210700" "" "" "" "1" "" "00006" "{PMID:Machol 2018:30580808}" "" "F" "" "" "" "0" "" "" "" "30580808-Pat6" "00210701" "" "" "" "1" "" "00006" "{PMID:Machol 2018:30580808}" "" "M" "" "" "" "0" "" "" "" "30580808-Pat7" "00210702" "" "" "" "1" "" "00006" "{PMID:Machol 2018:30580808}" "" "M" "" "" "" "0" "" "" "" "30580808-Pat8" "00210703" "" "" "" "1" "" "00006" "{PMID:Machol 2018:30580808}, {PMID:Chen 2022:34906496}" "" "M" "" "" "" "0" "" "" "" "Pat9;Pat127" "00210704" "" "" "" "1" "" "00006" "{PMID:Zhu 2015:25590979}, {PMID:Machol 2018:30580808}" "" "M" "-" "United States" "" "0" "" "" "" "Pat74;Pat10" "00210705" "" "" "" "1" "" "00006" "{PMID:Machol 2018:30580808}" "" "M" "" "" "" "0" "" "" "" "30580808-Pat11" "00210706" "" "" "" "1" "" "00006" "{PMID:Machol 2018:30580808}" "" "F" "" "" "" "0" "" "" "" "30580808-Pat12" "00210707" "" "" "" "1" "" "00006" "{PMID:Machol 2018:30580808}" "" "M" "" "" "" "0" "" "" "" "30580808-Pat13" "00210708" "" "" "" "1" "" "00006" "{PMID:Schön 2006:16571645}" "" "M" "" "" "" "0" "" "" "" "30580808-Pat14" "00210709" "" "" "" "1" "" "00006" "{PMID:Schön 2006:16571645}" "" "M" "" "" "" "0" "" "" "" "30580808-Pat15" "00434647" "" "" "" "1" "" "00006" "{PMID:Yi 2022:35536477}" "2-generation family, 1 affected, unaffected non carrier parents" "F" "" "China" "" "0" "" "" "" "patient" "00434648" "" "" "" "1" "" "00006" "{PMID:Carss 2014:24476948}" "affected fetus" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "F6" "00434649" "" "" "" "1" "" "00006" "{PMID:Neale 2012:22495311}" "" "" "" "" "" "0" "" "" "" "patient" "00434655" "" "" "" "1" "" "00006" "{PMID:Li 2022:34881817}" "" "F" "" "United States" "" "0" "" "" "" "Pat1" "00434656" "" "" "" "1" "" "00006" "{PMID:Li 2022:34881817}" "adopted" "F" "" "United States" "" "0" "" "" "" "patient" "00434781" "" "" "" "1" "" "00006" "{PMID:Chen 2022:34906496}" "" "" "" "" "" "0" "" "" "" "Pat123" "00434782" "" "" "" "1" "" "00006" "{PMID:Chen 2022:34906496}" "" "" "" "" "" "0" "" "" "" "Pat124" "00434783" "" "" "" "1" "" "00006" "{PMID:Chen 2022:34906496}" "" "" "" "" "" "0" "" "" "" "Pat126" "00434808" "" "" "" "1" "" "00006" "{PMID:Scott 2022:33461977}, {PMID:Gofin 2022:35796094}" "2-generation family, deceased fetus, unaffected non carrier parents" "F" "" "United States" "<00y00m00d" "0" "" "" "" "?;Pat5" "00434809" "" "" "" "1" "" "00006" "{PMID:Lo 2022:35699097}" "2-generation family, affected twin pair, unaffected carrier mother/sister" "M" "" "Japan" "" "0" "" "" "" "twins" "00434810" "" "" "" "1" "" "00006" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "" "" "0" "" "" "" "Pat18" "00434811" "" "" "" "1" "" "00006" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "" "" "0" "" "" "" "Pat7" "00434812" "" "" "" "1" "" "00006" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "" "" "0" "" "" "" "Pat8" "00434813" "" "" "" "1" "" "00006" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "" "" "0" "" "" "" "Pat43" "00434814" "" "" "" "1" "" "00006" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "" "" "0" "" "" "" "" "00434815" "" "" "" "1" "" "00006" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "" "" "0" "" "" "" "" "00434816" "" "" "" "1" "" "00006" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "" "" "0" "" "" "" "" "00434817" "" "" "" "1" "" "00006" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "" "" "0" "" "" "" "" "00434818" "" "" "" "1" "" "00006" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "" "" "0" "" "" "" "" "00434819" "" "" "" "1" "" "00006" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "" "" "0" "" "" "" "" "00434820" "" "" "" "1" "" "00006" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "" "" "0" "" "" "" "" "00434821" "" "" "" "1" "" "00006" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "" "" "0" "" "" "" "" "00434822" "" "" "" "1" "" "00006" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "" "" "0" "" "" "" "" "00434823" "" "" "" "1" "" "00006" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "" "" "0" "" "" "" "" "00434824" "" "" "" "1" "" "00006" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "" "" "0" "" "" "" "" "00434825" "" "" "" "1" "" "00006" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "" "" "0" "" "" "" "" "00434826" "" "" "" "1" "" "00006" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "" "" "0" "" "" "" "" "00434827" "" "" "" "1" "" "00006" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "" "" "0" "" "" "" "" "00434828" "" "" "" "1" "" "00006" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "" "" "0" "" "" "" "" "00434829" "" "" "" "1" "" "00006" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "" "" "0" "" "" "" "" "00434830" "" "" "" "1" "" "00006" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "" "" "0" "" "" "" "" "00434831" "" "" "" "1" "" "00006" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "" "" "0" "" "" "" "" "00434832" "" "" "" "1" "" "00006" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "" "" "0" "" "" "" "" "00434833" "" "" "" "1" "" "00006" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "" "" "0" "" "" "" "" "00434834" "" "" "" "1" "" "00006" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "" "" "0" "" "" "" "" "00434835" "" "" "" "1" "" "00006" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "" "" "0" "" "" "" "" "00434836" "" "" "" "1" "" "00006" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "" "" "0" "" "" "" "" "00434837" "" "" "" "5" "" "00006" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "family, 5 affected sibs" "" "" "" "" "0" "" "" "" "" "00434838" "" "" "" "1" "" "00006" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "" "" "0" "" "" "" "" "00434839" "" "" "" "1" "" "00006" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "" "" "0" "" "" "" "" "00434840" "" "" "" "2" "" "00006" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "family, 2 affected sibs" "" "" "" "" "0" "" "" "" "" "00434841" "" "" "" "1" "" "00006" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "sib" "" "" "" "" "0" "" "" "" "" "00434842" "" "" "" "1" "" "00006" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "" "" "0" "" "" "" "" "00434843" "" "" "" "1" "" "00006" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "" "" "0" "" "" "" "" "00434844" "" "" "" "1" "" "00006" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "" "" "0" "" "" "" "" "00464038" "" "" "" "2" "" "00006" "{PMID:Li 2025:39901255}" "2-generation family, affected twin pair, unaffected heterozygous carrier parents" "M" "no" "China" "" "0" "" "" "" "twins" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 61 "{{individualid}}" "{{diseaseid}}" "00183691" "00139" "00210696" "00198" "00210697" "00198" "00210698" "00198" "00210699" "00198" "00210700" "00198" "00210701" "00198" "00210702" "00198" "00210703" "00198" "00210704" "00198" "00210705" "00198" "00210706" "00198" "00210707" "00198" "00210708" "00198" "00210709" "00198" "00434647" "00156" "00434648" "00198" "00434649" "00138" "00434655" "00156" "00434656" "00156" "00434781" "05611" "00434782" "05611" "00434783" "05611" "00434808" "00156" "00434809" "00138" "00434810" "05611" "00434811" "05611" "00434812" "05611" "00434813" "05611" "00434814" "05611" "00434815" "05611" "00434816" "05611" "00434817" "05611" "00434818" "05611" "00434819" "05611" "00434820" "05611" "00434821" "05611" "00434822" "05611" "00434823" "05611" "00434824" "05611" "00434825" "05611" "00434826" "05611" "00434827" "05611" "00434828" "05611" "00434829" "05611" "00434830" "05611" "00434831" "05611" "00434832" "05611" "00434833" "05611" "00434834" "05611" "00434835" "05611" "00434836" "05611" "00434837" "05611" "00434838" "05611" "00434839" "05611" "00434840" "05611" "00434841" "05611" "00434842" "05611" "00434843" "05611" "00434844" "05611" "00464038" "05611" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00138, 00139, 00156, 00198, 05611, 05795 ## Count = 58 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000144377" "00139" "00183691" "00006" "Isolated (sporadic)" "17y" "severe developmental delay; absence of language; behavioral abnormalities; hypotonia; seizures; no movement disorder; MRI normal; no failure to thrive; no sucking/feeding difficulty; no thin/sparse scalp hair; hypertrichosis; thick eyebrows; no long eyelashes; no ptosis; no thin upper lip vermilion; thick lower lip vermilion; normal palate; no nose upturned/anteverted nostrils; no 5th finger or toe/nails abnormaliy; kyphosis; no ardiovascular abnormality; no inguinal hernia; no skin problems" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000159261" "00198" "00210696" "00006" "Isolated (sporadic)" "5y" "mild developmental delay; no speech impairment; no behavioral abnormalities ; hypotonia; no seizures; no movement disorder; no failure to thrive; no sucking/feeding difficulty; no thin/sparse scalp hair; no hypertrichosis; no thick eyebrows; no long eyelashes; no ptosis; no thin upper lip vermilion; no thick lower lip vermilion; normal palate; no nose upturned/anteverted nostrils; no 5th finger or toe/nails abnormaliy; no scoliosis; n/a; no inguinal hernia; no skin problems" "" "" "" "" "" "" "" "" "" "developmental delay" "" "0000159262" "00198" "00210697" "00006" "Isolated (sporadic)" "3y" "mild developmental delay; speech delay; behavioral abnormalities; spasticity; no seizures; movement disorder; MRI two discrete hyperintens white matter lesions; no failure to thrive; no sucking/feeding difficulty; no thin/sparse scalp hair; no hypertrichosis; no thick eyebrows; no long eyelashes; no ptosis; no thin upper lip vermilion; no thick lower lip vermilion; normal palate; no nose upturned/anteverted nostrils; no 5th finger or toe/nails abnormaliy; no scoliosis; no ardiovascular abnormality; no inguinal hernia; no undescended testis; hypo pigmented hair, cafe au lait macules" "" "" "" "" "" "" "" "" "" "developmental delay" "" "0000159263" "00198" "00210698" "00006" "Isolated (sporadic)" "2y" "mild developmental delay; no speech impairment; behavioral abnormalities; hypotonia; no seizures; no movement disorder; no failure to thrive; no sucking/feeding difficulty; no thin/sparse scalp hair; no hypertrichosis; no thick eyebrows; no long eyelashes; no ptosis; no thin upper lip vermilion; no thick lower lip vermilion; normal palate; no nose upturned/anteverted nostrils; no 5th finger or toe/nails abnormaliy; no scoliosis; no ardiovascular abnormality; no inguinal hernia; no undescended testis; no skin problems" "" "" "" "" "" "" "" "" "" "developmental delay" "" "0000159264" "00198" "00210699" "00006" "Isolated (sporadic)" "4y" "severe developmental delay; absence of language; behavioral abnormalities; hypotonia, spasticity; seizures; no movement disorder; MRI thinning of corpus callosum and splenium, periventricular white matter loss; failure to thrive; sucking/feeding difficulty; thin/sparse scalp hair; hypertrichosis; no thick eyebrows; no long eyelashes; no ptosis; thin upper lip vermilion; no thick lower lip vermilion; normal palate; nose upturned/anteverted nostrils; 5th finger or toe/nails abnormaliy; scoliosis; inguinal hernia; undescended testis; eczema" "" "" "" "" "" "" "" "" "" "developmental delay" "" "0000159265" "00198" "00210700" "00006" "Isolated (sporadic)" "18y" "severe developmental delay; absence of language; no behavioral abnormalities ; hypotonia; no seizures; movement disorder; MRI generalized cerebral atrophy, hypointensity globus pallidus; failure to thrive; sucking/feeding difficulty; thin/sparse scalp hair; no hypertrichosis; thick eyebrows; no long eyelashes; ptosis; thin upper lip vermilion; no thick lower lip vermilion; normal palate; nose upturned/anteverted nostrils; no 5th finger or toe/nails abnormaliy; scoliosis; left coronary distension; no inguinal hernia; eczema, scleroderma" "" "" "" "" "" "" "" "" "" "developmental delay" "" "0000159266" "00198" "00210701" "00006" "Isolated (sporadic)" "11y" "severe developmental delay; absence of language; behavioral abnormalities; hypotonia; seizures; no movement disorder; MRI generalized cerebral atrophy, hypo-myelination; failure to thrive; sucking/feeding difficulty; no thin/sparse scalp hair; no hypertrichosis; thick eyebrows; no long eyelashes; ptosis; no thin upper lip vermilion; thick lower lip vermilion; normal palate; nose upturned/anteverted nostrils; no 5th finger or toe/nails abnormaliy; scoliosis; non-progressive mild aortic dilatation (Z score=2.54).; inguinal hernia; undescended testis; no skin problems" "" "" "" "" "" "" "" "" "" "developmental delay" "" "0000159267" "00198" "00210702" "00006" "Isolated (sporadic)" "11y" "severe developmental delay (DQ=20); absence of language; behavioral abnormalities; hypotonia; no seizures; no movement disorder; MRI normal; no failure to thrive; no sucking/feeding difficulty; no thin/sparse scalp hair; no hypertrichosis; no thick eyebrows; no long eyelashes; no ptosis; thin upper lip vermilion; no thick lower lip vermilion; normal palate; no nose upturned/anteverted nostrils; no 5th finger or toe/nails abnormaliy; no scoliosis; no ardiovascular abnormality; inguinal hernia; no undescended testis; no skin problems" "" "" "" "" "" "" "" "" "" "developmental delay" "" "0000159268" "00198" "00210703" "00006" "Isolated (sporadic)" "2y6m" "moderate intellectual disability; absence of language; no behavioral abnormalities ; hypotonia; no seizures; no movement disorder; MRI normal; failure to thrive; sucking/feeding difficulty; thin/sparse scalp hair; hypertrichosis; thick eyebrows; long eyelashes; no ptosis; thin upper lip vermilion; thick lower lip vermilion; normal palate; no nose upturned/anteverted nostrils; no 5th finger or toe/nails abnormaliy; no scoliosis; no ardiovascular abnormality; no inguinal hernia; hypo-melanotic macula" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000159269" "00198" "00210704" "00006" "Isolated (sporadic)" "10y06m" "moderate developmental delay, moderate-severe ID; minimal speech; no behavioral abnormalities ; hypotonia; no seizures; no movement disorder; MRI normal; failure to thrive; sucking/feeding difficulty; no thin/sparse scalp hair; no hypertrichosis; no thick eyebrows; long eyelashes; ptosis; no thin upper lip vermilion; no thick lower lip vermilion; abnormal palate; nose upturned/anteverted nostrils; 5th finger or toe/nails abnormaliy; no scoliosis; no ardiovascular abnormality; no inguinal hernia; no undescended testis; vitiligo (present in unaffected father)" "<01y" "" "" "" "" "" "" "" "" "developmental delay" "" "0000159270" "00198" "00210705" "00006" "Isolated (sporadic)" "19y" "moderate-severe developmental delay; absence of language; no behavioral abnormalities ; no hypotonia; seizures; no movement disorder; MRI abnormal corpus callosum; no failure to thrive; sucking/feeding difficulty; thin/sparse scalp hair; no hypertrichosis; thick eyebrows; long eyelashes; ptosis; no thin upper lip vermilion; thick lower lip vermilion; abnormal palate; nose upturned/anteverted nostrils; 5th finger or toe/nails abnormaliy; no scoliosis; no ardiovascular abnormality; no inguinal hernia; no undescended testis; hyper pigmented irregular skin on back" "" "" "" "" "" "" "" "" "" "developmental delay" "" "0000159271" "00198" "00210706" "00006" "Isolated (sporadic)" "7y" "moderate developmental delay, moderate intellectual disability; speech delay; behavioral abnormalities; hypotonia; no seizures; no movement disorder; MRI slightly small corpus callosum, prominent perivascular spaces; no failure to thrive; no sucking/feeding difficulty; no thin/sparse scalp hair; hypertrichosis; no thick eyebrows; no long eyelashes; no ptosis; thin upper lip vermilion; no thick lower lip vermilion; normal palate; nose upturned/anteverted nostrils; no 5th finger or toe/nails abnormaliy; scoliosis; no ardiovascular abnormality; no inguinal hernia; eczema" "" "" "" "" "" "" "" "" "" "developmental delay" "" "0000159272" "00198" "00210707" "00006" "Isolated (sporadic)" "8y" "moderate-severe developmental delay; speech delay; behavioral abnormalities; hypotonia; no seizures; no movement disorder; MRI normal; no failure to thrive; no sucking/feeding difficulty; no thin/sparse scalp hair; hypertrichosis; no thick eyebrows; long eyelashes; no ptosis; thin upper lip vermilion; thick lower lip vermilion; normal palate; no nose upturned/anteverted nostrils; no 5th finger or toe/nails abnormaliy; no scoliosis; n/a; no inguinal hernia; no undescended testis; no skin problems" "" "" "" "" "" "" "" "" "" "developmental delay" "" "0000159273" "00198" "00210708" "00006" "Isolated (sporadic)" "5y" "mild intellectual disability; speech delay; behavioral abnormalities; hypotonia; no seizures; no movement disorder; MRI normal; failure to thrive; sucking/feeding difficulty; no thin/sparse scalp hair; hypertrichosis; thick eyebrows; long eyelashes; ptosis; no thin upper lip vermilion; no thick lower lip vermilion; abnormal palate; no nose upturned/anteverted nostrils; 5th finger or toe/nails abnormaliy; no scoliosis; no ardiovascular abnormality; no inguinal hernia; no undescended testis; no skin problems" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000159274" "00198" "00210709" "00006" "Isolated (sporadic)" "27m" "mild developmental delay; speech abnormalities; behavioral abnormalities; hypotonia; no seizures; no movement disorder; no failure to thrive; sucking/feeding difficulty; no thin/sparse scalp hair; no hypertrichosis; no thick eyebrows; no long eyelashes; no ptosis; no thin upper lip vermilion; no thick lower lip vermilion; normal palate; no nose upturned/anteverted nostrils; no 5th finger or toe/nails abnormaliy; no scoliosis; no inguinal hernia; no skin problems" "" "" "" "" "" "" "" "" "" "developmental delay" "" "0000324897" "00156" "00434647" "00006" "Isolated (sporadic)" "28y" "see paper; ..., feeding difficulty, dysphagia, vomiting, hypotonia, delayed mental development" "" "" "" "" "" "" "" "" "CSS8" "Coffin-Siris syndrome" "" "0000324898" "00198" "00434648" "00006" "Unknown" "" "abdominal situs inversus (HP:0003363); asplenia (HP:0001746); abnormality of the liver (HP:0001392); right atrial isomerism (HP:0011536); abnormality of the left ventricle (HP:0001711); abnormality of the coronary sinus (HP:0011642); ventricular septal defect (HP:0001629); atrioventricular canal defect (HP:0006695); double outlet right ventricle (HP:0001719); abnormality of the pulmonary veins (HP:0011718); right aortic arch (HP:0012020); persistent left superior vena cava (HP:0005301); abnormality of the heart (HP:0001627); small chin (HP:0000331); flat forehead (HP:0004425); flat nose (HP:0000457); micrognathia (HP:0000347); abnormality of the head (HP:0000234); hypoplasia of the thymus (HP:0000778); bilateral trilobed lungs (HP:0011861)" "" "" "" "" "" "" "" "" "" "structural fetal abnormalities" "" "0000324904" "00156" "00434655" "00006" "Isolated (sporadic)" "08y" "see paper; ..., severe developmental delay, 4y-walk; 8y-no speech; short stature; hypotonia; thin corpus callosum; seizures; macrocephaly; hypertelorism" "" "" "" "" "" "" "" "" "CSS8" "Coffin-Siris syndrome" "" "0000324905" "00156" "00434656" "00006" "Unknown" "14y" "see paper; ..., severe developmental delay, 14y-not walking independently; 14y-no speech; short stature; hypotonia; early-onset seizures; no macrocephaly; no hypertelorism" "" "" "" "" "" "" "" "" "CSS8" "Coffin-Siris syndrome" "" "0000325030" "05611" "00434781" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "CSS8" "neurodevelopmental dealy" "" "0000325031" "05611" "00434782" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "CSS8" "neurodevelopmental dealy" "" "0000325032" "05611" "00434783" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "CSS8" "neurodevelopmental dealy" "" "0000325049" "05611" "00434810" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "CSS8" "neurodevelopmental delay" "" "0000325050" "05611" "00434811" "00006" "Unknown" "" "milder symptoms" "" "" "" "" "" "" "" "" "CSS8" "neurodevelopmental delay" "" "0000325051" "05611" "00434812" "00006" "Unknown" "" "milder symptoms" "" "" "" "" "" "" "" "" "CSS8" "neurodevelopmental delay" "" "0000325052" "05611" "00434813" "00006" "Unknown" "" "milder symptoms" "" "" "" "" "" "" "" "" "CSS8" "neurodevelopmental delay" "" "0000325053" "05611" "00434814" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "CSS8" "neurodevelopmental delay" "" "0000325054" "05611" "00434815" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "CSS8" "neurodevelopmental delay" "" "0000325055" "05611" "00434816" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "CSS8" "neurodevelopmental delay" "" "0000325056" "05611" "00434817" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "CSS8" "neurodevelopmental delay" "" "0000325057" "05611" "00434818" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "CSS8" "neurodevelopmental delay" "" "0000325058" "05611" "00434819" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "CSS8" "neurodevelopmental delay" "" "0000325059" "05611" "00434820" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "CSS8" "neurodevelopmental delay" "" "0000325060" "05611" "00434821" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "CSS8" "neurodevelopmental delay" "" "0000325061" "05611" "00434822" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "CSS8" "neurodevelopmental delay" "" "0000325062" "05611" "00434823" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "CSS8" "neurodevelopmental delay" "" "0000325063" "05611" "00434824" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "CSS8" "neurodevelopmental delay" "" "0000325064" "05611" "00434825" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "CSS8" "neurodevelopmental delay" "" "0000325065" "05611" "00434826" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "CSS8" "neurodevelopmental delay" "" "0000325066" "05611" "00434827" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "CSS8" "neurodevelopmental delay" "" "0000325067" "05611" "00434828" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "CSS8" "neurodevelopmental delay" "" "0000325068" "05611" "00434829" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "CSS8" "neurodevelopmental delay" "" "0000325069" "05611" "00434830" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "CSS8" "neurodevelopmental delay" "" "0000325070" "05611" "00434831" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "CSS8" "neurodevelopmental delay" "" "0000325071" "05611" "00434832" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "CSS8" "neurodevelopmental delay" "" "0000325072" "05611" "00434833" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "CSS8" "neurodevelopmental delay" "" "0000325073" "05611" "00434834" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "CSS8" "neurodevelopmental delay" "" "0000325074" "05611" "00434835" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "CSS8" "neurodevelopmental delay" "" "0000325075" "05611" "00434836" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "CSS8" "neurodevelopmental delay" "" "0000325076" "05611" "00434837" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "CSS8" "neurodevelopmental delay" "" "0000325077" "05611" "00434838" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "CSS8" "neurodevelopmental delay" "" "0000325078" "05611" "00434839" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "CSS8" "neurodevelopmental delay" "" "0000325079" "05611" "00434840" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "CSS8" "neurodevelopmental delay" "" "0000325080" "05611" "00434841" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "CSS8" "neurodevelopmental delay" "" "0000325081" "05611" "00434842" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "CSS8" "neurodevelopmental delay" "" "0000325082" "05611" "00434843" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "CSS8" "neurodevelopmental delay" "" "0000325083" "05611" "00434844" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "CSS8" "neurodevelopmental delay" "" "0000350099" "05611" "00464038" "00006" "Isolated (sporadic)" "24y" "see paper; ..., 3y-moderate developmental delay, moderate intellectual disability, language delay (could not speak long or complex sentences); epilepsy (3y, 18y), cryptorchidism; 13y-strabismus; prominent forehead, small left eye, epicanthus, low-set ears, wide nose, thick lower lip" "" "" "" "" "" "" "" "" "CSS8" "neurodevelopmental disorder" "" ## Screenings ## Do not remove or alter this header ## ## Count = 61 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000184659" "00183691" "1" "00006" "00006" "2018-10-27 10:06:27" "" "" "SEQ;SEQ-NG" "DNA" "" "1256 gene panel" "0000211772" "00210696" "1" "00006" "00006" "2018-12-28 14:25:32" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000211773" "00210697" "1" "00006" "00006" "2018-12-28 14:25:32" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000211774" "00210698" "1" "00006" "00006" "2018-12-28 14:25:32" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000211775" "00210699" "1" "00006" "00006" "2018-12-28 14:25:32" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000211776" "00210700" "1" "00006" "00006" "2018-12-28 14:25:32" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000211777" "00210701" "1" "00006" "00006" "2018-12-28 14:25:32" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000211778" "00210702" "1" "00006" "00006" "2018-12-28 14:25:32" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000211779" "00210703" "1" "00006" "00006" "2018-12-28 14:25:32" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000211780" "00210704" "1" "00006" "00006" "2018-12-28 14:25:32" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000211781" "00210705" "1" "00006" "00006" "2018-12-28 14:25:32" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000211782" "00210706" "1" "00006" "00006" "2018-12-28 14:25:32" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000211783" "00210707" "1" "00006" "00006" "2018-12-28 14:25:32" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000211784" "00210708" "1" "00006" "00006" "2018-12-28 14:25:32" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000211785" "00210709" "1" "00006" "00006" "2018-12-28 14:25:32" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000436119" "00434647" "1" "00006" "00006" "2023-04-06 11:15:23" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000436120" "00434648" "1" "00006" "00006" "2023-04-06 11:34:15" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000436121" "00434649" "1" "00006" "00006" "2023-04-06 11:56:56" "" "" "SEQ-NG" "DNA" "" "" "0000436127" "00434655" "1" "00006" "00006" "2023-04-06 19:03:40" "" "" "SEQ-NG" "DNA" "" "" "0000436128" "00434656" "1" "00006" "00006" "2023-04-06 19:08:53" "" "" "SEQ-NG" "DNA" "" "WES" "0000436253" "00434781" "1" "00006" "00006" "2023-04-07 12:06:06" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000436254" "00434782" "1" "00006" "00006" "2023-04-07 12:06:06" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000436255" "00434783" "1" "00006" "00006" "2023-04-07 12:06:06" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000436280" "00434808" "1" "00006" "00006" "2023-04-07 15:19:57" "" "" "SEQ-NG" "DNA" "" "duo WES" "0000436281" "00434809" "1" "00006" "00006" "2023-04-07 15:26:58" "" "" "SEQ" "DNA" "" "" "0000436282" "00434810" "1" "00006" "00006" "2023-04-07 16:00:01" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000436283" "00434811" "1" "00006" "00006" "2023-04-07 16:00:01" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000436284" "00434812" "1" "00006" "00006" "2023-04-07 16:00:01" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000436285" "00434813" "1" "00006" "00006" "2023-04-07 16:00:01" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000436286" "00434814" "1" "00006" "00006" "2023-04-07 16:00:01" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000436287" "00434815" "1" "00006" "00006" "2023-04-07 16:00:01" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000436288" "00434816" "1" "00006" "00006" "2023-04-07 16:00:01" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000436289" "00434817" "1" "00006" "00006" "2023-04-07 16:00:01" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000436290" "00434818" "1" "00006" "00006" "2023-04-07 16:00:01" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000436291" "00434819" "1" "00006" "00006" "2023-04-07 16:00:01" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000436292" "00434820" "1" "00006" "00006" "2023-04-07 16:00:01" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000436293" "00434821" "1" "00006" "00006" "2023-04-07 16:00:01" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000436294" "00434822" "1" "00006" "00006" "2023-04-07 16:00:01" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000436295" "00434823" "1" "00006" "00006" "2023-04-07 16:00:01" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000436296" "00434824" "1" "00006" "00006" "2023-04-07 16:00:01" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000436297" "00434825" "1" "00006" "00006" "2023-04-07 16:00:01" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000436298" "00434826" "1" "00006" "00006" "2023-04-07 16:00:01" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000436299" "00434827" "1" "00006" "00006" "2023-04-07 16:00:01" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000436300" "00434828" "1" "00006" "00006" "2023-04-07 16:00:01" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000436301" "00434829" "1" "00006" "00006" "2023-04-07 16:00:01" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000436302" "00434830" "1" "00006" "00006" "2023-04-07 16:00:01" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000436303" "00434831" "1" "00006" "00006" "2023-04-07 16:00:01" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000436304" "00434832" "1" "00006" "00006" "2023-04-07 16:00:01" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000436305" "00434833" "1" "00006" "00006" "2023-04-07 16:00:01" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000436306" "00434834" "1" "00006" "00006" "2023-04-07 16:00:01" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000436307" "00434835" "1" "00006" "00006" "2023-04-07 16:00:01" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000436308" "00434836" "1" "00006" "00006" "2023-04-07 16:00:01" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000436309" "00434837" "1" "00006" "00006" "2023-04-07 16:00:01" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000436310" "00434838" "1" "00006" "00006" "2023-04-07 16:00:01" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000436311" "00434839" "1" "00006" "00006" "2023-04-07 16:00:01" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000436312" "00434840" "1" "00006" "00006" "2023-04-07 16:00:01" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000436313" "00434841" "1" "00006" "00006" "2023-04-07 16:00:01" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000436314" "00434842" "1" "00006" "00006" "2023-04-07 16:00:01" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000436315" "00434843" "1" "00006" "00006" "2023-04-07 16:00:01" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000436316" "00434844" "1" "00006" "00006" "2023-04-07 16:00:01" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000465669" "00464038" "1" "00006" "00006" "2025-02-14 15:52:07" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA" "" "WES" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 17 "{{screeningid}}" "{{geneid}}" "0000184659" "SMARCC2" "0000211772" "SMARCC2" "0000211773" "SMARCC2" "0000211774" "SMARCC2" "0000211775" "SMARCC2" "0000211776" "SMARCC2" "0000211777" "SMARCC2" "0000211778" "SMARCC2" "0000211779" "SMARCC2" "0000211780" "SMARCC2" "0000211781" "SMARCC2" "0000211782" "SMARCC2" "0000211783" "SMARCC2" "0000211784" "SMARCC2" "0000211785" "SMARCC2" "0000436281" "SMARCC2" "0000465669" "SMARCC2" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 110 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000255377" "0" "70" "12" "56566210" "56566210" "subst" "0" "01943" "SMARCC2_000001" "g.56566210A>G" "" "" "" "SMARCC2(NM_003075.4):c.1833+2T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56172426A>G" "" "likely pathogenic" "" "0000302350" "0" "30" "12" "56583344" "56583365" "del" "0" "02326" "SMARCC2_000002" "g.56583344_56583365del" "" "" "" "SMARCC2(NM_003075.5):c.-102_-81delCCGCGGCGGCGGGAGGCGGCGG" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56189560_56189581del" "" "likely benign" "" "0000408783" "0" "70" "12" "56571880" "56571880" "subst" "0" "00006" "SMARCC2_000004" "g.56571880G>C" "" "{PMID:Martinez 2017:27620904}, {DOI:Martinez 2017:10.1136/jmedgenet-2017-103964}" "" "" "" "De novo" "" "" "0" "" "" "g.56178096G>C" "" "likely pathogenic" "" "0000443385" "0" "90" "12" "56578720" "56578720" "subst" "0" "00006" "SMARCC2_000005" "g.56578720T>C" "" "{PMID:Machol 2018:30580808}" "" "" "" "De novo" "" "" "0" "" "" "g.56184936T>C" "" "pathogenic (dominant)" "" "0000443386" "11" "90" "12" "56575605" "56575605" "subst" "0" "00006" "SMARCC2_000006" "g.56575605C>T" "" "{PMID:Machol 2018:30580808}" "" "" "" "Germline" "" "" "0" "" "" "g.56181821C>T" "" "pathogenic (dominant)" "" "0000443387" "0" "90" "12" "56574844" "56574844" "dup" "0" "00006" "SMARCC2_000007" "g.56574844dup" "" "{PMID:Machol 2018:30580808}" "" "999dupA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.56181060dup" "" "pathogenic (dominant)" "" "0000443388" "0" "90" "12" "56566219" "56566219" "subst" "0" "00006" "SMARCC2_000009" "g.56566219A>G" "" "{PMID:Machol 2018:30580808}, {PMID:Chen 2022:34906496}" "" "" "ACMG PS1, PS2, PM2, P44" "De novo" "" "" "0" "" "" "g.56172435A>G" "" "pathogenic (dominant)" "ACMG" "0000443389" "0" "90" "12" "56566216" "56566216" "subst" "0" "00006" "SMARCC2_000008" "g.56566216A>G" "" "{PMID:Machol 2018:30580808}" "" "" "" "De novo" "" "" "0" "" "" "g.56172432A>G" "" "pathogenic (dominant)" "" "0000443390" "0" "90" "12" "56566216" "56566216" "subst" "0" "00006" "SMARCC2_000008" "g.56566216A>G" "" "{PMID:Machol 2018:30580808}" "" "" "" "De novo" "" "" "0" "" "" "g.56172432A>G" "" "pathogenic (dominant)" "" "0000443391" "0" "90" "12" "56566211" "56566211" "subst" "0" "00006" "SMARCC2_000010" "g.56566211C>A" "" "{PMID:Machol 2018:30580808}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.56172427C>A" "" "pathogenic (dominant)" "" "0000443392" "0" "90" "12" "56566210" "56566210" "subst" "0" "00006" "SMARCC2_000001" "g.56566210A>G" "" "{PMID:Machol 2018:30580808}, {PMID:Chen 2022:34906496}" "" "" "variant not maternal; ACMG PS3, PM2, PP4" "De novo" "" "" "0" "" "" "g.56172426A>G" "" "likely pathogenic (dominant)" "" "0000443393" "0" "90" "12" "56566210" "56566210" "subst" "0" "00006" "SMARCC2_000001" "g.56566210A>G" "" "{PMID:Zhu 2015:25590979}, {PMID:Machol 2018:30580808}" "" "" "" "De novo" "" "" "0" "" "" "g.56172426A>G" "" "pathogenic (dominant)" "" "0000443394" "0" "90" "12" "56565717" "56565717" "subst" "0" "00006" "SMARCC2_000011" "g.56565717A>G" "" "{PMID:Machol 2018:30580808}" "" "" "" "De novo" "" "" "0" "" "" "g.56171933A>G" "" "pathogenic (dominant)" "" "0000443395" "0" "90" "12" "56565652" "56565652" "subst" "0" "00006" "SMARCC2_000012" "g.56565652A>G" "" "{PMID:Machol 2018:30580808}" "" "" "" "De novo" "" "" "0" "" "" "g.56171868A>G" "" "pathogenic (dominant)" "" "0000443396" "0" "90" "12" "56561915" "56561915" "subst" "0" "00006" "SMARCC2_000013" "g.56561915T>C" "" "{PMID:Machol 2018:30580808}" "" "" "" "De novo" "" "" "0" "" "" "g.56168131T>C" "" "pathogenic (dominant)" "" "0000443397" "0" "90" "12" "56561902" "56561902" "subst" "0" "00006" "SMARCC2_000014" "g.56561902T>C" "" "{PMID:Machol 2018:30580808}" "" "" "" "De novo" "" "" "0" "" "" "g.56168118T>C" "" "pathogenic (dominant)" "" "0000443398" "0" "90" "12" "56558197" "56558199" "del" "0" "00006" "SMARCC2_000015" "g.56558197_56558199del" "" "{PMID:Machol 2018:30580808}" "" "3456_3458delCAT" "" "De novo" "" "" "0" "" "" "g.56164413_56164415del" "" "pathogenic (dominant)" "" "0000548685" "0" "50" "12" "56557523" "56557523" "subst" "3.6739E-5" "02325" "MYL6_000001" "g.56557523G>A" "" "" "" "SMARCC2(NM_001330288.2):c.3688C>T (p.P1230S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56163739G>A" "" "VUS" "" "0000548688" "0" "50" "12" "56567478" "56567478" "subst" "0" "02327" "SMARCC2_000016" "g.56567478A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56173694A>G" "" "VUS" "" "0000548689" "0" "50" "12" "56567636" "56567636" "subst" "0" "02327" "SMARCC2_000017" "g.56567636G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56173852G>C" "" "VUS" "" "0000548690" "0" "50" "12" "56571861" "56571861" "subst" "0" "02325" "SMARCC2_000018" "g.56571861G>A" "" "" "" "SMARCC2(NM_001330288.2):c.1327C>T (p.R443W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56178077G>A" "" "VUS" "" "0000548691" "0" "50" "12" "56575535" "56575535" "subst" "0" "02325" "SMARCC2_000019" "g.56575535G>A" "" "" "" "SMARCC2(NM_003075.5):c.793C>T (p.P265S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56181751G>A" "" "VUS" "" "0000548692" "0" "70" "12" "56575605" "56575605" "subst" "0" "02327" "SMARCC2_000006" "g.56575605C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56181821C>T" "" "likely pathogenic" "" "0000548693" "0" "50" "12" "56577703" "56577703" "subst" "0" "02327" "SMARCC2_000020" "g.56577703G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56183919G>A" "" "VUS" "" "0000548694" "0" "50" "12" "56578845" "56578845" "subst" "0" "02327" "SMARCC2_000021" "g.56578845A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56185061A>G" "" "VUS" "" "0000548695" "0" "70" "12" "56578887" "56578887" "dup" "0" "01804" "SMARCC2_000022" "g.56578887dup" "" "" "" "SMARCC2(NM_001130420.1):c.326dupA (p.(Tyr109Ter))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56185103dup" "" "likely pathogenic" "" "0000614306" "0" "50" "12" "56578886" "56578886" "subst" "0" "01804" "SMARCC2_000023" "g.56578886G>C" "" "" "" "SMARCC2(NM_001130420.1):c.327C>G (p.(Tyr109Ter)), SMARCC2(NM_001330288.2):c.327C>G (p.Y109*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56185102G>C" "" "VUS" "" "0000614307" "0" "50" "12" "56579937" "56579937" "subst" "0" "02327" "SMARCC2_000024" "g.56579937A>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56186153A>T" "" "VUS" "" "0000679595" "0" "30" "12" "56557536" "56557536" "subst" "0" "01943" "MYL6_000004" "g.56557536G>C" "" "" "" "SMARCC2(NM_001330288.2):c.3675C>G (p.P1225=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000679596" "0" "30" "12" "56566456" "56566456" "subst" "8.93358E-5" "01943" "SMARCC2_000026" "g.56566456A>G" "" "" "" "SMARCC2(NM_001330288.2):c.1776T>C (p.F592=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000679597" "0" "30" "12" "56574834" "56574834" "subst" "1.21862E-5" "01943" "SMARCC2_000027" "g.56574834T>C" "" "" "" "SMARCC2(NM_001330288.2):c.1008A>G (p.Q336=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000724147" "0" "50" "12" "56575263" "56575263" "subst" "0" "01943" "SMARCC2_000028" "g.56575263C>T" "" "" "" "SMARCC2(NM_001330288.2):c.956+3G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000724148" "0" "50" "12" "56578886" "56578886" "subst" "0" "02329" "SMARCC2_000023" "g.56578886G>C" "" "" "" "SMARCC2(NM_001130420.1):c.327C>G (p.(Tyr109Ter)), SMARCC2(NM_001330288.2):c.327C>G (p.Y109*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000805856" "0" "50" "12" "56577992" "56577992" "subst" "0" "01943" "SMARCC2_000029" "g.56577992C>T" "" "" "" "SMARCC2(NM_001330288.2):c.529G>A (p.V177I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000805857" "0" "30" "12" "56578623" "56578623" "subst" "1.21848E-5" "02325" "SMARCC2_000030" "g.56578623T>C" "" "" "" "SMARCC2(NM_001330288.2):c.492+5A>G, SMARCC2(NM_003075.5):c.492+5A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000805858" "0" "50" "12" "56578854" "56578854" "subst" "4.06081E-6" "02325" "SMARCC2_000031" "g.56578854T>C" "" "" "" "SMARCC2(NM_003075.5):c.359A>G (p.N120S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000853464" "0" "70" "12" "56563471" "56563471" "subst" "0" "02326" "SMARCC2_000032" "g.56563471C>A" "" "" "" "SMARCC2(NM_001330288.2):c.2557G>T (p.E853*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000863071" "0" "50" "12" "56558141" "56558141" "subst" "4.10759E-6" "01804" "MYL6_000005" "g.56558141C>T" "" "" "" "SMARCC2(NM_001130420.1):c.3328G>A (p.(Ala1110Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000863072" "0" "30" "12" "56558318" "56558318" "subst" "0.000113739" "02325" "MYL6_000006" "g.56558318G>C" "" "" "" "SMARCC2(NM_003075.5):c.3337C>G (p.P1113A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000890696" "0" "50" "12" "56566244" "56566244" "subst" "0" "02327" "SMARCC2_000033" "g.56566244A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000890697" "0" "70" "12" "56568534" "56568534" "subst" "0" "02326" "SMARCC2_000034" "g.56568534C>G" "" "" "" "SMARCC2(NM_001330288.2):c.1397G>C (p.R466P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000890698" "0" "70" "12" "56580972" "56580972" "subst" "0" "02327" "SMARCC2_000035" "g.56580972G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000913908" "0" "50" "12" "56559174" "56559174" "subst" "0" "02325" "MYL6_000007" "g.56559174G>T" "" "" "" "SMARCC2(NM_003075.5):c.3067C>A (p.Q1023K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000922463" "0" "90" "12" "56565481" "56565481" "subst" "0" "00006" "SMARCC2_000036" "g.56565481C>G" "" "{PMID:Yi 2022:35536477}" "" "" "" "De novo" "" "" "0" "" "" "g.56171697C>G" "" "likely pathogenic (dominant)" "ACMG" "0000922465" "0" "90" "12" "56567575" "56567575" "subst" "0" "00006" "SMARCC2_000037" "g.56567575G>A" "" "{PMID:Carss 2014:24476948}" "" "" "candidate pathogenic variant" "De novo" "" "" "0" "" "" "" "" "VUS" "" "0000922476" "0" "90" "12" "56566368" "56566368" "subst" "0" "00006" "SMARCC2_000038" "g.56566368C>A" "" "{PMID:Neale 2012:22495311}" "" "" "" "De novo" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000922484" "0" "70" "12" "56566221" "56566223" "del" "0" "00006" "SMARCC2_000039" "g.56566221_56566223del" "" "{PMID:Li 2022:34881817}" "" "" "" "De novo" "" "" "0" "" "" "g.56172437_56172439del" "" "likely pathogenic (dominant)" "" "0000922485" "0" "70" "12" "56572830" "56572833" "del" "0" "00006" "SMARCC2_000040" "g.56572830_56572833del" "" "{PMID:Li 2022:34881817}" "" "1094_1097delAGAA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.56179046_56179049del" "" "likely pathogenic (dominant)" "" "0000922612" "0" "70" "12" "56575345" "56575346" "del" "0" "00006" "SMARCC2_000059" "g.56575345_56575346del" "" "{PMID:Chen 2022:34906496}" "" "" "ACMG PVS1, PM2" "Germline/De novo (untested)" "" "" "0" "" "" "g.56181561_56181562del" "" "likely pathogenic (dominant)" "ACMG" "0000922613" "0" "70" "12" "56575335" "56575336" "del" "0" "00006" "SMARCC2_000058" "g.56575335_56575336del" "" "{PMID:Chen 2022:34906496}" "" "" "ACMG PVS1, PM2" "Germline/De novo (untested)" "" "" "0" "" "" "g.56181551_56181552del" "" "likely pathogenic (dominant)" "ACMG" "0000922614" "0" "90" "12" "56566219" "56566219" "subst" "0" "00006" "SMARCC2_000009" "g.56566219A>G" "" "{PMID:Chen 2022:34906496}" "" "" "ACMG PS1, PS2, PM2, P44" "De novo" "" "" "0" "" "" "g.56172435A>G" "" "pathogenic (dominant)" "ACMG" "0000922642" "0" "90" "12" "56566490" "56566490" "subst" "0" "00006" "SMARCC2_000041" "g.56566490T>C" "" "{PMID:Scott 2022:33461977}, {PMID:Gofin 2022:35796094}" "" "" "father not available" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "VUS" "" "0000922643" "21" "90" "12" "56559112" "56559112" "del" "4.45565E-5" "00006" "SMARCC2_000003" "g.56559112del" "" "{PMID:Lo 2022:35699097}" "" "G1044Dfs*17" "variant in unaffected mother/sister" "Germline" "" "" "0" "" "" "g.56165328del" "" "VUS (!)" "" "0000922644" "0" "70" "12" "56581030" "56581030" "subst" "0" "00006" "SMARCC2_000063" "g.56581030G>A" "" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.56187246G>A" "" "likely pathogenic (dominant)" "" "0000922645" "0" "70" "12" "56580972" "56580972" "subst" "0" "00006" "SMARCC2_000035" "g.56580972G>A" "" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.56187188G>A" "" "likely pathogenic (dominant)" "" "0000922646" "0" "70" "12" "56580972" "56580972" "subst" "0" "00006" "SMARCC2_000035" "g.56580972G>A" "" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.56187188G>A" "" "likely pathogenic (dominant)" "" "0000922647" "0" "70" "12" "56580972" "56580972" "subst" "0" "00006" "SMARCC2_000035" "g.56580972G>A" "" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.56187188G>A" "" "likely pathogenic (dominant)" "" "0000922648" "0" "70" "12" "56579937" "56579937" "subst" "0" "00006" "SMARCC2_000024" "g.56579937A>T" "" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.56186153A>T" "" "likely pathogenic (dominant)" "" "0000922649" "0" "70" "12" "56578886" "56578886" "subst" "0" "00006" "SMARCC2_000023" "g.56578886G>C" "" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.56185102G>C" "" "likely pathogenic (dominant)" "" "0000922650" "0" "70" "12" "56578886" "56578886" "subst" "0" "00006" "SMARCC2_000023" "g.56578886G>C" "" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.56185102G>C" "" "likely pathogenic (dominant)" "" "0000922651" "0" "70" "12" "56578887" "56578887" "dup" "0" "00006" "SMARCC2_000022" "g.56578887dup" "" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.56185103dup" "" "likely pathogenic (dominant)" "" "0000922652" "0" "70" "12" "56577703" "56577703" "subst" "0" "00006" "SMARCC2_000020" "g.56577703G>A" "" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.56183919G>A" "" "likely pathogenic (dominant)" "" "0000922653" "0" "70" "12" "56577703" "56577703" "subst" "0" "00006" "SMARCC2_000020" "g.56577703G>A" "" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.56183919G>A" "" "likely pathogenic (dominant)" "" "0000922654" "0" "70" "12" "56575856" "56575856" "subst" "4.08123E-6" "00006" "SMARCC2_000062" "g.56575856T>C" "" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.56182072T>C" "" "likely pathogenic (dominant)" "" "0000922655" "0" "70" "12" "56575585" "56575585" "subst" "0" "00006" "SMARCC2_000061" "g.56575585A>G" "" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.56181801A>G" "" "likely pathogenic (dominant)" "" "0000922656" "0" "70" "12" "56575523" "56575523" "subst" "0" "00006" "SMARCC2_000060" "g.56575523G>A" "" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.56181739G>A" "" "likely pathogenic (dominant)" "" "0000922657" "0" "70" "12" "56575523" "56575523" "subst" "0" "00006" "SMARCC2_000060" "g.56575523G>A" "" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.56181739G>A" "" "likely pathogenic (dominant)" "" "0000922658" "0" "70" "12" "56571878" "56571878" "subst" "0" "00006" "SMARCC2_000057" "g.56571878C>T" "" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.56178094C>T" "" "likely pathogenic (dominant)" "" "0000922659" "0" "70" "12" "56571861" "56571861" "subst" "0" "00006" "SMARCC2_000018" "g.56571861G>A" "" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.56178077G>A" "" "likely pathogenic (dominant)" "" "0000922660" "0" "70" "12" "56566249" "56566249" "subst" "0" "00006" "SMARCC2_000056" "g.56566249C>T" "" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.56172465C>T" "" "likely pathogenic (dominant)" "" "0000922661" "0" "70" "12" "56565728" "56565728" "subst" "0" "00006" "SMARCC2_000055" "g.56565728G>C" "" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.56171944G>C" "" "likely pathogenic (dominant)" "" "0000922662" "0" "70" "12" "56565701" "56565706" "del" "0" "00006" "SMARCC2_000054" "g.56565701_56565706del" "" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.56171917_56171922del" "" "likely pathogenic (dominant)" "" "0000922663" "0" "70" "12" "56565636" "56565636" "subst" "0" "00006" "SMARCC2_000053" "g.56565636A>G" "" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.56171852A>G" "" "likely pathogenic (dominant)" "" "0000922664" "0" "70" "12" "56565496" "56565496" "subst" "0" "00006" "SMARCC2_000052" "g.56565496G>A" "" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.56171712G>A" "" "likely pathogenic (dominant)" "" "0000922665" "0" "70" "12" "56565496" "56565496" "subst" "0" "00006" "SMARCC2_000052" "g.56565496G>A" "" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.56171712G>A" "" "likely pathogenic (dominant)" "" "0000922666" "0" "70" "12" "56563333" "56563333" "subst" "0" "00006" "SMARCC2_000051" "g.56563333C>G" "" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.56169549C>G" "" "likely pathogenic (dominant)" "" "0000922667" "0" "70" "12" "56561962" "56561962" "subst" "0" "00006" "SMARCC2_000050" "g.56561962T>C" "" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.56168178T>C" "" "likely pathogenic (dominant)" "" "0000922668" "0" "70" "12" "56561923" "56561923" "subst" "0" "00006" "SMARCC2_000049" "g.56561923T>C" "" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.56168139T>C" "" "likely pathogenic (dominant)" "" "0000922669" "0" "70" "12" "56561904" "56561904" "subst" "0" "00006" "SMARCC2_000048" "g.56561904C>A" "" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.56168120C>A" "" "likely pathogenic (dominant)" "" "0000922670" "0" "70" "12" "56559152" "56559152" "dup" "0" "00006" "SMARCC2_000047" "g.56559152dup" "" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.56165368dup" "" "likely pathogenic (dominant)" "" "0000922671" "1" "70" "12" "56559112" "56559112" "del" "4.45565E-5" "00006" "SMARCC2_000003" "g.56559112del" "" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "Germline" "" "" "0" "" "" "g.56165328del" "" "likely pathogenic (dominant)" "" "0000922672" "0" "70" "12" "56559112" "56559112" "del" "4.45565E-5" "00006" "SMARCC2_000003" "g.56559112del" "" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.56165328del" "" "likely pathogenic (dominant)" "" "0000922673" "0" "70" "12" "56559102" "56559106" "dup" "0" "00006" "SMARCC2_000046" "g.56559102_56559106dup" "" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.56165318_56165322dup" "" "likely pathogenic (dominant)" "" "0000922674" "1" "70" "12" "56558376" "56558376" "del" "0" "00006" "SMARCC2_000045" "g.56558376del" "" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "Germline" "" "" "0" "" "" "g.56164592del" "" "likely pathogenic (dominant)" "" "0000922675" "1" "70" "12" "56558376" "56558376" "del" "0" "00006" "SMARCC2_000045" "g.56558376del" "" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "Germline" "" "" "0" "" "" "g.56164592del" "" "likely pathogenic (dominant)" "" "0000922676" "0" "70" "12" "56558131" "56558131" "subst" "0" "00006" "SMARCC2_000044" "g.56558131G>A" "" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.56164347G>A" "" "likely pathogenic (dominant)" "" "0000922677" "0" "70" "12" "56558094" "56558094" "del" "0" "00006" "SMARCC2_000043" "g.56558094del" "" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.56164310del" "" "likely pathogenic (dominant)" "" "0000922678" "0" "70" "12" "56435686" "56583351" "del" "0" "00006" "SMARCC2_000042" "g.(?_56435686)_(56583351_?)del" "" "{DOI:Bosch 2023:10.1101/2023.03.30.23287962}" "" "" "deletion including SMARCC2, RPS26" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "likely pathogenic (dominant)" "" "0000949997" "0" "30" "12" "56563602" "56563602" "subst" "0.000263947" "02325" "SMARCC2_000064" "g.56563602C>T" "" "" "" "SMARCC2(NM_003075.5):c.2413G>A (p.D805N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000980388" "0" "30" "12" "56578623" "56578623" "subst" "1.21848E-5" "01804" "SMARCC2_000030" "g.56578623T>C" "" "" "" "SMARCC2(NM_001330288.2):c.492+5A>G, SMARCC2(NM_003075.5):c.492+5A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001000242" "0" "30" "12" "56559287" "56559287" "subst" "1.31507E-5" "01804" "MYL6_000008" "g.56559287C>G" "" "" "" "SMARCC2(NM_001130420.1):c.3047G>C (p.(Gly1016Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001000243" "0" "50" "12" "56565075" "56565075" "subst" "0.000300517" "01804" "SMARCC2_000065" "g.56565075G>A" "" "" "" "SMARCC2(NM_001130420.1):c.2327C>T (p.(Ser776Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001000244" "0" "30" "12" "56568438" "56568438" "subst" "0" "01804" "SMARCC2_000066" "g.56568438A>G" "" "" "" "SMARCC2(NM_001130420.1):c.1493T>C (p.(Met498Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001000245" "0" "50" "12" "56571833" "56571833" "subst" "0" "02327" "SMARCC2_000067" "g.56571833C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001000246" "0" "30" "12" "56572795" "56572795" "subst" "0" "01804" "SMARCC2_000068" "g.56572795G>A" "" "" "" "SMARCC2(NM_001130420.1):c.1127C>T (p.(Thr376Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001000247" "0" "30" "12" "56583193" "56583193" "subst" "9.97606E-6" "01804" "SMARCC2_000069" "g.56583193G>C" "" "" "" "SMARCC2(NM_001130420.1):c.53C>G (p.(Ala18Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001014999" "0" "50" "12" "56558371" "56558371" "subst" "0" "02325" "MYL6_000009" "g.56558371G>A" "" "" "" "SMARCC2(NM_003075.5):c.3284C>T (p.S1095F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001015000" "0" "90" "12" "56563697" "56563697" "subst" "0" "02325" "SMARCC2_000070" "g.56563697T>C" "" "" "" "SMARCC2(NM_003075.5):c.2320-2A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001015001" "0" "70" "12" "56565677" "56565678" "ins" "0" "02329" "SMARCC2_000071" "g.56565677_56565678insCACTT" "" "" "" "SMARCC2(NM_001330288.2):c.1970_1971insAAGTG (p.H657Qfs*33)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001029355" "0" "90" "12" "56568434" "56568434" "subst" "0" "00006" "SMARCC2_000072" "g.56568434C>A" "" "{PMID:Li 2025:39901255}" "" "" "" "De novo" "" "" "0" "" "" "g.56174650C>A" "" "pathogenic (dominant)" "" "0001039361" "0" "30" "12" "56559114" "56559114" "subst" "0.0017739" "01804" "MYL6_000010" "g.56559114G>C" "" "" "" "SMARCC2(NM_001330288.2):c.3220C>G (p.(Pro1074Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001039362" "0" "30" "12" "56559152" "56559152" "subst" "1.8449E-5" "01804" "MYL6_000011" "g.56559152G>A" "" "" "" "SMARCC2(NM_001330288.2):c.3182C>T (p.(Ala1061Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001039363" "0" "30" "12" "56563563" "56563563" "subst" "0.000150264" "01804" "SMARCC2_000073" "g.56563563T>C" "" "" "" "SMARCC2(NM_001330288.2):c.2545A>G (p.(Ile849Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001039364" "0" "30" "12" "56566207" "56566207" "subst" "4.29631E-5" "01804" "SMARCC2_000074" "g.56566207A>G" "" "" "" "SMARCC2(NM_001330288.2):c.1926+5T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001039365" "0" "50" "12" "56572600" "56572600" "subst" "4.0663E-6" "01804" "SMARCC2_000075" "g.56572600C>T" "" "" "" "SMARCC2(NM_001330288.2):c.1173G>A (p.(Thr391=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001039366" "0" "50" "12" "56572770" "56572771" "ins" "4.06144E-6" "01804" "SMARCC2_000076" "g.56572770_56572771insGA" "" "" "" "SMARCC2(NM_001330288.2):c.1141+10_1141+11insTC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001039367" "0" "30" "12" "56572771" "56572771" "subst" "4.06151E-6" "01804" "SMARCC2_000077" "g.56572771C>G" "" "" "" "SMARCC2(NM_001330288.2):c.1141+10G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001039368" "0" "30" "12" "56574790" "56574790" "subst" "1.21915E-5" "01804" "SMARCC2_000078" "g.56574790T>C" "" "" "" "SMARCC2(NM_001330288.2):c.1052A>G (p.(Asn351Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001039369" "0" "30" "12" "56580691" "56580691" "subst" "0" "01804" "SMARCC2_000079" "g.56580691C>T" "" "" "" "SMARCC2(NM_001330288.2):c.231+280G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001054364" "0" "30" "12" "56566264" "56566264" "subst" "0" "01804" "SMARCC2_000080" "g.56566264G>A" "" "" "" "SMARCC2(NM_001330288.2):c.1874C>T (p.(Ala625Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes SMARCC2 ## Count = 110 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000255377" "00025357" "70" "1833" "2" "1833" "2" "c.1833+2T>C" "r.spl?" "p.?" "" "0000302350" "00025357" "30" "-102" "0" "-81" "0" "c.-102_-81del" "r.(?)" "p.(=)" "" "0000408783" "00025357" "30" "1311" "-3" "1311" "-3" "c.1311-3C>G" "r.spl" "p.?" "" "0000443385" "00025357" "00" "400" "0" "400" "0" "c.400A>G" "r.(?)" "p.(Asn134Asp)" "" "0000443386" "00025357" "90" "723" "0" "723" "0" "c.723G>A" "r.(?)" "p.(Trp241*)" "" "0000443387" "00025357" "90" "999" "0" "999" "0" "c.999dup" "r.(?)" "p.(Glu334Argfs*49)" "" "0000443388" "00025357" "90" "1826" "0" "1826" "0" "c.1826T>C" "r.(?)" "p.(Leu609Pro)" "" "0000443389" "00025357" "90" "1829" "0" "1829" "0" "c.1829T>C" "r.(?)" "p.(Leu610Pro)" "" "0000443390" "00025357" "90" "1829" "0" "1829" "0" "c.1829T>C" "r.(?)" "p.(Leu610Pro)" "" "0000443391" "00025357" "90" "1833" "1" "1833" "1" "c.1833+1G>T" "r.(1771_1833del)" "p.?" "" "0000443392" "00025357" "90" "1833" "2" "1833" "2" "c.1833+2T>C" "r.spl" "p.?" "" "0000443393" "00025357" "90" "1833" "2" "1833" "2" "c.1833+2T>C" "r.spl" "p.?" "" "0000443394" "00025357" "90" "1838" "0" "1838" "0" "c.1838T>C" "r.(?)" "p.(Leu613Pro)" "" "0000443395" "00025357" "90" "1903" "0" "1903" "0" "c.1903T>C" "r.(?)" "p.(Cys635Arg)" "" "0000443396" "00025357" "90" "2686" "0" "2686" "0" "c.2686A>G" "r.(?)" "p.(Met896Val)" "" "0000443397" "00025357" "90" "2699" "0" "2699" "0" "c.2699A>G" "r.(?)" "p.(Glu900Gly)" "" "0000443398" "00025357" "90" "3456" "0" "3458" "0" "c.3456_3458del" "r.(?)" "p.(Met1153del)" "" "0000548685" "00025357" "50" "3595" "0" "3595" "0" "c.3595C>T" "r.(?)" "p.(Pro1199Ser)" "" "0000548688" "00025357" "50" "1650" "2" "1650" "2" "c.1650+2T>C" "r.spl?" "p.?" "" "0000548689" "00025357" "50" "1497" "-3" "1497" "-3" "c.1497-3C>G" "r.spl?" "p.?" "" "0000548690" "00025357" "50" "1327" "0" "1327" "0" "c.1327C>T" "r.(?)" "p.(Arg443Trp)" "" "0000548691" "00025357" "50" "793" "0" "793" "0" "c.793C>T" "r.(?)" "p.(Pro265Ser)" "" "0000548692" "00025357" "70" "723" "0" "723" "0" "c.723G>A" "r.(?)" "p.(Trp241Ter)" "" "0000548693" "00025357" "50" "574" "0" "574" "0" "c.574C>T" "r.(?)" "p.(Arg192Ter)" "" "0000548694" "00025357" "50" "368" "0" "368" "0" "c.368T>C" "r.(?)" "p.(Met123Thr)" "" "0000548695" "00025357" "70" "326" "0" "326" "0" "c.326dup" "r.(?)" "p.(Tyr109Ter)" "" "0000614306" "00025357" "50" "327" "0" "327" "0" "c.327C>G" "r.(?)" "p.(Tyr109Ter)" "" "0000614307" "00025357" "50" "317" "2" "317" "2" "c.317+2T>A" "r.spl?" "p.?" "" "0000679595" "00025357" "30" "3582" "0" "3582" "0" "c.3582C>G" "r.(?)" "p.(Pro1194=)" "" "0000679596" "00025357" "30" "1683" "0" "1683" "0" "c.1683T>C" "r.(?)" "p.(Phe561=)" "" "0000679597" "00025357" "30" "1008" "0" "1008" "0" "c.1008A>G" "r.(?)" "p.(Gln336=)" "" "0000724147" "00025357" "50" "956" "3" "956" "3" "c.956+3G>A" "r.spl?" "p.?" "" "0000724148" "00025357" "50" "327" "0" "327" "0" "c.327C>G" "r.(?)" "p.(Tyr109Ter)" "" "0000805856" "00025357" "50" "529" "0" "529" "0" "c.529G>A" "r.(?)" "p.(Val177Ile)" "" "0000805857" "00025357" "30" "492" "5" "492" "5" "c.492+5A>G" "r.spl?" "p.?" "" "0000805858" "00025357" "50" "359" "0" "359" "0" "c.359A>G" "r.(?)" "p.(Asn120Ser)" "" "0000853464" "00025357" "70" "2464" "0" "2464" "0" "c.2464G>T" "r.(?)" "p.(Glu822*)" "" "0000863071" "00025357" "50" "3514" "0" "3514" "0" "c.3514G>A" "r.(?)" "p.(Ala1172Thr)" "" "0000863072" "00025357" "30" "3337" "0" "3337" "0" "c.3337C>G" "r.(?)" "p.(Pro1113Ala)" "" "0000890696" "00025357" "50" "1801" "0" "1801" "0" "c.1801T>C" "r.(?)" "p.(Trp601Arg)" "" "0000890697" "00025357" "70" "1397" "0" "1397" "0" "c.1397G>C" "r.(?)" "p.(Arg466Pro)" "" "0000890698" "00025357" "70" "230" "0" "230" "0" "c.230C>T" "r.(?)" "p.(Pro77Leu)" "" "0000913908" "00025357" "50" "3067" "0" "3067" "0" "c.3067C>A" "r.(?)" "p.(Gln1023Lys)" "" "0000922463" "00025357" "90" "2074" "0" "2074" "0" "c.2074G>C" "r.(?)" "p.(Ala692Pro)" "" "0000922465" "00025357" "90" "1555" "0" "1555" "0" "c.1555C>T" "r.(?)" "p.(Arg519*)" "17" "0000922476" "00025357" "90" "1770" "1" "1770" "1" "c.1770+1G>T" "r.spl" "p.?" "" "0000922484" "00025357" "70" "1824" "0" "1826" "0" "c.1824_1826del" "r.(?)" "p.(Leu610del)" "" "0000922485" "00025357" "70" "1094" "0" "1097" "0" "c.1094_1097del" "r.(?)" "p.(Lys365Thrfs*12)" "" "0000922612" "00025357" "70" "880" "0" "881" "0" "c.880_881del" "r.(?)" "p.(Gly294LysfsTer3)" "10" "0000922613" "00025357" "70" "888" "0" "889" "0" "c.888_889del" "r.(?)" "p.(Tyr296Ter)" "10" "0000922614" "00025357" "90" "1826" "0" "1826" "0" "c.1826T>C" "r.(?)" "p.(Leu609Pro)" "19" "0000922642" "00025357" "90" "1651" "-2" "1651" "-2" "c.1651-2A>G" "r.spl" "p.?" "" "0000922643" "00025357" "90" "3129" "0" "3129" "0" "c.3129del" "r.(?)" "p.(Gly1044Aspfs*17)" "" "0000922644" "00025357" "70" "172" "0" "172" "0" "c.172C>T" "r.(?)" "p.(Gln58Ter)" "" "0000922645" "00025357" "70" "230" "0" "230" "0" "c.230C>T" "r.(?)" "p.(Pro77Leu)" "" "0000922646" "00025357" "70" "230" "0" "230" "0" "c.230C>T" "r.(?)" "p.(Pro77Leu)" "" "0000922647" "00025357" "70" "230" "0" "230" "0" "c.230C>T" "r.(?)" "p.(Pro77Leu)" "" "0000922648" "00025357" "70" "317" "2" "317" "2" "c.317+2T>A" "r.spl" "p.?" "" "0000922649" "00025357" "70" "327" "0" "327" "0" "c.327C>G" "r.(?)" "p.(Tyr109Ter)" "" "0000922650" "00025357" "70" "327" "0" "327" "0" "c.327C>G" "r.(?)" "p.(Tyr109Ter)" "" "0000922651" "00025357" "70" "326" "0" "326" "0" "c.326dup" "r.(?)" "p.(Tyr109Ter)" "" "0000922652" "00025357" "70" "574" "0" "574" "0" "c.574C>T" "r.(?)" "p.(Arg192Ter)" "" "0000922653" "00025357" "70" "574" "0" "574" "0" "c.574C>T" "r.(?)" "p.(Arg192Ter)" "" "0000922654" "00025357" "70" "640" "0" "640" "0" "c.640A>G" "r.(?)" "p.(Thr214Ala)" "" "0000922655" "00025357" "70" "743" "0" "743" "0" "c.743T>C" "r.(?)" "p.(Phe248Ser)" "" "0000922656" "00025357" "70" "805" "0" "805" "0" "c.805C>T" "r.(?)" "p.(Arg269Ter)" "" "0000922657" "00025357" "70" "805" "0" "805" "0" "c.805C>T" "r.(?)" "p.(Arg269Ter)" "" "0000922658" "00025357" "70" "1311" "-1" "1311" "-1" "c.1311-1G>A" "r.spl" "p.?" "" "0000922659" "00025357" "70" "1327" "0" "1327" "0" "c.1327C>T" "r.(?)" "p.(Arg443Trp)" "" "0000922660" "00025357" "70" "1796" "0" "1796" "0" "c.1796G>A" "r.(?)" "p.(Arg599His)" "" "0000922661" "00025357" "70" "1834" "-7" "1834" "-7" "c.1834-7C>G" "r.(?)" "p.Glu611_Ala612insHisGln" "" "0000922662" "00025357" "70" "1849" "0" "1854" "0" "c.1849_1854del" "r.(?)" "p.(Lys617_Asp618del)" "" "0000922663" "00025357" "70" "1919" "0" "1919" "0" "c.1919T>C" "r.(?)" "p.(Leu640Pro)" "" "0000922664" "00025357" "70" "2059" "0" "2059" "0" "c.2059C>T" "r.(?)" "p.(Arg687Ter)" "" "0000922665" "00025357" "70" "2059" "0" "2059" "0" "c.2059C>T" "r.(?)" "p.(Arg687Ter)" "" "0000922666" "00025357" "70" "2602" "0" "2602" "0" "c.2602G>C" "r.(?)" "p.(Ala868Pro)" "" "0000922667" "00025357" "70" "2639" "0" "2639" "0" "c.2639A>G" "r.(?)" "p.(Glu880Gly)" "" "0000922668" "00025357" "70" "2678" "0" "2678" "0" "c.2678A>G" "r.(?)" "p.(Glu893Gly)" "" "0000922669" "00025357" "70" "2697" "0" "2697" "0" "c.2697G>T" "r.(?)" "p.(Leu899Phe)" "" "0000922670" "00025357" "70" "3094" "0" "3094" "0" "c.3094dup" "r.(?)" "p.(Gln1032ProfsTer45)" "" "0000922671" "00025357" "70" "3129" "0" "3129" "0" "c.3129del" "r.(?)" "p.(Gly1044AspfsTer17)" "" "0000922672" "00025357" "70" "3129" "0" "3129" "0" "c.3129del" "r.(?)" "p.(Gly1044AspfsTer17)" "" "0000922673" "00025357" "70" "3135" "0" "3139" "0" "c.3135_3139dup" "r.(?)" "p.](Gly1047AlafsTer16),?]" "" "0000922674" "00025357" "70" "3279" "0" "3279" "0" "c.3279del" "r.(?)" "p.(Pro1094HisfsTer9)" "" "0000922675" "00025357" "70" "3279" "0" "3279" "0" "c.3279del" "r.(?)" "p.(Pro1094HisfsTer9)" "" "0000922676" "00025357" "70" "3524" "0" "3524" "0" "c.3524C>T" "r.(?)" "p.(Ala1175Val)" "" "0000922677" "00025357" "70" "3561" "0" "3561" "0" "c.3561del" "r.(?)" "p.(Leu1188CysfsTer95)" "" "0000922678" "00025357" "70" "0" "0" "0" "0" "c.-106_*1837{0}" "r.0" "p.0" "_1_28_" "0000949997" "00025357" "30" "2413" "0" "2413" "0" "c.2413G>A" "r.(?)" "p.(Asp805Asn)" "" "0000980388" "00025357" "30" "492" "5" "492" "5" "c.492+5A>G" "r.spl?" "p.?" "" "0001000242" "00025357" "30" "2954" "0" "2954" "0" "c.2954G>C" "r.(?)" "p.(Gly985Ala)" "" "0001000243" "00025357" "50" "2234" "0" "2234" "0" "c.2234C>T" "r.(?)" "p.(Ser745Phe)" "" "0001000244" "00025357" "30" "1493" "0" "1493" "0" "c.1493T>C" "r.(?)" "p.(Met498Thr)" "" "0001000245" "00025357" "50" "1355" "0" "1355" "0" "c.1355G>A" "r.(?)" "p.(Gly452Asp)" "" "0001000246" "00025357" "30" "1127" "0" "1127" "0" "c.1127C>T" "r.(?)" "p.(Thr376Ile)" "" "0001000247" "00025357" "30" "53" "0" "53" "0" "c.53C>G" "r.(?)" "p.(Ala18Gly)" "" "0001014999" "00025357" "50" "3284" "0" "3284" "0" "c.3284C>T" "r.(?)" "p.(Ser1095Phe)" "" "0001015000" "00025357" "90" "2320" "-2" "2320" "-2" "c.2320-2A>G" "r.spl?" "p.?" "" "0001015001" "00025357" "70" "1877" "0" "1878" "0" "c.1877_1878insAAGTG" "r.(?)" "p.(His626Glnfs*33)" "" "0001029355" "00025357" "90" "1496" "1" "1496" "1" "c.1496+1G>T" "r.[1496_1497ins[T;1496+2_1496+126],1383_1496del]" "p.[Met498_Arg499insSWVLWLRGRGYMRMPAYGCVLATVEMPARNTEEQTEKSTSRE,Ile461_Arg499delinsMet]" "16i" "0001039361" "00025357" "30" "3127" "0" "3127" "0" "c.3127C>G" "r.(?)" "p.(Pro1043Ala)" "" "0001039362" "00025357" "30" "3089" "0" "3089" "0" "c.3089C>T" "r.(?)" "p.(Ala1030Val)" "" "0001039363" "00025357" "30" "2452" "0" "2452" "0" "c.2452A>G" "r.(?)" "p.(Ile818Val)" "" "0001039364" "00025357" "30" "1833" "5" "1833" "5" "c.1833+5T>C" "r.spl?" "p.?" "" "0001039365" "00025357" "50" "1173" "0" "1173" "0" "c.1173G>A" "r.(?)" "p.(=)" "" "0001039366" "00025357" "50" "1141" "10" "1141" "11" "c.1141+10_1141+11insTC" "r.(=)" "p.(=)" "" "0001039367" "00025357" "30" "1141" "10" "1141" "10" "c.1141+10G>C" "r.(=)" "p.(=)" "" "0001039368" "00025357" "30" "1052" "0" "1052" "0" "c.1052A>G" "r.(?)" "p.(Asn351Ser)" "" "0001039369" "00025357" "30" "231" "280" "231" "280" "c.231+280G>A" "r.(=)" "p.(=)" "" "0001054364" "00025357" "30" "1781" "0" "1781" "0" "c.1781C>T" "r.(?)" "p.(Ala594Val)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 61 "{{screeningid}}" "{{variantid}}" "0000184659" "0000408783" "0000211772" "0000443385" "0000211773" "0000443386" "0000211774" "0000443387" "0000211775" "0000443388" "0000211776" "0000443389" "0000211777" "0000443390" "0000211778" "0000443391" "0000211779" "0000443392" "0000211780" "0000443393" "0000211781" "0000443394" "0000211782" "0000443395" "0000211783" "0000443396" "0000211784" "0000443397" "0000211785" "0000443398" "0000436119" "0000922463" "0000436120" "0000922465" "0000436121" "0000922476" "0000436127" "0000922484" "0000436128" "0000922485" "0000436253" "0000922612" "0000436254" "0000922613" "0000436255" "0000922614" "0000436280" "0000922642" "0000436281" "0000922643" "0000436282" "0000922644" "0000436283" "0000922645" "0000436284" "0000922646" "0000436285" "0000922647" "0000436286" "0000922648" "0000436287" "0000922649" "0000436288" "0000922650" "0000436289" "0000922651" "0000436290" "0000922652" "0000436291" "0000922653" "0000436292" "0000922654" "0000436293" "0000922655" "0000436294" "0000922656" "0000436295" "0000922657" "0000436296" "0000922658" "0000436297" "0000922659" "0000436298" "0000922660" "0000436299" "0000922661" "0000436300" "0000922662" "0000436301" "0000922663" "0000436302" "0000922664" "0000436303" "0000922665" "0000436304" "0000922666" "0000436305" "0000922667" "0000436306" "0000922668" "0000436307" "0000922669" "0000436308" "0000922670" "0000436309" "0000922671" "0000436310" "0000922672" "0000436311" "0000922673" "0000436312" "0000922674" "0000436313" "0000922675" "0000436314" "0000922676" "0000436315" "0000922677" "0000436316" "0000922678" "0000465669" "0001029355"