### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ###
## Filter: (gene_public = SMG8)
# charset = UTF-8
## Genes ## Do not remove or alter this header ##
## Count = 1
"{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}"
"SMG8" "smg-8 homolog, nonsense mediated mRNA decay factor (C. elegans)" "17" "q23.2" "unknown" "NC_000017.10" "UD_132465501227" "" "https://www.LOVD.nl/SMG8" "" "1" "25551" "55181" "613175" "1" "1" "1" "1" "NOTE: this gene is associated with the RP17 disease phenotype caused by rearrangements in the chromosome 17 region NC_000017.10:g.57295000_57522000 / NC_000017.11:g.59217639_59444639.\r\nEstablishment of this gene variant database (LSDB) was performed by Johan den Dunnen, supported by Global Variome." "" "g" "https://databases.lovd.nl/shared/refseq/SMG8_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2025-01-27 19:15:07" "00000" "2025-11-01 13:22:20"
## Transcripts ## Do not remove or alter this header ##
## Count = 1
"{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}"
"00019452" "SMG8" "smg-8 homolog, nonsense mediated mRNA decay factor (C. elegans)" "001" "NM_018149.6" "" "NP_060619.4" "" "" "" "-42" "3224" "2976" "57287371" "57292611" "" "0000-00-00 00:00:00" "" ""
## Diseases ## Do not remove or alter this header ##
## Count = 5
"{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}"
"00112" "RP" "retinitis pigmentosa (RP)" "" "268000" "" "" "" "00001" "2013-02-21 17:12:36" "00006" "2021-01-18 09:53:26"
"00139" "ID" "intellectual disability (ID)" "" "" "" "" "" "00084" "2013-06-04 18:18:07" "00006" "2015-02-09 10:02:49"
"00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12"
"02318" "RP17" "retinitis pigmentosa, type 17 (RP17)" "AD" "600852" "" "" "" "00006" "2014-09-25 23:29:40" "04542" "2023-11-06 16:13:11"
"05415" "USH" "Usher syndrome (USH)" "" "" "" "" "" "00006" "2018-04-02 16:40:44" "" ""
## Genes_To_Diseases ## Do not remove or alter this header ##
## Count = 2
"{{geneid}}" "{{diseaseid}}"
"SMG8" "00112"
"SMG8" "02318"
## Individuals ## Do not remove or alter this header ##
## Count = 37
"{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}"
"00320420" "" "" "" "2" "" "00006" "{PMID:Alzahrani 2020:33242396}, {DOI:Alzahrani 2020:10.1016/j.ajhg.2020.11.007}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "yes" "Saudi Arabia" "" "0" "" "" "" "Fam1-19DG1424"
"00320421" "" "" "00320420" "1" "" "00006" "{PMID:Alzahrani 2020:33242396}, {DOI:Alzahrani 2020:10.1016/j.ajhg.2020.11.007}" "fetus" "" "yes" "Saudi Arabia" "" "0" "" "" "" "Fam1-MDLREQ20196451"
"00320422" "" "" "" "2" "" "00006" "{PMID:Alzahrani 2020:33242396}, {DOI:Alzahrani 2020:10.1016/j.ajhg.2020.11.007}" "2-generation family, 2 affected brothers, unaffected heterozygous carrier parents" "M" "yes" "Saudi Arabia" "" "0" "" "" "" "19DG1391"
"00320423" "" "" "00320422" "1" "" "00006" "{PMID:Alzahrani 2020:33242396}, {DOI:Alzahrani 2020:10.1016/j.ajhg.2020.11.007}" "brother" "M" "yes" "Saudi Arabia" "" "0" "" "" "" "19DG1396"
"00320424" "" "" "" "3" "" "00006" "{PMID:Alzahrani 2020:33242396}, {DOI:Alzahrani 2020:10.1016/j.ajhg.2020.11.007}" "2-generation family, 3 affected (F, 2M), unaffected heterozygous carrier parents" "M" "yes" "Saudi Arabia" "" "0" "" "" "" "19DG0152"
"00320425" "" "" "00320424" "1" "" "00006" "{PMID:Alzahrani 2020:33242396}, {DOI:Alzahrani 2020:10.1016/j.ajhg.2020.11.007}" "brother" "M" "yes" "Saudi Arabia" "" "0" "" "" "" "19DG1342"
"00320426" "" "" "00320424" "1" "" "00006" "{PMID:Alzahrani 2020:33242396}, {DOI:Alzahrani 2020:10.1016/j.ajhg.2020.11.007}" "sister" "F" "yes" "Saudi Arabia" "" "0" "" "" "" "19DG0377"
"00320427" "" "" "" "2" "" "00006" "{PMID:Alzahrani 2020:33242396}, {DOI:Alzahrani 2020:10.1016/j.ajhg.2020.11.007}" "2-generation family, affected sister/brother, unaffected heterozygous carrier parents" "F" "yes" "Saudi Arabia" "" "0" "" "" "" "10DF10800_a"
"00320428" "" "" "00320427" "1" "" "00006" "{PMID:Alzahrani 2020:33242396}, {DOI:Alzahrani 2020:10.1016/j.ajhg.2020.11.007}" "brother" "M" "yes" "Saudi Arabia" "" "0" "" "" "" "10DF10800_b"
"00426193" "" "" "" "1" "" "00006" "{PMID:Al-Kasbi 2022:36344539}" "patient, other affecteds in family" "M" "yes" "Oman" "" "0" "" "" "" "10DF10800"
"00436090" "" "" "" "37" "" "04542" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "4-generation family, 37 affected (20F, 17M)" "F;M" "" "Netherlands" "" "0" "" "" "" "FamNL1"
"00436091" "" "" "" "11" "" "04542" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "5-generation family, 11 affected (6F, 5M)" "F;M" "" "Netherlands" "" "0" "" "" "" "FamNL2"
"00436092" "" "" "" "25" "" "04542" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "5-generation family, 25 affected (15F, 10M)" "F;M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "FamUK13"
"00436093" "" "" "" "51" "" "04542" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "8-generation family, 51 affected (29F, 22M)" "F;M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "FamUK1"
"00436094" "" "" "" "7" "" "04542" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "4-generation family, 7 affected (6F, M)" "F;M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "FamUK2"
"00436096" "" "" "" "4" "" "04542" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "4-generation family, 4 affected (3F, M)" "F;M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "FamUK4"
"00436097" "" "" "" "8" "" "04542" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "5-generation family, 8 affected (3F, 5M)" "F;M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "FamUK5"
"00436098" "" "" "" "10" "" "04542" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "7-generation family, 10 affected (6F, 4M)" "F;M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "FamUK6"
"00436099" "" "" "" "2" "" "04542" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "2-generation family, 2 affected sisters" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "FamUK7"
"00436100" "" "" "" "2" "" "04542" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "2-generation family, affected father and son" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "FamUK8"
"00436101" "" "" "" "10" "" "04542" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "4-generation family, 10 affected (9F, M)" "F;M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "FamUK9"
"00436102" "" "" "" "5" "" "04542" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "5-generation family, 5 affected (3F, 2M)" "F;M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "FamUK10"
"00436103" "" "" "" "5" "" "04542" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "4-generation family, 5 affected (5F)" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "FamUK11"
"00436104" "" "" "" "7" "" "04542" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "5-generation family, 7 affected (3F, 4M)" "F;M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "FamUK12"
"00436105" "" "" "" "42" "" "04542" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "5-generation family, 42 affected (22F, 19M, 1?)" "F;M" "" "Canada" "" "0" "" "" "" "FamCA1"
"00436106" "" "" "" "60" "" "04542" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "7-generation family, 60 affected (27F, 33M)" "F;M" "" "South Africa" "" "0" "" "" "" "FamSA1"
"00436107" "" "" "" "25" "" "04542" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "5-generation family, 25 affected (14F, 11M)" "F;M" "" "South Africa" "" "0" "" "" "" "FamSA2"
"00436108" "" "" "" "6" "" "04542" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "4-generation family, 6 affected (2F, 4M)" "F;M" "" "South Africa" "" "0" "" "" "" "FamSA3"
"00436109" "" "" "" "9" "" "04542" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "5-generation family, 9 affected (3F, 6M)" "F;M" "" "South Africa" "" "0" "" "" "" "FamSA4"
"00436110" "" "" "" "2" "" "04542" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "4-generation family, 2 affected sisters" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "FamUK14"
"00436111" "" "" "" "12" "" "04542" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "5 generation family, 12 affected (8F, 4M)" "F;M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "FamUK15"
"00436142" "" "" "" "1" "" "04542" "{PMID:Panneman 2023:36819107}" "" "F" "-" "United Kingdom (Great Britain)" "" "0" "" "" "" "067984"
"00456020" "" "" "" "6" "" "04542" "{DOI:de Bruijn 2024:10.3389/fgene.2024.1469686}" "6-generation family, 6 affected (2F, 4M)" "F;M" "" "Australia" "" "0" "" "" "" "FamAU1"
"00456021" "" "" "" "7" "" "04542" "{DOI:de Bruijn 2024:10.3389/fgene.2024.1469686}" "4-generation family, 7 affected (2F, 5M)" "F;M" "" "Australia" "" "0" "" "" "" "FamAU2"
"00456022" "" "" "" "13" "" "04542" "{DOI:de Bruijn 2024:10.3389/fgene.2024.1469686}" "5-generation family, 13 affected (11F, 2M)" "F;M" "" "Australia" "" "0" "" "" "" "FamAU3"
"00456023" "" "" "" "4" "" "04542" "{DOI:de Bruijn 2024:10.3389/fgene.2024.1469686}" "3-generation family, 4 affected (4F)" "F" "" "Germany" "" "0" "" "" "" "FamDE1"
"00456024" "" "" "" "16" "" "04542" "{DOI:de Bruijn 2024:10.3389/fgene.2024.1469686}" "6-generation family, 16 affected (9M, 7F)" "F;M" "" "United States" "" "0" "" "" "" "FamUS1"
## Individuals_To_Diseases ## Do not remove or alter this header ##
## Count = 39
"{{individualid}}" "{{diseaseid}}"
"00320420" "00198"
"00320421" "00198"
"00320422" "00198"
"00320423" "00198"
"00320424" "00198"
"00320425" "00198"
"00320426" "00198"
"00320427" "00198"
"00320427" "05415"
"00320428" "00198"
"00320428" "05415"
"00426193" "00139"
"00436090" "00112"
"00436091" "00112"
"00436092" "00112"
"00436093" "00112"
"00436094" "00112"
"00436096" "00112"
"00436097" "00112"
"00436098" "00112"
"00436099" "00112"
"00436100" "00112"
"00436101" "00112"
"00436102" "00112"
"00436103" "00112"
"00436104" "00112"
"00436105" "00112"
"00436106" "00112"
"00436107" "00112"
"00436108" "00112"
"00436109" "00112"
"00436110" "00112"
"00436111" "00112"
"00436142" "00112"
"00456020" "00112"
"00456021" "00112"
"00456022" "00112"
"00456023" "00112"
"00456024" "00112"
## Phenotypes ## Do not remove or alter this header ##
## Note: Only showing Phenotype columns active for Diseases 00112, 00139, 00198, 02318, 05415
## Count = 39
"{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}"
"0000242394" "00198" "00320420" "00006" "Familial, autosomal recessive" "23m" "ventricular septal defect, patent foramen ovale, persistent left superior vena cava, dilated coronary sinus; facial dysmorphism; global developmental delay; microcephaly; short stature; no eye abnormalities; no genitourinary abnormalities" "" "" "" "" "" "" "" "" "" "global developmental delay" ""
"0000242395" "00198" "00320421" "00006" "Familial, autosomal recessive" "<0d" "fetus; probable left pulmonary artery sling; facial dysmorphism; microcephaly; short stature; wide cavum septum pellucidum and ventricles" "" "" "" "" "" "" "" "" "" "" ""
"0000242396" "00198" "00320422" "00006" "Familial, autosomal recessive" "7y" "no congenital heart disease; facial dysmorphism; global developmental delay; no microcephaly; no short stature; abnormal white matter; no eye abnormalities; no genitourinary abnormalities" "" "" "" "" "" "" "" "" "" "global developmental delay" ""
"0000242397" "00198" "00320423" "00006" "Familial, autosomal recessive" "19y" "ventricular septal defect; facial dysmorphism; global developmental delay; borderline microcephaly; no short stature; strabismus; no genitourinary abnormalities" "" "" "" "" "" "" "" "" "" "global developmental delay" ""
"0000242398" "00198" "00320424" "00006" "Familial, autosomal recessive" "18y" "no congenital heart disease; facial dysmorphism; global developmental delay; microcephaly; borderline short stature; no central nervous system abnormality; strabismus; dilated renal collecting system, TUB, hypospadias" "" "" "" "" "" "" "" "" "" "global developmental delay" ""
"0000242399" "00198" "00320425" "00006" "Familial, autosomal recessive" "28y" "no congenital heart disease; facial dysmorphism; global developmental delay; no microcephaly; no short stature; cataract; hypospadias" "" "" "" "" "" "" "" "" "" "global developmental delay" ""
"0000242400" "00198" "00320426" "00006" "Familial, autosomal recessive" "10y" "no congenital heart disease; facial dysmorphism; global developmental delay; microcephaly; borderline short stature; no eye abnormalities; no genitourinary abnormalities" "" "" "" "" "" "" "" "" "" "global developmental delay" ""
"0000242401" "00198" "00320427" "00006" "Familial, autosomal recessive" "8y" "atrial septal defect, ventricular septal defect; facial dysmorphism; global developmental delay; microcephaly; short stature; abnormal white matter, brain atrophy; cataract; no genitourinary abnormalities" "" "" "" "" "" "" "" "" "" "global developmental delay" ""
"0000242402" "00198" "00320428" "00006" "Familial, autosomal recessive" "3y" "no congenital heart disease; facial dysmorphism; global developmental delay; microcephaly; short stature; abnormal white matter; cataract; hypospadias" "" "" "" "" "" "" "" "" "" "global developmental delay" ""
"0000242403" "05415" "00320427" "00006" "Familial, autosomal recessive" "8y" "Usher syndrome" "" "" "" "" "" "" "" "" "USH1G" "Usher syndrome" ""
"0000242404" "05415" "00320428" "00006" "Familial, autosomal recessive" "3y" "Usher syndrome" "" "" "" "" "" "" "" "" "USH1G" "Usher syndrome" ""
"0000317343" "00139" "00426193" "00006" "Familial, autosomal recessive" "5y" "Global developmental delay with severely impaired intellectual function and absent speech, additionally Usher syndrome phenotype" "" "" "" "" "" "" "" "" "" "intellectual disability" ""
"0000326274" "00112" "00436090" "04542" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" ""
"0000326275" "00112" "00436091" "04542" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" ""
"0000326276" "00112" "00436092" "04542" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" ""
"0000326277" "00112" "00436093" "04542" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" ""
"0000326278" "00112" "00436094" "04542" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" ""
"0000326280" "00112" "00436096" "04542" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" ""
"0000326281" "00112" "00436097" "04542" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" ""
"0000326282" "00112" "00436098" "04542" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" ""
"0000326283" "00112" "00436099" "04542" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" ""
"0000326284" "00112" "00436100" "04542" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" ""
"0000326285" "00112" "00436101" "04542" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" ""
"0000326286" "00112" "00436102" "04542" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" ""
"0000326287" "00112" "00436103" "04542" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" ""
"0000326288" "00112" "00436104" "04542" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" ""
"0000326289" "00112" "00436105" "04542" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" ""
"0000326290" "00112" "00436106" "04542" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" ""
"0000326291" "00112" "00436107" "04542" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" ""
"0000326292" "00112" "00436108" "04542" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" ""
"0000326293" "00112" "00436109" "04542" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" ""
"0000326294" "00112" "00436110" "04542" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" ""
"0000326295" "00112" "00436111" "04542" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" ""
"0000326326" "02318" "00436142" "04542" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" ""
"0000344540" "00112" "00456020" "04542" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" ""
"0000344541" "00112" "00456021" "04542" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" ""
"0000344542" "00112" "00456022" "04542" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" ""
"0000344543" "00112" "00456023" "04542" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" ""
"0000344544" "00112" "00456024" "04542" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" ""
## Screenings ## Do not remove or alter this header ##
## Count = 37
"{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}"
"0000321607" "00320420" "1" "00006" "00006" "2020-11-29 14:31:42" "" "" "SEQ;SEQ-NG" "DNA" "" ""
"0000321608" "00320421" "1" "00006" "00006" "2020-11-29 14:31:42" "" "" "SEQ;SEQ-NG" "DNA" "" ""
"0000321609" "00320422" "1" "00006" "00006" "2020-11-29 14:31:42" "" "" "SEQ;SEQ-NG" "DNA" "" ""
"0000321610" "00320423" "1" "00006" "00006" "2020-11-29 14:31:42" "" "" "SEQ;SEQ-NG" "DNA" "" ""
"0000321611" "00320424" "1" "00006" "00006" "2020-11-29 14:31:42" "" "" "SEQ;SEQ-NG" "DNA" "" ""
"0000321612" "00320425" "1" "00006" "00006" "2020-11-29 14:31:42" "" "" "SEQ;SEQ-NG" "DNA" "" ""
"0000321613" "00320426" "1" "00006" "00006" "2020-11-29 14:31:42" "" "" "SEQ;SEQ-NG" "DNA" "" ""
"0000321614" "00320427" "1" "00006" "00006" "2020-11-29 14:31:42" "" "" "SEQ;SEQ-NG" "DNA" "" ""
"0000321615" "00320428" "1" "00006" "00006" "2020-11-29 14:31:42" "" "" "SEQ;SEQ-NG" "DNA" "" ""
"0000427513" "00426193" "1" "00006" "00006" "2022-11-28 11:02:11" "" "" "SEQ;SEQ-NG" "DNA" "" "WES"
"0000437571" "00436090" "1" "04542" "00006" "2023-07-21 17:25:31" "" "" "arrayCGH;SEQ-NG" "DNA" "" "WES, WGS"
"0000437572" "00436091" "1" "04542" "00006" "2023-07-21 17:40:20" "" "" "SEQ-NG" "DNA" "" "WES, WGS"
"0000437573" "00436092" "1" "04542" "00006" "2023-07-21 18:01:50" "" "" "SEQ-NG" "DNA" "" "WES, WGS"
"0000437574" "00436093" "1" "04542" "00006" "2023-07-21 19:44:40" "" "" "arraySNP;SEQ-NG" "DNA" "" "WES, WGS"
"0000437575" "00436094" "1" "04542" "00006" "2023-07-21 19:44:40" "" "" "arraySNP;SEQ-NG" "DNA" "" "WES, WGS"
"0000437577" "00436096" "1" "04542" "00006" "2023-07-21 19:44:40" "" "" "arraySNP;SEQ-NG" "DNA" "" "WES, WGS"
"0000437578" "00436097" "1" "04542" "00006" "2023-07-21 19:44:40" "" "" "arraySNP;SEQ-NG" "DNA" "" "WES, WGS"
"0000437579" "00436098" "1" "04542" "00006" "2023-07-21 19:44:40" "" "" "arraySNP;SEQ-NG" "DNA" "" "WES, WGS"
"0000437580" "00436099" "1" "04542" "00006" "2023-07-21 19:44:40" "" "" "arraySNP;SEQ-NG" "DNA" "" "WES, WGS"
"0000437581" "00436100" "1" "04542" "00006" "2023-07-21 19:44:40" "" "" "arraySNP;SEQ-NG" "DNA" "" "WES, WGS"
"0000437582" "00436101" "1" "04542" "00006" "2023-07-21 19:44:40" "" "" "arraySNP;SEQ-NG" "DNA" "" "WES, WGS"
"0000437583" "00436102" "1" "04542" "00006" "2023-07-21 19:44:40" "" "" "arraySNP;SEQ-NG" "DNA" "" "WES, WGS"
"0000437584" "00436103" "1" "04542" "00006" "2023-07-21 19:44:40" "" "" "arraySNP;SEQ-NG" "DNA" "" "WES, WGS"
"0000437585" "00436104" "1" "04542" "00006" "2023-07-21 19:44:40" "" "" "arraySNP;SEQ-NG" "DNA" "" "WES, WGS"
"0000437586" "00436105" "1" "04542" "00006" "2023-07-21 20:28:43" "" "" "SEQ-NG" "DNA" "" "WES, WGS"
"0000437587" "00436106" "1" "04542" "00006" "2023-07-21 22:00:47" "" "" "SEQ-NG" "DNA" "" "WES, WGS"
"0000437588" "00436107" "1" "04542" "00006" "2023-07-21 22:00:47" "" "" "SEQ-NG" "DNA" "" "WES, WGS"
"0000437589" "00436108" "1" "04542" "00006" "2023-07-21 22:00:47" "" "" "SEQ-NG" "DNA" "" "WES, WGS"
"0000437590" "00436109" "1" "04542" "00006" "2023-07-21 22:00:47" "" "" "SEQ-NG" "DNA" "" "WES, WGS"
"0000437591" "00436110" "1" "04542" "00006" "2023-07-22 09:09:54" "" "" "SEQ;SEQ-NG" "DNA" "" "WES, WGS"
"0000437592" "00436111" "1" "04542" "00006" "2023-07-22 09:12:03" "" "" "SEQ-NG" "DNA" "" "WES, WGS"
"0000437623" "00436142" "1" "04542" "04542" "2023-08-17 14:45:15" "" "" "MIPsm" "DNA" "" ""
"0000457636" "00456020" "1" "04542" "04542" "2024-10-22 16:17:57" "" "" "MIPsm;SEQ-NG-I" "DNA" "" ""
"0000457637" "00456021" "1" "04542" "04542" "2024-10-22 16:29:58" "" "" "MIPsm;SEQ-NG-I" "DNA" "" ""
"0000457638" "00456022" "1" "04542" "04542" "2024-10-22 16:33:57" "" "" "MIPsm;SEQ-NG-I" "DNA" "" ""
"0000457639" "00456023" "1" "04542" "04542" "2024-10-22 16:37:34" "" "" "PCRq;SEQ-NG-I" "DNA" "" ""
"0000457640" "00456024" "1" "04542" "04542" "2024-10-22 16:45:11" "" "" "MIPsm;SEQ-NG-I" "DNA" "" ""
## Screenings_To_Genes ## Do not remove or alter this header ##
## Count = 11
"{{screeningid}}" "{{geneid}}"
"0000321607" "SMG8"
"0000321608" "SMG8"
"0000321609" "SMG8"
"0000321610" "SMG8"
"0000321611" "SMG8"
"0000321612" "SMG8"
"0000321613" "SMG8"
"0000321614" "SMG8"
"0000321614" "USH1G"
"0000321615" "SMG8"
"0000321615" "USH1G"
## Variants_On_Genome ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Count = 47
"{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}"
"0000704516" "3" "70" "17" "57287853" "57287853" "dup" "0" "00006" "SMG8_000002" "g.57287853dup" "" "{PMID:Alzahrani 2020:33242396}, {DOI:Alzahrani 2020:10.1016/j.ajhg.2020.11.007}" "" "441dupA" "" "Germline" "yes" "" "0" "" "" "g.59210492dup" "" "likely pathogenic (recessive)" ""
"0000704517" "3" "70" "17" "57287853" "57287853" "dup" "0" "00006" "SMG8_000002" "g.57287853dup" "" "{PMID:Alzahrani 2020:33242396}, {DOI:Alzahrani 2020:10.1016/j.ajhg.2020.11.007}" "" "441dupA" "" "Germline" "yes" "" "0" "" "" "g.59210492dup" "" "likely pathogenic (recessive)" ""
"0000704518" "3" "70" "17" "57290699" "57290699" "subst" "8.12137E-6" "00006" "SMG8_000005" "g.57290699C>T" "" "{PMID:Alzahrani 2020:33242396}, {DOI:Alzahrani 2020:10.1016/j.ajhg.2020.11.007}" "" "" "" "Germline" "yes" "" "0" "" "" "g.59213338C>T" "" "likely pathogenic (recessive)" ""
"0000704519" "3" "70" "17" "57290699" "57290699" "subst" "8.12137E-6" "00006" "SMG8_000005" "g.57290699C>T" "" "{PMID:Alzahrani 2020:33242396}, {DOI:Alzahrani 2020:10.1016/j.ajhg.2020.11.007}" "" "" "" "Germline" "yes" "" "0" "" "" "g.59213338C>T" "" "likely pathogenic (recessive)" ""
"0000704520" "3" "70" "17" "57288035" "57288035" "subst" "0" "00006" "SMG8_000003" "g.57288035A>G" "" "{PMID:Alzahrani 2020:33242396}, {DOI:Alzahrani 2020:10.1016/j.ajhg.2020.11.007}" "" "" "" "Germline" "yes" "" "0" "" "" "g.59210674A>G" "" "likely pathogenic (recessive)" ""
"0000704521" "3" "70" "17" "57288035" "57288035" "subst" "0" "00006" "SMG8_000003" "g.57288035A>G" "" "{PMID:Alzahrani 2020:33242396}, {DOI:Alzahrani 2020:10.1016/j.ajhg.2020.11.007}" "" "" "" "Germline" "yes" "" "0" "" "" "g.59210674A>G" "" "likely pathogenic (recessive)" ""
"0000704522" "3" "70" "17" "57288035" "57288035" "subst" "0" "00006" "SMG8_000003" "g.57288035A>G" "" "{PMID:Alzahrani 2020:33242396}, {DOI:Alzahrani 2020:10.1016/j.ajhg.2020.11.007}" "" "" "" "Germline" "yes" "" "0" "" "" "g.59210674A>G" "" "likely pathogenic (recessive)" ""
"0000704523" "3" "70" "17" "57288537" "57288537" "dup" "0" "00006" "SMG8_000004" "g.57288537dup" "" "{PMID:Alzahrani 2020:33242396}, {DOI:Alzahrani 2020:10.1016/j.ajhg.2020.11.007}" "" "1125dupG" "" "Germline" "yes" "" "0" "" "" "g.59211176dup" "" "likely pathogenic (recessive)" ""
"0000704524" "3" "70" "17" "57288537" "57288537" "dup" "0" "00006" "SMG8_000004" "g.57288537dup" "" "{PMID:Alzahrani 2020:33242396}, {DOI:Alzahrani 2020:10.1016/j.ajhg.2020.11.007}" "" "1125dupG" "" "Germline" "yes" "" "0" "" "" "g.59211176dup" "" "likely pathogenic (recessive)" ""
"0000865391" "0" "30" "17" "57289730" "57289730" "subst" "0.00272143" "02330" "SMG8_000006" "g.57289730G>T" "" "" "" "SMG8(NM_018149.7):c.1788G>T (p.P596=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000894064" "0" "30" "17" "57287667" "57287667" "subst" "0.00173396" "02330" "PRR11_000002" "g.57287667T>C" "" "" "" "SMG8(NM_018149.7):c.255T>C (p.P85=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000894065" "0" "30" "17" "57288129" "57288129" "subst" "0" "02330" "PRR11_000003" "g.57288129G>C" "" "" "" "SMG8(NM_018149.7):c.717G>C (p.P239=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000894066" "0" "50" "17" "57288787" "57288787" "subst" "0" "02325" "PRR11_000004" "g.57288787G>A" "" "" "" "SMG8(NM_018149.7):c.1375G>A (p.A459T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000904873" "3" "70" "17" "57288533" "57288534" "ins" "0" "00006" "SMG8_000007" "g.57288533_57288534insG" "" "{PMID:Al-Kasbi 2022:36344539}" "" "" "reported as candidate disease gene" "Germline" "" "" "0" "" "" "g.59211172_59211173insG" "" "VUS" ""
"0000931627" "0" "50" "17" "57290852" "57290852" "subst" "0.000353595" "03779" "SMG8_000008" "g.57290852T>C" "" "" "" "" "" "Unknown" "" "rs137980220" "0" "" "" "" "" "VUS" ""
"0000932874" "1" "90" "17" "57291915" "57518137" "dup" "0" "04542" "GDPD1_000001" "g.57291915_57518137dup" "" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "" "RP17_SV1" "" "Germline" "yes" "" "0" "" "" "g.59214554_59440776dup" "" "pathogenic (dominant)" ""
"0000932875" "1" "90" "17" "57260521" "57515862" "dup" "0" "04542" "GDPD1_000005" "g.57260521_57515862dup" "" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "" "RP17_SV5" "" "Germline" "yes" "" "0" "" "" "g.59183160_59438501dup" "" "pathogenic (dominant)" ""
"0000932876" "1" "90" "17" "57324706" "57324707" "ins" "0" "04542" "GDPD1_000006" "g.57324706_57324707ins[A;57440106_57510754;57295982_57510754;57295982_57324706]" "" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}, {DOI:de Bruijn 2024:10.3389/fgene.2024.1469686}" "" "RP17_SV6" "" "Germline" "yes" "" "0" "" "" "g.59247345_59247346ins[A;59362745_59433393;59218621_59433393;59218621_59247345]" "" "pathogenic (dominant)" ""
"0000932877" "1" "90" "17" "57456111" "57468959" "delins" "0" "04542" "GDPD1_000002" "g.57456111_57468959delins[57275839_57559111inv;AGGCTGGTC]" "" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "" "RP17_SV2" "" "Germline" "yes" "" "0" "" "" "g.59378750_59391598delins[59198478_59481750inv;AGGCTGGTC]" "" "pathogenic (dominant)" ""
"0000932878" "1" "90" "17" "57456111" "57468959" "delins" "0" "04542" "GDPD1_000002" "g.57456111_57468959delins[57275839_57559111inv;AGGCTGGTC]" "" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "" "RP17_SV2" "" "Germline" "yes" "" "0" "" "" "g.59378750_59391598delins[59198478_59481750inv;AGGCTGGTC]" "" "pathogenic (dominant)" ""
"0000932880" "1" "90" "17" "57456111" "57468959" "delins" "0" "04542" "GDPD1_000002" "g.57456111_57468959delins[57275839_57559111inv;AGGCTGGTC]" "" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "" "RP17_SV2" "" "Germline" "yes" "" "0" "" "" "g.59378750_59391598delins[59198478_59481750inv;AGGCTGGTC]" "" "pathogenic (dominant)" ""
"0000932881" "1" "90" "17" "57456111" "57468959" "delins" "0" "04542" "GDPD1_000002" "g.57456111_57468959delins[57275839_57559111inv;AGGCTGGTC]" "" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "" "RP17_SV2" "" "Germline" "yes" "" "0" "" "" "g.59378750_59391598delins[59198478_59481750inv;AGGCTGGTC]" "" "pathogenic (dominant)" ""
"0000932882" "1" "90" "17" "57456111" "57468959" "delins" "0" "04542" "GDPD1_000002" "g.57456111_57468959delins[57275839_57559111inv;AGGCTGGTC]" "" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "" "RP17_SV2" "" "Germline" "yes" "" "0" "" "" "g.59378750_59391598delins[59198478_59481750inv;AGGCTGGTC]" "" "pathogenic (dominant)" ""
"0000932883" "1" "90" "17" "57456111" "57468959" "delins" "0" "04542" "GDPD1_000002" "g.57456111_57468959delins[57275839_57559111inv;AGGCTGGTC]" "" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "" "RP17_SV2" "" "Germline" "yes" "" "0" "" "" "g.59378750_59391598delins[59198478_59481750inv;AGGCTGGTC]" "" "pathogenic (dominant)" ""
"0000932884" "1" "90" "17" "57456111" "57468959" "delins" "0" "04542" "GDPD1_000002" "g.57456111_57468959delins[57275839_57559111inv;AGGCTGGTC]" "" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "" "RP17_SV2" "" "Germline" "yes" "" "0" "" "" "g.59378750_59391598delins[59198478_59481750inv;AGGCTGGTC]" "" "pathogenic (dominant)" ""
"0000932885" "1" "90" "17" "57456111" "57468959" "delins" "0" "04542" "GDPD1_000002" "g.57456111_57468959delins[57275839_57559111inv;AGGCTGGTC]" "" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "" "RP17_SV2" "" "Germline" "yes" "" "0" "" "" "g.59378750_59391598delins[59198478_59481750inv;AGGCTGGTC]" "" "pathogenic (dominant)" ""
"0000932886" "1" "90" "17" "57456111" "57468959" "delins" "0" "04542" "GDPD1_000002" "g.57456111_57468959delins[57275839_57559111inv;AGGCTGGTC]" "" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "" "RP17_SV2" "" "Germline" "yes" "" "0" "" "" "g.59378750_59391598delins[59198478_59481750inv;AGGCTGGTC]" "" "pathogenic (dominant)" ""
"0000932887" "1" "90" "17" "57456111" "57468959" "delins" "0" "04542" "GDPD1_000002" "g.57456111_57468959delins[57275839_57559111inv;AGGCTGGTC]" "" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "" "RP17_SV2" "" "Germline" "yes" "" "0" "" "" "g.59378750_59391598delins[59198478_59481750inv;AGGCTGGTC]" "" "pathogenic (dominant)" ""
"0000932888" "1" "90" "17" "57456111" "57468959" "delins" "0" "04542" "GDPD1_000002" "g.57456111_57468959delins[57275839_57559111inv;AGGCTGGTC]" "" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "" "RP17_SV2" "" "Germline" "yes" "" "0" "" "" "g.59378750_59391598delins[59198478_59481750inv;AGGCTGGTC]" "" "pathogenic (dominant)" ""
"0000932889" "1" "90" "17" "57280008" "57483883" "delins" "0" "04542" "GDPD1_000004" "g.57280008_57483883delins[57233035_57634900inv;TAAGCA]" "" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "" "RP17_SV4" "" "Germline" "yes" "" "0" "" "" "g.59202647_59406522delins[59155674_59557539inv;TAAGCA]" "" "pathogenic (dominant)" ""
"0000932890" "1" "90" "17" "57516678" "57516679" "ins" "0" "04542" "GDPD1_000003" "g.57516678_57516679ins[AAAAAAAACTTGAAAAAGAAGTTTG;57247620_57391675;57516683_57612715inv;GGTCCAGATTGTG;57499214_57516678]" "" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "" "RP17_SV3" "" "Germline" "yes" "" "0" "" "" "g.59439317_59439318ins[AAAAAAAACTTGAAAAAGAAGTTTG;59170259_59314314;59439322_59535354inv;GGTCCAGATTGTG;59421853_59439317]" "" "pathogenic (dominant)" ""
"0000932891" "1" "90" "17" "57516678" "57516679" "ins" "0" "04542" "GDPD1_000003" "g.57516678_57516679ins[AAAAAAAACTTGAAAAAGAAGTTTG;57247620_57391675;57516683_57612715inv;GGTCCAGATTGTG;57499214_57516678]" "" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "" "RP17_SV3" "" "Germline" "yes" "" "0" "" "" "g.59439317_59439318ins[AAAAAAAACTTGAAAAAGAAGTTTG;59170259_59314314;59439322_59535354inv;GGTCCAGATTGTG;59421853_59439317]" "" "pathogenic (dominant)" ""
"0000932892" "1" "90" "17" "57516678" "57516679" "ins" "0" "04542" "GDPD1_000003" "g.57516678_57516679ins[AAAAAAAACTTGAAAAAGAAGTTTG;57247620_57391675;57516683_57612715inv;GGTCCAGATTGTG;57499214_57516678]" "" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "" "RP17_SV3" "" "Germline" "yes" "" "0" "" "" "g.59439317_59439318ins[AAAAAAAACTTGAAAAAGAAGTTTG;59170259_59314314;59439322_59535354inv;GGTCCAGATTGTG;59421853_59439317]" "" "pathogenic (dominant)" ""
"0000932893" "1" "90" "17" "57516678" "57516679" "ins" "0" "04542" "GDPD1_000003" "g.57516678_57516679ins[AAAAAAAACTTGAAAAAGAAGTTTG;57247620_57391675;57516683_57612715inv;GGTCCAGATTGTG;57499214_57516678]" "" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "" "RP17_SV3" "" "Germline" "yes" "" "0" "" "" "g.59439317_59439318ins[AAAAAAAACTTGAAAAAGAAGTTTG;59170259_59314314;59439322_59535354inv;GGTCCAGATTGTG;59421853_59439317]" "" "pathogenic (dominant)" ""
"0000932894" "1" "90" "17" "57326235" "57413152" "delins" "0" "04542" "GDPD1_000008" "g.57326235_57413152delins[CT;57277347_57631659inv]" "" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "" "RP17_SV8" "" "Germline" "yes" "" "0" "" "" "g.59248874_59335791delins[CT;59199986_59554298inv]" "" "pathogenic (dominant)" ""
"0000932895" "1" "90" "17" "57453631" "57468930" "delins" "0" "04542" "GDPD1_000007" "g.57453631_57468930delins[57259525_57710821inv;TT]" "" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "" "RP17_SV7" "" "Germline" "yes" "" "0" "" "" "g.59376270_59391569delins[59182164_59633460inv;TT]" "" "pathogenic (dominant)" ""
"0000932959" "1" "90" "17" "57456111" "57468959" "delins" "0" "04542" "GDPD1_000002" "g.57456111_57468959delins[57275839_57559111inv;AGGCTGGTC]" "" "{PMID:Panneman 2023:36819107}, {DOI:Panneman 2023:10.3389/fcell.2023.1112270}" "" "RP17_SV2" "" "Germline" "yes" "" "0" "" "" "g.59378750_59391598delins[59198478_59481750inv;AGGCTGGTC]" "" "pathogenic (dominant)" ""
"0000950965" "0" "30" "17" "57288541" "57288541" "subst" "0.000174649" "02330" "PRR11_000005" "g.57288541A>C" "" "" "" "SMG8(NM_018149.7):c.1129A>C (p.R377=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000982659" "0" "50" "17" "57288347" "57288347" "subst" "0" "01804" "PRR11_000006" "g.57288347T>C" "" "" "" "SMG8(NM_018149.7):c.935T>C (p.(Phe312Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000982660" "0" "30" "17" "57290502" "57290502" "subst" "0.000909689" "01804" "SMG8_000009" "g.57290502C>T" "" "" "" "SMG8(NM_018149.7):c.2318C>T (p.(Pro773Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0001012177" "1" "90" "17" "57456111" "57468959" "delins" "0" "04542" "GDPD1_000002" "g.57456111_57468959delins[57275839_57559111inv;AGGCTGGTC]" "" "{DOI:de Bruijn 2024:10.3389/fgene.2024.1469686}" "" "RP17_SV2" "" "Germline" "" "" "0" "" "" "g.59378750_59391598delins[59198478_59481750inv;AGGCTGGTC]" "" "pathogenic (dominant)" ""
"0001012178" "1" "90" "17" "57516678" "57516679" "ins" "0" "04542" "GDPD1_000003" "g.57516678_57516679ins[AAAAAAAACTTGAAAAAGAAGTTTG;57247620_57391675;57516683_57612715inv;GGTCCAGATTGTG;57499214_57516678]" "" "{DOI:de Bruijn 2024:10.3389/fgene.2024.1469686}" "" "RP17_SV3" "" "Germline" "" "" "0" "" "" "g.59439317_59439318ins[AAAAAAAACTTGAAAAAGAAGTTTG;59170259_59314314;59439322_59535354inv;GGTCCAGATTGTG;59421853_59439317]" "" "pathogenic (dominant)" ""
"0001012179" "1" "90" "17" "57516678" "57516679" "ins" "0" "04542" "GDPD1_000003" "g.57516678_57516679ins[AAAAAAAACTTGAAAAAGAAGTTTG;57247620_57391675;57516683_57612715inv;GGTCCAGATTGTG;57499214_57516678]" "" "{DOI:de Bruijn 2024:10.3389/fgene.2024.1469686}" "" "RP17_SV3" "" "Germline" "" "" "0" "" "" "g.59439317_59439318ins[AAAAAAAACTTGAAAAAGAAGTTTG;59170259_59314314;59439322_59535354inv;GGTCCAGATTGTG;59421853_59439317]" "" "pathogenic (dominant)" ""
"0001012180" "1" "90" "17" "57626499" "57626500" "ins" "0" "04542" "GDPD1_000010" "g.57626499_57626500ins[57413643_57623126inv;57264682_57626499]" "" "{DOI:de Bruijn 2024:10.3389/fgene.2024.1469686}" "" "RP17_SV9" "" "Germline" "yes" "" "0" "" "" "g.59549138_59549139ins[59336282_59545765inv;59187321_59549138]" "" "likely pathogenic (dominant)" ""
"0001012181" "1" "90" "17" "57365657" "57439922" "delins" "0" "04542" "GDPD1_000011" "g.57365657_57439922delins[57297473_57555520inv;A]" "" "{DOI:de Bruijn 2024:10.3389/fgene.2024.1469686}" "" "RP17_SV10" "" "Germline" "yes" "" "0" "" "" "g.59288296_59362561delins[59220112_59478159inv;A]" "" "pathogenic (dominant)" ""
"0001042025" "0" "50" "17" "57288043" "57288043" "subst" "1.62479E-5" "01804" "PRR11_000007" "g.57288043C>T" "" "" "" "SMG8(NM_018149.7):c.631C>T (p.(Leu211Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001056109" "0" "50" "17" "57287420" "57287420" "subst" "8.14117E-5" "01804" "PRR11_000008" "g.57287420G>C" "" "" "" "SMG8(NM_018149.7):c.8G>C (p.(Gly3Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
## Variants_On_Transcripts ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Note: Only showing Variants_On_Transcript columns active for Genes SMG8
## Count = 47
"{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}"
"0000704516" "00019452" "70" "441" "0" "441" "0" "c.441dup" "r.(?)" "p.(Val148Serfs*11)" ""
"0000704517" "00019452" "70" "441" "0" "441" "0" "c.441dup" "r.(?)" "p.(Val148Serfs*11)" ""
"0000704518" "00019452" "70" "2515" "0" "2515" "0" "c.2515C>T" "r.(?)" "p.(Arg839*)" ""
"0000704519" "00019452" "70" "2515" "0" "2515" "0" "c.2515C>T" "r.(?)" "p.(Arg839*)" ""
"0000704520" "00019452" "70" "623" "0" "623" "0" "c.623A>G" "r.(?)" "p.(His208Arg)" ""
"0000704521" "00019452" "70" "623" "0" "623" "0" "c.623A>G" "r.(?)" "p.(His208Arg)" ""
"0000704522" "00019452" "70" "623" "0" "623" "0" "c.623A>G" "r.(?)" "p.(His208Arg)" ""
"0000704523" "00019452" "70" "1125" "0" "1125" "0" "c.1125dup" "r.(?)" "p.(Pro376Alafs*2)" ""
"0000704524" "00019452" "70" "1125" "0" "1125" "0" "c.1125dup" "r.(?)" "p.(Pro376Alafs*2)" ""
"0000865391" "00019452" "30" "1788" "0" "1788" "0" "c.1788G>T" "r.(?)" "p.(Pro596=)" ""
"0000894064" "00019452" "30" "255" "0" "255" "0" "c.255T>C" "r.(?)" "p.(Pro85=)" ""
"0000894065" "00019452" "30" "717" "0" "717" "0" "c.717G>C" "r.(?)" "p.(Pro239=)" ""
"0000894066" "00019452" "50" "1375" "0" "1375" "0" "c.1375G>A" "r.(?)" "p.(Ala459Thr)" ""
"0000904873" "00019452" "70" "1121" "0" "1122" "0" "c.1121_1122insG" "r.(?)" "p.(Gly375TrpfsTer3)" ""
"0000931627" "00019452" "50" "2668" "0" "2668" "0" "c.2668T>C" "r.(?)" "p.(Tyr890His)" ""
"0000932874" "00019452" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" ""
"0000932875" "00019452" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" ""
"0000932876" "00019452" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" ""
"0000932877" "00019452" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" ""
"0000932878" "00019452" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" ""
"0000932880" "00019452" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" ""
"0000932881" "00019452" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" ""
"0000932882" "00019452" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" ""
"0000932883" "00019452" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" ""
"0000932884" "00019452" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" ""
"0000932885" "00019452" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" ""
"0000932886" "00019452" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" ""
"0000932887" "00019452" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" ""
"0000932888" "00019452" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" ""
"0000932889" "00019452" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" ""
"0000932890" "00019452" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" ""
"0000932891" "00019452" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" ""
"0000932892" "00019452" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" ""
"0000932893" "00019452" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" ""
"0000932894" "00019452" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" ""
"0000932895" "00019452" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" ""
"0000932959" "00019452" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" ""
"0000950965" "00019452" "30" "1129" "0" "1129" "0" "c.1129A>C" "r.(?)" "p.(=)" ""
"0000982659" "00019452" "50" "935" "0" "935" "0" "c.935T>C" "r.(?)" "p.(Phe312Ser)" ""
"0000982660" "00019452" "30" "2318" "0" "2318" "0" "c.2318C>T" "r.(?)" "p.(Pro773Leu)" ""
"0001012177" "00019452" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" ""
"0001012178" "00019452" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" ""
"0001012179" "00019452" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" ""
"0001012180" "00019452" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" ""
"0001012181" "00019452" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" ""
"0001042025" "00019452" "50" "631" "0" "631" "0" "c.631C>T" "r.(?)" "p.(Leu211Phe)" ""
"0001056109" "00019452" "50" "8" "0" "8" "0" "c.8G>C" "r.(?)" "p.(Gly3Ala)" ""
## Screenings_To_Variants ## Do not remove or alter this header ##
## Count = 37
"{{screeningid}}" "{{variantid}}"
"0000321607" "0000704516"
"0000321608" "0000704517"
"0000321609" "0000704518"
"0000321610" "0000704519"
"0000321611" "0000704520"
"0000321612" "0000704521"
"0000321613" "0000704522"
"0000321614" "0000704523"
"0000321615" "0000704524"
"0000427513" "0000904873"
"0000437571" "0000932874"
"0000437572" "0000932875"
"0000437573" "0000932876"
"0000437574" "0000932877"
"0000437575" "0000932878"
"0000437577" "0000932880"
"0000437578" "0000932881"
"0000437579" "0000932882"
"0000437580" "0000932883"
"0000437581" "0000932884"
"0000437582" "0000932885"
"0000437583" "0000932886"
"0000437584" "0000932887"
"0000437585" "0000932888"
"0000437586" "0000932889"
"0000437587" "0000932890"
"0000437588" "0000932891"
"0000437589" "0000932892"
"0000437590" "0000932893"
"0000437591" "0000932895"
"0000437592" "0000932894"
"0000437623" "0000932959"
"0000457636" "0001012177"
"0000457637" "0001012178"
"0000457638" "0001012179"
"0000457639" "0001012180"
"0000457640" "0001012181"