### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = SON) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "SON" "SON DNA binding protein" "21" "q22.1-q22.2" "unknown" "NC_000021.8" "UD_132438853040" "" "http://www.LOVD.nl/SON" "" "1" "11183" "6651" "182465" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "" "g" "http://databases.lovd.nl/shared/refseq/SON_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2016-10-06 22:29:51" "00000" "2026-01-20 18:57:21" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00024173" "SON" "transcript variant f" "003" "NM_138927.2" "" "NP_620305.2" "" "" "" "-55" "8371" "7281" "34915344" "34949820" "00006" "2016-10-06 22:31:40" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 4 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00139" "ID" "intellectual disability (ID)" "" "" "" "" "" "00084" "2013-06-04 18:18:07" "00006" "2015-02-09 10:02:49" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "05521" "seizures" "seizures" "" "" "" "" "" "00006" "2018-11-18 17:02:13" "" "" "05735" "ZTTKS" "Zhu-Tokita-Takenouchi-Kim syndrome (ZTTKS)" "AD" "617140" "" "" "" "00006" "2020-05-06 15:14:29" "00006" "2021-12-10 21:51:32" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 1 "{{geneid}}" "{{diseaseid}}" "SON" "05735" ## Individuals ## Do not remove or alter this header ## ## Count = 59 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00019864" "" "" "" "1" "" "00705" "{PMID:Gilissen 2014:24896178}, {PMID:Kim 2016:27545680}, {DOI:Kim 2016:10.1016/j.ajhg.2016.06.029}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "?" "Netherlands" "" "0" "" "" "" "" "00081336" "" "" "" "1" "" "00006" "{PMID:Kim 2016:27545680}, {DOI:Kim 2016:10.1016/j.ajhg.2016.06.029}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "" "" "0" "" "" "" "" "00081337" "" "" "" "1" "" "00006" "{PMID:Zhu 2015:25590979}, {DOI:Zhu 2015:10.1038/gim.2014.191}, {PMID:Kim 2016:27545680}, {DOI:Kim 2016:10.1016/j.ajhg.2016.06.029}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "no" "United States" "" "0" "" "" "" "Pat91;Pat03" "00081338" "" "" "" "1" "" "00006" "{PMID:Kim 2016:27545680}, {DOI:Kim 2016:10.1016/j.ajhg.2016.06.029}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "" "" "" "0" "" "" "" "" "00081339" "" "" "" "1" "" "00006" "{PMID:Kim 2016:27545680}, {DOI:Kim 2016:10.1016/j.ajhg.2016.06.029}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "" "" "" "0" "" "" "" "" "00081340" "" "" "" "1" "" "00006" "{PMID:Kim 2016:27545680}, {DOI:Kim 2016:10.1016/j.ajhg.2016.06.029}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "" "" "0" "" "" "" "" "00081341" "" "" "" "1" "" "00006" "{PMID:Kim 2016:27545680}, {DOI:Kim 2016:10.1016/j.ajhg.2016.06.029}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "" "" "" "0" "" "" "" "" "00081342" "" "" "" "1" "" "00006" "{PMID:Kim 2016:27545680}, {DOI:Kim 2016:10.1016/j.ajhg.2016.06.029}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "" "" "0" "" "" "" "" "00081343" "" "" "" "1" "" "00006" "{PMID:Kim 2016:27545680}, {DOI:Kim 2016:10.1016/j.ajhg.2016.06.029}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "" "" "0" "" "" "" "" "00081344" "" "" "" "1" "" "00006" "{PMID:Kim 2016:27545680}, {DOI:Kim 2016:10.1016/j.ajhg.2016.06.029}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "" "" "0" "" "" "" "" "00081345" "" "" "" "1" "" "00006" "{PMID:Kim 2016:27545680}, {DOI:Kim 2016:10.1016/j.ajhg.2016.06.029}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "" "" "" "0" "" "" "" "" "00081346" "" "" "" "1" "" "00006" "{PMID:Kim 2016:27545680}, {DOI:Kim 2016:10.1016/j.ajhg.2016.06.029}" "2-generastion family, 1 affected, conceived using an ovum donor, non-carrier father" "F" "" "" "" "0" "" "" "" "" "00081347" "" "" "" "1" "" "00006" "{PMID:Kim 2016:27545680}, {DOI:Kim 2016:10.1016/j.ajhg.2016.06.029}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "" "" "" "0" "" "" "" "" "00081348" "" "" "" "1" "" "00006" "{PMID:Kim 2016:27545680}, {DOI:Kim 2016:10.1016/j.ajhg.2016.06.029}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "" "" "" "0" "" "" "" "" "00081349" "" "" "" "1" "" "00006" "{PMID:Kim 2016:27545680}, {DOI:Kim 2016:10.1016/j.ajhg.2016.06.029}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "" "" "" "0" "" "" "" "" "00081350" "" "" "" "1" "" "00006" "{PMID:Kim 2016:27545680}, {DOI:Kim 2016:10.1016/j.ajhg.2016.06.029}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "" "" "" "0" "" "" "" "" "00081351" "" "" "" "1" "" "00006" "{PMID:Kim 2016:27545680}, {DOI:Kim 2016:10.1016/j.ajhg.2016.06.029}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "" "" "" "0" "" "" "" "" "00081352" "" "" "" "1" "" "00006" "{PMID:Kim 2016:27545680}, {DOI:Kim 2016:10.1016/j.ajhg.2016.06.029}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "" "" "0" "" "" "" "" "00081353" "" "" "" "1" "" "00006" "{PMID:Kim 2016:27545680}, {DOI:Kim 2016:10.1016/j.ajhg.2016.06.029}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "" "" "" "0" "" "" "" "" "00081354" "" "" "" "1" "" "00006" "{PMID:Kim 2016:27545680}, {DOI:Kim 2016:10.1016/j.ajhg.2016.06.029}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "" "" "" "0" "" "" "" "" "00289307" "" "" "" "1" "" "01807" "" "" "M" "" "" "" "0" "" "" "" "" "00301052" "" "" "" "1" "" "00006" "{PMID:Braddock 1994:7515754}, {PMID:Braddock 2016:27549381}" "" "F" "" "United States" "" "0" "" "" "" "Pat1" "00301053" "" "" "" "1" "" "00006" "{PMID:Braddock 1994:7515754}, {PMID:Braddock 2016:27549381}" "" "F" "" "United States" "" "0" "" "" "" "Pat2" "00301054" "" "" "" "1" "" "00006" "{PMID:Takenouchi 2016:27256762}" "" "M" "" "Japan" "" "0" "" "" "" "Pat" "00301055" "" "" "" "1" "" "00006" "{PMID:Tokita 2016:27545676}" "" "F" "" "" "" "0" "" "" "" "Subject 1" "00301056" "" "" "" "1" "" "00006" "{PMID:Tokita 2016:27545676}" "" "M" "" "" "" "0" "" "" "" "Subject 2" "00301057" "" "" "" "1" "" "00006" "{PMID:Tokita 2016:27545676}" "" "F" "" "" "" "0" "" "" "" "Subject 3" "00301058" "" "" "" "1" "" "00006" "{PMID:Tokita 2016:27545676}" "" "F" "" "" "" "0" "" "" "" "Subject 4" "00301059" "" "" "" "1" "" "00006" "{PMID:Tokita 2016:27545676}" "" "F" "" "" "" "0" "" "" "" "Subject 5" "00301060" "" "" "" "1" "" "00006" "{PMID:Tokita 2016:27545676}" "" "F" "" "" "" "0" "" "" "" "Subject 6" "00301061" "" "" "" "1" "" "00006" "{PMID:Tokita 2016:27545676}" "" "F" "" "" "" "0" "" "" "" "Subject 7" "00301072" "" "" "" "1" "" "00006" "{PMID:Izumi 2012:22614953}" "" "F" "" "United States" "" "0" "" "" "" "patient" "00301080" "" "" "" "1" "" "00006" "{PMID:Quintana Castanedo 2020:32045494}" "2-generation family, 1 affected, unaffected parents" "F" "" "Spain" "" "0" "" "" "" "patient" "00301081" "" "" "" "1" "" "00006" "{PMID:Yang 2019:31557424}" "2-generation family, 1 affected, unaffected parents" "F" "" "China" "" "0" "" "" "" "patient" "00303077" "" "" "" "1" "" "00006" "{PMID:Helbig 2016:26795593}" "" "" "" "United States" "" "0" "" "" "" "Pat119" "00308041" "" "" "" "1" "" "00006" "{PMID:Mahler 2019:31056085}" "2-generation family, 1 affected, unaffected non-carrier parents" "" "yes" "Germany" "" "0" "" "" "" "Pat20" "00308042" "" "" "" "1" "" "00006" "{PMID:Mahler 2019:31056085}" "2-generation family, 1 affected, unaffected non-carrier parents" "" "no" "Germany" "" "0" "" "" "" "Pat21" "00320135" "" "" "" "1" "" "01807" "" "" "F" "" "" "" "0" "" "" "" "" "00320174" "" "" "" "1" "" "01807" "" "" "F" "" "" "" "0" "" "" "" "" "00373718" "" "" "" "1" "" "01864" "" "" "F" "no" "China" "" "" "" "" "Chinese" "iw107" "00377114" "" "" "" "1" "" "03760" "{PMID:Dingemans 2022:34521999}, {DOI:Dingemans 2022:10.1038/s41431-021-00960-4}" "" "M" "" "" "" "" "" "" "" "Pat1" "00377116" "" "" "" "1" "" "03760" "{PMID:Dingemans 2022:34521999}, {DOI:Dingemans 2022:10.1038/s41431-021-00960-4}" "" "M" "" "" "" "" "" "" "" "Pat2" "00377117" "" "" "" "1" "" "03760" "{PMID:Dingemans 2022:34521999}, {DOI:Dingemans 2022:10.1038/s41431-021-00960-4}" "" "F" "" "" "" "" "" "" "" "Pat3" "00377118" "" "" "" "1" "" "03760" "{PMID:Dingemans 2022:34521999}, {DOI:Dingemans 2022:10.1038/s41431-021-00960-4}" "" "F" "" "" "" "" "" "" "" "Pat4" "00377119" "" "" "" "1" "" "03760" "{PMID:Dingemans 2022:34521999}, {DOI:Dingemans 2022:10.1038/s41431-021-00960-4}" "" "M" "" "" "" "" "" "" "" "Pat5" "00377120" "" "" "" "1" "" "03760" "{PMID:Dingemans 2022:34521999}, {DOI:Dingemans 2022:10.1038/s41431-021-00960-4}" "" "F" "" "" "" "" "" "" "" "Pat6" "00377121" "" "" "" "1" "" "03760" "{PMID:Dingemans 2022:34521999}, {DOI:Dingemans 2022:10.1038/s41431-021-00960-4}" "" "M" "" "" "" "" "" "" "" "Pat7" "00377122" "" "" "" "1" "" "03760" "{PMID:Dingemans 2022:34521999}, {DOI:Dingemans 2022:10.1038/s41431-021-00960-4}" "" "M" "" "" "" "" "" "" "" "Pat8" "00377123" "" "" "" "1" "" "03760" "{PMID:Dingemans 2022:34521999}, {DOI:Dingemans 2022:10.1038/s41431-021-00960-4}" "" "F" "" "" "" "" "" "" "" "Pat9" "00377124" "" "" "" "1" "" "03760" "{PMID:Dingemans 2022:34521999}, {DOI:Dingemans 2022:10.1038/s41431-021-00960-4}" "" "M" "" "" "" "" "" "" "" "Pat10" "00377125" "" "" "" "1" "" "03760" "{PMID:Dingemans 2022:34521999}, {DOI:Dingemans 2022:10.1038/s41431-021-00960-4}" "" "F" "" "" "" "" "" "" "" "Pat11" "00377126" "" "" "" "1" "" "03760" "{PMID:Dingemans 2022:34521999}, {DOI:Dingemans 2022:10.1038/s41431-021-00960-4}" "" "M" "" "" "" "" "" "" "" "Pat12" "00377127" "" "" "" "1" "" "03760" "{PMID:Dingemans 2022:34521999}, {DOI:Dingemans 2022:10.1038/s41431-021-00960-4}" "" "F" "" "" "" "" "" "" "" "Pat13" "00377128" "" "" "" "1" "" "03760" "{PMID:Dingemans 2022:34521999}, {DOI:Dingemans 2022:10.1038/s41431-021-00960-4}" "" "M" "" "" "" "" "" "" "" "Pat14" "00377129" "" "" "" "1" "" "03760" "{PMID:Dingemans 2022:34521999}, {DOI:Dingemans 2022:10.1038/s41431-021-00960-4}" "" "F" "" "" "" "" "" "" "" "Pat15" "00377130" "" "" "" "1" "" "03760" "{PMID:Dingemans 2022:34521999}, {DOI:Dingemans 2022:10.1038/s41431-021-00960-4}" "" "M" "" "" "" "" "" "" "" "Pat16" "00377131" "" "" "" "1" "" "03760" "{PMID:Dingemans 2022:34521999}, {DOI:Dingemans 2022:10.1038/s41431-021-00960-4}" "" "F" "" "" "" "" "" "" "" "Pat17" "00377132" "" "" "" "1" "" "03760" "{PMID:Dingemans 2022:34521999}, {DOI:Dingemans 2022:10.1038/s41431-021-00960-4}" "" "M" "" "" "" "" "" "" "" "Pat18" "00457742" "" "" "" "1" "" "03544" "" "" "M" "-" "- (not applicable)" "" "" "" "" "white" "" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 59 "{{individualid}}" "{{diseaseid}}" "00019864" "00139" "00081336" "00139" "00081337" "00139" "00081338" "00139" "00081339" "00139" "00081340" "00139" "00081341" "00139" "00081342" "00139" "00081343" "00139" "00081344" "00139" "00081345" "00139" "00081346" "00139" "00081347" "00139" "00081348" "00139" "00081349" "00139" "00081350" "00139" "00081351" "00139" "00081352" "00139" "00081353" "00139" "00081354" "00139" "00289307" "00198" "00301052" "00198" "00301053" "00198" "00301054" "00198" "00301055" "00198" "00301056" "00198" "00301057" "00198" "00301058" "00198" "00301059" "00198" "00301060" "00198" "00301061" "00198" "00301072" "00198" "00301080" "00139" "00301081" "00139" "00303077" "05521" "00308041" "00198" "00308042" "00198" "00320135" "00198" "00320174" "00198" "00373718" "05735" "00377114" "05735" "00377116" "05735" "00377117" "05735" "00377118" "05735" "00377119" "05735" "00377120" "05735" "00377121" "05735" "00377122" "05735" "00377123" "05735" "00377124" "05735" "00377125" "05735" "00377126" "05735" "00377127" "05735" "00377128" "05735" "00377129" "05735" "00377130" "05735" "00377131" "05735" "00377132" "05735" "00457742" "00198" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00139, 00198, 05521, 05735 ## Count = 59 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000020343" "00139" "00019864" "00006" "Isolated (sporadic)" "" "see paper; ..., severe intellectual disability (HP:0010864)" "" "" "" "" "" "" "" "" "" "" "" "0000060899" "00139" "00081336" "00006" "Isolated (sporadic)" "5y" "see paper; ..., moderate intellectual disability (HP:0002342)" "" "" "" "" "" "" "" "" "" "" "" "0000060900" "00139" "00081337" "00006" "Isolated (sporadic)" "04y11m" "see paper; ..., seizure disorders, minor dysmorphisms, macrocephaly, brain white matter abnormalities, intestinal atresia, ventriculoseptal defect; moderate/severe intellectual disability (HP:0001249); global developmental delay (HP:0001263)" "00y10m" "" "" "" "" "" "" "" "" "" "" "0000060901" "00139" "00081338" "00006" "Isolated (sporadic)" "19y" "see paper; ..., moderate intellectual disability (HP:0002342)" "" "" "" "" "" "" "" "" "" "" "" "0000060902" "00139" "00081339" "00006" "Isolated (sporadic)" "6y" "see paper; ..., mild intellectual disability (HP:0001256)" "" "" "" "" "" "" "" "" "" "" "" "0000060903" "00139" "00081340" "00006" "Isolated (sporadic)" "8y" "see paper; ..., mild intellectual disability (HP:0001256)" "" "" "" "" "" "" "" "" "" "" "" "0000060904" "00139" "00081341" "00006" "Isolated (sporadic)" "6y5m" "see paper; ..., mild intellectual disability (HP:0001256)" "" "" "" "" "" "" "" "" "" "" "" "0000060905" "00139" "00081342" "00006" "Isolated (sporadic)" "34y" "see paper; ..., mild intellectual disability (HP:0001256)" "" "" "" "" "" "" "" "" "" "" "" "0000060906" "00139" "00081343" "00006" "Isolated (sporadic)" "7y" "see paper; ..., moderate/severe intellectual disability (HP:0001249)" "" "" "" "" "" "" "" "" "" "" "" "0000060907" "00139" "00081344" "00006" "Isolated (sporadic)" "6y10m" "see paper; ..., mild intellectual disability (HP:0001256)" "" "" "" "" "" "" "" "" "" "" "" "0000060908" "00139" "00081345" "00006" "Isolated (sporadic)" "21y" "see paper; ..., severe intellectual disability (HP:0010864)" "" "" "" "" "" "" "" "" "" "" "" "0000060909" "00139" "00081346" "00006" "Isolated (sporadic)" "2y9m" "see paper; ..., moderate intellectual disability (HP:0002342)" "" "" "" "" "" "" "" "" "" "" "" "0000060910" "00139" "00081347" "00006" "Isolated (sporadic)" "14y" "see paper; ..., moderate intellectual disability (HP:0002342)" "" "" "" "" "" "" "" "" "" "" "" "0000060911" "00139" "00081348" "00006" "Isolated (sporadic)" "7y" "see paper; ..., severe intellectual disability (HP:0010864)" "" "" "" "" "" "" "" "" "" "" "" "0000060912" "00139" "00081349" "00006" "Isolated (sporadic)" "1y9m" "see paper; ..., severe intellectual disability (HP:0010864)" "" "" "" "" "" "" "" "" "" "" "" "0000060913" "00139" "00081350" "00006" "Isolated (sporadic)" "4y9m" "see paper; ..., moderate intellectual disability (HP:0002342)" "" "" "" "" "" "" "" "" "" "" "" "0000060914" "00139" "00081351" "00006" "Isolated (sporadic)" "4y11m" "see paper; ..., moderate intellectual disability (HP:0002342)" "" "" "" "" "" "" "" "" "" "" "" "0000060915" "00139" "00081352" "00006" "Isolated (sporadic)" "10y5m" "see paper; ..., moderate/severe intellectual disability (HP:0001249)" "" "" "" "" "" "" "" "" "" "" "" "0000060916" "00139" "00081353" "00006" "Isolated (sporadic)" "10y" "see paper; ..., moderate intellectual disability (HP:0002342)" "" "" "" "" "" "" "" "" "" "" "" "0000060917" "00139" "00081354" "00006" "Isolated (sporadic)" "10y" "see paper; ..., severe intellectual disability (HP:0010864)" "" "" "" "" "" "" "" "" "" "" "" "0000222938" "00198" "00289307" "01807" "Unknown" "" "Cognitive impairment (HP:0100543); Intellectual disability (HP:0001249); Encephalitis (HP:0002383); Microcephaly (HP:0000252); Short stature (HP:0004322); Seizures (HP:0001250); Strabismus (HP:0000486)" "" "" "" "" "" "" "" "" "" "" "" "0000228357" "00198" "00301052" "00006" "Familial, autosomal dominant" "29y" "developmental delay/intellectual disability; growth deficiency; Pierre Robin sequence; thrombocytopenia; megakaryocytes in bone marrow; enamel hypoplasia; large, posteriorly rotated ears; curly hair; no renal malformation; congenital heart disease; camptodactyly/clinodactyly; agenesis corpus callosum" "" "00y30m" "" "" "" "" "" "" "ZTTKS" "Braddock–Carey syndrome" "" "0000228358" "00198" "00301053" "00006" "Familial, autosomal dominant" "" "developmental delay/intellectual disability; growth deficiency; Pierre Robin sequence; thrombocytopenia; megakaryocytes in bone marrow; enamel hypoplasia; large, posteriorly rotated ears; curly hair; renal malformation; no congenital heart disease; camptodactyly/clinodactyly; agenesis corpus callosum; 4y6m-sparse hair, broad nasal root, U-shaped vermilion upper lip, thickness lower lip, lack of facial expression" "" "03y06m" "" "" "" "" "" "" "ZTTKS" "Braddock–Carey syndrome" "" "0000228359" "00198" "00301054" "00006" "Familial, autosomal dominant" "13y" "developmental delay/intellectual disability; growth deficiency; no Pierre Robin sequence; ;; no enamel hypoplasia; large, posteriorly rotated ears; curly hair; no renal malformation; congenital heart disease; no camptodactyly/no clinodactyly" "" "" "" "" "" "" "" "" "ZTTKS" "intellectual disability" "" "0000228360" "00198" "00301055" "00006" "Isolated (sporadic)" "6y" "intrauterine growth restriction, placenta previa; birth 32w, C-section for fetal distress; respiratory failure, feeding difficulties; height 2nd percentile, weight 3rd percentile, OFC 2nd percentile; developmental delay; regression; autism spectrum disorder; seizures; hypotonia; frontal bossing, bitemporal narrowing, epicanthal folds, thin lip, smooth philtrum; brain imaging global volume loss, thin corpus callosum, mild periventricular gliosis; congenital atrial septal defect (resolved); exotropia, nystagmus; hearing pressure-equalizing tubes; delayed gastric emptying, feeding difficulties; joint laxity; deep-vein thrombosis" "" "" "" "" "" "" "" "" "ZTTKS" "intellectual disability, congenital malformations, failure to thrive" "" "0000228361" "00198" "00301056" "00006" "Isolated (sporadic)" "23y" "maternal hypertension; birth full term, C-section for fetal distress; feeding difficulties; height 40th percentile, weight 1st percentile, OFC 50th percentile; developmental delay; regression; autism spectrum disorder; seizures; downslanting palpebral fissures, bifid uvula, submucous cleft palate, short philtrum; brain imaging progressive ventricular and subarachnoid space dilatation, arachnoid cyst; progressive vision loss, myopia, exotropia; auditory hallucination; pancreatic lipase insufficiency, dysphagia; scoliosis, arachnodactyly, dolichostenomelia" "" "" "" "" "" "" "" "" "ZTTKS" "intellectual disability, congenital malformations, failure to thrive" "" "0000228362" "00198" "00301057" "00006" "Isolated (sporadic)" "9y" "intrauterine growth restriction; birth full term, wrapped cord, variable heart rate, failure to progress; feeding difficulties, hypoglycemia; height 25th percentile, weight −2.29 (Z score), OFC −4 (Z score); developmental delay; no regression; autism spectrum disorder; no seizures, abnormal EEG; hypotonia, spasticity; downslanting palpebral fissures, downturned mouth, short philtrum, thin lip, thin limbs; brain imaging unremarkable; hearing pressure-equalizing tubes; failure to thrive, chronic diarrhea, feeding difficulties; joint laxity, cervical rib; IgG and IgA deficiency, recurrent infection" "" "" "" "" "" "" "" "" "ZTTKS" "intellectual disability, congenital malformations, failure to thrive" "" "0000228363" "00198" "00301058" "00006" "Isolated (sporadic)" "3y" "intrauterine growth restriction, maternal borderline diabetes, factor V deficiency; birth 33w, C-section for fetal distress; respiratory failure, feeding difficulties; height 75th percentile, weight 85th percentile, OFC 60th percentile; developmental delay; regression; staring spells; hypotonia; submucous and laryngeal cleft, frontal bossing, bitemporal narrowing, epicanthal folds, thin lip, smooth philtrum; brain imaging periventricular leukomalacia with mild dilation of the lateral ventricle; congenital abnormal placement of carotid arteries neck; esotropia, CVI, blue sclera, segmental optic nerve hypoplasia; hearing pressure-equalizing tubes; failure to thrive, G-tube feeding, diarrhea, reflux, gastric dysmotility; joint laxity, cervical ribs, mild syndactyly; IgA deficiency, recurrent infection" "" "" "" "" "" "" "" "" "ZTTKS" "intellectual disability, congenital malformations, failure to thrive" "" "0000228364" "00198" "00301059" "00006" "Isolated (sporadic)" "15y" "maternal hypertension; birth 35w, C-section for maternal hypertension; feeding difficulties, respiratory issues; height 3rd percentile, weight 12th percentile, OFC 72nd percentile; developmental delay; no regression; no hypotonia; downslanting palpebral fissures, laterally flared eyebrows, short philtrum; brain imaging prominent extra-axial spaces, dysgenesis of corpus callosum; congenital single kidney; history of bilateral eye surgery; feeding difficulties; exaggerated lumbar lordosis; borderline IgG levels" "" "" "" "" "" "" "" "" "ZTTKS" "intellectual disability, congenital malformations, failure to thrive" "" "0000228365" "00198" "00301060" "00006" "Isolated (sporadic)" "9y" "intrauterine growth restriction, oligohydramnios, pre-eclampsia, fetal anomalies; birth 36w, vaginal delivery; feeding difficulties, respiratory issues; height −3 (Z score), weight 2nd percentile, OFC 12th percentile; developmental delay; no regression; no autism spectrum disorder; no seizures, abnormal EEG; hypotonia; downslanting palpebral fissures, long face, full cheeks, short philtrum, thin lips; brain imaging evidence of prior MCA stroke, prominent ventricles; congenital dysplastic kidney, congenital lobar emphysema; strabismus; inconclusive hearing assessment; dysphagia, G-tube feeding; no musculo-skeletal features; prior middle cerebral artery infarct, multiple transient ischemic attacks" "" "" "" "" "" "" "" "" "ZTTKS" "intellectual disability, congenital malformations, failure to thrive" "" "0000228366" "00198" "00301061" "00006" "Isolated (sporadic)" "3y" "intrauterine growth restriction, fetal anomalies; birth 36w, C-section for fetal distress; respiratory distress, feeding difficulties; height 1st percentile, weight −3 (Z score), OFC −2.5 (Z score); developmental delay; no regression; no autism spectrum disorder; no seizures; hypotonia; downslanting palpebral fissures, epicanthal folds, smooth philtrum, thin lips; congenital ventricular septal defect, patent ductus arteriosus, agenesis of the left lung, gallbladder agenesis; no concerns; normal hearing; failure to thrive, G-tube recommended; hemivertebrae, rib fusion, thumb agenesis, syndactyly" "" "" "" "" "" "" "" "" "ZTTKS" "intellectual disability, congenital malformations, failure to thrive" "" "0000228377" "00198" "00301072" "00006" "Isolated (sporadic)" "" "see paper; ...,no thrombocytopenia; no agenesis corpus callosum; developmental delay; no growth deficiency; no microcephaly; micrognathia, Pierre Robin Sequence; no enamel hypoplasia; no ear abnormality; congenital heart disease" "" "" "" "" "" "" "" "" "" "" "" "0000228385" "00139" "00301080" "00006" "Isolated (sporadic)" "15y" "see paper; ..., moderate intellectual disability, multiple congenital anomalies, skin and nails abnormalities" "" "" "" "" "" "" "" "" "ZTTKS" "" "" "0000228386" "00139" "00301081" "00006" "Isolated (sporadic)" "13y02m" "see paper; ..., born small for gestational age, poor academic performance, delayed language development, motor retardation" "" "" "growth retardation" "" "" "" "" "" "ZTTKS" "" "" "0000230160" "05521" "00303077" "00006" "Isolated (sporadic)" "" "Unclassified epilepsy; age onset infantile" "" "" "" "" "" "" "" "" "" "seizures" "" "0000233467" "00198" "00308041" "00006" "Isolated (sporadic)" "" "severe global developmental delay, cardiac abnormalities, muscular hypotonia, facial dysmorphism" "" "" "" "" "" "" "" "" "ZTTKS" "developmental delay" "" "0000233468" "00198" "00308042" "00006" "Isolated (sporadic)" "" "severe global developmental delay, cardiac abnormalities, epilepsy, renal cyst" "" "" "" "" "" "" "" "" "ZTTKS" "developmental delay" "" "0000242181" "00198" "00320135" "01807" "Unknown" "" "Microcephaly (HP:0000252); Strabismus (HP:0000486); Delayed speech and language development (HP:0000750); Nail dysplasia (HP:0002164); Short stature (HP:0004322); Sleep-wake cycle disturbance (HP:0006979)" "" "" "" "" "" "" "" "" "" "" "" "0000242220" "00198" "00320174" "01807" "Unknown" "" "Muscular hypotonia (HP:0001252); Global developmental delay (HP:0001263); Partial agenesis of the corpus callosum (HP:0001338); Persistent left superior vena cava (HP:0005301)" "" "" "" "" "" "" "" "" "" "" "" "0000268943" "05735" "00373718" "01864" "Familial, autosomal dominant" "" "HP:0004322; HP:0004325; HP:0001249" "" "" "" "" "" "" "" "" "ZTTK syndrome (OMIM 617140)" "" "" "0000341932" "05735" "00377114" "00006" "Isolated (sporadic)" "" "see paper; ... (very detailed phenotype descriptions)" "" "" "" "" "" "" "" "" "ZTTKS" "intellectual disability syndrome" "" "0000341933" "05735" "00377116" "00006" "Isolated (sporadic)" "" "see paper; ... (very detailed phenotype descriptions)" "" "" "" "" "" "" "" "" "ZTTKS" "intellectual disability syndrome" "" "0000341934" "05735" "00377117" "00006" "Isolated (sporadic)" "" "see paper; ... (very detailed phenotype descriptions)" "" "" "" "" "" "" "" "" "ZTTKS" "intellectual disability syndrome" "" "0000341935" "05735" "00377118" "00006" "Isolated (sporadic)" "" "see paper; ... (very detailed phenotype descriptions)" "" "" "" "" "" "" "" "" "ZTTKS" "intellectual disability syndrome" "" "0000341936" "05735" "00377119" "00006" "Isolated (sporadic)" "" "see paper; ... (very detailed phenotype descriptions)" "" "" "" "" "" "" "" "" "ZTTKS" "intellectual disability syndrome" "" "0000341937" "05735" "00377120" "00006" "Isolated (sporadic)" "" "see paper; ... (very detailed phenotype descriptions)" "" "" "" "" "" "" "" "" "ZTTKS" "intellectual disability syndrome" "" "0000341938" "05735" "00377121" "00006" "Isolated (sporadic)" "" "see paper; ... (very detailed phenotype descriptions)" "" "" "" "" "" "" "" "" "ZTTKS" "intellectual disability syndrome" "" "0000341939" "05735" "00377122" "00006" "Isolated (sporadic)" "" "see paper; ... (very detailed phenotype descriptions)" "" "" "" "" "" "" "" "" "ZTTKS" "intellectual disability syndrome" "" "0000341940" "05735" "00377123" "00006" "Isolated (sporadic)" "" "see paper; ... (very detailed phenotype descriptions)" "" "" "" "" "" "" "" "" "ZTTKS" "intellectual disability syndrome" "" "0000341941" "05735" "00377124" "00006" "Isolated (sporadic)" "" "see paper; ... (very detailed phenotype descriptions)" "" "" "" "" "" "" "" "" "ZTTKS" "intellectual disability syndrome" "" "0000341942" "05735" "00377125" "00006" "Isolated (sporadic)" "" "see paper; ... (very detailed phenotype descriptions)" "" "" "" "" "" "" "" "" "ZTTKS" "intellectual disability syndrome" "" "0000341943" "05735" "00377126" "00006" "Isolated (sporadic)" "" "see paper; ... (very detailed phenotype descriptions)" "" "" "" "" "" "" "" "" "ZTTKS" "intellectual disability syndrome" "" "0000341944" "05735" "00377127" "00006" "Isolated (sporadic)" "" "see paper; ... (very detailed phenotype descriptions)" "" "" "" "" "" "" "" "" "ZTTKS" "intellectual disability syndrome" "" "0000341945" "05735" "00377128" "00006" "Isolated (sporadic)" "" "see paper; ... (very detailed phenotype descriptions)" "" "" "" "" "" "" "" "" "ZTTKS" "intellectual disability syndrome" "" "0000341946" "05735" "00377129" "00006" "Isolated (sporadic)" "" "see paper; ... (very detailed phenotype descriptions)" "" "" "" "" "" "" "" "" "ZTTKS" "intellectual disability syndrome" "" "0000341947" "05735" "00377130" "00006" "Isolated (sporadic)" "" "see paper; ... (very detailed phenotype descriptions)" "" "" "" "" "" "" "" "" "ZTTKS" "intellectual disability syndrome" "" "0000341948" "05735" "00377131" "00006" "Isolated (sporadic)" "" "see paper; ... (very detailed phenotype descriptions)" "" "" "" "" "" "" "" "" "ZTTKS" "intellectual disability syndrome" "" "0000341949" "05735" "00377132" "00006" "Isolated (sporadic)" "" "see paper; ... (very detailed phenotype descriptions)" "" "" "" "" "" "" "" "" "ZTTKS" "intellectual disability syndrome" "" "0000346191" "00198" "00457742" "03544" "Isolated (sporadic)" "" "HP:0001508, HP:0001263, HP:0001627" "" "" "" "" "" "" "" "" "ZTTKS" "" "" ## Screenings ## Do not remove or alter this header ## ## Count = 59 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000019855" "00019864" "1" "00705" "00705" "2014-09-08 11:27:20" "00006" "2016-10-07 11:46:11" "SEQ;SEQ-NG" "DNA" "" "" "0000081449" "00081336" "1" "00006" "00006" "2016-10-07 11:38:55" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000081450" "00081337" "1" "00006" "00006" "2016-10-07 11:38:55" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000081451" "00081338" "1" "00006" "00006" "2016-10-07 11:38:55" "" "" "SEQ" "DNA" "" "" "0000081452" "00081339" "1" "00006" "00006" "2016-10-07 11:38:55" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000081453" "00081340" "1" "00006" "00006" "2016-10-07 11:38:55" "" "" "SEQ" "DNA" "" "" "0000081454" "00081341" "1" "00006" "00006" "2016-10-07 11:38:55" "" "" "SEQ" "DNA" "" "" "0000081455" "00081342" "1" "00006" "00006" "2016-10-07 11:38:55" "" "" "SEQ" "DNA" "" "" "0000081456" "00081343" "1" "00006" "00006" "2016-10-07 11:38:55" "" "" "SEQ" "DNA" "" "" "0000081457" "00081344" "1" "00006" "00006" "2016-10-07 11:38:55" "" "" "SEQ" "DNA" "" "" "0000081458" "00081345" "1" "00006" "00006" "2016-10-07 11:38:55" "" "" "SEQ" "DNA" "" "" "0000081459" "00081346" "1" "00006" "00006" "2016-10-07 11:38:55" "" "" "SEQ" "DNA" "" "" "0000081460" "00081347" "1" "00006" "00006" "2016-10-07 11:38:55" "" "" "SEQ" "DNA" "" "" "0000081461" "00081348" "1" "00006" "00006" "2016-10-07 11:38:55" "" "" "SEQ" "DNA" "" "" "0000081462" "00081349" "1" "00006" "00006" "2016-10-07 11:38:55" "" "" "SEQ" "DNA" "" "" "0000081463" "00081350" "1" "00006" "00006" "2016-10-07 11:38:55" "" "" "SEQ" "DNA" "" "" "0000081464" "00081351" "1" "00006" "00006" "2016-10-07 11:38:55" "" "" "SEQ" "DNA" "" "" "0000081465" "00081352" "1" "00006" "00006" "2016-10-07 11:38:55" "" "" "SEQ" "DNA" "" "" "0000081466" "00081353" "1" "00006" "00006" "2016-10-07 11:38:55" "" "" "SEQ" "DNA" "" "" "0000081467" "00081354" "1" "00006" "00006" "2016-10-07 11:38:55" "" "" "SEQ" "DNA" "" "" "0000290477" "00289307" "1" "01807" "01807" "2020-03-02 12:47:11" "" "" "SEQ" "DNA" "" "" "0000302174" "00301052" "1" "00006" "00006" "2020-05-06 16:03:30" "00006" "2020-05-06 16:07:53" "arraySNP" "DNA" "" "Affymetrix SNP 6.0" "0000302175" "00301053" "1" "00006" "00006" "2020-05-06 16:12:34" "" "" "arraySNP" "DNA" "" "Affymetrix MIP Microarray" "0000302176" "00301054" "1" "00006" "00006" "2020-05-06 16:19:16" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000302177" "00301055" "1" "00006" "00006" "2020-05-06 16:54:09" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000302178" "00301056" "1" "00006" "00006" "2020-05-06 16:54:09" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000302179" "00301057" "1" "00006" "00006" "2020-05-06 16:54:09" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000302180" "00301058" "1" "00006" "00006" "2020-05-06 16:54:09" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000302181" "00301059" "1" "00006" "00006" "2020-05-06 16:54:09" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000302182" "00301060" "1" "00006" "00006" "2020-05-06 16:54:09" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000302183" "00301061" "1" "00006" "00006" "2020-05-06 16:54:09" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000302194" "00301072" "1" "00006" "00006" "2020-05-06 17:20:53" "00006" "2020-05-06 18:58:39" "arraySNP" "DNA" "" "Affymetrix Cytogenetics Whole‐Genome 2.7M array" "0000302202" "00301080" "1" "00006" "00006" "2020-05-07 09:07:36" "" "" "SEQ;SEQ-NG" "DNA" "" "1572 gene disease gene panel" "0000302203" "00301081" "1" "00006" "00006" "2020-05-07 09:14:14" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000304202" "00303077" "1" "00006" "00006" "2020-06-05 14:49:11" "" "" "SEQ-NG" "DNA" "" "WES" "0000309185" "00308041" "1" "00006" "00006" "2020-08-25 19:47:51" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000309186" "00308042" "1" "00006" "00006" "2020-08-25 19:47:51" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000321320" "00320135" "1" "01807" "01807" "2020-11-23 17:34:09" "" "" "SEQ" "DNA" "" "" "0000321359" "00320174" "1" "01807" "01807" "2020-11-23 17:47:01" "" "" "SEQ" "DNA" "" "" "0000374951" "00373718" "1" "01864" "01864" "2021-05-19 06:35:58" "" "" "SEQ-NG" "DNA" "blood" "WGS" "0000378319" "00377114" "1" "03760" "03760" "2021-07-05 16:58:19" "" "" "SEQ-NG" "DNA" "" "" "0000378321" "00377116" "1" "03760" "03760" "2021-07-05 17:01:26" "" "" "SEQ-NG" "DNA" "" "" "0000378322" "00377117" "1" "03760" "03760" "2021-07-05 17:05:13" "" "" "SEQ-NG" "DNA" "" "" "0000378323" "00377118" "1" "03760" "03760" "2021-07-05 17:07:37" "" "" "SEQ-NG" "DNA" "" "" "0000378324" "00377119" "1" "03760" "03760" "2021-07-06 08:47:07" "" "" "SEQ-NG" "DNA" "" "" "0000378325" "00377120" "1" "03760" "03760" "2021-07-06 08:48:51" "" "" "SEQ-NG" "DNA" "" "" "0000378326" "00377121" "1" "03760" "03760" "2021-07-06 08:49:57" "" "" "SEQ-NG" "DNA" "" "" "0000378327" "00377122" "1" "03760" "03760" "2021-07-06 08:54:51" "" "" "SEQ-NG" "DNA" "" "" "0000378328" "00377123" "1" "03760" "03760" "2021-07-06 08:55:53" "" "" "SEQ-NG" "DNA" "" "" "0000378329" "00377124" "1" "03760" "03760" "2021-07-06 08:58:37" "" "" "SEQ-NG" "DNA" "" "" "0000378330" "00377125" "1" "03760" "03760" "2021-07-06 09:01:17" "" "" "SEQ-NG" "DNA" "" "" "0000378331" "00377126" "1" "03760" "03760" "2021-07-06 09:02:32" "" "" "SEQ-NG" "DNA" "" "" "0000378332" "00377127" "1" "03760" "03760" "2021-07-06 09:03:49" "" "" "SEQ-NG" "DNA" "" "" "0000378333" "00377128" "1" "03760" "03760" "2021-07-06 09:04:45" "" "" "SEQ-NG" "DNA" "" "" "0000378334" "00377129" "1" "03760" "03760" "2021-07-06 09:05:40" "" "" "SEQ-NG" "DNA" "" "" "0000378335" "00377130" "1" "03760" "03760" "2021-07-06 09:06:34" "" "" "SEQ-NG" "DNA" "" "" "0000378336" "00377131" "1" "03760" "03760" "2021-07-06 09:07:29" "" "" "SEQ-NG" "DNA" "" "" "0000378337" "00377132" "1" "03760" "03760" "2021-07-06 09:08:18" "" "" "SEQ-NG" "DNA" "" "" "0000459362" "00457742" "1" "03544" "03544" "2024-11-18 07:39:20" "" "" "SEQ-NG-I" "DNA" "peripheral blood" "WES" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 40 "{{screeningid}}" "{{geneid}}" "0000019855" "SON" "0000081449" "SON" "0000081450" "SON" "0000081451" "SON" "0000081452" "SON" "0000081453" "SON" "0000081454" "SON" "0000081455" "SON" "0000081456" "SON" "0000081457" "SON" "0000081458" "SON" "0000081459" "SON" "0000081460" "SON" "0000081461" "SON" "0000081462" "SON" "0000081463" "SON" "0000081464" "SON" "0000081465" "SON" "0000081466" "SON" "0000081467" "SON" "0000302174" "RUNX1" "0000302174" "SON" "0000302175" "RUNX1" "0000302175" "SON" "0000302176" "SON" "0000302177" "SON" "0000302178" "SON" "0000302179" "SON" "0000302180" "SON" "0000302181" "SON" "0000302182" "SON" "0000302183" "SON" "0000302194" "RUNX1" "0000302202" "SON" "0000302203" "SON" "0000304202" "SON" "0000309185" "SON" "0000309186" "SON" "0000374951" "SON" "0000378322" "ZAN" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 217 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000040318" "0" "90" "21" "34923418" "34923419" "del" "0" "00705" "SON_000001" "g.34923418_34923419del" "" "{PMID:Gilissen 2014:24896178}, {PMID:Kim 2016:27545680}, {DOI:Kim 2016:10.1016/j.ajhg.2016.06.029}" "" "" "" "De novo" "-" "" "0" "" "" "g.33551112_33551113del" "" "pathogenic" "" "0000130587" "0" "90" "21" "34927086" "34927087" "del" "0" "00006" "SON_000002" "g.34927086_34927087del" "" "{PMID:Kim 2016:27545680}, {DOI:Kim 2016:10.1016/j.ajhg.2016.06.029}" "" "" "reduced mRNA expression (NMD)" "De novo" "-" "" "0" "" "" "g.33554780_33554781del" "" "pathogenic" "" "0000130588" "0" "90" "21" "34927290" "34927293" "del" "0" "00006" "SON_000003" "g.34927290_34927293del" "" "{PMID:Zhu 2015:25590979}, {DOI:Zhu 2015:10.1038/gim.2014.191}, {PMID:Kim 2016:27545680}, {DOI:Kim 2016:10.1016/j.ajhg.2016.06.029}" "" "" "reduced mRNA expression (NMD)" "De novo" "-" "" "0" "" "" "g.33554984_33554987del" "" "pathogenic (dominant)" "" "0000130589" "0" "90" "21" "34925389" "34925393" "del" "0" "00006" "SON_000004" "g.34925389_34925393del" "" "{PMID:Kim 2016:27545680}, {DOI:Kim 2016:10.1016/j.ajhg.2016.06.029}" "" "" "" "De novo" "-" "" "0" "" "" "g.33553083_33553087del" "" "pathogenic" "" "0000130590" "0" "90" "21" "34927290" "34927293" "del" "0" "00006" "SON_000003" "g.34927290_34927293del" "" "{PMID:Kim 2016:27545680}, {DOI:Kim 2016:10.1016/j.ajhg.2016.06.029}" "" "" "reduced mRNA expression (NMD)" "De novo" "-" "" "0" "" "" "g.33554984_33554987del" "" "pathogenic" "" "0000130591" "0" "50" "21" "34926536" "34926550" "del" "0" "00006" "SON_000005" "g.34926536_34926550del" "" "{PMID:Kim 2016:27545680}, {DOI:Kim 2016:10.1016/j.ajhg.2016.06.029}" "" "" "" "De novo" "-" "" "0" "" "" "g.33554230_33554244del" "" "VUS" "" "0000130592" "0" "90" "21" "34927539" "34927540" "ins" "0" "00006" "SON_000006" "g.34927539_34927540insCC" "" "{PMID:Kim 2016:27545680}, {DOI:Kim 2016:10.1016/j.ajhg.2016.06.029}" "" "" "" "De novo" "-" "" "0" "" "" "g.33555233_33555234insCC" "" "pathogenic" "" "0000130593" "0" "90" "21" "34925895" "34925896" "del" "0" "00006" "SON_000007" "g.34925895_34925896del" "" "{PMID:Kim 2016:27545680}, {DOI:Kim 2016:10.1016/j.ajhg.2016.06.029}" "" "" "" "De novo" "-" "" "0" "" "" "g.33553589_33553590del" "" "pathogenic" "" "0000130594" "0" "90" "21" "34926177" "34926177" "del" "0" "00006" "SON_000008" "g.34926177del" "" "{PMID:Kim 2016:27545680}, {DOI:Kim 2016:10.1016/j.ajhg.2016.06.029}" "" "" "" "De novo" "-" "" "0" "" "" "g.33553871del" "" "pathogenic" "" "0000130595" "0" "90" "21" "34927624" "34927624" "del" "0" "00006" "SON_000009" "g.34927624del" "" "{PMID:Kim 2016:27545680}, {DOI:Kim 2016:10.1016/j.ajhg.2016.06.029}" "" "" "" "De novo" "-" "" "0" "" "" "g.33555318del" "" "pathogenic" "" "0000130596" "0" "90" "21" "34925134" "34925135" "dup" "0" "00006" "SON_000010" "g.34925134_34925135dup" "" "{PMID:Kim 2016:27545680}, {DOI:Kim 2016:10.1016/j.ajhg.2016.06.029}" "" "" "" "De novo" "-" "" "0" "" "" "g.33552828_33552829dup" "" "pathogenic" "" "0000130597" "0" "90" "21" "34925688" "34925711" "del" "0" "00006" "SON_000011" "g.34925688_34925711del" "" "{PMID:Kim 2016:27545680}, {DOI:Kim 2016:10.1016/j.ajhg.2016.06.029}" "" "" "variant not in father/twin sister" "Unknown" "-" "" "0" "" "" "g.33553382_33553405del" "" "pathogenic" "" "0000130598" "0" "90" "21" "34923902" "34923902" "del" "0" "00006" "SON_000012" "g.34923902del" "" "{PMID:Kim 2016:27545680}, {DOI:Kim 2016:10.1016/j.ajhg.2016.06.029}" "" "" "" "De novo" "-" "" "0" "" "" "g.33551596del" "" "pathogenic" "" "0000130599" "0" "90" "21" "34924871" "34924871" "subst" "0" "00006" "SON_000013" "g.34924871C>T" "" "{PMID:Kim 2016:27545680}, {DOI:Kim 2016:10.1016/j.ajhg.2016.06.029}" "" "" "" "De novo" "-" "" "0" "" "" "g.33552565C>T" "" "pathogenic" "" "0000130600" "0" "90" "21" "34921805" "34921805" "del" "0" "00006" "SON_000014" "g.34921805del" "" "{PMID:Kim 2016:27545680}, {DOI:Kim 2016:10.1016/j.ajhg.2016.06.029}" "" "" "" "De novo" "-" "" "0" "" "" "g.33549499del" "" "pathogenic" "" "0000130601" "0" "90" "21" "34925592" "34925592" "del" "0" "00006" "SON_000015" "g.34925592del" "" "{PMID:Kim 2016:27545680}, {DOI:Kim 2016:10.1016/j.ajhg.2016.06.029}" "" "" "" "De novo" "-" "" "0" "" "" "g.33553286del" "" "pathogenic" "" "0000130602" "0" "90" "21" "34926086" "34926086" "dup" "0" "00006" "SON_000016" "g.34926086dup" "" "{PMID:Kim 2016:27545680}, {DOI:Kim 2016:10.1016/j.ajhg.2016.06.029}" "" "" "" "De novo" "-" "" "0" "" "" "g.33553780dup" "" "pathogenic" "" "0000130603" "0" "90" "21" "34927290" "34927293" "del" "0" "00006" "SON_000003" "g.34927290_34927293del" "" "{PMID:Kim 2016:27545680}, {DOI:Kim 2016:10.1016/j.ajhg.2016.06.029}" "" "" "" "De novo" "-" "" "0" "" "" "g.33554984_33554987del" "" "pathogenic" "" "0000130604" "0" "90" "21" "34927290" "34927293" "del" "0" "00006" "SON_000003" "g.34927290_34927293del" "" "{PMID:Kim 2016:27545680}, {DOI:Kim 2016:10.1016/j.ajhg.2016.06.029}" "" "" "" "De novo" "-" "" "0" "" "" "g.33554984_33554987del" "" "pathogenic" "" "0000130605" "0" "90" "21" "34877993" "34894566" "del" "0" "00006" "SON_000017" "g.(34877993_34894566)_(35278567_3559909)del" "" "{PMID:Kim 2016:27545680}, {DOI:Kim 2016:10.1016/j.ajhg.2016.06.029}" "" "" "deletion includes GART, SON, DONSON, CRYZL1 and ITSN1" "De novo" "" "" "0" "" "21q22.11q22.11(34894566-3527867)x1 dn" "" "" "pathogenic (dominant)" "" "0000130606" "0" "90" "21" "34926568" "34926569" "ins" "0" "00006" "SON_000018" "g.34926568_34926569insAA" "" "{PMID:Kim 2016:27545680}, {DOI:Kim 2016:10.1016/j.ajhg.2016.06.029}" "" "" "" "De novo" "-" "" "0" "" "" "g.33554262_33554263insAA" "" "pathogenic" "" "0000298433" "0" "90" "21" "34927290" "34927293" "del" "0" "02325" "SON_000025" "g.34927290_34927293del" "" "" "" "SON(NM_138927.2):c.5753_5756delTTAG (p.V1918Efs*87), SON(NM_138927.4):c.5753_5756delTTAG (p.V1918Efs*87)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.33554984_33554987del" "" "pathogenic" "" "0000299625" "0" "50" "21" "34922205" "34922205" "subst" "4.06213E-6" "02329" "SON_000019" "g.34922205C>T" "" "" "" "SON(NM_138927.4):c.668C>T (p.S223L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.33549899C>T" "" "VUS" "" "0000302383" "0" "30" "21" "34923207" "34923207" "subst" "0.00183989" "02326" "SON_000020" "g.34923207C>T" "" "" "" "SON(NM_138927.2):c.1670C>T (p.A557V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.33550901C>T" "" "likely benign" "" "0000302384" "0" "30" "21" "34926130" "34926130" "subst" "0.000756153" "02326" "SON_000024" "g.34926130T>C" "" "" "" "SON(NM_138927.2):c.4593T>C (p.N1531=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.33553824T>C" "" "likely benign" "" "0000328648" "0" "90" "21" "34924300" "34924300" "subst" "0" "01804" "SON_000021" "g.34924300C>A" "" "" "" "SON(NM_138927.1):c.2763C>A (p.(Tyr921Ter))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.33551994C>A" "" "pathogenic" "" "0000342121" "0" "30" "21" "34927047" "34927047" "subst" "0.000147278" "02327" "SON_000027" "g.34927047G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.33554741G>A" "" "likely benign" "" "0000570547" "0" "30" "21" "34922144" "34922144" "subst" "6.49862E-5" "02325" "SON_000028" "g.34922144G>C" "" "" "" "SON(NM_138927.4):c.607G>C (p.E203Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.33549838G>C" "" "likely benign" "" "0000570549" "0" "30" "21" "34922935" "34922935" "subst" "3.25039E-5" "02326" "SON_000030" "g.34922935A>T" "" "" "" "SON(NM_138927.2):c.1398A>T (p.P466=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.33550629A>T" "" "likely benign" "" "0000570550" "0" "30" "21" "34923329" "34923329" "subst" "0" "01804" "SON_000031" "g.34923329G>A" "" "" "" "SON(NM_032195.1):c.1792G>A (p.(Gly598Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.33551023G>A" "" "likely benign" "" "0000570551" "0" "30" "21" "34923330" "34923330" "subst" "4.1309E-6" "01804" "SON_000032" "g.34923330G>A" "" "" "" "SON(NM_032195.1):c.1793G>A (p.(Gly598Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.33551024G>A" "" "likely benign" "" "0000570552" "0" "30" "21" "34923617" "34923617" "subst" "0.00337522" "02326" "SON_000033" "g.34923617A>G" "" "" "" "SON(NM_138927.2):c.2080A>G (p.T694A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.33551311A>G" "" "likely benign" "" "0000570553" "0" "50" "21" "34923773" "34923773" "subst" "4.06091E-6" "02325" "SON_000034" "g.34923773C>A" "" "" "" "SON(NM_032195.3):c.2236C>A (p.L746I), SON(NM_138927.2):c.2236C>A (p.L746I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.33551467C>A" "" "VUS" "" "0000570554" "0" "30" "21" "34923773" "34923773" "subst" "4.06091E-6" "02326" "SON_000034" "g.34923773C>A" "" "" "" "SON(NM_032195.3):c.2236C>A (p.L746I), SON(NM_138927.2):c.2236C>A (p.L746I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.33551467C>A" "" "likely benign" "" "0000570555" "0" "30" "21" "34923959" "34923959" "subst" "0.000191507" "02325" "SON_000035" "g.34923959A>G" "" "" "" "SON(NM_138927.4):c.2422A>G (p.T808A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.33551653A>G" "" "likely benign" "" "0000570556" "0" "30" "21" "34924576" "34924576" "subst" "0.000292367" "02326" "SON_000036" "g.34924576C>T" "" "" "" "SON(NM_138927.2):c.3039C>T (p.Y1013=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.33552270C>T" "" "likely benign" "" "0000570557" "0" "50" "21" "34924772" "34924772" "subst" "0" "01804" "SON_000037" "g.34924772G>T" "" "" "" "SON(NM_032195.1):c.3235G>T (p.(Ala1079Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.33552466G>T" "" "VUS" "" "0000570558" "0" "30" "21" "34924863" "34924863" "subst" "0.00163685" "02326" "SON_000038" "g.34924863C>T" "" "" "" "SON(NM_032195.3):c.3326C>T (p.A1109V), SON(NM_138927.2):c.3326C>T (p.A1109V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.33552557C>T" "" "likely benign" "" "0000570559" "0" "30" "21" "34925225" "34925278" "dup" "0" "02326" "SON_000039" "g.34925225_34925278dup" "" "" "" "SON(NM_032195.3):c.3688_3741dup (p.Y1230_T1247dup), SON(NM_138927.2):c.3688_3741dup (p.Y1230_T1247dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.33552919_33552972dup" "" "likely benign" "" "0000570560" "0" "30" "21" "34925263" "34925263" "subst" "0.000901537" "02326" "SON_000040" "g.34925263A>G" "" "" "" "SON(NM_138927.2):c.3726A>G (p.S1242=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.33552957A>G" "" "likely benign" "" "0000570562" "0" "30" "21" "34926000" "34926000" "subst" "0.00218692" "01804" "SON_000042" "g.34926000A>G" "" "" "" "SON(NM_032195.1):c.4463A>G (p.(Asn1488Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.33553694A>G" "" "likely benign" "" "0000570564" "0" "90" "21" "34927290" "34927293" "del" "0" "01943" "SON_000003" "g.34927290_34927293del" "" "" "" "SON(NM_138927.2):c.5753_5756delTTAG (p.V1918Efs*87), SON(NM_138927.4):c.5753_5756delTTAG (p.V1918Efs*87)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.33554984_33554987del" "" "pathogenic" "" "0000570565" "0" "30" "21" "34927291" "34927291" "subst" "0.00291253" "02326" "SON_000044" "g.34927291T>C" "" "" "" "SON(NM_138927.2):c.5754T>C (p.V1918=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.33554985T>C" "" "likely benign" "" "0000570567" "0" "50" "21" "34927468" "34927488" "del" "0" "01804" "SON_000045" "g.34927468_34927488del" "" "" "" "SON(NM_001291411.1):c.5931_5951del (p.(Ser1992_Arg1998del)), SON(NM_138927.4):c.5931_5951delCAGCCGCACCCCCAGCCGCCG (p.S1992_R1998del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.33555162_33555182del" "" "VUS" "" "0000570568" "0" "30" "21" "34927468" "34927488" "del" "0" "02325" "SON_000045" "g.34927468_34927488del" "" "" "" "SON(NM_001291411.1):c.5931_5951del (p.(Ser1992_Arg1998del)), SON(NM_138927.4):c.5931_5951delCAGCCGCACCCCCAGCCGCCG (p.S1992_R1998del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.33555162_33555182del" "" "likely benign" "" "0000570570" "0" "30" "21" "34927501" "34927501" "subst" "0.000111571" "02326" "SON_000047" "g.34927501T>C" "" "" "" "SON(NM_138927.2):c.5964T>C (p.P1988=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.33555195T>C" "" "likely benign" "" "0000570572" "0" "30" "21" "34939585" "34939585" "subst" "0.00188427" "02326" "DONSON_000025" "g.34939585T>G" "" "" "" "SON(NM_138927.2):c.6768+12T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.33567279T>G" "" "likely benign" "" "0000570573" "0" "30" "21" "34945779" "34945779" "subst" "0.000453028" "02326" "DONSON_000026" "g.34945779G>A" "" "" "" "SON(NM_138927.2):c.7033+18G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.33573473G>A" "" "likely benign" "" "0000570574" "0" "30" "21" "34947942" "34947942" "subst" "0.00148837" "02326" "DONSON_000027" "g.34947942G>A" "" "" "" "SON(NM_138927.2):c.7074G>A (p.G2358=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.33575636G>A" "" "likely benign" "" "0000570575" "0" "30" "21" "34948068" "34948068" "subst" "0.00280126" "02326" "DONSON_000028" "g.34948068T>C" "" "" "" "SON(NM_138927.2):c.7106-16T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.33575762T>C" "" "likely benign" "" "0000570576" "0" "10" "21" "34948697" "34948697" "del" "0.999498" "01943" "DONSON_000029" "g.34948697del" "" "" "" "SON(NM_138927.2):c.7248delA (p.R2416Sfs*8)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.33576391del" "" "benign" "" "0000570577" "0" "50" "21" "34950681" "34950681" "subst" "2.84306E-5" "01804" "DONSON_000030" "g.34950681G>A" "" "" "" "DONSON(NM_017613.3):c.1633C>T (p.(Pro545Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.33578375G>A" "" "VUS" "" "0000570578" "0" "30" "21" "34950728" "34950728" "subst" "0.00291057" "01804" "DONSON_000031" "g.34950728G>A" "" "" "" "DONSON(NM_017613.3):c.1586C>T (p.(Thr529Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.33578422G>A" "" "likely benign" "" "0000570580" "0" "30" "21" "34960634" "34960634" "subst" "0.0230091" "01804" "CRYZL1_000002" "g.34960634G>C" "" "" "" "DONSON(NM_017613.3):c.314C>G (p.(Pro105Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.33588328G>C" "" "likely benign" "" "0000618329" "0" "30" "21" "34924549" "34924549" "subst" "0.000982661" "01943" "SON_000049" "g.34924549T>C" "" "" "" "SON(NM_138927.2):c.3012T>C (p.A1004=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.33552243T>C" "" "likely benign" "" "0000618330" "0" "30" "21" "34924549" "34924549" "subst" "0.000982661" "02326" "SON_000049" "g.34924549T>C" "" "" "" "SON(NM_138927.2):c.3012T>C (p.A1004=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.33552243T>C" "" "likely benign" "" "0000618331" "0" "30" "21" "34925936" "34925936" "subst" "0.000987051" "01943" "SON_000050" "g.34925936A>G" "" "" "" "SON(NM_138927.2):c.4399A>G (p.I1467V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.33553630A>G" "" "likely benign" "" "0000618332" "0" "30" "21" "34925936" "34925936" "subst" "0.000987051" "02326" "SON_000050" "g.34925936A>G" "" "" "" "SON(NM_138927.2):c.4399A>G (p.I1467V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.33553630A>G" "" "likely benign" "" "0000618333" "0" "30" "21" "34926388" "34926388" "subst" "0.000983029" "01943" "SON_000051" "g.34926388A>G" "" "" "" "SON(NM_138927.2):c.4851A>G (p.A1617=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.33554082A>G" "" "likely benign" "" "0000618334" "0" "30" "21" "34926388" "34926388" "subst" "0.000983029" "02326" "SON_000051" "g.34926388A>G" "" "" "" "SON(NM_138927.2):c.4851A>G (p.A1617=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.33554082A>G" "" "likely benign" "" "0000618336" "0" "30" "21" "34927291" "34927291" "subst" "0.00291253" "01943" "SON_000044" "g.34927291T>C" "" "" "" "SON(NM_138927.2):c.5754T>C (p.V1918=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.33554985T>C" "" "likely benign" "" "0000618337" "0" "30" "21" "34931565" "34931565" "subst" "8.47558E-6" "01804" "SON_000054" "g.34931565A>T" "" "" "" "SON(NM_032195.1):c.6351A>T (p.(Glu2117Asp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.33559259A>T" "" "likely benign" "" "0000618338" "0" "30" "21" "34948130" "34948130" "subst" "0.00218154" "02326" "DONSON_000032" "g.34948130G>A" "" "" "" "SON(NM_138927.2):c.7152G>A (p.R2384=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.33575824G>A" "" "likely benign" "" "0000624205" "0" "30" "21" "34923201" "34923201" "subst" "0.00203252" "02326" "SON_000048" "g.34923201C>T" "" "" "" "SON(NM_032195.3):c.1664C>T (p.T555M), SON(NM_138927.2):c.1664C>T (p.T555M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.33550895C>T" "" "likely benign" "" "0000624206" "0" "90" "21" "34927547" "34927547" "del" "0" "02325" "SON_000053" "g.34927547del" "" "" "" "SON(NM_138927.4):c.6010delG (p.V2004Wfs*2)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.33555241del" "" "pathogenic" "" "0000647149" "0" "90" "21" "34926529" "34926532" "dup" "0" "01807" "SON_000055" "g.34926529_34926532dup" "" "" "" "4992_4995dupTCAT" "" "Unknown" "" "" "0" "" "" "g.33554223_33554226dup" "" "pathogenic" "" "0000658826" "0" "30" "21" "34922544" "34922544" "subst" "0.000454856" "02326" "SON_000056" "g.34922544C>T" "" "" "" "SON(NM_138927.2):c.1007C>T (p.A336V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.33550238C>T" "" "likely benign" "" "0000658828" "0" "30" "21" "34927507" "34927507" "subst" "7.73761E-5" "02326" "SON_000058" "g.34927507T>C" "" "" "" "SON(NM_138927.2):c.5970T>C (p.R1990=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.33555201T>C" "" "likely benign" "" "0000658829" "0" "30" "21" "34947983" "34947983" "subst" "0.00111485" "02326" "DONSON_000033" "g.34947983C>T" "" "" "" "SON(NM_138927.2):c.7105+10C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.33575677C>T" "" "likely benign" "" "0000658830" "0" "30" "21" "34960874" "34960874" "subst" "0" "01804" "CRYZL1_000003" "g.34960874C>T" "" "" "" "DONSON(NM_017613.3):c.74G>A (p.(Arg25Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.33588568C>T" "" "likely benign" "" "0000665282" "0" "90" "21" "31391467" "39118687" "del" "0" "00006" "SON_000059" "g.(?_31391467)_(39118687_?)del" "" "{PMID:Braddock 1994:07515754}, {PMID:Braddock 2016:27549381}" "" "h919 31,391,467–39,118,687del" "" "De novo" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000665283" "0" "90" "21" "26968514" "36909426" "del" "0" "00006" "SON_000059" "g.(?_26968514)_(36909426_?)del" "" "{PMID:Braddock 1994:07515754}, {PMID:Braddock 2016:27549381}" "" "hg19 26,968,514–36,909,426del" "" "De novo" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000665284" "0" "90" "21" "34927290" "34927293" "del" "0" "00006" "SON_000003" "g.34927290_34927293del" "" "{PMID:Takenouchi 2016:27256762}" "" "5753_5756delTTAG" "" "De novo" "" "" "0" "" "" "g.33554984_33554987del" "" "pathogenic (dominant)" "" "0000665285" "0" "90" "21" "34927290" "34927293" "del" "0" "00006" "SON_000003" "g.34927290_34927293del" "" "{PMID:Tokita 2016:27545676}" "" "5753_5756delTTAG" "" "De novo" "" "" "0" "" "" "g.33554984_33554987del" "" "pathogenic (dominant)" "" "0000665286" "0" "90" "21" "34929534" "34929534" "del" "0" "00006" "SON_000060" "g.34929534del" "" "{PMID:Tokita 2016:27545676}" "" "6233delC" "" "De novo" "" "" "0" "" "" "g.33557228del" "" "pathogenic (dominant)" "" "0000665287" "0" "90" "21" "34925389" "34925393" "del" "0" "00006" "SON_000004" "g.34925389_34925393del" "" "{PMID:Tokita 2016:27545676}" "" "3852_3856delGGTAT" "" "De novo" "" "" "0" "" "" "g.33553083_33553087del" "" "pathogenic (dominant)" "" "0000665288" "0" "90" "21" "34921823" "34921823" "subst" "0" "00006" "SON_000061" "g.34921823C>T" "" "{PMID:Tokita 2016:27545676}" "" "" "" "De novo" "" "" "0" "" "" "g.33549517C>T" "" "pathogenic (dominant)" "" "0000665289" "0" "90" "21" "34927290" "34927293" "del" "0" "00006" "SON_000003" "g.34927290_34927293del" "" "{PMID:Tokita 2016:27545676}" "" "5753_5756delTTAG" "" "De novo" "" "" "0" "" "" "g.33554984_33554987del" "" "pathogenic (dominant)" "" "0000665290" "0" "90" "21" "34924610" "34924610" "dup" "0" "00006" "SON_000062" "g.34924610dup" "" "{PMID:Tokita 2016:27545676}" "" "3073dupA" "" "De novo" "" "" "0" "" "" "g.33552304dup" "" "pathogenic (dominant)" "" "0000665291" "1" "70" "21" "34926446" "34926446" "subst" "0" "00006" "SON_000063" "g.34926446A>T" "" "{PMID:Tokita 2016:27545676}" "" "" "" "De novo" "" "" "0" "" "" "g.33554140A>T" "" "VUS" "" "0000665292" "1" "70" "21" "34927065" "34927065" "subst" "0" "00006" "SON_000064" "g.34927065C>A" "" "{PMID:Tokita 2016:27545676}" "" "" "" "De novo" "" "" "0" "" "" "g.33554759C>A" "" "VUS" "" "0000665303" "0" "90" "21" "33351319" "35246835" "del" "0" "00006" "SON_000059" "g.(?_33351319)_(35246835_?)del" "" "{PMID:Izumi 2012:22614953}" "" "46,XX.arr 21q22.11 (32,273,189–34,168,705)x1 dn hg18" "1.9 Mb deletion" "De novo" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000665313" "0" "90" "21" "34922981" "34922981" "del" "0" "00006" "SON_000065" "g.34922981del" "" "{PMID:Quintana Castanedo 2020:32045494}" "" "" "" "De novo" "" "" "0" "" "" "g.33550675del" "" "pathogenic (dominant)" "" "0000665314" "0" "90" "21" "34921931" "34921931" "subst" "0" "00006" "SON_000066" "g.34921931C>T" "" "{PMID:Yang 2019:31557424}" "" "" "" "De novo" "" "" "0" "" "" "g.33549625C>T" "" "pathogenic (dominant)" "" "0000667615" "0" "70" "21" "34927086" "34927087" "del" "0" "00006" "SON_000002" "g.34927086_34927087del" "" "" "" "5549_5550delGA" "" "De novo" "" "" "0" "" "" "g.33554780_33554781del" "" "likely pathogenic (dominant)" "ACMG" "0000681710" "0" "30" "21" "34931988" "34931988" "subst" "3.65681E-5" "01943" "SON_000067" "g.34931988G>A" "" "" "" "SON(NM_138927.2):c.6564G>A (p.A2188=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000683685" "0" "90" "21" "34921805" "34921805" "del" "0" "00006" "SON_000014" "g.34921805del" "" "{PMID:Mahler 2019:31056085}" "" "268delC" "" "De novo" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000683686" "0" "90" "21" "34925592" "34925592" "del" "0" "00006" "SON_000015" "g.34925592del" "" "{PMID:Mahler 2019:31056085}" "" "4055delC" "" "De novo" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000693035" "0" "30" "21" "34922034" "34922034" "subst" "0.000935865" "02326" "SON_000068" "g.34922034C>T" "" "" "" "SON(NM_138927.2):c.497C>T (p.A166V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000693036" "0" "30" "21" "34925713" "34925713" "subst" "0.000718788" "01943" "SON_000069" "g.34925713G>A" "" "" "" "SON(NM_138927.2):c.4176G>A (p.P1392=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000693037" "0" "30" "21" "34925980" "34925980" "subst" "0.00043891" "01943" "SON_000070" "g.34925980A>G" "" "" "" "SON(NM_138927.2):c.4443A>G (p.S1481=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000693038" "0" "50" "21" "34927209" "34927209" "subst" "3.25224E-5" "01943" "SON_000071" "g.34927209G>A" "" "" "" "SON(NM_138927.2):c.5672G>A (p.R1891H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000704149" "0" "90" "21" "34924986" "34924986" "del" "0" "01807" "SON_000073" "g.34924986del" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.33552680del" "" "pathogenic" "" "0000704188" "0" "90" "21" "34924575" "34924575" "dup" "0" "01807" "SON_000072" "g.34924575dup" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.33552269dup" "" "pathogenic" "" "0000727884" "0" "30" "21" "34922194" "34922194" "subst" "0.00105595" "01943" "SON_000074" "g.34922194A>G" "" "" "" "SON(NM_138927.2):c.657A>G (p.T219=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727885" "0" "50" "21" "34922387" "34922398" "del" "0" "02329" "SON_000029" "g.34922387_34922398del" "" "" "" "SON(NM_138927.4):c.850_861delCCAGAGCCATCA (p.P284_S287del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000727886" "0" "30" "21" "34922515" "34922515" "subst" "0.00102744" "02326" "SON_000075" "g.34922515G>A" "" "" "" "SON(NM_138927.2):c.978G>A (p.M326I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727887" "0" "30" "21" "34924148" "34924148" "subst" "0.000527897" "02326" "SON_000076" "g.34924148A>G" "" "" "" "SON(NM_138927.2):c.2611A>G (p.M871V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727888" "0" "30" "21" "34924844" "34924844" "subst" "3.6553E-5" "02325" "SON_000077" "g.34924844A>G" "" "" "" "SON(NM_032195.3):c.3307A>G (p.M1103V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727889" "0" "90" "21" "34925248" "34925248" "del" "0" "02329" "SON_000023" "g.34925248del" "" "" "" "SON(NM_138927.4):c.3711delC (p.S1238Qfs*3)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000727890" "0" "30" "21" "34925742" "34925742" "subst" "0.000235522" "02326" "SON_000078" "g.34925742A>G" "" "" "" "SON(NM_138927.2):c.4205A>G (p.Y1402C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727891" "0" "50" "21" "34926497" "34926497" "subst" "0" "02325" "SON_000079" "g.34926497G>A" "" "" "" "SON(NM_032195.3):c.4960G>A (p.D1654N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000727892" "0" "30" "21" "34926748" "34926748" "subst" "0.000934041" "02326" "SON_000080" "g.34926748A>G" "" "" "" "SON(NM_138927.2):c.5211A>G (p.L1737=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727893" "0" "50" "21" "34926838" "34926839" "del" "4.47613E-5" "01943" "SON_000081" "g.34926838_34926839del" "" "" "" "SON(NM_138927.2):c.5301_5302delTG (p.A1768Qfs*6)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000727894" "0" "50" "21" "34926841" "34926853" "del" "4.06944E-5" "01943" "SON_000082" "g.34926841_34926853del" "" "" "" "SON(NM_138927.2):c.5304_5316delCAGCCCGGTTGTA (p.S1769Vfs*22)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000727895" "0" "50" "21" "34927065" "34927065" "subst" "0" "02329" "SON_000052" "g.34927065C>G" "" "" "" "SON(NM_138927.4):c.5528C>G (p.S1843C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000727896" "0" "50" "21" "34927200" "34927200" "subst" "0" "02329" "SON_000043" "g.34927200A>C" "" "" "" "SON(NM_138927.4):c.5663A>C (p.K1888T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000727897" "0" "30" "21" "34927501" "34927501" "subst" "0.000111571" "01943" "SON_000047" "g.34927501T>C" "" "" "" "SON(NM_138927.2):c.5964T>C (p.P1988=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727898" "0" "50" "21" "34929528" "34929528" "subst" "0" "02329" "SON_000026" "g.34929528C>T" "" "" "" "SON(NM_138927.4):c.6227C>T (p.P2076L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000727899" "0" "30" "21" "34932085" "34932085" "subst" "0" "02325" "SON_000083" "g.34932085A>C" "" "" "" "SON(NM_032195.3):c.6657+4A>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727900" "0" "50" "21" "34950642" "34950643" "del" "0" "01943" "DONSON_000034" "g.34950642_34950643del" "" "" "" "DONSON(NM_017613.4):c.1675_1676delGA (p.D559Lfs*4)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000727901" "0" "30" "21" "34960703" "34960703" "subst" "0" "01943" "CRYZL1_000005" "g.34960703C>T" "" "" "" "DONSON(NM_017613.4):c.245G>A (p.R82H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000785863" "0" "90" "21" "34924818" "34924818" "dup" "0" "01864" "SON_000084" "g.34924818dup" "" "" "" "" "" "De novo" "yes" "" "0" "" "" "g.33552512dup" "" "pathogenic (dominant)" "ACMG" "0000791041" "0" "90" "21" "34927290" "34927293" "del" "0" "03760" "SON_000003" "g.34927290_34927293del" "" "{PMID:Dingemans 2022:34521999}, {DOI:Dingemans 2022:10.1038/s41431-021-00960-4}" "" "" "" "De novo" "" "" "0" "" "" "g.33554984_33554987del" "" "pathogenic" "" "0000791044" "0" "90" "21" "34927290" "34927293" "del" "0" "03760" "SON_000003" "g.34927290_34927293del" "" "{PMID:Dingemans 2022:34521999}, {DOI:Dingemans 2022:10.1038/s41431-021-00960-4}" "" "" "" "De novo" "" "" "0" "" "" "g.33554984_33554987del" "" "pathogenic" "" "0000791045" "0" "90" "21" "34927290" "34927293" "del" "0" "03760" "SON_000003" "g.34927290_34927293del" "" "{PMID:Dingemans 2022:34521999}, {DOI:Dingemans 2022:10.1038/s41431-021-00960-4}" "" "" "" "De novo" "" "" "0" "" "" "g.33554984_33554987del" "" "pathogenic" "" "0000791046" "0" "90" "21" "34924740" "34924740" "subst" "0" "03760" "SON_000089" "g.34924740C>G" "" "{PMID:Dingemans 2022:34521999}, {DOI:Dingemans 2022:10.1038/s41431-021-00960-4}" "" "" "" "De novo" "" "" "0" "" "" "" "" "pathogenic" "" "0000791048" "0" "90" "21" "34921994" "34921994" "del" "0" "03760" "SON_000087" "g.34921994del" "" "{PMID:Dingemans 2022:34521999}, {DOI:Dingemans 2022:10.1038/s41431-021-00960-4}" "" "" "" "De novo" "" "" "0" "" "" "g.33549688del" "" "pathogenic" "" "0000791049" "0" "90" "21" "34921921" "34921921" "del" "0" "03760" "SON_000086" "g.34921921del" "" "{PMID:Dingemans 2022:34521999}, {DOI:Dingemans 2022:10.1038/s41431-021-00960-4}" "" "" "" "De novo" "" "" "0" "" "" "g.33549615del" "" "pathogenic" "" "0000791050" "0" "90" "21" "34915344" "34949820" "del" "0" "03760" "SON_000090" "g.(?_34915344)_(34949820_?)del" "" "{PMID:Dingemans 2022:34521999}, {DOI:Dingemans 2022:10.1038/s41431-021-00960-4}" "" "" "0.19 Mb deletion SON gene exact coordinates unknown" "De novo" "" "" "0" "" "" "" "" "pathogenic" "" "0000791051" "0" "90" "21" "34925248" "34925248" "del" "0" "03760" "SON_000023" "g.34925248del" "" "{PMID:Dingemans 2022:34521999}, {DOI:Dingemans 2022:10.1038/s41431-021-00960-4}" "" "" "" "De novo" "" "" "0" "" "" "g.33552942del" "" "pathogenic" "" "0000791052" "0" "90" "21" "34925248" "34925248" "del" "0" "03760" "SON_000023" "g.34925248del" "" "{PMID:Dingemans 2022:34521999}, {DOI:Dingemans 2022:10.1038/s41431-021-00960-4}" "" "" "" "Germline" "" "" "0" "" "" "g.33552942del" "" "pathogenic" "" "0000791053" "0" "90" "21" "34927547" "34927547" "del" "0" "03760" "SON_000053" "g.34927547del" "" "{PMID:Dingemans 2022:34521999}, {DOI:Dingemans 2022:10.1038/s41431-021-00960-4}" "" "" "" "Germline" "" "" "0" "" "" "g.33555241del" "" "pathogenic" "" "0000791054" "0" "90" "21" "34927290" "34927293" "del" "0" "03760" "SON_000003" "g.34927290_34927293del" "" "{PMID:Dingemans 2022:34521999}, {DOI:Dingemans 2022:10.1038/s41431-021-00960-4}" "" "" "" "Germline" "" "" "0" "" "" "g.33554984_33554987del" "" "pathogenic" "" "0000791055" "0" "90" "21" "34921885" "34921888" "del" "0" "03760" "SON_000085" "g.34921885_34921888del" "" "{PMID:Dingemans 2022:34521999}, {DOI:Dingemans 2022:10.1038/s41431-021-00960-4}" "" "" "" "Germline" "" "" "0" "" "" ".33549579_33549582del" "" "pathogenic" "" "0000791056" "0" "90" "21" "34927290" "34927293" "del" "0" "03760" "SON_000003" "g.34927290_34927293del" "" "{PMID:Dingemans 2022:34521999}, {DOI:Dingemans 2022:10.1038/s41431-021-00960-4}" "" "" "" "Germline" "" "" "0" "" "" "g.33554984_33554987del" "" "pathogenic" "" "0000791057" "0" "90" "21" "34927290" "34927293" "del" "0" "03760" "SON_000003" "g.34927290_34927293del" "" "{PMID:Dingemans 2022:34521999}, {DOI:Dingemans 2022:10.1038/s41431-021-00960-4}" "" "" "" "Germline" "" "" "0" "" "" "g.33554984_33554987del" "" "pathogenic" "" "0000791058" "0" "90" "21" "34922205" "34922205" "subst" "4.06213E-6" "03760" "SON_000019" "g.34922205C>T" "" "{PMID:Dingemans 2022:34521999}, {DOI:Dingemans 2022:10.1038/s41431-021-00960-4}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000791059" "0" "90" "21" "34924871" "34924871" "subst" "0" "03760" "SON_000013" "g.34924871C>T" "" "{PMID:Dingemans 2022:34521999}, {DOI:Dingemans 2022:10.1038/s41431-021-00960-4}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000791060" "0" "90" "21" "34923418" "34923419" "del" "0" "03760" "SON_000001" "g.34923418_34923419del" "" "{PMID:Dingemans 2022:34521999}, {DOI:Dingemans 2022:10.1038/s41431-021-00960-4}" "" "" "" "Germline" "" "" "0" "" "" "g.33551112_33551113del" "" "pathogenic" "" "0000791061" "0" "90" "21" "34923273" "34923273" "subst" "4.14776E-6" "03760" "SON_000088" "g.34923273C>G" "" "{PMID:Dingemans 2022:34521999}, {DOI:Dingemans 2022:10.1038/s41431-021-00960-4}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000809373" "0" "30" "21" "34922274" "34922274" "subst" "1.62697E-5" "01943" "SON_000091" "g.34922274C>T" "" "" "" "SON(NM_138927.2):c.737C>T (p.A246V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809374" "0" "30" "21" "34922804" "34922804" "subst" "0.000109861" "01943" "SON_000092" "g.34922804C>T" "" "" "" "SON(NM_138927.2):c.1267C>T (p.P423S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809375" "0" "50" "21" "34923842" "34923842" "subst" "0" "02325" "SON_000093" "g.34923842A>G" "" "" "" "SON(NM_032195.3):c.2305A>G (p.S769G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000809376" "0" "30" "21" "34923980" "34923980" "subst" "0.000122823" "01943" "SON_000094" "g.34923980A>C" "" "" "" "SON(NM_032195.3):c.2443A>C (p.M815L), SON(NM_138927.2):c.2443A>C (p.M815L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809377" "0" "30" "21" "34924118" "34924118" "subst" "0.000365461" "01943" "SON_000095" "g.34924118A>G" "" "" "" "SON(NM_138927.2):c.2581A>G (p.M861V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809378" "0" "30" "21" "34924863" "34924863" "subst" "0.00163685" "02325" "SON_000038" "g.34924863C>T" "" "" "" "SON(NM_032195.3):c.3326C>T (p.A1109V), SON(NM_138927.2):c.3326C>T (p.A1109V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809379" "0" "30" "21" "34926415" "34926415" "subst" "8.53159E-5" "01943" "SON_000096" "g.34926415T>C" "" "" "" "SON(NM_138927.2):c.4878T>C (p.Y1626=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809380" "0" "30" "21" "34947983" "34947983" "subst" "0.00111485" "01943" "DONSON_000033" "g.34947983C>T" "" "" "" "SON(NM_138927.2):c.7105+10C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000855951" "0" "30" "21" "34923201" "34923201" "subst" "0.00203252" "02325" "SON_000048" "g.34923201C>T" "" "" "" "SON(NM_032195.3):c.1664C>T (p.T555M), SON(NM_138927.2):c.1664C>T (p.T555M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000855952" "0" "50" "21" "34924741" "34924764" "del" "0" "01943" "SON_000100" "g.34924741_34924764del" "" "" "" "SON(NM_138927.2):c.3204_3227delAGCTTATGAACGCTCCATGATGTC (p.A1069_S1076del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000855953" "0" "30" "21" "34925014" "34925014" "subst" "7.31618E-5" "02326" "SON_000101" "g.34925014G>A" "" "" "" "SON(NM_138927.2):c.3477G>A (p.P1159=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000855954" "0" "30" "21" "34925574" "34925574" "subst" "8.93575E-5" "01943" "SON_000102" "g.34925574C>T" "" "" "" "SON(NM_138927.2):c.4037C>T (p.P1346L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000855955" "0" "30" "21" "34925584" "34925584" "subst" "8.12262E-6" "01943" "SON_000103" "g.34925584G>A" "" "" "" "SON(NM_138927.2):c.4047G>A (p.M1349I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000866619" "0" "30" "21" "34922572" "34922572" "subst" "2.43665E-5" "01943" "SON_000097" "g.34922572C>T" "" "" "" "SON(NM_138927.2):c.1035C>T (p.D345=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000866620" "0" "50" "21" "34923703" "34923705" "dup" "0" "02325" "SON_000098" "g.34923703_34923705dup" "" "" "" "SON(NM_032195.3):c.2166_2168dupGAC (p.T723dup), SON(NM_138927.4):c.2166_2168dup (p.(Thr723dup))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000866621" "0" "30" "21" "34923901" "34923901" "subst" "0.000479507" "01943" "SON_000099" "g.34923901T>C" "" "" "" "SON(NM_138927.2):c.2364T>C (p.T788=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000866622" "0" "30" "21" "34925225" "34925278" "dup" "0" "02325" "SON_000039" "g.34925225_34925278dup" "" "" "" "SON(NM_032195.3):c.3688_3741dup (p.Y1230_T1247dup), SON(NM_138927.2):c.3688_3741dup (p.Y1230_T1247dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000895459" "0" "50" "21" "34923187" "34923222" "del" "0" "02325" "SON_000104" "g.34923187_34923222del" "" "" "" "SON(NM_032195.3):c.1650_1685del (p.V553_P564del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000895460" "0" "50" "21" "34925669" "34925692" "del" "0" "02325" "SON_000105" "g.34925669_34925692del" "" "" "" "SON(NM_032195.3):c.4132_4155delTCTTCGACTGTAACTGTCCTGGAG (p.S1378_E1385del), SON(NM_138927.4):c.4132_4155del (p.(Ser1378_Glu1385del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000895462" "0" "70" "21" "34953704" "34953704" "dup" "0" "02329" "DONSON_000014" "g.34953704dup" "" "" "" "DONSON(NM_017613.4):c.1254dupT (p.K419*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000895463" "0" "70" "21" "34960866" "34960866" "subst" "0.00172117" "02329" "CRYZL1_000006" "g.34960866T>G" "" "" "" "DONSON(NM_017613.4):c.82A>C (p.(Ser28Arg), p.S28R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000915447" "0" "30" "21" "34918579" "34918579" "subst" "4.46886E-5" "02326" "GART_000009" "g.34918579G>A" "" "" "" "SON(NM_138927.2):c.138G>A (p.A46=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000915448" "0" "50" "21" "34939496" "34939496" "subst" "0" "02325" "DONSON_000035" "g.34939496G>T" "" "" "" "SON(NM_138927.4):c.6691G>T (p.A2231S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000927070" "0" "50" "21" "34948114" "34948114" "subst" "0" "02325" "DONSON_000036" "g.34948114T>G" "" "" "" "SON(NM_138927.4):c.7136T>G (p.I2379S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000927675" "0" "50" "21" "34923927" "34923927" "subst" "0" "03779" "SON_000106" "g.34923927C>G" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000931214" "0" "90" "21" "34927290" "34927293" "del" "0" "02329" "SON_000003" "g.34927290_34927293del" "" "" "" "SON(NM_138927.2):c.5753_5756delTTAG (p.V1918Efs*87), SON(NM_138927.4):c.5753_5756delTTAG (p.V1918Efs*87)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000931215" "0" "90" "21" "34954370" "34954370" "subst" "4.87448E-5" "02326" "DONSON_000010" "g.34954370T>C" "" "" "" "DONSON(NM_017613.4):c.1047-9A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000951496" "0" "50" "21" "34924129" "34924129" "subst" "1.21819E-5" "02325" "SON_000107" "g.34924129G>C" "" "" "" "SON(NM_032195.3):c.2592G>C (p.Q864H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000951497" "0" "30" "21" "34927447" "34927488" "del" "0" "02325" "SON_000108" "g.34927447_34927488del" "" "" "" "SON(NM_032195.3):c.5910_5951del (p.S1985_R1998del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000970292" "0" "30" "21" "34948982" "34948982" "subst" "0" "01804" "DONSON_000037" "g.34948982A>C" "" "" "" "SON(NM_138927.1):c.*252A>C (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000983961" "0" "30" "21" "34923703" "34923705" "dup" "0" "01804" "SON_000098" "g.34923703_34923705dup" "" "" "" "SON(NM_032195.3):c.2166_2168dupGAC (p.T723dup), SON(NM_138927.4):c.2166_2168dup (p.(Thr723dup))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000983962" "0" "50" "21" "34923904" "34923904" "subst" "0" "01804" "SON_000111" "g.34923904C>A" "" "" "" "SON(NM_138927.4):c.2367C>A (p.(Ser789Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000983963" "0" "30" "21" "34925669" "34925692" "del" "0" "01804" "SON_000105" "g.34925669_34925692del" "" "" "" "SON(NM_032195.3):c.4132_4155delTCTTCGACTGTAACTGTCCTGGAG (p.S1378_E1385del), SON(NM_138927.4):c.4132_4155del (p.(Ser1378_Glu1385del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000983964" "0" "30" "21" "34925765" "34925765" "subst" "0.000142123" "02325" "SON_000112" "g.34925765G>A" "" "" "" "SON(NM_032195.3):c.4228G>A (p.V1410I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005669" "0" "30" "21" "34918578" "34918578" "subst" "1.6255E-5" "02325" "GART_000013" "g.34918578C>T" "" "" "" "SON(NM_032195.3):c.137C>T (p.A46V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005670" "0" "30" "21" "34921872" "34921872" "subst" "0" "01804" "SON_000113" "g.34921872A>G" "" "" "" "SON(NM_138927.2):c.335A>G (p.(Lys112Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005671" "0" "30" "21" "34921896" "34921896" "subst" "0" "02327" "SON_000114" "g.34921896A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005672" "0" "30" "21" "34922300" "34922300" "subst" "0" "01804" "SON_000115" "g.34922300C>G" "" "" "" "SON(NM_138927.2):c.763C>G (p.(Leu255Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005673" "0" "30" "21" "34922537" "34922537" "subst" "1.21826E-5" "01804" "SON_000116" "g.34922537A>G" "" "" "" "SON(NM_138927.2):c.1000A>G (p.(Ile334Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005674" "0" "50" "21" "34922589" "34922589" "subst" "4.06118E-5" "01804" "SON_000117" "g.34922589C>G" "" "" "" "SON(NM_138927.2):c.1052C>G (p.(Ala351Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005675" "0" "50" "21" "34922736" "34922736" "subst" "0" "01804" "SON_000118" "g.34922736C>T" "" "" "" "SON(NM_138927.2):c.1199C>T (p.(Thr400Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005676" "0" "50" "21" "34922926" "34922946" "dup" "0" "02325" "SON_000119" "g.34922926_34922946dup" "" "" "" "SON(NM_032195.3):c.1389_1409dupGGAGCCACCACAGGAGGTACC (p.Q467_P473dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005677" "0" "30" "21" "34922927" "34922927" "subst" "4.06415E-5" "01804" "SON_000120" "g.34922927G>A" "" "" "" "SON(NM_138927.2):c.1390G>A (p.(Glu464Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005678" "0" "30" "21" "34922949" "34922949" "subst" "0" "01804" "SON_000121" "g.34922949A>G" "" "" "" "SON(NM_138927.2):c.1412A>G (p.(Glu471Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005679" "0" "70" "21" "34923516" "34923516" "del" "0" "01804" "SON_000122" "g.34923516del" "" "" "" "SON(NM_138927.2):c.1979delC (p.(Thr660fs))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001005680" "0" "30" "21" "34923743" "34923743" "subst" "4.06075E-6" "01804" "SON_000123" "g.34923743C>G" "" "" "" "SON(NM_138927.2):c.2206C>G (p.(Leu736Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005681" "0" "50" "21" "34923777" "34923777" "subst" "4.06058E-6" "01804" "SON_000124" "g.34923777C>T" "" "" "" "SON(NM_138927.2):c.2240C>T (p.(Ala747Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005682" "0" "30" "21" "34923899" "34923899" "subst" "2.84294E-5" "01804" "SON_000125" "g.34923899A>G" "" "" "" "SON(NM_138927.2):c.2362A>G (p.(Thr788Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005683" "0" "50" "21" "34923938" "34923938" "subst" "2.43752E-5" "02325" "SON_000126" "g.34923938A>G" "" "" "" "SON(NM_032195.3):c.2401A>G (p.M801V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005684" "0" "50" "21" "34924192" "34924192" "subst" "0" "01804" "SON_000127" "g.34924192G>A" "" "" "" "SON(NM_138927.2):c.2655G>A (p.(Met885Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005685" "0" "50" "21" "34924271" "34924271" "subst" "0" "01804" "SON_000128" "g.34924271G>C" "" "" "" "SON(NM_138927.2):c.2734G>C (p.(Asp912His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005686" "0" "30" "21" "34924455" "34924455" "subst" "0.00019093" "01804" "SON_000129" "g.34924455C>T" "" "" "" "SON(NM_032195.3):c.2918C>T (p.A973V), SON(NM_138927.2):c.2918C>T (p.(Ala973Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005687" "0" "50" "21" "34924607" "34924607" "subst" "1.62427E-5" "01804" "SON_000130" "g.34924607A>G" "" "" "" "SON(NM_138927.2):c.3070A>G (p.(Met1024Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005688" "0" "50" "21" "34925187" "34925187" "subst" "0" "02325" "SON_000131" "g.34925187A>T" "" "" "" "SON(NM_032195.3):c.3650A>T (p.Q1217L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005689" "0" "50" "21" "34925309" "34925309" "subst" "4.06081E-6" "01804" "SON_000132" "g.34925309T>G" "" "" "" "SON(NM_138927.2):c.3772T>G (p.(Ser1258Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005690" "0" "30" "21" "34925610" "34925610" "subst" "0" "01804" "SON_000133" "g.34925610C>T" "" "" "" "SON(NM_138927.2):c.4073C>T (p.(Ala1358Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005691" "0" "30" "21" "34925705" "34925705" "subst" "0" "01804" "SON_000134" "g.34925705A>G" "" "" "" "SON(NM_138927.2):c.4168A>G (p.(Thr1390Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005692" "0" "30" "21" "34925867" "34925867" "subst" "1.62437E-5" "01804" "SON_000135" "g.34925867A>G" "" "" "" "SON(NM_138927.2):c.4330A>G (p.(Thr1444Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005693" "0" "30" "21" "34926009" "34926009" "subst" "2.03262E-5" "01804" "SON_000136" "g.34926009C>T" "" "" "" "SON(NM_138927.2):c.4472C>T (p.(Ser1491Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005694" "0" "30" "21" "34926237" "34926237" "subst" "3.65598E-5" "02325" "SON_000137" "g.34926237T>G" "" "" "" "SON(NM_032195.3):c.4700T>G (p.L1567W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005695" "0" "30" "21" "34927112" "34927112" "subst" "0" "01804" "SON_000138" "g.34927112T>G" "" "" "" "SON(NM_138927.2):c.5575T>G (p.(Ser1859Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005696" "0" "50" "21" "34927449" "34927454" "del" "0" "01804" "SON_000139" "g.34927449_34927454del" "" "" "" "SON(NM_138927.2):c.5912_5917delGCCGCA (p.(Ser1971_Arg1972del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005697" "0" "30" "21" "34927501" "34927521" "del" "0" "01804" "SON_000140" "g.34927501_34927521del" "" "" "" "SON(NM_138927.2):c.5964_5984delTAGCCGTCGGAGCCGCACCCC (p.(Ser1989_Pro1995del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005698" "0" "30" "21" "34932410" "34932410" "subst" "3.66898E-5" "01804" "DONSON_000038" "g.34932410G>T" "" "" "" "SON(NM_032195.2):c.6885G>T (p.(Arg2295Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005699" "0" "50" "21" "34948838" "34948838" "subst" "0" "01804" "DONSON_000039" "g.34948838C>T" "" "" "" "SON(NM_138927.2):c.*108C>T (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005700" "0" "30" "21" "34951868" "34951868" "subst" "0" "01804" "DONSON_000040" "g.34951868C>A" "" "" "" "DONSON(NM_017613.3):c.1351G>T (p.(Ala451Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005701" "0" "50" "21" "34953631" "34953631" "subst" "0" "01804" "DONSON_000041" "g.34953631C>T" "" "" "" "DONSON(NM_017613.3):c.1327G>A (p.(Gly443Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005702" "0" "90" "21" "34957011" "34957011" "subst" "0" "01804" "CRYZL1_000007" "g.34957011G>A" "" "" "" "DONSON(NM_017613.3):c.670C>T (p.(Pro224Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001015884" "0" "30" "21" "34923980" "34923980" "subst" "0.000122823" "02325" "SON_000094" "g.34923980A>C" "" "" "" "SON(NM_032195.3):c.2443A>C (p.M815L), SON(NM_138927.2):c.2443A>C (p.M815L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001015885" "0" "30" "21" "34924455" "34924455" "subst" "0.00019093" "02325" "SON_000129" "g.34924455C>T" "" "" "" "SON(NM_032195.3):c.2918C>T (p.A973V), SON(NM_138927.2):c.2918C>T (p.(Ala973Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001015886" "0" "30" "21" "34924666" "34924689" "del" "0" "02325" "SON_000141" "g.34924666_34924689del" "" "" "" "SON(NM_032195.3):c.3129_3152delAGCCTACGAGCGCTCTATGATGTC (p.A1044_S1051del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001017377" "0" "90" "21" "34924217" "34924217" "subst" "0" "03544" "SON_000142" "g.34924217C>T" "" "" "" "" "" "De novo" "-" "" "0" "" "" "g.33551911C>T" "" "pathogenic (dominant)" "ACMG" "0001043561" "0" "90" "21" "34923252" "34923252" "subst" "0" "02329" "SON_000143" "g.34923252T>A" "" "" "" "SON(NM_138927.4):c.1715T>A (p.L572*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001043562" "0" "30" "21" "34927121" "34927121" "subst" "1.22244E-5" "01804" "SON_000144" "g.34927121C>T" "" "" "" "SON(NM_138927.4):c.5584C>T (p.(Arg1862Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001056992" "0" "50" "21" "34922027" "34922027" "subst" "0" "01804" "SON_000145" "g.34922027G>A" "" "" "" "SON(NM_138927.4):c.490G>A (p.(Ala164Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001056993" "0" "30" "21" "34922215" "34922223" "del" "0" "01804" "SON_000146" "g.34922215_34922223del" "" "" "" "SON(NM_138927.4):c.678_686del (p.(Glu227_Ser229del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001056994" "0" "30" "21" "34940854" "34940854" "dup" "0" "01804" "DONSON_000042" "g.34940854dup" "" "" "" "SON(NM_138927.4):c.6769-423dup" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001056995" "0" "50" "21" "34950726" "34950729" "del" "0" "01804" "DONSON_000043" "g.34950726_34950729del" "" "" "" "DONSON(NM_017613.4):c.1588_1591del (p.(Asn530Valfs*27))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001056997" "0" "50" "21" "34960866" "34960866" "subst" "0.00172117" "01804" "CRYZL1_000006" "g.34960866T>G" "" "" "" "DONSON(NM_017613.4):c.82A>C (p.(Ser28Arg), p.S28R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001067403" "0" "30" "21" "34921896" "34921896" "subst" "0" "02325" "SON_000114" "g.34921896A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001067404" "0" "50" "21" "34923231" "34923231" "subst" "7.35498E-5" "02325" "SON_000147" "g.34923231C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001067405" "0" "50" "21" "34925594" "34925594" "subst" "0" "02325" "SON_000148" "g.34925594G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001067406" "0" "50" "21" "34925655" "34925655" "subst" "0" "02325" "SON_000149" "g.34925655T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001067407" "0" "50" "21" "34925819" "34925819" "subst" "0" "02325" "SON_000150" "g.34925819C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001067408" "0" "50" "21" "34926254" "34926254" "subst" "0" "02325" "SON_000151" "g.34926254A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001067409" "0" "50" "21" "34926596" "34926596" "subst" "4.06141E-6" "02325" "SON_000152" "g.34926596G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes SON ## Count = 217 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000040318" "00024173" "90" "1881" "0" "1882" "0" "c.1881_1882del" "r.(?)" "p.(Val629Alafs*56)" "3" "0000130587" "00024173" "90" "5549" "0" "5550" "0" "c.5549_5550del" "r.(?)" "p.(Arg1850Ilefs*3)" "3" "0000130588" "00024173" "90" "5753" "0" "5756" "0" "c.5753_5756del" "r.(?)" "p.(Val1918Glufs*87)" "3" "0000130589" "00024173" "90" "3852" "0" "3856" "0" "c.3852_3856del" "r.(?)" "p.(Met1284llefs*2)" "3" "0000130590" "00024173" "90" "5753" "0" "5756" "0" "c.5753_5756del" "r.(?)" "p.(Val1918Glufs*87)" "3" "0000130591" "00024173" "50" "4999" "0" "5013" "0" "c.4999_5013del" "r.(?)" "p.(Asp1667_Asn1671del)" "3" "0000130592" "00024173" "90" "6002" "0" "6003" "0" "c.6002_6003insCC" "r.(?)" "p.(Arg2002Glnfs*5)" "3" "0000130593" "00024173" "90" "4358" "0" "4359" "0" "c.4358_4359del" "r.(?)" "p.(Thr1453Serfs*11)" "3" "0000130594" "00024173" "90" "4640" "0" "4640" "0" "c.4640del" "r.(?)" "p.(His1547Leufs*76)" "3" "0000130595" "00024173" "90" "6087" "0" "6087" "0" "c.6087del" "r.(?)" "p.(Ser2029Argfs*22)" "3" "0000130596" "00024173" "90" "3597" "0" "3598" "0" "c.3597_3598dup" "r.(?)" "p.(Pro1200Argfs*17)" "3" "0000130597" "00024173" "90" "4151" "0" "4174" "0" "c.4151_4174del" "r.(?)" "p.(Leu1384_Val1391del)" "3" "0000130598" "00024173" "90" "2365" "0" "2365" "0" "c.2365del" "r.(?)" "p.(Ser789Alafs*8)" "3" "0000130599" "00024173" "90" "3334" "0" "3334" "0" "c.3334C>T" "r.(?)" "p.(Arg1112*)" "3" "0000130600" "00024173" "90" "268" "0" "268" "0" "c.268del" "r.(?)" "p.(Ser90Valfs*59)" "3" "0000130601" "00024173" "90" "4055" "0" "4055" "0" "c.4055del" "r.(?)" "p.(Pro1352Glnfs*14)" "3" "0000130602" "00024173" "90" "4549" "0" "4549" "0" "c.4549dup" "r.(?)" "p.(Glu1517Glyfs*6)" "3" "0000130603" "00024173" "90" "5753" "0" "5756" "0" "c.5753_5756del" "r.(?)" "p.(Val1918Glufs*87)" "3" "0000130604" "00024173" "90" "5753" "0" "5756" "0" "c.5753_5756del" "r.(?)" "p.(Val1918Glufs*87)" "3" "0000130605" "00024173" "90" "0" "0" "0" "0" "c.-55_*1090[0]" "r.0" "p.0" "_1_12_" "0000130606" "00024173" "90" "5031" "0" "5032" "0" "c.5031_5032insAA" "r.(?)" "p.(Asp1678Lysfs*9)" "3" "0000298433" "00024173" "90" "5753" "0" "5756" "0" "c.5753_5756del" "r.(?)" "p.(Val1918GlufsTer87)" "" "0000299625" "00024173" "50" "668" "0" "668" "0" "c.668C>T" "r.(?)" "p.(Ser223Leu)" "" "0000302383" "00024173" "30" "1670" "0" "1670" "0" "c.1670C>T" "r.(?)" "p.(Ala557Val)" "" "0000302384" "00024173" "30" "4593" "0" "4593" "0" "c.4593T>C" "r.(?)" "p.(Asn1531=)" "" "0000328648" "00024173" "90" "2763" "0" "2763" "0" "c.2763C>A" "r.(?)" "p.(Tyr921Ter)" "" "0000342121" "00024173" "30" "5510" "0" "5510" "0" "c.5510G>A" "r.(?)" "p.(Arg1837His)" "" "0000570547" "00024173" "30" "607" "0" "607" "0" "c.607G>C" "r.(?)" "p.(Glu203Gln)" "" "0000570549" "00024173" "30" "1398" "0" "1398" "0" "c.1398A>T" "r.(?)" "p.(Pro466=)" "" "0000570550" "00024173" "30" "1792" "0" "1792" "0" "c.1792G>A" "r.(?)" "p.(Gly598Arg)" "" "0000570551" "00024173" "30" "1793" "0" "1793" "0" "c.1793G>A" "r.(?)" "p.(Gly598Glu)" "" "0000570552" "00024173" "30" "2080" "0" "2080" "0" "c.2080A>G" "r.(?)" "p.(Thr694Ala)" "" "0000570553" "00024173" "50" "2236" "0" "2236" "0" "c.2236C>A" "r.(?)" "p.(Leu746Ile)" "" "0000570554" "00024173" "30" "2236" "0" "2236" "0" "c.2236C>A" "r.(?)" "p.(Leu746Ile)" "" "0000570555" "00024173" "30" "2422" "0" "2422" "0" "c.2422A>G" "r.(?)" "p.(Thr808Ala)" "" "0000570556" "00024173" "30" "3039" "0" "3039" "0" "c.3039C>T" "r.(?)" "p.(Tyr1013=)" "" "0000570557" "00024173" "50" "3235" "0" "3235" "0" "c.3235G>T" "r.(?)" "p.(Ala1079Ser)" "" "0000570558" "00024173" "30" "3326" "0" "3326" "0" "c.3326C>T" "r.(?)" "p.(Ala1109Val)" "" "0000570559" "00024173" "30" "3688" "0" "3741" "0" "c.3688_3741dup" "r.(?)" "p.(Tyr1230_Thr1247dup)" "" "0000570560" "00024173" "30" "3726" "0" "3726" "0" "c.3726A>G" "r.(?)" "p.(Ser1242=)" "" "0000570562" "00024173" "30" "4463" "0" "4463" "0" "c.4463A>G" "r.(?)" "p.(Asn1488Ser)" "" "0000570564" "00024173" "90" "5753" "0" "5756" "0" "c.5753_5756del" "r.(?)" "p.(Val1918GlufsTer87)" "" "0000570565" "00024173" "30" "5754" "0" "5754" "0" "c.5754T>C" "r.(?)" "p.(Val1918=)" "" "0000570567" "00024173" "50" "5931" "0" "5951" "0" "c.5931_5951del" "r.(?)" "p.(Ser1992_Arg1998del)" "" "0000570568" "00024173" "30" "5931" "0" "5951" "0" "c.5931_5951del" "r.(?)" "p.(Ser1992_Arg1998del)" "" "0000570570" "00024173" "30" "5964" "0" "5964" "0" "c.5964T>C" "r.(?)" "p.(Pro1988=)" "" "0000570572" "00024173" "30" "6768" "12" "6768" "12" "c.6768+12T>G" "r.(=)" "p.(=)" "" "0000570573" "00024173" "30" "7033" "18" "7033" "18" "c.7033+18G>A" "r.(=)" "p.(=)" "" "0000570574" "00024173" "30" "7074" "0" "7074" "0" "c.7074G>A" "r.(?)" "p.(Gly2358=)" "" "0000570575" "00024173" "30" "7106" "-16" "7106" "-16" "c.7106-16T>C" "r.(=)" "p.(=)" "" "0000570576" "00024173" "10" "7248" "0" "7248" "0" "c.7248del" "r.(?)" "p.(Arg2416SerfsTer8)" "" "0000570577" "00024173" "50" "9232" "0" "9232" "0" "c.*1951G>A" "r.(=)" "p.(=)" "" "0000570578" "00024173" "30" "9279" "0" "9279" "0" "c.*1998G>A" "r.(=)" "p.(=)" "" "0000570580" "00024173" "30" "19185" "0" "19185" "0" "c.*11904G>C" "r.(=)" "p.(=)" "" "0000618329" "00024173" "30" "3012" "0" "3012" "0" "c.3012T>C" "r.(?)" "p.(Ala1004=)" "" "0000618330" "00024173" "30" "3012" "0" "3012" "0" "c.3012T>C" "r.(?)" "p.(Ala1004=)" "" "0000618331" "00024173" "30" "4399" "0" "4399" "0" "c.4399A>G" "r.(?)" "p.(Ile1467Val)" "" "0000618332" "00024173" "30" "4399" "0" "4399" "0" "c.4399A>G" "r.(?)" "p.(Ile1467Val)" "" "0000618333" "00024173" "30" "4851" "0" "4851" "0" "c.4851A>G" "r.(?)" "p.(Ala1617=)" "" "0000618334" "00024173" "30" "4851" "0" "4851" "0" "c.4851A>G" "r.(?)" "p.(Ala1617=)" "" "0000618336" "00024173" "30" "5754" "0" "5754" "0" "c.5754T>C" "r.(?)" "p.(Val1918=)" "" "0000618337" "00024173" "30" "6351" "0" "6351" "0" "c.6351A>T" "r.(?)" "p.(Glu2117Asp)" "" "0000618338" "00024173" "30" "7152" "0" "7152" "0" "c.7152G>A" "r.(?)" "p.(Arg2384=)" "" "0000624205" "00024173" "30" "1664" "0" "1664" "0" "c.1664C>T" "r.(?)" "p.(Thr555Met)" "" "0000624206" "00024173" "90" "6010" "0" "6010" "0" "c.6010del" "r.(?)" "p.(Val2004TrpfsTer2)" "" "0000647149" "00024173" "90" "4992" "0" "4995" "0" "c.4992_4995dup" "r.(?)" "p.(Leu1666Serfs*3)" "" "0000658826" "00024173" "30" "1007" "0" "1007" "0" "c.1007C>T" "r.(?)" "p.(Ala336Val)" "" "0000658828" "00024173" "30" "5970" "0" "5970" "0" "c.5970T>C" "r.(?)" "p.(Arg1990=)" "" "0000658829" "00024173" "30" "7105" "10" "7105" "10" "c.7105+10C>T" "r.(=)" "p.(=)" "" "0000658830" "00024173" "30" "19425" "0" "19425" "0" "c.*12144C>T" "r.(=)" "p.(=)" "" "0000665282" "00024173" "90" "0" "0" "0" "0" "c.-55_*1090[0]" "r.0" "p.0" "_1_12_" "0000665283" "00024173" "90" "0" "0" "0" "0" "c.-55_*1090[0]" "r.0" "p.0" "_1_12_" "0000665284" "00024173" "90" "5753" "0" "5756" "0" "c.5753_5756del" "r.(?)" "p.(Val1918Glufs*87)" "" "0000665285" "00024173" "90" "5753" "0" "5756" "0" "c.5753_5756del" "r.(?)" "p.(Val1918Glufs*87)" "" "0000665286" "00024173" "90" "6233" "0" "6233" "0" "c.6233del" "r.(?)" "p.(Pro2078Hisfs*4)" "" "0000665287" "00024173" "90" "3852" "0" "3856" "0" "c.3852_3856del" "r.(?)" "p.(Met1284Ilefs*2)" "" "0000665288" "00024173" "90" "286" "0" "286" "0" "c.286C>T" "r.(?)" "p.(Gln96*)" "" "0000665289" "00024173" "90" "5753" "0" "5756" "0" "c.5753_5756del" "r.(?)" "p.(Val1918Glufs*87)" "11" "0000665290" "00024173" "90" "3073" "0" "3073" "0" "c.3073dup" "r.(?)" "p.(Met1025Asnfs*6)" "" "0000665291" "00024173" "70" "4909" "0" "4909" "0" "c.4909A>T" "r.(?)" "p.(Thr1637Ser)" "" "0000665292" "00024173" "70" "5528" "0" "5528" "0" "c.5528C>A" "r.(?)" "p.(Ser1843Tyr)" "" "0000665303" "00024173" "90" "0" "0" "0" "0" "c.-55_*1090[0]" "r.0" "p.0" "" "0000665313" "00024173" "90" "1444" "0" "1444" "0" "c.1444del" "r.(?)" "p.(Leu482Cysfs*4)" "" "0000665314" "00024173" "90" "394" "0" "394" "0" "c.394C>T" "r.(?)" "p.(Gln132*)" "" "0000667615" "00024173" "70" "5549" "0" "5550" "0" "c.5549_5550del" "r.(?)" "p.(Arg1850Ilefs*3)" "" "0000681710" "00024173" "30" "6564" "0" "6564" "0" "c.6564G>A" "r.(?)" "p.(Ala2188=)" "" "0000683685" "00024173" "90" "268" "0" "268" "0" "c.268del" "r.(?)" "p.(Ser90Valfs*59)" "" "0000683686" "00024173" "90" "4055" "0" "4055" "0" "c.4055del" "r.(?)" "p.(Pro1352Glnfs*14)" "" "0000693035" "00024173" "30" "497" "0" "497" "0" "c.497C>T" "r.(?)" "p.(Ala166Val)" "" "0000693036" "00024173" "30" "4176" "0" "4176" "0" "c.4176G>A" "r.(?)" "p.(Pro1392=)" "" "0000693037" "00024173" "30" "4443" "0" "4443" "0" "c.4443A>G" "r.(?)" "p.(Ser1481=)" "" "0000693038" "00024173" "50" "5672" "0" "5672" "0" "c.5672G>A" "r.(?)" "p.(Arg1891His)" "" "0000704149" "00024173" "90" "3449" "0" "3449" "0" "c.3449del" "r.(?)" "p.(Pro1150Leufs*18)" "" "0000704188" "00024173" "90" "3038" "0" "3038" "0" "c.3038dup" "r.(?)" "p.(Tyr1013*)" "" "0000727884" "00024173" "30" "657" "0" "657" "0" "c.657A>G" "r.(?)" "p.(Thr219=)" "" "0000727885" "00024173" "50" "850" "0" "861" "0" "c.850_861del" "r.(?)" "p.(Pro284_Ser287del)" "" "0000727886" "00024173" "30" "978" "0" "978" "0" "c.978G>A" "r.(?)" "p.(Met326Ile)" "" "0000727887" "00024173" "30" "2611" "0" "2611" "0" "c.2611A>G" "r.(?)" "p.(Met871Val)" "" "0000727888" "00024173" "30" "3307" "0" "3307" "0" "c.3307A>G" "r.(?)" "p.(Met1103Val)" "" "0000727889" "00024173" "90" "3711" "0" "3711" "0" "c.3711del" "r.(?)" "p.(Ser1238GlnfsTer3)" "" "0000727890" "00024173" "30" "4205" "0" "4205" "0" "c.4205A>G" "r.(?)" "p.(Tyr1402Cys)" "" "0000727891" "00024173" "50" "4960" "0" "4960" "0" "c.4960G>A" "r.(?)" "p.(Asp1654Asn)" "" "0000727892" "00024173" "30" "5211" "0" "5211" "0" "c.5211A>G" "r.(?)" "p.(Leu1737=)" "" "0000727893" "00024173" "50" "5301" "0" "5302" "0" "c.5301_5302del" "r.(?)" "p.(Ala1768Glnfs*6)" "" "0000727894" "00024173" "50" "5304" "0" "5316" "0" "c.5304_5316del" "r.(?)" "p.(Ser1769Valfs*22)" "" "0000727895" "00024173" "50" "5528" "0" "5528" "0" "c.5528C>G" "r.(?)" "p.(Ser1843Cys)" "" "0000727896" "00024173" "50" "5663" "0" "5663" "0" "c.5663A>C" "r.(?)" "p.(Lys1888Thr)" "" "0000727897" "00024173" "30" "5964" "0" "5964" "0" "c.5964T>C" "r.(?)" "p.(Pro1988=)" "" "0000727898" "00024173" "50" "6227" "0" "6227" "0" "c.6227C>T" "r.(?)" "p.(Pro2076Leu)" "" "0000727899" "00024173" "30" "6657" "4" "6657" "4" "c.6657+4A>C" "r.spl?" "p.?" "" "0000727900" "00024173" "50" "9193" "0" "9194" "0" "c.*1912_*1913del" "r.(=)" "p.(=)" "" "0000727901" "00024173" "30" "19254" "0" "19254" "0" "c.*11973C>T" "r.(=)" "p.(=)" "" "0000785863" "00024173" "90" "3281" "0" "3281" "0" "c.3281dup" "r.(?)" "p.(Ser1095Valfs*6)" "3" "0000791041" "00024173" "90" "5753" "0" "5756" "0" "c.5753_5756del" "r.(?)" "p.(Val1918Glufs*87)" "" "0000791044" "00024173" "90" "5753" "0" "5756" "0" "c.5753_5756del" "r.?" "p.(Val1918Glufs*87)" "" "0000791045" "00024173" "90" "5753" "0" "5756" "0" "c.5753_5756del" "r.?" "p.(Val1918Glufs*87)" "" "0000791046" "00024173" "90" "3203" "0" "3203" "0" "c.3203C>G" "r.?" "p.(Ser1068*)" "" "0000791048" "00024173" "90" "457" "0" "457" "0" "c.457del" "r.(?)" "p.(Asp153Ilefs*4)" "" "0000791049" "00024173" "90" "384" "0" "384" "0" "c.384del" "r.(?)" "p.(Lys128Asnfs*21)" "" "0000791050" "00024173" "90" "0" "0" "0" "0" "c.-55_*1090{0}" "r.0?" "p.0?" "_1_12_" "0000791051" "00024173" "90" "3711" "0" "3711" "0" "c.3711del" "r.(?)" "p.(Ser1238Glnfs*3)" "" "0000791052" "00024173" "90" "3711" "0" "3711" "0" "c.3711del" "r.(?)" "p.(Ser1238Glnfs*3)" "" "0000791053" "00024173" "90" "6010" "0" "6010" "0" "c.6010del" "r.(?)" "p.(Val2004Trpfs*2)" "" "0000791054" "00024173" "90" "5753" "0" "5756" "0" "c.5753_5756del" "r.(?)" "p.(Val1918Glufs*87)" "" "0000791055" "00024173" "90" "348" "0" "351" "0" "c.348_351del" "r.(?)" "p.(Asn116Lysfs*32)" "" "0000791056" "00024173" "90" "5753" "0" "5756" "0" "c.5753_5756del" "r.(?)" "p.(Val1918Glufs*87)" "" "0000791057" "00024173" "90" "5753" "0" "5756" "0" "c.5753_5756del" "r.(?)" "p.(Val1918Glufs*87)" "" "0000791058" "00024173" "90" "668" "0" "668" "0" "c.668C>T" "r.(?)" "p.(Ser223Leu)" "" "0000791059" "00024173" "90" "3334" "0" "3334" "0" "c.3334C>T" "r.(?)" "p.(Arg1112*)" "" "0000791060" "00024173" "90" "1881" "0" "1882" "0" "c.1881_1882del" "r.(?)" "p.(Val629Alafs*56)" "" "0000791061" "00024173" "90" "1736" "0" "1736" "0" "c.1736C>G" "r.(?)" "p.(Thr579Ser)" "" "0000809373" "00024173" "30" "737" "0" "737" "0" "c.737C>T" "r.(?)" "p.(Ala246Val)" "" "0000809374" "00024173" "30" "1267" "0" "1267" "0" "c.1267C>T" "r.(?)" "p.(Pro423Ser)" "" "0000809375" "00024173" "50" "2305" "0" "2305" "0" "c.2305A>G" "r.(?)" "p.(Ser769Gly)" "" "0000809376" "00024173" "30" "2443" "0" "2443" "0" "c.2443A>C" "r.(?)" "p.(Met815Leu)" "" "0000809377" "00024173" "30" "2581" "0" "2581" "0" "c.2581A>G" "r.(?)" "p.(Met861Val)" "" "0000809378" "00024173" "30" "3326" "0" "3326" "0" "c.3326C>T" "r.(?)" "p.(Ala1109Val)" "" "0000809379" "00024173" "30" "4878" "0" "4878" "0" "c.4878T>C" "r.(?)" "p.(Tyr1626=)" "" "0000809380" "00024173" "30" "7105" "10" "7105" "10" "c.7105+10C>T" "r.(=)" "p.(=)" "" "0000855951" "00024173" "30" "1664" "0" "1664" "0" "c.1664C>T" "r.(?)" "p.(Thr555Met)" "" "0000855952" "00024173" "50" "3204" "0" "3227" "0" "c.3204_3227del" "r.(?)" "p.(Ala1069_Ser1076del)" "" "0000855953" "00024173" "30" "3477" "0" "3477" "0" "c.3477G>A" "r.(?)" "p.(Pro1159=)" "" "0000855954" "00024173" "30" "4037" "0" "4037" "0" "c.4037C>T" "r.(?)" "p.(Pro1346Leu)" "" "0000855955" "00024173" "30" "4047" "0" "4047" "0" "c.4047G>A" "r.(?)" "p.(Met1349Ile)" "" "0000866619" "00024173" "30" "1035" "0" "1035" "0" "c.1035C>T" "r.(?)" "p.(Asp345=)" "" "0000866620" "00024173" "50" "2166" "0" "2168" "0" "c.2166_2168dup" "r.(?)" "p.(Thr723dup)" "" "0000866621" "00024173" "30" "2364" "0" "2364" "0" "c.2364T>C" "r.(?)" "p.(Thr788=)" "" "0000866622" "00024173" "30" "3688" "0" "3741" "0" "c.3688_3741dup" "r.(?)" "p.(Tyr1230_Thr1247dup)" "" "0000895459" "00024173" "50" "1650" "0" "1685" "0" "c.1650_1685del" "r.(?)" "p.(Val553_Pro564del)" "" "0000895460" "00024173" "50" "4132" "0" "4155" "0" "c.4132_4155del" "r.(?)" "p.(Ser1378_Glu1385del)" "" "0000895462" "00024173" "70" "12255" "0" "12255" "0" "c.*4974dup" "r.(?)" "p.(=)" "" "0000895463" "00024173" "70" "19417" "0" "19417" "0" "c.*12136T>G" "r.(=)" "p.(=)" "" "0000915447" "00024173" "30" "138" "0" "138" "0" "c.138G>A" "r.(?)" "p.(Ala46=)" "" "0000915448" "00024173" "50" "6691" "0" "6691" "0" "c.6691G>T" "r.(?)" "p.(Ala2231Ser)" "" "0000927070" "00024173" "50" "7136" "0" "7136" "0" "c.7136T>G" "r.(?)" "p.(Ile2379Ser)" "" "0000927675" "00024173" "50" "2390" "0" "2390" "0" "c.2390C>G" "r.(?)" "p.(Ala797Gly)" "" "0000931214" "00024173" "90" "5753" "0" "5756" "0" "c.5753_5756del" "r.(?)" "p.(Val1918GlufsTer87)" "" "0000931215" "00024173" "90" "12921" "0" "12921" "0" "c.*5640T>C" "r.(=)" "p.(=)" "" "0000951496" "00024173" "50" "2592" "0" "2592" "0" "c.2592G>C" "r.(?)" "p.(Gln864His)" "" "0000951497" "00024173" "30" "5910" "0" "5951" "0" "c.5910_5951del" "r.(?)" "p.(Ser1985_Arg1998del)" "" "0000970292" "00024173" "30" "7533" "0" "7533" "0" "c.*252A>C" "r.(=)" "p.(=)" "" "0000983961" "00024173" "30" "2166" "0" "2168" "0" "c.2166_2168dup" "r.(?)" "p.(Thr723dup)" "" "0000983962" "00024173" "50" "2367" "0" "2367" "0" "c.2367C>A" "r.(?)" "p.(Ser789Arg)" "" "0000983963" "00024173" "30" "4132" "0" "4155" "0" "c.4132_4155del" "r.(?)" "p.(Ser1378_Glu1385del)" "" "0000983964" "00024173" "30" "4228" "0" "4228" "0" "c.4228G>A" "r.(?)" "p.(Val1410Ile)" "" "0001005669" "00024173" "30" "137" "0" "137" "0" "c.137C>T" "r.(?)" "p.(Ala46Val)" "" "0001005670" "00024173" "30" "335" "0" "335" "0" "c.335A>G" "r.(?)" "p.(Lys112Arg)" "" "0001005671" "00024173" "30" "359" "0" "359" "0" "c.359A>G" "r.(?)" "p.(Lys120Arg)" "" "0001005672" "00024173" "30" "763" "0" "763" "0" "c.763C>G" "r.(?)" "p.(Leu255Val)" "" "0001005673" "00024173" "30" "1000" "0" "1000" "0" "c.1000A>G" "r.(?)" "p.(Ile334Val)" "" "0001005674" "00024173" "50" "1052" "0" "1052" "0" "c.1052C>G" "r.(?)" "p.(Ala351Gly)" "" "0001005675" "00024173" "50" "1199" "0" "1199" "0" "c.1199C>T" "r.(?)" "p.(Thr400Ile)" "" "0001005676" "00024173" "50" "1389" "0" "1409" "0" "c.1389_1409dup" "r.(?)" "p.(Gln467_Pro473dup)" "" "0001005677" "00024173" "30" "1390" "0" "1390" "0" "c.1390G>A" "r.(?)" "p.(Glu464Lys)" "" "0001005678" "00024173" "30" "1412" "0" "1412" "0" "c.1412A>G" "r.(?)" "p.(Glu471Gly)" "" "0001005679" "00024173" "70" "1979" "0" "1979" "0" "c.1979del" "r.(?)" "p.(Thr660Lysfs*8)" "" "0001005680" "00024173" "30" "2206" "0" "2206" "0" "c.2206C>G" "r.(?)" "p.(Leu736Val)" "" "0001005681" "00024173" "50" "2240" "0" "2240" "0" "c.2240C>T" "r.(?)" "p.(Ala747Val)" "" "0001005682" "00024173" "30" "2362" "0" "2362" "0" "c.2362A>G" "r.(?)" "p.(Thr788Ala)" "" "0001005683" "00024173" "50" "2401" "0" "2401" "0" "c.2401A>G" "r.(?)" "p.(Met801Val)" "" "0001005684" "00024173" "50" "2655" "0" "2655" "0" "c.2655G>A" "r.(?)" "p.(Met885Ile)" "" "0001005685" "00024173" "50" "2734" "0" "2734" "0" "c.2734G>C" "r.(?)" "p.(Asp912His)" "" "0001005686" "00024173" "30" "2918" "0" "2918" "0" "c.2918C>T" "r.(?)" "p.(Ala973Val)" "" "0001005687" "00024173" "50" "3070" "0" "3070" "0" "c.3070A>G" "r.(?)" "p.(Met1024Val)" "" "0001005688" "00024173" "50" "3650" "0" "3650" "0" "c.3650A>T" "r.(?)" "p.(Gln1217Leu)" "" "0001005689" "00024173" "50" "3772" "0" "3772" "0" "c.3772T>G" "r.(?)" "p.(Ser1258Ala)" "" "0001005690" "00024173" "30" "4073" "0" "4073" "0" "c.4073C>T" "r.(?)" "p.(Ala1358Val)" "" "0001005691" "00024173" "30" "4168" "0" "4168" "0" "c.4168A>G" "r.(?)" "p.(Thr1390Ala)" "" "0001005692" "00024173" "30" "4330" "0" "4330" "0" "c.4330A>G" "r.(?)" "p.(Thr1444Ala)" "" "0001005693" "00024173" "30" "4472" "0" "4472" "0" "c.4472C>T" "r.(?)" "p.(Ser1491Phe)" "" "0001005694" "00024173" "30" "4700" "0" "4700" "0" "c.4700T>G" "r.(?)" "p.(Leu1567Trp)" "" "0001005695" "00024173" "30" "5575" "0" "5575" "0" "c.5575T>G" "r.(?)" "p.(Ser1859Ala)" "" "0001005696" "00024173" "50" "5912" "0" "5917" "0" "c.5912_5917del" "r.(?)" "p.(Ser1971_Arg1972del)" "" "0001005697" "00024173" "30" "5964" "0" "5984" "0" "c.5964_5984del" "r.(?)" "p.(Ser1992_Arg1998del)" "" "0001005698" "00024173" "30" "6657" "329" "6657" "329" "c.6657+329G>T" "r.(=)" "p.(=)" "" "0001005699" "00024173" "50" "7389" "0" "7389" "0" "c.*108C>T" "r.(=)" "p.(=)" "" "0001005700" "00024173" "30" "10419" "0" "10419" "0" "c.*3138C>A" "r.(=)" "p.(=)" "" "0001005701" "00024173" "50" "12182" "0" "12182" "0" "c.*4901C>T" "r.(=)" "p.(=)" "" "0001005702" "00024173" "90" "15562" "0" "15562" "0" "c.*8281G>A" "r.(=)" "p.(=)" "" "0001015884" "00024173" "30" "2443" "0" "2443" "0" "c.2443A>C" "r.(?)" "p.(Met815Leu)" "" "0001015885" "00024173" "30" "2918" "0" "2918" "0" "c.2918C>T" "r.(?)" "p.(Ala973Val)" "" "0001015886" "00024173" "30" "3129" "0" "3152" "0" "c.3129_3152del" "r.(?)" "p.(Ala1044_Ser1051del)" "" "0001017377" "00024173" "90" "2680" "0" "2680" "0" "c.2680C>T" "r.(?)" "p.(Gln894*)" "3" "0001043561" "00024173" "90" "1715" "0" "1715" "0" "c.1715T>A" "r.(?)" "p.(Leu572*)" "" "0001043562" "00024173" "30" "5584" "0" "5584" "0" "c.5584C>T" "r.(?)" "p.(Arg1862Cys)" "" "0001056992" "00024173" "50" "490" "0" "490" "0" "c.490G>A" "r.(?)" "p.(Ala164Thr)" "" "0001056993" "00024173" "30" "678" "0" "686" "0" "c.678_686del" "r.(?)" "p.(Glu227_Ser229del)" "" "0001056994" "00024173" "30" "6769" "-423" "6769" "-423" "c.6769-423dup" "r.(=)" "p.(=)" "" "0001056995" "00024173" "50" "9277" "0" "9280" "0" "c.*1996_*1999del" "r.(=)" "p.(=)" "" "0001056997" "00024173" "50" "19417" "0" "19417" "0" "c.*12136T>G" "r.(=)" "p.(=)" "" "0001067403" "00024173" "30" "359" "0" "359" "0" "c.359A>G" "r.(?)" "p.(Lys120Arg)" "" "0001067404" "00024173" "50" "1694" "0" "1694" "0" "c.1694C>T" "r.(?)" "p.(Ser565Leu)" "" "0001067405" "00024173" "50" "4057" "0" "4057" "0" "c.4057G>C" "r.(?)" "p.(Glu1353Gln)" "" "0001067406" "00024173" "50" "4118" "0" "4118" "0" "c.4118T>C" "r.(?)" "p.(Val1373Ala)" "" "0001067407" "00024173" "50" "4282" "0" "4282" "0" "c.4282C>G" "r.(?)" "p.(Gln1428Glu)" "" "0001067408" "00024173" "50" "4717" "0" "4717" "0" "c.4717A>C" "r.(?)" "p.(Lys1573Gln)" "" "0001067409" "00024173" "50" "5059" "0" "5059" "0" "c.5059G>A" "r.(?)" "p.(Glu1687Lys)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 61 "{{screeningid}}" "{{variantid}}" "0000019855" "0000040318" "0000081449" "0000130587" "0000081450" "0000130588" "0000081451" "0000130589" "0000081452" "0000130590" "0000081453" "0000130591" "0000081453" "0000130606" "0000081454" "0000130592" "0000081455" "0000130593" "0000081456" "0000130594" "0000081457" "0000130595" "0000081458" "0000130596" "0000081459" "0000130597" "0000081460" "0000130598" "0000081461" "0000130599" "0000081462" "0000130600" "0000081463" "0000130601" "0000081464" "0000130602" "0000081465" "0000130603" "0000081466" "0000130604" "0000081467" "0000130605" "0000290477" "0000647149" "0000302174" "0000665282" "0000302175" "0000665283" "0000302176" "0000665284" "0000302177" "0000665285" "0000302178" "0000665286" "0000302179" "0000665287" "0000302180" "0000665288" "0000302181" "0000665289" "0000302182" "0000665290" "0000302183" "0000665291" "0000302183" "0000665292" "0000302194" "0000665303" "0000302202" "0000665313" "0000302203" "0000665314" "0000304202" "0000667615" "0000309185" "0000683685" "0000309186" "0000683686" "0000321320" "0000704149" "0000321359" "0000704188" "0000374951" "0000785863" "0000378319" "0000791041" "0000378321" "0000791044" "0000378322" "0000791045" "0000378323" "0000791046" "0000378324" "0000791048" "0000378325" "0000791049" "0000378326" "0000791050" "0000378327" "0000791051" "0000378328" "0000791052" "0000378329" "0000791053" "0000378330" "0000791054" "0000378331" "0000791055" "0000378332" "0000791056" "0000378333" "0000791057" "0000378334" "0000791058" "0000378335" "0000791059" "0000378336" "0000791060" "0000378337" "0000791061" "0000459362" "0001017377"