### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = SOX2) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "SOX2" "SRY (sex determining region Y)-box 2" "3" "q26.3-q27" "unknown" "NC_000003.11" "UD_132084443046" "" "https://www.LOVD.nl/SOX2" "" "1" "11195" "6657" "184429" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was performed by Johan den Dunnen, supported by Global Variome." "" "g" "https://databases.lovd.nl/shared/refseq/SOX2_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2025-11-10 15:06:30" "00006" "2026-02-10 09:30:52" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00020036" "SOX2" "SRY (sex determining region Y)-box 2" "001" "NM_003106.3" "" "NP_003097.1" "" "" "" "-437" "2076" "954" "181429712" "181432224" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 6 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00356" "MCOP" "anoophthalmia/microphthalmia" "" "" "" "" "" "00006" "2014-03-14 18:41:31" "00006" "2025-11-23 21:29:13" "01659" "MCOPS3" "microphthalmia syndromic, type 3 (MCOPS-3)" "AD" "206900" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2024-06-06 16:55:16" "04214" "-" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00001" "2023-03-09 14:26:26" "05421" "microcephaly" "microcephaly" "" "" "" "" "" "00006" "2018-04-15 11:41:15" "" "" "05431" "MCOPS" "microphthalmia, syndromic (MCOPS)" "" "" "" "" "" "00006" "2018-05-23 11:15:07" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 2 "{{geneid}}" "{{diseaseid}}" "SOX2" "01659" "SOX2" "05431" ## Individuals ## Do not remove or alter this header ## ## Count = 25 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00050431" "" "" "" "1" "" "00006" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "family, 1 affected" "M" "" "United Kingdom (Great Britain)" "" "0" "Decipher" "" "" "" "00050673" "" "" "" "2" "" "00006" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "family, affected father/child" "M" "" "United Kingdom (Great Britain)" "" "0" "Decipher" "" "" "" "00154951" "" "" "" "1" "" "01807" "" "" "F" "" "(Germany)" "" "0" "" "" "" "" "00377807" "" "" "" "1" "" "00000" "{PMID:Gonzalez Rodriguez 2010:20494911}" "" "" "" "Mexico" "" "0" "" "" "Mexican-mestizo" "" "00449761" "" "" "" "1" "" "03544" "" "" "M" "-" "- (not applicable)" "" "" "" "" "white" "" "00468531" "" "" "" "1" "" "00006" "{PMID:Chassaing 2014:24033328}" "2-generation family, 1 affected, unaffected parents" "F" "" "France" "" "0" "" "" "" "Pat1" "00468532" "" "" "" "1" "" "00006" "{PMID:Chassaing 2014:24033328}" "2-generation family, affected fetus, unaffected non-carrier parents" "M" "" "France" "" "0" "" "" "" "Pat2" "00468533" "" "" "" "1" "" "00006" "{PMID:Chassaing 2014:24033328}" "2-generation family, 1 affected, unaffected parents" "M" "" "France" "" "0" "" "" "" "Pat3" "00468534" "" "" "" "1" "" "00006" "{PMID:Chassaing 2014:24033328}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "" "France" "" "0" "" "" "" "Pat4" "00468535" "" "" "" "1" "" "00006" "{PMID:Chassaing 2014:24033328}" "2-generation family, affected fetus, unaffected non-carrier parents" "F" "" "France" "" "0" "" "" "" "Pat5" "00468536" "" "" "" "2" "" "00006" "{PMID:Menetrey 2002:12002146}, {PMID:Chassaing 2014:24033328}" "2-generation family, patient and affected fetus (M), unaffected parents" "F" "" "France" "" "0" "" "" "" "patient;Pat6" "00468537" "" "" "" "1" "" "00006" "{PMID:Chassaing 2014:24033328}" "2-generation family, affected fetus, unaffected non-carrier parents" "M" "" "France" "" "0" "" "" "" "Pat7" "00468538" "" "" "" "1" "" "00006" "{PMID:Chassaing 2014:24033328}" "2-generation family, 1 affected, unaffected parents" "M" "" "France" "" "0" "" "" "" "Pat8" "00468539" "" "" "" "1" "" "00006" "{PMID:Chassaing 2014:24033328}" "2-generation family, affected fetus, unaffected non-carrier parents" "M" "" "France" "" "0" "" "" "" "Pat9" "00468540" "" "" "" "1" "" "00006" "{PMID:Chassaing 2014:24033328}" "2-generation family, affected fetus, unaffected non-carrier parents" "M" "" "France" "" "0" "" "" "" "Pat10" "00468541" "" "" "" "1" "" "00006" "{PMID:Chassaing 2014:24033328}" "2-generation family, 1 affected, unaffected parents" "F" "" "France" "" "0" "" "" "" "Pat11" "00468542" "" "" "" "1" "" "00006" "{PMID:Chassaing 2014:24033328}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "" "France" "" "0" "" "" "" "Pat12" "00468543" "" "" "" "1" "" "00006" "{PMID:Chassaing 2014:24033328}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "France" "" "0" "" "" "" "Pat13" "00468544" "" "" "" "1" "" "00006" "{PMID:Chassaing 2014:24033328}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "" "France" "" "0" "" "" "" "Pat14" "00468545" "" "" "" "1" "" "00006" "{PMID:Chassaing 2014:24033328}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "" "France" "" "0" "" "" "" "Pat15" "00468546" "" "" "" "1" "" "00006" "{PMID:Chassaing 2014:24033328}" "2-generation family, affected fetus, unaffected parents" "M" "" "France" "" "0" "" "" "" "Pat16" "00468547" "" "" "" "1" "" "00006" "{PMID:Chassaing 2014:24033328}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "France" "" "0" "" "" "" "Pat17" "00468548" "" "" "" "1" "" "00006" "{PMID:Chassaing 2014:24033328}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "France" "" "0" "" "" "" "Pat18" "00469411" "" "" "" "1" "" "00006" "{PMID:Retterer 2016:26633542}" "analysis proband (1/3040); possible combination of variants not reported" "" "" "United States" "" "0" "" "" "" "" "00472393" "" "" "" "1" "" "01164" "" "" "F" "?" "Syria" "" "0" "" "" "" "361390" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 25 "{{individualid}}" "{{diseaseid}}" "00050431" "00198" "00050673" "00198" "00154951" "00198" "00377807" "04214" "00449761" "05421" "00468531" "00356" "00468532" "00356" "00468533" "00356" "00468534" "00356" "00468535" "00356" "00468536" "00356" "00468537" "00356" "00468538" "00356" "00468539" "00356" "00468540" "00356" "00468541" "00356" "00468542" "00356" "00468543" "00356" "00468544" "00356" "00468545" "00356" "00468546" "00356" "00468547" "00356" "00468548" "00356" "00469411" "00198" "00472393" "01659" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00198, 00356, 01659, 04214, 05421, 05431 ## Count = 25 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000037043" "00198" "00050431" "00006" "Isolated (sporadic)" "" "bilateral microphthalmos, iris coloboma, microcephaly, absent septum pellucidum, dysplastic corpus callosum, intellectual disability mild, epicanthus, brachycephaly" "" "" "" "" "" "" "" "" "" "" "" "0000037285" "00198" "00050673" "00006" "Unknown" "" "intellectual disability, iris coloboma, autism" "" "" "" "" "" "" "" "" "" "" "" "0000127683" "00198" "00154951" "01807" "Unknown" "" "Global developmental delay (HP:0001263); Microcephaly (HP:0000252); Coloboma (HP:0000589); Dystonia (HP:0001332)" "" "" "" "" "" "" "" "" "" "" "" "0000272953" "04214" "00377807" "00000" "Familial" "" "Bilateral anophthalmia Corpus callosum partial agenesis, ventricular brain dilatation" "" "" "" "" "" "" "" "" "" "microphthalmia anophthalmia coloboma (MAC)" "" "0000338913" "05421" "00449761" "03544" "Isolated (sporadic)" "" "HP:0000528, HP:0002032" "" "" "" "" "" "" "" "" "MCOPS3" "anophtalmia" "" "0000353684" "00356" "00468531" "00006" "Unknown" "32y" "anophthalmia; MRI brain corpus callosum agenesis, Vermian hypoplasia; intellectual disability; short stature" "" "" "" "" "" "" "" "" "MCOPS3" "anophthalmia/microphthalmia" "" "0000353685" "00356" "00468532" "00006" "Isolated (sporadic)" "<0d" "30wg-fetus; microphthalmia, coloboma; MRI brain normal" "" "" "" "" "" "" "" "" "MCOPS3" "anophthalmia/microphthalmia" "" "0000353686" "00356" "00468533" "00006" "Unknown" "8y" "anophthalmia; MRI brain corpus callosum hypoplasia, periventricular heterotopia; intellectual disability; short stature" "" "" "" "" "" "" "" "" "MCOPS3" "anophthalmia/microphthalmia" "" "0000353687" "00356" "00468534" "00006" "Isolated (sporadic)" "5y" "anophthalmia; MRI brain normal; intellectual disability; growth hormone deficiency; micropenis" "" "" "" "" "" "" "" "" "MCOPS3" "anophthalmia/microphthalmia" "" "0000353688" "00356" "00468535" "00006" "Isolated (sporadic)" "<0d" "30wg-fetus; microphthalmia, athalamia, retinal dysplasia, sclerocornea; MRI brain normal; oesophageal atresia; hemi-uterus" "" "" "" "" "" "" "" "" "MCOPS3" "anophthalmia/microphthalmia" "" "0000353689" "00356" "00468536" "00006" "Isolated (sporadic)" "2m" "anophthalmia; MRI brain normal; oesophageal atresia" "" "" "" "" "" "" "" "" "MCOPS3" "anophthalmia/microphthalmia" "" "0000353690" "00356" "00468537" "00006" "Isolated (sporadic)" "<0d" "28wg-fetus; anophthalmia; MRI brain normal;" "" "" "" "" "" "" "" "" "MCOPS3" "anophthalmia/microphthalmia" "" "0000353691" "00356" "00468538" "00006" "Unknown" "4y" "anophthalmia, microphthalmia, coloboma; MRI brain corpus callosum hypoplasia; intellectual disability; hypogonadism, micropenis" "" "" "" "" "" "" "" "" "MCOPS3" "anophthalmia/microphthalmia" "" "0000353692" "00356" "00468539" "00006" "Isolated (sporadic)" "<0d" "23wg-fetus; anophthalmia; MRI brain ventriculomegaly;" "" "" "" "" "" "" "" "" "MCOPS3" "anophthalmia/microphthalmia" "" "0000353693" "00356" "00468540" "00006" "Isolated (sporadic)" "<0d" "24wg-fetus; microphthalmia, retinal dysplasia; MRI brain normal;" "" "" "" "" "" "" "" "" "MCOPS3" "anophthalmia/microphthalmia" "" "0000353694" "00356" "00468541" "00006" "Unknown" "37y" "microphthalmia; intellectual disability; hypogonadism" "" "" "" "" "" "" "" "" "MCOPS3" "anophthalmia/microphthalmia" "" "0000353695" "00356" "00468542" "00006" "Isolated (sporadic)" "17y" "anophthalmia; intellectual disability; growth hormone deficiency; cleft palate" "" "" "" "" "" "" "" "" "MCOPS3" "anophthalmia/microphthalmia" "" "0000353696" "00356" "00468543" "00006" "Isolated (sporadic)" "2y" "anophthalmia; MRI brain normal; intellectual disability; atrial septal defect; pyelic dilatation" "" "" "" "" "" "" "" "" "MCOPS3" "anophthalmia/microphthalmia" "" "0000353697" "00356" "00468544" "00006" "Isolated (sporadic)" "8y" "anophthalmia; MRI brain left cerebellar hemisphere hypoplasia; intellectual disability; cryptorchidism" "" "" "" "" "" "" "" "" "MCOPS3" "anophthalmia/microphthalmia" "" "0000353698" "00356" "00468545" "00006" "Isolated (sporadic)" "11y" "anophthalmia, microphthalmia; MRI brain corpus callosum hypoplasia; intellectual disability; oesophageal stenosis; micropenis" "" "" "" "" "" "" "" "" "MCOPS3" "anophthalmia/microphthalmia" "" "0000353699" "00356" "00468546" "00006" "Unknown" "<0d" "23wg-fetus; anophthalmia; MRI brain normal; bilateral cleft l/p" "" "" "" "" "" "" "" "" "MCOPS3" "anophthalmia/microphthalmia" "" "0000353700" "00356" "00468547" "00006" "Isolated (sporadic)" "20y" "anophthalmia; MRI brain corpus callosum hypoplasia, Vermian hypoplasia; intellectual disability; growth hormone deficiency; hypogonadism" "" "" "" "" "" "" "" "" "MCOPS3" "anophthalmia/microphthalmia" "" "0000353701" "00356" "00468548" "00006" "Isolated (sporadic)" "28y" "anophthalmia, microphthalmia; MRI brain normal; intellectual disability; growth hormone deficiency; hypogonadism" "" "" "" "" "" "" "" "" "MCOPS3" "anophthalmia/microphthalmia" "" "0000354564" "00198" "00469411" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "abnormality of the nervous system" "" "0000357196" "01659" "00472393" "01164" "Unknown" "06y" "Microcephaly, Anophthalmia, Abnormal optic chiasm morphology, Optic nerve aplasia" "" "" "" "" "" "" "" "" "" "" "" ## Screenings ## Do not remove or alter this header ## ## Count = 25 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000050376" "00050431" "1" "00006" "00006" "2015-09-27 16:16:40" "" "" "SEQ;SEQ-NG-I" "DNA" "" "" "0000050618" "00050673" "1" "00006" "00006" "2015-09-27 16:16:40" "" "" "SEQ;SEQ-NG-I" "DNA" "" "" "0000155812" "00154951" "0" "01807" "01807" "2018-03-07 03:32:39" "" "" "SEQ" "DNA" "" "" "0000379011" "00377807" "1" "00000" "00008" "2021-08-02 20:37:33" "" "" "SEQ" "DNA" "Blood" "" "0000451357" "00449761" "1" "03544" "03544" "2024-05-14 14:08:42" "" "" "SEQ-NG-I" "DNA" "peripheral blood" "CES" "0000470198" "00468531" "1" "00006" "00006" "2025-11-10 17:03:53" "00006" "2025-11-10 17:15:58" "arrayCGH" "DNA" "" "gene panel" "0000470199" "00468532" "1" "00006" "00006" "2025-11-10 17:03:53" "" "" "PCRq;SEQ" "DNA" "" "gene panel" "0000470200" "00468533" "1" "00006" "00006" "2025-11-10 17:03:53" "00006" "2025-11-10 17:22:50" "arrayCGH" "DNA" "" "gene panel" "0000470201" "00468534" "1" "00006" "00006" "2025-11-10 17:03:53" "00006" "2025-11-10 17:31:23" "arrayCGH" "DNA" "" "gene panel" "0000470202" "00468535" "1" "00006" "00006" "2025-11-10 17:03:53" "00006" "2025-11-10 17:32:19" "arrayCGH" "DNA" "" "gene panel" "0000470203" "00468536" "1" "00006" "00006" "2025-11-10 17:03:53" "" "" "PCRq;SEQ" "DNA" "" "gene panel" "0000470204" "00468537" "1" "00006" "00006" "2025-11-10 17:03:53" "" "" "PCRq;SEQ" "DNA" "" "gene panel" "0000470205" "00468538" "1" "00006" "00006" "2025-11-10 17:03:53" "" "" "PCRq;SEQ" "DNA" "" "gene panel" "0000470206" "00468539" "1" "00006" "00006" "2025-11-10 17:03:53" "" "" "PCRq;SEQ" "DNA" "" "gene panel" "0000470207" "00468540" "1" "00006" "00006" "2025-11-10 17:03:53" "" "" "PCRq;SEQ" "DNA" "" "gene panel" "0000470208" "00468541" "1" "00006" "00006" "2025-11-10 17:03:53" "" "" "PCRq;SEQ" "DNA" "" "gene panel" "0000470209" "00468542" "1" "00006" "00006" "2025-11-10 17:03:53" "" "" "PCRq;SEQ" "DNA" "" "gene panel" "0000470210" "00468543" "1" "00006" "00006" "2025-11-10 17:03:53" "" "" "PCRq;SEQ" "DNA" "" "gene panel" "0000470211" "00468544" "1" "00006" "00006" "2025-11-10 17:03:53" "" "" "PCRq;SEQ" "DNA" "" "gene panel" "0000470212" "00468545" "1" "00006" "00006" "2025-11-10 17:03:53" "" "" "PCRq;SEQ" "DNA" "" "gene panel" "0000470213" "00468546" "1" "00006" "00006" "2025-11-10 17:03:53" "" "" "PCRq;SEQ" "DNA" "" "gene panel" "0000470214" "00468547" "1" "00006" "00006" "2025-11-10 17:03:53" "" "" "PCRq;SEQ" "DNA" "" "gene panel" "0000470215" "00468548" "1" "00006" "00006" "2025-11-10 17:03:53" "" "" "PCRq;SEQ" "DNA" "" "gene panel" "0000471079" "00469411" "1" "00006" "00006" "2025-11-13 13:02:43" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000474062" "00472393" "1" "01164" "01164" "2026-02-09 15:22:29" "" "" "SEQ-NG-I" "DNA" "Blood" "" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 3 "{{screeningid}}" "{{geneid}}" "0000050376" "SOX2" "0000379011" "SOX2" "0000474062" "SOX2" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 55 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000079356" "0" "90" "3" "181430372" "181430372" "subst" "0" "00006" "SOX2_000031" "g.181430372T>C" "" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "" "" "" "De novo" "" "" "0" "" "" "g.181712584T>C" "" "pathogenic" "" "0000079598" "0" "90" "3" "181384474" "182500974" "del" "0" "00006" "SOX2_000000" "g.181384474_182500974del" "" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "" "" "decreased gene dosage" "De novo" "" "" "0" "" "" "g.181666686_182783186del" "" "pathogenic" "" "0000256547" "0" "50" "3" "181430224" "181430224" "subst" "2.21219E-5" "01943" "SOX2_000003" "g.181430224A>G" "" "" "" "SOX2(NM_003106.2):c.76A>G (p.T26A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.181712436A>G" "" "VUS" "" "0000298437" "0" "30" "3" "181430719" "181430719" "subst" "7.90455E-5" "02325" "SOX2_000004" "g.181430719G>A" "" "" "" "SOX2(NM_003106.4):c.571G>A (p.(Ala191Thr), p.A191T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.181712931G>A" "" "likely benign" "" "0000298438" "0" "90" "3" "181430751" "181430751" "del" "0" "02325" "SOX2_000005" "g.181430751del" "" "" "" "SOX2(NM_003106.4):c.603delC (p.D201Efs*2)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.181712963del" "" "pathogenic" "" "0000341749" "0" "50" "3" "181430485" "181430485" "subst" "0" "02327" "SOX2_000007" "g.181430485C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.181712697C>T" "" "VUS" "" "0000344575" "0" "90" "3" "181430611" "181430611" "subst" "0" "02327" "SOX2_000008" "g.181430611C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.181712823C>T" "" "pathogenic" "" "0000345812" "0" "30" "3" "181430701" "181430701" "subst" "8.33556E-6" "02327" "SOX2_000009" "g.181430701G>A" "" "" "" "SOX2(NM_003106.4):c.553G>A (p.G185S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.181712913G>A" "" "likely benign" "" "0000356892" "0" "90" "3" "181430628" "181430628" "subst" "0" "01807" "SOX2_000030" "g.181430628C>G" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.181712840C>G" "" "pathogenic" "" "0000518570" "0" "10" "3" "181430202" "181430202" "subst" "6.30132E-5" "02330" "SOX2_000032" "g.181430202G>C" "" "" "" "SOX2(NM_003106.4):c.54G>C (p.S18=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.181712414G>C" "" "benign" "" "0000518572" "0" "10" "3" "181430601" "181430601" "subst" "0.00104892" "02330" "SOX2_000033" "g.181430601G>A" "" "" "" "SOX2(NM_003106.4):c.453G>A (p.A151=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.181712813G>A" "" "benign" "" "0000518573" "0" "90" "3" "181430666" "181430666" "del" "0" "02325" "SOX2_000034" "g.181430666del" "" "" "" "SOX2(NM_003106.4):c.518delT (p.M173Rfs*30)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.181712878del" "" "pathogenic" "" "0000518574" "0" "50" "3" "181430711" "181430711" "subst" "0" "01943" "SOX2_000035" "g.181430711C>T" "" "" "" "SOX2(NM_003106.2):c.563C>T (p.A188V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.181712923C>T" "" "VUS" "" "0000518576" "0" "50" "3" "181430719" "181430719" "subst" "7.90455E-5" "01804" "SOX2_000004" "g.181430719G>A" "" "" "" "SOX2(NM_003106.4):c.571G>A (p.(Ala191Thr), p.A191T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.181712931G>A" "" "VUS" "" "0000518577" "0" "50" "3" "181430719" "181430719" "subst" "7.90455E-5" "02327" "SOX2_000004" "g.181430719G>A" "" "" "" "SOX2(NM_003106.4):c.571G>A (p.(Ala191Thr), p.A191T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.181712931G>A" "" "VUS" "" "0000518578" "0" "10" "3" "181430982" "181430982" "subst" "0.0017347" "02330" "SOX2_000036" "g.181430982C>T" "" "" "" "SOX2(NM_003106.2):c.834C>T (p.L278=), SOX2(NM_003106.4):c.834C>T (p.L278=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.181713194C>T" "" "benign" "" "0000518579" "0" "30" "3" "181430982" "181430982" "subst" "0.0017347" "01943" "SOX2_000036" "g.181430982C>T" "" "" "" "SOX2(NM_003106.2):c.834C>T (p.L278=), SOX2(NM_003106.4):c.834C>T (p.L278=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.181713194C>T" "" "likely benign" "" "0000608426" "0" "70" "3" "181430281" "181430281" "subst" "0" "02327" "SOX2_000037" "g.181430281A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.181712493A>C" "" "likely pathogenic" "" "0000608427" "0" "90" "3" "181430954" "181430954" "dup" "0" "02327" "SOX2_000038" "g.181430954dup" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.181713166dup" "" "pathogenic" "" "0000688987" "0" "50" "3" "181431007" "181431007" "subst" "1.26348E-5" "01943" "SOX2_000041" "g.181431007G>A" "" "" "" "SOX2(NM_003106.2):c.859G>A (p.A287T), SOX2(NM_003106.4):c.859G>A (p.A287T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000719285" "0" "90" "3" "181430218" "181430237" "del" "0" "02329" "SOX2_000006" "g.181430218_181430237del" "" "" "" "SOX2(NM_003106.4):c.70_89delAACTCCACCGCGGCGGCGGC (p.N24Rfs*65)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000719286" "0" "50" "3" "181430719" "181430719" "subst" "7.90455E-5" "02329" "SOX2_000004" "g.181430719G>A" "" "" "" "SOX2(NM_003106.4):c.571G>A (p.(Ala191Thr), p.A191T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000792031" "0" "90" "3" "181430218" "181430218" "del" "0" "00000" "SOX2_000042" "g.181430218del120" "" "{PMID:Gonzalez Rodriguez 2010:20494911}" "" "c.70del120" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000801086" "0" "90" "3" "181430628" "181430628" "subst" "0" "02325" "SOX2_000030" "g.181430628C>G" "" "" "" "SOX2(NM_003106.4):c.480C>G (p.Y160*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000885643" "0" "50" "3" "181430494" "181430494" "subst" "0" "02325" "SOX2_000043" "g.181430494A>T" "" "" "" "SOX2(NM_003106.4):c.346A>T (p.T116S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000885644" "0" "50" "3" "181430701" "181430701" "subst" "8.33556E-6" "02325" "SOX2_000009" "g.181430701G>A" "" "" "" "SOX2(NM_003106.4):c.553G>A (p.G185S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000931484" "0" "90" "3" "181430201" "181430201" "subst" "1.9548E-5" "03779" "SOX2_000044" "g.181430201C>A" "" "" "" "" "" "Unknown" "" "rs750091101" "0" "" "" "" "" "pathogenic" "" "0000975670" "0" "50" "3" "181430362" "181430362" "subst" "0" "01804" "SOX2_000045" "g.181430362A>C" "" "" "" "SOX2(NM_003106.4):c.214A>C (p.(Ser72Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000985215" "0" "70" "3" "181431083" "181431084" "del" "0" "03544" "SOX2_000046" "g.181431083_181431084del" "" "" "" "" "" "De novo" "-" "" "0" "" "" "g.181713295_181713296del" "{CV:3363103}" "likely pathogenic" "ACMG" "0000989414" "0" "90" "3" "181430628" "181430628" "subst" "0" "03779" "SOX2_000030" "g.181430628C>G" "" "" "" "" "" "CLASSIFICATION record" "" "rs55683010" "0" "" "" "" "" "pathogenic" "" "0000993454" "0" "30" "3" "181430554" "181430554" "subst" "1.77126E-5" "01804" "SOX2_000047" "g.181430554G>A" "" "" "" "SOX2(NM_003106.3):c.406G>A (p.(Gly136Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000993455" "0" "50" "3" "181430670" "181430670" "subst" "0" "01804" "SOX2_000048" "g.181430670G>A" "" "" "" "SOX2(NM_003106.3):c.522G>A (p.(Met174Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000993456" "0" "50" "3" "181431100" "181431100" "subst" "0" "01804" "SOX2_000049" "g.181431100T>C" "" "" "" "SOX2(NM_003106.3):c.952T>C (p.(Ter318Argext*?))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001024746" "0" "50" "3" "181431007" "181431007" "subst" "1.26348E-5" "02325" "SOX2_000041" "g.181431007G>A" "" "" "" "SOX2(NM_003106.2):c.859G>A (p.A287T), SOX2(NM_003106.4):c.859G>A (p.A287T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001058301" "0" "90" "3" "179477463" "183271852" "del" "0" "00006" "SOX2_000051" "g.(?_179477463)_(183271852_?)del" "" "{PMID:Chassaing 2014:24033328}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "hg18 3q26.33q27.1(180,960,157-184,754,546)x1" "g.(?_179759675)_(183554064_?)del" "" "pathogenic (dominant)" "" "0001058302" "0" "90" "3" "181430119" "181431322" "del" "0" "00006" "SOX2_000055" "g.(?_181430119)_(181431322_?)del" "" "{PMID:Chassaing 2014:24033328}" "" "(?_-30)_(*220_?)del" "" "De novo" "" "" "0" "" "" "g.(?_181712331)_(181713534_?)del" "" "pathogenic (dominant)" "" "0001058303" "0" "90" "3" "181292708" "181618928" "del" "0" "00006" "SOX2_000052" "g.(?_181292708)_(181618928_?)del" "" "{PMID:Chassaing 2014:24033328}" "" "hg18 3q26.33q26.33(182,775,402-183,101,622)x1" "0.33Mb deletion" "Germline/De novo (untested)" "" "" "0" "" "" "g.(?_181574920)_(181901140_?)del" "" "pathogenic (dominant)" "" "0001058304" "0" "90" "3" "181395277" "181475812" "del" "0" "00006" "SOX2_000053" "g.(?_181395277)_(181475812_?)del" "" "{PMID:Chassaing 2014:24033328}" "" "hg18 3q26.33q26.33(182,877,971-182,958,506)x1" "" "De novo" "" "" "0" "" "" "g.(?_181677489)_(181758024_?)del" "" "pathogenic (dominant)" "" "0001058305" "0" "90" "3" "179529660" "183819341" "del" "0" "00006" "SOX2_000054" "g.(?_179529660)_(183819341_?)del" "" "{PMID:Chassaing 2014:24033328}" "" "" "" "De novo" "" "" "0" "" "hg18 3q26.33q27.1(181,012,354-185,302,035)x1" "g.(?_179811872)_(184101553_?)del" "" "pathogenic (dominant)" "" "0001058306" "0" "90" "3" "181430218" "181430234" "del" "0" "00006" "SOX2_000050" "g.181430218_181430234del" "" "{PMID:Menetrey 2002:12002146}, {PMID:Chassaing 2014:24033328}" "" "" "mother germinal mosaicism with recurrence" "De novo" "" "" "0" "" "" "g.181712430_181712446del" "" "pathogenic (dominant)" "" "0001058307" "0" "90" "3" "181430235" "181430244" "dup" "0" "00006" "SOX2_000056" "g.181430235_181430244dup" "" "{PMID:Chassaing 2014:24033328}" "" "86_95dup" "" "De novo" "" "" "0" "" "" "g.181712447_181712456dup" "" "pathogenic (dominant)" "" "0001058308" "0" "90" "3" "181430299" "181430299" "subst" "0" "00006" "SOX2_000057" "g.181430299T>C" "" "{PMID:Chassaing 2014:24033328}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.181712511T>C" "" "pathogenic (dominant)" "" "0001058309" "0" "90" "3" "181430306" "181430321" "delins" "0" "00006" "SOX2_000058" "g.181430306_181430321delinsAT" "" "{PMID:Chassaing 2014:24033328}" "" "158_174delinsATG" "" "De novo" "" "" "0" "" "" "g.181712518_181712533delinsAT" "" "pathogenic (dominant)" "" "0001058310" "0" "90" "3" "181430348" "181430348" "del" "0" "00006" "SOX2_000059" "g.181430348del" "" "{PMID:Chassaing 2014:24033328}" "" "200delA" "" "De novo" "" "" "0" "" "" "g.181712560del" "" "pathogenic (dominant)" "" "0001058311" "0" "90" "3" "181430369" "181430369" "subst" "0" "00006" "SOX2_000060" "g.181430369G>C" "" "{PMID:Chassaing 2014:24033328}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.181712581G>C" "" "pathogenic (dominant)" "" "0001058312" "0" "90" "3" "181430384" "181430384" "subst" "0" "00006" "SOX2_000061" "g.181430384G>C" "" "{PMID:Chassaing 2014:24033328}" "" "" "" "De novo" "" "" "0" "" "" "g.181712596G>C" "" "pathogenic (dominant)" "" "0001058313" "0" "90" "3" "181430393" "181430393" "del" "0" "00006" "SOX2_000062" "g.181430393del" "" "{PMID:Chassaing 2014:24033328}" "" "245delT" "" "De novo" "" "" "0" "" "" "g.181712605del" "" "pathogenic (dominant)" "" "0001058314" "0" "90" "3" "181430403" "181430404" "delins" "0" "00006" "SOX2_000063" "g.181430403_181430404delinsT" "" "{PMID:Chassaing 2014:24033328}" "" "255_256delGGinsT" "" "De novo" "" "" "0" "" "" "g.181712615_181712616delinsT" "" "pathogenic (dominant)" "" "0001058315" "0" "90" "3" "181430458" "181430458" "subst" "0" "00006" "SOX2_000064" "g.181430458G>T" "" "{PMID:Chassaing 2014:24033328}" "" "" "" "De novo" "" "" "0" "" "" "g.181712670G>T" "" "pathogenic (dominant)" "" "0001058316" "0" "90" "3" "181430624" "181430627" "dup" "0" "00006" "SOX2_000065" "g.181430624_181430627dup" "" "{PMID:Chassaing 2014:24033328}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.181712836_181712839dup" "" "pathogenic (dominant)" "" "0001058317" "0" "90" "3" "181430661" "181430661" "subst" "0" "00006" "SOX2_000066" "g.181430661C>G" "" "{PMID:Chassaing 2014:24033328}" "" "" "" "De novo" "" "" "0" "" "" "g.181712873C>G" "" "pathogenic (dominant)" "" "0001058318" "0" "90" "3" "181430747" "181430747" "del" "0" "00006" "SOX2_000068" "g.181430747del" "" "{PMID:Chassaing 2014:24033328}" "" "599delA" "" "De novo" "" "" "0" "" "" "g.181712959del" "" "pathogenic (dominant)" "" "0001059201" "0" "90" "3" "181430731" "181430731" "subst" "0" "00006" "SOX2_000067" "g.181430731C>T" "" "{PMID:Retterer 2016:26633542}" "" "" "variants reported seperately, unknown if mono-allelic or bi-allelic" "Unknown" "" "" "0" "" "" "g.181712943C>T" "" "pathogenic" "" "0001064123" "0" "90" "3" "181430167" "181430168" "dup" "0" "02325" "SOX2_000069" "g.181430167_181430168dup" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001068174" "0" "70" "3" "181431099" "181431099" "dup" "0" "01164" "SOX2_000070" "g.181431099dup" "" "" "" "" "ACMG/AMP: PVS1-strong,PM2-supporting,PM4-moderate; (PVS1 reduced to \"strong\", numerous LoF variants causing frameshift in the very 3´end of the gene are known to be pathogenic for Microphthalmia, syndromic 3 (OMIM, ClinVar), in addition PM4, to reflect this pathomechanism (expert opinion)" "Germline" "?" "" "" "" "" "g.181713311dup" "" "likely pathogenic (dominant)" "ACMG" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes SOX2 ## Count = 55 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000079356" "00020036" "00" "224" "0" "224" "0" "c.224T>C" "r.(?)" "p.(Leu75Pro)" "" "0000079598" "00020036" "00" "-45675" "0" "1070826" "0" "c.-45675_*1069872del" "r.0?" "p.0?" "" "0000256547" "00020036" "50" "76" "0" "76" "0" "c.76A>G" "r.(?)" "p.(Thr26Ala)" "" "0000298437" "00020036" "30" "571" "0" "571" "0" "c.571G>A" "r.(?)" "p.(Ala191Thr)" "" "0000298438" "00020036" "90" "603" "0" "603" "0" "c.603del" "r.(?)" "p.(Asp201GlufsTer2)" "" "0000341749" "00020036" "50" "337" "0" "337" "0" "c.337C>T" "r.(?)" "p.(Arg113Trp)" "" "0000344575" "00020036" "90" "463" "0" "463" "0" "c.463C>T" "r.(?)" "p.(Gln155Ter)" "" "0000345812" "00020036" "30" "553" "0" "553" "0" "c.553G>A" "r.(?)" "p.(Gly185Ser)" "" "0000356892" "00020036" "90" "480" "0" "480" "0" "c.480C>G" "r.(?)" "p.(Tyr160*)" "1" "0000518570" "00020036" "10" "54" "0" "54" "0" "c.54G>C" "r.(?)" "p.(Ser18=)" "" "0000518572" "00020036" "10" "453" "0" "453" "0" "c.453G>A" "r.(?)" "p.(Ala151=)" "" "0000518573" "00020036" "90" "518" "0" "518" "0" "c.518del" "r.(?)" "p.(Met173ArgfsTer30)" "" "0000518574" "00020036" "50" "563" "0" "563" "0" "c.563C>T" "r.(?)" "p.(Ala188Val)" "" "0000518576" "00020036" "50" "571" "0" "571" "0" "c.571G>A" "r.(?)" "p.(Ala191Thr)" "" "0000518577" "00020036" "50" "571" "0" "571" "0" "c.571G>A" "r.(?)" "p.(Ala191Thr)" "" "0000518578" "00020036" "10" "834" "0" "834" "0" "c.834C>T" "r.(?)" "p.(Leu278=)" "" "0000518579" "00020036" "30" "834" "0" "834" "0" "c.834C>T" "r.(?)" "p.(Leu278=)" "" "0000608426" "00020036" "70" "133" "0" "133" "0" "c.133A>C" "r.(?)" "p.(Met45Leu)" "" "0000608427" "00020036" "90" "806" "0" "806" "0" "c.806dup" "r.(?)" "p.(Asp269GlufsTer41)" "" "0000688987" "00020036" "50" "859" "0" "859" "0" "c.859G>A" "r.(?)" "p.(Ala287Thr)" "" "0000719285" "00020036" "90" "70" "0" "89" "0" "c.70_89del" "r.(?)" "p.(Asn24ArgfsTer65)" "" "0000719286" "00020036" "50" "571" "0" "571" "0" "c.571G>A" "r.(?)" "p.(Ala191Thr)" "" "0000792031" "00020036" "90" "70" "0" "70" "0" "c.70del120" "r.(?)" "p.?" "1" "0000801086" "00020036" "90" "480" "0" "480" "0" "c.480C>G" "r.(?)" "p.(Tyr160*)" "" "0000885643" "00020036" "50" "346" "0" "346" "0" "c.346A>T" "r.(?)" "p.(Thr116Ser)" "" "0000885644" "00020036" "50" "553" "0" "553" "0" "c.553G>A" "r.(?)" "p.(Gly185Ser)" "" "0000931484" "00020036" "90" "53" "0" "53" "0" "c.53C>A" "r.(?)" "p.(Ser18Ter)" "" "0000975670" "00020036" "50" "214" "0" "214" "0" "c.214A>C" "r.(?)" "p.(Ser72Arg)" "" "0000985215" "00020036" "70" "935" "0" "936" "0" "c.935_936del" "r.(?)" "p.(Leu312Profs*125)" "1" "0000989414" "00020036" "90" "480" "0" "480" "0" "c.480C>G" "r.(?)" "p.(Tyr160Ter)" "" "0000993454" "00020036" "30" "406" "0" "406" "0" "c.406G>A" "r.(?)" "p.(Gly136Ser)" "" "0000993455" "00020036" "50" "522" "0" "522" "0" "c.522G>A" "r.(?)" "p.(Met174Ile)" "" "0000993456" "00020036" "50" "952" "0" "952" "0" "c.952T>C" "r.(?)" "p.(*318Argext*27)" "" "0001024746" "00020036" "50" "859" "0" "859" "0" "c.859G>A" "r.(?)" "p.(Ala287Thr)" "" "0001058301" "00020036" "90" "0" "0" "0" "0" "c.(?_-1952686)_(*1840750del_?)del" "r.0" "p.0" "_1_" "0001058302" "00020036" "90" "-30" "0" "1174" "0" "c.(?_-30)_(*220_?)del" "r.0" "p.0" "_1_" "0001058303" "00020036" "90" "-1374410" "0" "188780" "0" "c.(?_-1374410)_(*187826_?)del" "r.0" "p.0" "_1_" "0001058304" "00020036" "90" "-34872" "0" "45664" "0" "c.(?_-34872)_(*44710_?)del" "r.0" "p.0" "_1_" "0001058305" "00020036" "90" "-1900489" "0" "2389193" "0" "c.(?_-1900489)_(*2388239_?)del" "r.0" "p.0" "_1_" "0001058306" "00020036" "90" "70" "0" "86" "0" "c.70_86del" "r.(?)" "p.(Asn24GlyfsTer66)" "" "0001058307" "00020036" "90" "87" "0" "96" "0" "c.87_96dup" "r.(?)" "p.(Asn33GlyfsTer66)" "" "0001058308" "00020036" "90" "151" "0" "151" "0" "c.151T>C" "r.(?)" "p.(Trp51Arg)" "" "0001058309" "00020036" "90" "158" "0" "173" "0" "c.158_173delinsAT" "r.(?)" "p.(Arg53HisfsTer38)" "" "0001058310" "00020036" "90" "200" "0" "200" "0" "c.200del" "r.(?)" "p.(His67ProfsTer36)" "" "0001058311" "00020036" "90" "221" "0" "221" "0" "c.221G>C" "r.(?)" "p.(Arg74Pro)" "" "0001058312" "00020036" "90" "236" "0" "236" "0" "c.236G>C" "r.(?)" "p.(Trp79Ser)" "" "0001058313" "00020036" "90" "245" "0" "245" "0" "c.245del" "r.(?)" "p.(Leu82CysfsTer21)" "" "0001058314" "00020036" "90" "255" "0" "256" "0" "c.255_256delinsT" "r.(?)" "p.(Glu86ArgfsTer17)" "" "0001058315" "00020036" "90" "310" "0" "310" "0" "c.310G>T" "r.(?)" "p.(Glu104Ter)" "" "0001058316" "00020036" "90" "476" "0" "479" "0" "c.476_479dup" "r.(?)" "p.(Tyr160Ter)" "" "0001058317" "00020036" "90" "513" "0" "513" "0" "c.513C>G" "r.(?)" "p.(Tyr171Ter)" "" "0001058318" "00020036" "90" "599" "0" "599" "0" "c.599del" "r.(?)" "p.(Tyr200SerfsTer3)" "" "0001059201" "00020036" "90" "583" "0" "583" "0" "c.583C>T" "r.(?)" "p.(Gln195Ter)" "" "0001064123" "00020036" "90" "19" "0" "20" "0" "c.19_20dup" "r.(?)" "p.(Glu8Argfs*3)" "" "0001068174" "00020036" "70" "951" "0" "951" "0" "c.951dup" "r.(?)" "p.(*318Valext*119)" "1" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 25 "{{screeningid}}" "{{variantid}}" "0000050376" "0000079356" "0000050618" "0000079598" "0000155812" "0000356892" "0000379011" "0000792031" "0000451357" "0000985215" "0000470198" "0001058301" "0000470199" "0001058302" "0000470200" "0001058303" "0000470201" "0001058304" "0000470202" "0001058305" "0000470203" "0001058306" "0000470204" "0001058307" "0000470205" "0001058308" "0000470206" "0001058309" "0000470207" "0001058310" "0000470208" "0001058311" "0000470209" "0001058312" "0000470210" "0001058313" "0000470211" "0001058314" "0000470212" "0001058315" "0000470213" "0001058316" "0000470214" "0001058317" "0000470215" "0001058318" "0000471079" "0001059201" "0000474062" "0001068174"