### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = SPG7) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "SPG7" "spastic paraplegia 7 (pure and complicated autosomal recessive)" "16" "q24.3" "unknown" "NG_008082.1" "UD_132084508002" "" "http://www.LOVD.nl/SPG7" "" "1" "11237" "6687" "602783" "1" "1" "1" "1" " A database from the MITOchondrial DYNamics variation portal.\r\nEstablishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "alias: paraplegin (PGN)" "g" "http://databases.lovd.nl/shared/refseq/SPG7_codingDNA.html" "1" "" " A database from the MITOchondrial DYNamics variation portal." "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2017-08-01 16:29:44" "00000" "2026-01-20 18:57:21" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00020169" "SPG7" "transcript variant 1" "001" "NM_003119.2" "" "NP_003110.1" "" "" "" "-21" "3061" "2388" "89574805" "89624174" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 11 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00000" "Healthy/Control" "Healthy individual / control" "" "" "" "" "" "00000" "2012-07-26 17:29:43" "" "" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00232" "SRS;RSS" "Silver-Russell syndrome (SRS, Russell-Silver syndrome (RSS))" "AD" "180860" "" "" "" "00006" "2013-10-09 19:30:21" "00006" "2021-12-10 21:51:32" "00325" "SPG" "paraplegia, spastic (SPG)" "" "" "" "" "" "00006" "2014-02-15 22:29:17" "00006" "2016-11-28 13:01:43" "02642" "SPG7" "paraplegia, spastic, autosomal recessive, type 7 (SPG-7)" "AD;AR" "607259" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "04201" "SCAR" "ataxia, spinocerebellar, autosomal recessive" "AR" "" "" "" "" "00006" "2015-02-20 09:53:55" "00006" "2021-12-10 21:51:32" "04214" "-" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00001" "2023-03-09 14:26:26" "04293" "OPA" "atrophy, optic (OPA)" "" "" "" "" "" "00006" "2015-06-21 20:48:01" "00006" "2018-11-16 15:59:50" "05356" "ataxia" "ataxia" "" "" "" "" "" "00006" "2017-12-21 19:14:03" "" "" "05684" "neuropathy, optic" "neuropathy, optic" "" "" "" "" "" "00006" "2020-01-10 11:57:41" "00091" "2021-02-19 09:59:43" "07210" "scoliosis" "scoliosis" "" "" "" "" "" "00006" "2025-12-05 11:13:58" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 2 "{{geneid}}" "{{diseaseid}}" "SPG7" "02642" "SPG7" "05684" ## Individuals ## Do not remove or alter this header ## ## Count = 49 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00047000" "" "" "" "1" "" "01330" "" "" "" "" "" "" "0" "" "" "" "" "00054863" "" "" "" "1" "" "01479" "{PMID:van de Warrenburg 2016:27165006}, {DOI:van de Warrenburg 2016: 10.1038/ejhg.2016.42}" "" "F" "no" "Netherlands" "" "0" "" "" "" "Pat1" "00054864" "" "" "" "1" "" "01479" "{PMID:van de Warrenburg 2016:27165006}, {DOI:van de Warrenburg 2016: 10.1038/ejhg.2016.42}" "" "M" "" "" "" "0" "" "" "" "Pat2" "00054865" "" "" "" "1" "" "01479" "{PMID:van de Warrenburg 2016:27165006}, {DOI:van de Warrenburg 2016: 10.1038/ejhg.2016.42}" "" "M" "" "" "" "0" "" "" "" "Pat3" "00073162" "" "" "" "1" "" "01400" "ATX529" "" "M" "" "France" "" "0" "" "" "" "" "00080118" "" "" "" "1" "" "01594" "{PMID:Spengler 2012:22683032}, {PMID:Spengler 2013:23885231}, for EUCID-SRS consortium" "" "M" "" "" "" "0" "" "" "" "22683032-PatSR596/07" "00152016" "" "" "" "1" "" "01741" "" "" "" "" "" "" "0" "" "" "" "" "00154960" "" "" "" "1" "" "01807" "" "" "M" "" "(Germany)" "" "0" "" "" "" "" "00208777" "" "" "" "1" "" "01164" "" "" "F" "" "Germany" "" "0" "" "" "" "" "00248146" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" "" "00275583" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" "" "00276023" "" "" "" "1" "" "01164" "" "" "M" "" "" "" "0" "" "" "" "" "00291595" "" "" "" "9" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00291596" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00291597" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00291598" "" "" "" "3" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00291599" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00291600" "" "" "" "44" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00291601" "" "" "" "42" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00295573" "" "" "" "1" "" "01164" "" "" "M" "" "" "" "0" "" "" "" "" "00295597" "" "" "" "1" "" "01164" "" "" "M" "" "" "" "0" "" "" "" "" "00295647" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" "" "00295652" "" "" "" "1" "" "01164" "" "" "M" "" "" "" "0" "" "" "" "" "00295656" "" "" "" "1" "" "01164" "" "" "M" "" "" "" "0" "" "" "" "" "00295661" "" "" "" "1" "" "01164" "" "" "M" "" "" "" "0" "" "" "" "" "00295760" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" "" "00295928" "" "" "" "1" "" "01164" "" "" "M" "" "" "" "0" "" "" "" "" "00296675" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" "" "00299695" "" "" "" "1" "" "01164" "" "" "M" "" "" "" "0" "" "" "" "" "00300248" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" "" "00300637" "" "" "" "1" "" "01164" "" "" "M" "" "Germany" "" "0" "" "" "" "" "00302673" "" "" "" "1" "" "01807" "" "" "M" "" "(Germany)" "" "0" "" "" "" "" "00303061" "" "" "" "1" "" "01164" "" "" "M" "" "" "" "0" "" "" "" "" "00304548" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00304549" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00307273" "" "" "" "1" "" "00091" "" "" "F" "" "(France)" "" "0" "" "" "" "" "00314854" "" "" "" "1" "" "00006" "{PMID:Covone 2016:27406698}, {PMID:Neuser 2021:33847017}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "" "Italy" "" "0" "" "" "" "patient;Pat27" "00374862" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-4359" "00374863" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-1058" "00379690" "" "" "" "1" "" "03508" "" "" "M" "" "Korea, South (Republic)" "" "0" "" "" "" "IR_GH_0084" "00403898" "" "" "" "1" "" "00435" "" "" "M" "yes" "Egypt" "" "" "" "" "" "" "00408703" "" "" "" "1" "" "00006" "{PMID:Thomas 2022:34085946}" "patient and affected brother" "" "" "France" "" "0" "" "" "" "Pat29" "00414070" "" "" "" "1" "" "03208" "Pennings et al. 2022, in progress" "" "F" "" "Netherlands" "" "0" "" "" "" "AR18" "00414071" "" "" "" "1" "" "03208" "Pennings et al. 2022, in progress" "" "M" "" "Netherlands" "" "0" "" "" "" "AR19" "00455807" "" "" "" "1" "" "00006" "{PMID:Salinas 2020:33084218}" "patient" "M" "" "" "" "0" "" "" "" "Pat47" "00455812" "" "" "" "1" "" "00006" "{PMID:Salinas 2020:33084218}" "patient" "F" "" "" "" "0" "" "" "" "Pat52" "00462226" "" "" "" "1" "" "03544" "" "" "M" "-" "- (not applicable)" "" "" "" "" "white" "" "00467312" "" "" "" "1" "" "00006" "{PMID:Patak 2019:31397880}" "2-generation family, unaffected non-carrier parents" "F" "" "United States" "" "0" "" "" "white" "Pat2" "00470678" "" "" "" "1" "" "00006" "{PMID:Horbacz 2025:41210864}" "patient, affected" "F" "" "Poland" "" "0" "" "" "" "Pat39" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 46 "{{individualid}}" "{{diseaseid}}" "00047000" "00325" "00054863" "02642" "00054864" "02642" "00054865" "02642" "00073162" "04201" "00080118" "00198" "00080118" "00232" "00152016" "02642" "00154960" "00198" "00291595" "00198" "00291596" "00198" "00291597" "00198" "00291598" "00198" "00291599" "00198" "00291600" "00198" "00291601" "00198" "00295573" "00198" "00295597" "00198" "00295647" "00198" "00295652" "00198" "00295656" "00198" "00295661" "00198" "00295760" "00198" "00295928" "00198" "00296675" "00198" "00299695" "00198" "00300248" "00198" "00300637" "00198" "00302673" "00198" "00303061" "00198" "00304548" "00198" "00304549" "00198" "00307273" "04293" "00314854" "00198" "00374862" "00198" "00374863" "00198" "00379690" "04214" "00403898" "02642" "00408703" "00198" "00414070" "00000" "00414071" "00000" "00455807" "00198" "00455812" "00198" "00462226" "05356" "00467312" "00198" "00470678" "07210" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00000, 00198, 00232, 00325, 02642, 04201, 04214, 04293, 05356, 05684, 07210 ## Count = 39 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Head/Microcephaly}}" "{{Phenotype/Birth/Gestational_age_wk}}" "{{Phenotype/Feeding/Problems}}" "{{Phenotype/Hearing/Problems}}" "{{Phenotype/Vision/Problems}}" "{{Phenotype/Development/Motor_skills}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Intrauterine_growth_retardation/HPO/0001511}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/MRI/brain}}" "{{Phenotype/Eye/OCT}}" "{{Phenotype/Vision/Field}}" "{{Phenotype/Vision/Acuity}}" "{{Phenotype/Vision/Optic_nerve/Hypoplasia}}" "{{Phenotype/Vision/Colour}}" "{{Phenotype/Growth/Retardation/Postnatal/HPO_0008897}}" "{{Phenotype/Asymmetry/Body}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Habits}}" "{{Phenotype/Diagnosis/Criteria}}" "0000034729" "00325" "00047000" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000041527" "02642" "00054863" "01479" "Familial, autosomal recessive" "" "pure ataxia only" "58y" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "SPG7" "cerebellar ataxia" "" "" "0000041528" "02642" "00054864" "01479" "Familial, autosomal recessive" "" "pure ataxia only" "38y" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "SPG7" "cerebellar ataxia" "" "" "0000041529" "02642" "00054865" "01479" "Familial, autosomal recessive" "" "HSP and ataxia, mild pyramidal signs lower limbs" "52y" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "SPG7" "cerebellar ataxia" "" "" "0000053285" "04201" "00073162" "01400" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000082741" "00232" "00080118" "01594" "Unknown" "" "prominent forehead (HP:0011220)" "" "no macrocephaly congenital" "" "nr" "" "" "" "" "" "" "not small" "" "" "" "" "" "" "" "" "" "" "growth retardation (postnatal)" "no asymmetric growth" "unlikely SRS (Netchine Harbison-Score 2/5)" "SRS like (Bartholdi score: 35.7%), but due to the array results diagnosed as 16q24.3 microdeletion syndrome with normal intelligence" "" "" "0000127692" "00198" "00154960" "01807" "Unknown" "" "Limb ataxia (HP:0002070); Dysarthria (HP:0001260); Cerebellar atrophy (HP:0001272)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000157391" "00198" "00208777" "01164" "Unknown" "" "HP:0002313 (Spastic paraparesis); HP:0003808 (Abnormal muscle tone)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000187147" "00198" "00248146" "01164" "Unknown" "" "HP:0000759 (Abnormal peripheral nervous system morphology); HP:0007141 (Sensorimotor neuropathy)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000210203" "00198" "00275583" "01164" "Unknown" "" "Abnormality of the nervous system (HP:0000707)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000210579" "00198" "00276023" "01164" "Unknown" "" "Ataxia (HP:0001251)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000223138" "00198" "00295573" "01164" "Unknown" "" "Abnormality of nervous system physiology (HP:0012638); Gait disturbance (HP:0001288)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000223162" "00198" "00295597" "01164" "Unknown" "" "Spastic paraparesis (HP:0002313)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000223211" "00198" "00295647" "01164" "Unknown" "" "Abnormality of the musculature (HP:0003011)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000223216" "00198" "00295652" "01164" "Unknown" "" "Global developmental delay (HP:0001263); Abnormality of nervous system physiology (HP:0012638)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000223220" "00198" "00295656" "01164" "Unknown" "" "Spasticity (HP:0001257); Global developmental delay (HP:0001263); Microcephaly (HP:0000252)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000223225" "00198" "00295661" "01164" "Unknown" "" "Progressive spastic paraplegia (HP:0007020)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000223278" "00198" "00295760" "01164" "Unknown" "" "Abnormality of nervous system physiology (HP:0012638); Gait disturbance (HP:0001288)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000223404" "00198" "00295928" "01164" "Unknown" "" "Spastic hemiparesis (HP:0011099); Abnormal muscle tone (HP:0003808)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000224076" "00198" "00296675" "01164" "Unknown" "" "Abnormality of brain morphology (HP:0012443); Ataxia (HP:0001251); Cerebellar atrophy (HP:0001272); Abnormality of the cerebellum (HP:0001317); Abnormality of eye movement (HP:0000496); Abnormality of saccadic eye movements (HP:0000570)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000227000" "00198" "00299695" "01164" "Unknown" "" "Abnormality of muscle physiology (HP:0011804); Exercise-induced muscle cramps (HP:0003710)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000227550" "00198" "00300248" "01164" "Unknown" "" "Spastic paraparesis (HP:0002313); Abnormality of the musculature (HP:0003011)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000227948" "00198" "00300637" "01164" "Unknown" "" "Abnormality of nervous system physiology (HP:0012638); Spastic paraparesis (HP:0002313)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000229754" "00198" "00302673" "01807" "Unknown" "" "Spastic paraplegia (HP:0001258)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000230144" "00198" "00303061" "01164" "Unknown" "" "Abnormality of nervous system morphology (HP:0012639); Cerebral palsy (HP:0100021); Ventriculomegaly (HP:0002119); Hydrocephalus (HP:0000238)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000233074" "04293" "00307273" "00091" "Familial, autosomal dominant" "50y" "Moderately reduced visual acuity (HP:0030515); Optic atrophy (HP:0000648); Optic disc pallor (HP:0000543); Retinal atrophy (HP:0001105)" "06y" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000238612" "00198" "00314854" "00006" "Familial, autosomal recessive" "15y" "see paper; ..., normal facial shape (-HP:0001999); no brachycephaly (-HP:0000248); normal age walking; normal speech; no global developmental delay (-HP:0001263); no intellectual disability (-HP:0001249); no behavioral abnormalities (-HP:0000708); no seizures (-HP:0001250); hyporeflexia lower limbs (HP:0002600); generalized hyperreflexia (HP:0007034); muscular hypotonia (HP:0001252) trunk, upper limbs; muscular hypertonia (HP:0001276) lower limbs; dysarthria (HP:0001260); peripheral neuropathy (HP:0009830); visual impairment (HP:0000505), strabismus, oculomotor apraxia; muscle atrophy, EMG: severe neurogenic pattern, joint retraction, ankle clonus, tongue fasciculations, spastic gait; no recurrent respiratory infections (-HP:0002205); abnormal corpus callosum morphology (HP:0001273), mild thinning; no cerebral atrophy (-HP:0002059); no cerebellar atrophy (-HP:0001272); no aplasia/hypoplasia cerebellar vermis (-HP:0006817); non-invasive ventilation;" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "HSAN9" "progressive motor neuron disease" "" "" "0000270072" "00198" "00374862" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "spasticity" "" "" "0000270073" "00198" "00374863" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "neuropathy" "" "" "0000274272" "04214" "00379690" "03508" "Familial, autosomal dominant" "" "HP:0032037, HP:0001123, HP:0000639, HP:0003745, HP:0000648" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "Infantile nystagmus" "" "" "0000296571" "02642" "00403898" "00435" "Familial, autosomal recessive" "45y" "cerebellar ataxia\r\nSpastic lower limbs, hyperreflexia, intact abdominal reflexes\r\nperipheral neuropathy\r\npes cavus" "" "" "" "" "" "" "" "38y" "33y" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "SPG-7" "HSP" "" "" "0000300822" "00198" "00408703" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "cerebellar ataxia" "" "" "0000305971" "00000" "00414070" "03208" "Familial, autosomal recessive" "" "bilateral pyramidal syndrome" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000305972" "00000" "00414071" "03208" "Familial, autosomal recessive" "" "ataxia" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000344340" "00198" "00455807" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "SPG7" "neurogenetic diseases" "" "" "0000344345" "00198" "00455812" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "SPG7" "neurogenetic diseases" "" "" "0000349726" "05356" "00462226" "03544" "Isolated (sporadic)" "" "HP:0002073, HP:0001260, HP:0002015, HP:0011443, HP:0012378" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "SPG7" "ataxia" "" "" "0000352519" "00198" "00467312" "00006" "Isolated (sporadic)" "" "see paper; ..., atrial septal defect, tracheomalacia, cleft palate, jaundice; developmental delay" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "developmental delay" "" "" "0000355572" "07210" "00470678" "00006" "Isolated (sporadic)" "13y" "see paper; ... scoliosis, no other skeletal defects; no symptoms; physical activity" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "severe adolescent idiopathic scoliosis" "" "" ## Screenings ## Do not remove or alter this header ## ## Count = 50 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000047200" "00047000" "1" "01330" "01330" "2015-08-04 16:53:47" "" "" "SEQ" "DNA" "" "" "0000054815" "00054863" "1" "01479" "01479" "2015-11-30 14:57:13" "" "" "SEQ-NG" "DNA" "" "" "0000054816" "00054864" "1" "01479" "01479" "2015-11-30 15:14:58" "" "" "SEQ-NG" "DNA" "" "" "0000054817" "00054865" "1" "01479" "01479" "2015-11-30 15:24:31" "" "" "SEQ-NG" "DNA" "" "" "0000073321" "00073162" "1" "01400" "01400" "2016-06-08 16:24:05" "" "" "SEQ;SEQ-NG-I" "DNA" "" "" "0000080211" "00080118" "1" "01594" "00008" "2016-09-01 17:30:25" "" "" "arrayCNV; PCRq" "DNA" "" "" "0000152870" "00152016" "1" "01741" "01741" "2018-02-01 13:44:03" "" "" "SEQ-NG" "DNA" "" "" "0000155821" "00154960" "0" "01807" "01807" "2018-03-07 04:00:30" "" "" "SEQ" "DNA" "" "" "0000155822" "00154960" "0" "01807" "01807" "2018-03-07 04:00:30" "" "" "SEQ" "DNA" "" "" "0000209826" "00208777" "1" "01164" "01164" "2018-12-17 10:13:18" "" "" "SEQ-NG" "DNA" "" "" "0000249251" "00248146" "1" "01164" "01164" "2019-07-19 11:43:19" "" "" "SEQ-NG-S" "DNA" "" "" "0000276741" "00275583" "1" "01164" "01164" "2020-01-09 21:03:40" "" "" "SEQ-NG-S" "DNA" "" "" "0000277170" "00276023" "1" "01164" "01164" "2020-01-24 11:02:09" "" "" "SEQ-NG-S" "DNA" "" "" "0000292763" "00291595" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000292764" "00291596" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000292765" "00291597" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000292766" "00291598" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000292767" "00291599" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000292768" "00291600" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000292769" "00291601" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000296743" "00295573" "1" "01164" "01164" "2020-03-18 10:48:40" "" "" "SEQ-NG-S" "DNA" "" "" "0000296767" "00295597" "1" "01164" "01164" "2020-03-18 10:49:34" "" "" "SEQ-NG-S" "DNA" "" "" "0000296819" "00295647" "1" "01164" "01164" "2020-03-22 12:43:19" "" "" "SEQ-NG-S" "DNA" "" "" "0000296824" "00295652" "1" "01164" "01164" "2020-03-22 12:43:29" "" "" "SEQ-NG-S" "DNA" "" "" "0000296828" "00295656" "1" "01164" "01164" "2020-03-22 12:43:45" "" "" "SEQ-NG-S" "DNA" "" "" "0000296833" "00295661" "1" "01164" "01164" "2020-03-22 12:43:55" "" "" "SEQ-NG-S" "DNA" "" "" "0000296933" "00295760" "1" "01164" "01164" "2020-03-26 12:30:30" "" "" "SEQ-NG-S" "DNA" "" "" "0000297100" "00295928" "1" "01164" "01164" "2020-03-30 10:44:23" "" "" "SEQ-NG-S" "DNA" "" "" "0000297785" "00296675" "1" "01164" "01164" "2020-04-10 08:52:01" "" "" "SEQ-NG-S" "DNA" "" "" "0000300805" "00299695" "1" "01164" "01164" "2020-04-20 10:31:01" "" "" "SEQ-NG-S" "DNA" "" "" "0000301366" "00300248" "1" "01164" "01164" "2020-04-24 15:08:01" "" "" "SEQ-NG-S" "DNA" "" "" "0000301758" "00300637" "1" "01164" "01164" "2020-05-04 10:24:01" "" "" "SEQ-NG-S" "DNA" "" "" "0000303798" "00302673" "1" "01807" "01807" "2020-05-27 17:21:02" "" "" "SEQ" "DNA" "" "" "0000304186" "00303061" "1" "01164" "01164" "2020-06-05 14:37:01" "" "" "SEQ-NG-S" "DNA" "" "" "0000305677" "00304548" "1" "03575" "00006" "2020-06-24 11:55:42" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000305678" "00304549" "1" "03575" "00006" "2020-06-24 11:55:42" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000308415" "00307273" "1" "00091" "00091" "2020-08-07 16:51:03" "" "" "SEQ-NG" "DNA" "Blood" "" "0000316028" "00314854" "1" "00006" "00006" "2020-10-19 19:13:33" "00006" "2020-10-19 19:21:10" "SEQ;SEQ-NG" "DNA" "" "WES" "0000376056" "00374862" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000376057" "00374863" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000380892" "00379690" "1" "03508" "03508" "2021-08-06 10:39:06" "" "" "SEQ-NG-I" "DNA" "" "" "0000405136" "00403898" "1" "00435" "00435" "2022-02-24 20:24:13" "" "" "SEQ" "DNA" "blood" "" "0000409966" "00408703" "1" "00006" "00006" "2022-04-25 20:53:24" "" "" "SEQ-NG" "DNA" "" "" "0000415349" "00414070" "1" "03208" "00006" "2022-07-27 10:49:59" "" "" "SEQ;SEQ-NG" "DNA" "blood" "WES" "0000415350" "00414071" "1" "03208" "00006" "2022-07-27 10:49:59" "" "" "SEQ;SEQ-NG" "DNA" "blood" "WES" "0000457423" "00455807" "1" "00006" "00006" "2024-10-20 15:03:37" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000457428" "00455812" "1" "00006" "00006" "2024-10-20 15:03:37" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000463858" "00462226" "1" "03544" "03544" "2025-02-01 17:42:29" "" "" "SEQ-NG-I" "DNA" "peripheral blood" "WES" "0000468975" "00467312" "1" "00006" "00006" "2025-10-10 16:51:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000472345" "00470678" "1" "00006" "00006" "2025-12-05 11:16:06" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 15 "{{screeningid}}" "{{geneid}}" "0000047200" "SPG7" "0000054815" "SPG7" "0000054816" "SPG7" "0000054817" "SPG7" "0000073321" "SPG7" "0000152870" "CYP7B1" "0000152870" "MARS2" "0000152870" "SPG7" "0000308415" "OPA1" "0000308415" "SPG7" "0000316028" "SPG7" "0000316028" "TECPR2" "0000376056" "SPG7" "0000376057" "SPG7" "0000405136" "SPG7" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 296 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000075870" "0" "50" "16" "89611100" "89611100" "subst" "2.03036E-5" "01330" "SPG7_000001" "g.89611100C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.89544692C>T" "" "VUS" "" "0000084828" "0" "90" "16" "89613145" "89613145" "subst" "0.00287905" "01479" "SPG7_000003" "g.89613145C>T" "" "{PMID:van de Warrenburg 2016:27165006}, {DOI:van de Warrenburg 2016: 10.1038/ejhg.2016.42}" "" "" "" "Germline" "" "" "0" "" "" "g.89546737C>T" "" "pathogenic" "" "0000084829" "0" "70" "16" "89613070" "89613078" "del" "0" "01479" "SPG7_000002" "g.89613070_89613078del" "" "{PMID:van de Warrenburg 2016:27165006}, {DOI:van de Warrenburg 2016: 10.1038/ejhg.2016.42}" "" "" "" "Germline" "" "" "0" "" "" "g.89546662_89546670del" "" "likely pathogenic" "" "0000084830" "0" "70" "16" "89613070" "89613078" "del" "0" "01479" "SPG7_000002" "g.89613070_89613078del" "" "{PMID:van de Warrenburg 2016:27165006}, {DOI:van de Warrenburg 2016: 10.1038/ejhg.2016.42}" "" "" "" "Germline" "" "" "0" "" "" "g.89546662_89546670del" "" "likely pathogenic" "" "0000084831" "0" "70" "16" "89613145" "89613145" "subst" "0.00287905" "01479" "SPG7_000003" "g.89613145C>T" "" "{PMID:van de Warrenburg 2016:27165006}, {DOI:van de Warrenburg 2016: 10.1038/ejhg.2016.42}" "" "" "" "Germline" "" "" "0" "" "" "g.89546737C>T" "" "likely pathogenic" "" "0000084832" "0" "70" "16" "89613145" "89613145" "subst" "0.00287905" "01479" "SPG7_000003" "g.89613145C>T" "" "{PMID:van de Warrenburg 2016:27165006}, {DOI:van de Warrenburg 2016: 10.1038/ejhg.2016.42}" "" "" "" "Germline" "" "" "0" "" "" "g.89546737C>T" "" "likely pathogenic" "" "0000084833" "0" "90" "16" "89616994" "89616994" "subst" "0" "01479" "SPG7_000004" "g.89616994G>T" "" "{PMID:van de Warrenburg 2016:27165006}, {DOI:van de Warrenburg 2016: 10.1038/ejhg.2016.42}" "" "" "" "Germline" "" "" "0" "" "" "g.89550586G>T" "" "pathogenic" "" "0000116957" "11" "90" "16" "89590510" "89590511" "del" "0" "01400" "SPG7_000005" "g.89590510_89590511del" "" "" "" "473_474delTC" "" "Germline" "" "" "0" "" "" "g.89524102_89524103del" "" "pathogenic" "" "0000129160" "0" "50" "16" "0" "0" "" "0" "01594" "ANKRD11_000024" "g.(88700001_89371838)_(89607414_qter)del" "" "{PMID:Spengler 2012:22683032}, {PMID:Spengler 2013:23885231}, for EUCID-SRS consortium" "" "" "deletion affecting ANKRD11 and part of SPG7" "De novo" "" "" "0" "normal methylation H19/IGF2:IG-DMR, KCNQ1OT1:TSS-DMR" "arr[hg19] 16q24.3(89,371,838-89,607,414)x1 dn" "" "" "VUS" "" "0000248026" "0" "10" "16" "89597221" "89597221" "subst" "0.47362" "02325" "SPG7_000023" "g.89597221A>G" "" "" "" "SPG7(NM_003119.3):c.987+5A>G, SPG7(NM_003119.4):c.987+5A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89530813A>G" "" "benign" "" "0000249402" "0" "30" "16" "89592874" "89592874" "subst" "0" "02325" "SPG7_000021" "g.89592874A>G" "" "" "" "SPG7(NM_003119.2):c.756A>G (p.(Gly252Gly)), SPG7(NM_003119.4):c.756A>G (p.G252=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89526466A>G" "" "likely benign" "" "0000253287" "0" "10" "16" "89597221" "89597221" "subst" "0.47362" "01943" "SPG7_000023" "g.89597221A>G" "" "" "" "SPG7(NM_003119.3):c.987+5A>G, SPG7(NM_003119.4):c.987+5A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89530813A>G" "" "benign" "" "0000311484" "0" "10" "16" "89574166" "89574166" "subst" "0.47976" "02325" "SPG7_000070" "g.89574166C>G" "" "" "" "SPG7(NM_003119.4):c.-660C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89507758C>G" "" "benign" "" "0000311485" "0" "90" "16" "89598369" "89598369" "subst" "0.000822261" "02325" "SPG7_000025" "g.89598369G>A" "" "" "" "SPG7(NM_003119.2):c.1045G>A (p.(Gly349Ser)), SPG7(NM_003119.3):c.1045G>A (p.G349S), SPG7(NM_003119.4):c.1045G>A (p.G349S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89531961G>A" "" "pathogenic" "" "0000311486" "0" "50" "16" "89599001" "89599001" "subst" "2.03933E-5" "02325" "SPG7_000029" "g.89599001G>A" "" "" "" "SPG7(NM_003119.4):c.1281G>A (p.T427=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89532593G>A" "" "VUS" "" "0000311487" "0" "30" "16" "89603162" "89603164" "del" "0" "02325" "SPG7_000033" "g.89603162_89603164del" "" "" "" "SPG7(NM_003119.4):c.1324+4118_1324+4120delTCT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89536754_89536756del" "" "likely benign" "" "0000311488" "0" "50" "16" "89611101" "89611101" "subst" "1.21828E-5" "02325" "SPG7_000034" "g.89611101G>A" "" "" "" "SPG7(NM_003119.4):c.1370G>A (p.R457Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89544693G>A" "" "VUS" "" "0000311489" "0" "30" "16" "89611153" "89611153" "subst" "4.46831E-5" "02325" "SPG7_000036" "g.89611153C>T" "" "" "" "SPG7(NM_003119.4):c.1422C>T (p.H474=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89544745C>T" "" "likely benign" "" "0000311490" "0" "30" "16" "89613073" "89613073" "subst" "0.00466893" "02325" "SPG7_000037" "g.89613073G>A" "" "" "" "SPG7(NM_003119.4):c.1457G>A (p.R486Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89546665G>A" "" "likely benign" "" "0000311491" "0" "90" "16" "89613145" "89613145" "subst" "0.00287905" "02325" "SPG7_000003" "g.89613145C>T" "" "" "" "SPG7(NM_001363850.1):c.1529C>T (p.A510V), SPG7(NM_003119.2):c.1529C>T (p.(Ala510Val)), SPG7(NM_003119.4):c.1529C>T (p.A510V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89546737C>T" "" "pathogenic" "" "0000311492" "0" "30" "16" "89614451" "89614451" "subst" "0.000122642" "02325" "SPG7_000038" "g.89614451C>T" "" "" "" "SPG7(NM_003119.4):c.1593C>T (p.H531=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89548043C>T" "" "likely benign" "" "0000311493" "0" "10" "16" "89614511" "89614511" "subst" "0.000853078" "02325" "SPG7_000039" "g.89614511C>T" "" "" "" "SPG7(NM_003119.4):c.1653C>T (p.R551=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89548103C>T" "" "benign" "" "0000311495" "0" "30" "16" "89576895" "89576895" "subst" "0" "02325" "SPG7_000011" "g.89576895C>A" "" "" "" "SPG7(NM_003119.4):c.184-3C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89510487C>A" "" "likely benign" "" "0000311496" "0" "30" "16" "89576894" "89576894" "dup" "0" "02325" "SPG7_000009" "g.89576894dup" "" "" "" "SPG7(NM_003119.4):c.184-3delCinsTC, SPG7(NM_003119.4):c.184-4dupT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89510486dup" "" "likely benign" "" "0000311498" "0" "13" "16" "89576894" "89576894" "del" "0" "02325" "SPG7_000010" "g.89576894del" "" "" "" "SPG7(NM_003119.4):c.184-4delT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89510486del" "" "benign" "" "0000311499" "0" "50" "16" "89620971" "89620971" "subst" "1.25372E-5" "02325" "SPG7_000042" "g.89620971G>A" "" "" "" "SPG7(NM_003119.2):c.2181G>A (p.(Ala727=)), SPG7(NM_003119.4):c.2181G>A (p.A727=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89554563G>A" "" "VUS" "" "0000311500" "0" "10" "16" "89590243" "89590243" "subst" "0" "02325" "SPG7_000017" "g.89590243G>A" "" "" "" "SPG7(NM_003119.4):c.377-171G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89523835G>A" "" "benign" "" "0000311502" "0" "10" "16" "89590667" "89590667" "subst" "0.47487" "02325" "SPG7_000020" "g.89590667T>C" "" "" "" "SPG7(NM_003119.3):c.618+12T>C, SPG7(NM_003119.4):c.618+12T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89524259T>C" "" "benign" "" "0000311503" "0" "30" "16" "89574834" "89574834" "subst" "0.00118225" "02325" "SPG7_000007" "g.89574834G>T" "" "" "" "SPG7(NM_003119.4):c.9G>T (p.V3=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89508426G>T" "" "likely benign" "" "0000313872" "0" "90" "16" "89598369" "89598369" "subst" "0.000822261" "02326" "SPG7_000025" "g.89598369G>A" "" "" "" "SPG7(NM_003119.2):c.1045G>A (p.(Gly349Ser)), SPG7(NM_003119.3):c.1045G>A (p.G349S), SPG7(NM_003119.4):c.1045G>A (p.G349S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89531961G>A" "" "pathogenic" "" "0000315579" "0" "30" "16" "89598356" "89598356" "subst" "0.00503259" "01943" "SPG7_000024" "g.89598356C>T" "" "" "" "SPG7(NM_003119.3):c.1032C>T (p.G344=), SPG7(NM_003119.4):c.1032C>T (p.G344=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89531948C>T" "" "likely benign" "" "0000315580" "0" "50" "16" "89598372" "89598372" "subst" "0.000146796" "01943" "SPG7_000026" "g.89598372C>A" "" "" "" "SPG7(NM_003119.3):c.1048C>A (p.P350T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89531964C>A" "" "VUS" "" "0000315581" "0" "50" "16" "89598415" "89598415" "subst" "2.03535E-5" "01943" "SPG7_000027" "g.89598415C>T" "" "" "" "SPG7(NM_003119.3):c.1091C>T (p.T364M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89532007C>T" "" "VUS" "" "0000315582" "0" "50" "16" "89598933" "89598933" "subst" "7.75371E-5" "01943" "SPG7_000028" "g.89598933G>A" "" "" "" "SPG7(NM_003119.3):c.1213G>A (p.V405I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89532525G>A" "" "VUS" "" "0000315583" "0" "50" "16" "89599015" "89599015" "subst" "8.15275E-6" "01943" "SPG7_000030" "g.89599015C>T" "" "" "" "SPG7(NM_003119.3):c.1295C>T (p.T432M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89532607C>T" "" "VUS" "" "0000315584" "0" "50" "16" "89599025" "89599025" "subst" "2.85456E-5" "01943" "SPG7_000031" "g.89599025G>T" "" "" "" "SPG7(NM_003119.3):c.1305G>T (p.Q435H), SPG7(NM_003119.4):c.1305G>T (p.(Gln435His), p.Q435H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89532617G>T" "" "VUS" "" "0000315585" "0" "30" "16" "89599054" "89599054" "subst" "0.00105513" "01943" "SPG7_000032" "g.89599054C>T" "" "" "" "SPG7(NM_003119.3):c.1324+10C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89532646C>T" "" "likely benign" "" "0000315586" "0" "50" "16" "89611140" "89611140" "subst" "0" "01943" "SPG7_000035" "g.89611140G>T" "" "" "" "SPG7(NM_003119.3):c.1409G>T (p.R470L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89544732G>T" "" "VUS" "" "0000315587" "0" "90" "16" "89613145" "89613145" "subst" "0.00287905" "01943" "SPG7_000003" "g.89613145C>T" "" "" "" "SPG7(NM_001363850.1):c.1529C>T (p.A510V), SPG7(NM_003119.2):c.1529C>T (p.(Ala510Val)), SPG7(NM_003119.4):c.1529C>T (p.A510V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89546737C>T" "" "pathogenic" "" "0000315588" "0" "10" "16" "89614534" "89614534" "subst" "0.0539916" "01943" "SPG7_000040" "g.89614534C>T" "" "" "" "SPG7(NM_003119.3):c.1663+13C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89548126C>T" "" "benign" "" "0000315589" "0" "30" "16" "89576895" "89576895" "subst" "0" "01943" "SPG7_000012" "g.89576895C>T" "" "" "" "SPG7(NM_003119.3):c.184-3C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89510487C>T" "" "likely benign" "" "0000315590" "0" "30" "16" "89576900" "89576900" "subst" "8.7187E-6" "01943" "SPG7_000013" "g.89576900C>T" "" "" "" "SPG7(NM_003119.3):c.186C>T (p.S62=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89510492C>T" "" "likely benign" "" "0000315591" "0" "30" "16" "89576913" "89576913" "subst" "0.000673425" "01943" "SPG7_000014" "g.89576913C>T" "" "" "" "SPG7(NM_003119.3):c.199C>T (p.L67=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89510505C>T" "" "likely benign" "" "0000315592" "0" "90" "16" "89620905" "89620921" "del" "0" "01943" "SPG7_000041" "g.89620905_89620921del" "" "" "" "SPG7(NM_003119.2):c.2115_2131del (p.(Leu706GlnfsTer30)), SPG7(NM_003119.3):c.2115_2131delGCTGGTGGCCAAGGCCT (p.L706Qfs*30), SPG7(NM_003119.4):c.2115..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89554497_89554513del" "" "pathogenic" "" "0000315593" "0" "30" "16" "89623388" "89623388" "subst" "0.000552338" "01943" "RPL13_000001" "g.89623388G>A" "" "" "" "SPG7(NM_003119.2):c.2275G>A (p.(Ala759Thr)), SPG7(NM_003119.3):c.2275G>A (p.A759T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89556980G>A" "" "likely benign" "" "0000315594" "0" "90" "16" "89576947" "89576947" "subst" "0.000426656" "01943" "SPG7_000015" "g.89576947T>A" "" "" "" "SPG7(NM_001363850.1):c.233T>A (p.L78*), SPG7(NM_003119.3):c.233T>A (p.L78*), SPG7(NM_003119.4):c.233T>A (p.(Leu78Ter), p.L78*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89510539T>A" "" "pathogenic" "" "0000315595" "0" "30" "16" "89590511" "89590511" "subst" "7.31309E-5" "01943" "SPG7_000018" "g.89590511C>T" "" "" "" "SPG7(NM_003119.3):c.474C>T (p.L158=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89524103C>T" "" "likely benign" "" "0000315596" "0" "30" "16" "89590584" "89590584" "subst" "0.000105628" "01943" "SPG7_000019" "g.89590584G>A" "" "" "" "SPG7(NM_003119.3):c.547G>A (p.V183I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89524176G>A" "" "likely benign" "" "0000315597" "0" "10" "16" "89590667" "89590667" "subst" "0.47487" "01943" "SPG7_000020" "g.89590667T>C" "" "" "" "SPG7(NM_003119.3):c.618+12T>C, SPG7(NM_003119.4):c.618+12T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89524259T>C" "" "benign" "" "0000338857" "0" "10" "16" "89590667" "89590667" "subst" "0.47487" "02327" "SPG7_000020" "g.89590667T>C" "" "" "" "SPG7(NM_003119.3):c.618+12T>C, SPG7(NM_003119.4):c.618+12T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89524259T>C" "" "benign" "" "0000338859" "0" "10" "16" "89597235" "89597235" "subst" "0.00184398" "02327" "SPG7_000048" "g.89597235G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89530827G>A" "" "benign" "" "0000338860" "0" "30" "16" "89599063" "89599063" "subst" "0.000115323" "02327" "SPG7_000053" "g.89599063C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89532655C>T" "" "likely benign" "" "0000338861" "0" "10" "16" "89611199" "89611199" "subst" "0.101442" "02327" "SPG7_000054" "g.89611199G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89544791G>A" "" "benign" "" "0000338862" "0" "10" "16" "89613181" "89613181" "subst" "0" "02327" "SPG7_000057" "g.89613181C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89546773C>T" "" "benign" "" "0000338864" "0" "10" "16" "89614534" "89614534" "subst" "0.0539916" "02327" "SPG7_000040" "g.89614534C>T" "" "" "" "SPG7(NM_003119.3):c.1663+13C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89548126C>T" "" "benign" "" "0000340537" "0" "10" "16" "89574834" "89574834" "subst" "0.00118225" "02327" "SPG7_000007" "g.89574834G>T" "" "" "" "SPG7(NM_003119.4):c.9G>T (p.V3=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89508426G>T" "" "benign" "" "0000340538" "0" "10" "16" "89590460" "89590460" "subst" "4.06841E-6" "02327" "SPG7_000046" "g.89590460G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89524052G>T" "" "benign" "" "0000340539" "0" "10" "16" "89597221" "89597221" "subst" "0.47362" "02327" "SPG7_000023" "g.89597221A>G" "" "" "" "SPG7(NM_003119.3):c.987+5A>G, SPG7(NM_003119.4):c.987+5A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89530813A>G" "" "benign" "" "0000340540" "0" "10" "16" "89611153" "89611153" "subst" "4.46831E-5" "02327" "SPG7_000036" "g.89611153C>T" "" "" "" "SPG7(NM_003119.4):c.1422C>T (p.H474=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89544745C>T" "" "benign" "" "0000340541" "0" "10" "16" "89614511" "89614511" "subst" "0.000853078" "02327" "SPG7_000039" "g.89614511C>T" "" "" "" "SPG7(NM_003119.4):c.1653C>T (p.R551=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89548103C>T" "" "benign" "" "0000340542" "0" "10" "16" "89623393" "89623393" "subst" "0.012485" "02327" "RPL13_000002" "g.89623393G>A" "" "" "" "SPG7(NM_003119.4):c.2280G>A (p.P760=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89556985G>A" "" "benign" "" "0000340543" "0" "10" "16" "89623405" "89623405" "subst" "0.0286391" "02327" "RPL13_000003" "g.89623405C>T" "" "" "" "SPG7(NM_003119.4):c.2292C>T (p.I764=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89556997C>T" "" "benign" "" "0000340544" "0" "10" "16" "89623408" "89623408" "subst" "0.00268889" "02327" "RPL13_000004" "g.89623408C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89557000C>T" "" "benign" "" "0000341011" "0" "30" "16" "89599001" "89599001" "subst" "2.03933E-5" "02327" "SPG7_000029" "g.89599001G>A" "" "" "" "SPG7(NM_003119.4):c.1281G>A (p.T427=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89532593G>A" "" "likely benign" "" "0000341546" "0" "10" "16" "89620302" "89620302" "subst" "0.00407438" "02327" "SPG7_000065" "g.89620302G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89553894G>A" "" "benign" "" "0000341583" "0" "30" "16" "89623388" "89623388" "subst" "0.000552338" "02327" "RPL13_000001" "g.89623388G>A" "" "" "" "SPG7(NM_003119.2):c.2275G>A (p.(Ala759Thr)), SPG7(NM_003119.3):c.2275G>A (p.A759T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89556980G>A" "" "likely benign" "" "0000342984" "0" "50" "16" "89613069" "89613069" "subst" "2.43696E-5" "02327" "SPG7_000055" "g.89613069A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89546661A>G" "" "VUS" "" "0000343267" "0" "10" "16" "89620328" "89620328" "subst" "0.147144" "02327" "SPG7_000066" "g.89620328G>A" "" "" "" "SPG7(NM_003119.4):c.2063G>A (p.R688Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89553920G>A" "" "benign" "" "0000344165" "0" "50" "16" "89620213" "89620213" "subst" "0" "02327" "SPG7_000064" "g.89620213G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89553805G>T" "" "VUS" "" "0000344902" "0" "90" "16" "89616940" "89616940" "subst" "0" "02327" "SPG7_000061" "g.89616940C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89550532C>T" "" "pathogenic" "" "0000345064" "0" "90" "16" "89579404" "89579405" "ins" "0" "02327" "SPG7_000045" "g.89579404_89579405insTA" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89512996_89512997insTA" "" "pathogenic" "" "0000345489" "0" "90" "16" "89616994" "89616994" "subst" "0" "02327" "SPG7_000004" "g.89616994G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89550586G>T" "" "pathogenic" "" "0000346079" "0" "50" "16" "89599044" "89599044" "subst" "0" "02327" "SPG7_000052" "g.89599044G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89532636G>C" "" "VUS" "" "0000346199" "0" "50" "16" "89619501" "89619501" "subst" "4.09578E-6" "02327" "SPG7_000063" "g.89619501G>A" "" "" "" "SPG7(NM_003119.3):c.1894G>A (p.G632R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89553093G>A" "" "VUS" "" "0000346513" "0" "70" "16" "89620367" "89620367" "subst" "2.88669E-5" "02327" "SPG7_000068" "g.89620367A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89553959A>C" "" "likely pathogenic" "" "0000347718" "0" "90" "16" "89574828" "89574828" "subst" "0" "02327" "SPG7_000043" "g.89574828G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89508420G>A" "" "pathogenic" "" "0000347886" "0" "90" "16" "89620361" "89620361" "dup" "0" "02327" "SPG7_000067" "g.89620361dup" "" "" "" "SPG7(NM_003119.2):c.2096dup, SPG7(NM_003119.2):c.2096dupT (p.(Met699fs))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89553953dup" "" "pathogenic" "" "0000349541" "0" "10" "16" "89613123" "89613123" "subst" "0.148174" "02327" "SPG7_000056" "g.89613123A>G" "" "" "" "SPG7(NM_003119.4):c.1507A>G (p.T503A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89546715A>G" "" "benign" "" "0000349831" "0" "70" "16" "89616987" "89616987" "subst" "0" "02327" "SPG7_000062" "g.89616987G>C" "" "" "" "SPG7(NM_003119.4):c.1749G>C (p.W583C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89550579G>C" "" "likely pathogenic" "" "0000351420" "0" "70" "16" "89598369" "89598369" "subst" "0.000822261" "02327" "SPG7_000025" "g.89598369G>A" "" "" "" "SPG7(NM_003119.2):c.1045G>A (p.(Gly349Ser)), SPG7(NM_003119.3):c.1045G>A (p.G349S), SPG7(NM_003119.4):c.1045G>A (p.G349S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89531961G>A" "" "likely pathogenic" "" "0000351709" "0" "90" "16" "89619527" "89619527" "dup" "0" "01741" "SPG7_000059" "g.89619527dup" "" "" "" "1920dupC" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.89553119dup" "" "pathogenic" "" "0000356902" "0" "70" "16" "89595883" "89595883" "subst" "8.2335E-6" "01807" "SPG7_000060" "g.89595883A>G" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.89529475A>G" "" "likely pathogenic" "" "0000356903" "0" "70" "16" "89613145" "89613145" "subst" "0.00287905" "01807" "SPG7_000003" "g.89613145C>T" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.89546737C>T" "" "likely pathogenic" "" "0000440046" "0" "90" "16" "89598369" "89598369" "subst" "0.000822261" "01164" "SPG7_000025" "g.89598369G>A" "" "" "" "" "ACMG grading: PM3,PS3,PP5,PP3,PM2,PP1; reported in Bonn 2010. HumMut 31: 617. Brugman 2008. Neurology 71: 1500 Fogel 2014. JAMA 71: 1237" "Germline" "" "rs141659620" "0" "" "" "g.89531961G>A" "" "pathogenic" "ACMG" "0000559924" "0" "10" "16" "89576894" "89576894" "del" "0" "02330" "SPG7_000010" "g.89576894del" "" "" "" "SPG7(NM_003119.4):c.184-4delT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89510486del" "" "benign" "" "0000559925" "0" "10" "16" "89576894" "89576894" "dup" "0" "02330" "SPG7_000009" "g.89576894dup" "" "" "" "SPG7(NM_003119.4):c.184-3delCinsTC, SPG7(NM_003119.4):c.184-4dupT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89510486dup" "" "benign" "" "0000559926" "0" "30" "16" "89576960" "89576960" "subst" "0" "02325" "SPG7_000071" "g.89576960A>G" "" "" "" "SPG7(NM_003119.4):c.246A>G (p.Q82=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89510552A>G" "" "likely benign" "" "0000559927" "0" "10" "16" "89590169" "89590170" "ins" "0" "02325" "SPG7_000072" "g.89590169_89590170insTCTCA" "" "" "" "SPG7(NM_003119.4):c.377-245_377-244insTCTCA" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89523761_89523762insTCTCA" "" "benign" "" "0000559928" "0" "50" "16" "89590648" "89590648" "subst" "0" "02327" "SPG7_000073" "g.89590648G>T" "" "" "" "SPG7(NM_003119.4):c.611G>T (p.(Gly204Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89524240G>T" "" "VUS" "" "0000559929" "0" "90" "16" "89592812" "89592812" "del" "0" "02327" "SPG7_000074" "g.89592812del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89526404del" "" "pathogenic" "" "0000559930" "0" "90" "16" "89595989" "89595989" "dup" "0" "02326" "SPG7_000047" "g.89595989dup" "" "" "" "SPG7(NM_003119.4):c.861+2dupT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89529581dup" "" "pathogenic" "" "0000559931" "0" "90" "16" "89595989" "89595989" "dup" "0" "02329" "SPG7_000047" "g.89595989dup" "" "" "" "SPG7(NM_003119.4):c.861+2dupT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89529581dup" "" "pathogenic" "" "0000559932" "0" "90" "16" "89598369" "89598369" "subst" "0.000822261" "01943" "SPG7_000025" "g.89598369G>A" "" "" "" "SPG7(NM_003119.2):c.1045G>A (p.(Gly349Ser)), SPG7(NM_003119.3):c.1045G>A (p.G349S), SPG7(NM_003119.4):c.1045G>A (p.G349S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89531961G>A" "" "pathogenic" "" "0000559933" "0" "50" "16" "89598372" "89598372" "subst" "0.000146796" "02327" "SPG7_000026" "g.89598372C>A" "" "" "" "SPG7(NM_003119.3):c.1048C>A (p.P350T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89531964C>A" "" "VUS" "" "0000559934" "0" "70" "16" "89598383" "89598383" "subst" "0" "02325" "SPG7_000075" "g.89598383T>G" "" "" "" "SPG7(NM_003119.4):c.1059T>G (p.C353W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89531975T>G" "" "likely pathogenic" "" "0000559935" "0" "30" "16" "89603153" "89603153" "subst" "0.00125899" "02325" "SPG7_000076" "g.89603153C>T" "" "" "" "SPG7(NM_003119.4):c.1324+4109C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89536745C>T" "" "likely benign" "" "0000559936" "0" "10" "16" "89603231" "89603231" "subst" "0.000613218" "02330" "SPG7_000077" "g.89603231C>T" "" "" "" "SPG7(NM_199367.2):c.1383C>T (p.T461=), SPG7(NM_199367.3):c.1383C>T (p.T461=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89536823C>T" "" "benign" "" "0000559937" "0" "30" "16" "89611081" "89611081" "subst" "2.84257E-5" "02327" "RPL13_000005" "g.89611081C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89544673C>A" "" "likely benign" "" "0000559938" "0" "30" "16" "89611118" "89611118" "subst" "4.06108E-6" "01943" "RPL13_000006" "g.89611118G>C" "" "" "" "SPG7(NM_003119.3):c.1387G>C (p.G463R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89544710G>C" "" "likely benign" "" "0000559939" "0" "90" "16" "89613070" "89613078" "del" "0" "02325" "SPG7_000002" "g.89613070_89613078del" "" "" "" "SPG7(NM_001363850.1):c.1450-1_1457delGGAGAGGCG, SPG7(NM_003119.4):c.1450-1_1457delGGAGAGGCG, SPG7(NM_003119.4):c.1454_1462del (p.(Arg485_Glu487del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89546662_89546670del" "" "pathogenic" "" "0000559940" "0" "30" "16" "89613083" "89613083" "subst" "0" "01943" "RPL13_000007" "g.89613083T>C" "" "" "" "SPG7(NM_003119.3):c.1467T>C (p.F489=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89546675T>C" "" "likely benign" "" "0000559941" "0" "10" "16" "89617037" "89617037" "subst" "0.000678337" "02330" "RPL13_000008" "g.89617037G>A" "" "" "" "SPG7(NM_003119.4):c.1779+20G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89550629G>A" "" "benign" "" "0000559942" "0" "30" "16" "89619493" "89619493" "subst" "0" "01943" "RPL13_000009" "g.89619493C>G" "" "" "" "SPG7(NM_003119.3):c.1886C>G (p.A629G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89553085C>G" "" "likely benign" "" "0000559943" "0" "50" "16" "89619540" "89619540" "subst" "0.000798973" "02330" "RPL13_000010" "g.89619540T>A" "" "" "" "SPG7(NM_001363850.1):c.1933T>A (p.S645T), SPG7(NM_003119.4):c.1933T>A (p.S645T, p.(Ser645Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89553132T>A" "" "VUS" "" "0000559944" "0" "10" "16" "89620186" "89620186" "subst" "0.0032419" "02330" "RPL13_000011" "g.89620186C>G" "" "" "" "SPG7(NM_003119.4):c.1937-16C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89553778C>G" "" "benign" "" "0000559945" "0" "10" "16" "89620187" "89620187" "subst" "4.08123E-5" "02330" "RPL13_000012" "g.89620187G>A" "" "" "" "SPG7(NM_003119.4):c.1937-15G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89553779G>A" "" "benign" "" "0000559946" "0" "50" "16" "89620204" "89620204" "subst" "7.33221E-5" "02325" "RPL13_000013" "g.89620204G>T" "" "" "" "SPG7(NM_003119.4):c.1939G>T (p.(Ala647Ser), p.A647S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89553796G>T" "" "VUS" "" "0000559947" "0" "50" "16" "89620231" "89620231" "subst" "1.627E-5" "02327" "RPL13_000014" "g.89620231C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89553823C>T" "" "VUS" "" "0000559948" "0" "30" "16" "89629311" "89629311" "subst" "0.000350019" "02327" "RPL13_000015" "g.89629311C>T" "" "" "" "RPL13(NM_000977.4):c.497C>T (p.(Ala166Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89562903C>T" "" "likely benign" "" "0000577979" "0" "70" "16" "89613145" "89613145" "subst" "0.00287905" "01164" "SPG7_000003" "g.89613145C>T" "" "" "" "" "ACMG grading: PM3,PP3,PS4; reported in Berg 2013. Genet Med 15: 36; Bonn 2010. HumMutat 31: 617; Sanchez-Ferrero 2013. ClinGenet 83: 257; Brugman 2008. Neurology 71: 1500; Schlipf 2011. ClinGenet 80: 148" "Germline" "" "rs61755320" "0" "" "" "g.89546737C>T" "" "likely pathogenic" "ACMG" "0000577980" "0" "70" "16" "89595987" "89595987" "dup" "0" "01164" "SPG7_000022" "g.89595987dup" "" "" "" "" "reported in van Gassem 2012. Brain 135: 2994" "Germline" "" "rs797046003" "0" "" "" "g.89529579dup" "" "likely pathogenic" "ACMG" "0000616286" "0" "30" "16" "89595977" "89595977" "subst" "8.15667E-6" "01943" "SPG7_000079" "g.89595977T>C" "" "" "" "SPG7(NM_003119.3):c.851T>C (p.F284S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89529569T>C" "" "likely benign" "" "0000616287" "0" "90" "16" "89595977" "89595977" "del" "0" "01943" "SPG7_000080" "g.89595977del" "" "" "" "SPG7(NM_003119.3):c.851delT (p.F284Sfs*45)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89529569del" "" "pathogenic" "" "0000623583" "0" "30" "16" "89590669" "89590691" "del" "0" "02325" "SPG7_000078" "g.89590669_89590691del" "" "" "" "SPG7(NM_001363850.1):c.614_618+18delGGCCTGTGAGTGAGGGTGCGGGA, SPG7(NM_003119.4):c.614_618+18delGGCCTGTGAGTGAGGGTGCGGGA" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89524261_89524283del" "" "likely benign" "" "0000623584" "0" "50" "16" "89613073" "89613073" "subst" "4.16497E-6" "02325" "RPL13_000020" "g.89613073G>T" "" "" "" "SPG7(NM_003119.4):c.1457G>T (p.R486L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89546665G>T" "" "VUS" "" "0000630874" "0" "99" "16" "89598369" "89598369" "subst" "0.000822261" "01164" "SPG7_000025" "g.89598369G>A" "" "Bonn et al. 2010. HumMut 31: 617; Brugman et al. 2008. Neurology 71: 1500; Fogel et al. 2014. JAMA 71: 1237" "" "" "primarily chronic progressive MS, differential diagnosis of hereditary neurological diseases" "Germline" "" "rs141659620" "0" "" "" "g.89531961G>A" "" "pathogenic" "ACMG" "0000631914" "0" "70" "16" "89598423" "89598423" "subst" "4.06994E-6" "01164" "SPG7_000081" "g.89598423C>T" "" "" "" "" "ACMG: PVS1,PM2; no other path variant in SPG7 detected" "Germline" "" "" "0" "" "" "g.89532015C>T" "" "likely pathogenic" "ACMG" "0000649452" "1" "50" "16" "89576947" "89576947" "subst" "0.000426656" "03575" "SPG7_000015" "g.89576947T>A" "9/2789 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 9 heterozygous; {DB:CLININrs121918358}" "Germline" "" "rs121918358" "0" "" "" "g.89510539T>A" "" "VUS" "" "0000649453" "1" "70" "16" "89598369" "89598369" "subst" "0.000822261" "03575" "SPG7_000025" "g.89598369G>A" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs141659620}" "Germline" "" "rs141659620" "0" "" "" "g.89531961G>A" "" "likely pathogenic" "" "0000649454" "1" "90" "16" "89611139" "89611139" "subst" "8.12367E-6" "03575" "SPG7_000082" "g.89611139C>T" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs748555510}" "Germline" "" "rs748555510" "0" "" "" "g.89544731C>T" "" "pathogenic" "" "0000649455" "1" "50" "16" "89613145" "89613145" "subst" "0.00287905" "03575" "SPG7_000003" "g.89613145C>T" "3/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 3 heterozygous, no homozygous; {DB:CLININrs61755320}" "Germline" "" "rs61755320" "0" "" "" "g.89546737C>T" "" "VUS" "" "0000649456" "1" "70" "16" "89614501" "89614501" "subst" "4.16022E-6" "03575" "SPG7_000083" "g.89614501C>A" "1/2791 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs863224220}" "Germline" "" "rs863224220" "0" "" "" "g.89548093C>A" "" "likely pathogenic" "" "0000649457" "1" "50" "16" "89623393" "89623393" "subst" "0.012485" "03575" "RPL13_000002" "g.89623393G>A" "44/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 44 heterozygous; {DB:CLININrs11559075}" "Germline" "" "rs11559075" "0" "" "" "g.89556985G>A" "" "VUS" "" "0000649458" "1" "10" "16" "89623405" "89623405" "subst" "0.0286391" "03575" "RPL13_000003" "g.89623405C>T" "42/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "42 heterozygous, no homozygous; {DB:CLININrs61747711}" "Germline" "" "rs61747711" "0" "" "" "g.89556997C>T" "" "benign" "" "0000653444" "0" "90" "16" "89598369" "89598369" "subst" "0.000822261" "01164" "SPG7_000025" "g.89598369G>A" "" "" "" "" "Bonn et al. 2010. HumMut 31: 617; Brugman et al. 2008. Neurology 71: 1500; Fogel et al. 2014. JAMA 71: 1237" "Germline" "" "rs141659620" "0" "" "" "g.89531961G>A" "" "pathogenic" "ACMG" "0000653477" "0" "50" "16" "89614469" "89614469" "subst" "0.000127356" "01164" "SPG7_000086" "g.89614469C>G" "" "" "" "" "" "Germline" "" "rs139952725" "0" "" "" "g.89548061C>G" "" "VUS" "ACMG" "0000653533" "0" "90" "16" "89613070" "89613078" "del" "0" "01164" "SPG7_000002" "g.89613070_89613078del" "" "" "" "" "Gassen van et al. 2012. Brain 135: 2994; McDermott et al. 2001. Neurology 56: 467" "Germline" "" "rs768823392" "0" "" "" "g.89546662_89546670del" "" "pathogenic" "ACMG" "0000653534" "0" "90" "16" "89595987" "89595987" "dup" "0" "01164" "SPG7_000022" "g.89595987dup" "" "" "" "" "van Gassem et al. 2012. Brain 135: 2994" "Germline" "" "rs797046003" "0" "" "" "g.89529579dup" "" "pathogenic" "ACMG" "0000653540" "0" "70" "16" "89613145" "89613145" "subst" "0.00287905" "01164" "SPG7_000003" "g.89613145C>T" "" "" "" "" "ACMG: PS4,PM3,PP3; no second variant detected in SPG7, probably not explaining phenotype; -; Berg et al. 2013. Genet Med 15: 36; Bonn et al. 2010. HumMutat 31: 617; Sanchez-Ferrero et al. 2013. ClinGenet 83: 257; Brugman et al. 2008. Neurology 71: 1500; Schlipf et al. 2011. ClinGenet 80: 148" "Germline" "" "rs61755320" "0" "" "" "g.89546737C>T" "" "likely pathogenic" "ACMG" "0000653544" "0" "50" "16" "89574894" "89574894" "subst" "9.74488E-6" "01164" "SPG7_000084" "g.89574894G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.89508486G>C" "" "VUS" "ACMG" "0000653551" "0" "70" "16" "89613145" "89613145" "subst" "0.00287905" "01164" "SPG7_000003" "g.89613145C>T" "" "" "" "" "ACMG: PS4,PM3,PP3; -; Berg et al. 2013. Genet Med 15: 36; Bonn et al. 2010. HumMutat 31: 617; Sanchez-Ferrero et al. 2013. ClinGenet 83: 257; Brugman et al. 2008. Neurology 71: 1500; Schlipf et al. 2011. ClinGenet 80: 148" "Germline" "" "rs61755320" "0" "" "" "g.89546737C>T" "" "likely pathogenic" "ACMG" "0000653552" "0" "70" "16" "89598373" "89598401" "del" "0" "01164" "SPG7_000085" "g.89598373_89598401del" "" "" "" "" "ACMG: PVS1,PM2" "Germline" "" "rs775364547" "0" "" "" "g.89531965_89531993del" "" "likely pathogenic" "ACMG" "0000659585" "0" "70" "16" "89613145" "89613145" "subst" "0.00287905" "01164" "SPG7_000003" "g.89613145C>T" "" "" "" "" "ACMG: PS4,PM3,PP3; -; Berg et al. 2013. Genet Med 15: 36; Bonn et al. 2010. HumMutat 31: 617; Sanchez-Ferrero et al. 2013. ClinGenet 83: 257; Brugman et al. 2008. Neurology 71: 1500; Schlipf et al. 2011. ClinGenet 80: 148" "Germline" "" "rs61755320" "0" "" "" "g.89546737C>T" "" "likely pathogenic" "ACMG" "0000659586" "0" "90" "16" "89595987" "89595987" "dup" "0" "01164" "SPG7_000022" "g.89595987dup" "" "" "" "" "van Gassem et al. 2012. Brain 135: 2994" "Germline" "" "rs797046003" "0" "" "" "g.89529579dup" "" "pathogenic" "ACMG" "0000659715" "0" "90" "16" "89598369" "89598369" "subst" "0.000822261" "01164" "SPG7_000025" "g.89598369G>A" "" "" "" "" "no second varinat detected in SPG7; Bonn et al. 2010. HumMut 31: 617; Brugman et al. 2008. Neurology 71: 1500; Fogel et al. 2014. JAMA 71: 1237" "Germline" "" "rs141659620" "0" "" "" "g.89531961G>A" "" "pathogenic" "ACMG" "0000660448" "0" "70" "16" "89613145" "89613145" "subst" "0.00287905" "01164" "SPG7_000003" "g.89613145C>T" "" "" "" "" "ACMG grading: PS4,PM3,PP3; no second variant detected in SPG7, no CNV in SPG7; Berg et al. 2013. Genet Med 15: 36; Bonn et al. 2010. HumMutat 31: 617; Sanchez-Ferrero et al. 2013. ClinGenet 83: 257; Brugman et al. 2008. Neurology 71: 1500; Schlipf et al. 2011. ClinGenet 80: 148" "Germline" "" "rs61755320" "0" "" "" "g.89546737C>T" "" "likely pathogenic" "ACMG" "0000663703" "0" "90" "16" "89613070" "89613078" "del" "0" "01164" "SPG7_000002" "g.89613070_89613078del" "" "Gassen van et al. 2012. Brain 135: 2994; McDermott et al. 2001. Neurology 56: 467" "" "" "no second variant detected in SPG7" "Germline" "" "rs768823392" "0" "" "" "g.89546662_89546670del" "" "pathogenic" "" "0000664291" "0" "70" "16" "89576947" "89576947" "subst" "0.000426656" "01164" "SPG7_000015" "g.89576947T>A" "" "" "" "" "ACMG grading: PVS1,PM2\r\nno second path variant detected in SPG7, patient at age 26 affected by paraspastic, positive family history of spastic paraplegia" "Germline" "" "rs121918358" "0" "" "" "g.89510539T>A" "" "likely pathogenic" "ACMG" "0000664830" "0" "70" "16" "89613145" "89613145" "subst" "0.00287905" "01164" "SPG7_000003" "g.89613145C>T" "" "" "" "" "{PMID:Reiss 2003:12754701}, {DOI:Croci 2020:10.1038/s41431-020-0624-x}" "Germline" "" "rs61755320" "0" "" "" "g.89546737C>T" "" "likely pathogenic" "" "0000667193" "0" "50" "16" "89623296" "89623296" "subst" "0" "01807" "SPG7_000087" "g.89623296T>G" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.89556888T>G" "" "VUS" "" "0000667599" "0" "50" "16" "89597175" "89597175" "subst" "0" "01164" "SPG7_000088" "g.89597175G>A" "" "" "" "" "ACMG grading: PM2,PP3\r\nno second variant detected in SPG7, no dosis change; Infantile cerebral palsy symmetric leg-stressed at age 2y, GMFCS stage 1 unclear etiology, hydrocephalus prenatally diagnosed, no intracranial pressure signs, MRI: plexus choroideus left attached to the left lateral ventricle, ventriculomegaly, signal changes of the adjacent cerebral parenchyma decreasing" "Germline" "" "" "0" "" "" "g.89530767G>A" "" "VUS" "ACMG" "0000669365" "3" "50" "16" "89576947" "89576947" "subst" "0.000426656" "03575" "SPG7_000015" "g.89576947T>A" "1/2789 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 1 homozygous; {DB:CLININrs121918358}" "Germline" "" "rs121918358" "0" "" "" "g.89510539T>A" "" "VUS" "" "0000669366" "3" "50" "16" "89623393" "89623393" "subst" "0.012485" "03575" "RPL13_000002" "g.89623393G>A" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 1 homozygous; {DB:CLININrs11559075}" "Germline" "" "rs11559075" "0" "" "" "g.89556985G>A" "" "VUS" "" "0000680749" "0" "30" "16" "89597088" "89597088" "subst" "4.06058E-6" "01943" "SPG7_000089" "g.89597088C>T" "" "" "" "SPG7(NM_001363850.1):c.862-3C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000680750" "0" "30" "16" "89598974" "89598974" "subst" "8.14259E-6" "01943" "SPG7_000090" "g.89598974C>T" "" "" "" "SPG7(NM_001363850.1):c.1254C>T (p.S418=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000680751" "0" "30" "16" "89603231" "89603231" "subst" "0.000613218" "01943" "SPG7_000077" "g.89603231C>T" "" "" "" "SPG7(NM_199367.2):c.1383C>T (p.T461=), SPG7(NM_199367.3):c.1383C>T (p.T461=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000680752" "0" "50" "16" "89619501" "89619501" "subst" "4.09578E-6" "01943" "SPG7_000063" "g.89619501G>A" "" "" "" "SPG7(NM_003119.3):c.1894G>A (p.G632R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000682792" "0" "13" "16" "89598369" "89598369" "subst" "0.000822261" "00091" "SPG7_000025" "g.89598369G>A" "" "" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "likely benign" "" "0000692217" "0" "50" "16" "89611153" "89611153" "subst" "0" "01943" "RPL13_000021" "g.89611153C>A" "" "" "" "SPG7(NM_001363850.1):c.1422C>A (p.H474Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000692218" "0" "90" "16" "89613070" "89613078" "del" "0" "01943" "SPG7_000002" "g.89613070_89613078del" "" "" "" "SPG7(NM_001363850.1):c.1450-1_1457delGGAGAGGCG, SPG7(NM_003119.4):c.1450-1_1457delGGAGAGGCG, SPG7(NM_003119.4):c.1454_1462del (p.(Arg485_Glu487del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000698156" "11" "90" "16" "89597127" "89597127" "subst" "1.21817E-5" "00006" "SPG7_000091" "g.89597127G>A" "" "{PMID:Covone 2016:27406698}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000726083" "0" "90" "16" "89574828" "89574828" "subst" "0" "02329" "SPG7_000006" "g.89574828G>C" "" "" "" "SPG7(NM_003119.4):c.3G>C (p.M1?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000726084" "0" "90" "16" "89613145" "89613145" "subst" "0.00287905" "02329" "SPG7_000003" "g.89613145C>T" "" "" "" "SPG7(NM_001363850.1):c.1529C>T (p.A510V), SPG7(NM_003119.2):c.1529C>T (p.(Ala510Val)), SPG7(NM_003119.4):c.1529C>T (p.A510V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000726085" "0" "90" "16" "89620905" "89620921" "del" "0" "02329" "SPG7_000041" "g.89620905_89620921del" "" "" "" "SPG7(NM_003119.2):c.2115_2131del (p.(Leu706GlnfsTer30)), SPG7(NM_003119.3):c.2115_2131delGCTGGTGGCCAAGGCCT (p.L706Qfs*30), SPG7(NM_003119.4):c.2115..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000726086" "0" "50" "16" "89623341" "89623341" "subst" "5.68597E-5" "02327" "RPL13_000022" "g.89623341T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000787407" "1" "50" "16" "89590651" "89590651" "subst" "4.90404E-5" "00006" "SPG7_000092" "g.89590651G>A" "" "{PMID:Ganapathy 2019:31069529}" "" "" "" "Germline" "" "rs760639086" "0" "" "" "g.89524243G>A" "" "VUS" "" "0000787408" "0" "50" "16" "89598984" "89598984" "subst" "0" "00006" "SPG7_000094" "g.89598984T>C" "" "{PMID:Ganapathy 2019:31069529}" "" "" "" "Germline" "" "" "0" "" "" "g.89532576T>C" "" "VUS" "" "0000787613" "2" "50" "16" "89595979" "89595979" "subst" "1.22384E-5" "00000" "SPG7_000093" "g.89595979A>G" "" "0" "" "" "" "Germline" "" "rs763745195" "0" "" "" "g.89529571A>G" "" "VUS" "" "0000794125" "0" "70" "16" "89598944" "89598944" "subst" "0" "03508" "SPG7_000095" "g.89598944T>G" "" "" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "VUS" "ACMG" "0000807725" "0" "50" "16" "89574845" "89574850" "dup" "0" "02325" "SPG7_000096" "g.89574845_89574850dup" "" "" "" "SPG7(NM_003119.4):c.20_25dupTGCTCC (p.L7_L8dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000807726" "0" "90" "16" "89590451" "89590451" "subst" "0" "02327" "SPG7_000097" "g.89590451C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000807727" "0" "30" "16" "89590669" "89590691" "del" "0" "01943" "SPG7_000078" "g.89590669_89590691del" "" "" "" "SPG7(NM_001363850.1):c.614_618+18delGGCCTGTGAGTGAGGGTGCGGGA, SPG7(NM_003119.4):c.614_618+18delGGCCTGTGAGTGAGGGTGCGGGA" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000807728" "0" "30" "16" "89603202" "89603202" "subst" "0" "01943" "SPG7_000098" "g.89603202G>C" "" "" "" "SPG7(NM_199367.2):c.1354G>C (p.G452R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000807729" "0" "90" "16" "89614464" "89614464" "subst" "0" "02329" "RPL13_000023" "g.89614464G>T" "" "" "" "SPG7(NM_001363850.1):c.1606G>T (p.G536*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000807730" "0" "50" "16" "89614503" "89614503" "subst" "2.49848E-5" "01943" "RPL13_000024" "g.89614503G>A" "" "" "" "SPG7(NM_001363850.1):c.1645G>A (p.V549M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000807731" "0" "30" "16" "89619540" "89619540" "subst" "0.000798973" "01943" "RPL13_000010" "g.89619540T>A" "" "" "" "SPG7(NM_001363850.1):c.1933T>A (p.S645T), SPG7(NM_003119.4):c.1933T>A (p.S645T, p.(Ser645Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000807732" "0" "30" "16" "89620316" "89620316" "subst" "8.15654E-6" "01943" "RPL13_000025" "g.89620316T>A" "" "" "" "SPG7(NM_003119.3):c.2051T>A (p.M684K), SPG7(NM_003119.4):c.2051T>A (p.(Met684Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000841202" "0" "90" "16" "89620255" "89620255" "subst" "0" "00435" "SPG7_000099" "g.89620255C>T" "" "" "" "" "" "Germline" "yes" "" "" "" "" "" "" "pathogenic (recessive)" "" "0000847193" "0" "70" "16" "89576947" "89576947" "subst" "0.000426656" "00006" "SPG7_000015" "g.89576947T>A" "" "{PMID:Thomas 2022:34085946}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "VUS" "" "0000854721" "0" "90" "16" "89616987" "89616987" "subst" "0" "02325" "SPG7_000062" "g.89616987G>C" "" "" "" "SPG7(NM_003119.4):c.1749G>C (p.W583C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000865025" "0" "90" "16" "89598369" "89598369" "subst" "0.000822261" "01804" "SPG7_000025" "g.89598369G>A" "" "" "" "SPG7(NM_003119.2):c.1045G>A (p.(Gly349Ser)), SPG7(NM_003119.3):c.1045G>A (p.G349S), SPG7(NM_003119.4):c.1045G>A (p.G349S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000865026" "0" "30" "16" "89617020" "89617020" "subst" "0" "01943" "RPL13_000026" "g.89617020G>T" "" "" "" "SPG7(NM_001363850.1):c.1779+3G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000865027" "0" "30" "16" "89620317" "89620317" "subst" "8.15993E-6" "01943" "RPL13_000027" "g.89620317G>C" "" "" "" "SPG7(NM_003119.3):c.2052G>C (p.M684I), SPG7(NM_003119.4):c.2052G>C (p.(Met684Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000865028" "0" "70" "16" "89620894" "89620894" "subst" "0" "01804" "RPL13_000028" "g.89620894G>A" "" "" "" "SPG7(NM_003119.2):c.2104G>A (p.(Glu702Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000865029" "0" "90" "16" "89620905" "89620921" "del" "0" "01804" "SPG7_000041" "g.89620905_89620921del" "" "" "" "SPG7(NM_003119.2):c.2115_2131del (p.(Leu706GlnfsTer30)), SPG7(NM_003119.3):c.2115_2131delGCTGGTGGCCAAGGCCT (p.L706Qfs*30), SPG7(NM_003119.4):c.2115..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000873172" "0" "70" "16" "89598369" "89598369" "subst" "0.000822261" "03208" "SPG7_000025" "g.89598369G>A" "" "Pennings et al. 2022, in progress" "" "NM_003119.4:c.1045G>A" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000873173" "11" "90" "16" "89595987" "89595987" "dup" "0" "03208" "SPG7_000022" "g.89595987dup" "" "Pennings et al. 2022, in progress" "" "NM_003119.3:c.861dup" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000893249" "0" "10" "16" "89575608" "89575608" "subst" "0" "02326" "SPG7_000100" "g.89575608T>A" "" "" "" "SPG7(NM_003119.4):c.183+600T>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000893250" "0" "10" "16" "89576766" "89576766" "subst" "0" "02326" "SPG7_000101" "g.89576766T>C" "" "" "" "SPG7(NM_003119.4):c.184-132T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000893251" "0" "10" "16" "89576894" "89576894" "del" "0" "02326" "SPG7_000010" "g.89576894del" "" "" "" "SPG7(NM_003119.4):c.184-4delT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000893252" "0" "10" "16" "89577046" "89577046" "subst" "0.471441" "02326" "SPG7_000102" "g.89577046C>T" "" "" "" "SPG7(NM_003119.4):c.286+46C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000893253" "0" "10" "16" "89590060" "89590060" "subst" "0" "02326" "SPG7_000103" "g.89590060G>A" "" "" "" "SPG7(NM_003119.4):c.377-354G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000893254" "0" "10" "16" "89590169" "89590170" "ins" "0" "02326" "SPG7_000072" "g.89590169_89590170insTCTCA" "" "" "" "SPG7(NM_003119.4):c.377-245_377-244insTCTCA" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000893255" "0" "10" "16" "89590243" "89590243" "subst" "0" "02326" "SPG7_000017" "g.89590243G>A" "" "" "" "SPG7(NM_003119.4):c.377-171G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000893257" "0" "10" "16" "89590825" "89590825" "subst" "0" "02326" "SPG7_000105" "g.89590825C>T" "" "" "" "SPG7(NM_003119.4):c.618+170C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000893258" "0" "10" "16" "89592622" "89592622" "subst" "0" "02326" "SPG7_000106" "g.89592622C>T" "" "" "" "SPG7(NM_003119.4):c.619-115C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000893259" "0" "10" "16" "89592690" "89592690" "subst" "0.146652" "02326" "SPG7_000107" "g.89592690G>A" "" "" "" "SPG7(NM_003119.4):c.619-47G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000893260" "0" "10" "16" "89596106" "89596106" "subst" "0" "02326" "SPG7_000108" "g.89596106C>T" "" "" "" "SPG7(NM_003119.4):c.861+119C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000893261" "0" "10" "16" "89597057" "89597057" "subst" "0.465337" "02326" "SPG7_000109" "g.89597057G>T" "" "" "" "SPG7(NM_003119.4):c.862-34G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000893262" "0" "30" "16" "89598356" "89598356" "subst" "0.00503259" "02326" "SPG7_000024" "g.89598356C>T" "" "" "" "SPG7(NM_003119.3):c.1032C>T (p.G344=), SPG7(NM_003119.4):c.1032C>T (p.G344=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000893263" "0" "30" "16" "89598407" "89598407" "subst" "0.000386789" "02326" "SPG7_000110" "g.89598407G>A" "" "" "" "SPG7(NM_003119.4):c.1083G>A (p.A361=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000893264" "0" "10" "16" "89598760" "89598760" "subst" "0" "02326" "SPG7_000111" "g.89598760A>G" "" "" "" "SPG7(NM_003119.4):c.1151-111A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000893265" "0" "50" "16" "89598892" "89598892" "subst" "1.23096E-5" "02325" "SPG7_000112" "g.89598892G>A" "" "" "" "SPG7(NM_003119.4):c.1172G>A (p.(Arg391Gln), p.R391Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000893266" "0" "10" "16" "89599192" "89599192" "dup" "0" "02326" "SPG7_000113" "g.89599192dup" "" "" "" "SPG7(NM_003119.4):c.1324+148dupA" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000893267" "0" "10" "16" "89603064" "89603064" "subst" "0" "02326" "SPG7_000114" "g.89603064A>G" "" "" "" "SPG7(NM_003119.4):c.1324+4020A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000893268" "0" "10" "16" "89612265" "89612265" "dup" "0" "02326" "RPL13_000029" "g.89612265dup" "" "" "" "SPG7(NM_003119.4):c.1450-801dupT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000893269" "0" "10" "16" "89612991" "89612991" "del" "0" "02326" "RPL13_000030" "g.89612991del" "" "" "" "SPG7(NM_003119.4):c.1450-75delC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000893270" "0" "10" "16" "89613037" "89613037" "subst" "0.19318" "02326" "RPL13_000031" "g.89613037G>A" "" "" "" "SPG7(NM_003119.4):c.1450-29G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000893271" "0" "90" "16" "89613070" "89613078" "del" "0" "02329" "SPG7_000002" "g.89613070_89613078del" "" "" "" "SPG7(NM_001363850.1):c.1450-1_1457delGGAGAGGCG, SPG7(NM_003119.4):c.1450-1_1457delGGAGAGGCG, SPG7(NM_003119.4):c.1454_1462del (p.(Arg485_Glu487del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000893272" "0" "10" "16" "89613123" "89613123" "subst" "0.148174" "02326" "SPG7_000056" "g.89613123A>G" "" "" "" "SPG7(NM_003119.4):c.1507A>G (p.T503A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000893273" "0" "10" "16" "89613233" "89613233" "subst" "0" "02326" "RPL13_000032" "g.89613233A>C" "" "" "" "SPG7(NM_003119.4):c.1552+65A>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000893274" "0" "50" "16" "89614435" "89614435" "subst" "0" "02325" "RPL13_000033" "g.89614435A>G" "" "" "" "SPG7(NM_003119.4):c.1577A>G (p.N526S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000893275" "0" "10" "16" "89615453" "89615453" "subst" "0.160195" "02326" "RPL13_000034" "g.89615453A>C" "" "" "" "SPG7(NM_003119.4):c.1663+932A>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000893276" "0" "10" "16" "89615765" "89615765" "subst" "0.13776" "02326" "RPL13_000035" "g.89615765T>G" "" "" "" "SPG7(NM_003119.4):c.1664-1137T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000893277" "0" "10" "16" "89616790" "89616790" "subst" "0" "02326" "RPL13_000036" "g.89616790G>A" "" "" "" "SPG7(NM_003119.4):c.1664-112G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000893278" "0" "10" "16" "89616887" "89616887" "subst" "0.00436751" "02327" "RPL13_000037" "g.89616887C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000893279" "0" "90" "16" "89616910" "89616910" "subst" "0.000142407" "02327" "RPL13_000038" "g.89616910A>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000893280" "0" "10" "16" "89617008" "89617008" "subst" "0.00383306" "02327" "RPL13_000039" "g.89617008C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000893281" "0" "10" "16" "89617064" "89617064" "subst" "0.154557" "02326" "RPL13_000040" "g.89617064G>C" "" "" "" "SPG7(NM_003119.4):c.1779+47G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000893282" "0" "30" "16" "89619540" "89619540" "subst" "0.000798973" "02327" "RPL13_000010" "g.89619540T>A" "" "" "" "SPG7(NM_001363850.1):c.1933T>A (p.S645T), SPG7(NM_003119.4):c.1933T>A (p.S645T, p.(Ser645Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000893283" "0" "30" "16" "89619540" "89619540" "subst" "0.000798973" "02326" "RPL13_000010" "g.89619540T>A" "" "" "" "SPG7(NM_001363850.1):c.1933T>A (p.S645T), SPG7(NM_003119.4):c.1933T>A (p.S645T, p.(Ser645Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000893284" "0" "10" "16" "89620148" "89620148" "subst" "0.168249" "02326" "RPL13_000041" "g.89620148A>G" "" "" "" "SPG7(NM_003119.4):c.1937-54A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000893285" "0" "50" "16" "89620204" "89620204" "subst" "7.33221E-5" "02327" "RPL13_000013" "g.89620204G>T" "" "" "" "SPG7(NM_003119.4):c.1939G>T (p.(Ala647Ser), p.A647S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000893286" "0" "70" "16" "89620238" "89620238" "subst" "0" "02329" "RPL13_000042" "g.89620238C>T" "" "" "" "SPG7(NM_001363850.1):c.1973C>T (p.A658V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000893287" "0" "30" "16" "89620301" "89620301" "subst" "4.07425E-6" "02326" "RPL13_000043" "g.89620301C>T" "" "" "" "SPG7(NM_003119.2):c.2036C>T (p.(Ala679Val)), SPG7(NM_003119.4):c.2036C>T (p.A679V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000893288" "0" "10" "16" "89620328" "89620328" "subst" "0.147144" "02326" "SPG7_000066" "g.89620328G>A" "" "" "" "SPG7(NM_003119.4):c.2063G>A (p.R688Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000893289" "0" "50" "16" "89623353" "89623353" "subst" "0" "02327" "RPL13_000044" "g.89623353T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000893290" "0" "10" "16" "89623992" "89623993" "ins" "0" "02326" "RPL13_000045" "g.89623992_89623993insCACA" "" "" "" "SPG7(NM_003119.4):c.*490_*491insACAC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000914719" "0" "10" "16" "89597110" "89597110" "subst" "0.00261693" "02326" "SPG7_000115" "g.89597110G>A" "" "" "" "SPG7(NM_003119.4):c.881G>A (p.R294H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000914720" "0" "90" "16" "89598377" "89598377" "dup" "0" "02329" "SPG7_000050" "g.89598377dup" "" "" "" "SPG7(NM_001363850.1):c.1053dupC (p.G352Rfs*44)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000914721" "0" "50" "16" "89598919" "89598919" "subst" "4.09239E-5" "02327" "SPG7_000116" "g.89598919G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000914722" "0" "50" "16" "89611153" "89611153" "subst" "0" "02327" "RPL13_000021" "g.89611153C>A" "" "" "" "SPG7(NM_001363850.1):c.1422C>A (p.H474Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000926379" "0" "30" "16" "89598986" "89598986" "subst" "0.000114056" "02330" "SPG7_000117" "g.89598986C>T" "" "" "" "SPG7(NM_001363850.1):c.1266C>T (p.S422=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000926380" "0" "50" "16" "89619511" "89619511" "subst" "0" "02327" "RPL13_000046" "g.89619511C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000926381" "0" "10" "16" "89623393" "89623393" "subst" "0.012485" "02326" "RPL13_000002" "g.89623393G>A" "" "" "" "SPG7(NM_003119.4):c.2280G>A (p.P760=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000930680" "0" "90" "16" "89576947" "89576947" "subst" "0.000426656" "02325" "SPG7_000015" "g.89576947T>A" "" "" "" "SPG7(NM_001363850.1):c.233T>A (p.L78*), SPG7(NM_003119.3):c.233T>A (p.L78*), SPG7(NM_003119.4):c.233T>A (p.(Leu78Ter), p.L78*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000930681" "0" "50" "16" "89613159" "89613159" "subst" "0" "02325" "RPL13_000047" "g.89613159G>C" "" "" "" "SPG7(NM_003119.4):c.1543G>C (p.G515R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000950776" "0" "50" "16" "89599025" "89599025" "subst" "2.85456E-5" "02325" "SPG7_000031" "g.89599025G>T" "" "" "" "SPG7(NM_003119.3):c.1305G>T (p.Q435H), SPG7(NM_003119.4):c.1305G>T (p.(Gln435His), p.Q435H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000950777" "0" "70" "16" "89611140" "89611140" "subst" "8.12414E-6" "02325" "RPL13_000048" "g.89611140G>A" "" "" "" "SPG7(NM_003119.4):c.1409G>A (p.R470Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000950778" "0" "90" "16" "89613145" "89613145" "subst" "0.00287905" "01804" "SPG7_000003" "g.89613145C>T" "" "" "" "SPG7(NM_001363850.1):c.1529C>T (p.A510V), SPG7(NM_003119.2):c.1529C>T (p.(Ala510Val)), SPG7(NM_003119.4):c.1529C>T (p.A510V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000968623" "0" "90" "16" "89576947" "89576947" "subst" "0.000426656" "02330" "SPG7_000015" "g.89576947T>A" "" "" "" "SPG7(NM_001363850.1):c.233T>A (p.L78*), SPG7(NM_003119.3):c.233T>A (p.L78*), SPG7(NM_003119.4):c.233T>A (p.(Leu78Ter), p.L78*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000968624" "0" "90" "16" "89592857" "89592857" "subst" "2.03028E-5" "02329" "SPG7_000118" "g.89592857C>T" "" "" "" "SPG7(NM_001363850.1):c.739C>T (p.R247*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000968625" "0" "50" "16" "89597149" "89597154" "del" "0" "02325" "SPG7_000119" "g.89597149_89597154del" "" "" "" "SPG7(NM_003119.4):c.920_925delGCTTCA (p.S307_F308del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000972346" "0" "70" "16" "89620335" "89620335" "del" "0" "03779" "SPG7_000122" "g.89620335del" "" "" "" "" "" "CLASSIFICATION record" "" "rs1555617559" "0" "" "" "" "" "likely pathogenic" "" "0000982220" "0" "50" "16" "89598378" "89598378" "subst" "8.14107E-6" "02327" "SPG7_000120" "g.89598378G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000982221" "0" "30" "16" "89603235" "89603235" "subst" "0.000296452" "01804" "SPG7_000121" "g.89603235G>A" "" "" "" "SPG7(NM_199367.3):c.1387G>A (p.(Ala463Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000982222" "0" "90" "16" "89616953" "89616953" "subst" "3.65705E-5" "01804" "RPL13_000049" "g.89616953C>T" "" "" "" "SPG7(NM_003119.4):c.1715C>T (p.(Ala572Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000982223" "0" "50" "16" "89619414" "89619414" "subst" "3.25203E-5" "02325" "RPL13_000050" "g.89619414G>A" "" "" "" "SPG7(NM_003119.4):c.1807G>A (p.A603T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000982224" "0" "50" "16" "89620938" "89620938" "subst" "1.24151E-5" "01804" "RPL13_000051" "g.89620938G>C" "" "" "" "SPG7(NM_003119.4):c.2148G>C (p.(Lys716Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000982225" "0" "50" "16" "89623338" "89623338" "subst" "5.27987E-5" "01804" "RPL13_000052" "g.89623338A>G" "" "" "" "SPG7(NM_003119.4):c.2225A>G (p.(Asp742Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000982226" "0" "50" "16" "89623374" "89623374" "subst" "5.68551E-5" "01804" "RPL13_000053" "g.89623374C>T" "" "" "" "SPG7(NM_003119.4):c.2261C>T (p.(Pro754Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000982227" "0" "50" "16" "89623388" "89623388" "subst" "0.000552338" "01804" "RPL13_000001" "g.89623388G>A" "" "" "" "SPG7(NM_003119.2):c.2275G>A (p.(Ala759Thr)), SPG7(NM_003119.3):c.2275G>A (p.A759T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001002807" "0" "50" "16" "89592874" "89592874" "subst" "0" "01804" "SPG7_000021" "g.89592874A>G" "" "" "" "SPG7(NM_003119.2):c.756A>G (p.(Gly252Gly)), SPG7(NM_003119.4):c.756A>G (p.G252=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001002808" "0" "50" "16" "89598450" "89598450" "subst" "0" "02325" "SPG7_000123" "g.89598450C>G" "" "" "" "SPG7(NM_003119.4):c.1126C>G (p.P376A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001002809" "0" "50" "16" "89620301" "89620301" "subst" "4.07425E-6" "01804" "RPL13_000043" "g.89620301C>T" "" "" "" "SPG7(NM_003119.2):c.2036C>T (p.(Ala679Val)), SPG7(NM_003119.4):c.2036C>T (p.A679V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001002810" "0" "70" "16" "89620361" "89620361" "dup" "0" "01804" "SPG7_000067" "g.89620361dup" "" "" "" "SPG7(NM_003119.2):c.2096dup, SPG7(NM_003119.2):c.2096dupT (p.(Met699fs))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001002811" "0" "50" "16" "89620971" "89620971" "subst" "1.25372E-5" "01804" "SPG7_000042" "g.89620971G>A" "" "" "" "SPG7(NM_003119.2):c.2181G>A (p.(Ala727=)), SPG7(NM_003119.4):c.2181G>A (p.A727=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001002812" "0" "50" "16" "89627709" "89627709" "subst" "0" "01804" "RPL13_000054" "g.89627709G>T" "" "" "" "RPL13(NM_000977.3):c.179G>T (p.(Arg60Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001002813" "0" "50" "16" "89628158" "89628158" "subst" "8.15215E-6" "01804" "RPL13_000055" "g.89628158C>T" "" "" "" "RPL13(NM_000977.3):c.419C>T (p.(Ser140Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001011926" "3" "90" "16" "89576947" "89576947" "subst" "0.000426656" "00006" "SPG7_000015" "g.89576947T>A" "" "{PMID:Salinas 2020:33084218}" "" "" "" "Germline" "" "" "0" "" "" "g.89510539T>A" "VCV000006816.9" "pathogenic (recessive)" "" "0001011931" "1" "90" "16" "89576947" "89576947" "subst" "0.000426656" "00006" "SPG7_000015" "g.89576947T>A" "" "{PMID:Salinas 2020:33084218}" "" "" "" "Germline" "" "" "0" "" "" "g.89510539T>A" "VCV000006816.9" "pathogenic (recessive)" "" "0001012002" "2" "90" "16" "89613145" "89613145" "subst" "0.00287905" "00006" "SPG7_000003" "g.89613145C>T" "" "{PMID:Salinas 2020:33084218}" "" "" "" "Germline" "" "" "0" "" "" "g.89546737C>T" "VCV000042016.10" "pathogenic (recessive)" "" "0001015452" "0" "50" "16" "89611148" "89611148" "subst" "1.62484E-5" "02327" "RPL13_000056" "g.89611148C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001015453" "0" "50" "16" "89623304" "89623304" "subst" "3.65863E-5" "02327" "RPL13_000057" "g.89623304G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001015454" "0" "50" "16" "89623395" "89623395" "subst" "0" "02325" "RPL13_000058" "g.89623395A>C" "" "" "" "SPG7(NM_003119.4):c.2282A>C (p.Q761P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001023908" "21" "70" "16" "89620319" "89620319" "del" "0" "03544" "SPG7_000124" "g.89620319del" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.89553911del" "" "likely pathogenic" "ACMG" "0001023909" "10" "70" "16" "89613145" "89613145" "subst" "0.00287905" "03544" "SPG7_000003" "g.89613145C>T" "" "" "" "" "" "Germline" "?" "rs61755320" "0" "" "" "g.89546737C>T" "{CV:42016}" "likely pathogenic" "ACMG" "0001026800" "0" "30" "16" "89597367" "89597367" "subst" "0" "02326" "SPG7_000125" "g.89597367T>C" "" "" "" "SPG7(NM_003119.4):c.987+151T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001026801" "0" "30" "16" "89599241" "89599241" "subst" "0" "02326" "SPG7_000126" "g.89599241C>T" "" "" "" "SPG7(NM_003119.4):c.1324+197C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001041506" "0" "50" "16" "89590648" "89590648" "subst" "0" "01804" "SPG7_000073" "g.89590648G>T" "" "" "" "SPG7(NM_003119.4):c.611G>T (p.(Gly204Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001041507" "0" "30" "16" "89595995" "89595995" "subst" "0.000188571" "01804" "SPG7_000127" "g.89595995C>G" "" "" "" "SPG7(NM_003119.4):c.861+8C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001041508" "0" "50" "16" "89598892" "89598892" "subst" "1.23096E-5" "01804" "SPG7_000112" "g.89598892G>A" "" "" "" "SPG7(NM_003119.4):c.1172G>A (p.(Arg391Gln), p.R391Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001041509" "0" "70" "16" "89599042" "89599045" "del" "0" "01804" "SPG7_000128" "g.89599042_89599045del" "" "" "" "SPG7(NM_003119.4):c.1322_1324+1del" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001041510" "0" "50" "16" "89611154" "89611154" "subst" "1.21872E-5" "01804" "RPL13_000060" "g.89611154G>A" "" "" "" "SPG7(NM_003119.4):c.1423G>A (p.(Val475Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001041511" "0" "30" "16" "89612990" "89612991" "del" "0" "02326" "RPL13_000061" "g.89612990_89612991del" "" "" "" "SPG7(NM_003119.4):c.1450-76_1450-75delCC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001041512" "0" "50" "16" "89616943" "89616943" "subst" "1.62514E-5" "01804" "RPL13_000062" "g.89616943A>C" "" "" "" "SPG7(NM_003119.4):c.1705A>C (p.(Lys569Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001041513" "0" "50" "16" "89619540" "89619540" "subst" "0.000798973" "01804" "RPL13_000010" "g.89619540T>A" "" "" "" "SPG7(NM_001363850.1):c.1933T>A (p.S645T), SPG7(NM_003119.4):c.1933T>A (p.S645T, p.(Ser645Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001041514" "0" "50" "16" "89620316" "89620316" "subst" "8.15654E-6" "01804" "RPL13_000025" "g.89620316T>A" "" "" "" "SPG7(NM_003119.3):c.2051T>A (p.M684K), SPG7(NM_003119.4):c.2051T>A (p.(Met684Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001041515" "0" "50" "16" "89620317" "89620317" "subst" "8.15993E-6" "01804" "RPL13_000027" "g.89620317G>C" "" "" "" "SPG7(NM_003119.3):c.2052G>C (p.M684I), SPG7(NM_003119.4):c.2052G>C (p.(Met684Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001041516" "0" "10" "16" "89622524" "89622524" "subst" "0" "02326" "RPL13_000063" "g.89622524T>G" "" "" "" "SPG7(NM_003119.4):c.2182-771T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001041517" "0" "10" "16" "89623405" "89623405" "subst" "0.0286391" "02326" "RPL13_000003" "g.89623405C>T" "" "" "" "SPG7(NM_003119.4):c.2292C>T (p.I764=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001041518" "0" "50" "16" "89629311" "89629311" "subst" "0.000350019" "01804" "RPL13_000015" "g.89629311C>T" "" "" "" "RPL13(NM_000977.4):c.497C>T (p.(Ala166Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001046587" "0" "30" "16" "89599062" "89599062" "subst" "9.05603E-5" "02326" "SPG7_000129" "g.89599062C>T" "" "" "" "SPG7(NM_003119.4):c.1324+18C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001046588" "0" "50" "16" "89603171" "89603171" "subst" "6.09826E-5" "02325" "SPG7_000130" "g.89603171A>G" "" "" "" "SPG7(NM_003119.4):c.1324+4127A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001049104" "0" "50" "16" "89623318" "89623318" "subst" "0" "00006" "SPG7_000131" "g.89623318G>C" "" "{PMID:Patak 2019:31397880}" "" "" "" "De novo" "" "" "0" "" "" "g.89556910G>C" "" "VUS" "" "0001055734" "0" "50" "16" "89574846" "89574848" "dup" "0" "01804" "SPG7_000044" "g.89574846_89574848dup" "" "" "" "SPG7(NM_003119.4):c.21_23dup (p.(Leu8dup))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001055735" "0" "90" "16" "89576947" "89576947" "subst" "0.000426656" "01804" "SPG7_000015" "g.89576947T>A" "" "" "" "SPG7(NM_001363850.1):c.233T>A (p.L78*), SPG7(NM_003119.3):c.233T>A (p.L78*), SPG7(NM_003119.4):c.233T>A (p.(Leu78Ter), p.L78*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001055736" "0" "50" "16" "89577003" "89577003" "subst" "0" "01804" "SPG7_000132" "g.89577003A>G" "" "" "" "SPG7(NM_003119.4):c.286+3A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001055737" "0" "50" "16" "89590465" "89590465" "subst" "4.06832E-6" "01804" "SPG7_000133" "g.89590465G>A" "" "" "" "SPG7(NM_003119.4):c.428G>A (p.(Arg143His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001055738" "0" "50" "16" "89592848" "89592848" "subst" "1.62423E-5" "01804" "SPG7_000134" "g.89592848T>G" "" "" "" "SPG7(NM_003119.4):c.730T>G (p.(Ser244Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001055739" "0" "50" "16" "89599025" "89599025" "subst" "2.85456E-5" "01804" "SPG7_000031" "g.89599025G>T" "" "" "" "SPG7(NM_003119.3):c.1305G>T (p.Q435H), SPG7(NM_003119.4):c.1305G>T (p.(Gln435His), p.Q435H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001055740" "0" "90" "16" "89613070" "89613078" "del" "0" "01804" "SPG7_000002" "g.89613070_89613078del" "" "" "" "SPG7(NM_001363850.1):c.1450-1_1457delGGAGAGGCG, SPG7(NM_003119.4):c.1450-1_1457delGGAGAGGCG, SPG7(NM_003119.4):c.1454_1462del (p.(Arg485_Glu487del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001055741" "0" "90" "16" "89619468" "89619468" "subst" "0" "01804" "RPL13_000064" "g.89619468C>T" "" "" "" "SPG7(NM_003119.4):c.1861C>T (p.(Gln621*))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001055742" "0" "50" "16" "89620204" "89620204" "subst" "7.33221E-5" "01804" "RPL13_000013" "g.89620204G>T" "" "" "" "SPG7(NM_003119.4):c.1939G>T (p.(Ala647Ser), p.A647S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001055743" "0" "30" "16" "89627345" "89627345" "subst" "3.84819E-5" "01804" "RPL13_000065" "g.89627345C>T" "" "" "" "RPL13(NM_000977.4):c.-20-3C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001055744" "0" "50" "16" "89628077" "89628077" "subst" "4.06415E-6" "01804" "RPL13_000066" "g.89628077A>G" "" "" "" "RPL13(NM_000977.4):c.338A>G (p.(Asn113Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001055745" "0" "30" "16" "89628169" "89628169" "subst" "4.09108E-6" "01804" "RPL13_000067" "g.89628169C>T" "" "" "" "RPL13(NM_000977.4):c.420+10C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001055746" "0" "50" "16" "89629344" "89629344" "subst" "0" "01804" "RPL13_000068" "g.89629344A>G" "" "" "" "RPL13(NM_000977.4):c.530A>G (p.(Lys177Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001057557" "0" "70" "16" "89621122" "89621122" "subst" "0" "03779" "SPG7_000135" "g.89621122T>G" "" "" "" "" "" "Unknown" "" "rs1021570154" "0" "" "" "" "" "likely pathogenic" "" "0001060877" "0" "50" "16" "89613145" "89613145" "subst" "0.00287905" "00006" "SPG7_000003" "g.89613145C>T" "" "{PMID:Horbacz 2025:41210864}" "" "" "ACMG PM1, PM2, PP3; not in 142 controls" "Germline/De novo (untested)" "" "" "0" "" "" "g.89546737C>T" "" "VUS" "ACMG" "0001066576" "0" "30" "16" "89574945" "89574945" "subst" "0.00976439" "02325" "chr16_007819" "g.89574945G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001066577" "0" "90" "16" "89592798" "89592798" "dup" "0" "02325" "chr16_007820" "g.89592798dup" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001066578" "0" "50" "16" "89598378" "89598378" "subst" "8.14107E-6" "02325" "SPG7_000120" "g.89598378G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001066579" "0" "50" "16" "89619511" "89619511" "subst" "0" "02325" "RPL13_000046" "g.89619511C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001066580" "0" "50" "16" "89623388" "89623388" "subst" "0.000552338" "02325" "RPL13_000001" "g.89623388G>A" "" "" "" "SPG7(NM_003119.2):c.2275G>A (p.(Ala759Thr)), SPG7(NM_003119.3):c.2275G>A (p.A759T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001066581" "0" "50" "16" "89623933" "89623933" "subst" "0" "01804" "chr16_007821" "g.89623933G>A" "" "" "" "SPG7(NM_003119.4):c.*432G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes SPG7 ## Count = 296 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000075870" "00020169" "50" "1369" "0" "1369" "0" "c.1369C>T" "r.(?)" "p.(Arg457*)" "" "0000084828" "00020169" "70" "1529" "0" "1529" "0" "c.1529C>T" "r.(?)" "p.(Ala510Val)" "" "0000084829" "00020169" "70" "1454" "0" "1462" "0" "c.1454_1462del" "r.(?)" "p.(Arg485_Glu487del)" "" "0000084830" "00020169" "70" "1454" "0" "1462" "0" "c.1454_1462del" "r.(?)" "p.(Arg485_Glu487del)" "" "0000084831" "00020169" "70" "1529" "0" "1529" "0" "c.1529C>T" "r.(?)" "p.(Ala510Val)" "" "0000084832" "00020169" "70" "1529" "0" "1529" "0" "c.1529C>T" "r.(?)" "p.(Ala510Val)" "" "0000084833" "00020169" "90" "1756" "0" "1756" "0" "c.1756G>T" "r.(?)" "p.(Glu586*)" "" "0000116957" "00020169" "90" "473" "0" "474" "0" "c.473_474del" "r.(?)" "p.(Leu158Glnfs*30)" "4" "0000129160" "00020169" "50" "0" "0" "0" "0" "c.c.(?_-1)_(1324+1_?)del" "r.0?" "p.0?" "" "0000248026" "00020169" "10" "987" "5" "987" "5" "c.987+5A>G" "r.spl?" "p.?" "" "0000249402" "00020169" "30" "756" "0" "756" "0" "c.756A>G" "r.(?)" "p.(Gly252=)" "" "0000253287" "00020169" "10" "987" "5" "987" "5" "c.987+5A>G" "r.spl?" "p.?" "" "0000311484" "00020169" "10" "-660" "0" "-660" "0" "c.-660C>G" "r.(?)" "p.(=)" "" "0000311485" "00020169" "90" "1045" "0" "1045" "0" "c.1045G>A" "r.(?)" "p.(Gly349Ser)" "" "0000311486" "00020169" "50" "1281" "0" "1281" "0" "c.1281G>A" "r.(?)" "p.(Thr427=)" "" "0000311487" "00020169" "30" "1324" "4118" "1324" "4120" "c.1324+4118_1324+4120del" "r.(=)" "p.(=)" "" "0000311488" "00020169" "50" "1370" "0" "1370" "0" "c.1370G>A" "r.(?)" "p.(Arg457Gln)" "" "0000311489" "00020169" "30" "1422" "0" "1422" "0" "c.1422C>T" "r.(?)" "p.(His474=)" "" "0000311490" "00020169" "30" "1457" "0" "1457" "0" "c.1457G>A" "r.(?)" "p.(Arg486Gln)" "" "0000311491" "00020169" "90" "1529" "0" "1529" "0" "c.1529C>T" "r.(?)" "p.(Ala510Val)" "" "0000311492" "00020169" "30" "1593" "0" "1593" "0" "c.1593C>T" "r.(?)" "p.(His531=)" "" "0000311493" "00020169" "10" "1653" "0" "1653" "0" "c.1653C>T" "r.(?)" "p.(Arg551=)" "" "0000311495" "00020169" "30" "184" "-3" "184" "-3" "c.184-3C>A" "r.spl?" "p.?" "" "0000311496" "00020169" "30" "184" "-4" "184" "-4" "c.184-4dup" "r.spl?" "p.?" "" "0000311498" "00020169" "13" "184" "-4" "184" "-4" "c.184-4del" "r.spl?" "p.?" "" "0000311499" "00020169" "50" "2181" "0" "2181" "0" "c.2181G>A" "r.(?)" "p.(Ala727=)" "" "0000311500" "00020169" "10" "377" "-171" "377" "-171" "c.377-171G>A" "r.(=)" "p.(=)" "" "0000311502" "00020169" "10" "618" "12" "618" "12" "c.618+12T>C" "r.(=)" "p.(=)" "" "0000311503" "00020169" "30" "9" "0" "9" "0" "c.9G>T" "r.(?)" "p.(Val3=)" "" "0000313872" "00020169" "90" "1045" "0" "1045" "0" "c.1045G>A" "r.(?)" "p.(Gly349Ser)" "" "0000315579" "00020169" "30" "1032" "0" "1032" "0" "c.1032C>T" "r.(?)" "p.(Gly344=)" "" "0000315580" "00020169" "50" "1048" "0" "1048" "0" "c.1048C>A" "r.(?)" "p.(Pro350Thr)" "" "0000315581" "00020169" "50" "1091" "0" "1091" "0" "c.1091C>T" "r.(?)" "p.(Thr364Met)" "" "0000315582" "00020169" "50" "1213" "0" "1213" "0" "c.1213G>A" "r.(?)" "p.(Val405Ile)" "" "0000315583" "00020169" "50" "1295" "0" "1295" "0" "c.1295C>T" "r.(?)" "p.(Thr432Met)" "" "0000315584" "00020169" "50" "1305" "0" "1305" "0" "c.1305G>T" "r.(?)" "p.(Gln435His)" "" "0000315585" "00020169" "30" "1324" "10" "1324" "10" "c.1324+10C>T" "r.(=)" "p.(=)" "" "0000315586" "00020169" "50" "1409" "0" "1409" "0" "c.1409G>T" "r.(?)" "p.(Arg470Leu)" "" "0000315587" "00020169" "90" "1529" "0" "1529" "0" "c.1529C>T" "r.(?)" "p.(Ala510Val)" "" "0000315588" "00020169" "10" "1663" "13" "1663" "13" "c.1663+13C>T" "r.(=)" "p.(=)" "" "0000315589" "00020169" "30" "184" "-3" "184" "-3" "c.184-3C>T" "r.spl?" "p.?" "" "0000315590" "00020169" "30" "186" "0" "186" "0" "c.186C>T" "r.(?)" "p.(Ser62=)" "" "0000315591" "00020169" "30" "199" "0" "199" "0" "c.199C>T" "r.(?)" "p.(Leu67=)" "" "0000315592" "00020169" "90" "2115" "0" "2131" "0" "c.2115_2131del" "r.(?)" "p.(Leu706GlnfsTer30)" "" "0000315593" "00020169" "30" "2275" "0" "2275" "0" "c.2275G>A" "r.(?)" "p.(Ala759Thr)" "" "0000315594" "00020169" "90" "233" "0" "233" "0" "c.233T>A" "r.(?)" "p.(Leu78Ter)" "" "0000315595" "00020169" "30" "474" "0" "474" "0" "c.474C>T" "r.(?)" "p.(Leu158=)" "" "0000315596" "00020169" "30" "547" "0" "547" "0" "c.547G>A" "r.(?)" "p.(Val183Ile)" "" "0000315597" "00020169" "10" "618" "12" "618" "12" "c.618+12T>C" "r.(=)" "p.(=)" "" "0000338857" "00020169" "10" "618" "12" "618" "12" "c.618+12T>C" "r.(=)" "p.(=)" "" "0000338859" "00020169" "10" "987" "19" "987" "19" "c.987+19G>A" "r.(=)" "p.(=)" "" "0000338860" "00020169" "30" "1324" "19" "1324" "19" "c.1324+19C>T" "r.(=)" "p.(=)" "" "0000338861" "00020169" "10" "1449" "19" "1449" "19" "c.1449+19G>A" "r.(=)" "p.(=)" "" "0000338862" "00020169" "10" "1552" "13" "1552" "13" "c.1552+13C>T" "r.(=)" "p.(=)" "" "0000338864" "00020169" "10" "1663" "13" "1663" "13" "c.1663+13C>T" "r.(=)" "p.(=)" "" "0000340537" "00020169" "10" "9" "0" "9" "0" "c.9G>T" "r.(?)" "p.(Val3=)" "" "0000340538" "00020169" "10" "423" "0" "423" "0" "c.423G>T" "r.(?)" "p.(Arg141=)" "" "0000340539" "00020169" "10" "987" "5" "987" "5" "c.987+5A>G" "r.spl?" "p.?" "" "0000340540" "00020169" "10" "1422" "0" "1422" "0" "c.1422C>T" "r.(?)" "p.(His474=)" "" "0000340541" "00020169" "10" "1653" "0" "1653" "0" "c.1653C>T" "r.(?)" "p.(Arg551=)" "" "0000340542" "00020169" "10" "2280" "0" "2280" "0" "c.2280G>A" "r.(?)" "p.(Pro760=)" "" "0000340543" "00020169" "10" "2292" "0" "2292" "0" "c.2292C>T" "r.(?)" "p.(Ile764=)" "" "0000340544" "00020169" "10" "2295" "0" "2295" "0" "c.2295C>T" "r.(?)" "p.(Asp765=)" "" "0000341011" "00020169" "30" "1281" "0" "1281" "0" "c.1281G>A" "r.(?)" "p.(Thr427=)" "" "0000341546" "00020169" "10" "2037" "0" "2037" "0" "c.2037G>A" "r.(?)" "p.(Ala679=)" "" "0000341583" "00020169" "30" "2275" "0" "2275" "0" "c.2275G>A" "r.(?)" "p.(Ala759Thr)" "" "0000342984" "00020169" "50" "1453" "0" "1453" "0" "c.1453A>G" "r.(?)" "p.(Arg485Gly)" "" "0000343267" "00020169" "10" "2063" "0" "2063" "0" "c.2063G>A" "r.(?)" "p.(Arg688Gln)" "" "0000344165" "00020169" "50" "1948" "0" "1948" "0" "c.1948G>T" "r.(?)" "p.(Asp650Tyr)" "" "0000344902" "00020169" "90" "1702" "0" "1702" "0" "c.1702C>T" "r.(?)" "p.(Gln568Ter)" "" "0000345064" "00020169" "90" "335" "0" "336" "0" "c.335_336insTA" "r.(?)" "p.(Glu112AspfsTer42)" "" "0000345489" "00020169" "90" "1756" "0" "1756" "0" "c.1756G>T" "r.(?)" "p.(Glu586Ter)" "" "0000346079" "00020169" "50" "1324" "0" "1324" "0" "c.1324G>C" "r.(?)" "p.(Gly442Arg)" "" "0000346199" "00020169" "50" "1894" "0" "1894" "0" "c.1894G>A" "r.(?)" "p.(Gly632Arg)" "" "0000346513" "00020169" "70" "2102" "0" "2102" "0" "c.2102A>C" "r.(?)" "p.(His701Pro)" "" "0000347718" "00020169" "90" "3" "0" "3" "0" "c.3G>A" "r.(?)" "p.(Met1?)" "" "0000347886" "00020169" "90" "2096" "0" "2096" "0" "c.2096dup" "r.(?)" "p.(Met699IlefsTer4)" "" "0000349541" "00020169" "10" "1507" "0" "1507" "0" "c.1507A>G" "r.(?)" "p.(Thr503Ala)" "" "0000349831" "00020169" "70" "1749" "0" "1749" "0" "c.1749G>C" "r.(?)" "p.(Trp583Cys)" "" "0000351420" "00020169" "70" "1045" "0" "1045" "0" "c.1045G>A" "r.(?)" "p.(Gly349Ser)" "" "0000351709" "00020169" "90" "1920" "0" "1920" "0" "c.1920dup" "r.(?)" "p.(Asn641Glnfs*38)" "" "0000356902" "00020169" "70" "759" "-2" "759" "-2" "c.759-2A>G" "r.spl" "p.?" "5i" "0000356903" "00020169" "70" "1529" "0" "1529" "0" "c.1529C>T" "r.(?)" "p.(Ala510Val)" "11" "0000440046" "00020169" "90" "1045" "0" "1045" "0" "c.1045G>A" "r.(?)" "p.Gly349Ser" "" "0000559924" "00020169" "10" "184" "-4" "184" "-4" "c.184-4del" "r.spl?" "p.?" "" "0000559925" "00020169" "10" "184" "-4" "184" "-4" "c.184-4dup" "r.spl?" "p.?" "" "0000559926" "00020169" "30" "246" "0" "246" "0" "c.246A>G" "r.(?)" "p.(Gln82=)" "" "0000559927" "00020169" "10" "377" "-245" "377" "-244" "c.377-245_377-244insTCTCA" "r.(=)" "p.(=)" "" "0000559928" "00020169" "50" "611" "0" "611" "0" "c.611G>T" "r.(?)" "p.(Gly204Val)" "" "0000559929" "00020169" "90" "694" "0" "694" "0" "c.694del" "r.(?)" "p.(Glu232SerfsTer2)" "" "0000559930" "00020169" "90" "861" "2" "861" "2" "c.861+2dup" "r.spl?" "p.?" "" "0000559931" "00020169" "90" "861" "2" "861" "2" "c.861+2dup" "r.spl?" "p.?" "" "0000559932" "00020169" "90" "1045" "0" "1045" "0" "c.1045G>A" "r.(?)" "p.(Gly349Ser)" "" "0000559933" "00020169" "50" "1048" "0" "1048" "0" "c.1048C>A" "r.(?)" "p.(Pro350Thr)" "" "0000559934" "00020169" "70" "1059" "0" "1059" "0" "c.1059T>G" "r.(?)" "p.(Cys353Trp)" "" "0000559935" "00020169" "30" "1324" "4109" "1324" "4109" "c.1324+4109C>T" "r.(=)" "p.(=)" "" "0000559936" "00020169" "10" "1324" "4187" "1324" "4187" "c.1324+4187C>T" "r.(=)" "p.(=)" "" "0000559937" "00020169" "30" "1350" "0" "1350" "0" "c.1350C>A" "r.(?)" "p.(Ile450=)" "" "0000559938" "00020169" "30" "1387" "0" "1387" "0" "c.1387G>C" "r.(?)" "p.(Gly463Arg)" "" "0000559939" "00020169" "90" "1454" "0" "1462" "0" "c.1454_1462del" "r.(?)" "p.(Arg485_Glu487del)" "" "0000559940" "00020169" "30" "1467" "0" "1467" "0" "c.1467T>C" "r.(?)" "p.(Phe489=)" "" "0000559941" "00020169" "10" "1779" "20" "1779" "20" "c.1779+20G>A" "r.(=)" "p.(=)" "" "0000559942" "00020169" "30" "1886" "0" "1886" "0" "c.1886C>G" "r.(?)" "p.(Ala629Gly)" "" "0000559943" "00020169" "50" "1933" "0" "1933" "0" "c.1933T>A" "r.(?)" "p.(Ser645Thr)" "" "0000559944" "00020169" "10" "1937" "-16" "1937" "-16" "c.1937-16C>G" "r.(=)" "p.(=)" "" "0000559945" "00020169" "10" "1937" "-15" "1937" "-15" "c.1937-15G>A" "r.(=)" "p.(=)" "" "0000559946" "00020169" "50" "1939" "0" "1939" "0" "c.1939G>T" "r.(?)" "p.(Ala647Ser)" "" "0000559947" "00020169" "50" "1966" "0" "1966" "0" "c.1966C>T" "r.(?)" "p.(Arg656Cys)" "" "0000559948" "00020169" "30" "8198" "0" "8198" "0" "c.*5810C>T" "r.(=)" "p.(=)" "" "0000577979" "00020169" "70" "1529" "0" "1529" "0" "c.1529C>T" "r.(?)" "p.Ala510Val" "" "0000577980" "00020169" "70" "861" "0" "861" "0" "c.861dup" "r.(?)" "p.Asn288*" "" "0000616286" "00020169" "30" "851" "0" "851" "0" "c.851T>C" "r.(?)" "p.(Phe284Ser)" "" "0000616287" "00020169" "90" "851" "0" "851" "0" "c.851del" "r.(?)" "p.(Phe284SerfsTer45)" "" "0000623583" "00020169" "30" "618" "14" "618" "36" "c.618+14_618+36del" "r.(=)" "p.(=)" "" "0000623584" "00020169" "50" "1457" "0" "1457" "0" "c.1457G>T" "r.(?)" "p.(Arg486Leu)" "" "0000630874" "00020169" "99" "1045" "0" "1045" "0" "c.1045G>A" "r.(?)" "p.(Gly349Ser)" "" "0000631914" "00020169" "70" "1099" "0" "1099" "0" "c.1099C>T" "r.(?)" "p.(Gln367*)" "" "0000649452" "00020169" "50" "233" "0" "233" "0" "c.233T>A" "r.(?)" "p.(Leu78*)" "" "0000649453" "00020169" "70" "1045" "0" "1045" "0" "c.1045G>A" "r.(?)" "p.(Gly349Ser)" "" "0000649454" "00020169" "90" "1408" "0" "1408" "0" "c.1408C>T" "r.(?)" "p.(Arg470*)" "" "0000649455" "00020169" "50" "1529" "0" "1529" "0" "c.1529C>T" "r.(?)" "p.(Ala510Val)" "" "0000649456" "00020169" "70" "1643" "0" "1643" "0" "c.1643C>A" "r.(?)" "p.(Ala548Asp)" "" "0000649457" "00020169" "50" "2280" "0" "2280" "0" "c.2280G>A" "r.(?)" "p.(Pro760=)" "" "0000649458" "00020169" "10" "2292" "0" "2292" "0" "c.2292C>T" "r.(=)" "p.(=)" "" "0000653444" "00020169" "90" "1045" "0" "1045" "0" "c.1045G>A" "r.(?)" "p.(Gly349Ser)" "" "0000653477" "00020169" "50" "1611" "0" "1611" "0" "c.1611C>G" "r.(?)" "p.(His537Gln)" "" "0000653533" "00020169" "90" "1454" "0" "1462" "0" "c.1454_1462del" "r.(?)" "p.(Arg485_Glu487del)" "" "0000653534" "00020169" "90" "861" "0" "861" "0" "c.861dup" "r.(?)" "p.(Asn288*)" "" "0000653540" "00020169" "70" "1529" "0" "1529" "0" "c.1529C>T" "r.(?)" "p.(Ala510Val)" "" "0000653544" "00020169" "50" "69" "0" "69" "0" "c.69G>C" "r.(?)" "p.(Trp23Cys)" "" "0000653551" "00020169" "70" "1529" "0" "1529" "0" "c.1529C>T" "r.(?)" "p.(Ala510Val)" "" "0000653552" "00020169" "70" "1049" "0" "1077" "0" "c.1049_1077del" "r.(?)" "p.(Pro350Glnfs*36)" "" "0000659585" "00020169" "70" "1529" "0" "1529" "0" "c.1529C>T" "r.(?)" "p.(Ala510Val)" "" "0000659586" "00020169" "90" "861" "0" "861" "0" "c.861dup" "r.(?)" "p.(Asn288*)" "" "0000659715" "00020169" "90" "1045" "0" "1045" "0" "c.1045G>A" "r.(?)" "p.(Gly349Ser)" "" "0000660448" "00020169" "70" "1529" "0" "1529" "0" "c.1529C>T" "r.(?)" "p.(Ala510Val)" "" "0000663703" "00020169" "90" "1454" "0" "1462" "0" "c.1454_1462del" "r.(?)" "p.(Arg485_Glu487del)" "" "0000664291" "00020169" "70" "233" "0" "233" "0" "c.233T>A" "r.(?)" "p.(Leu78*)" "" "0000664830" "00020169" "70" "1529" "0" "1529" "0" "c.1529C>T" "r.(?)" "p.(Ala510Val)" "" "0000667193" "00020169" "50" "2183" "0" "2183" "0" "c.2183T>G" "r.(?)" "p.(Leu728Arg)" "" "0000667599" "00020169" "50" "946" "0" "946" "0" "c.946G>A" "r.(?)" "p.(Glu316Lys)" "" "0000669365" "00020169" "50" "233" "0" "233" "0" "c.233T>A" "r.(?)" "p.(Leu78*)" "" "0000669366" "00020169" "50" "2280" "0" "2280" "0" "c.2280G>A" "r.(=)" "p.(=)" "" "0000680749" "00020169" "30" "862" "-3" "862" "-3" "c.862-3C>T" "r.spl?" "p.?" "" "0000680750" "00020169" "30" "1254" "0" "1254" "0" "c.1254C>T" "r.(?)" "p.(Ser418=)" "" "0000680751" "00020169" "30" "1324" "4187" "1324" "4187" "c.1324+4187C>T" "r.(=)" "p.(=)" "" "0000680752" "00020169" "50" "1894" "0" "1894" "0" "c.1894G>A" "r.(?)" "p.(Gly632Arg)" "" "0000682792" "00020169" "13" "1045" "0" "1045" "0" "c.1045G>A" "r.(?)" "p.(Gly349Ser)" "" "0000692217" "00020169" "50" "1422" "0" "1422" "0" "c.1422C>A" "r.(?)" "p.(His474Gln)" "" "0000692218" "00020169" "90" "1454" "0" "1462" "0" "c.1454_1462del" "r.(?)" "p.(Arg485_Glu487del)" "" "0000698156" "00020169" "90" "898" "0" "898" "0" "c.898G>A" "r.(?)" "p.(Gly300Arg)" "" "0000726083" "00020169" "90" "3" "0" "3" "0" "c.3G>C" "r.(?)" "p.(Met1?)" "" "0000726084" "00020169" "90" "1529" "0" "1529" "0" "c.1529C>T" "r.(?)" "p.(Ala510Val)" "" "0000726085" "00020169" "90" "2115" "0" "2131" "0" "c.2115_2131del" "r.(?)" "p.(Leu706GlnfsTer30)" "" "0000726086" "00020169" "50" "2228" "0" "2228" "0" "c.2228T>C" "r.(?)" "p.(Ile743Thr)" "" "0000787407" "00020169" "50" "614" "0" "614" "0" "c.614G>A" "r.(?)" "p.(Arg205Gln)" "4" "0000787408" "00020169" "50" "1264" "0" "1264" "0" "c.1264T>C" "r.(?)" "p.(Ser422Pro)" "9" "0000787613" "00020169" "50" "853" "0" "853" "0" "c.853A>G" "r.(?)" "p.(Ser285Gly)" "6" "0000794125" "00020169" "70" "1224" "0" "1224" "0" "c.1224T>G" "r.(?)" "p.(Asp408Glu)" "" "0000807725" "00020169" "50" "20" "0" "25" "0" "c.20_25dup" "r.(?)" "p.(Leu7_Leu8dup)" "" "0000807726" "00020169" "90" "414" "0" "414" "0" "c.414C>G" "r.(?)" "p.(Tyr138*)" "" "0000807727" "00020169" "30" "618" "14" "618" "36" "c.618+14_618+36del" "r.(=)" "p.(=)" "" "0000807728" "00020169" "30" "1324" "4158" "1324" "4158" "c.1324+4158G>C" "r.(=)" "p.(=)" "" "0000807729" "00020169" "90" "1606" "0" "1606" "0" "c.1606G>T" "r.(?)" "p.(Gly536*)" "" "0000807730" "00020169" "50" "1645" "0" "1645" "0" "c.1645G>A" "r.(?)" "p.(Val549Met)" "" "0000807731" "00020169" "30" "1933" "0" "1933" "0" "c.1933T>A" "r.(?)" "p.(Ser645Thr)" "" "0000807732" "00020169" "30" "2051" "0" "2051" "0" "c.2051T>A" "r.(?)" "p.(Met684Lys)" "" "0000841202" "00020169" "90" "1990" "0" "1990" "0" "c.1990C>T" "r.(?)" "p.(Gln664*)" "15" "0000847193" "00020169" "70" "233" "0" "233" "0" "c.233T>A" "r.(?)" "p.(Leu78*)" "" "0000854721" "00020169" "90" "1749" "0" "1749" "0" "c.1749G>C" "r.(?)" "p.(Trp583Cys)" "" "0000865025" "00020169" "90" "1045" "0" "1045" "0" "c.1045G>A" "r.(?)" "p.(Gly349Ser)" "" "0000865026" "00020169" "30" "1779" "3" "1779" "3" "c.1779+3G>T" "r.spl?" "p.?" "" "0000865027" "00020169" "30" "2052" "0" "2052" "0" "c.2052G>C" "r.(?)" "p.(Met684Ile)" "" "0000865028" "00020169" "70" "2104" "0" "2104" "0" "c.2104G>A" "r.(?)" "p.(Glu702Lys)" "" "0000865029" "00020169" "90" "2115" "0" "2131" "0" "c.2115_2131del" "r.(?)" "p.(Leu706GlnfsTer30)" "" "0000873172" "00020169" "70" "1045" "0" "1045" "0" "c.1045G>A" "r.(?)" "p.(Gly349Ser)" "" "0000873173" "00020169" "90" "861" "0" "861" "0" "c.861dup" "r.(?)" "p.(Asn288*)" "" "0000893249" "00020169" "10" "183" "600" "183" "600" "c.183+600T>A" "r.(=)" "p.(=)" "" "0000893250" "00020169" "10" "184" "-132" "184" "-132" "c.184-132T>C" "r.(=)" "p.(=)" "" "0000893251" "00020169" "10" "184" "-4" "184" "-4" "c.184-4del" "r.spl?" "p.?" "" "0000893252" "00020169" "10" "286" "46" "286" "46" "c.286+46C>T" "r.(=)" "p.(=)" "" "0000893253" "00020169" "10" "377" "-354" "377" "-354" "c.377-354G>A" "r.(=)" "p.(=)" "" "0000893254" "00020169" "10" "377" "-245" "377" "-244" "c.377-245_377-244insTCTCA" "r.(=)" "p.(=)" "" "0000893255" "00020169" "10" "377" "-171" "377" "-171" "c.377-171G>A" "r.(=)" "p.(=)" "" "0000893257" "00020169" "10" "618" "170" "618" "170" "c.618+170C>T" "r.(=)" "p.(=)" "" "0000893258" "00020169" "10" "619" "-115" "619" "-115" "c.619-115C>T" "r.(=)" "p.(=)" "" "0000893259" "00020169" "10" "619" "-47" "619" "-47" "c.619-47G>A" "r.(=)" "p.(=)" "" "0000893260" "00020169" "10" "861" "119" "861" "119" "c.861+119C>T" "r.(=)" "p.(=)" "" "0000893261" "00020169" "10" "862" "-34" "862" "-34" "c.862-34G>T" "r.(=)" "p.(=)" "" "0000893262" "00020169" "30" "1032" "0" "1032" "0" "c.1032C>T" "r.(?)" "p.(Gly344=)" "" "0000893263" "00020169" "30" "1083" "0" "1083" "0" "c.1083G>A" "r.(?)" "p.(Ala361=)" "" "0000893264" "00020169" "10" "1151" "-111" "1151" "-111" "c.1151-111A>G" "r.(=)" "p.(=)" "" "0000893265" "00020169" "50" "1172" "0" "1172" "0" "c.1172G>A" "r.(?)" "p.(Arg391Gln)" "" "0000893266" "00020169" "10" "1324" "148" "1324" "148" "c.1324+148dup" "r.(=)" "p.(=)" "" "0000893267" "00020169" "10" "1324" "4020" "1324" "4020" "c.1324+4020A>G" "r.(=)" "p.(=)" "" "0000893268" "00020169" "10" "1450" "-801" "1450" "-801" "c.1450-801dup" "r.(=)" "p.(=)" "" "0000893269" "00020169" "10" "1450" "-75" "1450" "-75" "c.1450-75del" "r.(=)" "p.(=)" "" "0000893270" "00020169" "10" "1450" "-29" "1450" "-29" "c.1450-29G>A" "r.(=)" "p.(=)" "" "0000893271" "00020169" "90" "1454" "0" "1462" "0" "c.1454_1462del" "r.(?)" "p.(Arg485_Glu487del)" "" "0000893272" "00020169" "10" "1507" "0" "1507" "0" "c.1507A>G" "r.(?)" "p.(Thr503Ala)" "" "0000893273" "00020169" "10" "1552" "65" "1552" "65" "c.1552+65A>C" "r.(=)" "p.(=)" "" "0000893274" "00020169" "50" "1577" "0" "1577" "0" "c.1577A>G" "r.(?)" "p.(Asn526Ser)" "" "0000893275" "00020169" "10" "1663" "932" "1663" "932" "c.1663+932A>C" "r.(=)" "p.(=)" "" "0000893276" "00020169" "10" "1664" "-1137" "1664" "-1137" "c.1664-1137T>G" "r.(=)" "p.(=)" "" "0000893277" "00020169" "10" "1664" "-112" "1664" "-112" "c.1664-112G>A" "r.(=)" "p.(=)" "" "0000893278" "00020169" "10" "1664" "-15" "1664" "-15" "c.1664-15C>A" "r.(=)" "p.(=)" "" "0000893279" "00020169" "90" "1672" "0" "1672" "0" "c.1672A>T" "r.(?)" "p.(Lys558*)" "" "0000893280" "00020169" "10" "1770" "0" "1770" "0" "c.1770C>T" "r.(?)" "p.(Ala590=)" "" "0000893281" "00020169" "10" "1779" "47" "1779" "47" "c.1779+47G>C" "r.(=)" "p.(=)" "" "0000893282" "00020169" "30" "1933" "0" "1933" "0" "c.1933T>A" "r.(?)" "p.(Ser645Thr)" "" "0000893283" "00020169" "30" "1933" "0" "1933" "0" "c.1933T>A" "r.(?)" "p.(Ser645Thr)" "" "0000893284" "00020169" "10" "1937" "-54" "1937" "-54" "c.1937-54A>G" "r.(=)" "p.(=)" "" "0000893285" "00020169" "50" "1939" "0" "1939" "0" "c.1939G>T" "r.(?)" "p.(Ala647Ser)" "" "0000893286" "00020169" "70" "1973" "0" "1973" "0" "c.1973C>T" "r.(?)" "p.(Ala658Val)" "" "0000893287" "00020169" "30" "2036" "0" "2036" "0" "c.2036C>T" "r.(?)" "p.(Ala679Val)" "" "0000893288" "00020169" "10" "2063" "0" "2063" "0" "c.2063G>A" "r.(?)" "p.(Arg688Gln)" "" "0000893289" "00020169" "50" "2240" "0" "2240" "0" "c.2240T>C" "r.(?)" "p.(Ile747Thr)" "" "0000893290" "00020169" "10" "2879" "0" "2880" "0" "c.*491_*492insCACA" "r.(=)" "p.(=)" "" "0000914719" "00020169" "10" "881" "0" "881" "0" "c.881G>A" "r.(?)" "p.(Arg294His)" "" "0000914720" "00020169" "90" "1053" "0" "1053" "0" "c.1053dup" "r.(?)" "p.(Gly352ArgfsTer44)" "" "0000914721" "00020169" "50" "1199" "0" "1199" "0" "c.1199G>A" "r.(?)" "p.(Arg400Gln)" "" "0000914722" "00020169" "50" "1422" "0" "1422" "0" "c.1422C>A" "r.(?)" "p.(His474Gln)" "" "0000926379" "00020169" "30" "1266" "0" "1266" "0" "c.1266C>T" "r.(?)" "p.(Ser422=)" "" "0000926380" "00020169" "50" "1904" "0" "1904" "0" "c.1904C>T" "r.(?)" "p.(Ser635Leu)" "" "0000926381" "00020169" "10" "2280" "0" "2280" "0" "c.2280G>A" "r.(?)" "p.(Pro760=)" "" "0000930680" "00020169" "90" "233" "0" "233" "0" "c.233T>A" "r.(?)" "p.(Leu78Ter)" "" "0000930681" "00020169" "50" "1543" "0" "1543" "0" "c.1543G>C" "r.(?)" "p.(Gly515Arg)" "" "0000950776" "00020169" "50" "1305" "0" "1305" "0" "c.1305G>T" "r.(?)" "p.(Gln435His)" "" "0000950777" "00020169" "70" "1409" "0" "1409" "0" "c.1409G>A" "r.(?)" "p.(Arg470Gln)" "" "0000950778" "00020169" "90" "1529" "0" "1529" "0" "c.1529C>T" "r.(?)" "p.(Ala510Val)" "" "0000968623" "00020169" "90" "233" "0" "233" "0" "c.233T>A" "r.(?)" "p.(Leu78Ter)" "" "0000968624" "00020169" "90" "739" "0" "739" "0" "c.739C>T" "r.(?)" "p.(Arg247*)" "" "0000968625" "00020169" "50" "920" "0" "925" "0" "c.920_925del" "r.(?)" "p.(Ser307_Phe308del)" "" "0000972346" "00020169" "70" "2070" "0" "2070" "0" "c.2070del" "r.(?)" "p.(Phe691SerfsTer8)" "" "0000982220" "00020169" "50" "1054" "0" "1054" "0" "c.1054G>A" "r.(?)" "p.(Gly352Ser)" "" "0000982221" "00020169" "30" "1324" "4191" "1324" "4191" "c.1324+4191G>A" "r.(=)" "p.(=)" "" "0000982222" "00020169" "90" "1715" "0" "1715" "0" "c.1715C>T" "r.(?)" "p.(Ala572Val)" "" "0000982223" "00020169" "50" "1807" "0" "1807" "0" "c.1807G>A" "r.(?)" "p.(Ala603Thr)" "" "0000982224" "00020169" "50" "2148" "0" "2148" "0" "c.2148G>C" "r.(?)" "p.(Lys716Asn)" "" "0000982225" "00020169" "50" "2225" "0" "2225" "0" "c.2225A>G" "r.(?)" "p.(Asp742Gly)" "" "0000982226" "00020169" "50" "2261" "0" "2261" "0" "c.2261C>T" "r.(?)" "p.(Pro754Leu)" "" "0000982227" "00020169" "50" "2275" "0" "2275" "0" "c.2275G>A" "r.(?)" "p.(Ala759Thr)" "" "0001002807" "00020169" "50" "756" "0" "756" "0" "c.756A>G" "r.(?)" "p.(Gly252=)" "" "0001002808" "00020169" "50" "1126" "0" "1126" "0" "c.1126C>G" "r.(?)" "p.(Pro376Ala)" "" "0001002809" "00020169" "50" "2036" "0" "2036" "0" "c.2036C>T" "r.(?)" "p.(Ala679Val)" "" "0001002810" "00020169" "70" "2096" "0" "2096" "0" "c.2096dup" "r.(?)" "p.(Met699IlefsTer4)" "" "0001002811" "00020169" "50" "2181" "0" "2181" "0" "c.2181G>A" "r.(?)" "p.(Ala727=)" "" "0001002812" "00020169" "50" "6596" "0" "6596" "0" "c.*4208G>T" "r.(=)" "p.(=)" "" "0001002813" "00020169" "50" "7045" "0" "7045" "0" "c.*4657C>T" "r.(=)" "p.(=)" "" "0001011926" "00020169" "90" "233" "0" "233" "0" "c.233T>A" "r.(?)" "p.(Leu78Ter)" "" "0001011931" "00020169" "90" "233" "0" "233" "0" "c.233T>A" "r.(?)" "p.(Leu78Ter)" "" "0001012002" "00020169" "90" "1529" "0" "1529" "0" "c.1529C>T" "r.(?)" "p.(Ala510Val)" "" "0001015452" "00020169" "50" "1417" "0" "1417" "0" "c.1417C>T" "r.(?)" "p.(Arg473Trp)" "" "0001015453" "00020169" "50" "2191" "0" "2191" "0" "c.2191G>A" "r.(?)" "p.(Ala731Thr)" "" "0001015454" "00020169" "50" "2282" "0" "2282" "0" "c.2282A>C" "r.(?)" "p.(Gln761Pro)" "" "0001023908" "00020169" "70" "2054" "0" "2054" "0" "c.2054del" "r.(?)" "p.(Gly685Alafs*14)" "15" "0001023909" "00020169" "70" "1529" "0" "1529" "0" "c.1529C>T" "r.(?)" "p.(Ala510Val)" "11" "0001026800" "00020169" "30" "987" "151" "987" "151" "c.987+151T>C" "r.(=)" "p.(=)" "" "0001026801" "00020169" "30" "1324" "197" "1324" "197" "c.1324+197C>T" "r.(=)" "p.(=)" "" "0001041506" "00020169" "50" "611" "0" "611" "0" "c.611G>T" "r.(?)" "p.(Gly204Val)" "" "0001041507" "00020169" "30" "861" "8" "861" "8" "c.861+8C>G" "r.(=)" "p.(=)" "" "0001041508" "00020169" "50" "1172" "0" "1172" "0" "c.1172G>A" "r.(?)" "p.(Arg391Gln)" "" "0001041509" "00020169" "70" "1322" "0" "1324" "1" "c.1322_1324+1del" "r.spl?" "p.?" "" "0001041510" "00020169" "50" "1423" "0" "1423" "0" "c.1423G>A" "r.(?)" "p.(Val475Ile)" "" "0001041511" "00020169" "30" "1450" "-76" "1450" "-75" "c.1450-76_1450-75del" "r.(=)" "p.(=)" "" "0001041512" "00020169" "50" "1705" "0" "1705" "0" "c.1705A>C" "r.(?)" "p.(Lys569Gln)" "" "0001041513" "00020169" "50" "1933" "0" "1933" "0" "c.1933T>A" "r.(?)" "p.(Ser645Thr)" "" "0001041514" "00020169" "50" "2051" "0" "2051" "0" "c.2051T>A" "r.(?)" "p.(Met684Lys)" "" "0001041515" "00020169" "50" "2052" "0" "2052" "0" "c.2052G>C" "r.(?)" "p.(Met684Ile)" "" "0001041516" "00020169" "10" "2182" "-771" "2182" "-771" "c.2182-771T>G" "r.(=)" "p.(=)" "" "0001041517" "00020169" "10" "2292" "0" "2292" "0" "c.2292C>T" "r.(?)" "p.(Ile764=)" "" "0001041518" "00020169" "50" "8198" "0" "8198" "0" "c.*5810C>T" "r.(=)" "p.(=)" "" "0001046587" "00020169" "30" "1324" "18" "1324" "18" "c.1324+18C>T" "r.(=)" "p.(=)" "" "0001046588" "00020169" "50" "1324" "4127" "1324" "4127" "c.1324+4127A>G" "r.(=)" "p.(=)" "" "0001049104" "00020169" "50" "2205" "0" "2205" "0" "c.2205G>C" "r.(?)" "p.(Lys735Asn)" "" "0001055734" "00020169" "50" "21" "0" "23" "0" "c.21_23dup" "r.(?)" "p.(Leu8dup)" "" "0001055735" "00020169" "90" "233" "0" "233" "0" "c.233T>A" "r.(?)" "p.(Leu78Ter)" "" "0001055736" "00020169" "50" "286" "3" "286" "3" "c.286+3A>G" "r.spl?" "p.?" "" "0001055737" "00020169" "50" "428" "0" "428" "0" "c.428G>A" "r.(?)" "p.(Arg143His)" "" "0001055738" "00020169" "50" "730" "0" "730" "0" "c.730T>G" "r.(?)" "p.(Ser244Ala)" "" "0001055739" "00020169" "50" "1305" "0" "1305" "0" "c.1305G>T" "r.(?)" "p.(Gln435His)" "" "0001055740" "00020169" "90" "1454" "0" "1462" "0" "c.1454_1462del" "r.(?)" "p.(Arg485_Glu487del)" "" "0001055741" "00020169" "90" "1861" "0" "1861" "0" "c.1861C>T" "r.(?)" "p.(Gln621*)" "" "0001055742" "00020169" "50" "1939" "0" "1939" "0" "c.1939G>T" "r.(?)" "p.(Ala647Ser)" "" "0001055743" "00020169" "30" "6232" "0" "6232" "0" "c.*3844C>T" "r.(=)" "p.(=)" "" "0001055744" "00020169" "50" "6964" "0" "6964" "0" "c.*4576A>G" "r.(=)" "p.(=)" "" "0001055745" "00020169" "30" "7056" "0" "7056" "0" "c.*4668C>T" "r.(=)" "p.(=)" "" "0001055746" "00020169" "50" "8231" "0" "8231" "0" "c.*5843A>G" "r.(=)" "p.(=)" "" "0001057557" "00020169" "70" "2181" "151" "2181" "151" "c.2181+151T>G" "r.(?)" "p.(?)" "" "0001060877" "00020169" "50" "1529" "0" "1529" "0" "c.1529C>T" "r.(?)" "p.(Ala510Val)" "" "0001066576" "00020169" "30" "120" "0" "120" "0" "c.120G>A" "r.(?)" "p.(=)" "" "0001066577" "00020169" "90" "680" "0" "680" "0" "c.680dup" "r.(?)" "p.(Ala228Serfs*3)" "" "0001066578" "00020169" "50" "1054" "0" "1054" "0" "c.1054G>A" "r.(?)" "p.(Gly352Ser)" "" "0001066579" "00020169" "50" "1904" "0" "1904" "0" "c.1904C>T" "r.(?)" "p.(Ser635Leu)" "" "0001066580" "00020169" "50" "2275" "0" "2275" "0" "c.2275G>A" "r.(?)" "p.(Ala759Thr)" "" "0001066581" "00020169" "50" "2820" "0" "2820" "0" "c.*432G>A" "r.(=)" "p.(=)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 60 "{{screeningid}}" "{{variantid}}" "0000047200" "0000075870" "0000054815" "0000084828" "0000054815" "0000084829" "0000054816" "0000084830" "0000054816" "0000084831" "0000054817" "0000084832" "0000054817" "0000084833" "0000073321" "0000116957" "0000080211" "0000129160" "0000152870" "0000351709" "0000155821" "0000356902" "0000155822" "0000356903" "0000209826" "0000440046" "0000249251" "0000577979" "0000249251" "0000577980" "0000276741" "0000630874" "0000277170" "0000631914" "0000292763" "0000649452" "0000292764" "0000649453" "0000292765" "0000649454" "0000292766" "0000649455" "0000292767" "0000649456" "0000292768" "0000649457" "0000292769" "0000649458" "0000296743" "0000653444" "0000296767" "0000653477" "0000296819" "0000653533" "0000296819" "0000653534" "0000296824" "0000653540" "0000296828" "0000653544" "0000296833" "0000653551" "0000296833" "0000653552" "0000296933" "0000659585" "0000296933" "0000659586" "0000297100" "0000659715" "0000297785" "0000660448" "0000300805" "0000663703" "0000301366" "0000664291" "0000301758" "0000664830" "0000303798" "0000667193" "0000304186" "0000667599" "0000305677" "0000669365" "0000305678" "0000669366" "0000308415" "0000682792" "0000316028" "0000698156" "0000376056" "0000787407" "0000376056" "0000787613" "0000376057" "0000787408" "0000380892" "0000794125" "0000405136" "0000841202" "0000409966" "0000847193" "0000415349" "0000873172" "0000415350" "0000873173" "0000457423" "0001011926" "0000457428" "0001011931" "0000457428" "0001012002" "0000463858" "0001023908" "0000463858" "0001023909" "0000468975" "0001049104" "0000472345" "0001060877"