### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = SPTLC1) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "SPTLC1" "serine palmitoyltransferase, long chain base subunit 1" "9" "q22.31" "unknown" "LRG_272" "UD_132119060911" "" "https://www.LOVD.nl/SPTLC1" "" "1" "11277" "10558" "605712" "1" "1" "1" "1" "This database is one of the gene variant databases from the:.\r\nVariants involved in Inherited Peripheral Neuropathies are also collected by the IPNMDB. All variants submitted here will be shared with the IPNMDB." "" "g" "https://databases.lovd.nl/shared/refseq/SPTLC1_codingDNA.html" "1" "" "This database is one of the gene variant databases from the Leiden Muscular Dystrophy pages" "-1" "" "-1" "00001" "2012-05-23 00:00:00" "00006" "2019-12-30 20:03:52" "00006" "2026-03-06 17:26:39" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00020257" "SPTLC1" "transcript variant 1" "001" "NM_006415.2" "" "NP_006406.1" "" "" "" "-38" "2742" "1422" "94877690" "94793427" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 8 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "01466" "HSAN1A" "neuropathy, sensory and autonomic, hereditary, type 1A (HSAN-1A)" "AD" "162400" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "04214" "-" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00001" "2023-03-09 14:26:26" "05113" "CMT" "Charcot-Marie-Tooth disease (CMT)" "" "" "" "" "" "00006" "2016-01-11 01:40:57" "" "" "05123" "SMA" "atrophy, muscular, spinal (SMA)" "" "" "" "" "" "00006" "2016-01-24 01:41:54" "" "" "05383" "HSAN" "neuropathy, sensory and autonomic, hereditary (HSAN)" "" "" "" "" "" "00006" "2018-01-27 17:13:02" "" "" "05384" "neuropathy" "neuropathy" "" "" "" "" "" "00006" "2018-01-27 20:34:06" "" "" "07236" "motor neuron disease" "motor neuron disease" "" "" "" "" "" "00006" "2026-03-03 15:11:15" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 1 "{{geneid}}" "{{diseaseid}}" "SPTLC1" "01466" ## Individuals ## Do not remove or alter this header ## ## Count = 22 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00037172" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00037173" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00037174" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00037175" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00037176" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00037177" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00037178" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00151947" "" "" "" "1" "" "00006" "{PMID:Rotthier 2011:21618344}" "" "" "" "" "" "0" "" "" "" "" "00151948" "" "" "" "1" "" "00006" "{PMID:Dawkins 2001:11242114}" "" "" "" "" "" "0" "" "" "" "" "00151949" "" "" "" "1" "" "00006" "{PMID:Dawkins 2001:11242114}" "" "" "" "" "" "0" "" "" "" "" "00151950" "" "" "" "1" "" "00006" "{PMID:Dawkins 2001:11242114}" "" "" "" "" "" "0" "" "" "" "" "00151951" "" "" "" "1" "" "00006" "{PMID:Rotthier 2009:19651702}" "" "" "" "" "" "0" "" "" "" "" "00151952" "" "" "" "1" "" "00006" "{PMID:Rotthier 2009:19651702}" "" "" "" "" "" "0" "" "" "" "" "00151953" "" "" "" "1" "" "00006" "{PMID:Verhoeven 2004:15037712}" "" "" "" "" "" "0" "" "" "" "" "00294894" "" "" "" "69" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00305257" "" "" "" "2" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00374867" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-5660" "00404328" "" "" "" "1" "" "00435" "" "" "F" "no" "Egypt" "" "" "" "" "" "" "00408940" "" "" "" "1" "" "00000" "{PMID:Lerat-2019:31393079}" "" "F" "" "France" "" "0" "" "" "French" "I" "00473450" "" "" "" "1" "" "00006" "{PMID:Molaei 2025:41315541}" "analysis 2009 neuromuscular disorder individuals; patient, no family history" "M" "no" "Iran" "" "0" "" "" "" "Fam211624Pat768" "00473890" "" "" "" "1" "" "00006" "{PMID:Molaei 2025:41315541}" "analysis 2009 neuromuscular disorder individuals; patient, no family history" "F" "no" "Iran" "" "0" "" "" "" "Fam9808774Pat1399" "00473952" "" "" "" "1" "" "00006" "{PMID:Molaei 2025:41315541}" "analysis 2009 neuromuscular disorder individuals; patient, no family history" "F" "no" "Iran" "" "0" "" "" "" "Fam9908904Pat1483" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 15 "{{individualid}}" "{{diseaseid}}" "00151947" "05383" "00151948" "05383" "00151949" "05383" "00151950" "05383" "00151951" "05383" "00151952" "05383" "00151953" "05383" "00294894" "00198" "00305257" "00198" "00374867" "00198" "00404328" "05113" "00408940" "04214" "00473450" "07236" "00473890" "05384" "00473952" "05123" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00198, 01466, 04214, 05113, 05123, 05383, 05384, 07236 ## Count = 13 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000124310" "05383" "00151947" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "HSAN-1A" "neuropathy, hereditary sensory, type I" "" "0000124311" "05383" "00151948" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "HSAN-1A" "neuropathy, hereditary sensory, type I" "" "0000124312" "05383" "00151949" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "HSAN-1A" "neuropathy, hereditary sensory, type I" "" "0000124313" "05383" "00151950" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "HSAN-1A" "neuropathy, hereditary sensory, type I" "" "0000124314" "05383" "00151951" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "HSAN-1A" "neuropathy, hereditary sensory, type I" "" "0000124315" "05383" "00151952" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "HSAN-1A" "neuropathy, hereditary sensory, type I" "" "0000124316" "05383" "00151953" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "HSAN-1A" "neuropathy, hereditary sensory, type I" "" "0000270077" "00198" "00374867" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "myopathy" "" "0000296916" "05113" "00404328" "00435" "Isolated (sporadic)" "12y" "18-y female with progressive distal weakness and wasting of both lower and upper limbs, frequent foot ulcerations, stocking and glove hypesthesia and impaired deep sensation. Nerve conduction velocity study showed axonal neuropathy" "" "" "" "" "" "" "" "" "" "4y" "" "0000301058" "04214" "00408940" "00000" "Isolated (sporadic)" "87y" "urinary incontinence, small legs" "12y" "" "Sensori?motor Demyelinating, pes cavus" "" "" "" "" "" "" "inherited peripheral neuropathy (IPN)" "" "0000358245" "07236" "00473450" "00006" "Unknown" "70y" "Sporadic case, distal upper muscle weakness and paresthesia started 8 months ago, distal upper and lower neuropathy ,fasciculation, muscle cramps, heel walking inability and periventricular and deep white matter lesions reported in brain MRI." "" "" "" "" "" "" "" "" "" "motor neuron disease" "" "0000358685" "05384" "00473890" "00006" "Unknown" "42y" "onset 18y, Lower muscle weakness due to neuropathy; Foot posture eversion; Pes cavus; Wasting of lower limbs; EMG-NCV: chronic motor neuropathy." "" "" "" "" "" "" "" "" "" "hereditary neuropathy" "" "0000358747" "05123" "00473952" "00006" "Unknown" "12y" "onset 9y with feet weakness; Difficulty walking, running, climbing steps, rising from seated position; Hand weakness; Proximal & distal muscle weakness, legs>arms; Laxity in fingers, wrists, elbows & knees; Positive Gowers sign; EMG-NCV: mild non-irritable myopathic pattern; Shortening of Rt. femur in MRI; Muscle biopsy: neurogenic atrophy with denervation & reinnervation process." "" "" "" "" "" "" "" "" "" "spinal myscular atrophy" "" ## Screenings ## Do not remove or alter this header ## ## Count = 22 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000037242" "00037172" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000037243" "00037173" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000037244" "00037174" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000037245" "00037175" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000037246" "00037176" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000037247" "00037177" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000037248" "00037178" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000152804" "00151947" "1" "00006" "00006" "2012-11-07 13:01:03" "" "" "SEQ" "DNA" "" "" "0000152805" "00151948" "1" "00006" "00006" "2012-11-07 13:01:03" "" "" "SEQ" "DNA" "" "" "0000152806" "00151949" "1" "00006" "00006" "2012-11-07 13:01:03" "" "" "SEQ" "DNA" "" "" "0000152807" "00151950" "1" "00006" "00006" "2012-11-07 13:01:03" "" "" "SEQ" "DNA" "" "" "0000152808" "00151951" "1" "00006" "00006" "2012-11-07 13:01:03" "" "" "SEQ" "DNA" "" "" "0000152809" "00151952" "1" "00006" "00006" "2012-11-07 13:01:03" "" "" "SEQ" "DNA" "" "" "0000152810" "00151953" "1" "00006" "00006" "2012-11-07 13:01:03" "" "" "SEQ" "DNA" "" "" "0000296062" "00294894" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000306386" "00305257" "1" "03575" "00006" "2020-06-24 11:55:42" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000376061" "00374867" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000405567" "00404328" "1" "00435" "00435" "2022-03-01 01:54:14" "" "" "SEQ" "DNA" "blood" "" "0000410205" "00408940" "1" "00000" "00008" "2022-04-29 01:04:01" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood" "" "0000475119" "00473450" "1" "00006" "00006" "2026-03-06 17:24:40" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000475559" "00473890" "1" "00006" "00006" "2026-03-06 17:24:40" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000475621" "00473952" "1" "00006" "00006" "2026-03-06 17:24:40" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 17 "{{screeningid}}" "{{geneid}}" "0000037242" "SPTLC1" "0000037243" "SPTLC1" "0000037244" "SPTLC1" "0000037245" "SPTLC1" "0000037246" "SPTLC1" "0000037247" "SPTLC1" "0000037248" "SPTLC1" "0000152804" "SPTLC1" "0000152805" "SPTLC1" "0000152806" "SPTLC1" "0000152807" "SPTLC1" "0000152808" "SPTLC1" "0000152809" "SPTLC1" "0000152810" "SPTLC1" "0000376061" "SPTLC1" "0000405567" "SPTLC1" "0000410205" "SPTLC1" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 73 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000064367" "1" "10" "9" "94808215" "94808215" "subst" "0" "01164" "SPTLC1_000014" "g.94808215C>T" "" "" "" "" "" "Germline" "" "rs77660866" "0" "" "" "g.92045933C>T" "" "benign" "" "0000064368" "1" "10" "9" "94800690" "94800690" "subst" "0.0269582" "01164" "SPTLC1_000013" "g.94800690G>C" "" "" "" "" "" "Germline" "" "rs3750441" "0" "" "" "g.92038408G>C" "" "benign" "" "0000064369" "1" "10" "9" "94874666" "94874666" "subst" "0" "01164" "SPTLC1_000017" "g.94874666A>T" "" "" "" "" "" "Germline" "" "rs7019642" "0" "" "" "g.92112384A>T" "" "benign" "" "0000064370" "1" "50" "9" "94794576" "94794576" "del" "0" "01164" "SPTLC1_000012" "g.94794576del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.92032294del" "" "VUS" "" "0000064371" "1" "10" "9" "94874649" "94874649" "subst" "0" "01164" "SPTLC1_000016" "g.94874649A>T" "" "" "" "" "" "Germline" "" "rs7019629" "0" "" "" "g.92112367A>T" "" "benign" "" "0000064372" "1" "10" "9" "94830356" "94830356" "subst" "0.0202957" "01164" "SPTLC1_000015" "g.94830356C>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.92068074C>A" "" "benign" "" "0000064373" "1" "10" "9" "94793358" "94793358" "subst" "0" "01164" "SPTLC1_000011" "g.94793358C>T" "" "" "" "" "" "Germline" "" "rs12002804" "0" "" "" "g.92031076C>T" "" "benign" "" "0000246854" "0" "90" "9" "94842328" "94842328" "subst" "0" "02330" "SPTLC1_000003" "g.94842328A>G" "" "" "" "SPTLC1(NM_006415.4):c.397T>C (p.C133R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.92080046A>G" "" "pathogenic" "" "0000246855" "0" "90" "9" "94842326" "94842326" "subst" "0" "02330" "SPTLC1_000005" "g.94842326A>C" "" "" "" "SPTLC1(NM_006415.4):c.399T>G (p.C133W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.92080044A>C" "" "pathogenic" "" "0000246860" "0" "90" "9" "94830377" "94830377" "subst" "8.15774E-6" "02330" "SPTLC1_000006" "g.94830377A>T" "" "" "" "SPTLC1(NM_006415.4):c.431T>A (p.V144D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.92068095A>T" "" "pathogenic" "" "0000308801" "0" "10" "9" "94800624" "94800624" "subst" "0.00041419" "02330" "SPTLC1_000002" "g.94800624C>G" "" "" "" "SPTLC1(NM_001281303.1):c.1160G>C (p.G387A), SPTLC1(NM_001281303.2):c.1160G>C (p.G387A), SPTLC1(NM_006415.4):c.1160G>C (p.G387A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.92038342C>G" "" "benign" "" "0000308802" "0" "50" "9" "94794687" "94794687" "subst" "0.000122759" "02330" "SPTLC1_000019" "g.94794687G>A" "" "" "" "SPTLC1(NM_001281303.2):c.1450C>T (p.R484C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.92032405G>A" "" "VUS" "" "0000308803" "0" "30" "9" "94794623" "94794623" "subst" "0.00483912" "02330" "SPTLC1_000018" "g.94794623T>C" "" "" "" "SPTLC1(NM_001281303.2):c.1514A>G (p.K505R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.92032341T>C" "" "likely benign" "" "0000308804" "0" "10" "9" "94843263" "94843263" "subst" "1.63112E-5" "02330" "SPTLC1_000028" "g.94843263T>C" "" "" "" "SPTLC1(NM_001281303.2):c.261-18A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.92080981T>C" "" "benign" "" "0000308805" "0" "90" "9" "94842327" "94842327" "subst" "0" "02330" "SPTLC1_000004" "g.94842327C>T" "" "" "" "SPTLC1(NM_006415.4):c.398G>A (p.C133Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.92080045C>T" "" "pathogenic" "" "0000308806" "0" "30" "9" "94841852" "94841852" "subst" "0.000846857" "02330" "SPTLC1_000027" "g.94841852G>A" "" "" "" "SPTLC1(NM_001281303.2):c.427+446C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.92079570G>A" "" "likely benign" "" "0000308807" "0" "10" "9" "94830356" "94830356" "subst" "0.0202957" "02330" "SPTLC1_000015" "g.94830356C>A" "" "" "" "SPTLC1(NM_001281303.2):c.452G>T (p.R151L), SPTLC1(NM_006415.4):c.452G>T (p.R151L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.92068074C>A" "" "benign" "" "0000308808" "0" "10" "9" "94812355" "94812355" "subst" "0.0124072" "02330" "SPTLC1_000026" "g.94812355T>C" "" "" "" "SPTLC1(NM_001281303.2):c.781-6A>G, SPTLC1(NM_006415.2):c.781-6A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.92050073T>C" "" "benign" "" "0000308809" "0" "30" "9" "94812335" "94812335" "subst" "0.000268445" "02330" "SPTLC1_000025" "g.94812335G>A" "" "" "" "SPTLC1(NM_001281303.2):c.795C>T (p.Y265=), SPTLC1(NM_006415.2):c.795C>T (p.Y265=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.92050053G>A" "" "likely benign" "" "0000308810" "0" "90" "9" "94809543" "94809543" "subst" "0" "02330" "SPTLC1_000007" "g.94809543G>A" "" "" "" "SPTLC1(NM_006415.4):c.992C>T (p.S331F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.92047261G>A" "" "pathogenic" "" "0000314111" "0" "10" "9" "94830356" "94830356" "subst" "0.0202957" "02326" "SPTLC1_000015" "g.94830356C>A" "" "" "" "SPTLC1(NM_001281303.2):c.452G>T (p.R151L), SPTLC1(NM_006415.4):c.452G>T (p.R151L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.92068074C>A" "" "benign" "" "0000314112" "0" "10" "9" "94812355" "94812355" "subst" "0.0124072" "02326" "SPTLC1_000026" "g.94812355T>C" "" "" "" "SPTLC1(NM_001281303.2):c.781-6A>G, SPTLC1(NM_006415.2):c.781-6A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.92050073T>C" "" "benign" "" "0000314113" "0" "50" "9" "94809995" "94809995" "subst" "2.04147E-5" "02326" "SPTLC1_000024" "g.94809995C>T" "" "" "" "SPTLC1(NM_001281303.2):c.889-5G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.92047713C>T" "" "VUS" "" "0000315704" "0" "30" "9" "94794758" "94794758" "subst" "0.000625376" "01943" "SPTLC1_000020" "g.94794758C>T" "" "" "" "SPTLC1(NM_001281303.1):c.1379G>A (p.R460H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.92032476C>T" "" "likely benign" "" "0000315705" "0" "10" "9" "94809555" "94809555" "subst" "0.000590112" "01943" "SPTLC1_000023" "g.94809555G>A" "" "" "" "SPTLC1(NM_001281303.1):c.985-5C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.92047273G>A" "" "benign" "" "0000351639" "0" "90" "9" "94842328" "94842328" "subst" "0" "00006" "SPTLC1_000003" "g.94842328A>G" "" "{PMID:Rotthier 2011:21618344}" "" "" "" "Germline" "" "" "0" "" "" "g.92080046A>G" "" "pathogenic" "" "0000351640" "0" "90" "9" "94842327" "94842327" "subst" "0" "00006" "SPTLC1_000004" "g.94842327C>T" "" "{PMID:Dawkins 2001:11242114}" "" "" "" "Germline" "" "" "0" "" "" "g.92080045C>T" "" "pathogenic" "" "0000351641" "0" "90" "9" "94842326" "94842326" "subst" "0" "00006" "SPTLC1_000005" "g.94842326A>C" "" "{PMID:Dawkins 2001:11242114}" "" "" "" "Germline" "" "" "0" "" "" "g.92080044A>C" "" "pathogenic" "" "0000351642" "0" "90" "9" "94830377" "94830377" "subst" "8.15774E-6" "00006" "SPTLC1_000006" "g.94830377A>T" "" "{PMID:Dawkins 2001:11242114}" "" "" "" "Germline" "" "" "0" "" "" "g.92068095A>T" "" "pathogenic" "" "0000351643" "0" "90" "9" "94809543" "94809543" "subst" "0" "00006" "SPTLC1_000007" "g.94809543G>A" "" "{PMID:Rotthier 2009:19651702}" "" "" "" "Germline" "" "" "0" "" "" "g.92047261G>A" "" "pathogenic" "" "0000351644" "0" "90" "9" "94809480" "94809480" "subst" "4.0627E-6" "00006" "SPTLC1_000001" "g.94809480G>A" "" "{PMID:Rotthier 2009:19651702}" "" "" "" "Germline" "" "" "0" "" "" "g.92047198G>A" "" "pathogenic" "" "0000351645" "0" "90" "9" "94800624" "94800624" "subst" "0.00041419" "00006" "SPTLC1_000002" "g.94800624C>G" "" "{PMID:Verhoeven 2004:15037712}" "" "" "" "Germline" "" "rs119482084" "0" "" "" "g.92038342C>G" "" "pathogenic" "" "0000538645" "0" "30" "9" "94794686" "94794686" "subst" "0.0001968" "02330" "SPTLC1_000029" "g.94794686C>T" "" "" "" "SPTLC1(NM_001281303.2):c.1451G>A (p.R484H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.92032404C>T" "" "likely benign" "" "0000538646" "0" "30" "9" "94794705" "94794706" "del" "0" "02330" "SPTLC1_000030" "g.94794705_94794706del" "" "" "" "SPTLC1(NM_001281303.2):c.1435_1436delAG (p.R479Dfs*21)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.92032423_92032424del" "" "likely benign" "" "0000538647" "0" "10" "9" "94797172" "94797172" "subst" "0.00368492" "02330" "SPTLC1_000031" "g.94797172G>A" "" "" "" "SPTLC1(NM_001281303.2):c.1255-7C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.92034890G>A" "" "benign" "" "0000538648" "0" "10" "9" "94800670" "94800671" "dup" "0" "02330" "SPTLC1_000032" "g.94800670_94800671dup" "" "" "" "SPTLC1(NM_001281303.2):c.1137-15_1137-14dupGT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.92038388_92038389dup" "" "benign" "" "0000538649" "0" "10" "9" "94808269" "94808269" "subst" "0.0105976" "02330" "SPTLC1_000033" "g.94808269T>C" "" "" "" "SPTLC1(NM_001281303.2):c.1136+12A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.92045987T>C" "" "benign" "" "0000538650" "0" "50" "9" "94817760" "94817760" "subst" "1.223E-5" "02330" "SPTLC1_000034" "g.94817760C>A" "" "" "" "SPTLC1(NM_001281303.2):c.707G>T (p.R236L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.92055478C>A" "" "VUS" "" "0000538651" "0" "50" "9" "94821496" "94821496" "subst" "1.62739E-5" "02330" "SPTLC1_000035" "g.94821496G>A" "" "" "" "SPTLC1(NM_001281303.2):c.655C>T (p.R219*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.92059214G>A" "" "VUS" "" "0000538652" "0" "10" "9" "94830232" "94830232" "subst" "0.102536" "02330" "SPTLC1_000036" "g.94830232C>G" "" "" "" "SPTLC1(NM_006415.4):c.560+16G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.92067950C>G" "" "benign" "" "0000538653" "0" "10" "9" "94830232" "94830232" "subst" "0.102536" "02325" "SPTLC1_000036" "g.94830232C>G" "" "" "" "SPTLC1(NM_006415.4):c.560+16G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.92067950C>G" "" "benign" "" "0000538654" "0" "50" "9" "94842358" "94842358" "subst" "8.1285E-5" "02330" "SPTLC1_000037" "g.94842358C>T" "" "" "" "SPTLC1(NM_001281303.2):c.367G>A (p.A123T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.92080076C>T" "" "VUS" "" "0000538655" "0" "30" "9" "94874782" "94874782" "subst" "0.000228704" "02330" "SPTLC1_000038" "g.94874782G>C" "" "" "" "SPTLC1(NM_001281303.2):c.120C>G (p.F40L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.92112500G>C" "" "likely benign" "" "0000538656" "0" "30" "9" "94877671" "94877671" "subst" "8.22267E-6" "02330" "SPTLC1_000039" "g.94877671G>A" "" "" "" "SPTLC1(NM_001281303.2):c.-19C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.92115389G>A" "" "likely benign" "" "0000612188" "0" "30" "9" "94800624" "94800624" "subst" "0.00041419" "02326" "SPTLC1_000002" "g.94800624C>G" "" "" "" "SPTLC1(NM_001281303.1):c.1160G>C (p.G387A), SPTLC1(NM_001281303.2):c.1160G>C (p.G387A), SPTLC1(NM_006415.4):c.1160G>C (p.G387A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.92038342C>G" "" "likely benign" "" "0000612189" "0" "30" "9" "94808306" "94808306" "subst" "0.000109969" "01943" "SPTLC1_000040" "g.94808306C>T" "" "" "" "SPTLC1(NM_001281303.1):c.1111G>A (p.G371R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.92046024C>T" "" "likely benign" "" "0000612190" "0" "50" "9" "94871059" "94871059" "subst" "0" "02326" "SPTLC1_000042" "g.94871059T>G" "" "" "" "SPTLC1(NM_001281303.2):c.223A>C (p.K75Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.92108777T>G" "" "VUS" "" "0000622299" "0" "30" "9" "94809996" "94809996" "subst" "2.45246E-5" "02330" "SPTLC1_000041" "g.94809996G>A" "" "" "" "SPTLC1(NM_006415.4):c.889-6C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.92047714G>A" "" "likely benign" "" "0000652751" "1" "30" "9" "94830356" "94830356" "subst" "0.0202957" "03575" "SPTLC1_000015" "g.94830356C>A" "69/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "69 heterozygous; {DB:CLININrs45461899}" "Germline" "" "rs45461899" "0" "" "" "g.92068074C>A" "" "likely benign" "" "0000670074" "3" "30" "9" "94830356" "94830356" "subst" "0.0202957" "03575" "SPTLC1_000015" "g.94830356C>A" "2/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "2 homozygous; {DB:CLININrs45461899}" "Germline" "" "rs45461899" "0" "" "" "g.92068074C>A" "" "likely benign" "" "0000690606" "0" "50" "9" "94800624" "94800624" "subst" "0.00041419" "01943" "SPTLC1_000002" "g.94800624C>G" "" "" "" "SPTLC1(NM_001281303.1):c.1160G>C (p.G387A), SPTLC1(NM_001281303.2):c.1160G>C (p.G387A), SPTLC1(NM_006415.4):c.1160G>C (p.G387A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000787412" "0" "50" "9" "94809461" "94809461" "subst" "0" "00006" "SPTLC1_000043" "g.94809461C>G" "" "{PMID:Ganapathy 2019:31069529}" "" "" "" "Germline" "" "" "0" "" "" "g.92047179C>G" "" "VUS" "" "0000804221" "0" "50" "9" "94809504" "94809505" "del" "0" "02330" "SPTLC1_000044" "g.94809504_94809505del" "" "" "" "SPTLC1(NM_006415.4):c.1030_1031delCT (p.L344Vfs*7)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000841664" "0" "90" "9" "94809543" "94809543" "subst" "0" "00435" "SPTLC1_000007" "g.94809543G>A" "" "" "" "" "" "De novo" "-" "" "" "" "" "" "" "pathogenic" "" "0000847470" "0" "50" "9" "0" "0" "" "0" "00000" "PTCH1_000000" "g.?" "" "" "" "c.?35delCCGCTTCCTTCCGGAAGGCGGGTCACAAG" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000852334" "0" "30" "9" "94812242" "94812242" "subst" "0.000195155" "01943" "SPTLC1_000045" "g.94812242A>G" "" "" "" "SPTLC1(NM_001281303.1):c.888T>C (p.N296=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000888921" "0" "50" "9" "94794708" "94794708" "subst" "4.0653E-6" "02330" "SPTLC1_000046" "g.94794708C>A" "" "" "" "SPTLC1(NM_001281303.2):c.1429G>T (p.A477S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000888922" "0" "30" "9" "94800584" "94800584" "subst" "9.33949E-5" "02330" "SPTLC1_000047" "g.94800584C>T" "" "" "" "SPTLC1(NM_001281303.2):c.1200G>A (p.E400=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000888923" "0" "30" "9" "94809916" "94809916" "subst" "0.000101691" "02326" "SPTLC1_000048" "g.94809916C>T" "" "" "" "SPTLC1(NM_006415.2):c.963G>A (p.R321=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000888924" "0" "50" "9" "94817760" "94817760" "subst" "1.63067E-5" "02330" "SPTLC1_000049" "g.94817760C>T" "" "" "" "SPTLC1(NM_001368273.1):c.242G>A (p.R81H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000913190" "0" "50" "9" "94817760" "94817760" "subst" "4.48434E-5" "02330" "SPTLC1_000050" "g.94817760C>G" "" "" "" "SPTLC1(NM_006415.4):c.707G>C (p.R236P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000925079" "0" "50" "9" "94877642" "94877642" "subst" "0" "02330" "SPTLC1_000051" "g.94877642G>C" "" "" "" "SPTLC1(NM_006415.4):c.11C>G (p.A4G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000949322" "0" "30" "9" "94812335" "94812335" "subst" "0.000268445" "02326" "SPTLC1_000025" "g.94812335G>A" "" "" "" "SPTLC1(NM_001281303.2):c.795C>T (p.Y265=), SPTLC1(NM_006415.2):c.795C>T (p.Y265=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000965530" "0" "30" "9" "94871074" "94871074" "subst" "7.44091E-5" "02326" "SPTLC1_000052" "g.94871074C>A" "" "" "" "SPTLC1(NM_006415.2):c.208G>T (p.V70F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000997996" "0" "30" "9" "94794767" "94794767" "subst" "8.5275E-5" "02330" "SPTLC1_000053" "g.94794767C>A" "" "" "" "SPTLC1(NM_001368273.1):c.937G>T (p.A313S), SPTLC1(NM_006415.4):c.1402G>T (p.(Ala468Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000997997" "0" "50" "9" "94871032" "94871032" "subst" "4.10715E-5" "01804" "SPTLC1_000054" "g.94871032T>C" "" "" "" "SPTLC1(NM_006415.3):c.250A>G (p.(Ile84Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001025689" "0" "30" "9" "94800624" "94800624" "subst" "0.00041419" "02325" "SPTLC1_000002" "g.94800624C>G" "" "" "" "SPTLC1(NM_001281303.1):c.1160G>C (p.G387A), SPTLC1(NM_001281303.2):c.1160G>C (p.G387A), SPTLC1(NM_006415.4):c.1160G>C (p.G387A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001037626" "0" "30" "9" "94794767" "94794767" "subst" "8.5275E-5" "01804" "SPTLC1_000053" "g.94794767C>A" "" "" "" "SPTLC1(NM_001368273.1):c.937G>T (p.A313S), SPTLC1(NM_006415.4):c.1402G>T (p.(Ala468Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001037627" "0" "30" "9" "94842338" "94842338" "subst" "0.0012719" "01804" "SPTLC1_000055" "g.94842338G>A" "" "" "" "SPTLC1(NM_006415.4):c.387C>T (p.(Gly129=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001046215" "0" "30" "9" "94821488" "94821488" "subst" "2.4417E-5" "02326" "SPTLC1_000056" "g.94821488T>C" "" "" "" "SPTLC1(NM_006415.2):c.663A>G (p.L221=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001069515" "0" "50" "9" "94874782" "94874812" "dup" "0" "00006" "SPTLC1_000059" "g.94874782_94874812dup" "" "{PMID:Molaei 2025:41315541}" "" "" "ACMG PM2" "Germline" "" "" "0" "" "" "g.92112500_92112530dup" "SCV006075297" "VUS" "ACMG" "0001069952" "0" "50" "9" "94800570" "94800570" "subst" "0" "00006" "SPTLC1_000058" "g.94800570C>G" "" "{PMID:Molaei 2025:41315541}" "" "" "ACMG PM2, PP2, PP3" "Germline" "" "" "0" "" "" "g.92038288C>G" "SCV006075296" "VUS" "ACMG" "0001070014" "0" "50" "9" "94797101" "94797101" "subst" "0" "00006" "SPTLC1_000057" "g.94797101G>C" "" "{PMID:Molaei 2025:41315541}" "" "" "ACMG PM2, PP3" "Germline" "" "" "0" "" "" "g.92034819G>C" "SCV006075295" "VUS" "ACMG" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes SPTLC1 ## Count = 73 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000064367" "00020257" "10" "1136" "66" "1136" "66" "c.1136+66G>A" "r.(=)" "p.(=)" "" "0000064368" "00020257" "10" "1137" "-43" "1137" "-43" "c.1137-43C>G" "r.(=)" "p.(=)" "" "0000064369" "00020257" "10" "165" "71" "165" "71" "c.165+71T>A" "r.(=)" "p.(=)" "" "0000064370" "00020257" "50" "1600" "0" "1600" "0" "c.*178del" "r.(=)" "p.(=)" "" "0000064371" "00020257" "10" "165" "88" "165" "88" "c.165+88T>A" "r.(=)" "p.(=)" "" "0000064372" "00020257" "10" "452" "0" "452" "0" "c.452G>T" "r.(?)" "p.(Arg151Leu)" "" "0000064373" "00020257" "10" "2811" "0" "2811" "0" "c.*1389G>A" "r.(=)" "p.(=)" "" "0000246854" "00020257" "90" "397" "0" "397" "0" "c.397T>C" "r.(?)" "p.(Cys133Arg)" "" "0000246855" "00020257" "90" "399" "0" "399" "0" "c.399T>G" "r.(?)" "p.(Cys133Trp)" "" "0000246860" "00020257" "90" "431" "0" "431" "0" "c.431T>A" "r.(?)" "p.(Val144Asp)" "" "0000308801" "00020257" "10" "1160" "0" "1160" "0" "c.1160G>C" "r.(?)" "p.(Gly387Ala)" "" "0000308802" "00020257" "50" "1482" "0" "1482" "0" "c.*60C>T" "r.(=)" "p.(=)" "" "0000308803" "00020257" "30" "1546" "0" "1546" "0" "c.*124A>G" "r.(=)" "p.(=)" "" "0000308804" "00020257" "10" "261" "-18" "261" "-18" "c.261-18A>G" "r.(=)" "p.(=)" "" "0000308805" "00020257" "90" "398" "0" "398" "0" "c.398G>A" "r.(?)" "p.(Cys133Tyr)" "" "0000308806" "00020257" "30" "427" "446" "427" "446" "c.427+446C>T" "r.(=)" "p.(=)" "" "0000308807" "00020257" "10" "452" "0" "452" "0" "c.452G>T" "r.(?)" "p.(Arg151Leu)" "" "0000308808" "00020257" "10" "781" "-6" "781" "-6" "c.781-6A>G" "r.(=)" "p.(=)" "" "0000308809" "00020257" "30" "795" "0" "795" "0" "c.795C>T" "r.(?)" "p.(Tyr265=)" "" "0000308810" "00020257" "90" "992" "0" "992" "0" "c.992C>T" "r.(?)" "p.(Ser331Phe)" "" "0000314111" "00020257" "10" "452" "0" "452" "0" "c.452G>T" "r.(?)" "p.(Arg151Leu)" "" "0000314112" "00020257" "10" "781" "-6" "781" "-6" "c.781-6A>G" "r.(=)" "p.(=)" "" "0000314113" "00020257" "50" "889" "-5" "889" "-5" "c.889-5G>A" "r.spl?" "p.?" "" "0000315704" "00020257" "30" "1411" "0" "1411" "0" "c.1411G>A" "r.(?)" "p.(Val471Ile)" "" "0000315705" "00020257" "10" "985" "-5" "985" "-5" "c.985-5C>T" "r.spl?" "p.?" "" "0000351639" "00020257" "90" "397" "0" "397" "0" "c.397T>C" "r.(?)" "p.(Cys133Arg)" "5" "0000351640" "00020257" "90" "398" "0" "398" "0" "c.398G>A" "r.(?)" "p.(Cys133Tyr)" "5" "0000351641" "00020257" "90" "399" "0" "399" "0" "c.399T>G" "r.(?)" "p.(Cys133Trp)" "5" "0000351642" "00020257" "90" "431" "0" "431" "0" "c.431T>A" "r.(?)" "p.(Val144Asp)" "6" "0000351643" "00020257" "90" "992" "0" "992" "0" "c.992C>T" "r.(?)" "p.(Ser331Phe)" "11" "0000351644" "00020257" "90" "1055" "0" "1055" "0" "c.1055C>T" "r.(?)" "p.(Ala352Val)" "11" "0000351645" "00020257" "90" "1160" "0" "1160" "0" "c.1160G>C" "r.(?)" "p.(Gly387Ala)" "13" "0000538645" "00020257" "30" "1483" "0" "1483" "0" "c.*61G>A" "r.(=)" "p.(=)" "" "0000538646" "00020257" "30" "1467" "0" "1468" "0" "c.*45_*46del" "r.(=)" "p.(=)" "" "0000538647" "00020257" "10" "1255" "-7" "1255" "-7" "c.1255-7C>T" "r.(=)" "p.(=)" "" "0000538648" "00020257" "10" "1137" "-15" "1137" "-14" "c.1137-15_1137-14dup" "r.(=)" "p.(=)" "" "0000538649" "00020257" "10" "1136" "12" "1136" "12" "c.1136+12A>G" "r.(=)" "p.(=)" "" "0000538650" "00020257" "50" "707" "0" "707" "0" "c.707G>T" "r.(?)" "p.(Arg236Leu)" "" "0000538651" "00020257" "50" "655" "0" "655" "0" "c.655C>T" "r.(?)" "p.(Arg219Ter)" "" "0000538652" "00020257" "10" "560" "16" "560" "16" "c.560+16G>C" "r.(=)" "p.(=)" "" "0000538653" "00020257" "10" "560" "16" "560" "16" "c.560+16G>C" "r.(=)" "p.(=)" "" "0000538654" "00020257" "50" "367" "0" "367" "0" "c.367G>A" "r.(?)" "p.(Ala123Thr)" "" "0000538655" "00020257" "30" "120" "0" "120" "0" "c.120C>G" "r.(?)" "p.(Phe40Leu)" "" "0000538656" "00020257" "30" "-19" "0" "-19" "0" "c.-19C>T" "r.(?)" "p.(=)" "" "0000612188" "00020257" "30" "1160" "0" "1160" "0" "c.1160G>C" "r.(?)" "p.(Gly387Ala)" "" "0000612189" "00020257" "30" "1111" "0" "1111" "0" "c.1111G>A" "r.(?)" "p.(Gly371Arg)" "" "0000612190" "00020257" "50" "223" "0" "223" "0" "c.223A>C" "r.(?)" "p.(Lys75Gln)" "" "0000622299" "00020257" "30" "889" "-6" "889" "-6" "c.889-6C>T" "r.(=)" "p.(=)" "" "0000652751" "00020257" "30" "452" "0" "452" "0" "c.452G>T" "r.(?)" "p.(Arg151Leu)" "" "0000670074" "00020257" "30" "452" "0" "452" "0" "c.452G>T" "r.(?)" "p.(Arg151Leu)" "" "0000690606" "00020257" "50" "1160" "0" "1160" "0" "c.1160G>C" "r.(?)" "p.(Gly387Ala)" "" "0000787412" "00020257" "50" "1074" "0" "1074" "0" "c.1074G>C" "r.(?)" "p.(Glu358Asp)" "11" "0000804221" "00020257" "50" "1030" "0" "1031" "0" "c.1030_1031del" "r.(?)" "p.(Leu344Valfs*7)" "" "0000841664" "00020257" "90" "992" "0" "992" "0" "c.992C>T" "r.(?)" "p.(Ser331Phe)" "11" "0000847470" "00020257" "50" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" "" "0000852334" "00020257" "30" "888" "0" "888" "0" "c.888T>C" "r.(?)" "p.(Asn296=)" "" "0000888921" "00020257" "50" "1461" "0" "1461" "0" "c.*39G>T" "r.(=)" "p.(=)" "" "0000888922" "00020257" "30" "1200" "0" "1200" "0" "c.1200G>A" "r.(?)" "p.(Glu400=)" "" "0000888923" "00020257" "30" "963" "0" "963" "0" "c.963G>A" "r.(?)" "p.(Arg321=)" "" "0000888924" "00020257" "50" "707" "0" "707" "0" "c.707G>A" "r.(?)" "p.(Arg236His)" "" "0000913190" "00020257" "50" "707" "0" "707" "0" "c.707G>C" "r.(?)" "p.(Arg236Pro)" "" "0000925079" "00020257" "50" "11" "0" "11" "0" "c.11C>G" "r.(?)" "p.(Ala4Gly)" "" "0000949322" "00020257" "30" "795" "0" "795" "0" "c.795C>T" "r.(?)" "p.(Tyr265=)" "" "0000965530" "00020257" "30" "208" "0" "208" "0" "c.208G>T" "r.(?)" "p.(Val70Phe)" "" "0000997996" "00020257" "30" "1402" "0" "1402" "0" "c.1402G>T" "r.(?)" "p.(Ala468Ser)" "" "0000997997" "00020257" "50" "250" "0" "250" "0" "c.250A>G" "r.(?)" "p.(Ile84Val)" "" "0001025689" "00020257" "30" "1160" "0" "1160" "0" "c.1160G>C" "r.(?)" "p.(Gly387Ala)" "" "0001037626" "00020257" "30" "1402" "0" "1402" "0" "c.1402G>T" "r.(?)" "p.(Ala468Ser)" "" "0001037627" "00020257" "30" "387" "0" "387" "0" "c.387C>T" "r.(?)" "p.(=)" "" "0001046215" "00020257" "30" "663" "0" "663" "0" "c.663A>G" "r.(?)" "p.(=)" "" "0001069515" "00020257" "50" "93" "0" "123" "0" "c.93_123dup" "r.(?)" "p.(Lys42AspfsTer11)" "" "0001069952" "00020257" "50" "1214" "0" "1214" "0" "c.1214G>C" "r.(?)" "p.(Arg405Pro)" "" "0001070014" "00020257" "50" "1319" "0" "1319" "0" "c.1319C>G" "r.(?)" "p.(Pro440Arg)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 22 "{{screeningid}}" "{{variantid}}" "0000037242" "0000064367" "0000037243" "0000064368" "0000037244" "0000064369" "0000037245" "0000064370" "0000037246" "0000064371" "0000037247" "0000064372" "0000037248" "0000064373" "0000152804" "0000351639" "0000152805" "0000351640" "0000152806" "0000351641" "0000152807" "0000351642" "0000152808" "0000351643" "0000152809" "0000351644" "0000152810" "0000351645" "0000296062" "0000652751" "0000306386" "0000670074" "0000376061" "0000787412" "0000405567" "0000841664" "0000410205" "0000847470" "0000475119" "0001069515" "0000475559" "0001069952" "0000475621" "0001070014"