### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = STK11) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "STK11" "serine/threonine kinase 11" "19" "p13.3" "unknown" "LRG_319" "UD_132084511613" "" "https://www.LOVD.nl/STK11" "" "1" "11389" "6794" "602216" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "" "g" "http://databases.lovd.nl/shared/refseq/STK11_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2016-12-10 13:19:14" "00000" "2025-11-01 13:22:20" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00020464" "STK11" "serine/threonine kinase 11" "001" "NM_000455.4" "" "NP_000446.1" "" "" "" "-1115" "2161" "1302" "1205798" "1228434" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 11 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00000" "Healthy/Control" "Healthy individual / control" "" "" "" "" "" "00000" "2012-07-26 17:29:43" "" "" "00091" "CRC" "cancer, colorectal, susceptibility to (CRC)" "AD;SMu" "114500" "" "" "" "00001" "2012-12-07 10:49:46" "00006" "2021-12-10 21:51:32" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00318" "cancer, breast" "cancer, breast" "" "" "" "" "" "00006" "2014-02-02 14:42:53" "00006" "2019-08-28 08:24:47" "00341" "PJS" "Peutz-Jeghers syndrome (PJS)" "AD" "175200" "" "" "" "00006" "2014-03-05 21:05:29" "00006" "2021-12-10 21:51:32" "00602" "TGCT" "tumor, germ cell, testicular (TGCT, spermatocytic seminoma, somatic)" "" "273300" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2017-03-17 11:11:19" "00681" "cancer, pancreatic" "cancer, pancreatic" "" "260350" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2019-08-28 08:24:29" "01524" "cancer, prostate" "cancer, prostate" "AD;SMu" "176807" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "04148" "BROVCA" "cancer, breast-ovarian, familial, susceptibility to" "" "" "" "" "" "00006" "2014-11-02 11:19:07" "00006" "2017-08-28 21:33:05" "05093" "cancer" "cancer" "" "" "" "" "" "00006" "2015-10-23 13:34:05" "" "" "05489" "cancer, colon" "cancer, colon" "" "" "" "" "" "00006" "2018-10-26 16:33:57" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 3 "{{geneid}}" "{{diseaseid}}" "STK11" "00341" "STK11" "00602" "STK11" "00681" ## Individuals ## Do not remove or alter this header ## ## Count = 432 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00003296" "" "" "" "1" "" "00552" "" "" "" "" "" "" "0" "" "" "" "" "00016109" "" "" "" "2" "" "00667" "" "" "F" "" "China" ">31y" "0" "" "" "Han" "" "00016110" "" "" "" "1" "" "00667" "" "" "M" "" "China" ">28y" "0" "" "" "Han" "" "00016111" "" "" "" "2" "" "00667" "" "" "F" "" "China" ">42y" "0" "" "" "Han" "" "00016112" "" "" "" "2" "" "00667" "" "" "F" "" "(China)" ">32y" "0" "" "" "Han" "" "00016113" "" "" "" "1" "" "00667" "" "" "F" "" "China" ">16y" "0" "" "" "Han" "" "00016114" "" "" "" "1" "" "00667" "" "" "M" "" "China" ">45y" "0" "" "" "Han" "" "00016115" "" "" "" "4" "" "00667" "" "" "M" "" "China" "56y" "0" "" "" "Han" "" "00016116" "" "" "" "1" "" "00667" "" "" "M" "" "China" ">18y" "0" "" "" "Han" "" "00016117" "" "" "" "3" "" "00667" "" "" "M" "" "China" "60y" "0" "" "" "Han" "" "00016118" "" "" "" "1" "" "00667" "" "" "F" "" "China" ">36y" "0" "" "" "Han" "" "00016119" "" "" "" "1" "" "00667" "" "" "F" "" "China" ">32y" "0" "" "" "Han" "" "00016120" "" "" "" "3" "" "00667" "" "" "M" "" "China" ">56y" "0" "" "" "Han" "" "00016121" "" "" "" "3" "" "00667" "" "" "M" "" "China" ">46y" "0" "" "" "Han" "" "00016122" "" "" "" "5" "" "00667" "" "" "M" "" "China" "59y" "0" "" "" "Han" "" "00037197" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00037198" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00037199" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00037200" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00037201" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00037202" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00037203" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00090787" "" "" "" "1" "" "01816" "" "gene panel study on colon cancer cases" "" "" "United States" "" "0" "data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database" "" "" "" "00090788" "" "" "" "1" "" "01816" "" "gene panel study on colon cancer cases" "" "" "United States" "" "0" "data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database" "" "" "" "00090789" "" "" "" "1" "" "01816" "" "gene panel study on colon cancer cases" "" "" "United States" "" "0" "data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database" "" "" "" "00090790" "" "" "" "2" "" "01816" "" "gene panel study on colon cancer cases" "" "" "United States" "" "0" "data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database" "" "" "" "00090791" "" "" "" "1" "" "01816" "" "gene panel study on colon cancer cases" "" "" "United States" "" "0" "data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database" "" "" "" "00090792" "" "" "" "4" "" "01816" "" "gene panel study on controls" "" "" "United States" "" "0" "data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database" "" "" "" "00090793" "" "" "" "1" "" "01816" "" "gene panel study on colon cancer cases" "" "" "United States" "" "0" "data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database" "" "" "" "00090794" "" "" "" "1" "" "01816" "" "gene panel study on colon cancer cases" "" "" "United States" "" "0" "data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database" "" "" "" "00090795" "" "" "" "2" "" "01816" "" "gene panel study on colon cancer cases" "" "" "United States" "" "0" "data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database" "" "" "" "00090796" "" "" "" "2" "" "01816" "" "gene panel study on colon cancer cases" "" "" "United States" "" "0" "data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database" "" "" "" "00090797" "" "" "" "1" "" "01816" "" "gene panel study on colon cancer cases" "" "" "United States" "" "0" "data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database" "" "" "" "00090798" "" "" "" "1" "" "01816" "" "gene panel study on colon cancer cases" "" "" "United States" "" "0" "data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database" "" "" "" "00090799" "" "" "" "1" "" "01816" "" "gene panel study on colon cancer cases" "" "" "United States" "" "0" "data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database" "" "" "" "00090800" "" "" "" "2" "" "01816" "" "gene panel study on colon cancer cases" "" "" "United States" "" "0" "data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database" "" "" "" "00090801" "" "" "" "2" "" "01816" "" "gene panel study on colon cancer cases" "" "" "United States" "" "0" "data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database" "" "" "" "00090802" "" "" "" "1" "" "01816" "" "gene panel study on colon cancer cases" "" "" "United States" "" "0" "data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database" "" "" "" "00090803" "" "" "" "1" "" "01816" "" "gene panel study on colon cancer cases" "" "" "United States" "" "0" "data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database" "" "" "" "00090893" "" "" "" "1" "" "01816" "" "gene panel study on colon cancer cases" "" "" "United States" "" "0" "data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database" "" "" "" "00100944" "" "" "" "1" "" "01741" "" "" "" "" "Germany" "" "0" "" "" "" "" "00179194" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179195" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00179196" "" "" "" "172" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00179197" "" "" "" "261" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179198" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00179199" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00179200" "" "" "" "6" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00179201" "" "" "" "3" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179202" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179203" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00179204" "" "" "" "2" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00179205" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179206" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00179207" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00179208" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00179209" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179210" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179211" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179212" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00179213" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00179214" "" "" "" "4" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00179215" "" "" "" "8" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179216" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00179217" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00179218" "" "" "" "2" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179219" "" "" "" "5" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00179220" "" "" "" "4" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179221" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00179222" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179223" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179224" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179225" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00179226" "" "" "" "2" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179227" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179228" "" "" "" "3" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179229" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00179230" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179231" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179232" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00179233" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179234" "" "" "" "9" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00179235" "" "" "" "19" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179236" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179237" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179238" "" "" "" "3" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179239" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00179240" "" "" "" "3" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179241" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00179242" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179243" "" "" "" "143" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00179244" "" "" "" "210" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179245" "" "" "" "26" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00179246" "" "" "" "52" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179247" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179248" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00179249" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00179250" "" "" "" "2" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179251" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00179252" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00179253" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00179254" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00179255" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179256" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179257" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00179258" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179259" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00179260" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179261" "" "" "" "571" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00179262" "" "" "" "882" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179263" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00179264" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179265" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179266" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179267" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00179268" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00179269" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179270" "" "" "" "3" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00179271" "" "" "" "5" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179272" "" "" "" "2" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00179273" "" "" "" "4" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179274" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00179275" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00179276" "" "" "" "2" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00179277" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179278" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00179279" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179280" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00179281" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179282" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179283" "" "" "" "3" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00179284" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179285" "" "" "" "3" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00179286" "" "" "" "4" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179287" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00179288" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00180880" "" "" "" "3" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "-con-F" "00180881" "" "" "" "3" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00180882" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "-con-F" "00180883" "" "" "" "10" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00180884" "" "" "" "16" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "-con-F" "00181622" "" "" "" "2" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 53 male breast cancer cases" "M" "" "Japan" "" "0" "" "" "" "-cases-M" "00181623" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 53 male breast cancer cases" "M" "" "Japan" "" "0" "" "" "" "-cases-M" "00181624" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 53 male breast cancer cases" "M" "" "Japan" "" "0" "" "" "" "-cases-M" "00181625" "" "" "" "7" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 53 male breast cancer cases" "M" "" "Japan" "" "0" "" "" "" "-cases-M" "00182859" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182860" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182861" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182862" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182863" "" "" "" "265" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182864" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182865" "" "" "" "5" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182866" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182867" "" "" "" "2" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182868" "" "" "" "2" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182869" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182870" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182871" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182872" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182873" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182874" "" "" "" "10" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182875" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182876" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182877" "" "" "" "2" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182878" "" "" "" "11" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182879" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182880" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182881" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182882" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182883" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182884" "" "" "" "29" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182885" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182886" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182887" "" "" "" "3" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182888" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182889" "" "" "" "2" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182890" "" "" "" "294" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182891" "" "" "" "45" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182892" "" "" "" "2" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182893" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182894" "" "" "" "2" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182895" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182896" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182897" "" "" "" "31" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182898" "" "" "" "1054" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182899" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182900" "" "" "" "3" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182901" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182902" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182903" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182904" "" "" "" "5" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182905" "" "" "" "7" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182906" "" "" "" "2" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182907" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182908" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182909" "" "" "" "4" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182910" "" "" "" "2" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00183555" "" "" "" "1" "" "02940" "{PMID:Baert-Desurmont 2018:29967336}" "" "" "" "France" "" "0" "" "" "" "29967336-Pat" "00183556" "" "" "" "1" "" "02940" "{PMID:Baert-Desurmont 2018:29967336}" "" "" "" "France" "" "0" "" "" "" "29967336-Pat" "00183557" "" "" "" "1" "" "02940" "{PMID:Baert-Desurmont 2018:29967336}" "" "" "" "France" "" "0" "" "" "" "29967336-Pat" "00183558" "" "" "" "1" "" "02940" "{PMID:Baert-Desurmont 2018:29967336}" "" "" "" "France" "" "0" "" "" "" "29967336-Pat" "00183559" "" "" "" "1" "" "00770" "" "" "" "" "Australia" "" "0" "" "" "" "" "00183560" "" "" "" "1" "" "00770" "" "" "" "" "Australia" "" "0" "" "" "" "" "00183561" "" "" "" "1" "" "00770" "" "" "" "" "Australia" "" "0" "" "" "" "" "00183562" "" "" "" "1" "" "00770" "" "" "" "" "Australia" "" "0" "" "" "" "" "00183563" "" "" "" "1" "" "00770" "" "" "" "" "Australia" "" "0" "" "" "" "" "00183564" "" "" "" "1" "" "00770" "" "" "" "" "Australia" "" "0" "" "" "" "" "00183565" "" "" "" "1" "" "00770" "" "" "" "" "Australia" "" "0" "" "" "" "" "00183566" "" "" "" "1" "" "00770" "" "" "" "" "Australia" "" "0" "" "" "" "" "00183567" "" "" "" "1" "" "00770" "" "" "" "" "Australia" "" "0" "" "" "" "" "00183568" "" "" "" "1" "" "00770" "" "" "" "" "Australia" "" "0" "" "" "" "" "00183569" "" "" "" "1" "" "00770" "" "" "" "" "Australia" "" "0" "" "" "" "" "00183570" "" "" "" "1" "" "00770" "" "" "" "" "Australia" "" "0" "" "" "" "" "00183571" "" "" "" "1" "" "00770" "" "" "" "" "Australia" "" "0" "" "" "" "" "00183572" "" "" "" "1" "" "00770" "" "" "" "" "Australia" "" "0" "" "" "" "" "00183573" "" "" "" "1" "" "00770" "" "" "" "" "Australia" "" "0" "" "" "" "" "00183574" "" "" "" "1" "" "00770" "" "" "" "" "Australia" "" "0" "" "" "" "" "00183575" "" "" "" "1" "" "00770" "" "" "" "" "Australia" "" "0" "" "" "" "" "00183576" "" "" "" "1" "" "00770" "" "" "" "" "Australia" "" "0" "" "" "" "" "00183647" "" "" "" "3" "" "00650" "" "2 generation family, 2 first degree relatives are mutation carrier" "F" "no" "India" "46y" "0" "" "" "Asian" "PJ1" "00183648" "" "" "" "1" "" "00650" "" "" "F" "no" "India" ">45y" "0" "" "" "Asian" "PJ2" "00183649" "" "" "" "2" "" "00650" "" "" "M" "no" "India" "41y" "0" "" "" "Asian" "PJ3" "00183650" "" "" "" "1" "" "00650" "" "" "M" "no" "India" ">21y" "0" "" "" "Asian" "PJ4" "00183651" "" "" "" "1" "" "00650" "" "" "F" "no" "India" "34y" "0" "" "" "Asian" "PJ5" "00183652" "" "" "" "1" "" "00650" "" "" "F" "no" "India" ">47y" "0" "" "" "Asian" "PJ6" "00183653" "" "" "" "1" "" "00650" "" "" "F" "no" "India" ">54y" "0" "" "" "Asian" "PJ7" "00218076" "" "" "" "1" "" "00006" "{PMID:Slavin 2017:28649662}" "" "F" "" "" "" "0" "" "" "European, white" "28649662-PatCGRSX1109" "00246630" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" "" "00263144" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" "" "00263153" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" "" "00263157" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" "" "00263158" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" "" "00263159" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" "" "00263160" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" "" "00263161" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" "" "00263162" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" "" "00263163" "" "" "" "1" "" "01164" "" "" "M" "" "" "" "0" "" "" "" "" "00263164" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" "" "00263165" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" "" "00265103" "" "" "" "1" "" "01164" "" "" "M" "" "" "" "0" "" "" "" "" "00289435" "" "" "" "1" "" "03616" "{DOI:Terkelsen 2020:10.1002/mgg3.1381}" "" "M" "" "Denmark" "" "0" "" "" "" "" "00292037" "" "" "" "159" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00304643" "" "" "" "3" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00334509" "" "" "" "1" "" "02551" "" "" "F" "" "" "" "0" "" "" "" "" "00336338" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00336339" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341689" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341690" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341691" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341692" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341693" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341694" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341695" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341696" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341697" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341698" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341699" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341700" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341701" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341702" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341703" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341704" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341705" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341706" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341707" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341708" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341709" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341710" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341711" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341712" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341713" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341714" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341715" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341716" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341717" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341718" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341719" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341720" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341721" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341722" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341723" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341724" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341725" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341726" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341727" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341728" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341729" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341730" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341731" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341732" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341733" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341734" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341735" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341736" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341737" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341738" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341739" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341740" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341741" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341742" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341743" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341744" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341745" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341746" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341747" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341748" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341915" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341916" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341917" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348934" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348935" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348936" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348937" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348938" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348939" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348940" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348941" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348942" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348943" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348944" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348945" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348946" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348947" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348948" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348949" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348950" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348951" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348952" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348953" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348954" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348955" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348956" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348957" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348958" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348959" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348960" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348961" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348962" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348963" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348964" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348965" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348966" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348967" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348968" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348969" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348970" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348971" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348972" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348973" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348974" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348975" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348976" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348977" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348978" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348979" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348980" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348981" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348982" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348983" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348984" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348985" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348986" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348987" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353827" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353828" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353829" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353830" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353831" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353832" "" "" "" "6" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353833" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353834" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353835" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353836" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353837" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353838" "" "" "" "7" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353839" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353840" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353841" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353842" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353843" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353844" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353845" "" "" "" "5" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353846" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353847" "" "" "" "7" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353848" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353849" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353850" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353851" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353852" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353853" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353854" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353855" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353856" "" "" "" "5" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353857" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358603" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358604" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358605" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358606" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358607" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358608" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358609" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358610" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358611" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358612" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358613" "" "" "" "9" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358614" "" "" "" "6" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358615" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358616" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358617" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358618" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358619" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358620" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358621" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358622" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358623" "" "" "" "9" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358624" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358625" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358626" "" "" "" "6" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358627" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358628" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358629" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358630" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358631" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358632" "" "" "" "8" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358633" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00393152" "" "" "" "1" "" "01164" "" "" "F" "?" "Germany" "" "0" "" "" "" "189107" "00396941" "" "" "" "1" "" "00006" "{PMID:Moreno-Cabrera 2021:33219106}" "" "" "" "Spain" "" "0" "" "" "" "S14" "00416445" "" "" "" "1" "" "01164" "" "" "F" "-" "Germany" "" "0" "" "" "" "203676_182721_ISY" "00431558" "" "" "" "1" "" "04467" "" "" "" "" "" "" "" "" "" "" "" "00435203" "" "" "" "1" "" "01741" "" "" "" "" "" "" "" "" "" "" "" "00443726" "" "" "" "1" "" "04599" "" "" "?" "" "Mexico" "" "" "" "" "Mexican" "MXCCR0506_S20" "00443727" "" "" "" "1" "" "04599" "" "" "F" "" "Mexico" "" "" "" "" "Mexican" "MXCCR0706" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 400 "{{individualid}}" "{{diseaseid}}" "00016109" "00341" "00016110" "00341" "00016111" "00341" "00016112" "00341" "00016113" "00341" "00016114" "00341" "00016115" "00341" "00016116" "00341" "00016117" "00341" "00016118" "00341" "00016119" "00341" "00016120" "00341" "00016121" "00341" "00016122" "00341" "00037197" "00198" "00037198" "00198" "00037199" "00198" "00037200" "00198" "00037201" "00198" "00037202" "00198" "00037203" "00198" "00090787" "00091" "00090788" "00091" "00090789" "00091" "00090790" "00091" "00090791" "00091" "00090792" "00000" "00090793" "00091" "00090794" "00091" "00090795" "00091" "00090796" "00091" "00090797" "00091" "00090798" "00091" "00090799" "00091" "00090800" "00091" "00090801" "00091" "00090802" "00091" "00090803" "00091" "00090893" "00091" "00100944" "00341" "00179194" "00000" "00179195" "00318" "00179196" "00318" "00179197" "00000" "00179198" "00318" "00179199" "00318" "00179200" "00318" "00179201" "00000" "00179202" "00000" "00179203" "00318" "00179204" "00318" "00179205" "00000" "00179206" "00318" "00179207" "00318" "00179208" "00318" "00179209" "00000" "00179210" "00000" "00179211" "00000" "00179212" "00318" "00179213" "00318" "00179214" "00318" "00179215" "00000" "00179216" "00318" "00179217" "00318" "00179218" "00000" "00179219" "00318" "00179220" "00000" "00179221" "00318" "00179222" "00000" "00179223" "00000" "00179224" "00000" "00179225" "00318" "00179226" "00000" "00179227" "00000" "00179228" "00000" "00179229" "00318" "00179230" "00000" "00179231" "00000" "00179232" "00318" "00179233" "00000" "00179234" "00318" "00179235" "00000" "00179236" "00000" "00179237" "00000" "00179238" "00000" "00179239" "00318" "00179240" "00000" "00179241" "00318" "00179242" "00000" "00179243" "00318" "00179244" "00000" "00179245" "00318" "00179246" "00000" "00179247" "00000" "00179248" "00318" "00179249" "00318" "00179250" "00000" "00179251" "00318" "00179252" "00318" "00179253" "00318" "00179254" "00318" "00179255" "00000" "00179256" "00000" "00179257" "00318" "00179258" "00000" "00179259" "00318" "00179260" "00000" "00179261" "00318" "00179262" "00000" "00179263" "00318" "00179264" "00000" "00179265" "00000" "00179266" "00000" "00179267" "00318" "00179268" "00318" "00179269" "00000" "00179270" "00318" "00179271" "00000" "00179272" "00318" "00179273" "00000" "00179274" "00318" "00179275" "00318" "00179276" "00318" "00179277" "00000" "00179278" "00318" "00179279" "00000" "00179280" "00318" "00179281" "00000" "00179282" "00000" "00179283" "00318" "00179284" "00000" "00179285" "00318" "00179286" "00000" "00179287" "00000" "00179288" "00000" "00180880" "00000" "00180881" "00318" "00180882" "00000" "00180883" "00318" "00180884" "00000" "00181622" "00318" "00181623" "00318" "00181624" "00318" "00181625" "00318" "00182859" "00000" "00182860" "00000" "00182861" "00000" "00182862" "00000" "00182863" "00000" "00182864" "00000" "00182865" "00000" "00182866" "00000" "00182867" "00000" "00182868" "00000" "00182869" "00000" "00182870" "00000" "00182871" "00000" "00182872" "00000" "00182873" "00000" "00182874" "00000" "00182875" "00000" "00182876" "00000" "00182877" "00000" "00182878" "00000" "00182879" "00000" "00182880" "00000" "00182881" "00000" "00182882" "00000" "00182883" "00000" "00182884" "00000" "00182885" "00000" "00182886" "00000" "00182887" "00000" "00182888" "00000" "00182889" "00000" "00182890" "00000" "00182891" "00000" "00182892" "00000" "00182893" "00000" "00182894" "00000" "00182895" "00000" "00182896" "00000" "00182897" "00000" "00182898" "00000" "00182899" "00000" "00182900" "00000" "00182901" "00000" "00182902" "00000" "00182903" "00000" "00182904" "00000" "00182905" "00000" "00182906" "00000" "00182907" "00000" "00182908" "00000" "00182909" "00000" "00182910" "00000" "00183555" "00341" "00183556" "00341" "00183557" "00341" "00183558" "00341" "00183647" "00341" "00183648" "00341" "00183649" "00341" "00183650" "00341" "00183651" "00341" "00183652" "00341" "00183653" "00341" "00218076" "04148" "00289435" "00341" "00292037" "00198" "00304643" "00198" "00334509" "00198" "00336338" "00000" "00336339" "00000" "00341689" "00000" "00341690" "00000" "00341691" "00000" "00341692" "00000" "00341693" "00000" "00341694" "00000" "00341695" "00000" "00341696" "00000" "00341697" "00000" "00341698" "00000" "00341699" "00000" "00341700" "00000" "00341701" "00000" "00341702" "00000" "00341703" "00000" "00341704" "00000" "00341705" "00000" "00341706" "00000" "00341707" "00000" "00341708" "00000" "00341709" "00000" "00341710" "00000" "00341711" "00000" "00341712" "00000" "00341713" "00000" "00341714" "00000" "00341715" "00000" "00341716" "00000" "00341717" "00000" "00341718" "00000" "00341719" "00000" "00341720" "00000" "00341721" "00000" "00341722" "00000" "00341723" "00000" "00341724" "00000" "00341725" "00000" "00341726" "00000" "00341727" "00000" "00341728" "00000" "00341729" "00000" "00341730" "00000" "00341731" "00000" "00341732" "00000" "00341733" "00000" "00341734" "00000" "00341735" "00000" "00341736" "00000" "00341737" "00000" "00341738" "00000" "00341739" "00000" "00341740" "00000" "00341741" "00000" "00341742" "00000" "00341743" "00000" "00341744" "00000" "00341745" "00000" "00341746" "00000" "00341747" "00000" "00341748" "00000" "00341915" "00318" "00341916" "00318" "00341917" "00318" "00348934" "00318" "00348935" "00318" "00348936" "00318" "00348937" "00318" "00348938" "00318" "00348939" "00318" "00348940" "00318" "00348941" "00318" "00348942" "00318" "00348943" "00318" "00348944" "00318" "00348945" "00318" "00348946" "00318" "00348947" "00318" "00348948" "00318" "00348949" "00318" "00348950" "00318" "00348951" "00318" "00348952" "00318" "00348953" "00318" "00348954" "00318" "00348955" "00318" "00348956" "00318" "00348957" "00318" "00348958" "00318" "00348959" "00318" "00348960" "00318" "00348961" "00318" "00348962" "00318" "00348963" "00318" "00348964" "00318" "00348965" "00318" "00348966" "00318" "00348967" "00318" "00348968" "00318" "00348969" "00318" "00348970" "00318" "00348971" "00318" "00348972" "00318" "00348973" "00318" "00348974" "00318" "00348975" "00318" "00348976" "00318" "00348977" "00318" "00348978" "00318" "00348979" "00318" "00348980" "00318" "00348981" "00318" "00348982" "00318" "00348983" "00318" "00348984" "00318" "00348985" "00318" "00348986" "00318" "00348987" "00318" "00353827" "00318" "00353828" "00318" "00353829" "00318" "00353830" "00318" "00353831" "00318" "00353832" "00318" "00353833" "00318" "00353834" "00318" "00353835" "00318" "00353836" "00318" "00353837" "00318" "00353838" "00318" "00353839" "00318" "00353840" "00318" "00353841" "00318" "00353842" "00318" "00353843" "00318" "00353844" "00318" "00353845" "00318" "00353846" "00318" "00353847" "00318" "00353848" "00318" "00353849" "00318" "00353850" "00318" "00353851" "00318" "00353852" "00318" "00353853" "00318" "00353854" "00318" "00353855" "00318" "00353856" "00318" "00353857" "00318" "00358603" "00000" "00358604" "00000" "00358605" "00000" "00358606" "00000" "00358607" "00000" "00358608" "00000" "00358609" "00000" "00358610" "00000" "00358611" "00000" "00358612" "00000" "00358613" "00000" "00358614" "00000" "00358615" "00000" "00358616" "00000" "00358617" "00000" "00358618" "00000" "00358619" "00000" "00358620" "00000" "00358621" "00000" "00358622" "00000" "00358623" "00000" "00358624" "00000" "00358625" "00000" "00358626" "00000" "00358627" "00000" "00358628" "00000" "00358629" "00000" "00358630" "00000" "00358631" "00000" "00358632" "00000" "00358633" "00000" "00393152" "00341" "00396941" "05093" "00416445" "00341" "00431558" "01524" "00435203" "00318" "00443726" "05489" "00443727" "05489" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00000, 00091, 00198, 00318, 00341, 00602, 00681, 01524, 04148, 05093, 05489 ## Count = 51 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Cysts}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Cancer/Sub_type}}" "{{Phenotype/Eye/Retina}}" "{{Phenotype/Neoplasm}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000014900" "00341" "00016109" "00667" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000014901" "00341" "00016110" "00667" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000014902" "00341" "00016111" "00667" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000014903" "00341" "00016122" "00667" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000014904" "00341" "00016112" "00667" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000014905" "00341" "00016113" "00667" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000014906" "00341" "00016114" "00667" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000014907" "00341" "00016115" "00667" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000014908" "00341" "00016116" "00667" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000014909" "00341" "00016117" "00667" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000014910" "00341" "00016118" "00667" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000014911" "00341" "00016119" "00667" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000014912" "00341" "00016120" "00667" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000014913" "00341" "00016121" "00667" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000079163" "00341" "00100944" "01741" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000144259" "00341" "00183555" "02940" "Unknown" "" "Peutz-Jeghers" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000144260" "00341" "00183556" "02940" "Unknown" "" "Peutz-Jeghers" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000144261" "00341" "00183557" "02940" "Unknown" "" "Peutz-Jeghers" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000144262" "00341" "00183558" "02940" "Unknown" "" "Peutz-Jeghers" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000144315" "00341" "00183647" "00650" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000144316" "00341" "00183648" "00650" "Familial" "" "Family history of breast cancer in mother. Proband has mucocutaneous pigmentation and GI polyps" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000144317" "00341" "00183649" "00650" "Unknown" "" "small bowel cancer with polyposis and mucocutaneous pigmentation. Son of proband also has pigmentation and is carrier of the mutation" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000144318" "00341" "00183650" "00650" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000144319" "00341" "00183651" "00650" "Unknown" "" "gonadoblastoma of ovary with multiple hamartomatous polyposis" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000144320" "00341" "00183652" "00650" "Unknown" "" "hyperpigmentation, infiltrating ductal carcinoma of breast Grade III with ER/PR/Her2 +/+/-" "" "" "" "" "" "" "" "" "" "" "" "" "" "Peutz-Jeghers syndrome" "" "0000144321" "00341" "00183653" "00650" "Unknown" "" "hyperpigmentation, infiltrating ductal carcinoma of breast Grade III with ER/PR/Her2 +/+/-" "" "" "" "" "" "" "" "" "" "" "" "" "" "Peutz-Jeghers syndrome" "" "0000156827" "00198" "00037197" "01164" "Unknown" "" "Peutz-Jeghers syndrome" "" "" "" "" "" "" "" "" "" "" "" "" "" "Peutz-Jeghers syndrome" "" "0000156828" "00198" "00037198" "01164" "Familial" "" "family history: father, uncle and grand-father (paternal) died from intestinal-cancer, paternal cousin: PJS" "" "" "" "" "" "" "" "" "" "" "" "" "" "cancer?" "" "0000156829" "00198" "00037199" "01164" "Unknown" "" "suspected familiar breast- and ovarial-cancer, BC and Ovarial-Ca" "" "" "" "" "" "" "" "" "" "" "" "" "" "breas cancer" "" "0000156830" "00198" "00037200" "01164" "Unknown" "" "suspected Peutz-Jeghers syndrome" "" "" "" "" "" "" "" "" "" "" "" "" "" "Peutz-Jeghers syndrome?" "" "0000156831" "00198" "00037201" "01164" "Unknown" "" "Peutz-Jehgers syndrome, gastric adenocarcinoma, Peutz-Jehgers polyps of colon, Pigmentspots Lip" "" "" "" "" "" "" "" "" "" "" "" "" "" "Peutz-Jeghers syndrome" "" "0000156832" "00198" "00037202" "01164" "Unknown" "" "suspected Peutz-Jeghers syndrome" "" "" "" "" "" "" "" "" "" "" "" "" "" "Peutz-Jeghers syndrome?" "" "0000156833" "00198" "00037203" "01164" "Familial" "" "family history positive, suspected PJS" "" "" "" "" "" "" "" "" "" "" "" "" "" "Peutz-Jeghers syndrome?" "" "0000166529" "04148" "00218076" "00006" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "breast cancer" "" "0000186486" "00198" "00246630" "01164" "Unknown" "" "HP:0100615 (Ovarian neoplasm), HP:0000119 (Abnormality of the genitourinary system), serous ovarian cancer at 61y; sister breast cancer at 56y; mother breast cancer at 80y" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000201581" "00198" "00263144" "01164" "Unknown" "" "Abnormality of the genitourinary system (HP:0000119); Ovarian neoplasm (HP:0100615)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000201589" "00198" "00263153" "01164" "Unknown" "" "Breast carcinoma (HP:0003002); Abnormality of the breast (HP:0000769)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000201592" "00198" "00263157" "01164" "Unknown" "" "Pituitary prolactin cell adenoma (HP:0006767)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000201593" "00198" "00263158" "01164" "Unknown" "" "Intestinal polyposis (HP:0200008)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000201594" "00198" "00263159" "01164" "Unknown" "" "Breast carcinoma (HP:0003002)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000201595" "00198" "00263160" "01164" "Unknown" "" "Breast carcinoma (HP:0003002)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000201596" "00198" "00263161" "01164" "Unknown" "" "Breast carcinoma (HP:0003002)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000201597" "00198" "00263162" "01164" "Unknown" "" "Neoplasm (HP:0002664)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000201598" "00198" "00263165" "01164" "Unknown" "" "Colon cancer (HP:0003003)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000202949" "00198" "00265103" "01164" "Unknown" "" "Intestinal polyposis (HP:0200008)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000223047" "00341" "00289435" "03616" "Unknown" "" "Hamartomatous polyposis (HP:0004390), adenocarcinoma of the large intestine (HP:0040275)" "" "60y" "" "" "" "" "" "" "" "" "" "" "" "Peutz-Jeghers syndrome" "" "0000252572" "00198" "00334509" "02551" "Unknown" "" "Breast carcinoma (HP:0003002)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000286393" "00341" "00393152" "01164" "Familial, autosomal dominant" "" "Abnormality of skin pigmentation, Abnormal pigmentation of the oral mucosa" "" "" "" "" "" "" "" "" "" "" "" "" "Peutz-Jeghers syndrome" "Peutz-Jeghers syndrome" "" "0000290100" "05093" "00396941" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "polyposis" "" "0000308165" "00341" "00416445" "01164" "Unknown" "" "Hamartomatous polyposis, Intestinal obstruction, Abnormal stomach morphology, Colorectal polyposis, Hepatic cysts" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000333008" "05489" "00443727" "04599" "Unknown" "65" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" ## Screenings ## Do not remove or alter this header ## ## Count = 432 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000003215" "00003296" "1" "00552" "00552" "2013-11-05 19:16:02" "" "" "SEQ-NG-I" "DNA" "" "" "0000016027" "00016109" "1" "00667" "00667" "2014-02-25 09:42:49" "" "" "SEQ" "DNA" "Blood" "" "0000016028" "00016110" "1" "00667" "00667" "2014-02-25 11:19:44" "" "" "SEQ" "DNA" "Blood" "" "0000016029" "00016111" "1" "00667" "00667" "2014-02-25 11:31:06" "" "" "SEQ" "DNA" "Blood" "" "0000016030" "00016112" "1" "00667" "00667" "2014-02-25 11:41:58" "" "" "SEQ" "DNA" "Blood" "" "0000016031" "00016113" "1" "00667" "00667" "2014-02-25 11:48:58" "" "" "SEQ" "DNA" "Blood" "" "0000016032" "00016114" "1" "00667" "00667" "2014-02-25 12:05:08" "" "" "SEQ" "DNA" "Blood" "" "0000016033" "00016115" "1" "00667" "00667" "2014-02-25 12:11:41" "" "" "SEQ" "DNA" "Blood" "" "0000016035" "00016116" "1" "00667" "00667" "2014-02-25 12:21:45" "" "" "SEQ" "DNA" "Blood" "" "0000016036" "00016117" "1" "00667" "00667" "2014-02-25 12:34:39" "" "" "SEQ" "DNA" "Blood" "" "0000016037" "00016118" "1" "00667" "00667" "2014-02-25 12:40:58" "" "" "SEQ" "DNA" "Blood" "" "0000016038" "00016119" "1" "00667" "00667" "2014-02-25 12:45:49" "" "" "SEQ" "DNA" "Blood" "" "0000016039" "00016120" "1" "00667" "00667" "2014-02-25 12:53:23" "" "" "SEQ" "DNA" "Blood" "" "0000016040" "00016121" "1" "00667" "00667" "2014-02-26 02:14:48" "" "" "SEQ" "DNA" "Blood" "" "0000016041" "00016122" "1" "00667" "00667" "2014-02-26 02:19:33" "" "" "SEQ" "DNA" "Blood" "" "0000037267" "00037197" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000037268" "00037198" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000037269" "00037199" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000037270" "00037200" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000037271" "00037201" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000037272" "00037202" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000037273" "00037203" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000090932" "00090787" "1" "01816" "00006" "2016-11-21 16:06:29" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000090933" "00090788" "1" "01816" "00006" "2016-11-21 16:06:29" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000090934" "00090789" "1" "01816" "00006" "2016-11-21 16:06:29" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000090935" "00090790" "1" "01816" "00006" "2016-11-21 16:06:29" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000090936" "00090791" "1" "01816" "00006" "2016-11-21 16:06:29" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000090937" "00090792" "1" "01816" "00006" "2016-11-21 16:06:29" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000090938" "00090793" "1" "01816" "00006" "2016-11-21 16:06:29" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000090939" "00090794" "1" "01816" "00006" "2016-11-21 16:06:29" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000090940" "00090795" "1" "01816" "00006" "2016-11-21 16:06:29" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000090941" "00090796" "1" "01816" "00006" "2016-11-21 16:06:29" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000090942" "00090797" "1" "01816" "00006" "2016-11-21 16:06:29" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000090943" "00090798" "1" "01816" "00006" "2016-11-21 16:06:29" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000090944" "00090799" "1" "01816" "00006" "2016-11-21 16:06:29" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000090945" "00090800" "1" "01816" "00006" "2016-11-21 16:06:29" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000090946" "00090801" "1" "01816" "00006" "2016-11-21 16:06:29" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000090947" "00090802" "1" "01816" "00006" "2016-11-21 16:06:29" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000090948" "00090803" "1" "01816" "00006" "2016-11-21 16:06:29" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000091038" "00090893" "1" "01816" "00006" "2016-11-21 16:06:29" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000101367" "00100944" "1" "01741" "01741" "2017-03-15 16:57:08" "" "" "SEQ" "DNA" "" "" "0000180097" "00179194" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180098" "00179195" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180099" "00179196" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180100" "00179197" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180101" "00179198" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180102" "00179199" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180103" "00179200" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180104" "00179201" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180105" "00179202" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180106" "00179203" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180107" "00179204" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180108" "00179205" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180109" "00179206" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180110" "00179207" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180111" "00179208" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180112" "00179209" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180113" "00179210" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180114" "00179211" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180115" "00179212" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180116" "00179213" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180117" "00179214" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180118" "00179215" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180119" "00179216" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180120" "00179217" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180121" "00179218" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180122" "00179219" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180123" "00179220" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180124" "00179221" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180125" "00179222" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180126" "00179223" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180127" "00179224" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180128" "00179225" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180129" "00179226" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180130" "00179227" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180131" "00179228" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180132" "00179229" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180133" "00179230" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180134" "00179231" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180135" "00179232" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180136" "00179233" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180137" "00179234" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180138" "00179235" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180139" "00179236" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180140" "00179237" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180141" "00179238" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180142" "00179239" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180143" "00179240" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180144" "00179241" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180145" "00179242" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180146" "00179243" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180147" "00179244" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180148" "00179245" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180149" "00179246" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180150" "00179247" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180151" "00179248" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180152" "00179249" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180153" "00179250" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180154" "00179251" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180155" "00179252" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180156" "00179253" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180157" "00179254" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180158" "00179255" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180159" "00179256" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180160" "00179257" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180161" "00179258" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180162" "00179259" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180163" "00179260" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180164" "00179261" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180165" "00179262" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180166" "00179263" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180167" "00179264" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180168" "00179265" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180169" "00179266" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180170" "00179267" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180171" "00179268" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180172" "00179269" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180173" "00179270" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180174" "00179271" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180175" "00179272" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180176" "00179273" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180177" "00179274" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180178" "00179275" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180179" "00179276" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180180" "00179277" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180181" "00179278" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180182" "00179279" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180183" "00179280" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180184" "00179281" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180185" "00179282" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180186" "00179283" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180187" "00179284" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180188" "00179285" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180189" "00179286" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180190" "00179287" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000180191" "00179288" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000181817" "00180880" "1" "01714" "00006" "2018-09-07 18:47:50" "" "" "SEQ" "DNA" "" "" "0000181818" "00180881" "1" "01714" "00006" "2018-09-07 18:47:50" "" "" "SEQ" "DNA" "" "" "0000181819" "00180882" "1" "01714" "00006" "2018-09-07 18:47:50" "" "" "SEQ" "DNA" "" "" "0000181820" "00180883" "1" "01714" "00006" "2018-09-07 18:47:50" "" "" "SEQ" "DNA" "" "" "0000181821" "00180884" "1" "01714" "00006" "2018-09-07 18:47:50" "" "" "SEQ" "DNA" "" "" "0000182582" "00181622" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000182583" "00181623" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000182584" "00181624" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000182585" "00181625" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183819" "00182859" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183820" "00182860" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183821" "00182861" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183822" "00182862" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183823" "00182863" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183824" "00182864" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183825" "00182865" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183826" "00182866" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183827" "00182867" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183828" "00182868" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183829" "00182869" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183830" "00182870" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183831" "00182871" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183832" "00182872" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183833" "00182873" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183834" "00182874" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183835" "00182875" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183836" "00182876" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183837" "00182877" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183838" "00182878" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183839" "00182879" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183840" "00182880" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183841" "00182881" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183842" "00182882" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183843" "00182883" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183844" "00182884" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183845" "00182885" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183846" "00182886" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183847" "00182887" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183848" "00182888" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183849" "00182889" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183850" "00182890" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183851" "00182891" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183852" "00182892" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183853" "00182893" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183854" "00182894" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183855" "00182895" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183856" "00182896" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183857" "00182897" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183858" "00182898" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183859" "00182899" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183860" "00182900" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183861" "00182901" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183862" "00182902" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183863" "00182903" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183864" "00182904" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183865" "00182905" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183866" "00182906" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183867" "00182907" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183868" "00182908" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183869" "00182909" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183870" "00182910" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000184523" "00183555" "1" "02940" "00770" "2018-04-21 06:42:58" "" "" "SEQ-NG" "DNA" "" "CRC 10 gene panel" "0000184524" "00183556" "1" "02940" "00770" "2018-04-21 06:42:58" "" "" "SEQ-NG" "DNA" "" "CRC 10 gene panel" "0000184525" "00183557" "1" "02940" "00770" "2018-04-21 06:42:58" "" "" "SEQ-NG" "DNA" "" "CRC 10 gene panel" "0000184526" "00183558" "1" "02940" "00770" "2018-04-21 06:42:58" "" "" "SEQ-NG" "DNA" "" "CRC 10 gene panel" "0000184527" "00183559" "1" "00770" "00770" "2016-07-07 12:00:00" "" "" "SEQ" "DNA" "" "" "0000184528" "00183560" "1" "00770" "00770" "2016-07-07 12:00:00" "" "" "SEQ" "DNA" "" "" "0000184529" "00183561" "1" "00770" "00770" "2016-07-07 12:00:00" "" "" "SEQ" "DNA" "" "" "0000184530" "00183562" "1" "00770" "00770" "2016-07-07 12:00:00" "" "" "SEQ" "DNA" "" "" "0000184531" "00183563" "1" "00770" "00770" "2016-07-07 12:00:00" "" "" "SEQ" "DNA" "" "" "0000184532" "00183564" "1" "00770" "00770" "2016-07-07 12:00:00" "" "" "SEQ" "DNA" "" "" "0000184533" "00183565" "1" "00770" "00770" "2016-07-07 12:00:00" "" "" "SEQ" "DNA" "" "" "0000184534" "00183566" "1" "00770" "00770" "2016-07-07 12:00:00" "" "" "SEQ" "DNA" "" "" "0000184535" "00183567" "1" "00770" "00770" "2016-07-07 12:00:00" "" "" "SEQ" "DNA" "" "" "0000184536" "00183568" "1" "00770" "00770" "2016-07-07 12:00:00" "" "" "SEQ" "DNA" "" "" "0000184537" "00183569" "1" "00770" "00770" "2016-07-07 12:00:00" "" "" "SEQ" "DNA" "" "" "0000184538" "00183570" "1" "00770" "00770" "2016-07-07 12:00:00" "" "" "SEQ" "DNA" "" "" "0000184539" "00183571" "1" "00770" "00770" "2016-07-07 12:00:00" "" "" "SEQ" "DNA" "" "" "0000184540" "00183572" "1" "00770" "00770" "2016-07-07 12:00:00" "" "" "SEQ" "DNA" "" "" "0000184541" "00183573" "1" "00770" "00770" "2016-07-07 12:00:00" "" "" "SEQ" "DNA" "" "" "0000184542" "00183574" "1" "00770" "00770" "2016-07-07 12:00:00" "" "" "SEQ" "DNA" "" "" "0000184543" "00183575" "1" "00770" "00770" "2016-07-07 12:00:00" "" "" "SEQ" "DNA" "" "" "0000184544" "00183576" "1" "00770" "00770" "2016-07-07 12:00:00" "" "" "SEQ" "DNA" "" "" "0000184615" "00183647" "1" "00650" "00650" "2018-10-24 08:16:13" "" "" "MLPA" "DNA" "" "" "0000184616" "00183648" "1" "00650" "00650" "2018-10-24 12:59:48" "" "" "MLPA" "DNA" "" "" "0000184617" "00183649" "1" "00650" "00650" "2018-10-24 13:20:13" "" "" "PCR;SEQ" "DNA" "" "" "0000184618" "00183650" "1" "00650" "00650" "2018-10-24 14:21:19" "" "" "MLPA" "DNA" "" "" "0000184619" "00183651" "1" "00650" "00650" "2018-10-24 14:27:54" "" "" "PCR;SEQ" "DNA" "" "" "0000184620" "00183652" "1" "00650" "00650" "2018-10-24 14:33:58" "" "" "PCR;SEQ" "DNA" "" "" "0000184621" "00183653" "1" "00650" "00650" "2018-10-24 14:44:09" "" "" "PCR;SEQ" "DNA" "" "" "0000219146" "00218076" "1" "00006" "00006" "2019-01-22 09:11:01" "" "" "SEQ;SEQ-NG" "DNA" "" "26 gene panel BRCA" "0000247741" "00246630" "1" "01164" "01164" "2019-07-15 17:47:27" "" "" "SEQ-NG-S" "DNA" "" "" "0000264250" "00263144" "1" "01164" "01164" "2019-08-23 12:26:47" "" "" "SEQ-NG-S" "DNA" "" "" "0000264259" "00263153" "1" "01164" "01164" "2019-08-23 12:26:55" "" "" "SEQ-NG-S" "DNA" "" "" "0000264263" "00263157" "1" "01164" "01164" "2019-08-23 12:26:58" "" "" "SEQ-NG-S" "DNA" "" "" "0000264264" "00263158" "1" "01164" "01164" "2019-08-23 12:26:58" "" "" "SEQ-NG-S" "DNA" "" "" "0000264265" "00263159" "1" "01164" "01164" "2019-08-23 12:26:58" "" "" "SEQ-NG-S" "DNA" "" "" "0000264266" "00263160" "1" "01164" "01164" "2019-08-23 12:26:58" "" "" "SEQ-NG-S" "DNA" "" "" "0000264267" "00263161" "1" "01164" "01164" "2019-08-23 12:26:58" "" "" "SEQ-NG-S" "DNA" "" "" "0000264268" "00263162" "1" "01164" "01164" "2019-08-23 12:27:00" "" "" "SEQ-NG-S" "DNA" "" "" "0000264269" "00263163" "1" "01164" "01164" "2019-08-23 12:27:00" "" "" "SEQ-NG-S" "DNA" "" "" "0000264270" "00263164" "1" "01164" "01164" "2019-08-23 12:27:00" "" "" "SEQ-NG-S" "DNA" "" "" "0000264271" "00263165" "1" "01164" "01164" "2019-08-23 12:27:02" "" "" "SEQ-NG-S" "DNA" "" "" "0000266223" "00265103" "1" "01164" "01164" "2019-09-13 15:59:20" "" "" "SEQ-NG-S" "DNA" "" "" "0000290605" "00289435" "1" "03616" "03616" "2020-03-09 12:09:00" "00006" "2020-05-28 15:37:04" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "Blood" "" "0000293205" "00292037" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000305772" "00304643" "1" "03575" "00006" "2020-06-24 11:55:42" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000335737" "00334509" "1" "02551" "02551" "2021-03-01 09:44:01" "" "" "SEQ" "DNA" "" "" "0000337568" "00336338" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000337569" "00336339" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342919" "00341689" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342920" "00341690" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342921" "00341691" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342922" "00341692" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342923" "00341693" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342924" "00341694" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342925" "00341695" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342926" "00341696" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342927" "00341697" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342928" "00341698" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342929" "00341699" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342930" "00341700" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342931" "00341701" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342932" "00341702" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342933" "00341703" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342934" "00341704" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342935" "00341705" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342936" "00341706" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342937" "00341707" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342938" "00341708" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342939" "00341709" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342940" "00341710" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342941" "00341711" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342942" "00341712" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342943" "00341713" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342944" "00341714" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342945" "00341715" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342946" "00341716" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342947" "00341717" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342948" "00341718" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342949" "00341719" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342950" "00341720" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342951" "00341721" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342952" "00341722" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342953" "00341723" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342954" "00341724" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342955" "00341725" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342956" "00341726" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342957" "00341727" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342958" "00341728" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342959" "00341729" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342960" "00341730" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342961" "00341731" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342962" "00341732" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342963" "00341733" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342964" "00341734" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342965" "00341735" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342966" "00341736" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342967" "00341737" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342968" "00341738" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342969" "00341739" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342970" "00341740" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342971" "00341741" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342972" "00341742" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342973" "00341743" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342974" "00341744" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342975" "00341745" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342976" "00341746" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342977" "00341747" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342978" "00341748" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000343145" "00341915" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000343146" "00341916" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000343147" "00341917" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350164" "00348934" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350165" "00348935" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350166" "00348936" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350167" "00348937" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350168" "00348938" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350169" "00348939" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350170" "00348940" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350171" "00348941" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350172" "00348942" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350173" "00348943" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350174" "00348944" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350175" "00348945" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350176" "00348946" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350177" "00348947" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350178" "00348948" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350179" "00348949" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350180" "00348950" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350181" "00348951" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350182" "00348952" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350183" "00348953" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350184" "00348954" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350185" "00348955" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350186" "00348956" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350187" "00348957" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350188" "00348958" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350189" "00348959" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350190" "00348960" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350191" "00348961" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350192" "00348962" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350193" "00348963" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350194" "00348964" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350195" "00348965" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350196" "00348966" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350197" "00348967" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350198" "00348968" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350199" "00348969" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350200" "00348970" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350201" "00348971" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350202" "00348972" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350203" "00348973" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350204" "00348974" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350205" "00348975" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350206" "00348976" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350207" "00348977" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350208" "00348978" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350209" "00348979" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350210" "00348980" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350211" "00348981" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350212" "00348982" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350213" "00348983" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350214" "00348984" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350215" "00348985" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350216" "00348986" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350217" "00348987" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355057" "00353827" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355058" "00353828" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355059" "00353829" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355060" "00353830" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355061" "00353831" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355062" "00353832" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355063" "00353833" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355064" "00353834" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355065" "00353835" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355066" "00353836" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355067" "00353837" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355068" "00353838" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355069" "00353839" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355070" "00353840" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355071" "00353841" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355072" "00353842" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355073" "00353843" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355074" "00353844" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355075" "00353845" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355076" "00353846" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355077" "00353847" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355078" "00353848" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355079" "00353849" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355080" "00353850" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355081" "00353851" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355082" "00353852" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355083" "00353853" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355084" "00353854" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355085" "00353855" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355086" "00353856" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355087" "00353857" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359833" "00358603" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359834" "00358604" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359835" "00358605" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359836" "00358606" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359837" "00358607" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359838" "00358608" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359839" "00358609" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359840" "00358610" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359841" "00358611" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359842" "00358612" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359843" "00358613" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359844" "00358614" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359845" "00358615" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359846" "00358616" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359847" "00358617" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359848" "00358618" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359849" "00358619" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359850" "00358620" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359851" "00358621" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359852" "00358622" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359853" "00358623" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359854" "00358624" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359855" "00358625" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359856" "00358626" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359857" "00358627" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359858" "00358628" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359859" "00358629" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359860" "00358630" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359861" "00358631" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359862" "00358632" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359863" "00358633" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000394400" "00393152" "1" "01164" "01164" "2021-11-26 09:43:44" "" "" "SEQ-NG-I" "DNA" "Blood" "WES" "0000398183" "00396941" "1" "00006" "00006" "2021-12-17 16:17:25" "" "" "MLPA;SEQ-NG" "DNA" "" "" "0000417724" "00416445" "1" "01164" "01164" "2022-08-31 11:02:56" "" "" "SEQ-NG-I" "DNA" "Blood" "WES" "0000432991" "00431558" "1" "04467" "04467" "2023-02-15 05:23:57" "" "" "SEQ-NG-I" "DNA" "" "" "0000436678" "00435203" "1" "01741" "01741" "2023-06-07 09:30:48" "" "" "SEQ-NG" "DNA" "" "" "0000445221" "00443726" "1" "04599" "04599" "2023-12-01 07:35:51" "" "" "SEQ-NG-I" "DNA" "Blood" "TruSight Cancer Sequencing Panel" "0000445222" "00443727" "1" "04599" "04599" "2023-12-01 07:40:05" "" "" "SEQ-NG-I" "DNA" "Blood" "TruSight Cancer Sequencing Panel" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 416 "{{screeningid}}" "{{geneid}}" "0000003215" "STK11" "0000016027" "STK11" "0000016028" "STK11" "0000016029" "STK11" "0000016030" "STK11" "0000016031" "STK11" "0000016032" "STK11" "0000016033" "STK11" "0000016035" "STK11" "0000016036" "STK11" "0000016037" "STK11" "0000016038" "STK11" "0000016039" "STK11" "0000016040" "STK11" "0000016041" "STK11" "0000037267" "STK11" "0000037268" "STK11" "0000037269" "STK11" "0000037270" "STK11" "0000037271" "STK11" "0000037272" "STK11" "0000037273" "STK11" "0000090932" "STK11" "0000090933" "STK11" "0000090934" "STK11" "0000090935" "STK11" "0000090936" "STK11" "0000090937" "STK11" "0000090938" "STK11" "0000090939" "STK11" "0000090940" "STK11" "0000090941" "STK11" "0000090942" "STK11" "0000090943" "STK11" "0000090944" "STK11" "0000090945" "STK11" "0000090946" "STK11" "0000090947" "STK11" "0000090948" "STK11" "0000091038" "STK11" "0000101367" "STK11" "0000180097" "STK11" "0000180098" "STK11" "0000180099" "STK11" "0000180100" "STK11" "0000180101" "STK11" "0000180102" "STK11" "0000180103" "STK11" "0000180104" "STK11" "0000180105" "STK11" "0000180106" "STK11" "0000180107" "STK11" "0000180108" "STK11" "0000180109" "STK11" "0000180110" "STK11" "0000180111" "STK11" "0000180112" "STK11" "0000180113" "STK11" "0000180114" "STK11" "0000180115" "STK11" "0000180116" "STK11" "0000180117" "STK11" "0000180118" "STK11" "0000180119" "STK11" "0000180120" "STK11" "0000180121" "STK11" "0000180122" "STK11" "0000180123" "STK11" "0000180124" "STK11" "0000180125" "STK11" "0000180126" "STK11" "0000180127" "STK11" "0000180128" "STK11" "0000180129" "STK11" "0000180130" "STK11" "0000180131" "STK11" "0000180132" "STK11" "0000180133" "STK11" "0000180134" "STK11" "0000180135" "STK11" "0000180136" "STK11" "0000180137" "STK11" "0000180138" "STK11" "0000180139" "STK11" "0000180140" "STK11" "0000180141" "STK11" "0000180142" "STK11" "0000180143" "STK11" "0000180144" "STK11" "0000180145" "STK11" "0000180146" "STK11" "0000180147" "STK11" "0000180148" "STK11" "0000180149" "STK11" "0000180150" "STK11" "0000180151" "STK11" "0000180152" "STK11" "0000180153" "STK11" "0000180154" "STK11" "0000180155" "STK11" "0000180156" "STK11" "0000180157" "STK11" "0000180158" "STK11" "0000180159" "STK11" "0000180160" "STK11" "0000180161" "STK11" "0000180162" "STK11" "0000180163" "STK11" "0000180164" "STK11" "0000180165" "STK11" "0000180166" "STK11" "0000180167" "STK11" "0000180168" "STK11" "0000180169" "STK11" "0000180170" "STK11" "0000180171" "STK11" "0000180172" "STK11" "0000180173" "STK11" "0000180174" "STK11" "0000180175" "STK11" "0000180176" "STK11" "0000180177" "STK11" "0000180178" "STK11" "0000180179" "STK11" "0000180180" "STK11" "0000180181" "STK11" "0000180182" "STK11" "0000180183" "STK11" "0000180184" "STK11" "0000180185" "STK11" "0000180186" "STK11" "0000180187" "STK11" "0000180188" "STK11" "0000180189" "STK11" "0000180190" "STK11" "0000180191" "STK11" "0000181817" "STK11" "0000181818" "STK11" "0000181819" "STK11" "0000181820" "STK11" "0000181821" "STK11" "0000182582" "STK11" "0000182583" "STK11" "0000182584" "STK11" "0000182585" "STK11" "0000183819" "STK11" "0000183820" "STK11" "0000183821" "STK11" "0000183822" "STK11" "0000183823" "STK11" "0000183824" "STK11" "0000183825" "STK11" "0000183826" "STK11" "0000183827" "STK11" "0000183828" "STK11" "0000183829" "STK11" "0000183830" "STK11" "0000183831" "STK11" "0000183832" "STK11" "0000183833" "STK11" "0000183834" "STK11" "0000183835" "STK11" "0000183836" "STK11" "0000183837" "STK11" "0000183838" "STK11" "0000183839" "STK11" "0000183840" "STK11" "0000183841" "STK11" "0000183842" "STK11" "0000183843" "STK11" "0000183844" "STK11" "0000183845" "STK11" "0000183846" "STK11" "0000183847" "STK11" "0000183848" "STK11" "0000183849" "STK11" "0000183850" "STK11" "0000183851" "STK11" "0000183852" "STK11" "0000183853" "STK11" "0000183854" "STK11" "0000183855" "STK11" "0000183856" "STK11" "0000183857" "STK11" "0000183858" "STK11" "0000183859" "STK11" "0000183860" "STK11" "0000183861" "STK11" "0000183862" "STK11" "0000183863" "STK11" "0000183864" "STK11" "0000183865" "STK11" "0000183866" "STK11" "0000183867" "STK11" "0000183868" "STK11" "0000183869" "STK11" "0000183870" "STK11" "0000184523" "STK11" "0000184524" "STK11" "0000184525" "STK11" "0000184526" "STK11" "0000184527" "STK11" "0000184528" "STK11" "0000184529" "STK11" "0000184530" "STK11" "0000184531" "STK11" "0000184532" "STK11" "0000184533" "STK11" "0000184534" "STK11" "0000184535" "STK11" "0000184536" "STK11" "0000184537" "STK11" "0000184538" "STK11" "0000184539" "STK11" "0000184540" "STK11" "0000184541" "STK11" "0000184542" "STK11" "0000184543" "STK11" "0000184544" "STK11" "0000184615" "STK11" "0000184616" "STK11" "0000184617" "STK11" "0000184618" "STK11" "0000184619" "STK11" "0000184620" "STK11" "0000184621" "STK11" "0000219146" "STK11" "0000290605" "STK11" "0000337568" "STK11" "0000337569" "STK11" "0000342919" "STK11" "0000342920" "STK11" "0000342921" "STK11" "0000342922" "STK11" "0000342923" "STK11" "0000342924" "STK11" "0000342925" "STK11" "0000342926" "STK11" "0000342927" "STK11" "0000342928" "STK11" "0000342929" "STK11" "0000342930" "STK11" "0000342931" "STK11" "0000342932" "STK11" "0000342933" "STK11" "0000342934" "STK11" "0000342935" "STK11" "0000342936" "STK11" "0000342937" "STK11" "0000342938" "STK11" "0000342939" "STK11" "0000342940" "STK11" "0000342941" "STK11" "0000342942" "STK11" "0000342943" "STK11" "0000342944" "STK11" "0000342945" "STK11" "0000342946" "STK11" "0000342947" "STK11" "0000342948" "STK11" "0000342949" "STK11" "0000342950" "STK11" "0000342951" "STK11" "0000342952" "STK11" "0000342953" "STK11" "0000342954" "STK11" "0000342955" "STK11" "0000342956" "STK11" "0000342957" "STK11" "0000342958" "STK11" "0000342959" "STK11" "0000342960" "STK11" "0000342961" "STK11" "0000342962" "STK11" "0000342963" "STK11" "0000342964" "STK11" "0000342965" "STK11" "0000342966" "STK11" "0000342967" "STK11" "0000342968" "STK11" "0000342969" "STK11" "0000342970" "STK11" "0000342971" "STK11" "0000342972" "STK11" "0000342973" "STK11" "0000342974" "STK11" "0000342975" "STK11" "0000342976" "STK11" "0000342977" "STK11" "0000342978" "STK11" "0000343145" "STK11" "0000343146" "STK11" "0000343147" "STK11" "0000350164" "STK11" "0000350165" "STK11" "0000350166" "STK11" "0000350167" "STK11" "0000350168" "STK11" "0000350169" "STK11" "0000350170" "STK11" "0000350171" "STK11" "0000350172" "STK11" "0000350173" "STK11" "0000350174" "STK11" "0000350175" "STK11" "0000350176" "STK11" "0000350177" "STK11" "0000350178" "STK11" "0000350179" "STK11" "0000350180" "STK11" "0000350181" "STK11" "0000350182" "STK11" "0000350183" "STK11" "0000350184" "STK11" "0000350185" "STK11" "0000350186" "STK11" "0000350187" "STK11" "0000350188" "STK11" "0000350189" "STK11" "0000350190" "STK11" "0000350191" "STK11" "0000350192" "STK11" "0000350193" "STK11" "0000350194" "STK11" "0000350195" "STK11" "0000350196" "STK11" "0000350197" "STK11" "0000350198" "STK11" "0000350199" "STK11" "0000350200" "STK11" "0000350201" "STK11" "0000350202" "STK11" "0000350203" "STK11" "0000350204" "STK11" "0000350205" "STK11" "0000350206" "STK11" "0000350207" "STK11" "0000350208" "STK11" "0000350209" "STK11" "0000350210" "STK11" "0000350211" "STK11" "0000350212" "STK11" "0000350213" "STK11" "0000350214" "STK11" "0000350215" "STK11" "0000350216" "STK11" "0000350217" "STK11" "0000355057" "STK11" "0000355058" "STK11" "0000355059" "STK11" "0000355060" "STK11" "0000355061" "STK11" "0000355062" "STK11" "0000355063" "STK11" "0000355064" "STK11" "0000355065" "STK11" "0000355066" "STK11" "0000355067" "STK11" "0000355068" "STK11" "0000355069" "STK11" "0000355070" "STK11" "0000355071" "STK11" "0000355072" "STK11" "0000355073" "STK11" "0000355074" "STK11" "0000355075" "STK11" "0000355076" "STK11" "0000355077" "STK11" "0000355078" "STK11" "0000355079" "STK11" "0000355080" "STK11" "0000355081" "STK11" "0000355082" "STK11" "0000355083" "STK11" "0000355084" "STK11" "0000355085" "STK11" "0000355086" "STK11" "0000355087" "STK11" "0000359833" "STK11" "0000359834" "STK11" "0000359835" "STK11" "0000359836" "STK11" "0000359837" "STK11" "0000359838" "STK11" "0000359839" "STK11" "0000359840" "STK11" "0000359841" "STK11" "0000359842" "STK11" "0000359843" "STK11" "0000359844" "STK11" "0000359845" "STK11" "0000359846" "STK11" "0000359847" "STK11" "0000359848" "STK11" "0000359849" "STK11" "0000359850" "STK11" "0000359851" "STK11" "0000359852" "STK11" "0000359853" "STK11" "0000359854" "STK11" "0000359855" "STK11" "0000359856" "STK11" "0000359857" "STK11" "0000359858" "STK11" "0000359859" "STK11" "0000359860" "STK11" "0000359861" "STK11" "0000359862" "STK11" "0000359863" "STK11" "0000394400" "STK11" "0000398183" "STK11" "0000417724" "STK11" "0000432991" "STK11" "0000436678" "STK11" "0000445221" "STK11" "0000445222" "STK11" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 666 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000021762" "0" "55" "19" "1220473" "1220473" "subst" "4.28064E-5" "00552" "STK11_000501" "g.1220473C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.1220474C>T" "" "VUS" "" "0000035714" "0" "75" "19" "1207063" "1207074" "del" "0" "00667" "STK11_000502" "g.1207063_1207074del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.1207064_1207075del" "" "likely pathogenic" "" "0000035715" "1" "75" "19" "1218415" "1218415" "subst" "0" "00667" "STK11_000503" "g.1218415G>A" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.1218416G>A" "" "likely pathogenic" "" "0000035716" "0" "75" "19" "1218434" "1218443" "del" "0" "00667" "STK11_000504" "g.1218434_1218443del" "" "" "" "308_317del" "" "Germline" "yes" "" "0" "" "" "g.1218435_1218444del" "" "likely pathogenic" "" "0000035717" "0" "75" "19" "1219350" "1219351" "dup" "0" "00667" "STK11_000505" "g.1219350_1219351dup" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.1219351_1219352dup" "" "likely pathogenic" "" "0000035718" "1" "75" "19" "1220718" "1220718" "subst" "0" "00667" "STK11_000506" "g.1220718T>C" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.1220719T>C" "" "likely pathogenic" "" "0000035719" "1" "75" "19" "1221260" "1221260" "subst" "0" "00667" "STK11_000507" "g.1221260C>G" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.1221261C>G" "" "likely pathogenic" "" "0000035720" "1" "75" "19" "1221267" "1221270" "dup" "0" "00667" "STK11_000508" "g.1221267_1221270dup" "" "" "" "787_790dup" "" "Germline" "yes" "" "0" "" "" "g.1221268_1221271dup" "" "likely pathogenic" "" "0000035721" "1" "75" "19" "1221311" "1221312" "del" "0" "00667" "STK11_000509" "g.1221311_1221312del" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.1221312_1221313del" "" "likely pathogenic" "" "0000035722" "1" "75" "19" "1221947" "1221947" "subst" "0" "00667" "STK11_000510" "g.1221947G>A" "" "" "" "" "Variant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message." "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic" "" "0000035723" "1" "75" "19" "1221951" "1221951" "subst" "0" "00667" "STK11_000511" "g.1221951T>G" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.1221952T>G" "" "likely pathogenic" "" "0000035724" "1" "75" "19" "1221976" "1221976" "subst" "0" "00667" "STK11_000512" "g.1221976G>C" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.1221977G>C" "" "likely pathogenic" "" "0000035725" "1" "75" "19" "1221977" "1221978" "ins" "0" "00667" "STK11_000513" "g.1221977_1221978insC" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.1221978_1221979insC" "" "likely pathogenic" "" "0000035726" "1" "75" "19" "1221992" "1222000" "del" "0" "00667" "STK11_000514" "g.1221992_1222000del" "" "" "" "898_906del" "" "Germline" "yes" "" "0" "" "" "g.1221993_1222001del" "" "likely pathogenic" "" "0000035727" "0" "75" "19" "1221989" "1221989" "subst" "0" "00667" "STK11_000515" "g.1221989C>T" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.1221990C>T" "" "likely pathogenic" "" "0000064392" "1" "90" "19" "1220505" "1220505" "subst" "0" "01164" "STK11_000519" "g.1220505G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.1220506G>A" "" "pathogenic" "" "0000064393" "1" "90" "19" "1220415" "1220415" "subst" "0" "01164" "STK11_000518" "g.1220415C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.1220416C>T" "" "pathogenic" "" "0000064394" "1" "50" "19" "1226555" "1226555" "subst" "0.000428305" "01164" "STK11_000517" "g.1226555C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.1226556C>T" "" "VUS" "" "0000064395" "1" "90" "19" "1221994" "1221994" "subst" "0" "01164" "STK11_000516" "g.1221994C>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.1221995C>G" "" "pathogenic" "" "0000064396" "1" "90" "19" "1221954" "1221954" "subst" "0" "01164" "STK11_000521" "g.1221954T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.1221955T>C" "" "pathogenic" "" "0000064397" "1" "90" "19" "1220644" "1220644" "subst" "0" "01164" "STK11_000520" "g.1220644C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.1220645C>T" "" "pathogenic" "" "0000064398" "1" "90" "19" "1221992" "1222000" "del" "0" "01164" "STK11_000514" "g.1221992_1222000del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.1221993_1222001del" "" "pathogenic" "" "0000149061" "1" "50" "19" "1206943" "1206943" "subst" "4.4603E-6" "01816" "STK11_000536" "g.1206943A>G" "" "Thibodeau lab (Mayo Clinic)" "" "" "" "Germline" "" "" "0" "" "" "g.1206944A>G" "" "VUS" "" "0000149062" "1" "50" "19" "1220466" "1220466" "subst" "0" "01816" "STK11_000534" "g.1220466G>A" "" "Thibodeau lab (Mayo Clinic)" "" "" "" "Germline" "" "" "0" "" "" "g.1220467G>A" "" "VUS" "" "0000149063" "1" "50" "19" "1220595" "1220595" "subst" "0" "01816" "STK11_000535" "g.1220595G>A" "" "Thibodeau lab (Mayo Clinic)" "" "" "" "Germline" "" "" "0" "" "" "g.1220596G>A" "" "VUS" "" "0000149064" "1" "50" "19" "1221979" "1221979" "subst" "0.000188612" "01816" "STK11_000526" "g.1221979C>A" "" "Thibodeau lab (Mayo Clinic)" "" "" "" "Germline" "" "" "0" "" "" "g.1221980C>A" "" "VUS" "" "0000149065" "1" "50" "19" "1223125" "1223125" "subst" "0.00514848" "01816" "STK11_000527" "g.1223125C>G" "" "Thibodeau lab (Mayo Clinic)" "" "" "" "Germline" "" "" "0" "" "" "g.1223126C>G" "" "VUS" "" "0000149066" "1" "50" "19" "1223125" "1223125" "subst" "0.00514848" "01816" "STK11_000527" "g.1223125C>G" "" "Thibodeau lab (Mayo Clinic)" "" "" "" "Germline" "" "" "0" "" "" "g.1223126C>G" "" "VUS" "" "0000149067" "1" "30" "19" "1226555" "1226555" "subst" "0.000428305" "01816" "STK11_000517" "g.1226555C>T" "" "Thibodeau lab (Mayo Clinic)" "" "" "" "Germline" "" "" "0" "" "" "g.1226556C>T" "" "likely benign" "" "0000149068" "1" "50" "19" "1226602" "1226602" "subst" "0" "01816" "STK11_000528" "g.1226602G>T" "" "Thibodeau lab (Mayo Clinic)" "" "" "" "Germline" "" "" "0" "" "" "g.1226603G>T" "" "VUS" "" "0000149069" "1" "50" "19" "1226628" "1226628" "subst" "8.09562E-5" "01816" "STK11_000529" "g.1226628G>A" "" "Thibodeau lab (Mayo Clinic)" "" "" "" "Germline" "" "" "0" "" "" "g.1226629G>A" "" "VUS" "" "0000149070" "1" "50" "19" "1226640" "1226640" "subst" "0.000165898" "01816" "STK11_000530" "g.1226640G>A" "" "Thibodeau lab (Mayo Clinic)" "" "" "" "Germline" "" "" "0" "" "" "g.1226641G>A" "" "VUS" "" "0000149071" "1" "50" "19" "1227645" "1227645" "subst" "0" "01816" "STK11_000531" "g.1227645C>G" "" "Thibodeau lab (Mayo Clinic)" "" "" "" "Germline" "" "" "0" "" "" "g.1227646C>G" "" "VUS" "" "0000149072" "1" "50" "19" "1227747" "1227747" "subst" "0" "01816" "STK11_000532" "g.1227747G>A" "" "Thibodeau lab (Mayo Clinic)" "" "" "" "Germline" "" "" "0" "" "" "g.1227748G>A" "" "VUS" "" "0000149073" "1" "50" "19" "1227759" "1227759" "subst" "0" "01816" "STK11_000533" "g.1227759G>A" "" "Thibodeau lab (Mayo Clinic)" "" "" "" "Germline" "" "" "0" "" "" "g.1227760G>A" "" "VUS" "" "0000149074" "1" "50" "19" "1227777" "1227777" "subst" "0" "01816" "STK11_000523" "g.1227777C>G" "" "Thibodeau lab (Mayo Clinic)" "" "" "" "Germline" "" "" "0" "" "" "g.1227778C>G" "" "VUS" "" "0000149075" "1" "50" "19" "1227923" "1227923" "subst" "0" "01816" "STK11_000524" "g.1227923C>G" "" "Thibodeau lab (Mayo Clinic)" "" "" "" "Germline" "" "" "0" "" "" "g.1227924C>G" "" "VUS" "" "0000149076" "1" "50" "19" "1227933" "1227933" "subst" "0" "01816" "STK11_000525" "g.1227933G>C" "" "Thibodeau lab (Mayo Clinic)" "" "" "" "Germline" "" "" "0" "" "" "g.1227934G>C" "" "VUS" "" "0000149077" "1" "50" "19" "1228069" "1228069" "subst" "0" "01816" "C19orf26_000001" "g.1228069T>A" "" "Thibodeau lab (Mayo Clinic)" "" "" "" "Germline" "" "" "0" "" "" "g.1228070T>A" "" "VUS" "" "0000149167" "3" "50" "19" "1223125" "1223125" "subst" "0.00514848" "01816" "STK11_000527" "g.1223125C>G" "" "Thibodeau lab (Mayo Clinic)" "" "" "" "Germline" "" "" "0" "" "" "g.1223126C>G" "" "VUS" "" "0000163908" "0" "90" "19" "1220698" "1220698" "subst" "0" "01741" "STK11_000522" "g.1220698G>A" "" "" "" "" "" "De novo" "" "" "0" "" "" "g.1220699G>A" "" "pathogenic" "" "0000247612" "0" "30" "19" "1226529" "1226529" "subst" "0.000481542" "02330" "STK11_000583" "g.1226529A>G" "" "" "" "STK11(NM_000455.4):c.1185A>G (p.(Thr395=)), STK11(NM_000455.5):c.1185A>G (p.T395=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1226530A>G" "" "likely benign" "" "0000247621" "0" "30" "19" "1220518" "1220518" "del" "0.000593411" "02330" "STK11_000554" "g.1220518del" "" "" "" "STK11(NM_000455.5):c.597+14delA" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1220519del" "" "likely benign" "" "0000249726" "0" "50" "19" "1226471" "1226471" "subst" "1.66995E-5" "02325" "STK11_000581" "g.1226471A>C" "" "" "" "STK11(NM_000455.5):c.1127A>C (p.E376A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1226472A>C" "" "VUS" "" "0000255461" "0" "90" "19" "1220694" "1220694" "subst" "0" "01943" "STK11_000561" "g.1220694A>T" "" "" "" "STK11(NM_000455.4):c.712A>T (p.I238F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1220695A>T" "" "pathogenic" "" "0000255469" "0" "90" "19" "1218495" "1218495" "subst" "0" "01943" "STK11_000544" "g.1218495A>T" "" "" "" "STK11(NM_000455.4):c.370A>T (p.K124*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1218496A>T" "" "pathogenic" "" "0000255550" "0" "90" "19" "1218451" "1218451" "del" "0" "01943" "STK11_000592" "g.1218451del" "" "" "" "STK11(NM_000455.4):c.326delA (p.N109Mfs*20)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1218452del" "" "pathogenic" "" "0000255768" "0" "90" "19" "1218414" "1218414" "subst" "0" "01943" "STK11_000542" "g.1218414A>G" "" "" "" "STK11(NM_000455.4):c.291-2A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1218415A>G" "" "pathogenic" "" "0000255769" "0" "90" "19" "1220370" "1220370" "subst" "0" "01943" "STK11_000595" "g.1220370A>T" "" "" "" "STK11(NM_000455.4):c.465-2A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1220371A>T" "" "pathogenic" "" "0000256551" "0" "50" "19" "1207006" "1207006" "subst" "4.08247E-6" "01943" "STK11_000537" "g.1207006A>G" "" "" "" "STK11(NM_000455.4):c.94A>G (p.T32A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1207007A>G" "" "VUS" "" "0000308859" "0" "10" "19" "1223125" "1223125" "subst" "0.00514848" "02330" "STK11_000527" "g.1223125C>G" "" "" "" "STK11(NM_000455.4):c.1062C>G (p.F354L, p.(Phe354Leu)), STK11(NM_000455.5):c.1062C>G (p.F354L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1223126C>G" "" "benign" "" "0000308860" "0" "30" "19" "1226640" "1226640" "subst" "0.000165898" "02330" "STK11_000530" "g.1226640G>A" "" "" "" "STK11(NM_000455.5):c.1296G>A (p.Q432=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1226641G>A" "" "likely benign" "" "0000308861" "0" "10" "19" "1207176" "1207176" "subst" "0.00563163" "02330" "STK11_000540" "g.1207176C>A" "" "" "" "STK11(NM_000455.4):c.264C>A (p.(Ile88=)), STK11(NM_000455.5):c.264C>A (p.I88=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1207177C>A" "" "benign" "" "0000308862" "0" "30" "19" "1219396" "1219396" "subst" "0" "02330" "STK11_000547" "g.1219396G>A" "" "" "" "STK11(NM_000455.5):c.448G>A (p.V150M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1219397G>A" "" "likely benign" "" "0000308863" "0" "30" "19" "1220573" "1220573" "subst" "7.25449E-5" "02330" "STK11_000555" "g.1220573G>A" "" "" "" "STK11(NM_000455.4):c.598-7G>A, STK11(NM_000455.5):c.598-7G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1220574G>A" "" "likely benign" "" "0000308864" "0" "30" "19" "1220599" "1220599" "subst" "0" "02330" "STK11_000557" "g.1220599C>T" "" "" "" "STK11(NM_000455.5):c.617C>T (p.A206V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1220600C>T" "" "likely benign" "" "0000308865" "0" "10" "19" "1220648" "1220648" "subst" "0.000600926" "02330" "STK11_000560" "g.1220648C>T" "" "" "" "STK11(NM_000455.5):c.666C>T (p.P222=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1220649C>T" "" "benign" "" "0000308866" "0" "10" "19" "1221293" "1221293" "subst" "0.00584503" "02330" "STK11_000567" "g.1221293C>T" "" "" "" "STK11(NM_000455.4):c.816C>T (p.(Tyr272=)), STK11(NM_000455.5):c.816C>T (p.Y272=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1221294C>T" "" "benign" "" "0000308867" "0" "10" "19" "1222012" "1222012" "subst" "0.186351" "02330" "STK11_000574" "g.1222012G>C" "" "" "" "STK11(NM_000455.4):c.920+7G>C, STK11(NM_000455.5):c.920+7G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1222013G>C" "" "benign" "" "0000311582" "0" "10" "19" "1223125" "1223125" "subst" "0.00514848" "02325" "STK11_000527" "g.1223125C>G" "" "" "" "STK11(NM_000455.4):c.1062C>G (p.F354L, p.(Phe354Leu)), STK11(NM_000455.5):c.1062C>G (p.F354L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1223126C>G" "" "benign" "" "0000311583" "0" "30" "19" "1226450" "1226450" "subst" "0" "02325" "STK11_000580" "g.1226450C>T" "" "" "" "STK11(NM_000455.5):c.1109-3C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1226451C>T" "" "likely benign" "" "0000311584" "0" "30" "19" "1226498" "1226498" "subst" "0" "02325" "STK11_000582" "g.1226498G>C" "" "" "" "STK11(NM_000455.5):c.1154G>C (p.G385A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1226499G>C" "" "likely benign" "" "0000311585" "0" "30" "19" "1226544" "1226544" "subst" "4.49188E-5" "02325" "STK11_000584" "g.1226544G>A" "" "" "" "STK11(NM_000455.5):c.1200G>A (p.L400=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1226545G>A" "" "likely benign" "" "0000311586" "0" "30" "19" "1226640" "1226640" "subst" "0.000165898" "02325" "STK11_000530" "g.1226640G>A" "" "" "" "STK11(NM_000455.5):c.1296G>A (p.Q432=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1226641G>A" "" "likely benign" "" "0000311587" "0" "30" "19" "1219315" "1219315" "subst" "0" "02325" "STK11_000546" "g.1219315C>T" "" "" "" "STK11(NM_000455.5):c.375-8C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1219316C>T" "" "likely benign" "" "0000311588" "0" "90" "19" "1220505" "1220505" "subst" "0" "02325" "STK11_000553" "g.1220505G>T" "" "" "" "STK11(NM_000455.5):c.597+1G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1220506G>T" "" "pathogenic" "" "0000311589" "0" "30" "19" "1221264" "1221264" "subst" "0.000171441" "02325" "STK11_000566" "g.1221264T>C" "" "" "" "STK11(NM_000455.4):c.787T>C (p.(Leu263=), p.L263=), STK11(NM_000455.5):c.787T>C (p.L263=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1221265T>C" "" "likely benign" "" "0000311590" "0" "10" "19" "1222012" "1222012" "subst" "0.186351" "02325" "STK11_000574" "g.1222012G>C" "" "" "" "STK11(NM_000455.4):c.920+7G>C, STK11(NM_000455.5):c.920+7G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1222013G>C" "" "benign" "" "0000311591" "0" "30" "19" "1223008" "1223008" "subst" "0.000747089" "02325" "STK11_000578" "g.1223008G>A" "" "" "" "STK11(NM_000455.4):c.945G>A (p.(Pro315=)), STK11(NM_000455.5):c.945G>A (p.P315=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1223009G>A" "" "likely benign" "" "0000313198" "0" "10" "19" "1226672" "1226672" "subst" "0.00042199" "02329" "STK11_000586" "g.1226672G>A" "" "" "" "STK11(NM_000455.4):c.*16+10G>A (p.(=)), STK11(NM_000455.5):c.*16+10G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1226673G>A" "" "benign" "" "0000313199" "0" "10" "19" "1223125" "1223125" "subst" "0.00514848" "02329" "STK11_000527" "g.1223125C>G" "" "" "" "STK11(NM_000455.4):c.1062C>G (p.F354L, p.(Phe354Leu)), STK11(NM_000455.5):c.1062C>G (p.F354L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1223126C>G" "" "benign" "" "0000313200" "0" "10" "19" "1207176" "1207176" "subst" "0.00563163" "02329" "STK11_000540" "g.1207176C>A" "" "" "" "STK11(NM_000455.4):c.264C>A (p.(Ile88=)), STK11(NM_000455.5):c.264C>A (p.I88=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1207177C>A" "" "benign" "" "0000313201" "0" "30" "19" "1220379" "1220379" "subst" "0" "02329" "STK11_000550" "g.1220379T>C" "" "" "" "STK11(NM_000455.5):c.472T>C (p.C158R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1220380T>C" "" "likely benign" "" "0000313202" "0" "30" "19" "1221236" "1221236" "subst" "0" "02329" "STK11_000565" "g.1221236C>T" "" "" "" "STK11(NM_000455.5):c.759C>T (p.Y253=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1221237C>T" "" "likely benign" "" "0000313203" "0" "30" "19" "1221293" "1221293" "subst" "0.00584503" "02329" "STK11_000567" "g.1221293C>T" "" "" "" "STK11(NM_000455.4):c.816C>T (p.(Tyr272=)), STK11(NM_000455.5):c.816C>T (p.Y272=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1221294C>T" "" "likely benign" "" "0000313204" "0" "30" "19" "1221319" "1221319" "subst" "0.000138225" "02329" "STK11_000569" "g.1221319C>T" "" "" "" "STK11(NM_000455.5):c.842C>T (p.P281L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1221320C>T" "" "likely benign" "" "0000315830" "0" "10" "19" "1223125" "1223125" "subst" "0.00514848" "01943" "STK11_000527" "g.1223125C>G" "" "" "" "STK11(NM_000455.4):c.1062C>G (p.F354L, p.(Phe354Leu)), STK11(NM_000455.5):c.1062C>G (p.F354L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1223126C>G" "" "benign" "" "0000315831" "0" "10" "19" "1226628" "1226628" "subst" "3.67983E-5" "01943" "STK11_000585" "g.1226628G>C" "" "" "" "STK11(NM_000455.4):c.1284G>C (p.S428=), STK11(NM_000455.5):c.1284G>C (p.S428=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1226629G>C" "" "benign" "" "0000315832" "0" "90" "19" "1207068" "1207069" "dup" "0" "01943" "STK11_000538" "g.1207068_1207069dup" "" "" "" "STK11(NM_000455.4):c.156_157dupGG (p.D53Gfs*12)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1207069_1207070dup" "" "pathogenic" "" "0000315833" "0" "90" "19" "1207077" "1207087" "del" "0" "01943" "STK11_000539" "g.1207077_1207087del" "" "" "" "STK11(NM_000455.4):c.165_175delGGGGGAAGGCT (p.G56Lfs*103)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1207078_1207088del" "" "pathogenic" "" "0000315834" "0" "90" "19" "1207203" "1207203" "subst" "0" "01943" "STK11_000541" "g.1207203G>C" "" "" "" "STK11(NM_000455.4):c.290+1G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1207204G>C" "" "pathogenic" "" "0000315835" "0" "90" "19" "1218423" "1218423" "subst" "0" "01943" "STK11_000543" "g.1218423C>T" "" "" "" "STK11(NM_000455.4):c.298C>T (p.Q100*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1218424C>T" "" "pathogenic" "" "0000315836" "0" "10" "19" "1218523" "1218523" "subst" "0.160922" "01943" "STK11_000545" "g.1218523G>T" "" "" "" "STK11(NM_000455.4):c.374+24G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1218524G>T" "" "benign" "" "0000315837" "0" "90" "19" "1219413" "1219413" "dup" "0" "01943" "STK11_000548" "g.1219413dup" "" "" "" "STK11(NM_000455.4):c.464_464+1insG" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1219414dup" "" "pathogenic" "" "0000315838" "0" "90" "19" "1220375" "1220375" "subst" "0" "01943" "STK11_000549" "g.1220375C>G" "" "" "" "STK11(NM_000455.4):c.468C>G (p.Y156*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1220376C>G" "" "pathogenic" "" "0000315839" "0" "90" "19" "1220487" "1220487" "subst" "0" "01943" "STK11_000551" "g.1220487G>A" "" "" "" "STK11(NM_000455.4):c.580G>A (p.D194N), STK11(NM_000455.5):c.580G>A (p.D194N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1220488G>A" "" "pathogenic" "" "0000315840" "0" "70" "19" "1220489" "1220489" "subst" "0" "01943" "STK11_000552" "g.1220489C>A" "" "" "" "STK11(NM_000455.4):c.582C>A (p.D194E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1220490C>A" "" "likely pathogenic" "" "0000315842" "0" "90" "19" "1206976" "1206985" "del" "0" "01943" "STK11_000591" "g.1206976_1206985del" "" "" "" "STK11(NM_000455.4):c.64_73delATGGACACGT (p.M22Sfs*26)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1206977_1206986del" "" "pathogenic" "" "0000315843" "0" "90" "19" "1220632" "1220632" "del" "0" "01943" "STK11_000558" "g.1220632del" "" "" "" "STK11(NM_000455.4):c.650delC (p.P217Rfs*70)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1220633del" "" "pathogenic" "" "0000315844" "0" "90" "19" "1220707" "1220707" "subst" "0" "01943" "STK11_000562" "g.1220707G>T" "" "" "" "STK11(NM_000455.4):c.725G>T (p.G242V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1220708G>T" "" "pathogenic" "" "0000315845" "0" "90" "19" "1220709" "1220709" "del" "0" "01943" "STK11_000563" "g.1220709del" "" "" "" "STK11(NM_000455.4):c.727delG (p.V243Sfs*44)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1220710del" "" "pathogenic" "" "0000315846" "0" "90" "19" "1220721" "1220721" "subst" "0" "01943" "STK11_000564" "g.1220721G>A" "" "" "" "STK11(NM_000455.4):c.734+5G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1220722G>A" "" "pathogenic" "" "0000315847" "0" "90" "19" "1221316" "1221333" "delins" "0" "01943" "STK11_000568" "g.1221316_1221333delinsGGGA" "" "" "" "STK11(NM_000455.4):c.839_861delCCCCGCTCTCTGACCTGCTGAAAinsGGGATGAAA (p.P280Rfs*7)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1221317_1221334delinsGGGA" "" "pathogenic" "" "0000315848" "0" "90" "19" "1221341" "1221341" "subst" "0" "01943" "STK11_000570" "g.1221341T>C" "" "" "" "STK11(NM_000455.4):c.862+2T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1221342T>C" "" "pathogenic" "" "0000315849" "0" "90" "19" "1221993" "1221993" "subst" "0" "01943" "STK11_000571" "g.1221993T>A" "" "" "" "STK11(NM_000455.4):c.908T>A (p.I303N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1221994T>A" "" "pathogenic" "" "0000315850" "0" "90" "19" "1221995" "1221995" "subst" "0" "01943" "STK11_000572" "g.1221995C>T" "" "" "" "STK11(NM_000455.4):c.910C>T (p.R304W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1221996C>T" "" "pathogenic" "" "0000315851" "0" "90" "19" "1221995" "1221995" "del" "0" "01943" "STK11_000573" "g.1221995del" "" "" "" "STK11(NM_000455.4):c.910delC (p.R304Gfs*32)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1221996del" "" "pathogenic" "" "0000315852" "0" "10" "19" "1222012" "1222012" "subst" "0.186351" "01943" "STK11_000574" "g.1222012G>C" "" "" "" "STK11(NM_000455.4):c.920+7G>C, STK11(NM_000455.5):c.920+7G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1222013G>C" "" "benign" "" "0000315853" "0" "90" "19" "1222972" "1222972" "subst" "0" "01943" "STK11_000575" "g.1222972G>A" "" "" "" "STK11(NM_000455.4):c.921-12G>A, STK11(NM_000455.5):c.921-12G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1222973G>A" "" "pathogenic" "" "0000315854" "0" "90" "19" "1222983" "1222983" "subst" "0" "01943" "STK11_000576" "g.1222983G>C" "" "" "" "STK11(NM_000455.4):c.921-1G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1222984G>C" "" "pathogenic" "" "0000315855" "0" "90" "19" "1222986" "1222986" "subst" "0" "01943" "STK11_000577" "g.1222986G>A" "" "" "" "STK11(NM_000455.4):c.923G>A (p.W308*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1222987G>A" "" "pathogenic" "" "0000315856" "0" "90" "19" "1223054" "1223054" "dup" "0" "01943" "STK11_000579" "g.1223054dup" "" "" "" "STK11(NM_000455.4):c.991dupC (p.R331Pfs*29)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1223055dup" "" "pathogenic" "" "0000337054" "0" "30" "19" "1219421" "1219421" "subst" "0.000571257" "02327" "STK11_000593" "g.1219421G>A" "" "" "" "STK11(NM_000455.5):c.464+9G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1219422G>A" "" "likely benign" "" "0000337058" "0" "30" "19" "1220513" "1220513" "subst" "0" "02327" "STK11_000596" "g.1220513G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1220514G>A" "" "likely benign" "" "0000337059" "0" "90" "19" "1220578" "1220578" "subst" "0" "02327" "STK11_000597" "g.1220578A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1220579A>G" "" "pathogenic" "" "0000337060" "0" "90" "19" "1220578" "1220578" "subst" "0" "02327" "STK11_000598" "g.1220578A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1220579A>C" "" "pathogenic" "" "0000337061" "0" "90" "19" "1221211" "1221211" "subst" "0" "02327" "STK11_000589" "g.1221211G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1221212G>A" "" "pathogenic" "" "0000337062" "0" "10" "19" "1222012" "1222012" "subst" "0.186351" "02327" "STK11_000574" "g.1222012G>C" "" "" "" "STK11(NM_000455.4):c.920+7G>C, STK11(NM_000455.5):c.920+7G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1222013G>C" "" "benign" "" "0000337064" "0" "90" "19" "1222972" "1222972" "subst" "0" "02327" "STK11_000575" "g.1222972G>A" "" "" "" "STK11(NM_000455.4):c.921-12G>A, STK11(NM_000455.5):c.921-12G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1222973G>A" "" "pathogenic" "" "0000337065" "0" "30" "19" "1226450" "1226450" "subst" "0" "02327" "STK11_000580" "g.1226450C>T" "" "" "" "STK11(NM_000455.5):c.1109-3C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1226451C>T" "" "likely benign" "" "0000339329" "0" "10" "19" "1207176" "1207176" "subst" "0.00563163" "02327" "STK11_000540" "g.1207176C>A" "" "" "" "STK11(NM_000455.4):c.264C>A (p.(Ile88=)), STK11(NM_000455.5):c.264C>A (p.I88=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1207177C>A" "" "benign" "" "0000342587" "0" "90" "19" "1221995" "1221995" "subst" "0" "02327" "STK11_000572" "g.1221995C>T" "" "" "" "STK11(NM_000455.4):c.910C>T (p.R304W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1221996C>T" "" "pathogenic" "" "0000347078" "0" "90" "19" "1221954" "1221954" "subst" "0" "02327" "STK11_000521" "g.1221954T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1221955T>C" "" "pathogenic" "" "0000348992" "0" "10" "19" "1226555" "1226555" "subst" "0.000428305" "02327" "STK11_000517" "g.1226555C>T" "" "" "" "STK11(NM_000455.5):c.1211C>T (p.S404F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.1226556C>T" "" "benign" "" "0000403558" "1" "50" "19" "1206951" "1206951" "subst" "0" "01714" "STK11_000600" "g.1206951G>C" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer" "Germline" "" "" "0" "" "" "g.1206952G>C" "" "VUS" "" "0000403559" "1" "50" "19" "1206977" "1206977" "subst" "0" "01714" "STK11_000601" "g.1206977T>C" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 11241 controls" "Germline" "" "" "0" "" "" "g.1206978T>C" "" "VUS" "" "0000403560" "1" "10" "19" "1207008" "1207008" "subst" "0.000310184" "01714" "STK11_000603" "g.1207008C>G" "172/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs79175212" "0" "" "" "g.1207009C>G" "" "benign" "" "0000403561" "1" "10" "19" "1207008" "1207008" "subst" "0.000310184" "01714" "STK11_000603" "g.1207008C>G" "261/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs79175212" "0" "" "" "g.1207009C>G" "" "benign" "" "0000403562" "1" "50" "19" "1207031" "1207031" "subst" "0" "01714" "STK11_000605" "g.1207031G>A" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 11241 controls" "Germline" "" "" "0" "" "" "g.1207032G>A" "" "VUS" "" "0000403563" "1" "50" "19" "1207032" "1207032" "subst" "0" "01714" "STK11_000606" "g.1207032C>A" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 11241 controls" "Germline" "" "" "0" "" "" "g.1207033C>A" "" "VUS" "" "0000403564" "1" "50" "19" "1207037" "1207037" "subst" "5.70204E-5" "01714" "STK11_000607" "g.1207037G>T" "6/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs148830698" "0" "" "" "g.1207038G>T" "" "VUS" "" "0000403565" "1" "50" "19" "1207037" "1207037" "subst" "5.70204E-5" "01714" "STK11_000607" "g.1207037G>T" "3/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs148830698" "0" "" "" "g.1207038G>T" "" "VUS" "" "0000403566" "1" "50" "19" "1207063" "1207063" "subst" "0" "01714" "STK11_000610" "g.1207063A>C" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer" "Germline" "" "rs730881986" "0" "" "" "g.1207064A>C" "" "VUS" "" "0000403567" "1" "50" "19" "1207086" "1207086" "subst" "4.07242E-6" "01714" "STK11_000612" "g.1207086C>T" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 11241 controls" "Germline" "" "rs756661578" "0" "" "" "g.1207087C>T" "" "VUS" "" "0000403568" "1" "50" "19" "1207155" "1207155" "subst" "8.29511E-6" "01714" "STK11_000615" "g.1207155G>A" "2/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.1207156G>A" "" "VUS" "" "0000403569" "1" "50" "19" "1207155" "1207155" "subst" "8.29511E-6" "01714" "STK11_000615" "g.1207155G>A" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.1207156G>A" "" "VUS" "" "0000403570" "1" "50" "19" "1207161" "1207161" "subst" "4.18337E-6" "01714" "STK11_000616" "g.1207161G>A" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 11241 controls" "Germline" "" "" "0" "" "" "g.1207162G>A" "" "VUS" "" "0000403571" "1" "50" "19" "1207176" "1207176" "subst" "2.56761E-5" "01714" "STK11_000617" "g.1207176C>T" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 11241 controls" "Germline" "" "rs56354945" "0" "" "" "g.1207177C>T" "" "VUS" "" "0000403572" "1" "50" "19" "1218465" "1218465" "subst" "4.06174E-6" "01714" "STK11_000619" "g.1218465G>A" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 11241 controls" "Germline" "" "" "0" "" "" "g.1218466G>A" "" "VUS" "" "0000403573" "1" "50" "19" "1218477" "1218477" "subst" "0" "01714" "STK11_000620" "g.1218477T>C" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer" "Germline" "" "" "0" "" "" "g.1218478T>C" "" "VUS" "" "0000403574" "1" "50" "19" "1218482" "1218482" "subst" "8.12506E-5" "01714" "STK11_000621" "g.1218482C>T" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer" "Germline" "" "rs372511774" "0" "" "" "g.1218483C>T" "" "VUS" "" "0000403575" "1" "50" "19" "1219347" "1219347" "subst" "0" "01714" "STK11_000622" "g.1219347G>T" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer" "Germline" "" "rs757021648" "0" "" "" "g.1219348G>T" "" "VUS" "" "0000403576" "3" "10" "19" "1219380" "1219380" "subst" "0" "01714" "STK11_000623" "g.1219380G>A" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 11241 controls" "Germline" "" "rs376788924" "0" "" "" "g.1219381G>A" "" "benign" "" "0000403577" "1" "10" "19" "1219407" "1219407" "subst" "0" "01714" "STK11_000624" "g.1219407C>T" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 11241 controls" "Germline" "" "" "0" "" "" "g.1219408C>T" "" "benign" "" "0000403578" "1" "50" "19" "1220393" "1220393" "subst" "0" "01714" "STK11_000625" "g.1220393C>T" "4/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.1220394C>T" "" "VUS" "" "0000403579" "1" "50" "19" "1220393" "1220393" "subst" "0" "01714" "STK11_000625" "g.1220393C>T" "8/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.1220394C>T" "" "VUS" "" "0000403580" "1" "50" "19" "1220429" "1220429" "subst" "0" "01714" "STK11_000627" "g.1220429C>T" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 11241 controls" "Germline" "" "" "0" "" "" "g.1220430C>T" "" "VUS" "" "0000403581" "1" "50" "19" "1220466" "1220466" "subst" "0" "01714" "STK11_000534" "g.1220466G>A" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs587782032" "0" "" "" "g.1220467G>A" "" "VUS" "" "0000403582" "1" "50" "19" "1220466" "1220466" "subst" "0" "01714" "STK11_000534" "g.1220466G>A" "2/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs587782032" "0" "" "" "g.1220467G>A" "" "VUS" "" "0000403583" "1" "50" "19" "1220473" "1220473" "subst" "4.28064E-5" "01714" "STK11_000501" "g.1220473C>T" "5/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs587781515" "0" "" "" "g.1220474C>T" "" "VUS" "" "0000403584" "1" "50" "19" "1220473" "1220473" "subst" "4.28064E-5" "01714" "STK11_000501" "g.1220473C>T" "4/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs587781515" "0" "" "" "g.1220474C>T" "" "VUS" "" "0000403585" "1" "50" "19" "1220483" "1220483" "subst" "0" "01714" "STK11_000628" "g.1220483C>G" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 11241 controls" "Germline" "" "" "0" "" "" "g.1220484C>G" "" "VUS" "" "0000403586" "1" "50" "19" "1220582" "1220582" "subst" "0" "01714" "STK11_000629" "g.1220582A>G" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer" "Germline" "" "" "0" "" "" "g.1220583A>G" "" "VUS" "" "0000403587" "1" "50" "19" "1220588" "1220588" "subst" "0" "01714" "STK11_000630" "g.1220588C>G" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer" "Germline" "" "" "0" "" "" "g.1220589C>G" "" "VUS" "" "0000403588" "1" "50" "19" "1220590" "1220590" "subst" "2.48952E-5" "01714" "STK11_000631" "g.1220590C>T" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer" "Germline" "" "rs587782379" "0" "" "" "g.1220591C>T" "" "VUS" "" "0000403589" "1" "50" "19" "1220597" "1220597" "subst" "2.8957E-5" "01714" "STK11_000632" "g.1220597G>A" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 11241 controls" "Germline" "" "rs532889728" "0" "" "" "g.1220598G>A" "" "VUS" "" "0000403590" "1" "50" "19" "1220599" "1220599" "subst" "0" "01714" "STK11_000557" "g.1220599C>T" "2/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer" "Germline" "" "rs764244639" "0" "" "" "g.1220600C>T" "" "VUS" "" "0000403591" "1" "10" "19" "1220603" "1220603" "subst" "0" "01714" "STK11_000633" "g.1220603C>T" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer" "Germline" "" "rs569380138" "0" "" "" "g.1220604C>T" "" "benign" "" "0000403592" "1" "10" "19" "1220612" "1220612" "subst" "0" "01714" "STK11_000634" "g.1220612C>T" "3/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer" "Germline" "" "rs786201213" "0" "" "" "g.1220613C>T" "" "benign" "" "0000403593" "1" "10" "19" "1220645" "1220645" "subst" "0" "01714" "STK11_000635" "g.1220645G>A" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs587780720" "0" "" "" "g.1220646G>A" "" "benign" "" "0000403594" "1" "10" "19" "1220645" "1220645" "subst" "0" "01714" "STK11_000635" "g.1220645G>A" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs587780720" "0" "" "" "g.1220646G>A" "" "benign" "" "0000403595" "1" "50" "19" "1220670" "1220670" "subst" "0" "01714" "STK11_000636" "g.1220670A>G" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer" "Germline" "" "" "0" "" "" "g.1220671A>G" "" "VUS" "" "0000403596" "1" "10" "19" "1220702" "1220702" "subst" "1.67372E-5" "01714" "STK11_000639" "g.1220702G>A" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 11241 controls" "Germline" "" "rs759743897" "0" "" "" "g.1220703G>A" "" "benign" "" "0000403597" "1" "50" "19" "1220703" "1220703" "subst" "2.92845E-5" "01714" "STK11_000640" "g.1220703G>T" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer" "Germline" "" "rs587780721" "0" "" "" "g.1220704G>T" "" "VUS" "" "0000403598" "1" "10" "19" "1220705" "1220705" "subst" "0.000175709" "01714" "STK11_000641" "g.1220705T>C" "9/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs533550278" "0" "" "" "g.1220706T>C" "" "benign" "" "0000403599" "1" "10" "19" "1220705" "1220705" "subst" "0.000175709" "01714" "STK11_000641" "g.1220705T>C" "19/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs533550278" "0" "" "" "g.1220706T>C" "" "benign" "" "0000403600" "1" "50" "19" "1221218" "1221218" "subst" "1.2224E-5" "01714" "STK11_000643" "g.1221218C>T" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer" "Germline" "" "rs754761142" "0" "" "" "g.1221219C>T" "" "VUS" "" "0000403601" "1" "50" "19" "1221226" "1221226" "subst" "0" "01714" "STK11_000644" "g.1221226C>T" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer" "Germline" "" "" "0" "" "" "g.1221227C>T" "" "VUS" "" "0000403602" "1" "50" "19" "1221278" "1221278" "subst" "0" "01714" "STK11_000646" "g.1221278C>T" "3/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer" "Germline" "" "rs539772540" "0" "" "" "g.1221279C>T" "" "VUS" "" "0000403603" "1" "50" "19" "1221294" "1221294" "subst" "8.28054E-6" "01714" "STK11_000647" "g.1221294G>A" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs587782199" "0" "" "" "g.1221295G>A" "" "VUS" "" "0000403604" "1" "50" "19" "1221294" "1221294" "subst" "8.28054E-6" "01714" "STK11_000647" "g.1221294G>A" "3/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs587782199" "0" "" "" "g.1221295G>A" "" "VUS" "" "0000403605" "1" "50" "19" "1221306" "1221306" "subst" "0" "01714" "STK11_000648" "g.1221306G>A" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 11241 controls" "Germline" "" "" "0" "" "" "g.1221307G>A" "" "VUS" "" "0000403606" "1" "50" "19" "1221311" "1221311" "subst" "0" "01714" "STK11_000649" "g.1221311T>C" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer" "Germline" "" "" "0" "" "" "g.1221312T>C" "" "VUS" "" "0000403607" "1" "10" "19" "1221319" "1221319" "subst" "0.000138225" "01714" "STK11_000569" "g.1221319C>T" "143/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs121913322" "0" "" "" "g.1221320C>T" "" "benign" "" "0000403608" "1" "10" "19" "1221319" "1221319" "subst" "0.000138225" "01714" "STK11_000569" "g.1221319C>T" "210/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs121913322" "0" "" "" "g.1221320C>T" "" "benign" "" "0000403609" "1" "10" "19" "1221961" "1221961" "subst" "0" "01714" "STK11_000650" "g.1221961C>T" "26/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs148928808" "0" "" "" "g.1221962C>T" "" "benign" "" "0000403610" "1" "10" "19" "1221961" "1221961" "subst" "0" "01714" "STK11_000650" "g.1221961C>T" "52/11214 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs148928808" "0" "" "" "g.1221962C>T" "" "benign" "" "0000403611" "1" "10" "19" "1221967" "1221967" "subst" "0" "01714" "STK11_000652" "g.1221967G>A" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer" "Germline" "" "rs587781178" "0" "" "" "g.1221968G>A" "" "benign" "" "0000403612" "1" "50" "19" "1222991" "1222991" "subst" "0" "01714" "STK11_000653" "g.1222991C>T" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 11241 controls" "Germline" "" "rs750366043" "0" "" "" "g.1222992C>T" "" "VUS" "" "0000403613" "1" "50" "19" "1223023" "1223023" "subst" "0" "01714" "STK11_000654" "g.1223023G>T" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.1223024G>T" "" "VUS" "" "0000403614" "1" "50" "19" "1223023" "1223023" "subst" "0" "01714" "STK11_000654" "g.1223023G>T" "2/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.1223024G>T" "" "VUS" "" "0000403615" "1" "50" "19" "1223055" "1223055" "subst" "4.36891E-5" "01714" "STK11_000656" "g.1223055G>A" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 11241 controls" "Germline" "" "rs371264852" "0" "" "" "g.1223056G>A" "" "VUS" "" "0000403616" "1" "10" "19" "1223080" "1223080" "subst" "0" "01714" "STK11_000657" "g.1223080G>A" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 11241 controls" "Germline" "" "rs773049570" "0" "" "" "g.1223081G>A" "" "benign" "" "0000403617" "1" "50" "19" "1223088" "1223088" "subst" "0" "01714" "STK11_000658" "g.1223088A>T" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 11241 controls" "Germline" "" "" "0" "" "" "g.1223089A>T" "" "VUS" "" "0000403618" "1" "50" "19" "1223090" "1223090" "subst" "1.66561E-5" "01714" "STK11_000659" "g.1223090G>A" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 11241 controls" "Germline" "" "rs368547224" "0" "" "" "g.1223091G>A" "" "VUS" "" "0000403619" "1" "50" "19" "1223098" "1223098" "subst" "0" "01714" "STK11_000660" "g.1223098C>A" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer" "Germline" "" "" "0" "" "" "g.1223099C>A" "" "VUS" "" "0000403620" "1" "50" "19" "1223103" "1223103" "subst" "1.65508E-5" "01714" "STK11_000661" "g.1223103C>T" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer" "Germline" "" "" "0" "" "" "g.1223104C>T" "" "VUS" "" "0000403621" "1" "10" "19" "1223107" "1223107" "subst" "2.06536E-5" "01714" "STK11_000662" "g.1223107C>T" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs778274196" "0" "" "" "g.1223108C>T" "" "benign" "" "0000403622" "1" "10" "19" "1223107" "1223107" "subst" "2.06536E-5" "01714" "STK11_000662" "g.1223107C>T" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs778274196" "0" "" "" "g.1223108C>T" "" "benign" "" "0000403623" "1" "50" "19" "1223108" "1223108" "subst" "4.9527E-5" "01714" "STK11_000663" "g.1223108G>A" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs553752236" "0" "" "" "g.1223109G>A" "" "VUS" "" "0000403624" "1" "50" "19" "1223108" "1223108" "subst" "4.9527E-5" "01714" "STK11_000663" "g.1223108G>A" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs553752236" "0" "" "" "g.1223109G>A" "" "VUS" "" "0000403625" "1" "10" "19" "1223125" "1223125" "subst" "0.00514848" "01714" "STK11_000527" "g.1223125C>G" "571/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs59912467" "0" "" "" "g.1223126C>G" "" "benign" "" "0000403626" "1" "10" "19" "1223125" "1223125" "subst" "0.00514848" "01714" "STK11_000527" "g.1223125C>G" "882/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs59912467" "0" "" "" "g.1223126C>G" "" "benign" "" "0000403627" "1" "50" "19" "1223126" "1223126" "subst" "4.11879E-6" "01714" "STK11_000664" "g.1223126G>A" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 11241 controls" "Germline" "" "rs769403473" "0" "" "" "g.1223127G>A" "" "VUS" "" "0000403628" "1" "50" "19" "1223150" "1223150" "subst" "4.12752E-6" "01714" "STK11_000666" "g.1223150A>G" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer" "Germline" "" "rs764458789" "0" "" "" "g.1223151A>G" "" "VUS" "" "0000403629" "1" "50" "19" "1223152" "1223152" "subst" "0" "01714" "STK11_000667" "g.1223152T>G" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer" "Germline" "" "" "0" "" "" "g.1223153T>G" "" "VUS" "" "0000403630" "1" "90" "19" "1223153" "1223153" "subst" "0" "01714" "STK11_000668" "g.1223153C>T" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer" "Germline" "" "" "0" "" "" "g.1223154C>T" "" "pathogenic" "" "0000403631" "1" "50" "19" "1223171" "1223171" "subst" "0" "01714" "STK11_000670" "g.1223171G>A" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 11241 controls" "Germline" "" "rs747655835" "0" "" "" "g.1223172G>A" "" "VUS" "" "0000403632" "1" "50" "19" "1226484" "1226484" "subst" "0" "01714" "STK11_000671" "g.1226484T>C" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 11241 controls" "Germline" "" "" "0" "" "" "g.1226485T>C" "" "VUS" "" "0000403633" "1" "50" "19" "1226491" "1226491" "subst" "0" "01714" "STK11_000672" "g.1226491C>T" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer" "Germline" "" "rs535449626" "0" "" "" "g.1226492C>T" "" "VUS" "" "0000403634" "1" "10" "19" "1226534" "1226534" "subst" "7.00538E-5" "01714" "STK11_000675" "g.1226534C>T" "3/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs558040549" "0" "" "" "g.1226535C>T" "" "benign" "" "0000403635" "1" "10" "19" "1226534" "1226534" "subst" "7.00538E-5" "01714" "STK11_000675" "g.1226534C>T" "5/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs558040549" "0" "" "" "g.1226535C>T" "" "benign" "" "0000403636" "1" "10" "19" "1226535" "1226535" "subst" "8.78843E-6" "01714" "STK11_000676" "g.1226535G>A" "2/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs774759899" "0" "" "" "g.1226536G>A" "" "benign" "" "0000403637" "1" "10" "19" "1226535" "1226535" "subst" "8.78843E-6" "01714" "STK11_000676" "g.1226535G>A" "4/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs774759899" "0" "" "" "g.1226536G>A" "" "benign" "" "0000403638" "1" "50" "19" "1226536" "1226536" "subst" "0" "01714" "STK11_000677" "g.1226536G>A" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 11241 controls" "Germline" "" "" "0" "" "" "g.1226537G>A" "" "VUS" "" "0000403639" "1" "10" "19" "1226538" "1226538" "subst" "0.000240539" "01714" "STK11_000678" "g.1226538G>A" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 11241 controls" "Germline" "" "rs184271025" "0" "" "" "g.1226539G>A" "" "benign" "" "0000403640" "1" "50" "19" "1226569" "1226569" "subst" "8.42141E-5" "01714" "STK11_000679" "g.1226569C>T" "2/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs368466538" "0" "" "" "g.1226570C>T" "" "VUS" "" "0000403641" "1" "50" "19" "1226569" "1226569" "subst" "8.42141E-5" "01714" "STK11_000679" "g.1226569C>T" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs368466538" "0" "" "" "g.1226570C>T" "" "VUS" "" "0000403642" "1" "10" "19" "1226574" "1226574" "subst" "0" "01714" "STK11_000681" "g.1226574C>T" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 11241 controls" "Germline" "" "rs864622171" "0" "" "" "g.1226575C>T" "" "benign" "" "0000403643" "1" "50" "19" "1226582" "1226582" "subst" "0" "01714" "STK11_000682" "g.1226582C>G" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer" "Germline" "" "" "0" "" "" "g.1226583C>G" "" "VUS" "" "0000403644" "1" "50" "19" "1226588" "1226588" "subst" "0" "01714" "STK11_000683" "g.1226588G>A" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 11241 controls" "Germline" "" "rs775978755" "0" "" "" "g.1226589G>A" "" "VUS" "" "0000403645" "1" "10" "19" "1226601" "1226601" "subst" "6.32359E-5" "01714" "STK11_000684" "g.1226601C>T" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer" "Germline" "" "rs375328708" "0" "" "" "g.1226602C>T" "" "benign" "" "0000403646" "1" "50" "19" "1226617" "1226617" "subst" "7.01459E-6" "01714" "STK11_000685" "g.1226617C>G" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer" "Germline" "" "" "0" "" "" "g.1226618C>G" "" "VUS" "" "0000403647" "1" "50" "19" "1226620" "1226620" "subst" "0" "01714" "STK11_000686" "g.1226620C>T" "3/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs587782687" "0" "" "" "g.1226621C>T" "" "VUS" "" "0000403648" "1" "50" "19" "1226620" "1226620" "subst" "0" "01714" "STK11_000686" "g.1226620C>T" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs587782687" "0" "" "" "g.1226621C>T" "" "VUS" "" "0000403649" "1" "50" "19" "1226621" "1226621" "subst" "0" "01714" "STK11_000687" "g.1226621G>A" "3/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs752699287" "0" "" "" "g.1226622G>A" "" "VUS" "" "0000403650" "1" "50" "19" "1226621" "1226621" "subst" "0" "01714" "STK11_000687" "g.1226621G>A" "4/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs752699287" "0" "" "" "g.1226622G>A" "" "VUS" "" "0000403651" "1" "50" "19" "1226627" "1226627" "subst" "4.40529E-5" "01714" "STK11_000688" "g.1226627C>G" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer" "Germline" "" "rs587781537" "0" "" "" "g.1226628C>G" "" "VUS" "" "0000403652" "1" "10" "19" "1226628" "1226628" "subst" "8.09562E-5" "01714" "STK11_000529" "g.1226628G>A" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer" "Germline" "" "rs369097329" "0" "" "" "g.1226629G>A" "" "benign" "" "0000405513" "3" "10" "19" "1207008" "1207008" "subst" "0.000310184" "01714" "STK11_000603" "g.1207008C>G" "3/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs79175212" "0" "" "" "g.1207009C>G" "" "benign" "" "0000405514" "3" "10" "19" "1221319" "1221319" "subst" "0.000138225" "01714" "STK11_000569" "g.1221319C>T" "3/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs121913322" "0" "" "" "g.1221320C>T" "" "benign" "" "0000405515" "3" "10" "19" "1221319" "1221319" "subst" "0.000138225" "01714" "STK11_000569" "g.1221319C>T" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs121913322" "0" "" "" "g.1221320C>T" "" "benign" "" "0000405516" "3" "10" "19" "1223125" "1223125" "subst" "0.00514848" "01714" "STK11_000527" "g.1223125C>G" "10/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs59912467" "0" "" "" "g.1223126C>G" "" "benign" "" "0000405517" "3" "10" "19" "1223125" "1223125" "subst" "0.00514848" "01714" "STK11_000527" "g.1223125C>G" "16/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs59912467" "0" "" "" "g.1223126C>G" "" "benign" "" "0000406472" "1" "10" "19" "1207008" "1207008" "subst" "0.000310184" "01714" "STK11_000603" "g.1207008C>G" "2/53 cases" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs79175212" "0" "" "" "g.1207009C>G" "" "benign" "" "0000406473" "1" "10" "19" "1221319" "1221319" "subst" "0.000138225" "01714" "STK11_000569" "g.1221319C>T" "1/53 cases" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs121913322" "0" "" "" "g.1221320C>T" "" "benign" "" "0000406474" "3" "10" "19" "1223125" "1223125" "subst" "0.00514848" "01714" "STK11_000527" "g.1223125C>G" "1/53 cases" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs59912467" "0" "" "" "g.1223126C>G" "" "benign" "" "0000406475" "1" "10" "19" "1223125" "1223125" "subst" "0.00514848" "01714" "STK11_000527" "g.1223125C>G" "7/53 cases" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs59912467" "0" "" "" "g.1223126C>G" "" "benign" "" "0000407709" "1" "50" "19" "1206950" "1206950" "subst" "0" "01714" "STK11_000599" "g.1206950C>T" "1/12439 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.1206951C>T" "" "VUS" "" "0000407710" "1" "50" "19" "1206951" "1206951" "subst" "0" "01714" "STK11_000600" "g.1206951G>C" "1/12488 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.1206952G>C" "" "VUS" "" "0000407711" "1" "50" "19" "1206978" "1206978" "subst" "0" "01714" "STK11_000602" "g.1206978G>C" "1/12488 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.1206979G>C" "" "VUS" "" "0000407712" "3" "10" "19" "1207008" "1207008" "subst" "0.000310184" "01714" "STK11_000603" "g.1207008C>G" "1/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs79175212" "0" "" "" "g.1207009C>G" "" "benign" "" "0000407713" "1" "10" "19" "1207008" "1207008" "subst" "0.000310184" "01714" "STK11_000603" "g.1207008C>G" "265/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs79175212" "0" "" "" "g.1207009C>G" "" "benign" "" "0000407714" "1" "50" "19" "1207019" "1207019" "subst" "0" "01714" "STK11_000604" "g.1207019A>G" "1/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.1207020A>G" "" "VUS" "" "0000407715" "1" "50" "19" "1207037" "1207037" "subst" "5.70204E-5" "01714" "STK11_000607" "g.1207037G>T" "5/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs148830698" "0" "" "" "g.1207038G>T" "" "VUS" "" "0000407716" "1" "50" "19" "1207038" "1207038" "subst" "0" "01714" "STK11_000608" "g.1207038G>C" "1/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.1207039G>C" "" "VUS" "" "0000407717" "1" "50" "19" "1207050" "1207050" "subst" "0" "01714" "STK11_000609" "g.1207050C>G" "2/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.1207051C>G" "" "VUS" "" "0000407718" "1" "50" "19" "1207070" "1207070" "subst" "4.07199E-6" "01714" "STK11_000611" "g.1207070A>G" "2/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.1207071A>G" "" "VUS" "" "0000407719" "1" "50" "19" "1207134" "1207134" "subst" "0" "01714" "STK11_000613" "g.1207134G>T" "1/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.1207135G>T" "" "VUS" "" "0000407720" "1" "50" "19" "1207143" "1207143" "subst" "0" "01714" "STK11_000614" "g.1207143C>T" "1/12464 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.1207144C>T" "" "VUS" "" "0000407721" "1" "50" "19" "1207155" "1207155" "subst" "8.29511E-6" "01714" "STK11_000615" "g.1207155G>A" "1/12464 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.1207156G>A" "" "VUS" "" "0000407722" "1" "50" "19" "1207182" "1207182" "subst" "0" "01714" "STK11_000618" "g.1207182C>T" "1/12464 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.1207183C>T" "" "VUS" "" "0000407723" "1" "50" "19" "1218465" "1218465" "subst" "4.06174E-6" "01714" "STK11_000619" "g.1218465G>A" "1/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.1218466G>A" "" "VUS" "" "0000407724" "1" "50" "19" "1220393" "1220393" "subst" "0" "01714" "STK11_000625" "g.1220393C>T" "10/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.1220394C>T" "" "VUS" "" "0000407725" "1" "50" "19" "1220420" "1220420" "subst" "0" "01714" "STK11_000626" "g.1220420C>T" "1/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.1220421C>T" "" "VUS" "" "0000407726" "1" "50" "19" "1220429" "1220429" "subst" "0" "01714" "STK11_000627" "g.1220429C>T" "1/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.1220430C>T" "" "VUS" "" "0000407727" "1" "50" "19" "1220466" "1220466" "subst" "0" "01714" "STK11_000534" "g.1220466G>A" "2/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs587782032" "0" "" "" "g.1220467G>A" "" "VUS" "" "0000407728" "1" "50" "19" "1220473" "1220473" "subst" "4.28064E-5" "01714" "STK11_000501" "g.1220473C>T" "11/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs587781515" "0" "" "" "g.1220474C>T" "" "VUS" "" "0000407729" "1" "50" "19" "1220590" "1220590" "subst" "2.48952E-5" "01714" "STK11_000631" "g.1220590C>T" "1/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs587782379" "0" "" "" "g.1220591C>T" "" "VUS" "" "0000407730" "1" "50" "19" "1220599" "1220599" "subst" "0" "01714" "STK11_000557" "g.1220599C>T" "1/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs764244639" "0" "" "" "g.1220600C>T" "" "VUS" "" "0000407731" "1" "10" "19" "1220612" "1220612" "subst" "0" "01714" "STK11_000634" "g.1220612C>T" "1/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs786201213" "0" "" "" "g.1220613C>T" "" "benign" "" "0000407732" "1" "50" "19" "1220681" "1220681" "subst" "0" "01714" "STK11_000637" "g.1220681C>T" "1/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.1220682C>T" "" "VUS" "" "0000407733" "1" "90" "19" "1220700" "1220700" "subst" "0" "01714" "STK11_000638" "g.1220700T>G" "1/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.1220701T>G" "" "pathogenic" "" "0000407734" "1" "10" "19" "1220705" "1220705" "subst" "0.000175709" "01714" "STK11_000641" "g.1220705T>C" "29/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs533550278" "0" "" "" "g.1220706T>C" "" "benign" "" "0000407735" "1" "50" "19" "1220708" "1220708" "subst" "4.19013E-5" "01714" "STK11_000642" "g.1220708G>A" "1/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs776823114" "0" "" "" "g.1220709G>A" "" "VUS" "" "0000407736" "1" "50" "19" "1221227" "1221227" "subst" "8.15062E-6" "01714" "STK11_000645" "g.1221227G>A" "1/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs748112446" "0" "" "" "g.1221228G>A" "" "VUS" "" "0000407737" "1" "50" "19" "1221278" "1221278" "subst" "0" "01714" "STK11_000646" "g.1221278C>T" "3/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs539772540" "0" "" "" "g.1221279C>T" "" "VUS" "" "0000407738" "1" "50" "19" "1221294" "1221294" "subst" "8.28054E-6" "01714" "STK11_000647" "g.1221294G>A" "1/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs587782199" "0" "" "" "g.1221295G>A" "" "VUS" "" "0000407739" "3" "10" "19" "1221319" "1221319" "subst" "0.000138225" "01714" "STK11_000569" "g.1221319C>T" "2/12489 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs121913322" "0" "" "" "g.1221320C>T" "" "benign" "" "0000407740" "1" "10" "19" "1221319" "1221319" "subst" "0.000138225" "01714" "STK11_000569" "g.1221319C>T" "294/12489 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs121913322" "0" "" "" "g.1221320C>T" "" "benign" "" "0000407741" "1" "10" "19" "1221961" "1221961" "subst" "0" "01714" "STK11_000650" "g.1221961C>T" "45/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs148928808" "0" "" "" "g.1221962C>T" "" "benign" "" "0000407742" "1" "50" "19" "1221963" "1221963" "subst" "0" "01714" "STK11_000651" "g.1221963A>C" "2/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.1221964A>C" "" "VUS" "" "0000407743" "1" "10" "19" "1223035" "1223035" "subst" "3.7034E-5" "01714" "STK11_000655" "g.1223035G>A" "1/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs553474397" "0" "" "" "g.1223036G>A" "" "benign" "" "0000407744" "1" "50" "19" "1223103" "1223103" "subst" "1.65508E-5" "01714" "STK11_000661" "g.1223103C>T" "2/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.1223104C>T" "" "VUS" "" "0000407745" "1" "10" "19" "1223107" "1223107" "subst" "2.06536E-5" "01714" "STK11_000662" "g.1223107C>T" "1/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs778274196" "0" "" "" "g.1223108C>T" "" "benign" "" "0000407746" "1" "50" "19" "1223108" "1223108" "subst" "4.9527E-5" "01714" "STK11_000663" "g.1223108G>A" "1/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs553752236" "0" "" "" "g.1223109G>A" "" "VUS" "" "0000407747" "3" "10" "19" "1223125" "1223125" "subst" "0.00514848" "01714" "STK11_000527" "g.1223125C>G" "31/12486 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs59912467" "0" "" "" "g.1223126C>G" "" "benign" "" "0000407748" "1" "10" "19" "1223125" "1223125" "subst" "0.00514848" "01714" "STK11_000527" "g.1223125C>G" "1054/12486 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs59912467" "0" "" "" "g.1223126C>G" "" "benign" "" "0000407749" "1" "50" "19" "1223126" "1223126" "subst" "4.11879E-6" "01714" "STK11_000664" "g.1223126G>A" "1/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs769403473" "0" "" "" "g.1223127G>A" "" "VUS" "" "0000407750" "1" "50" "19" "1223136" "1223136" "subst" "0" "01714" "STK11_000665" "g.1223136A>G" "3/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs752781994" "0" "" "" "g.1223137A>G" "" "VUS" "" "0000407751" "1" "50" "19" "1223170" "1223170" "subst" "2.09032E-5" "01714" "STK11_000669" "g.1223170C>T" "1/12489 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs376069854" "0" "" "" "g.1223171C>T" "" "VUS" "" "0000407752" "1" "50" "19" "1226519" "1226519" "subst" "8.45501E-6" "01714" "STK11_000673" "g.1226519T>C" "1/12488 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.1226520T>C" "" "VUS" "" "0000407753" "1" "50" "19" "1226523" "1226523" "subst" "0" "01714" "STK11_000674" "g.1226523C>G" "1/12488 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.1226524C>G" "" "VUS" "" "0000407754" "1" "10" "19" "1226534" "1226534" "subst" "7.00538E-5" "01714" "STK11_000675" "g.1226534C>T" "5/12488 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs558040549" "0" "" "" "g.1226535C>T" "" "benign" "" "0000407755" "1" "10" "19" "1226535" "1226535" "subst" "8.78843E-6" "01714" "STK11_000676" "g.1226535G>A" "7/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs774759899" "0" "" "" "g.1226536G>A" "" "benign" "" "0000407756" "1" "50" "19" "1226536" "1226536" "subst" "0" "01714" "STK11_000677" "g.1226536G>A" "2/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.1226537G>A" "" "VUS" "" "0000407757" "1" "50" "19" "1226570" "1226570" "subst" "0" "01714" "STK11_000680" "g.1226570G>A" "1/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs587782364" "0" "" "" "g.1226571G>A" "" "VUS" "" "0000407758" "1" "50" "19" "1226582" "1226582" "subst" "0" "01714" "STK11_000682" "g.1226582C>G" "1/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.1226583C>G" "" "VUS" "" "0000407759" "1" "50" "19" "1226620" "1226620" "subst" "0" "01714" "STK11_000686" "g.1226620C>T" "4/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs587782687" "0" "" "" "g.1226621C>T" "" "VUS" "" "0000407760" "1" "50" "19" "1226621" "1226621" "subst" "0" "01714" "STK11_000687" "g.1226621G>A" "2/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs752699287" "0" "" "" "g.1226622G>A" "" "VUS" "" "0000408641" "0" "50" "19" "1205798" "1226663" "del" "0" "00770" "STK11_000694" "g.(?_1205798)_(1226663_?)del" "" "" "" "-1115-?_1302+?del" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000408642" "0" "50" "19" "1205798" "1207203" "del" "0" "00770" "STK11_000693" "g.(?_1205798)_(1207203_1218415)del" "" "" "" "-1115-?_290+?del" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000408643" "0" "50" "19" "1207092" "1207092" "subst" "0" "00770" "STK11_000698" "g.1207092C>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.1207093C>A" "" "VUS" "" "0000408644" "0" "50" "19" "1207124" "1207124" "del" "0" "00770" "STK11_000699" "g.1207124del" "" "" "" "212delC" "" "Germline" "" "" "0" "" "" "g.1207125del" "" "VUS" "" "0000408645" "0" "50" "19" "1218500" "1218500" "subst" "0" "00770" "STK11_000701" "g.1218500A>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.1218501A>G" "" "VUS" "" "0000408646" "0" "50" "19" "1220645" "1220657" "del" "0" "00770" "STK11_000707" "g.1220645_1220657del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.1220646_1220658del" "" "VUS" "" "0000408647" "0" "50" "19" "1221947" "1226663" "del" "0" "00770" "STK11_000709" "g.(1221340_1221947)_(1226663_?)del" "" "" "" "863-?_1302+?del" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000408648" "0" "50" "19" "1221982" "1221990" "del" "0" "00770" "STK11_000710" "g.1221982_1221990del" "" "" "" "897del9, unclear whether c.898_906del9 is equivalent to c.907_915del9 (protein identical)" "" "Germline" "" "" "0" "" "" "g.1221983_1221991del" "" "VUS" "" "0000408649" "0" "50" "19" "1221995" "1221995" "del" "0" "00770" "STK11_000573" "g.1221995del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.1221996del" "" "VUS" "" "0000408650" "0" "50" "19" "1219337" "1219344" "delins" "0" "00770" "STK11_000702" "g.1219337_1219344delinsN[32]" "" "" "" "389_396delins32" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000408651" "0" "95" "19" "1220717" "1220717" "subst" "0" "00770" "STK11_000708" "g.1220717G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.1220718G>A" "" "pathogenic" "" "0000408652" "0" "95" "19" "1220400" "1220400" "subst" "0" "00770" "STK11_000706" "g.1220400G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.1220401G>T" "" "pathogenic" "" "0000408653" "0" "95" "19" "1223040" "1223040" "del" "0" "00770" "STK11_000711" "g.1223040del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.1223041del" "" "pathogenic" "" "0000408654" "0" "95" "19" "1205798" "1207203" "del" "0" "00770" "STK11_000693" "g.(?_1205798)_(1207203_1218415)del" "" "" "" "1-?_290+?del" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000408655" "0" "95" "19" "1207069" "1207070" "ins" "0" "00770" "STK11_000696" "g.1207069_1207070insCC" "" "" "" "157_158insCC" "" "Germline" "" "" "0" "" "" "g.1207070_1207071insCC" "" "pathogenic" "" "0000408656" "0" "95" "19" "1218415" "1219413" "del" "0" "00770" "STK11_000691" "g.(1207203_1218415)_(1219413_1220371)del" "" "" "" "291-?_464+?del" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000408657" "0" "95" "19" "1218415" "1226663" "del" "0" "00770" "STK11_000700" "g.(1207203_1218415)_(1226663_?)del" "" "" "" "291_1302del" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000408658" "0" "95" "19" "1219357" "1219357" "subst" "0" "00770" "STK11_000703" "g.1219357C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.1219358C>T" "" "pathogenic" "" "0000408659" "0" "90" "19" "1219402" "1219402" "subst" "0" "02940" "STK11_000705" "g.1219402C>T" "" "{PMID:Baert-Desurmont 2018:29967336}" "" "" "disruptive variant (mosaic)" "Somatic" "" "" "0" "" "" "g.1219403C>T" "" "pathogenic" "" "0000408660" "0" "90" "19" "1219380" "1219381" "ins" "0" "02940" "STK11_000704" "g.1219380_1219381insTGTGCCG" "" "{PMID:Baert-Desurmont 2018:29967336}" "" "" "disruptive variant" "Germline" "" "" "0" "" "" "g.1219381_1219382insTGTGCCG" "" "pathogenic" "" "0000408661" "0" "90" "19" "1207041" "1207041" "dup" "0" "02940" "STK11_000695" "g.1207041dup" "" "{PMID:Baert-Desurmont 2018:29967336}" "" "" "disruptive variant" "Germline" "" "" "0" "" "" "g.1207042dup" "" "pathogenic" "" "0000408662" "0" "90" "19" "1207069" "1207070" "delins" "0" "02940" "STK11_000697" "g.1207069_1207070delinsT" "" "{PMID:Baert-Desurmont 2018:29967336}" "" "" "disruptive variant (mosaic)" "Somatic" "" "" "0" "" "" "g.1207070_1207071delinsT" "" "pathogenic" "" "0000408737" "0" "70" "19" "1221947" "1222006" "del" "0" "00650" "STK11_000692" "g.(1221340_1221947)_(1222006_1222983)del" "" "" "" "863-?_920+?del" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic" "" "0000408738" "0" "90" "19" "1218415" "1219413" "del" "0" "00650" "STK11_000691" "g.(1207203_1218415)_(1219413_1220371)del" "" "" "" "291-?_464+?del" "" "Germline" "?" "" "0" "" "" "" "" "pathogenic" "" "0000408739" "0" "90" "19" "1221319" "1221319" "dup" "0" "00650" "STK11_000690" "g.1221319dup" "" "" "" "842dupC" "" "Germline" "yes" "" "0" "" "" "g.1221320dup" "" "pathogenic" "" "0000408740" "0" "90" "19" "1221319" "1221319" "dup" "0" "00650" "STK11_000690" "g.1221319dup" "" "" "" "842dupC" "" "Germline" "yes" "" "0" "" "" "g.1221320dup" "" "pathogenic" "" "0000408741" "0" "90" "19" "1218415" "1219413" "del" "0" "00650" "STK11_000691" "g.(1207203_1218415)_(1219413_1220371)del" "" "" "" "291-?_464+?del" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000408742" "0" "90" "19" "1221319" "1221319" "dup" "0" "00650" "STK11_000690" "g.1221319dup" "" "" "" "c.842_843insC" "" "Germline" "" "" "0" "" "" "g.1221320dup" "" "pathogenic" "" "0000408743" "0" "50" "19" "1220449" "1220449" "subst" "0" "00650" "STK11_000689" "g.1220449A>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.1220450A>T" "" "VUS" "" "0000408744" "0" "50" "19" "1220449" "1220449" "subst" "0" "00650" "STK11_000689" "g.1220449A>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.1220450A>T" "" "VUS" "" "0000453992" "0" "50" "19" "1205808" "1228434" "dup" "0" "00006" "STK11_000712" "g.(?_1205808)_(1228434_?)dup" "1/2134 cases BRCA" "{PMID:Slavin 2017:28649662}" "" "STK11 gene duplication" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000500612" "0" "50" "19" "1206955" "1206955" "subst" "0" "01164" "STK11_000713" "g.1206955G>A" "" "" "" "" "ACMG grading: BP4; suspicion of a hereditary cancer predisposition in family" "Germline" "" "" "0" "" "" "g.1206956G>A" "" "VUS" "ACMG" "0000566040" "0" "90" "19" "1207092" "1207092" "subst" "0" "02327" "STK11_000714" "g.1207092C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.1207093C>G" "" "pathogenic" "" "0000566041" "0" "90" "19" "1207109" "1207109" "dup" "0" "01943" "STK11_000715" "g.1207109dup" "" "" "" "STK11(NM_000455.4):c.197dupT (p.L67Afs*96)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.1207110dup" "" "pathogenic" "" "0000566042" "0" "10" "19" "1207238" "1207238" "subst" "0.292004" "02327" "STK11_000716" "g.1207238G>T" "" "" "" "STK11(NM_000455.4):c.290+36G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.1207239G>T" "" "benign" "" "0000566044" "0" "10" "19" "1218384" "1218384" "subst" "0.00953625" "02327" "STK11_000717" "g.1218384C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.1218385C>T" "" "benign" "" "0000566045" "0" "10" "19" "1218494" "1218494" "subst" "0.00148722" "01804" "STK11_000718" "g.1218494G>A" "" "" "" "STK11(NM_000455.4):c.369G>A (p.(Gln123=)), STK11(NM_000455.5):c.369G>A (p.Q123=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.1218495G>A" "" "benign" "" "0000566046" "0" "30" "19" "1218494" "1218494" "subst" "0.00148722" "02327" "STK11_000718" "g.1218494G>A" "" "" "" "STK11(NM_000455.4):c.369G>A (p.(Gln123=)), STK11(NM_000455.5):c.369G>A (p.Q123=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.1218495G>A" "" "likely benign" "" "0000566047" "0" "10" "19" "1218494" "1218494" "subst" "0.00148722" "02329" "STK11_000718" "g.1218494G>A" "" "" "" "STK11(NM_000455.4):c.369G>A (p.(Gln123=)), STK11(NM_000455.5):c.369G>A (p.Q123=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.1218495G>A" "" "benign" "" "0000566048" "0" "10" "19" "1218523" "1218523" "subst" "0.160922" "02327" "STK11_000545" "g.1218523G>T" "" "" "" "STK11(NM_000455.4):c.374+24G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.1218524G>T" "" "benign" "" "0000566050" "0" "10" "19" "1220321" "1220321" "subst" "0" "02327" "STK11_000719" "g.1220321T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.1220322T>C" "" "benign" "" "0000566051" "0" "30" "19" "1220354" "1220354" "subst" "2.36873E-5" "01804" "STK11_000720" "g.1220354G>T" "" "" "" "STK11(NM_000455.4):c.465-18G>T (p.(=)), STK11(NM_000455.5):c.465-18G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.1220355G>T" "" "likely benign" "" "0000566052" "0" "30" "19" "1220354" "1220354" "subst" "2.36873E-5" "02327" "STK11_000720" "g.1220354G>T" "" "" "" "STK11(NM_000455.4):c.465-18G>T (p.(=)), STK11(NM_000455.5):c.465-18G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.1220355G>T" "" "likely benign" "" "0000566053" "0" "90" "19" "1220400" "1220400" "subst" "0" "02327" "STK11_000706" "g.1220400G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.1220401G>T" "" "pathogenic" "" "0000566054" "0" "90" "19" "1220466" "1220467" "delins" "0" "02327" "STK11_000721" "g.1220466_1220467delinsT" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.1220467_1220468delinsT" "" "pathogenic" "" "0000566056" "0" "90" "19" "1220487" "1220487" "subst" "0" "02325" "STK11_000551" "g.1220487G>A" "" "" "" "STK11(NM_000455.4):c.580G>A (p.D194N), STK11(NM_000455.5):c.580G>A (p.D194N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.1220488G>A" "" "pathogenic" "" "0000566057" "0" "90" "19" "1220585" "1220586" "dup" "0" "01943" "STK11_000723" "g.1220585_1220586dup" "" "" "" "STK11(NM_000455.4):c.603_604dupGC (p.H202Rfs*86), STK11(NM_000455.5):c.603_604dupGC (p.H202Rfs*86)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.1220586_1220587dup" "" "pathogenic" "" "0000566058" "0" "30" "19" "1220669" "1220669" "subst" "0" "02330" "STK11_000724" "g.1220669C>T" "" "" "" "STK11(NM_000455.5):c.687C>T (p.D229=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.1220670C>T" "" "likely benign" "" "0000566059" "0" "90" "19" "1220683" "1220683" "del" "0" "02327" "STK11_000725" "g.1220683del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.1220684del" "" "pathogenic" "" "0000566060" "0" "50" "19" "1220703" "1220703" "subst" "8.36701E-6" "02325" "STK11_000726" "g.1220703G>A" "" "" "" "STK11(NM_000455.4):c.721G>A (p.(Ala241Thr)), STK11(NM_000455.5):c.721G>A (p.A241T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.1220704G>A" "" "VUS" "" "0000566061" "0" "30" "19" "1220705" "1220705" "subst" "0.000175709" "02330" "STK11_000641" "g.1220705T>C" "" "" "" "STK11(NM_000455.5):c.723T>C (p.A241=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.1220706T>C" "" "likely benign" "" "0000566062" "0" "30" "19" "1220727" "1220727" "del" "0" "02327" "STK11_000727" "g.1220727del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.1220728del" "" "likely benign" "" "0000566063" "0" "30" "19" "1220748" "1220748" "subst" "1.34581E-5" "02327" "STK11_000728" "g.1220748C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.1220749C>T" "" "likely benign" "" "0000566064" "0" "10" "19" "1221161" "1221161" "subst" "0" "02327" "STK11_000729" "g.1221161C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.1221162C>T" "" "benign" "" "0000566065" "0" "30" "19" "1221264" "1221264" "subst" "0.000171441" "02330" "STK11_000566" "g.1221264T>C" "" "" "" "STK11(NM_000455.4):c.787T>C (p.(Leu263=), p.L263=), STK11(NM_000455.5):c.787T>C (p.L263=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.1221265T>C" "" "likely benign" "" "0000566066" "0" "30" "19" "1221264" "1221264" "subst" "0.000171441" "02327" "STK11_000566" "g.1221264T>C" "" "" "" "STK11(NM_000455.4):c.787T>C (p.(Leu263=), p.L263=), STK11(NM_000455.5):c.787T>C (p.L263=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.1221265T>C" "" "likely benign" "" "0000566067" "0" "10" "19" "1221293" "1221293" "subst" "0.00584503" "01804" "STK11_000567" "g.1221293C>T" "" "" "" "STK11(NM_000455.4):c.816C>T (p.(Tyr272=)), STK11(NM_000455.5):c.816C>T (p.Y272=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.1221294C>T" "" "benign" "" "0000566068" "0" "10" "19" "1221293" "1221293" "subst" "0.00584503" "02327" "STK11_000567" "g.1221293C>T" "" "" "" "STK11(NM_000455.4):c.816C>T (p.(Tyr272=)), STK11(NM_000455.5):c.816C>T (p.Y272=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.1221294C>T" "" "benign" "" "0000566069" "0" "30" "19" "1221881" "1221881" "subst" "0" "02327" "STK11_000730" "g.1221881G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.1221882G>A" "" "likely benign" "" "0000566070" "0" "50" "19" "1221975" "1221975" "subst" "0" "01943" "STK11_000731" "g.1221975G>A" "" "" "" "STK11(NM_000455.4):c.890G>A (p.R297K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.1221976G>A" "" "VUS" "" "0000566071" "0" "30" "19" "1223008" "1223008" "subst" "0.000747089" "02330" "STK11_000578" "g.1223008G>A" "" "" "" "STK11(NM_000455.4):c.945G>A (p.(Pro315=)), STK11(NM_000455.5):c.945G>A (p.P315=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.1223009G>A" "" "likely benign" "" "0000566072" "0" "30" "19" "1223125" "1223125" "subst" "0.00514848" "01804" "STK11_000527" "g.1223125C>G" "" "" "" "STK11(NM_000455.4):c.1062C>G (p.F354L, p.(Phe354Leu)), STK11(NM_000455.5):c.1062C>G (p.F354L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.1223126C>G" "" "likely benign" "" "0000566073" "0" "10" "19" "1223125" "1223125" "subst" "0.00514848" "02327" "STK11_000527" "g.1223125C>G" "" "" "" "STK11(NM_000455.4):c.1062C>G (p.F354L, p.(Phe354Leu)), STK11(NM_000455.5):c.1062C>G (p.F354L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.1223126C>G" "" "benign" "" "0000566074" "0" "30" "19" "1226544" "1226544" "subst" "4.49188E-5" "02330" "STK11_000584" "g.1226544G>A" "" "" "" "STK11(NM_000455.5):c.1200G>A (p.L400=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.1226545G>A" "" "likely benign" "" "0000566075" "0" "30" "19" "1226555" "1226555" "subst" "0.000428305" "02330" "STK11_000517" "g.1226555C>T" "" "" "" "STK11(NM_000455.5):c.1211C>T (p.S404F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.1226556C>T" "" "likely benign" "" "0000566076" "0" "30" "19" "1226654" "1226654" "subst" "0.000305998" "01943" "C19orf26_000002" "g.1226654C>T" "" "" "" "STK11(NM_000455.4):c.*8C>T, STK11(NM_000455.5):c.*8C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.1226655C>T" "" "likely benign" "" "0000566077" "0" "30" "19" "1226654" "1226654" "subst" "0.000305998" "02325" "C19orf26_000002" "g.1226654C>T" "" "" "" "STK11(NM_000455.4):c.*8C>T, STK11(NM_000455.5):c.*8C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.1226655C>T" "" "likely benign" "" "0000566078" "0" "30" "19" "1226672" "1226672" "subst" "0.00042199" "02327" "STK11_000586" "g.1226672G>A" "" "" "" "STK11(NM_000455.4):c.*16+10G>A (p.(=)), STK11(NM_000455.5):c.*16+10G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.1226673G>A" "" "likely benign" "" "0000594757" "0" "50" "19" "1206955" "1206955" "subst" "0" "01164" "STK11_000713" "g.1206955G>A" "" "" "" "" "ACMG grading: BP4" "Germline" "" "" "0" "" "" "g.1206956G>A" "" "VUS" "ACMG" "0000594766" "0" "50" "19" "1226602" "1226602" "subst" "0" "01164" "STK11_000528" "g.1226602G>T" "" "" "" "" "ACMG grading: BP4" "Germline" "" "rs762482152" "0" "" "" "g.1226603G>T" "" "VUS" "ACMG" "0000594770" "0" "50" "19" "1226537" "1226537" "subst" "1.33217E-5" "01164" "STK11_000738" "g.1226537C>T" "" "" "" "" "reported in Yurgelun 2015. Gastroenterology 3: 604; Caminski 2016. Hum Mutat 7: 640" "Germline" "" "rs768058962" "0" "" "" "g.1226538C>T" "" "VUS" "ACMG" "0000594771" "0" "50" "19" "1220614" "1220614" "subst" "4.55386E-5" "01164" "STK11_000735" "g.1220614G>A" "" "" "" "" "ACMG grading: BP4,PM2" "Germline" "" "rs730881982" "0" "" "" "g.1220615G>A" "" "VUS" "ACMG" "0000594773" "0" "50" "19" "1226494" "1226494" "subst" "0" "01164" "STK11_000737" "g.1226494C>T" "" "" "" "" "ACMG grading: BP5; co-occurence with truncating variant in RAD51C (c.181_182delfs*)" "Germline" "" "rs752015385" "0" "" "" "g.1226495C>T" "" "VUS" "ACMG" "0000594774" "0" "70" "19" "1220487" "1220487" "subst" "0" "01164" "STK11_000551" "g.1220487G>A" "" "" "" "" "ACMG grading: PM5,PP1,PP3,PM2,PM1; BC at age 49y, mother OC; reported in W Lim 2003. Br J Cancer 89: 308-313; Ngeow 2013. Gastroenterology 144: 1420-9; Borun P 2013. BMC Med Genet 14: 58" "Germline" "" "rs121913315" "0" "" "" "g.1220488G>A" "" "likely pathogenic" "ACMG" "0000594775" "0" "50" "19" "1223127" "1223127" "subst" "0" "01164" "STK11_000736" "g.1223127A>T" "" "" "" "" "ACMG grading: BP4" "Germline" "" "" "0" "" "" "g.1223128A>T" "" "VUS" "ACMG" "0000594776" "0" "50" "19" "1218511" "1218511" "subst" "1.22044E-5" "01164" "STK11_000734" "g.1218511G>A" "" "" "" "" "malignant myopericytoma at age 31y, mother BC at age 30y, aunt ms CUP at age 38y, grandmother ms BC at age 33y; 36 HBOC gene panel negative result" "Germline" "" "rs568625247" "0" "" "" "g.1218512G>A" "" "VUS" "ACMG" "0000594777" "0" "50" "19" "1226569" "1226569" "subst" "8.42141E-5" "01164" "STK11_000679" "g.1226569C>T" "" "" "" "" "ACMG grading: PM2; not affected but family history of BC/OC; mother OC and bilateral BC, sister BC under the age of 50y; reported in Couch 2015. J Clin Oncol 33: 304; Jiang 2018. BMC Med Genet 19: 141" "Germline" "" "rs368466538" "0" "" "" "g.1226570C>T" "" "VUS" "ACMG" "0000594778" "0" "50" "19" "1206957" "1206957" "subst" "0" "01164" "STK11_000732" "g.1206957C>T" "" "" "" "" "not affected but family history of BC, 2 sisters with BC at age 70y" "Germline" "" "rs786201234" "0" "" "" "g.1206958C>T" "" "VUS" "ACMG" "0000594779" "0" "50" "19" "1206968" "1206968" "subst" "4.17927E-6" "01164" "STK11_000733" "g.1206968C>T" "" "" "" "" "Adeno-CRC at age 55y, sister CRC at age 59y, father CRC at age 64y and prostate-ca, other prostate cancer in paternal line, cousin maternal side BC at age 43y" "Germline" "" "" "0" "" "" "g.1206969C>T" "" "VUS" "ACMG" "0000596842" "0" "70" "19" "1221975" "1221975" "subst" "0" "01164" "STK11_000731" "g.1221975G>A" "" "" "" "" "ACMG grading: PS2, PM1, PM2; reported in Westerman 1999. Hum Mutat 13: 476; Tan 2017. Fam Cancer 16: 417" "Germline" "" "" "0" "" "" "g.1221976G>A" "" "likely pathogenic" "ACMG" "0000617351" "0" "30" "19" "1221272" "1221272" "subst" "0.000200593" "02330" "STK11_000739" "g.1221272G>A" "" "" "" "STK11(NM_000455.5):c.795G>A (p.E265=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.1221273G>A" "" "likely benign" "" "0000617352" "0" "30" "19" "1223127" "1223127" "subst" "0" "02327" "C19orf26_000005" "g.1223127A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.1223128A>C" "" "likely benign" "" "0000617353" "0" "30" "19" "1226654" "1226654" "subst" "0.000305998" "02327" "C19orf26_000002" "g.1226654C>T" "" "" "" "STK11(NM_000455.4):c.*8C>T, STK11(NM_000455.5):c.*8C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.1226655C>T" "" "likely benign" "" "0000623936" "0" "30" "19" "1220354" "1220354" "subst" "2.36873E-5" "02330" "STK11_000720" "g.1220354G>T" "" "" "" "STK11(NM_000455.4):c.465-18G>T (p.(=)), STK11(NM_000455.5):c.465-18G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.1220355G>T" "" "likely benign" "" "0000623937" "0" "50" "19" "1223055" "1223055" "subst" "4.36891E-5" "02325" "STK11_000656" "g.1223055G>A" "" "" "" "STK11(NM_000455.5):c.992G>A (p.R331Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.1223056G>A" "" "VUS" "" "0000623938" "0" "30" "19" "1226672" "1226672" "subst" "0.00042199" "01943" "STK11_000586" "g.1226672G>A" "" "" "" "STK11(NM_000455.4):c.*16+10G>A (p.(=)), STK11(NM_000455.5):c.*16+10G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.1226673G>A" "" "likely benign" "" "0000647291" "0" "90" "19" "1221202" "1221202" "subst" "0" "03616" "STK11_000740" "g.1221202C>A" "" "{DOI:Terkelsen 2020:10.1002/mgg3.1381}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.1221203C>A" "" "likely pathogenic" "ACMG" "0000649894" "1" "30" "19" "1228260" "1228260" "subst" "0" "03575" "C19orf26_000006" "g.1228260C>A" "159/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "159 heterozygous; {DB:CLININrs111773256}" "Germline" "" "rs111773256" "0" "" "" "g.1228261C>A" "" "likely benign" "" "0000658482" "0" "30" "19" "1218522" "1218522" "subst" "1.62993E-5" "02327" "STK11_000741" "g.1218522C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.1218523C>T" "" "likely benign" "" "0000658483" "0" "30" "19" "1220368" "1220368" "subst" "8.59853E-5" "02329" "STK11_000742" "g.1220368G>A" "" "" "" "STK11(NM_000455.5):c.465-4G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.1220369G>A" "" "likely benign" "" "0000658484" "0" "30" "19" "1223055" "1223055" "subst" "4.36891E-5" "02327" "STK11_000656" "g.1223055G>A" "" "" "" "STK11(NM_000455.5):c.992G>A (p.R331Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.1223056G>A" "" "likely benign" "" "0000658485" "0" "30" "19" "1226512" "1226512" "subst" "0" "02327" "C19orf26_000007" "g.1226512G>A" "" "" "" "STK11(NM_000455.4):c.1168G>A (p.V390M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.1226513G>A" "" "likely benign" "" "0000669460" "3" "30" "19" "1228260" "1228260" "subst" "0" "03575" "C19orf26_000006" "g.1228260C>A" "3/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "3 homozygous; {DB:CLININrs111773256}" "Germline" "" "rs111773256" "0" "" "" "g.1228261C>A" "" "likely benign" "" "0000681274" "0" "50" "19" "1219417" "1219417" "subst" "0" "02327" "STK11_000743" "g.1219417G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000681275" "0" "30" "19" "1221305" "1221305" "subst" "2.90956E-5" "02330" "STK11_000744" "g.1221305C>T" "" "" "" "STK11(NM_000455.5):c.828C>T (p.G276=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000681276" "0" "30" "19" "1226529" "1226529" "subst" "0.000481542" "02329" "STK11_000583" "g.1226529A>G" "" "" "" "STK11(NM_000455.4):c.1185A>G (p.(Thr395=)), STK11(NM_000455.5):c.1185A>G (p.T395=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000692679" "0" "30" "19" "1220572" "1220572" "subst" "0.000364488" "02330" "STK11_000745" "g.1220572C>T" "" "" "" "STK11(NM_000455.4):c.598-8C>T (p.(=)), STK11(NM_000455.5):c.598-8C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000692680" "0" "30" "19" "1220573" "1220573" "subst" "7.25449E-5" "02329" "STK11_000555" "g.1220573G>A" "" "" "" "STK11(NM_000455.4):c.598-7G>A, STK11(NM_000455.5):c.598-7G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000692681" "0" "10" "19" "1220596" "1220596" "subst" "0" "02329" "STK11_000746" "g.1220596C>T" "" "" "" "STK11(NM_000455.5):c.614C>T (p.A205V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000692682" "0" "30" "19" "1231085" "1231085" "subst" "0" "01943" "C19orf26_000008" "g.1231085T>C" "" "" "" "CBARP(NM_152769.2):c.1169A>G (p.D390G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727122" "0" "30" "19" "1206954" "1206954" "subst" "3.01938E-5" "02329" "STK11_000747" "g.1206954G>A" "" "" "" "STK11(NM_000455.4):c.42G>A (p.(Glu14=)), STK11(NM_000455.5):c.42G>A (p.E14=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727123" "0" "30" "19" "1220572" "1220572" "subst" "0.000364488" "02329" "STK11_000745" "g.1220572C>T" "" "" "" "STK11(NM_000455.4):c.598-8C>T (p.(=)), STK11(NM_000455.5):c.598-8C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727124" "0" "50" "19" "1220736" "1220736" "subst" "0.000130569" "01804" "STK11_000748" "g.1220736G>A" "" "" "" "STK11(NM_000455.4):c.734+20G>A (p.(=)), STK11(NM_000455.5):c.734+20G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000727125" "0" "30" "19" "1223008" "1223008" "subst" "0.000747089" "02329" "STK11_000578" "g.1223008G>A" "" "" "" "STK11(NM_000455.4):c.945G>A (p.(Pro315=)), STK11(NM_000455.5):c.945G>A (p.P315=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727126" "0" "50" "19" "1223094" "1223094" "subst" "0" "02327" "C19orf26_000009" "g.1223094T>C" "" "" "" "STK11(NM_000455.4):c.1031T>C (p.(Leu344Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000734530" "0" "50" "19" "1221243" "1221243" "subst" "0" "02551" "STK11_000749" "g.1221243G>A" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000737199" "1" "50" "19" "1218476" "1218476" "del" "0" "04020" "STK11_000817" "g.1218476del" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1218475_TA_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000737200" "1" "50" "19" "1220429" "1220429" "del" "0" "04020" "STK11_000832" "g.1220429del" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1220428_AC_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742550" "1" "50" "19" "1206913" "1206913" "subst" "0" "04020" "STK11_000750" "g.1206913A>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1206913_A_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742551" "1" "50" "19" "1206915" "1206915" "subst" "0" "04020" "STK11_000751" "g.1206915G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1206915_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742552" "1" "50" "19" "1206917" "1206917" "subst" "5.27649E-6" "04020" "STK11_000753" "g.1206917A>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1206917_A_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742553" "1" "50" "19" "1206936" "1206936" "subst" "0" "04020" "STK11_000756" "g.1206936G>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1206936_G_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742554" "1" "50" "19" "1206938" "1206938" "subst" "0" "04020" "STK11_000757" "g.1206938T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1206938_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742555" "1" "50" "19" "1206941" "1206941" "subst" "0" "04020" "STK11_000758" "g.1206941G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1206941_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742556" "1" "50" "19" "1206945" "1206945" "subst" "0" "04020" "STK11_000761" "g.1206945G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1206945_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742557" "1" "50" "19" "1206946" "1206946" "subst" "0" "04020" "STK11_000762" "g.1206946T>C" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1206946_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742558" "1" "50" "19" "1206948" "1206948" "subst" "0" "04020" "STK11_000763" "g.1206948C>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1206948_C_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742559" "1" "50" "19" "1206950" "1206950" "subst" "0" "04020" "STK11_000599" "g.1206950C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1206950_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742560" "1" "50" "19" "1206952" "1206952" "subst" "0" "04020" "STK11_000764" "g.1206952G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1206952_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742561" "1" "50" "19" "1206982" "1206982" "subst" "0" "04020" "STK11_000772" "g.1206982A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1206982_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742562" "1" "50" "19" "1206983" "1206983" "subst" "0" "04020" "STK11_000773" "g.1206983C>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1206983_C_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742563" "1" "50" "19" "1206989" "1206989" "subst" "0" "04020" "STK11_000776" "g.1206989T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1206989_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742564" "1" "50" "19" "1206994" "1206994" "subst" "0" "04020" "STK11_000777" "g.1206994C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1206994_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742565" "1" "50" "19" "1206995" "1206995" "subst" "0" "04020" "STK11_000778" "g.1206995G>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1206995_G_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742566" "1" "50" "19" "1206998" "1206998" "subst" "0" "04020" "STK11_000779" "g.1206998T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1206998_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742567" "1" "50" "19" "1207001" "1207001" "subst" "0" "04020" "STK11_000780" "g.1207001A>G" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1207001_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742568" "1" "50" "19" "1207012" "1207012" "subst" "0" "04020" "STK11_000782" "g.1207012G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1207012_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742569" "1" "50" "19" "1207013" "1207013" "subst" "0" "04020" "STK11_000783" "g.1207013T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1207013_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742570" "1" "50" "19" "1207028" "1207028" "subst" "8.14883E-6" "04020" "STK11_000786" "g.1207028G>T" "4/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1207028_G_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742571" "1" "50" "19" "1207031" "1207031" "subst" "0" "04020" "STK11_000605" "g.1207031G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1207031_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742572" "1" "50" "19" "1207039" "1207039" "subst" "0" "04020" "STK11_000790" "g.1207039G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1207039_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742573" "1" "50" "19" "1207069" "1207069" "subst" "0" "04020" "STK11_000795" "g.1207069G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1207069_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742574" "1" "50" "19" "1207071" "1207071" "subst" "0" "04020" "STK11_000796" "g.1207071C>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1207071_C_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742575" "1" "50" "19" "1207099" "1207099" "subst" "0" "04020" "STK11_000799" "g.1207099G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1207099_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742576" "1" "50" "19" "1207121" "1207121" "subst" "0" "04020" "STK11_000801" "g.1207121A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1207121_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742577" "1" "50" "19" "1207147" "1207147" "subst" "0" "04020" "STK11_000802" "g.1207147A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1207147_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742578" "1" "50" "19" "1207160" "1207160" "subst" "4.1708E-6" "04020" "STK11_000803" "g.1207160A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1207160_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742579" "1" "50" "19" "1207166" "1207166" "subst" "0" "04020" "STK11_000804" "g.1207166T>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1207166_T_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742580" "1" "50" "19" "1207181" "1207181" "subst" "0" "04020" "STK11_000806" "g.1207181A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1207181_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742581" "1" "50" "19" "1218422" "1218422" "subst" "1.62476E-5" "04020" "STK11_000808" "g.1218422T>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1218422_T_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742582" "1" "50" "19" "1218424" "1218424" "subst" "0" "04020" "STK11_000809" "g.1218424A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1218424_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742583" "1" "50" "19" "1218435" "1218435" "subst" "1.62466E-5" "04020" "STK11_000810" "g.1218435A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1218435_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742584" "1" "50" "19" "1218442" "1218442" "subst" "1.2185E-5" "04020" "STK11_000813" "g.1218442G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1218442_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742585" "1" "50" "19" "1218444" "1218444" "subst" "0" "04020" "STK11_000814" "g.1218444C>T" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1218444_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742586" "1" "50" "19" "1218450" "1218450" "subst" "0" "04020" "STK11_000815" "g.1218450A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1218450_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742587" "1" "50" "19" "1218472" "1218472" "subst" "0" "04020" "STK11_000816" "g.1218472T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1218472_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742588" "1" "50" "19" "1218477" "1218477" "subst" "0" "04020" "STK11_000620" "g.1218477T>C" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1218477_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742589" "1" "50" "19" "1218483" "1218483" "subst" "4.06263E-6" "04020" "STK11_000819" "g.1218483G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1218483_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742590" "1" "50" "19" "1218487" "1218487" "subst" "0" "04020" "STK11_000820" "g.1218487A>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1218487_A_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742591" "1" "50" "19" "1218498" "1218498" "subst" "0" "04020" "STK11_000822" "g.1218498A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1218498_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742592" "1" "50" "19" "1219323" "1219323" "subst" "0" "04020" "STK11_000824" "g.1219323G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1219323_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742593" "1" "50" "19" "1220371" "1220371" "subst" "0" "04020" "STK11_000827" "g.1220371G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1220371_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742594" "1" "50" "19" "1220382" "1220382" "subst" "0" "04020" "STK11_000828" "g.1220382C>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1220382_C_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742595" "1" "50" "19" "1220397" "1220397" "subst" "0" "04020" "STK11_000829" "g.1220397C>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1220397_C_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742596" "1" "50" "19" "1220413" "1220413" "subst" "0" "04020" "STK11_000830" "g.1220413G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1220413_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742597" "1" "50" "19" "1220463" "1220463" "subst" "0" "04020" "STK11_000834" "g.1220463A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1220463_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742598" "1" "50" "19" "1220586" "1220586" "subst" "0" "04020" "STK11_000837" "g.1220586C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1220586_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742599" "1" "50" "19" "1220596" "1220596" "subst" "0" "04020" "STK11_000746" "g.1220596C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1220596_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742600" "1" "50" "19" "1220634" "1220634" "subst" "0" "04020" "STK11_000840" "g.1220634G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1220634_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742601" "1" "50" "19" "1221319" "1221319" "subst" "0.000138225" "04020" "STK11_000569" "g.1221319C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1221319_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742602" "1" "50" "19" "1221962" "1221962" "subst" "0" "04020" "STK11_000843" "g.1221962G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1221962_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742603" "1" "50" "19" "1222992" "1222992" "subst" "0" "04020" "STK11_000845" "g.1222992G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1222992_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742604" "1" "50" "19" "1223022" "1223022" "subst" "0" "04020" "STK11_000855" "g.1223022T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223022_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742605" "1" "50" "19" "1223096" "1223096" "subst" "0" "04020" "STK11_000864" "g.1223096C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223096_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742606" "1" "50" "19" "1223130" "1223130" "subst" "0" "04020" "STK11_000868" "g.1223130T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223130_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742607" "1" "50" "19" "1223132" "1223132" "subst" "0" "04020" "STK11_000869" "g.1223132G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223132_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742608" "1" "50" "19" "1223134" "1223134" "subst" "0.00012347" "04020" "STK11_000870" "g.1223134G>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223134_G_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742609" "1" "50" "19" "1223171" "1223171" "subst" "0" "04020" "STK11_000670" "g.1223171G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223171_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742776" "1" "50" "19" "1220423" "1220423" "dup" "0" "04020" "STK11_000831" "g.1220423dup" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1220421_A_AT" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742777" "1" "50" "19" "1220506" "1220580" "del" "0" "04020" "STK11_000836" "g.1220506_1220580del" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1220502_GAGGTAGGCACGTGCTAGGGGGGGCCCTGGGGCGCCCCCTCCCGGGCACTCCCTGAGGGCTGCACGGCACCGCCAC_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742778" "1" "50" "19" "1223004" "1223004" "del" "0" "04020" "STK11_000848" "g.1223004del" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223002_TC_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749795" "1" "50" "19" "1206916" "1206916" "subst" "0" "04020" "STK11_000752" "g.1206916G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1206916_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749796" "1" "50" "19" "1206934" "1206934" "subst" "4.69814E-6" "04020" "STK11_000755" "g.1206934C>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1206934_C_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749797" "1" "50" "19" "1206944" "1206944" "subst" "0" "04020" "STK11_000760" "g.1206944T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1206944_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749798" "1" "50" "19" "1206958" "1206958" "subst" "8.51992E-6" "04020" "STK11_000765" "g.1206958G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1206958_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749799" "1" "50" "19" "1206962" "1206962" "subst" "0" "04020" "STK11_000767" "g.1206962T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1206962_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749800" "1" "50" "19" "1206964" "1206964" "subst" "0" "04020" "STK11_000768" "g.1206964A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1206964_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749801" "1" "50" "19" "1206970" "1206970" "subst" "0" "04020" "STK11_000769" "g.1206970G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1206970_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749802" "1" "50" "19" "1206971" "1206971" "subst" "0" "04020" "STK11_000770" "g.1206971T>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1206971_T_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749803" "1" "50" "19" "1206973" "1206973" "subst" "0" "04020" "STK11_000771" "g.1206973G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1206973_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749804" "1" "50" "19" "1206983" "1206983" "subst" "0" "04020" "STK11_000774" "g.1206983C>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1206983_C_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749805" "1" "50" "19" "1207002" "1207002" "subst" "4.0845E-6" "04020" "STK11_000781" "g.1207002C>G" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1207002_C_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749806" "1" "50" "19" "1207006" "1207006" "subst" "4.08247E-6" "04020" "STK11_000537" "g.1207006A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1207006_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749807" "1" "50" "19" "1207021" "1207021" "subst" "0" "04020" "STK11_000784" "g.1207021C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1207021_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749808" "1" "50" "19" "1207024" "1207024" "subst" "0" "04020" "STK11_000785" "g.1207024C>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1207024_C_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749809" "1" "50" "19" "1207034" "1207034" "subst" "0" "04020" "STK11_000787" "g.1207034A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1207034_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749810" "1" "50" "19" "1207035" "1207035" "subst" "0" "04020" "STK11_000788" "g.1207035G>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1207035_G_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749811" "1" "50" "19" "1207052" "1207052" "subst" "0" "04020" "STK11_000791" "g.1207052G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1207052_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749812" "1" "50" "19" "1207063" "1207063" "subst" "0" "04020" "STK11_000610" "g.1207063A>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1207063_A_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749813" "1" "50" "19" "1207063" "1207063" "subst" "0" "04020" "STK11_000792" "g.1207063A>G" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1207063_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749814" "1" "50" "19" "1207067" "1207067" "subst" "0" "04020" "STK11_000794" "g.1207067G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1207067_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749815" "1" "50" "19" "1207090" "1207090" "subst" "0" "04020" "STK11_000797" "g.1207090T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1207090_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749816" "1" "50" "19" "1207096" "1207096" "subst" "0" "04020" "STK11_000798" "g.1207096A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1207096_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749817" "1" "50" "19" "1207118" "1207118" "subst" "0" "04020" "STK11_000800" "g.1207118C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1207118_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749818" "1" "50" "19" "1207175" "1207175" "subst" "0" "04020" "STK11_000805" "g.1207175T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1207175_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749819" "1" "50" "19" "1218417" "1218417" "subst" "0" "04020" "STK11_000807" "g.1218417G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1218417_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749820" "1" "50" "19" "1218435" "1218435" "subst" "0" "04020" "STK11_000811" "g.1218435A>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1218435_A_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749821" "1" "50" "19" "1218493" "1218493" "subst" "1.2189E-5" "04020" "STK11_000821" "g.1218493A>G" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1218493_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749822" "1" "50" "19" "1218499" "1218499" "subst" "4.06402E-6" "04020" "STK11_000823" "g.1218499T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1218499_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749823" "1" "50" "19" "1219323" "1219323" "subst" "0" "04020" "STK11_000825" "g.1219323G>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1219323_G_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749824" "1" "50" "19" "1219324" "1219324" "subst" "0" "04020" "STK11_000826" "g.1219324T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1219324_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749825" "1" "50" "19" "1220430" "1220430" "subst" "0" "04020" "STK11_000833" "g.1220430A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1220430_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749826" "1" "50" "19" "1220490" "1220490" "subst" "0" "04020" "STK11_000835" "g.1220490C>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1220490_C_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749827" "1" "50" "19" "1220586" "1220586" "subst" "0" "04020" "STK11_000838" "g.1220586C>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1220586_C_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749828" "1" "50" "19" "1220595" "1220595" "subst" "0" "04020" "STK11_000535" "g.1220595G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1220595_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749829" "1" "50" "19" "1220614" "1220614" "subst" "4.55386E-5" "04020" "STK11_000735" "g.1220614G>A" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1220614_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749830" "1" "50" "19" "1221217" "1221217" "subst" "0" "04020" "STK11_000841" "g.1221217A>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1221217_A_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749831" "1" "50" "19" "1221226" "1221226" "subst" "0" "04020" "STK11_000644" "g.1221226C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1221226_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749832" "1" "50" "19" "1221319" "1221319" "subst" "3.3509E-5" "04020" "STK11_000842" "g.1221319C>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1221319_C_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749833" "1" "50" "19" "1221996" "1221996" "subst" "0" "04020" "STK11_000844" "g.1221996G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1221996_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749834" "1" "50" "19" "1222986" "1222986" "subst" "0" "04020" "STK11_000577" "g.1222986G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1222986_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749835" "1" "50" "19" "1222996" "1222996" "subst" "0" "04020" "STK11_000846" "g.1222996G>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1222996_G_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749836" "1" "50" "19" "1222998" "1222998" "subst" "0" "04020" "STK11_000847" "g.1222998A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1222998_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749837" "1" "50" "19" "1223004" "1223004" "subst" "0" "04020" "STK11_000849" "g.1223004C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223004_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749838" "1" "50" "19" "1223009" "1223009" "subst" "0" "04020" "STK11_000851" "g.1223009G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223009_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749839" "1" "50" "19" "1223010" "1223010" "subst" "0" "04020" "STK11_000852" "g.1223010C>G" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223010_C_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749840" "1" "50" "19" "1223010" "1223010" "subst" "0" "04020" "STK11_000853" "g.1223010C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223010_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749841" "1" "50" "19" "1223030" "1223030" "subst" "0" "04020" "STK11_000856" "g.1223030C>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223030_C_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749842" "1" "50" "19" "1223034" "1223034" "subst" "0" "04020" "STK11_000858" "g.1223034C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223034_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749843" "1" "50" "19" "1223054" "1223054" "subst" "0" "04020" "STK11_000860" "g.1223054C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223054_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749844" "1" "50" "19" "1223060" "1223060" "subst" "0" "04020" "STK11_000861" "g.1223060C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223060_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749845" "1" "50" "19" "1223075" "1223075" "subst" "1.69127E-5" "04020" "STK11_000862" "g.1223075G>A" "4/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223075_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749846" "1" "50" "19" "1223103" "1223103" "subst" "0" "04020" "STK11_000867" "g.1223103C>G" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223103_C_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749847" "1" "50" "19" "1223165" "1223165" "subst" "0" "04020" "STK11_000874" "g.1223165G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223165_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749848" "1" "50" "19" "1223169" "1223169" "subst" "0" "04020" "STK11_000875" "g.1223169C>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223169_C_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754690" "1" "50" "19" "1206919" "1206919" "subst" "0" "04020" "STK11_000754" "g.1206919G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1206919_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754691" "1" "50" "19" "1206943" "1206943" "subst" "4.4603E-6" "04020" "STK11_000759" "g.1206943A>T" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1206943_A_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754692" "1" "50" "19" "1206959" "1206959" "subst" "0" "04020" "STK11_000766" "g.1206959A>G" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1206959_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754693" "1" "50" "19" "1206983" "1206983" "subst" "8.23289E-6" "04020" "STK11_000775" "g.1206983C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1206983_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754694" "1" "50" "19" "1207037" "1207037" "subst" "0" "04020" "STK11_000789" "g.1207037G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1207037_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754695" "1" "50" "19" "1207037" "1207037" "subst" "5.70204E-5" "04020" "STK11_000607" "g.1207037G>T" "6/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1207037_G_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754696" "1" "50" "19" "1207065" "1207065" "subst" "0" "04020" "STK11_000793" "g.1207065G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1207065_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754697" "1" "50" "19" "1218441" "1218441" "subst" "8.12354E-6" "04020" "STK11_000812" "g.1218441C>T" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1218441_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754698" "1" "50" "19" "1218480" "1218480" "subst" "4.46878E-5" "04020" "STK11_000818" "g.1218480A>G" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1218480_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754699" "1" "50" "19" "1220379" "1220379" "subst" "0" "04020" "STK11_000550" "g.1220379T>C" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1220379_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754700" "1" "50" "19" "1220466" "1220466" "subst" "0" "04020" "STK11_000534" "g.1220466G>A" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1220466_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754701" "1" "50" "19" "1220473" "1220473" "subst" "4.28064E-5" "04020" "STK11_000501" "g.1220473C>T" "7/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1220473_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754702" "1" "50" "19" "1220587" "1220587" "subst" "0" "04020" "STK11_000839" "g.1220587A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1220587_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754703" "1" "50" "19" "1221294" "1221294" "subst" "8.28054E-6" "04020" "STK11_000647" "g.1221294G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1221294_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754704" "1" "50" "19" "1223007" "1223007" "subst" "0" "04020" "STK11_000850" "g.1223007C>T" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223007_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754705" "1" "50" "19" "1223013" "1223013" "subst" "0" "04020" "STK11_000854" "g.1223013A>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223013_A_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754706" "1" "50" "19" "1223033" "1223033" "subst" "0" "04020" "STK11_000857" "g.1223033C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223033_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754707" "1" "50" "19" "1223042" "1223042" "subst" "0" "04020" "STK11_000859" "g.1223042G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223042_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754708" "1" "50" "19" "1223055" "1223055" "subst" "4.36891E-5" "04020" "STK11_000656" "g.1223055G>A" "5/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223055_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754709" "1" "50" "19" "1223079" "1223079" "subst" "4.21131E-6" "04020" "STK11_000863" "g.1223079C>T" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223079_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754710" "1" "50" "19" "1223090" "1223090" "subst" "1.66561E-5" "04020" "STK11_000659" "g.1223090G>A" "7/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223090_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754711" "1" "50" "19" "1223094" "1223094" "subst" "0" "04020" "C19orf26_000009" "g.1223094T>C" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223094_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754712" "1" "50" "19" "1223099" "1223099" "subst" "1.24259E-5" "04020" "STK11_000865" "g.1223099G>A" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223099_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754713" "1" "50" "19" "1223102" "1223102" "subst" "6.61917E-5" "04020" "STK11_000866" "g.1223102G>A" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223102_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754714" "1" "50" "19" "1223103" "1223103" "subst" "1.65508E-5" "04020" "STK11_000661" "g.1223103C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223103_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754715" "1" "50" "19" "1223108" "1223108" "subst" "4.9527E-5" "04020" "STK11_000663" "g.1223108G>A" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223108_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754716" "1" "50" "19" "1223126" "1223126" "subst" "4.11879E-6" "04020" "STK11_000664" "g.1223126G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223126_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754717" "1" "50" "19" "1223140" "1223140" "subst" "0" "04020" "STK11_000871" "g.1223140C>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223140_C_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754718" "1" "50" "19" "1223150" "1223150" "subst" "4.12752E-6" "04020" "STK11_000666" "g.1223150A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223150_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754719" "1" "50" "19" "1223151" "1223151" "subst" "7.8456E-5" "04020" "STK11_000872" "g.1223151C>T" "5/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223151_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754720" "1" "50" "19" "1223163" "1223163" "subst" "0" "04020" "STK11_000873" "g.1223163C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223163_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759464" "1" "50" "19" "1206919" "1206919" "subst" "0" "04020" "STK11_000754" "g.1206919G>A" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1206919_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759465" "1" "50" "19" "1206943" "1206943" "subst" "4.4603E-6" "04020" "STK11_000759" "g.1206943A>T" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1206943_A_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759466" "1" "50" "19" "1206959" "1206959" "subst" "0" "04020" "STK11_000766" "g.1206959A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1206959_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759467" "1" "50" "19" "1206983" "1206983" "subst" "8.23289E-6" "04020" "STK11_000775" "g.1206983C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1206983_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759468" "1" "50" "19" "1207037" "1207037" "subst" "0" "04020" "STK11_000789" "g.1207037G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1207037_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759469" "1" "50" "19" "1207037" "1207037" "subst" "5.70204E-5" "04020" "STK11_000607" "g.1207037G>T" "4/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1207037_G_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759470" "1" "50" "19" "1207065" "1207065" "subst" "0" "04020" "STK11_000793" "g.1207065G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1207065_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759471" "1" "50" "19" "1218441" "1218441" "subst" "8.12354E-6" "04020" "STK11_000812" "g.1218441C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1218441_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759472" "1" "50" "19" "1218480" "1218480" "subst" "4.46878E-5" "04020" "STK11_000818" "g.1218480A>G" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1218480_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759473" "1" "50" "19" "1220379" "1220379" "subst" "0" "04020" "STK11_000550" "g.1220379T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1220379_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759474" "1" "50" "19" "1220466" "1220466" "subst" "0" "04020" "STK11_000534" "g.1220466G>A" "9/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1220466_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759475" "1" "50" "19" "1220473" "1220473" "subst" "4.28064E-5" "04020" "STK11_000501" "g.1220473C>T" "6/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1220473_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759476" "1" "50" "19" "1220587" "1220587" "subst" "0" "04020" "STK11_000839" "g.1220587A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1220587_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759477" "1" "50" "19" "1221294" "1221294" "subst" "8.28054E-6" "04020" "STK11_000647" "g.1221294G>A" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1221294_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759478" "1" "50" "19" "1223007" "1223007" "subst" "0" "04020" "STK11_000850" "g.1223007C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223007_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759479" "1" "50" "19" "1223013" "1223013" "subst" "0" "04020" "STK11_000854" "g.1223013A>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223013_A_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759480" "1" "50" "19" "1223033" "1223033" "subst" "0" "04020" "STK11_000857" "g.1223033C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223033_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759481" "1" "50" "19" "1223042" "1223042" "subst" "0" "04020" "STK11_000859" "g.1223042G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223042_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759482" "1" "50" "19" "1223055" "1223055" "subst" "4.36891E-5" "04020" "STK11_000656" "g.1223055G>A" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223055_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759483" "1" "50" "19" "1223079" "1223079" "subst" "4.21131E-6" "04020" "STK11_000863" "g.1223079C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223079_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759484" "1" "50" "19" "1223090" "1223090" "subst" "1.66561E-5" "04020" "STK11_000659" "g.1223090G>A" "9/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223090_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759485" "1" "50" "19" "1223094" "1223094" "subst" "0" "04020" "C19orf26_000009" "g.1223094T>C" "4/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223094_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759486" "1" "50" "19" "1223099" "1223099" "subst" "1.24259E-5" "04020" "STK11_000865" "g.1223099G>A" "4/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223099_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759487" "1" "50" "19" "1223102" "1223102" "subst" "6.61917E-5" "04020" "STK11_000866" "g.1223102G>A" "6/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223102_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759488" "1" "50" "19" "1223103" "1223103" "subst" "1.65508E-5" "04020" "STK11_000661" "g.1223103C>T" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223103_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759489" "1" "50" "19" "1223108" "1223108" "subst" "4.9527E-5" "04020" "STK11_000663" "g.1223108G>A" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223108_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759490" "1" "50" "19" "1223126" "1223126" "subst" "4.11879E-6" "04020" "STK11_000664" "g.1223126G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223126_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759491" "1" "50" "19" "1223140" "1223140" "subst" "0" "04020" "STK11_000871" "g.1223140C>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223140_C_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759492" "1" "50" "19" "1223150" "1223150" "subst" "4.12752E-6" "04020" "STK11_000666" "g.1223150A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223150_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759493" "1" "50" "19" "1223151" "1223151" "subst" "7.8456E-5" "04020" "STK11_000872" "g.1223151C>T" "8/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223151_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759494" "1" "50" "19" "1223163" "1223163" "subst" "0" "04020" "STK11_000873" "g.1223163C>T" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr19_1223163_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000808661" "0" "10" "19" "1207238" "1207238" "subst" "0.292004" "02369" "STK11_000716" "g.1207238G>T" "" "" "" "STK11(NM_000455.4):c.290+36G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000808662" "0" "10" "19" "1207280" "1207280" "subst" "0" "02369" "STK11_000876" "g.1207280C>T" "" "" "" "STK11(NM_000455.4):c.290+78C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000808663" "0" "10" "19" "1218523" "1218523" "subst" "0.160922" "02369" "STK11_000545" "g.1218523G>T" "" "" "" "STK11(NM_000455.4):c.374+24G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000808664" "0" "10" "19" "1219428" "1219428" "subst" "0" "02326" "STK11_000877" "g.1219428A>T" "" "" "" "STK11(NM_000455.4):c.464+16A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000808665" "0" "10" "19" "1219452" "1219458" "dup" "0" "02369" "STK11_000594" "g.1219452_1219458dup" "" "" "" "STK11(NM_000455.4):c.464+40_464+46dupGGGGGCC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000808666" "0" "30" "19" "1220518" "1220518" "del" "0.000593411" "02329" "STK11_000554" "g.1220518del" "" "" "" "STK11(NM_000455.5):c.597+14delA" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000808667" "0" "30" "19" "1220573" "1220573" "subst" "7.25449E-5" "02369" "STK11_000555" "g.1220573G>A" "" "" "" "STK11(NM_000455.4):c.598-7G>A, STK11(NM_000455.5):c.598-7G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000808668" "0" "30" "19" "1220736" "1220736" "subst" "0.000130569" "02329" "STK11_000748" "g.1220736G>A" "" "" "" "STK11(NM_000455.4):c.734+20G>A (p.(=)), STK11(NM_000455.5):c.734+20G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000808669" "0" "10" "19" "1220757" "1220757" "subst" "0.0057931" "02327" "STK11_000878" "g.1220757T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000808670" "0" "10" "19" "1222012" "1222012" "subst" "0.186351" "02369" "STK11_000574" "g.1222012G>C" "" "" "" "STK11(NM_000455.4):c.920+7G>C, STK11(NM_000455.5):c.920+7G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000808671" "0" "30" "19" "1226640" "1226640" "subst" "0.000165898" "02329" "STK11_000530" "g.1226640G>A" "" "" "" "STK11(NM_000455.5):c.1296G>A (p.Q432=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000825315" "0" "70" "19" "1207203" "1207203" "subst" "0" "01164" "STK11_000879" "g.1207203G>A" "" "" "" "" "ACMG: PVS1, PS4_MOD, PM2_SUP, PP4" "Germline" "" "" "" "" "" "" "" "pathogenic (dominant)" "ACMG" "0000830390" "0" "90" "19" "0" "0" "" "0" "00006" "NPHS1_000138" "g.?" "" "{PMID:Moreno-Cabrera 2021:33219106}" "" "del ex5-8" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic" "" "0000855434" "0" "10" "19" "1219380" "1219380" "subst" "0" "02329" "STK11_000623" "g.1219380G>A" "" "" "" "STK11(NM_000455.5):c.432G>A (p.P144=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000855435" "0" "30" "19" "1222959" "1222959" "subst" "2.25364E-5" "02327" "STK11_000885" "g.1222959C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000855436" "0" "30" "19" "1226544" "1226544" "subst" "4.49188E-5" "02329" "STK11_000584" "g.1226544G>A" "" "" "" "STK11(NM_000455.5):c.1200G>A (p.L400=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000865851" "0" "50" "19" "1206954" "1206954" "subst" "3.01938E-5" "01804" "STK11_000747" "g.1206954G>A" "" "" "" "STK11(NM_000455.4):c.42G>A (p.(Glu14=)), STK11(NM_000455.5):c.42G>A (p.E14=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000865852" "0" "50" "19" "1220703" "1220703" "subst" "8.36701E-6" "01804" "STK11_000726" "g.1220703G>A" "" "" "" "STK11(NM_000455.4):c.721G>A (p.(Ala241Thr)), STK11(NM_000455.5):c.721G>A (p.A241T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000865853" "0" "30" "19" "1221264" "1221264" "subst" "0.000171441" "02326" "STK11_000566" "g.1221264T>C" "" "" "" "STK11(NM_000455.4):c.787T>C (p.(Leu263=), p.L263=), STK11(NM_000455.5):c.787T>C (p.L263=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000865854" "0" "30" "19" "1221264" "1221264" "subst" "0.000171441" "02329" "STK11_000566" "g.1221264T>C" "" "" "" "STK11(NM_000455.4):c.787T>C (p.(Leu263=), p.L263=), STK11(NM_000455.5):c.787T>C (p.L263=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000865855" "0" "90" "19" "1221316" "1221319" "del" "0" "01943" "STK11_000880" "g.1221316_1221319del" "" "" "" "STK11(NM_000455.4):c.839_842delCCCC (p.P280Rfs*6)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000865856" "0" "90" "19" "1221321" "1221326" "del" "0" "01943" "STK11_000881" "g.1221321_1221326del" "" "" "" "STK11(NM_000455.4):c.844_849delCTCTCT (p.L282_S283del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000865857" "0" "90" "19" "1221328" "1221331" "del" "0" "01943" "STK11_000882" "g.1221328_1221331del" "" "" "" "STK11(NM_000455.4):c.851_854delACCT (p.D284Gfs*2)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000865858" "0" "90" "19" "1221333" "1221333" "subst" "0" "01943" "STK11_000883" "g.1221333C>A" "" "" "" "STK11(NM_000455.4):c.856C>A (p.L286M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000865859" "0" "90" "19" "1221943" "1221979" "del" "0" "01943" "STK11_000884" "g.1221943_1221979del" "" "" "" "STK11(NM_000455.4):c.863-7_892del" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000865860" "0" "30" "19" "1223008" "1223008" "subst" "0.000747089" "01804" "STK11_000578" "g.1223008G>A" "" "" "" "STK11(NM_000455.4):c.945G>A (p.(Pro315=)), STK11(NM_000455.5):c.945G>A (p.P315=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000865861" "0" "10" "19" "1223125" "1223125" "subst" "0.00514848" "02326" "STK11_000527" "g.1223125C>G" "" "" "" "STK11(NM_000455.4):c.1062C>G (p.F354L, p.(Phe354Leu)), STK11(NM_000455.5):c.1062C>G (p.F354L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000865862" "0" "30" "19" "1226555" "1226555" "subst" "0.000428305" "02329" "STK11_000517" "g.1226555C>T" "" "" "" "STK11(NM_000455.5):c.1211C>T (p.S404F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000877449" "0" "70" "19" "1207053" "1207053" "dup" "0" "01164" "STK11_000886" "g.1207053dup" "" "" "" "" "ACMG: PVS1, PM2_SUP" "Germline" "-" "" "0" "" "" "g.1207054dup" "" "likely pathogenic (dominant)" "ACMG" "0000894772" "0" "50" "19" "1218482" "1218482" "subst" "8.12506E-5" "01804" "STK11_000621" "g.1218482C>T" "" "" "" "STK11(NM_000455.4):c.357C>T (p.(Asn119=)), STK11(NM_000455.5):c.357C>T (p.N119=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000894773" "0" "30" "19" "1219316" "1219316" "subst" "7.30628E-5" "02329" "STK11_000887" "g.1219316G>A" "" "" "" "STK11(NM_000455.5):c.375-7G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000894774" "0" "70" "19" "1219342" "1219342" "subst" "0" "02330" "STK11_000888" "g.1219342T>C" "" "" "" "STK11(NM_000455.5):c.394T>C (p.C132R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000894775" "0" "10" "19" "1219421" "1219421" "subst" "0.000571257" "02329" "STK11_000593" "g.1219421G>A" "" "" "" "STK11(NM_000455.5):c.464+9G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000894776" "0" "30" "19" "1219432" "1219432" "del" "0" "02329" "STK11_000889" "g.1219432del" "" "" "" "STK11(NM_000455.5):c.464+20delG" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000894777" "0" "50" "19" "1220466" "1220466" "subst" "0" "01804" "STK11_000534" "g.1220466G>A" "" "" "" "STK11(NM_000455.4):c.559G>A (p.(Gly187Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000894778" "0" "50" "19" "1221281" "1221281" "subst" "0" "02329" "STK11_000890" "g.1221281G>T" "" "" "" "STK11(NM_000455.5):c.804G>T (p.G268=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000894779" "0" "30" "19" "1221302" "1221302" "subst" "0.000207859" "02329" "STK11_000891" "g.1221302G>A" "" "" "" "STK11(NM_000455.5):c.825G>A (p.P275=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000894780" "0" "50" "19" "1221934" "1221934" "subst" "5.96698E-5" "01804" "STK11_000892" "g.1221934C>T" "" "" "" "STK11(NM_000455.4):c.863-14C>T (p.(=)), STK11(NM_000455.5):c.863-14C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000894781" "0" "30" "19" "1222012" "1222012" "subst" "2.41598E-5" "02329" "STK11_000893" "g.1222012G>A" "" "" "" "STK11(NM_000455.5):c.920+7G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000894782" "0" "30" "19" "1226438" "1226438" "subst" "0" "02327" "C19orf26_000010" "g.1226438C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000894783" "0" "30" "19" "1226529" "1226529" "subst" "0.000481542" "01804" "STK11_000583" "g.1226529A>G" "" "" "" "STK11(NM_000455.4):c.1185A>G (p.(Thr395=)), STK11(NM_000455.5):c.1185A>G (p.T395=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000894784" "0" "30" "19" "1226628" "1226628" "subst" "3.67983E-5" "02329" "STK11_000585" "g.1226628G>C" "" "" "" "STK11(NM_000455.4):c.1284G>C (p.S428=), STK11(NM_000455.5):c.1284G>C (p.S428=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000915120" "0" "30" "19" "1218510" "1218510" "subst" "6.50777E-5" "02327" "STK11_000894" "g.1218510C>T" "" "" "" "STK11(NM_000455.5):c.374+11C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000915121" "0" "30" "19" "1220727" "1220727" "subst" "3.4241E-5" "02329" "STK11_000895" "g.1220727C>T" "" "" "" "STK11(NM_000455.5):c.734+11C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000915122" "0" "30" "19" "1221323" "1221323" "subst" "1.25912E-5" "02329" "STK11_000896" "g.1221323C>G" "" "" "" "STK11(NM_000455.5):c.846C>G (p.L282=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000915123" "0" "30" "19" "1221934" "1221934" "subst" "5.96698E-5" "02327" "STK11_000892" "g.1221934C>T" "" "" "" "STK11(NM_000455.4):c.863-14C>T (p.(=)), STK11(NM_000455.5):c.863-14C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000915124" "0" "30" "19" "1226529" "1226529" "subst" "0.000481542" "02327" "STK11_000583" "g.1226529A>G" "" "" "" "STK11(NM_000455.4):c.1185A>G (p.(Thr395=)), STK11(NM_000455.5):c.1185A>G (p.T395=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000915125" "0" "30" "19" "1226596" "1226596" "subst" "1.24707E-5" "02327" "C19orf26_000011" "g.1226596T>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000915126" "0" "30" "19" "1226640" "1226640" "subst" "0.000165898" "02327" "STK11_000530" "g.1226640G>A" "" "" "" "STK11(NM_000455.5):c.1296G>A (p.Q432=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000918616" "0" "70" "19" "1223125" "1223125" "subst" "0.00514848" "04467" "STK11_000527" "g.1223125C>G" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000926805" "0" "30" "19" "1219344" "1219344" "subst" "0" "02329" "STK11_000897" "g.1219344C>T" "" "" "" "STK11(NM_000455.5):c.396C>T (p.C132=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000926806" "0" "30" "19" "1221206" "1221210" "del" "0" "02329" "STK11_000898" "g.1221206_1221210del" "" "" "" "STK11(NM_000455.5):c.735-6_735-2delATGAA" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000926807" "0" "30" "19" "1221934" "1221934" "subst" "5.96698E-5" "02329" "STK11_000892" "g.1221934C>T" "" "" "" "STK11(NM_000455.4):c.863-14C>T (p.(=)), STK11(NM_000455.5):c.863-14C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000926808" "0" "30" "19" "1226669" "1226669" "subst" "4.46239E-5" "02329" "C19orf26_000012" "g.1226669C>T" "" "" "" "STK11(NM_000455.4):c.*16+7C>T (p.(=)), STK11(NM_000455.5):c.*16+7C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000927780" "0" "50" "19" "1221987" "1221987" "subst" "0" "01741" "STK11_000899" "g.1221987G>C" "" "" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.1221988G>C" "" "VUS" "" "0000930995" "0" "30" "19" "1207176" "1207176" "subst" "0.00563163" "01804" "STK11_000540" "g.1207176C>A" "" "" "" "STK11(NM_000455.4):c.264C>A (p.(Ile88=)), STK11(NM_000455.5):c.264C>A (p.I88=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000930996" "0" "30" "19" "1220357" "1220357" "subst" "0" "02327" "STK11_000900" "g.1220357G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000930997" "0" "30" "19" "1221242" "1221242" "subst" "1.22302E-5" "02329" "STK11_000901" "g.1221242C>T" "" "" "" "STK11(NM_000455.5):c.765C>T (p.F255=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000951205" "0" "30" "19" "1207075" "1207075" "subst" "0" "02329" "STK11_000902" "g.1207075C>T" "" "" "" "STK11(NM_000455.5):c.163C>T (p.L55=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000951206" "0" "30" "19" "1207119" "1207119" "subst" "0" "02329" "STK11_000903" "g.1207119G>T" "" "" "" "STK11(NM_000455.5):c.207G>T (p.S69=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000951207" "0" "30" "19" "1218482" "1218482" "subst" "8.12506E-5" "02329" "STK11_000621" "g.1218482C>T" "" "" "" "STK11(NM_000455.4):c.357C>T (p.(Asn119=)), STK11(NM_000455.5):c.357C>T (p.N119=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000951208" "0" "50" "19" "1220393" "1220393" "subst" "0" "01804" "STK11_000625" "g.1220393C>T" "" "" "" "STK11(NM_000455.4):c.486C>T (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000951209" "0" "70" "19" "1220395" "1220395" "subst" "0" "02330" "STK11_000905" "g.1220395G>A" "" "" "" "STK11(NM_000455.5):c.488G>A (p.G163D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000951210" "0" "30" "19" "1220563" "1220563" "subst" "0" "02327" "STK11_000906" "g.1220563G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000951211" "0" "30" "19" "1220597" "1220597" "subst" "2.8957E-5" "02329" "STK11_000632" "g.1220597G>A" "" "" "" "STK11(NM_000455.4):c.615G>A (p.A205=), STK11(NM_000455.5):c.615G>A (p.A205=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000951212" "0" "30" "19" "1220660" "1220660" "subst" "2.91087E-5" "02329" "STK11_000907" "g.1220660C>T" "" "" "" "STK11(NM_000455.5):c.678C>T (p.N226=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000951213" "0" "30" "19" "1221239" "1221239" "subst" "0" "02327" "STK11_000908" "g.1221239C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000951214" "0" "30" "19" "1221979" "1221979" "subst" "0.000188612" "02329" "STK11_000526" "g.1221979C>A" "" "" "" "STK11(NM_000455.5):c.894C>A (p.F298L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000951215" "0" "50" "19" "1226672" "1226672" "subst" "0.00042199" "01804" "STK11_000586" "g.1226672G>A" "" "" "" "STK11(NM_000455.4):c.*16+10G>A (p.(=)), STK11(NM_000455.5):c.*16+10G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000952121" "0" "90" "19" "1220375" "1220375" "subst" "0" "04599" "STK11_000904" "g.1220375C>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.1220376C>A" "527815" "pathogenic" "ACMG" "0000952122" "0" "90" "19" "1220375" "1220375" "subst" "0" "04599" "STK11_000904" "g.1220375C>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.1220376C>A" "527815" "pathogenic" "ACMG" "0000969548" "0" "10" "19" "1212795" "1212795" "subst" "0" "02326" "STK11_000909" "g.1212795G>A" "" "" "" "STK11(NM_000455.4):c.290+5593G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000969549" "0" "30" "19" "1218510" "1218510" "subst" "6.50777E-5" "02329" "STK11_000894" "g.1218510C>T" "" "" "" "STK11(NM_000455.5):c.374+11C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000969550" "0" "30" "19" "1220544" "1220544" "subst" "0.000591357" "02327" "STK11_000910" "g.1220544C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000969551" "0" "30" "19" "1221920" "1221920" "subst" "0" "02327" "STK11_000911" "g.1221920G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000969552" "0" "30" "19" "1222011" "1222011" "subst" "0" "02327" "STK11_000912" "g.1222011C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000969553" "0" "30" "19" "1222037" "1222037" "subst" "0.000679608" "02327" "STK11_000913" "g.1222037G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000969554" "0" "50" "19" "1226491" "1226491" "subst" "0" "02329" "STK11_000672" "g.1226491C>T" "" "" "" "STK11(NM_000455.5):c.1147C>T (p.R383C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000969555" "0" "50" "19" "1226512" "1226512" "subst" "0" "02326" "C19orf26_000007" "g.1226512G>A" "" "" "" "STK11(NM_000455.4):c.1168G>A (p.V390M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000983189" "0" "30" "19" "1206943" "1206943" "subst" "4.4603E-6" "02327" "STK11_000759" "g.1206943A>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000983190" "0" "90" "19" "1207091" "1207091" "dup" "0" "02327" "STK11_000914" "g.1207091dup" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000983191" "0" "50" "19" "1220600" "1220600" "subst" "0" "01804" "STK11_000915" "g.1220600G>T" "" "" "" "STK11(NM_000455.4):c.618G>T (p.(Ala206=)), STK11(NM_000455.5):c.618G>T (p.A206=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000983192" "0" "30" "19" "1220633" "1220633" "subst" "3.44611E-5" "02329" "STK11_000559" "g.1220633G>A" "" "" "" "STK11(NM_000455.5):c.651G>A (p.P217=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000983193" "0" "10" "19" "1220648" "1220648" "subst" "0.000600926" "02329" "STK11_000560" "g.1220648C>T" "" "" "" "STK11(NM_000455.5):c.666C>T (p.P222=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000983194" "0" "30" "19" "1226508" "1226508" "subst" "8.40668E-6" "01804" "C19orf26_000013" "g.1226508G>A" "" "" "" "STK11(NM_000455.4):c.1164G>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000983195" "0" "50" "19" "1226520" "1226520" "subst" "1.69766E-5" "01804" "C19orf26_000014" "g.1226520G>A" "" "" "" "STK11(NM_000455.4):c.1176G>A (p.(Met392Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000983196" "0" "50" "19" "1226524" "1226524" "subst" "1.28009E-5" "02329" "C19orf26_000015" "g.1226524G>A" "" "" "" "STK11(NM_000455.5):c.1180G>A (p.G394S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000983197" "0" "30" "19" "1226538" "1226538" "subst" "0.000240539" "02329" "STK11_000678" "g.1226538G>A" "" "" "" "STK11(NM_000455.5):c.1194G>A (p.A398=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000983198" "0" "50" "19" "1241846" "1241863" "dup" "0" "01804" "ATP5D_000005" "g.1241846_1241863dup" "" "" "" "ATP5F1D(NM_001687.5):c.-4_14dup (p.(Ala5_Leu6insAlaMetLeuProAlaAla))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001004347" "0" "30" "19" "1218518" "1218523" "del" "0" "02329" "STK11_000916" "g.1218518_1218523del" "" "" "" "STK11(NM_000455.5):c.374+19_374+24delGGACCG" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001004348" "0" "50" "19" "1220430" "1220430" "subst" "0" "02329" "STK11_000833" "g.1220430A>G" "" "" "" "STK11(NM_000455.5):c.523A>G (p.K175E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001004349" "0" "30" "19" "1220600" "1220600" "subst" "0" "02329" "STK11_000915" "g.1220600G>T" "" "" "" "STK11(NM_000455.4):c.618G>T (p.(Ala206=)), STK11(NM_000455.5):c.618G>T (p.A206=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001004350" "0" "50" "19" "1220703" "1220703" "subst" "8.36701E-6" "02329" "STK11_000726" "g.1220703G>A" "" "" "" "STK11(NM_000455.4):c.721G>A (p.(Ala241Thr)), STK11(NM_000455.5):c.721G>A (p.A241T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001015740" "0" "30" "19" "1219422" "1219422" "subst" "0.000110522" "02329" "STK11_000917" "g.1219422C>T" "" "" "" "STK11(NM_000455.5):c.464+10C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001015741" "0" "30" "19" "1220572" "1220572" "subst" "0.000364488" "01804" "STK11_000745" "g.1220572C>T" "" "" "" "STK11(NM_000455.4):c.598-8C>T (p.(=)), STK11(NM_000455.5):c.598-8C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001015742" "0" "90" "19" "1220585" "1220586" "dup" "0" "02325" "STK11_000723" "g.1220585_1220586dup" "" "" "" "STK11(NM_000455.4):c.603_604dupGC (p.H202Rfs*86), STK11(NM_000455.5):c.603_604dupGC (p.H202Rfs*86)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001015743" "0" "30" "19" "1223055" "1223055" "subst" "4.36891E-5" "02329" "STK11_000656" "g.1223055G>A" "" "" "" "STK11(NM_000455.5):c.992G>A (p.R331Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001015744" "0" "50" "19" "1226669" "1226669" "subst" "4.46239E-5" "01804" "C19orf26_000012" "g.1226669C>T" "" "" "" "STK11(NM_000455.4):c.*16+7C>T (p.(=)), STK11(NM_000455.5):c.*16+7C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001027170" "0" "30" "19" "1207179" "1207179" "subst" "8.60652E-6" "02329" "STK11_000918" "g.1207179C>T" "" "" "" "STK11(NM_000455.5):c.267C>T (p.P89=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001027171" "0" "30" "19" "1220525" "1220525" "dup" "0" "02329" "STK11_000919" "g.1220525dup" "" "" "" "STK11(NM_000455.5):c.597+21dupG" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001027172" "0" "30" "19" "1220597" "1220597" "subst" "2.8957E-5" "02326" "STK11_000632" "g.1220597G>A" "" "" "" "STK11(NM_000455.4):c.615G>A (p.A205=), STK11(NM_000455.5):c.615G>A (p.A205=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001027173" "0" "30" "19" "1223113" "1223113" "subst" "2.88572E-5" "02329" "C19orf26_000016" "g.1223113C>T" "" "" "" "STK11(NM_000455.5):c.1050C>T (p.D350=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001027174" "0" "30" "19" "1226538" "1226538" "subst" "0.000240539" "02327" "STK11_000678" "g.1226538G>A" "" "" "" "STK11(NM_000455.5):c.1194G>A (p.A398=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001042605" "0" "10" "19" "1206602" "1206602" "subst" "0" "02327" "STK11_000920" "g.1206602C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001042607" "0" "30" "19" "1221264" "1221264" "subst" "0.000171441" "01804" "STK11_000566" "g.1221264T>C" "" "" "" "STK11(NM_000455.4):c.787T>C (p.(Leu263=), p.L263=), STK11(NM_000455.5):c.787T>C (p.L263=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001042608" "0" "50" "19" "1226494" "1226494" "subst" "0" "02329" "STK11_000737" "g.1226494C>T" "" "" "" "STK11(NM_000455.5):c.1150C>T (p.R384W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001049524" "0" "30" "19" "1226520" "1226520" "subst" "1.69766E-5" "03779" "C19orf26_000014" "g.1226520G>A" "" "" "" "" "" "Unknown" "" "rs746930791" "0" "" "" "" "" "likely benign" "" "0001056397" "0" "30" "19" "1221260" "1221260" "subst" "" "02327" "chr19_008519" "g.1221260C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001056398" "0" "50" "19" "1223094" "1223094" "subst" "" "01804" "C19orf26_000009" "g.1223094T>C" "" "" "" "STK11(NM_000455.4):c.1031T>C (p.(Leu344Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes STK11 ## Count = 666 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000021762" "00020464" "55" "566" "0" "566" "0" "c.566C>T" "r.(?)" "p.(Thr189Ile)" "4" "0000035714" "00020464" "75" "151" "0" "162" "0" "c.151_162del" "r.(?)" "p.(Met51_Leu54del)" "1" "0000035715" "00020464" "75" "291" "-1" "291" "-1" "c.291-1G>A" "r.spl" "p.?" "1i" "0000035716" "00020464" "75" "309" "0" "318" "0" "c.309_318del" "r.(?)" "p.(Arg103Serfs*23)" "2" "0000035717" "00020464" "75" "402" "0" "403" "0" "c.402_403dup" "r.(?)" "p.(Gly135Valfs*27)" "3" "0000035718" "00020464" "75" "734" "2" "734" "2" "c.734+2T>C" "r.spl" "p.?" "5i" "0000035719" "00020464" "75" "783" "0" "783" "0" "c.783C>G" "r.(?)" "p.(Tyr261*)" "6" "0000035720" "00020464" "75" "790" "0" "793" "0" "c.790_793dup" "r.(?)" "p.(Glu265Valfs*2)" "6" "0000035721" "00020464" "75" "834" "0" "835" "0" "c.834_835del" "r.(?)" "p.(Cys278Trpfs*6)" "6" "0000035722" "00020464" "75" "862" "0" "862" "0" "c.862G>A" "r.(?)" "p.(Gly288Arg)" "6" "0000035723" "00020464" "75" "866" "0" "866" "0" "c.866T>G" "r.(?)" "p.(Met289Arg)" "7" "0000035724" "00020464" "75" "891" "0" "891" "0" "c.891G>C" "r.(?)" "p.(Arg297Ser)" "7" "0000035725" "00020464" "75" "892" "0" "893" "0" "c.892_893insC" "r.(?)" "p.(Phe298Serfs*20)" "7" "0000035726" "00020464" "75" "907" "0" "915" "0" "c.907_915del" "r.(?)" "p.(Ile303_Gln305del)" "7" "0000035727" "00020464" "75" "904" "0" "904" "0" "c.904C>T" "r.(?)" "p.(Gln302*)" "7" "0000064392" "00020464" "90" "597" "1" "597" "1" "c.597+1G>A" "r.spl?" "p.?" "" "0000064393" "00020464" "90" "508" "0" "508" "0" "c.508C>T" "r.(?)" "p.(Gln170*)" "" "0000064394" "00020464" "50" "1211" "0" "1211" "0" "c.1211C>T" "r.(?)" "p.(Ser404Phe)" "" "0000064395" "00020464" "90" "909" "0" "909" "0" "c.909C>G" "r.(?)" "p.(Ile303Met)" "" "0000064396" "00020464" "90" "869" "0" "869" "0" "c.869T>C" "r.(?)" "p.(Leu290Pro)" "" "0000064397" "00020464" "90" "662" "0" "662" "0" "c.662C>T" "r.(?)" "p.(Pro221Leu)" "" "0000064398" "00020464" "90" "907" "0" "915" "0" "c.907_915del" "r.(?)" "p.(Ile303_Gln305del)" "" "0000149061" "00020464" "00" "31" "0" "31" "0" "c.31A>G" "r.(?)" "p.(Met11Val)" "" "0000149062" "00020464" "00" "559" "0" "559" "0" "c.559G>A" "r.(?)" "p.(Gly187Ser)" "" "0000149063" "00020464" "00" "613" "0" "613" "0" "c.613G>A" "r.(?)" "p.(Ala205Thr)" "" "0000149064" "00020464" "00" "894" "0" "894" "0" "c.894C>A" "r.(?)" "p.(Phe298Leu)" "" "0000149065" "00020464" "00" "1062" "0" "1062" "0" "c.1062C>G" "r.(?)" "p.(Phe354Leu)" "" "0000149066" "00020464" "00" "1062" "0" "1062" "0" "c.1062C>G" "r.(?)" "p.(Phe354Leu)" "" "0000149067" "00020464" "00" "1211" "0" "1211" "0" "c.1211C>T" "r.(?)" "p.(Ser404Phe)" "" "0000149068" "00020464" "00" "1258" "0" "1258" "0" "c.1258G>T" "r.(?)" "p.(Ala420Ser)" "" "0000149069" "00020464" "00" "1284" "0" "1284" "0" "c.1284G>A" "r.(=)" "p.(=)" "" "0000149070" "00020464" "00" "1296" "0" "1296" "0" "c.1296G>A" "r.(=)" "p.(=)" "" "0000149071" "00020464" "00" "1372" "0" "1372" "0" "c.*70C>G" "r.(=)" "p.(=)" "" "0000149072" "00020464" "00" "1474" "0" "1474" "0" "c.*172G>A" "r.(=)" "p.(=)" "" "0000149073" "00020464" "00" "1486" "0" "1486" "0" "c.*184G>A" "r.(=)" "p.(=)" "" "0000149074" "00020464" "00" "1504" "0" "1504" "0" "c.*202C>G" "r.(=)" "p.(=)" "" "0000149075" "00020464" "00" "1650" "0" "1650" "0" "c.*348C>G" "r.(=)" "p.(=)" "" "0000149076" "00020464" "00" "1660" "0" "1660" "0" "c.*358G>C" "r.(=)" "p.(=)" "" "0000149077" "00020464" "00" "1796" "0" "1796" "0" "c.*494T>A" "r.(=)" "p.(=)" "" "0000149167" "00020464" "00" "1062" "0" "1062" "0" "c.1062C>G" "r.(?)" "p.(Phe354Leu)" "" "0000163908" "00020464" "90" "716" "0" "716" "0" "c.716G>A" "r.(?)" "p.(Trp239*)" "5" "0000247612" "00020464" "30" "1185" "0" "1185" "0" "c.1185A>G" "r.(?)" "p.(Thr395=)" "" "0000247621" "00020464" "30" "597" "14" "597" "14" "c.597+14del" "r.(=)" "p.(=)" "" "0000249726" "00020464" "50" "1127" "0" "1127" "0" "c.1127A>C" "r.(?)" "p.(Glu376Ala)" "" "0000255461" "00020464" "90" "712" "0" "712" "0" "c.712A>T" "r.(?)" "p.(Ile238Phe)" "" "0000255469" "00020464" "90" "370" "0" "370" "0" "c.370A>T" "r.(?)" "p.(Lys124Ter)" "" "0000255550" "00020464" "90" "326" "0" "326" "0" "c.326del" "r.(?)" "p.(Asn109MetfsTer20)" "" "0000255768" "00020464" "90" "291" "-2" "291" "-2" "c.291-2A>G" "r.spl?" "p.?" "" "0000255769" "00020464" "90" "465" "-2" "465" "-2" "c.465-2A>T" "r.spl?" "p.?" "" "0000256551" "00020464" "50" "94" "0" "94" "0" "c.94A>G" "r.(?)" "p.(Thr32Ala)" "" "0000308859" "00020464" "10" "1062" "0" "1062" "0" "c.1062C>G" "r.(?)" "p.(Phe354Leu)" "" "0000308860" "00020464" "30" "1296" "0" "1296" "0" "c.1296G>A" "r.(?)" "p.(Gln432=)" "" "0000308861" "00020464" "10" "264" "0" "264" "0" "c.264C>A" "r.(?)" "p.(Ile88=)" "" "0000308862" "00020464" "30" "448" "0" "448" "0" "c.448G>A" "r.(?)" "p.(Val150Met)" "" "0000308863" "00020464" "30" "598" "-7" "598" "-7" "c.598-7G>A" "r.(=)" "p.(=)" "" "0000308864" "00020464" "30" "617" "0" "617" "0" "c.617C>T" "r.(?)" "p.(Ala206Val)" "" "0000308865" "00020464" "10" "666" "0" "666" "0" "c.666C>T" "r.(?)" "p.(Pro222=)" "" "0000308866" "00020464" "10" "816" "0" "816" "0" "c.816C>T" "r.(?)" "p.(Tyr272=)" "" "0000308867" "00020464" "10" "920" "7" "920" "7" "c.920+7G>C" "r.(=)" "p.(=)" "" "0000311582" "00020464" "10" "1062" "0" "1062" "0" "c.1062C>G" "r.(?)" "p.(Phe354Leu)" "" "0000311583" "00020464" "30" "1109" "-3" "1109" "-3" "c.1109-3C>T" "r.spl?" "p.?" "" "0000311584" "00020464" "30" "1154" "0" "1154" "0" "c.1154G>C" "r.(?)" "p.(Gly385Ala)" "" "0000311585" "00020464" "30" "1200" "0" "1200" "0" "c.1200G>A" "r.(?)" "p.(Leu400=)" "" "0000311586" "00020464" "30" "1296" "0" "1296" "0" "c.1296G>A" "r.(?)" "p.(Gln432=)" "" "0000311587" "00020464" "30" "375" "-8" "375" "-8" "c.375-8C>T" "r.(=)" "p.(=)" "" "0000311588" "00020464" "90" "597" "1" "597" "1" "c.597+1G>T" "r.spl?" "p.?" "" "0000311589" "00020464" "30" "787" "0" "787" "0" "c.787T>C" "r.(?)" "p.(Leu263=)" "" "0000311590" "00020464" "10" "920" "7" "920" "7" "c.920+7G>C" "r.(=)" "p.(=)" "" "0000311591" "00020464" "30" "945" "0" "945" "0" "c.945G>A" "r.(?)" "p.(Pro315=)" "" "0000313198" "00020464" "10" "1318" "10" "1318" "10" "c.*16+10G>A" "r.(=)" "p.(=)" "" "0000313199" "00020464" "10" "1062" "0" "1062" "0" "c.1062C>G" "r.(?)" "p.(Phe354Leu)" "" "0000313200" "00020464" "10" "264" "0" "264" "0" "c.264C>A" "r.(?)" "p.(Ile88=)" "" "0000313201" "00020464" "30" "472" "0" "472" "0" "c.472T>C" "r.(?)" "p.(Cys158Arg)" "" "0000313202" "00020464" "30" "759" "0" "759" "0" "c.759C>T" "r.(?)" "p.(Tyr253=)" "" "0000313203" "00020464" "30" "816" "0" "816" "0" "c.816C>T" "r.(?)" "p.(Tyr272=)" "" "0000313204" "00020464" "30" "842" "0" "842" "0" "c.842C>T" "r.(?)" "p.(Pro281Leu)" "" "0000315830" "00020464" "10" "1062" "0" "1062" "0" "c.1062C>G" "r.(?)" "p.(Phe354Leu)" "" "0000315831" "00020464" "10" "1284" "0" "1284" "0" "c.1284G>C" "r.(?)" "p.(Ser428=)" "" "0000315832" "00020464" "90" "156" "0" "157" "0" "c.156_157dup" "r.(?)" "p.(Asp53GlyfsTer12)" "" "0000315833" "00020464" "90" "165" "0" "175" "0" "c.165_175del" "r.(?)" "p.(Gly56LeufsTer103)" "" "0000315834" "00020464" "90" "290" "1" "290" "1" "c.290+1G>C" "r.spl?" "p.?" "" "0000315835" "00020464" "90" "298" "0" "298" "0" "c.298C>T" "r.(?)" "p.(Gln100Ter)" "" "0000315836" "00020464" "10" "374" "24" "374" "24" "c.374+24G>T" "r.(=)" "p.(=)" "" "0000315837" "00020464" "90" "464" "1" "464" "1" "c.464+1dup" "r.spl?" "p.?" "" "0000315838" "00020464" "90" "468" "0" "468" "0" "c.468C>G" "r.(?)" "p.(Tyr156Ter)" "" "0000315839" "00020464" "90" "580" "0" "580" "0" "c.580G>A" "r.(?)" "p.(Asp194Asn)" "" "0000315840" "00020464" "70" "582" "0" "582" "0" "c.582C>A" "r.(?)" "p.(Asp194Glu)" "" "0000315842" "00020464" "90" "64" "0" "73" "0" "c.64_73del" "r.(?)" "p.(Met22SerfsTer26)" "" "0000315843" "00020464" "90" "650" "0" "650" "0" "c.650del" "r.(?)" "p.(Pro217ArgfsTer70)" "" "0000315844" "00020464" "90" "725" "0" "725" "0" "c.725G>T" "r.(?)" "p.(Gly242Val)" "" "0000315845" "00020464" "90" "727" "0" "727" "0" "c.727del" "r.(?)" "p.(Val243SerfsTer44)" "" "0000315846" "00020464" "90" "734" "5" "734" "5" "c.734+5G>A" "r.spl?" "p.?" "" "0000315847" "00020464" "90" "839" "0" "856" "0" "c.839_856delinsGGGA" "r.(?)" "p.(Pro280ArgfsTer7)" "" "0000315848" "00020464" "90" "862" "2" "862" "2" "c.862+2T>C" "r.spl?" "p.?" "" "0000315849" "00020464" "90" "908" "0" "908" "0" "c.908T>A" "r.(?)" "p.(Ile303Asn)" "" "0000315850" "00020464" "90" "910" "0" "910" "0" "c.910C>T" "r.(?)" "p.(Arg304Trp)" "" "0000315851" "00020464" "90" "910" "0" "910" "0" "c.910del" "r.(?)" "p.(Arg304GlyfsTer32)" "" "0000315852" "00020464" "10" "920" "7" "920" "7" "c.920+7G>C" "r.(=)" "p.(=)" "" "0000315853" "00020464" "90" "921" "-12" "921" "-12" "c.921-12G>A" "r.(=)" "p.(=)" "" "0000315854" "00020464" "90" "921" "-1" "921" "-1" "c.921-1G>C" "r.spl?" "p.?" "" "0000315855" "00020464" "90" "923" "0" "923" "0" "c.923G>A" "r.(?)" "p.(Trp308Ter)" "" "0000315856" "00020464" "90" "991" "0" "991" "0" "c.991dup" "r.(?)" "p.(Arg331ProfsTer29)" "" "0000337054" "00020464" "30" "464" "9" "464" "9" "c.464+9G>A" "r.(=)" "p.(=)" "" "0000337058" "00020464" "30" "597" "9" "597" "9" "c.597+9G>A" "r.(=)" "p.(=)" "" "0000337059" "00020464" "90" "598" "-2" "598" "-2" "c.598-2A>G" "r.spl?" "p.?" "" "0000337060" "00020464" "90" "598" "-2" "598" "-2" "c.598-2A>C" "r.spl?" "p.?" "" "0000337061" "00020464" "90" "735" "-1" "735" "-1" "c.735-1G>A" "r.spl?" "p.?" "" "0000337062" "00020464" "10" "920" "7" "920" "7" "c.920+7G>C" "r.(=)" "p.(=)" "" "0000337064" "00020464" "90" "921" "-12" "921" "-12" "c.921-12G>A" "r.(=)" "p.(=)" "" "0000337065" "00020464" "30" "1109" "-3" "1109" "-3" "c.1109-3C>T" "r.spl?" "p.?" "" "0000339329" "00020464" "10" "264" "0" "264" "0" "c.264C>A" "r.(?)" "p.(Ile88=)" "" "0000342587" "00020464" "90" "910" "0" "910" "0" "c.910C>T" "r.(?)" "p.(Arg304Trp)" "" "0000347078" "00020464" "90" "869" "0" "869" "0" "c.869T>C" "r.(?)" "p.(Leu290Pro)" "" "0000348992" "00020464" "10" "1211" "0" "1211" "0" "c.1211C>T" "r.(?)" "p.(Ser404Phe)" "" "0000403558" "00020464" "50" "39" "0" "39" "0" "c.39G>C" "r.(?)" "p.(=)" "1" "0000403559" "00020464" "50" "65" "0" "65" "0" "c.65T>C" "r.(?)" "p.(Met22Thr)" "1" "0000403560" "00020464" "10" "96" "0" "96" "0" "c.96C>G" "r.(?)" "p.(=)" "1" "0000403561" "00020464" "10" "96" "0" "96" "0" "c.96C>G" "r.(?)" "p.(=)" "1" "0000403562" "00020464" "50" "119" "0" "119" "0" "c.119G>A" "r.(?)" "p.(Arg40His)" "1" "0000403563" "00020464" "50" "120" "0" "120" "0" "c.120C>A" "r.(?)" "p.(=)" "1" "0000403564" "00020464" "50" "125" "0" "125" "0" "c.125G>T" "r.(?)" "p.(Arg42Leu)" "1" "0000403565" "00020464" "50" "125" "0" "125" "0" "c.125G>T" "r.(?)" "p.(Arg42Leu)" "1" "0000403566" "00020464" "50" "151" "0" "151" "0" "c.151A>C" "r.(?)" "p.(Met51Leu)" "1" "0000403567" "00020464" "50" "174" "0" "174" "0" "c.174C>T" "r.(?)" "p.(=)" "1" "0000403568" "00020464" "50" "243" "0" "243" "0" "c.243G>A" "r.(?)" "p.(=)" "1" "0000403569" "00020464" "50" "243" "0" "243" "0" "c.243G>A" "r.(?)" "p.(=)" "1" "0000403570" "00020464" "50" "249" "0" "249" "0" "c.249G>A" "r.(?)" "p.(=)" "1" "0000403571" "00020464" "50" "264" "0" "264" "0" "c.264C>T" "r.(?)" "p.(=)" "1" "0000403572" "00020464" "50" "340" "0" "340" "0" "c.340G>A" "r.(?)" "p.(Val114Met)" "2" "0000403573" "00020464" "50" "352" "0" "352" "0" "c.352T>C" "r.(?)" "p.(Tyr118His)" "2" "0000403574" "00020464" "50" "357" "0" "357" "0" "c.357C>T" "r.(?)" "p.(=)" "2" "0000403575" "00020464" "50" "399" "0" "399" "0" "c.399G>T" "r.(?)" "p.(=)" "3" "0000403576" "00020464" "10" "432" "0" "432" "0" "c.432G>A" "r.(?)" "p.(=)" "3" "0000403577" "00020464" "10" "459" "0" "459" "0" "c.459C>T" "r.(?)" "p.(=)" "3" "0000403578" "00020464" "50" "486" "0" "486" "0" "c.486C>T" "r.(?)" "p.(=)" "4" "0000403579" "00020464" "50" "486" "0" "486" "0" "c.486C>T" "r.(?)" "p.(=)" "4" "0000403580" "00020464" "50" "522" "0" "522" "0" "c.522C>T" "r.(?)" "p.(=)" "4" "0000403581" "00020464" "50" "559" "0" "559" "0" "c.559G>A" "r.(?)" "p.(Gly187Ser)" "4" "0000403582" "00020464" "50" "559" "0" "559" "0" "c.559G>A" "r.(?)" "p.(Gly187Ser)" "4" "0000403583" "00020464" "50" "566" "0" "566" "0" "c.566C>T" "r.(?)" "p.(Thr189Ile)" "4" "0000403584" "00020464" "50" "566" "0" "566" "0" "c.566C>T" "r.(?)" "p.(Thr189Ile)" "4" "0000403585" "00020464" "50" "576" "0" "576" "0" "c.576C>G" "r.(?)" "p.(Ile192Met)" "4" "0000403586" "00020464" "50" "600" "0" "600" "0" "c.600A>G" "r.(?)" "p.(=)" "5" "0000403587" "00020464" "50" "606" "0" "606" "0" "c.606C>G" "r.(?)" "p.(His202Gln)" "5" "0000403588" "00020464" "50" "608" "0" "608" "0" "c.608C>T" "r.(?)" "p.(Pro203Leu)" "5" "0000403589" "00020464" "50" "615" "0" "615" "0" "c.615G>A" "r.(?)" "p.(=)" "5" "0000403590" "00020464" "50" "617" "0" "617" "0" "c.617C>T" "r.(?)" "p.(Ala206Val)" "5" "0000403591" "00020464" "10" "621" "0" "621" "0" "c.621C>T" "r.(?)" "p.(=)" "5" "0000403592" "00020464" "10" "630" "0" "630" "0" "c.630C>T" "r.(?)" "p.(=)" "5" "0000403593" "00020464" "10" "663" "0" "663" "0" "c.663G>A" "r.(?)" "p.(=)" "5" "0000403594" "00020464" "10" "663" "0" "663" "0" "c.663G>A" "r.(?)" "p.(=)" "5" "0000403595" "00020464" "50" "688" "0" "688" "0" "c.688A>G" "r.(?)" "p.(Thr230Ala)" "5" "0000403596" "00020464" "10" "720" "0" "720" "0" "c.720G>A" "r.(?)" "p.(=)" "5" "0000403597" "00020464" "50" "721" "0" "721" "0" "c.721G>T" "r.(?)" "p.(Ala241Ser)" "5" "0000403598" "00020464" "10" "723" "0" "723" "0" "c.723T>C" "r.(?)" "p.(=)" "5" "0000403599" "00020464" "10" "723" "0" "723" "0" "c.723T>C" "r.(?)" "p.(=)" "5" "0000403600" "00020464" "50" "741" "0" "741" "0" "c.741C>T" "r.(?)" "p.(=)" "6" "0000403601" "00020464" "50" "749" "0" "749" "0" "c.749C>T" "r.(?)" "p.(Thr250Met)" "6" "0000403602" "00020464" "50" "801" "0" "801" "0" "c.801C>T" "r.(?)" "p.(=)" "6" "0000403603" "00020464" "50" "817" "0" "817" "0" "c.817G>A" "r.(?)" "p.(Ala273Thr)" "6" "0000403604" "00020464" "50" "817" "0" "817" "0" "c.817G>A" "r.(?)" "p.(Ala273Thr)" "6" "0000403605" "00020464" "50" "829" "0" "829" "0" "c.829G>A" "r.(?)" "p.(Asp277Asn)" "6" "0000403606" "00020464" "50" "834" "0" "834" "0" "c.834T>C" "r.(?)" "p.(=)" "6" "0000403607" "00020464" "10" "842" "0" "842" "0" "c.842C>T" "r.(?)" "p.(Pro281Leu)" "6" "0000403608" "00020464" "10" "842" "0" "842" "0" "c.842C>T" "r.(?)" "p.(Pro281Leu)" "6" "0000403609" "00020464" "10" "876" "0" "876" "0" "c.876C>T" "r.(?)" "p.(=)" "7" "0000403610" "00020464" "10" "876" "0" "876" "0" "c.876C>T" "r.(?)" "p.(=)" "7" "0000403611" "00020464" "10" "882" "0" "882" "0" "c.882G>A" "r.(?)" "p.(=)" "7" "0000403612" "00020464" "50" "928" "0" "928" "0" "c.928C>T" "r.(?)" "p.(Arg310Trp)" "8" "0000403613" "00020464" "50" "960" "0" "960" "0" "c.960G>T" "r.(?)" "p.(=)" "8" "0000403614" "00020464" "50" "960" "0" "960" "0" "c.960G>T" "r.(?)" "p.(=)" "8" "0000403615" "00020464" "50" "992" "0" "992" "0" "c.992G>A" "r.(?)" "p.(Arg331Gln)" "8" "0000403616" "00020464" "10" "1017" "0" "1017" "0" "c.1017G>A" "r.(?)" "p.(=)" "8" "0000403617" "00020464" "50" "1025" "0" "1025" "0" "c.1025A>T" "r.(?)" "p.(Glu342Val)" "8" "0000403618" "00020464" "50" "1027" "0" "1027" "0" "c.1027G>A" "r.(?)" "p.(Asp343Asn)" "8" "0000403619" "00020464" "50" "1035" "0" "1035" "0" "c.1035C>A" "r.(?)" "p.(His345Gln)" "8" "0000403620" "00020464" "50" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Ala347Val)" "8" "0000403621" "00020464" "10" "1044" "0" "1044" "0" "c.1044C>T" "r.(?)" "p.(=)" "8" "0000403622" "00020464" "10" "1044" "0" "1044" "0" "c.1044C>T" "r.(?)" "p.(=)" "8" "0000403623" "00020464" "50" "1045" "0" "1045" "0" "c.1045G>A" "r.(?)" "p.(Glu349Lys)" "8" "0000403624" "00020464" "50" "1045" "0" "1045" "0" "c.1045G>A" "r.(?)" "p.(Glu349Lys)" "8" "0000403625" "00020464" "10" "1062" "0" "1062" "0" "c.1062C>G" "r.(?)" "p.(Phe354Leu)" "8" "0000403626" "00020464" "10" "1062" "0" "1062" "0" "c.1062C>G" "r.(?)" "p.(Phe354Leu)" "8" "0000403627" "00020464" "50" "1063" "0" "1063" "0" "c.1063G>A" "r.(?)" "p.(Asp355Asn)" "8" "0000403628" "00020464" "50" "1087" "0" "1087" "0" "c.1087A>G" "r.(?)" "p.(Thr363Ala)" "8" "0000403629" "00020464" "50" "1089" "0" "1089" "0" "c.1089T>G" "r.(?)" "p.(=)" "8" "0000403630" "00020464" "90" "1090" "0" "1090" "0" "c.1090C>T" "r.(?)" "p.(Gln364*)" "8" "0000403631" "00020464" "50" "1108" "0" "1108" "0" "c.1108G>A" "r.(?)" "p.(Gly370Arg)" "8" "0000403632" "00020464" "50" "1140" "0" "1140" "0" "c.1140T>C" "r.(?)" "p.(=)" "9" "0000403633" "00020464" "50" "1147" "0" "1147" "0" "c.1147C>T" "r.(?)" "p.(Arg383Cys)" "9" "0000403634" "00020464" "10" "1190" "0" "1190" "0" "c.1190C>T" "r.(?)" "p.(Ala397Val)" "9" "0000403635" "00020464" "10" "1190" "0" "1190" "0" "c.1190C>T" "r.(?)" "p.(Ala397Val)" "9" "0000403636" "00020464" "10" "1191" "0" "1191" "0" "c.1191G>A" "r.(?)" "p.(=)" "9" "0000403637" "00020464" "10" "1191" "0" "1191" "0" "c.1191G>A" "r.(?)" "p.(=)" "9" "0000403638" "00020464" "50" "1192" "0" "1192" "0" "c.1192G>A" "r.(?)" "p.(Ala398Thr)" "9" "0000403639" "00020464" "10" "1194" "0" "1194" "0" "c.1194G>A" "r.(?)" "p.(=)" "9" "0000403640" "00020464" "50" "1225" "0" "1225" "0" "c.1225C>T" "r.(?)" "p.(Arg409Trp)" "9" "0000403641" "00020464" "50" "1225" "0" "1225" "0" "c.1225C>T" "r.(?)" "p.(Arg409Trp)" "9" "0000403642" "00020464" "10" "1230" "0" "1230" "0" "c.1230C>T" "r.(?)" "p.(=)" "9" "0000403643" "00020464" "50" "1238" "0" "1238" "0" "c.1238C>G" "r.(?)" "p.(Pro413Arg)" "9" "0000403644" "00020464" "50" "1244" "0" "1244" "0" "c.1244G>A" "r.(?)" "p.(Arg415His)" "9" "0000403645" "00020464" "10" "1257" "0" "1257" "0" "c.1257C>T" "r.(?)" "p.(=)" "9" "0000403646" "00020464" "50" "1273" "0" "1273" "0" "c.1273C>G" "r.(?)" "p.(Arg425Gly)" "9" "0000403647" "00020464" "50" "1276" "0" "1276" "0" "c.1276C>T" "r.(?)" "p.(Arg426Trp)" "9" "0000403648" "00020464" "50" "1276" "0" "1276" "0" "c.1276C>T" "r.(?)" "p.(Arg426Trp)" "9" "0000403649" "00020464" "50" "1277" "0" "1277" "0" "c.1277G>A" "r.(?)" "p.(Arg426Gln)" "9" "0000403650" "00020464" "50" "1277" "0" "1277" "0" "c.1277G>A" "r.(?)" "p.(Arg426Gln)" "9" "0000403651" "00020464" "50" "1283" "0" "1283" "0" "c.1283C>G" "r.(?)" "p.(Ser428Trp)" "9" "0000403652" "00020464" "10" "1284" "0" "1284" "0" "c.1284G>A" "r.(?)" "p.(=)" "9" "0000405513" "00020464" "10" "96" "0" "96" "0" "c.96C>G" "r.(?)" "p.(=)" "" "0000405514" "00020464" "10" "842" "0" "842" "0" "c.842C>T" "r.(?)" "p.(Pro281Leu)" "" "0000405515" "00020464" "10" "842" "0" "842" "0" "c.842C>T" "r.(?)" "p.(Pro281Leu)" "" "0000405516" "00020464" "10" "1062" "0" "1062" "0" "c.1062C>G" "r.(?)" "p.(Phe354Leu)" "" "0000405517" "00020464" "10" "1062" "0" "1062" "0" "c.1062C>G" "r.(?)" "p.(Phe354Leu)" "" "0000406472" "00020464" "10" "96" "0" "96" "0" "c.96C>G" "r.(?)" "p.(=)" "" "0000406473" "00020464" "10" "842" "0" "842" "0" "c.842C>T" "r.(?)" "p.(Pro281Leu)" "" "0000406474" "00020464" "10" "1062" "0" "1062" "0" "c.1062C>G" "r.(?)" "p.(Phe354Leu)" "" "0000406475" "00020464" "10" "1062" "0" "1062" "0" "c.1062C>G" "r.(?)" "p.(Phe354Leu)" "" "0000407709" "00020464" "50" "38" "0" "38" "0" "c.38C>T" "r.(?)" "p.(Thr13Met)" "" "0000407710" "00020464" "50" "39" "0" "39" "0" "c.39G>C" "r.(?)" "p.(=)" "" "0000407711" "00020464" "50" "66" "0" "66" "0" "c.66G>C" "r.(?)" "p.(Met22Ile)" "" "0000407712" "00020464" "10" "96" "0" "96" "0" "c.96C>G" "r.(?)" "p.(=)" "" "0000407713" "00020464" "10" "96" "0" "96" "0" "c.96C>G" "r.(?)" "p.(=)" "" "0000407714" "00020464" "50" "107" "0" "107" "0" "c.107A>G" "r.(?)" "p.(Tyr36Cys)" "" "0000407715" "00020464" "50" "125" "0" "125" "0" "c.125G>T" "r.(?)" "p.(Arg42Leu)" "" "0000407716" "00020464" "50" "126" "0" "126" "0" "c.126G>C" "r.(?)" "p.(=)" "" "0000407717" "00020464" "50" "138" "0" "138" "0" "c.138C>G" "r.(?)" "p.(Ile46Met)" "" "0000407718" "00020464" "50" "158" "0" "158" "0" "c.158A>G" "r.(?)" "p.(Asp53Gly)" "" "0000407719" "00020464" "50" "222" "0" "222" "0" "c.222G>T" "r.(?)" "p.(Arg74Ser)" "" "0000407720" "00020464" "50" "231" "0" "231" "0" "c.231C>T" "r.(?)" "p.(=)" "" "0000407721" "00020464" "50" "243" "0" "243" "0" "c.243G>A" "r.(?)" "p.(=)" "" "0000407722" "00020464" "50" "270" "0" "270" "0" "c.270C>T" "r.(?)" "p.(=)" "" "0000407723" "00020464" "50" "340" "0" "340" "0" "c.340G>A" "r.(?)" "p.(Val114Met)" "" "0000407724" "00020464" "50" "486" "0" "486" "0" "c.486C>T" "r.(?)" "p.(=)" "" "0000407725" "00020464" "50" "513" "0" "513" "0" "c.513C>T" "r.(?)" "p.(=)" "" "0000407726" "00020464" "50" "522" "0" "522" "0" "c.522C>T" "r.(?)" "p.(=)" "" "0000407727" "00020464" "50" "559" "0" "559" "0" "c.559G>A" "r.(?)" "p.(Gly187Ser)" "" "0000407728" "00020464" "50" "566" "0" "566" "0" "c.566C>T" "r.(?)" "p.(Thr189Ile)" "" "0000407729" "00020464" "50" "608" "0" "608" "0" "c.608C>T" "r.(?)" "p.(Pro203Leu)" "" "0000407730" "00020464" "50" "617" "0" "617" "0" "c.617C>T" "r.(?)" "p.(Ala206Val)" "" "0000407731" "00020464" "10" "630" "0" "630" "0" "c.630C>T" "r.(?)" "p.(=)" "" "0000407732" "00020464" "50" "699" "0" "699" "0" "c.699C>T" "r.(?)" "p.(=)" "" "0000407733" "00020464" "90" "718" "0" "718" "0" "c.718T>G" "r.(?)" "p.(Ser240Ala)" "" "0000407734" "00020464" "10" "723" "0" "723" "0" "c.723T>C" "r.(?)" "p.(=)" "" "0000407735" "00020464" "50" "726" "0" "726" "0" "c.726G>A" "r.(?)" "p.(=)" "" "0000407736" "00020464" "50" "750" "0" "750" "0" "c.750G>A" "r.(?)" "p.(=)" "" "0000407737" "00020464" "50" "801" "0" "801" "0" "c.801C>T" "r.(?)" "p.(=)" "" "0000407738" "00020464" "50" "817" "0" "817" "0" "c.817G>A" "r.(?)" "p.(Ala273Thr)" "" "0000407739" "00020464" "10" "842" "0" "842" "0" "c.842C>T" "r.(?)" "p.(Pro281Leu)" "" "0000407740" "00020464" "10" "842" "0" "842" "0" "c.842C>T" "r.(?)" "p.(Pro281Leu)" "" "0000407741" "00020464" "10" "876" "0" "876" "0" "c.876C>T" "r.(?)" "p.(=)" "" "0000407742" "00020464" "50" "878" "0" "878" "0" "c.878A>C" "r.(?)" "p.(Glu293Ala)" "" "0000407743" "00020464" "10" "972" "0" "972" "0" "c.972G>A" "r.(?)" "p.(=)" "" "0000407744" "00020464" "50" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Ala347Val)" "" "0000407745" "00020464" "10" "1044" "0" "1044" "0" "c.1044C>T" "r.(?)" "p.(=)" "" "0000407746" "00020464" "50" "1045" "0" "1045" "0" "c.1045G>A" "r.(?)" "p.(Glu349Lys)" "" "0000407747" "00020464" "10" "1062" "0" "1062" "0" "c.1062C>G" "r.(?)" "p.(Phe354Leu)" "" "0000407748" "00020464" "10" "1062" "0" "1062" "0" "c.1062C>G" "r.(?)" "p.(Phe354Leu)" "" "0000407749" "00020464" "50" "1063" "0" "1063" "0" "c.1063G>A" "r.(?)" "p.(Asp355Asn)" "" "0000407750" "00020464" "50" "1073" "0" "1073" "0" "c.1073A>G" "r.(?)" "p.(Asp358Gly)" "" "0000407751" "00020464" "50" "1107" "0" "1107" "0" "c.1107C>T" "r.(?)" "p.(=)" "" "0000407752" "00020464" "50" "1175" "0" "1175" "0" "c.1175T>C" "r.(?)" "p.(Met392Thr)" "" "0000407753" "00020464" "50" "1179" "0" "1179" "0" "c.1179C>G" "r.(?)" "p.(Asn393Lys)" "" "0000407754" "00020464" "10" "1190" "0" "1190" "0" "c.1190C>T" "r.(?)" "p.(Ala397Val)" "" "0000407755" "00020464" "10" "1191" "0" "1191" "0" "c.1191G>A" "r.(?)" "p.(=)" "" "0000407756" "00020464" "50" "1192" "0" "1192" "0" "c.1192G>A" "r.(?)" "p.(Ala398Thr)" "" "0000407757" "00020464" "50" "1226" "0" "1226" "0" "c.1226G>A" "r.(?)" "p.(Arg409Gln)" "" "0000407758" "00020464" "50" "1238" "0" "1238" "0" "c.1238C>G" "r.(?)" "p.(Pro413Arg)" "" "0000407759" "00020464" "50" "1276" "0" "1276" "0" "c.1276C>T" "r.(?)" "p.(Arg426Trp)" "" "0000407760" "00020464" "50" "1277" "0" "1277" "0" "c.1277G>A" "r.(?)" "p.(Arg426Gln)" "" "0000408641" "00020464" "50" "-1115" "0" "1318" "0" "c.(?_-1115)_(*16_?)del" "r.0?" "p.0?" "_1_9i_" "0000408642" "00020464" "50" "-1115" "0" "290" "1" "c.(?_-1115)_(290+1_291-1)del" "r.0?" "p.0?" "_1_1i" "0000408643" "00020464" "50" "180" "0" "180" "0" "c.180C>A" "r.(?)" "p.(Tyr60*)" "?" "0000408644" "00020464" "50" "212" "0" "212" "0" "c.212del" "r.(?)" "p.(Thr71Serfs*25)" "?" "0000408645" "00020464" "50" "374" "1" "374" "1" "c.374+1A>G" "r.spl" "p.?" "?" "0000408646" "00020464" "50" "663" "0" "675" "0" "c.663_675del" "r.(?)" "p.(Pro222Thrfs*61)" "?" "0000408647" "00020464" "50" "863" "-1" "1318" "0" "c.(862+1_863-1)_(*16_?)del" "r.?" "p.?" "6i_9i_" "0000408648" "00020464" "50" "897" "0" "905" "0" "c.897_905del" "r.(?)" "p.(Ile303_Gln305del)" "?" "0000408649" "00020464" "50" "910" "0" "910" "0" "c.910del" "r.(?)" "p.(Arg304Glyfs*32)" "?" "0000408650" "00020464" "50" "389" "0" "396" "0" "c.389_396delins(32)" "r.(?)" "p.Glu130_Cys132delIns11" "?" "0000408651" "00020464" "95" "734" "1" "734" "1" "c.734+1G>A" "r.spl" "p.?" "5i" "0000408652" "00020464" "95" "493" "0" "493" "0" "c.493G>T" "r.(?)" "p.(Glu165*)" "4" "0000408653" "00020464" "95" "977" "0" "977" "0" "c.977del" "r.(?)" "p.(Pro326Glnfs*10)" "8" "0000408654" "00020464" "95" "-1115" "0" "290" "1" "c.(?_-1115)_(290+1_291-1)del" "r.0?" "p.0?" "_1_1i" "0000408655" "00020464" "95" "157" "0" "158" "0" "c.157_158insCC" "r.(?)" "p.(Asp53Alafs*12)" "1" "0000408656" "00020464" "95" "291" "-1" "464" "1" "c.(290+1_291-1)_(464+1_465-1)del" "r.?" "p.?" "1i_3i" "0000408657" "00020464" "95" "291" "-1" "1318" "0" "c.(290+1_291-1)_(*16_?)del" "r.?" "p.?" "1i_(i_" "0000408658" "00020464" "95" "409" "0" "409" "0" "c.409C>T" "r.(?)" "p.(Gln137*)" "3" "0000408659" "00020464" "90" "454" "0" "454" "0" "c.454C>T" "r.(?)" "p.Gln152*" "" "0000408660" "00020464" "90" "432" "0" "433" "0" "c.432_433insTGTGCCG" "r.(?)" "p.(Glu145Cysfs*20)" "" "0000408661" "00020464" "90" "129" "0" "129" "0" "c.129dup" "r.(?)" "p.(Lys44Glnfs*119)" "" "0000408662" "00020464" "90" "157" "0" "158" "0" "c.157_158delinsT" "r.(?)" "p.(Asp53Serfs*11)" "" "0000408737" "00020464" "70" "863" "-1" "920" "1" "c.(862+1_863-1)_(920+1_921-1)del" "r.?" "p.(Gly288Alafs*29)" "6i_7i" "0000408738" "00020464" "90" "291" "-1" "464" "1" "c.(290+1_291-1)_(464+1_465-1)del" "r.?" "p.(Glu98_Gly155del)" "1i_3i" "0000408739" "00020464" "90" "842" "0" "842" "0" "c.842dup" "r.(?)" "p.(Leu282Alafs*3)" "6" "0000408740" "00020464" "90" "842" "0" "842" "0" "c.842dup" "r.(?)" "p.(Leu282Alafs*3)" "6" "0000408741" "00020464" "90" "291" "-1" "464" "1" "c.(290+1_291-1)_(464+1_465-1)del" "r.?" "p.(Glu98_Gly155del)" "1i_3i" "0000408742" "00020464" "90" "842" "0" "842" "0" "c.842dup" "r.(?)" "p.(Leu282Alafs*3)" "6" "0000408743" "00020464" "50" "542" "0" "542" "0" "c.542A>T" "r.(?)" "p.(Asn181Ile)" "4" "0000408744" "00020464" "50" "542" "0" "542" "0" "c.542A>T" "r.(?)" "p.(Asn181Ile)" "4" "0000453992" "00020464" "50" "-1105" "0" "2161" "0" "c.(?_-1105)_(*859_?)dup" "r.?" "p.?" "_1_10_" "0000500612" "00020464" "50" "43" "0" "43" "0" "c.43G>A" "r.(?)" "p.(Gly15Ser)" "" "0000566040" "00020464" "90" "180" "0" "180" "0" "c.180C>G" "r.(?)" "p.(Tyr60Ter)" "" "0000566041" "00020464" "90" "197" "0" "197" "0" "c.197dup" "r.(?)" "p.(Leu67AlafsTer96)" "" "0000566042" "00020464" "10" "290" "36" "290" "36" "c.290+36G>T" "r.(=)" "p.(=)" "" "0000566044" "00020464" "10" "291" "-32" "291" "-32" "c.291-32C>T" "r.(=)" "p.(=)" "" "0000566045" "00020464" "10" "369" "0" "369" "0" "c.369G>A" "r.(?)" "p.(Gln123=)" "" "0000566046" "00020464" "30" "369" "0" "369" "0" "c.369G>A" "r.(?)" "p.(Gln123=)" "" "0000566047" "00020464" "10" "369" "0" "369" "0" "c.369G>A" "r.(?)" "p.(Gln123=)" "" "0000566048" "00020464" "10" "374" "24" "374" "24" "c.374+24G>T" "r.(=)" "p.(=)" "" "0000566050" "00020464" "10" "465" "-51" "465" "-51" "c.465-51T>C" "r.(=)" "p.(=)" "" "0000566051" "00020464" "30" "465" "-18" "465" "-18" "c.465-18G>T" "r.(=)" "p.(=)" "" "0000566052" "00020464" "30" "465" "-18" "465" "-18" "c.465-18G>T" "r.(=)" "p.(=)" "" "0000566053" "00020464" "90" "493" "0" "493" "0" "c.493G>T" "r.(?)" "p.(Glu165Ter)" "" "0000566054" "00020464" "90" "559" "0" "560" "0" "c.559_560delinsT" "r.(?)" "p.(Gly187LeufsTer100)" "" "0000566056" "00020464" "90" "580" "0" "580" "0" "c.580G>A" "r.(?)" "p.(Asp194Asn)" "" "0000566057" "00020464" "90" "603" "0" "604" "0" "c.603_604dup" "r.(?)" "p.(His202ArgfsTer86)" "" "0000566058" "00020464" "30" "687" "0" "687" "0" "c.687C>T" "r.(?)" "p.(Asp229=)" "" "0000566059" "00020464" "90" "701" "0" "701" "0" "c.701del" "r.(?)" "p.(Phe234SerfsTer53)" "" "0000566060" "00020464" "50" "721" "0" "721" "0" "c.721G>A" "r.(?)" "p.(Ala241Thr)" "" "0000566061" "00020464" "30" "723" "0" "723" "0" "c.723T>C" "r.(?)" "p.(Ala241=)" "" "0000566062" "00020464" "30" "734" "11" "734" "11" "c.734+11del" "r.(=)" "p.(=)" "" "0000566063" "00020464" "30" "734" "32" "734" "32" "c.734+32C>T" "r.(=)" "p.(=)" "" "0000566064" "00020464" "10" "735" "-51" "735" "-51" "c.735-51C>T" "r.(=)" "p.(=)" "" "0000566065" "00020464" "30" "787" "0" "787" "0" "c.787T>C" "r.(?)" "p.(Leu263=)" "" "0000566066" "00020464" "30" "787" "0" "787" "0" "c.787T>C" "r.(?)" "p.(Leu263=)" "" "0000566067" "00020464" "10" "816" "0" "816" "0" "c.816C>T" "r.(?)" "p.(Tyr272=)" "" "0000566068" "00020464" "10" "816" "0" "816" "0" "c.816C>T" "r.(?)" "p.(Tyr272=)" "" "0000566069" "00020464" "30" "863" "-67" "863" "-67" "c.863-67G>A" "r.(=)" "p.(=)" "" "0000566070" "00020464" "50" "890" "0" "890" "0" "c.890G>A" "r.(?)" "p.(Arg297Lys)" "" "0000566071" "00020464" "30" "945" "0" "945" "0" "c.945G>A" "r.(?)" "p.(Pro315=)" "" "0000566072" "00020464" "30" "1062" "0" "1062" "0" "c.1062C>G" "r.(?)" "p.(Phe354Leu)" "" "0000566073" "00020464" "10" "1062" "0" "1062" "0" "c.1062C>G" "r.(?)" "p.(Phe354Leu)" "" "0000566074" "00020464" "30" "1200" "0" "1200" "0" "c.1200G>A" "r.(?)" "p.(Leu400=)" "" "0000566075" "00020464" "30" "1211" "0" "1211" "0" "c.1211C>T" "r.(?)" "p.(Ser404Phe)" "" "0000566076" "00020464" "30" "1310" "0" "1310" "0" "c.*8C>T" "r.(=)" "p.(=)" "" "0000566077" "00020464" "30" "1310" "0" "1310" "0" "c.*8C>T" "r.(=)" "p.(=)" "" "0000566078" "00020464" "30" "1318" "10" "1318" "10" "c.*16+10G>A" "r.(=)" "p.(=)" "" "0000594757" "00020464" "50" "43" "0" "43" "0" "c.43G>A" "r.(?)" "p.(Gly15Ser)" "" "0000594766" "00020464" "50" "1258" "0" "1258" "0" "c.1258G>T" "r.(?)" "p.(Ala420Ser)" "" "0000594770" "00020464" "50" "1193" "0" "1193" "0" "c.1193C>T" "r.(?)" "p.(Ala398Val)" "" "0000594771" "00020464" "50" "632" "0" "632" "0" "c.632G>A" "r.(?)" "p.(Arg211Gln)" "" "0000594773" "00020464" "50" "1150" "0" "1150" "0" "c.1150C>T" "r.(?)" "p.(Arg384Trp)" "" "0000594774" "00020464" "70" "580" "0" "580" "0" "c.580G>A" "r.(?)" "p.(Asp194Asn)" "" "0000594775" "00020464" "50" "1064" "0" "1064" "0" "c.1064A>T" "r.(?)" "p.(Asp355Val)" "" "0000594776" "00020464" "50" "374" "12" "374" "12" "c.374+12G>A" "r.(?)" "p.(?)" "" "0000594777" "00020464" "50" "1225" "0" "1225" "0" "c.1225C>T" "r.(?)" "p.(Arg409Trp)" "" "0000594778" "00020464" "50" "45" "0" "45" "0" "c.45C>T" "r.(?)" "p.(Gly15Gly)" "" "0000594779" "00020464" "50" "56" "0" "56" "0" "c.56C>T" "r.(?)" "p.(Ser19Leu)" "" "0000596842" "00020464" "70" "890" "0" "890" "0" "c.890G>A" "r.(?)" "p.(Arg297Lys)" "" "0000617351" "00020464" "30" "795" "0" "795" "0" "c.795G>A" "r.(?)" "p.(Glu265=)" "" "0000617352" "00020464" "30" "1064" "0" "1064" "0" "c.1064A>C" "r.(?)" "p.(Asp355Ala)" "" "0000617353" "00020464" "30" "1310" "0" "1310" "0" "c.*8C>T" "r.(=)" "p.(=)" "" "0000623936" "00020464" "30" "465" "-18" "465" "-18" "c.465-18G>T" "r.(=)" "p.(=)" "" "0000623937" "00020464" "50" "992" "0" "992" "0" "c.992G>A" "r.(?)" "p.(Arg331Gln)" "" "0000623938" "00020464" "30" "1318" "10" "1318" "10" "c.*16+10G>A" "r.(=)" "p.(=)" "" "0000647291" "00020464" "90" "735" "-10" "735" "-10" "c.735-10C>A" "r.734_735ins735-8_735-1" "p.Tyr246Asnfs*44" "" "0000649894" "00020464" "30" "1987" "0" "1987" "0" "c.*685C>A" "r.(=)" "p.(=)" "" "0000658482" "00020464" "30" "374" "23" "374" "23" "c.374+23C>T" "r.(=)" "p.(=)" "" "0000658483" "00020464" "30" "465" "-4" "465" "-4" "c.465-4G>A" "r.spl?" "p.?" "" "0000658484" "00020464" "30" "992" "0" "992" "0" "c.992G>A" "r.(?)" "p.(Arg331Gln)" "" "0000658485" "00020464" "30" "1168" "0" "1168" "0" "c.1168G>A" "r.(?)" "p.(Val390Met)" "" "0000669460" "00020464" "30" "1987" "0" "1987" "0" "c.*685C>A" "r.(=)" "p.(=)" "" "0000681274" "00020464" "50" "464" "5" "464" "5" "c.464+5G>C" "r.spl?" "p.?" "" "0000681275" "00020464" "30" "828" "0" "828" "0" "c.828C>T" "r.(?)" "p.(Gly276=)" "" "0000681276" "00020464" "30" "1185" "0" "1185" "0" "c.1185A>G" "r.(?)" "p.(Thr395=)" "" "0000692679" "00020464" "30" "598" "-8" "598" "-8" "c.598-8C>T" "r.(=)" "p.(=)" "" "0000692680" "00020464" "30" "598" "-7" "598" "-7" "c.598-7G>A" "r.(=)" "p.(=)" "" "0000692681" "00020464" "10" "614" "0" "614" "0" "c.614C>T" "r.(?)" "p.(Ala205Val)" "" "0000692682" "00020464" "30" "4812" "0" "4812" "0" "c.*3510T>C" "r.(=)" "p.(=)" "" "0000727122" "00020464" "30" "42" "0" "42" "0" "c.42G>A" "r.(?)" "p.(Glu14=)" "" "0000727123" "00020464" "30" "598" "-8" "598" "-8" "c.598-8C>T" "r.(=)" "p.(=)" "" "0000727124" "00020464" "50" "734" "20" "734" "20" "c.734+20G>A" "r.(=)" "p.(=)" "" "0000727125" "00020464" "30" "945" "0" "945" "0" "c.945G>A" "r.(?)" "p.(Pro315=)" "" "0000727126" "00020464" "50" "1031" "0" "1031" "0" "c.1031T>C" "r.(?)" "p.(Leu344Pro)" "" "0000734530" "00020464" "50" "766" "0" "766" "0" "c.766G>A" "r.(?)" "p.(Glu256Lys)" "" "0000737199" "00020464" "50" "351" "0" "351" "0" "c.351del" "r.(?)" "p.(Leu117Phefs*12)" "" "0000737200" "00020464" "50" "522" "0" "522" "0" "c.522del" "r.(?)" "p.(His174Glnfs*113)" "" "0000742550" "00020464" "50" "1" "0" "1" "0" "c.1A>T" "r.?" "p.?" "" "0000742551" "00020464" "50" "3" "0" "3" "0" "c.3G>A" "r.?" "p.?" "" "0000742552" "00020464" "50" "5" "0" "5" "0" "c.5A>C" "r.(?)" "p.(Glu2Ala)" "" "0000742553" "00020464" "50" "24" "0" "24" "0" "c.24G>T" "r.(?)" "p.(Gln8His)" "" "0000742554" "00020464" "50" "26" "0" "26" "0" "c.26T>C" "r.(?)" "p.(Leu9Pro)" "" "0000742555" "00020464" "50" "29" "0" "29" "0" "c.29G>A" "r.(?)" "p.(Gly10Asp)" "" "0000742556" "00020464" "50" "33" "0" "33" "0" "c.33G>A" "r.(?)" "p.(Met11Ile)" "" "0000742557" "00020464" "50" "34" "0" "34" "0" "c.34T>C" "r.(?)" "p.(Phe12Leu)" "" "0000742558" "00020464" "50" "36" "0" "36" "0" "c.36C>A" "r.(?)" "p.(Phe12Leu)" "" "0000742559" "00020464" "50" "38" "0" "38" "0" "c.38C>T" "r.(?)" "p.(Thr13Met)" "" "0000742560" "00020464" "50" "40" "0" "40" "0" "c.40G>A" "r.(?)" "p.(Glu14Lys)" "" "0000742561" "00020464" "50" "70" "0" "70" "0" "c.70A>G" "r.(?)" "p.(Thr24Ala)" "" "0000742562" "00020464" "50" "71" "0" "71" "0" "c.71C>A" "r.(?)" "p.(Thr24Lys)" "" "0000742563" "00020464" "50" "77" "0" "77" "0" "c.77T>C" "r.(?)" "p.(Ile26Thr)" "" "0000742564" "00020464" "50" "82" "0" "82" "0" "c.82C>T" "r.(?)" "p.(Arg28Cys)" "" "0000742565" "00020464" "50" "83" "0" "83" "0" "c.83G>C" "r.(?)" "p.(Arg28Pro)" "" "0000742566" "00020464" "50" "86" "0" "86" "0" "c.86T>C" "r.(?)" "p.(Ile29Thr)" "" "0000742567" "00020464" "50" "89" "0" "89" "0" "c.89A>G" "r.(?)" "p.(Asp30Gly)" "" "0000742568" "00020464" "50" "100" "0" "100" "0" "c.100G>A" "r.(?)" "p.(Val34Ile)" "" "0000742569" "00020464" "50" "101" "0" "101" "0" "c.101T>C" "r.(?)" "p.(Val34Ala)" "" "0000742570" "00020464" "50" "116" "0" "116" "0" "c.116G>T" "r.(?)" "p.(Arg39Leu)" "" "0000742571" "00020464" "50" "119" "0" "119" "0" "c.119G>A" "r.(?)" "p.(Arg40His)" "" "0000742572" "00020464" "50" "127" "0" "127" "0" "c.127G>A" "r.(?)" "p.(Ala43Thr)" "" "0000742573" "00020464" "50" "157" "0" "157" "0" "c.157G>A" "r.(?)" "p.(Asp53Asn)" "" "0000742574" "00020464" "50" "159" "0" "159" "0" "c.159C>A" "r.(?)" "p.(Asp53Glu)" "" "0000742575" "00020464" "50" "187" "0" "187" "0" "c.187G>A" "r.(?)" "p.(Val63Met)" "" "0000742576" "00020464" "50" "209" "0" "209" "0" "c.209A>G" "r.(?)" "p.(Glu70Gly)" "" "0000742577" "00020464" "50" "235" "0" "235" "0" "c.235A>G" "r.(?)" "p.(Ile79Val)" "" "0000742578" "00020464" "50" "248" "0" "248" "0" "c.248A>G" "r.(?)" "p.(Lys83Arg)" "" "0000742579" "00020464" "50" "254" "0" "254" "0" "c.254T>G" "r.(?)" "p.(Leu85Trp)" "" "0000742580" "00020464" "50" "269" "0" "269" "0" "c.269A>G" "r.(?)" "p.(Asn90Ser)" "" "0000742581" "00020464" "50" "297" "0" "297" "0" "c.297T>G" "r.(?)" "p.(Ile99Met)" "" "0000742582" "00020464" "50" "299" "0" "299" "0" "c.299A>G" "r.(?)" "p.(Gln100Arg)" "" "0000742583" "00020464" "50" "310" "0" "310" "0" "c.310A>G" "r.(?)" "p.(Arg104Gly)" "" "0000742584" "00020464" "50" "317" "0" "317" "0" "c.317G>A" "r.(?)" "p.(Arg106Gln)" "" "0000742585" "00020464" "50" "319" "0" "319" "0" "c.319C>T" "r.(?)" "p.(His107Tyr)" "" "0000742586" "00020464" "50" "325" "0" "325" "0" "c.325A>G" "r.(?)" "p.(Asn109Asp)" "" "0000742587" "00020464" "50" "347" "0" "347" "0" "c.347T>C" "r.(?)" "p.(Val116Ala)" "" "0000742588" "00020464" "50" "352" "0" "352" "0" "c.352T>C" "r.(?)" "p.(Tyr118His)" "" "0000742589" "00020464" "50" "358" "0" "358" "0" "c.358G>A" "r.(?)" "p.(Glu120Lys)" "" "0000742590" "00020464" "50" "362" "0" "362" "0" "c.362A>T" "r.(?)" "p.(Glu121Val)" "" "0000742591" "00020464" "50" "373" "0" "373" "0" "c.373A>G" "r.(?)" "p.(Met125Val)" "" "0000742592" "00020464" "50" "375" "0" "375" "0" "c.375G>A" "r.(?)" "p.(Met125Ile)" "" "0000742593" "00020464" "50" "465" "-1" "465" "-1" "c.465-1G>A" "r.spl?" "p.?" "" "0000742594" "00020464" "50" "475" "0" "475" "0" "c.475C>G" "r.(?)" "p.(Gln159Glu)" "" "0000742595" "00020464" "50" "490" "0" "490" "0" "c.490C>A" "r.(?)" "p.(Leu164Met)" "" "0000742596" "00020464" "50" "506" "0" "506" "0" "c.506G>A" "r.(?)" "p.(Ser169Asn)" "" "0000742597" "00020464" "50" "556" "0" "556" "0" "c.556A>G" "r.(?)" "p.(Thr186Ala)" "" "0000742598" "00020464" "50" "604" "0" "604" "0" "c.604C>T" "r.(?)" "p.(His202Tyr)" "" "0000742599" "00020464" "50" "614" "0" "614" "0" "c.614C>T" "r.(?)" "p.(Ala205Val)" "" "0000742600" "00020464" "50" "652" "0" "652" "0" "c.652G>A" "r.(?)" "p.(Ala218Thr)" "" "0000742601" "00020464" "50" "842" "0" "842" "0" "c.842C>T" "r.(?)" "p.(Pro281Leu)" "" "0000742602" "00020464" "50" "877" "0" "877" "0" "c.877G>A" "r.(?)" "p.(Glu293Lys)" "" "0000742603" "00020464" "50" "929" "0" "929" "0" "c.929G>A" "r.(?)" "p.(Arg310Gln)" "" "0000742604" "00020464" "50" "959" "0" "959" "0" "c.959T>C" "r.(?)" "p.(Val320Ala)" "" "0000742605" "00020464" "50" "1033" "0" "1033" "0" "c.1033C>T" "r.(?)" "p.(His345Tyr)" "" "0000742606" "00020464" "50" "1067" "0" "1067" "0" "c.1067T>C" "r.(?)" "p.(Ile356Thr)" "" "0000742607" "00020464" "50" "1069" "0" "1069" "0" "c.1069G>A" "r.(?)" "p.(Glu357Lys)" "" "0000742608" "00020464" "50" "1071" "0" "1071" "0" "c.1071G>T" "r.(?)" "p.(Glu357Asp)" "" "0000742609" "00020464" "50" "1108" "0" "1108" "0" "c.1108G>A" "r.(?)" "p.(Gly370Arg)" "" "0000742776" "00020464" "50" "516" "0" "516" "0" "c.516dup" "r.(?)" "p.(Val173Cysfs*93)" "" "0000742777" "00020464" "50" "597" "2" "598" "0" "c.597+2_598del" "r.spl?" "p.?" "" "0000742778" "00020464" "50" "941" "0" "941" "0" "c.941del" "r.(?)" "p.(Pro314Leufs*22)" "" "0000749795" "00020464" "50" "4" "0" "4" "0" "c.4G>A" "r.(?)" "p.(Glu2Lys)" "" "0000749796" "00020464" "50" "22" "0" "22" "0" "c.22C>G" "r.(?)" "p.(Gln8Glu)" "" "0000749797" "00020464" "50" "32" "0" "32" "0" "c.32T>C" "r.(?)" "p.(Met11Thr)" "" "0000749798" "00020464" "50" "46" "0" "46" "0" "c.46G>A" "r.(?)" "p.(Glu16Lys)" "" "0000749799" "00020464" "50" "50" "0" "50" "0" "c.50T>C" "r.(?)" "p.(Leu17Pro)" "" "0000749800" "00020464" "50" "52" "0" "52" "0" "c.52A>G" "r.(?)" "p.(Met18Val)" "" "0000749801" "00020464" "50" "58" "0" "58" "0" "c.58G>A" "r.(?)" "p.(Val20Met)" "" "0000749802" "00020464" "50" "59" "0" "59" "0" "c.59T>G" "r.(?)" "p.(Val20Gly)" "" "0000749803" "00020464" "50" "61" "0" "61" "0" "c.61G>A" "r.(?)" "p.(Gly21Ser)" "" "0000749804" "00020464" "50" "71" "0" "71" "0" "c.71C>G" "r.(?)" "p.(Thr24Arg)" "" "0000749805" "00020464" "50" "90" "0" "90" "0" "c.90C>G" "r.(?)" "p.(Asp30Glu)" "" "0000749806" "00020464" "50" "94" "0" "94" "0" "c.94A>G" "r.(?)" "p.(Thr32Ala)" "" "0000749807" "00020464" "50" "109" "0" "109" "0" "c.109C>T" "r.(?)" "p.(Gln37*)" "" "0000749808" "00020464" "50" "112" "0" "112" "0" "c.112C>G" "r.(?)" "p.(Pro38Ala)" "" "0000749809" "00020464" "50" "122" "0" "122" "0" "c.122A>G" "r.(?)" "p.(Lys41Arg)" "" "0000749810" "00020464" "50" "123" "0" "123" "0" "c.123G>C" "r.(?)" "p.(Lys41Asn)" "" "0000749811" "00020464" "50" "140" "0" "140" "0" "c.140G>A" "r.(?)" "p.(Gly47Asp)" "" "0000749812" "00020464" "50" "151" "0" "151" "0" "c.151A>C" "r.(?)" "p.(Met51Leu)" "" "0000749813" "00020464" "50" "151" "0" "151" "0" "c.151A>G" "r.(?)" "p.(Met51Val)" "" "0000749814" "00020464" "50" "155" "0" "155" "0" "c.155G>A" "r.(?)" "p.(Gly52Glu)" "" "0000749815" "00020464" "50" "178" "0" "178" "0" "c.178T>C" "r.(?)" "p.(Tyr60His)" "" "0000749816" "00020464" "50" "184" "0" "184" "0" "c.184A>G" "r.(?)" "p.(Lys62Glu)" "" "0000749817" "00020464" "50" "206" "0" "206" "0" "c.206C>T" "r.(?)" "p.(Ser69Leu)" "" "0000749818" "00020464" "50" "263" "0" "263" "0" "c.263T>C" "r.(?)" "p.(Ile88Thr)" "" "0000749819" "00020464" "50" "292" "0" "292" "0" "c.292G>A" "r.(?)" "p.(Glu98Lys)" "" "0000749820" "00020464" "50" "310" "0" "310" "0" "c.310A>T" "r.(?)" "p.(Arg104Trp)" "" "0000749821" "00020464" "50" "368" "0" "368" "0" "c.368A>G" "r.(?)" "p.(Gln123Arg)" "" "0000749822" "00020464" "50" "374" "0" "374" "0" "c.374T>C" "r.(?)" "p.(Met125Thr)" "" "0000749823" "00020464" "50" "375" "0" "375" "0" "c.375G>C" "r.(?)" "p.(Met125Ile)" "" "0000749824" "00020464" "50" "376" "0" "376" "0" "c.376T>C" "r.(?)" "p.(Tyr126His)" "" "0000749825" "00020464" "50" "523" "0" "523" "0" "c.523A>G" "r.(?)" "p.(Lys175Glu)" "" "0000749826" "00020464" "50" "583" "0" "583" "0" "c.583C>A" "r.(?)" "p.(Leu195Met)" "" "0000749827" "00020464" "50" "604" "0" "604" "0" "c.604C>A" "r.(?)" "p.(His202Asn)" "" "0000749828" "00020464" "50" "613" "0" "613" "0" "c.613G>A" "r.(?)" "p.(Ala205Thr)" "" "0000749829" "00020464" "50" "632" "0" "632" "0" "c.632G>A" "r.(?)" "p.(Arg211Gln)" "" "0000749830" "00020464" "50" "740" "0" "740" "0" "c.740A>T" "r.(?)" "p.(Asn247Ile)" "" "0000749831" "00020464" "50" "749" "0" "749" "0" "c.749C>T" "r.(?)" "p.(Thr250Met)" "" "0000749832" "00020464" "50" "842" "0" "842" "0" "c.842C>A" "r.(?)" "p.(Pro281Gln)" "" "0000749833" "00020464" "50" "911" "0" "911" "0" "c.911G>A" "r.(?)" "p.(Arg304Gln)" "" "0000749834" "00020464" "50" "923" "0" "923" "0" "c.923G>A" "r.(?)" "p.(Trp308*)" "" "0000749835" "00020464" "50" "933" "0" "933" "0" "c.933G>C" "r.(?)" "p.(Lys311Asn)" "" "0000749836" "00020464" "50" "935" "0" "935" "0" "c.935A>G" "r.(?)" "p.(Lys312Arg)" "" "0000749837" "00020464" "50" "941" "0" "941" "0" "c.941C>T" "r.(?)" "p.(Pro314Leu)" "" "0000749838" "00020464" "50" "946" "0" "946" "0" "c.946G>A" "r.(?)" "p.(Ala316Thr)" "" "0000749839" "00020464" "50" "947" "0" "947" "0" "c.947C>G" "r.(?)" "p.(Ala316Gly)" "" "0000749840" "00020464" "50" "947" "0" "947" "0" "c.947C>T" "r.(?)" "p.(Ala316Val)" "" "0000749841" "00020464" "50" "967" "0" "967" "0" "c.967C>A" "r.(?)" "p.(Pro323Thr)" "" "0000749842" "00020464" "50" "971" "0" "971" "0" "c.971C>T" "r.(?)" "p.(Pro324Leu)" "" "0000749843" "00020464" "50" "991" "0" "991" "0" "c.991C>T" "r.(?)" "p.(Arg331Trp)" "" "0000749844" "00020464" "50" "997" "0" "997" "0" "c.997C>T" "r.(?)" "p.(Arg333Cys)" "" "0000749845" "00020464" "50" "1012" "0" "1012" "0" "c.1012G>A" "r.(?)" "p.(Val338Met)" "" "0000749846" "00020464" "50" "1040" "0" "1040" "0" "c.1040C>G" "r.(?)" "p.(Ala347Gly)" "" "0000749847" "00020464" "50" "1102" "0" "1102" "0" "c.1102G>A" "r.(?)" "p.(Val368Met)" "" "0000749848" "00020464" "50" "1106" "0" "1106" "0" "c.1106C>G" "r.(?)" "p.(Pro369Arg)" "" "0000754690" "00020464" "50" "7" "0" "7" "0" "c.7G>A" "r.(?)" "p.(Val3Met)" "" "0000754691" "00020464" "50" "31" "0" "31" "0" "c.31A>T" "r.(?)" "p.(Met11Leu)" "" "0000754692" "00020464" "50" "47" "0" "47" "0" "c.47A>G" "r.(?)" "p.(Glu16Gly)" "" "0000754693" "00020464" "50" "71" "0" "71" "0" "c.71C>T" "r.(?)" "p.(Thr24Met)" "" "0000754694" "00020464" "50" "125" "0" "125" "0" "c.125G>A" "r.(?)" "p.(Arg42Gln)" "" "0000754695" "00020464" "50" "125" "0" "125" "0" "c.125G>T" "r.(?)" "p.(Arg42Leu)" "" "0000754696" "00020464" "50" "153" "0" "153" "0" "c.153G>A" "r.(?)" "p.(Met51Ile)" "" "0000754697" "00020464" "50" "316" "0" "316" "0" "c.316C>T" "r.(?)" "p.(Arg106Trp)" "" "0000754698" "00020464" "50" "355" "0" "355" "0" "c.355A>G" "r.(?)" "p.(Asn119Asp)" "" "0000754699" "00020464" "50" "472" "0" "472" "0" "c.472T>C" "r.(?)" "p.(Cys158Arg)" "" "0000754700" "00020464" "50" "559" "0" "559" "0" "c.559G>A" "r.(?)" "p.(Gly187Ser)" "" "0000754701" "00020464" "50" "566" "0" "566" "0" "c.566C>T" "r.(?)" "p.(Thr189Ile)" "" "0000754702" "00020464" "50" "605" "0" "605" "0" "c.605A>G" "r.(?)" "p.(His202Arg)" "" "0000754703" "00020464" "50" "817" "0" "817" "0" "c.817G>A" "r.(?)" "p.(Ala273Thr)" "" "0000754704" "00020464" "50" "944" "0" "944" "0" "c.944C>T" "r.(?)" "p.(Pro315Leu)" "" "0000754705" "00020464" "50" "950" "0" "950" "0" "c.950A>C" "r.(?)" "p.(Glu317Ala)" "" "0000754706" "00020464" "50" "970" "0" "970" "0" "c.970C>T" "r.(?)" "p.(Pro324Ser)" "" "0000754707" "00020464" "50" "979" "0" "979" "0" "c.979G>A" "r.(?)" "p.(Asp327Asn)" "" "0000754708" "00020464" "50" "992" "0" "992" "0" "c.992G>A" "r.(?)" "p.(Arg331Gln)" "" "0000754709" "00020464" "50" "1016" "0" "1016" "0" "c.1016C>T" "r.(?)" "p.(Pro339Leu)" "" "0000754710" "00020464" "50" "1027" "0" "1027" "0" "c.1027G>A" "r.(?)" "p.(Asp343Asn)" "" "0000754711" "00020464" "50" "1031" "0" "1031" "0" "c.1031T>C" "r.(?)" "p.(Leu344Pro)" "" "0000754712" "00020464" "50" "1036" "0" "1036" "0" "c.1036G>A" "r.(?)" "p.(Gly346Ser)" "" "0000754713" "00020464" "50" "1039" "0" "1039" "0" "c.1039G>A" "r.(?)" "p.(Ala347Thr)" "" "0000754714" "00020464" "50" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Ala347Val)" "" "0000754715" "00020464" "50" "1045" "0" "1045" "0" "c.1045G>A" "r.(?)" "p.(Glu349Lys)" "" "0000754716" "00020464" "50" "1063" "0" "1063" "0" "c.1063G>A" "r.(?)" "p.(Asp355Asn)" "" "0000754717" "00020464" "50" "1077" "0" "1077" "0" "c.1077C>G" "r.(?)" "p.(Asp359Glu)" "" "0000754718" "00020464" "50" "1087" "0" "1087" "0" "c.1087A>G" "r.(?)" "p.(Thr363Ala)" "" "0000754719" "00020464" "50" "1088" "0" "1088" "0" "c.1088C>T" "r.(?)" "p.(Thr363Ile)" "" "0000754720" "00020464" "50" "1100" "0" "1100" "0" "c.1100C>T" "r.(?)" "p.(Thr367Met)" "" "0000759464" "00020464" "50" "7" "0" "7" "0" "c.7G>A" "r.(?)" "p.(Val3Met)" "" "0000759465" "00020464" "50" "31" "0" "31" "0" "c.31A>T" "r.(?)" "p.(Met11Leu)" "" "0000759466" "00020464" "50" "47" "0" "47" "0" "c.47A>G" "r.(?)" "p.(Glu16Gly)" "" "0000759467" "00020464" "50" "71" "0" "71" "0" "c.71C>T" "r.(?)" "p.(Thr24Met)" "" "0000759468" "00020464" "50" "125" "0" "125" "0" "c.125G>A" "r.(?)" "p.(Arg42Gln)" "" "0000759469" "00020464" "50" "125" "0" "125" "0" "c.125G>T" "r.(?)" "p.(Arg42Leu)" "" "0000759470" "00020464" "50" "153" "0" "153" "0" "c.153G>A" "r.(?)" "p.(Met51Ile)" "" "0000759471" "00020464" "50" "316" "0" "316" "0" "c.316C>T" "r.(?)" "p.(Arg106Trp)" "" "0000759472" "00020464" "50" "355" "0" "355" "0" "c.355A>G" "r.(?)" "p.(Asn119Asp)" "" "0000759473" "00020464" "50" "472" "0" "472" "0" "c.472T>C" "r.(?)" "p.(Cys158Arg)" "" "0000759474" "00020464" "50" "559" "0" "559" "0" "c.559G>A" "r.(?)" "p.(Gly187Ser)" "" "0000759475" "00020464" "50" "566" "0" "566" "0" "c.566C>T" "r.(?)" "p.(Thr189Ile)" "" "0000759476" "00020464" "50" "605" "0" "605" "0" "c.605A>G" "r.(?)" "p.(His202Arg)" "" "0000759477" "00020464" "50" "817" "0" "817" "0" "c.817G>A" "r.(?)" "p.(Ala273Thr)" "" "0000759478" "00020464" "50" "944" "0" "944" "0" "c.944C>T" "r.(?)" "p.(Pro315Leu)" "" "0000759479" "00020464" "50" "950" "0" "950" "0" "c.950A>C" "r.(?)" "p.(Glu317Ala)" "" "0000759480" "00020464" "50" "970" "0" "970" "0" "c.970C>T" "r.(?)" "p.(Pro324Ser)" "" "0000759481" "00020464" "50" "979" "0" "979" "0" "c.979G>A" "r.(?)" "p.(Asp327Asn)" "" "0000759482" "00020464" "50" "992" "0" "992" "0" "c.992G>A" "r.(?)" "p.(Arg331Gln)" "" "0000759483" "00020464" "50" "1016" "0" "1016" "0" "c.1016C>T" "r.(?)" "p.(Pro339Leu)" "" "0000759484" "00020464" "50" "1027" "0" "1027" "0" "c.1027G>A" "r.(?)" "p.(Asp343Asn)" "" "0000759485" "00020464" "50" "1031" "0" "1031" "0" "c.1031T>C" "r.(?)" "p.(Leu344Pro)" "" "0000759486" "00020464" "50" "1036" "0" "1036" "0" "c.1036G>A" "r.(?)" "p.(Gly346Ser)" "" "0000759487" "00020464" "50" "1039" "0" "1039" "0" "c.1039G>A" "r.(?)" "p.(Ala347Thr)" "" "0000759488" "00020464" "50" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Ala347Val)" "" "0000759489" "00020464" "50" "1045" "0" "1045" "0" "c.1045G>A" "r.(?)" "p.(Glu349Lys)" "" "0000759490" "00020464" "50" "1063" "0" "1063" "0" "c.1063G>A" "r.(?)" "p.(Asp355Asn)" "" "0000759491" "00020464" "50" "1077" "0" "1077" "0" "c.1077C>G" "r.(?)" "p.(Asp359Glu)" "" "0000759492" "00020464" "50" "1087" "0" "1087" "0" "c.1087A>G" "r.(?)" "p.(Thr363Ala)" "" "0000759493" "00020464" "50" "1088" "0" "1088" "0" "c.1088C>T" "r.(?)" "p.(Thr363Ile)" "" "0000759494" "00020464" "50" "1100" "0" "1100" "0" "c.1100C>T" "r.(?)" "p.(Thr367Met)" "" "0000808661" "00020464" "10" "290" "36" "290" "36" "c.290+36G>T" "r.(=)" "p.(=)" "" "0000808662" "00020464" "10" "290" "78" "290" "78" "c.290+78C>T" "r.(=)" "p.(=)" "" "0000808663" "00020464" "10" "374" "24" "374" "24" "c.374+24G>T" "r.(=)" "p.(=)" "" "0000808664" "00020464" "10" "464" "16" "464" "16" "c.464+16A>T" "r.(=)" "p.(=)" "" "0000808665" "00020464" "10" "464" "40" "464" "46" "c.464+40_464+46dup" "r.(=)" "p.(=)" "" "0000808666" "00020464" "30" "597" "14" "597" "14" "c.597+14del" "r.(=)" "p.(=)" "" "0000808667" "00020464" "30" "598" "-7" "598" "-7" "c.598-7G>A" "r.(=)" "p.(=)" "" "0000808668" "00020464" "30" "734" "20" "734" "20" "c.734+20G>A" "r.(=)" "p.(=)" "" "0000808669" "00020464" "10" "734" "41" "734" "41" "c.734+41T>C" "r.(=)" "p.(=)" "" "0000808670" "00020464" "10" "920" "7" "920" "7" "c.920+7G>C" "r.(=)" "p.(=)" "" "0000808671" "00020464" "30" "1296" "0" "1296" "0" "c.1296G>A" "r.(?)" "p.(Gln432=)" "" "0000825315" "00020464" "70" "290" "1" "290" "1" "c.290+1G>A" "r.spl?" "p.?" "" "0000830390" "00020464" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" "4i_8i" "0000855434" "00020464" "10" "432" "0" "432" "0" "c.432G>A" "r.(?)" "p.(Pro144=)" "" "0000855435" "00020464" "30" "921" "-25" "921" "-25" "c.921-25C>T" "r.(=)" "p.(=)" "" "0000855436" "00020464" "30" "1200" "0" "1200" "0" "c.1200G>A" "r.(?)" "p.(Leu400=)" "" "0000865851" "00020464" "50" "42" "0" "42" "0" "c.42G>A" "r.(?)" "p.(Glu14=)" "" "0000865852" "00020464" "50" "721" "0" "721" "0" "c.721G>A" "r.(?)" "p.(Ala241Thr)" "" "0000865853" "00020464" "30" "787" "0" "787" "0" "c.787T>C" "r.(?)" "p.(Leu263=)" "" "0000865854" "00020464" "30" "787" "0" "787" "0" "c.787T>C" "r.(?)" "p.(Leu263=)" "" "0000865855" "00020464" "90" "839" "0" "842" "0" "c.839_842del" "r.(?)" "p.(Pro280Argfs*6)" "" "0000865856" "00020464" "90" "844" "0" "849" "0" "c.844_849del" "r.(?)" "p.(Leu282_Ser283del)" "" "0000865857" "00020464" "90" "851" "0" "854" "0" "c.851_854del" "r.(?)" "p.(Asp284Glyfs*2)" "" "0000865858" "00020464" "90" "856" "0" "856" "0" "c.856C>A" "r.(?)" "p.(Leu286Met)" "" "0000865859" "00020464" "90" "863" "-5" "894" "0" "c.863-5_894del" "r.spl?" "p.?" "" "0000865860" "00020464" "30" "945" "0" "945" "0" "c.945G>A" "r.(?)" "p.(Pro315=)" "" "0000865861" "00020464" "10" "1062" "0" "1062" "0" "c.1062C>G" "r.(?)" "p.(Phe354Leu)" "" "0000865862" "00020464" "30" "1211" "0" "1211" "0" "c.1211C>T" "r.(?)" "p.(Ser404Phe)" "" "0000877449" "00020464" "70" "141" "0" "141" "0" "c.141dup" "r.(?)" "p.(Lys48Glnfs*115)" "" "0000894772" "00020464" "50" "357" "0" "357" "0" "c.357C>T" "r.(?)" "p.(Asn119=)" "" "0000894773" "00020464" "30" "375" "-7" "375" "-7" "c.375-7G>A" "r.(=)" "p.(=)" "" "0000894774" "00020464" "70" "394" "0" "394" "0" "c.394T>C" "r.(?)" "p.(Cys132Arg)" "" "0000894775" "00020464" "10" "464" "9" "464" "9" "c.464+9G>A" "r.(=)" "p.(=)" "" "0000894776" "00020464" "30" "464" "20" "464" "20" "c.464+20del" "r.(=)" "p.(=)" "" "0000894777" "00020464" "50" "559" "0" "559" "0" "c.559G>A" "r.(?)" "p.(Gly187Ser)" "" "0000894778" "00020464" "50" "804" "0" "804" "0" "c.804G>T" "r.(?)" "p.(Gly268=)" "" "0000894779" "00020464" "30" "825" "0" "825" "0" "c.825G>A" "r.(?)" "p.(Pro275=)" "" "0000894780" "00020464" "50" "863" "-14" "863" "-14" "c.863-14C>T" "r.(=)" "p.(=)" "" "0000894781" "00020464" "30" "920" "7" "920" "7" "c.920+7G>A" "r.(=)" "p.(=)" "" "0000894782" "00020464" "30" "1109" "-15" "1109" "-15" "c.1109-15C>A" "r.(=)" "p.(=)" "" "0000894783" "00020464" "30" "1185" "0" "1185" "0" "c.1185A>G" "r.(?)" "p.(Thr395=)" "" "0000894784" "00020464" "30" "1284" "0" "1284" "0" "c.1284G>C" "r.(?)" "p.(Ser428=)" "" "0000915120" "00020464" "30" "374" "11" "374" "11" "c.374+11C>T" "r.(=)" "p.(=)" "" "0000915121" "00020464" "30" "734" "11" "734" "11" "c.734+11C>T" "r.(=)" "p.(=)" "" "0000915122" "00020464" "30" "846" "0" "846" "0" "c.846C>G" "r.(?)" "p.(Leu282=)" "" "0000915123" "00020464" "30" "863" "-14" "863" "-14" "c.863-14C>T" "r.(=)" "p.(=)" "" "0000915124" "00020464" "30" "1185" "0" "1185" "0" "c.1185A>G" "r.(?)" "p.(Thr395=)" "" "0000915125" "00020464" "30" "1252" "0" "1252" "0" "c.1252T>A" "r.(?)" "p.(Cys418Ser)" "" "0000915126" "00020464" "30" "1296" "0" "1296" "0" "c.1296G>A" "r.(?)" "p.(Gln432=)" "" "0000918616" "00020464" "70" "1062" "0" "1062" "0" "c.1062C>G" "r.(?)" "p.(Phe354Leu)" "" "0000926805" "00020464" "30" "396" "0" "396" "0" "c.396C>T" "r.(?)" "p.(Cys132=)" "" "0000926806" "00020464" "30" "735" "-6" "735" "-2" "c.735-6_735-2del" "r.spl?" "p.?" "" "0000926807" "00020464" "30" "863" "-14" "863" "-14" "c.863-14C>T" "r.(=)" "p.(=)" "" "0000926808" "00020464" "30" "1318" "7" "1318" "7" "c.*16+7C>T" "r.(=)" "p.(=)" "" "0000927780" "00020464" "50" "902" "0" "902" "0" "c.902G>C" "r.(?)" "p.(Arg301Pro)" "" "0000930995" "00020464" "30" "264" "0" "264" "0" "c.264C>A" "r.(?)" "p.(Ile88=)" "" "0000930996" "00020464" "30" "465" "-15" "465" "-15" "c.465-15G>T" "r.(=)" "p.(=)" "" "0000930997" "00020464" "30" "765" "0" "765" "0" "c.765C>T" "r.(?)" "p.(=)" "" "0000951205" "00020464" "30" "163" "0" "163" "0" "c.163C>T" "r.(?)" "p.(=)" "" "0000951206" "00020464" "30" "207" "0" "207" "0" "c.207G>T" "r.(?)" "p.(=)" "" "0000951207" "00020464" "30" "357" "0" "357" "0" "c.357C>T" "r.(?)" "p.(Asn119=)" "" "0000951208" "00020464" "50" "486" "0" "486" "0" "c.486C>T" "r.(?)" "p.(=)" "" "0000951209" "00020464" "70" "488" "0" "488" "0" "c.488G>A" "r.(?)" "p.(Gly163Asp)" "" "0000951210" "00020464" "30" "598" "-17" "598" "-17" "c.598-17G>A" "r.(=)" "p.(=)" "" "0000951211" "00020464" "30" "615" "0" "615" "0" "c.615G>A" "r.(?)" "p.(=)" "" "0000951212" "00020464" "30" "678" "0" "678" "0" "c.678C>T" "r.(?)" "p.(=)" "" "0000951213" "00020464" "30" "762" "0" "762" "0" "c.762C>G" "r.(?)" "p.(=)" "" "0000951214" "00020464" "30" "894" "0" "894" "0" "c.894C>A" "r.(?)" "p.(Phe298Leu)" "" "0000951215" "00020464" "50" "1318" "10" "1318" "10" "c.*16+10G>A" "r.(=)" "p.(=)" "" "0000952121" "00020464" "90" "468" "0" "468" "0" "c.468C>A" "r.(?)" "p.(Tyr156*)" "" "0000952122" "00020464" "90" "468" "0" "468" "0" "c.468C>A" "r.(?)" "p.(Tyr156*)" "" "0000969548" "00020464" "10" "290" "5593" "290" "5593" "c.290+5593G>A" "r.(=)" "p.(=)" "" "0000969549" "00020464" "30" "374" "11" "374" "11" "c.374+11C>T" "r.(=)" "p.(=)" "" "0000969550" "00020464" "30" "598" "-36" "598" "-36" "c.598-36C>T" "r.(=)" "p.(=)" "" "0000969551" "00020464" "30" "863" "-28" "863" "-28" "c.863-28G>C" "r.(=)" "p.(=)" "" "0000969552" "00020464" "30" "920" "6" "920" "6" "c.920+6C>T" "r.(=)" "p.(=)" "" "0000969553" "00020464" "30" "920" "32" "920" "32" "c.920+32G>A" "r.(=)" "p.(=)" "" "0000969554" "00020464" "50" "1147" "0" "1147" "0" "c.1147C>T" "r.(?)" "p.(Arg383Cys)" "" "0000969555" "00020464" "50" "1168" "0" "1168" "0" "c.1168G>A" "r.(?)" "p.(Val390Met)" "" "0000983189" "00020464" "30" "31" "0" "31" "0" "c.31A>T" "r.(?)" "p.(Met11Leu)" "" "0000983190" "00020464" "90" "179" "0" "179" "0" "c.179dup" "r.(?)" "p.(Tyr60*)" "" "0000983191" "00020464" "50" "618" "0" "618" "0" "c.618G>T" "r.(?)" "p.(=)" "" "0000983192" "00020464" "30" "651" "0" "651" "0" "c.651G>A" "r.(?)" "p.(Pro217=)" "" "0000983193" "00020464" "10" "666" "0" "666" "0" "c.666C>T" "r.(?)" "p.(Pro222=)" "" "0000983194" "00020464" "30" "1164" "0" "1164" "0" "c.1164G>A" "r.(?)" "p.(=)" "" "0000983195" "00020464" "50" "1176" "0" "1176" "0" "c.1176G>A" "r.(?)" "p.(Met392Ile)" "" "0000983196" "00020464" "50" "1180" "0" "1180" "0" "c.1180G>A" "r.(?)" "p.(Gly394Ser)" "" "0000983197" "00020464" "30" "1194" "0" "1194" "0" "c.1194G>A" "r.(?)" "p.(=)" "" "0000983198" "00020464" "50" "15573" "0" "15590" "0" "c.*14271_*14288dup" "r.(=)" "p.(=)" "" "0001004347" "00020464" "30" "374" "19" "374" "24" "c.374+19_374+24del" "r.(=)" "p.(=)" "" "0001004348" "00020464" "50" "523" "0" "523" "0" "c.523A>G" "r.(?)" "p.(Lys175Glu)" "" "0001004349" "00020464" "30" "618" "0" "618" "0" "c.618G>T" "r.(?)" "p.(=)" "" "0001004350" "00020464" "50" "721" "0" "721" "0" "c.721G>A" "r.(?)" "p.(Ala241Thr)" "" "0001015740" "00020464" "30" "464" "10" "464" "10" "c.464+10C>T" "r.(=)" "p.(=)" "" "0001015741" "00020464" "30" "598" "-8" "598" "-8" "c.598-8C>T" "r.(=)" "p.(=)" "" "0001015742" "00020464" "90" "603" "0" "604" "0" "c.603_604dup" "r.(?)" "p.(His202ArgfsTer86)" "" "0001015743" "00020464" "30" "992" "0" "992" "0" "c.992G>A" "r.(?)" "p.(Arg331Gln)" "" "0001015744" "00020464" "50" "1318" "7" "1318" "7" "c.*16+7C>T" "r.(=)" "p.(=)" "" "0001027170" "00020464" "30" "267" "0" "267" "0" "c.267C>T" "r.(?)" "p.(=)" "" "0001027171" "00020464" "30" "597" "21" "597" "21" "c.597+21dup" "r.(=)" "p.(=)" "" "0001027172" "00020464" "30" "615" "0" "615" "0" "c.615G>A" "r.(?)" "p.(=)" "" "0001027173" "00020464" "30" "1050" "0" "1050" "0" "c.1050C>T" "r.(?)" "p.(=)" "" "0001027174" "00020464" "30" "1194" "0" "1194" "0" "c.1194G>A" "r.(?)" "p.(=)" "" "0001042605" "00020464" "10" "-311" "0" "-311" "0" "c.-311C>T" "r.(?)" "p.(=)" "" "0001042607" "00020464" "30" "787" "0" "787" "0" "c.787T>C" "r.(?)" "p.(Leu263=)" "" "0001042608" "00020464" "50" "1150" "0" "1150" "0" "c.1150C>T" "r.(?)" "p.(Arg384Trp)" "" "0001049524" "00020464" "30" "1176" "0" "1176" "0" "c.1176G>A" "r.(?)" "p.(Met392Ile)" "" "0001056397" "00020464" "30" "783" "0" "783" "0" "c.783C>T" "r.(?)" "p.(=)" "" "0001056398" "00020464" "50" "1031" "0" "1031" "0" "c.1031T>C" "r.(?)" "p.(Leu344Pro)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 433 "{{screeningid}}" "{{variantid}}" "0000003215" "0000021762" "0000016027" "0000035714" "0000016028" "0000035715" "0000016029" "0000035716" "0000016030" "0000035717" "0000016031" "0000035718" "0000016032" "0000035719" "0000016033" "0000035720" "0000016035" "0000035721" "0000016036" "0000035722" "0000016037" "0000035723" "0000016038" "0000035724" "0000016039" "0000035725" "0000016040" "0000035726" "0000016041" "0000035727" "0000037267" "0000064392" "0000037268" "0000064393" "0000037269" "0000064394" "0000037270" "0000064395" "0000037271" "0000064396" "0000037272" "0000064397" "0000037273" "0000064398" "0000090932" "0000149061" "0000090933" "0000149062" "0000090934" "0000149063" "0000090935" "0000149064" "0000090936" "0000149065" "0000090937" "0000149066" "0000090938" "0000149067" "0000090939" "0000149068" "0000090940" "0000149069" "0000090941" "0000149070" "0000090942" "0000149071" "0000090943" "0000149072" "0000090944" "0000149073" "0000090945" "0000149074" "0000090946" "0000149075" "0000090947" "0000149076" "0000090948" "0000149077" "0000091038" "0000149167" "0000101367" "0000163908" "0000180097" "0000403558" "0000180098" "0000403559" "0000180099" "0000403560" "0000180100" "0000403561" "0000180101" "0000403562" "0000180102" "0000403563" "0000180103" "0000403564" "0000180104" "0000403565" "0000180105" "0000403566" "0000180106" "0000403567" "0000180107" "0000403568" "0000180108" "0000403569" "0000180109" "0000403570" "0000180110" "0000403571" "0000180111" "0000403572" "0000180112" "0000403573" "0000180113" "0000403574" "0000180114" "0000403575" "0000180115" "0000403576" "0000180116" "0000403577" "0000180117" "0000403578" "0000180118" "0000403579" "0000180119" "0000403580" "0000180120" "0000403581" "0000180121" "0000403582" "0000180122" "0000403583" "0000180123" "0000403584" "0000180124" "0000403585" "0000180125" "0000403586" "0000180126" "0000403587" "0000180127" "0000403588" "0000180128" "0000403589" "0000180129" "0000403590" "0000180130" "0000403591" "0000180131" "0000403592" "0000180132" "0000403593" "0000180133" "0000403594" "0000180134" "0000403595" "0000180135" "0000403596" "0000180136" "0000403597" "0000180137" "0000403598" "0000180138" "0000403599" "0000180139" "0000403600" "0000180140" "0000403601" "0000180141" "0000403602" "0000180142" "0000403603" "0000180143" "0000403604" "0000180144" "0000403605" "0000180145" "0000403606" "0000180146" "0000403607" "0000180147" "0000403608" "0000180148" "0000403609" "0000180149" "0000403610" "0000180150" "0000403611" "0000180151" "0000403612" "0000180152" "0000403613" "0000180153" "0000403614" "0000180154" "0000403615" "0000180155" "0000403616" "0000180156" "0000403617" "0000180157" "0000403618" "0000180158" "0000403619" "0000180159" "0000403620" "0000180160" "0000403621" "0000180161" "0000403622" "0000180162" "0000403623" "0000180163" "0000403624" "0000180164" "0000403625" "0000180165" "0000403626" "0000180166" "0000403627" "0000180167" "0000403628" "0000180168" "0000403629" "0000180169" "0000403630" "0000180170" "0000403631" "0000180171" "0000403632" "0000180172" "0000403633" "0000180173" "0000403634" "0000180174" "0000403635" "0000180175" "0000403636" "0000180176" "0000403637" "0000180177" "0000403638" "0000180178" "0000403639" "0000180179" "0000403640" "0000180180" "0000403641" "0000180181" "0000403642" "0000180182" "0000403643" "0000180183" "0000403644" "0000180184" "0000403645" "0000180185" "0000403646" "0000180186" "0000403647" "0000180187" "0000403648" "0000180188" "0000403649" "0000180189" "0000403650" "0000180190" "0000403651" "0000180191" "0000403652" "0000181817" "0000405513" "0000181818" "0000405514" "0000181819" "0000405515" "0000181820" "0000405516" "0000181821" "0000405517" "0000182582" "0000406472" "0000182583" "0000406473" "0000182584" "0000406474" "0000182585" "0000406475" "0000183819" "0000407709" "0000183820" "0000407710" "0000183821" "0000407711" "0000183822" "0000407712" "0000183823" "0000407713" "0000183824" "0000407714" "0000183825" "0000407715" "0000183826" "0000407716" "0000183827" "0000407717" "0000183828" "0000407718" "0000183829" "0000407719" "0000183830" "0000407720" "0000183831" "0000407721" "0000183832" "0000407722" "0000183833" "0000407723" "0000183834" "0000407724" "0000183835" "0000407725" "0000183836" "0000407726" "0000183837" "0000407727" "0000183838" "0000407728" "0000183839" "0000407729" "0000183840" "0000407730" "0000183841" "0000407731" "0000183842" "0000407732" "0000183843" "0000407733" "0000183844" "0000407734" "0000183845" "0000407735" "0000183846" "0000407736" "0000183847" "0000407737" "0000183848" "0000407738" "0000183849" "0000407739" "0000183850" "0000407740" "0000183851" "0000407741" "0000183852" "0000407742" "0000183853" "0000407743" "0000183854" "0000407744" "0000183855" "0000407745" "0000183856" "0000407746" "0000183857" "0000407747" "0000183858" "0000407748" "0000183859" "0000407749" "0000183860" "0000407750" "0000183861" "0000407751" "0000183862" "0000407752" "0000183863" "0000407753" "0000183864" "0000407754" "0000183865" "0000407755" "0000183866" "0000407756" "0000183867" "0000407757" "0000183868" "0000407758" "0000183869" "0000407759" "0000183870" "0000407760" "0000184523" "0000408659" "0000184524" "0000408660" "0000184525" "0000408661" "0000184526" "0000408662" "0000184527" "0000408641" "0000184528" "0000408642" "0000184529" "0000408643" "0000184530" "0000408644" "0000184531" "0000408645" "0000184532" "0000408646" "0000184533" "0000408647" "0000184534" "0000408648" "0000184535" "0000408649" "0000184536" "0000408650" "0000184537" "0000408651" "0000184538" "0000408652" "0000184539" "0000408653" "0000184540" "0000408654" "0000184541" "0000408655" "0000184542" "0000408656" "0000184543" "0000408657" "0000184544" "0000408658" "0000184615" "0000408737" "0000184616" "0000408738" "0000184617" "0000408739" "0000184617" "0000408740" "0000184618" "0000408741" "0000184619" "0000408742" "0000184620" "0000408743" "0000184621" "0000408744" "0000219146" "0000453992" "0000247741" "0000500612" "0000264250" "0000594757" "0000264259" "0000594766" "0000264263" "0000594770" "0000264264" "0000594771" "0000264265" "0000594773" "0000264266" "0000594774" "0000264267" "0000594775" "0000264268" "0000594776" "0000264269" "0000594777" "0000264270" "0000594778" "0000264271" "0000594779" "0000266223" "0000596842" "0000290605" "0000647291" "0000293205" "0000649894" "0000305772" "0000669460" "0000335737" "0000734530" "0000337568" "0000737199" "0000337569" "0000737200" "0000342919" "0000742550" "0000342920" "0000742551" "0000342921" "0000742552" "0000342922" "0000742553" "0000342923" "0000742554" "0000342924" "0000742555" "0000342925" "0000742556" "0000342926" "0000742557" "0000342927" "0000742558" "0000342928" "0000742559" "0000342929" "0000742560" "0000342930" "0000742561" "0000342931" "0000742562" "0000342932" "0000742563" "0000342933" "0000742564" "0000342934" "0000742565" "0000342935" "0000742566" "0000342936" "0000742567" "0000342937" "0000742568" "0000342938" "0000742569" "0000342939" "0000742570" "0000342940" "0000742571" "0000342941" "0000742572" "0000342942" "0000742573" "0000342943" "0000742574" "0000342944" "0000742575" "0000342945" "0000742576" "0000342946" "0000742577" "0000342947" "0000742578" "0000342948" "0000742579" "0000342949" "0000742580" "0000342950" "0000742581" "0000342951" "0000742582" "0000342952" "0000742583" "0000342953" "0000742584" "0000342954" "0000742585" "0000342955" "0000742586" "0000342956" "0000742587" "0000342957" "0000742588" "0000342958" "0000742589" "0000342959" "0000742590" "0000342960" "0000742591" "0000342961" "0000742592" "0000342962" "0000742593" "0000342963" "0000742594" "0000342964" "0000742595" "0000342965" "0000742596" "0000342966" "0000742597" "0000342967" "0000742598" "0000342968" "0000742599" "0000342969" "0000742600" "0000342970" "0000742601" "0000342971" "0000742602" "0000342972" "0000742603" "0000342973" "0000742604" "0000342974" "0000742605" "0000342975" "0000742606" "0000342976" "0000742607" "0000342977" "0000742608" "0000342978" "0000742609" "0000343145" "0000742776" "0000343146" "0000742777" "0000343147" "0000742778" "0000350164" "0000749795" "0000350165" "0000749796" "0000350166" "0000749797" "0000350167" "0000749798" "0000350168" "0000749799" "0000350169" "0000749800" "0000350170" "0000749801" "0000350171" "0000749802" "0000350172" "0000749803" "0000350173" "0000749804" "0000350174" "0000749805" "0000350175" "0000749806" "0000350176" "0000749807" "0000350177" "0000749808" "0000350178" "0000749809" "0000350179" "0000749810" "0000350180" "0000749811" "0000350181" "0000749812" "0000350182" "0000749813" "0000350183" "0000749814" "0000350184" "0000749815" "0000350185" "0000749816" "0000350186" "0000749817" "0000350187" "0000749818" "0000350188" "0000749819" "0000350189" "0000749820" "0000350190" "0000749821" "0000350191" "0000749822" "0000350192" "0000749823" "0000350193" "0000749824" "0000350194" "0000749825" "0000350195" "0000749826" "0000350196" "0000749827" "0000350197" "0000749828" "0000350198" "0000749829" "0000350199" "0000749830" "0000350200" "0000749831" "0000350201" "0000749832" "0000350202" "0000749833" "0000350203" "0000749834" "0000350204" "0000749835" "0000350205" "0000749836" "0000350206" "0000749837" "0000350207" "0000749838" "0000350208" "0000749839" "0000350209" "0000749840" "0000350210" "0000749841" "0000350211" "0000749842" "0000350212" "0000749843" "0000350213" "0000749844" "0000350214" "0000749845" "0000350215" "0000749846" "0000350216" "0000749847" "0000350217" "0000749848" "0000355057" "0000754690" "0000355058" "0000754691" "0000355059" "0000754692" "0000355060" "0000754693" "0000355061" "0000754694" "0000355062" "0000754695" "0000355063" "0000754696" "0000355064" "0000754697" "0000355065" "0000754698" "0000355066" "0000754699" "0000355067" "0000754700" "0000355068" "0000754701" "0000355069" "0000754702" "0000355070" "0000754703" "0000355071" "0000754704" "0000355072" "0000754705" "0000355073" "0000754706" "0000355074" "0000754707" "0000355075" "0000754708" "0000355076" "0000754709" "0000355077" "0000754710" "0000355078" "0000754711" "0000355079" "0000754712" "0000355080" "0000754713" "0000355081" "0000754714" "0000355082" "0000754715" "0000355083" "0000754716" "0000355084" "0000754717" "0000355085" "0000754718" "0000355086" "0000754719" "0000355087" "0000754720" "0000359833" "0000759464" "0000359834" "0000759465" "0000359835" "0000759466" "0000359836" "0000759467" "0000359837" "0000759468" "0000359838" "0000759469" "0000359839" "0000759470" "0000359840" "0000759471" "0000359841" "0000759472" "0000359842" "0000759473" "0000359843" "0000759474" "0000359844" "0000759475" "0000359845" "0000759476" "0000359846" "0000759477" "0000359847" "0000759478" "0000359848" "0000759479" "0000359849" "0000759480" "0000359850" "0000759481" "0000359851" "0000759482" "0000359852" "0000759483" "0000359853" "0000759484" "0000359854" "0000759485" "0000359855" "0000759486" "0000359856" "0000759487" "0000359857" "0000759488" "0000359858" "0000759489" "0000359859" "0000759490" "0000359860" "0000759491" "0000359861" "0000759492" "0000359862" "0000759493" "0000359863" "0000759494" "0000394400" "0000825315" "0000398183" "0000830390" "0000417724" "0000877449" "0000432991" "0000918616" "0000436678" "0000927780" "0000445221" "0000952121" "0000445222" "0000952122"