### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = STXBP2) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "STXBP2" "syntaxin binding protein 2" "19" "p13.3-p13.2" "unknown" "LRG_165" "UD_132085227684" "" "https://www.LOVD.nl/STXBP2" "" "1" "11445" "6813" "601717" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "" "g" "https://databases.lovd.nl/shared/refseq/STXBP2_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2018-08-01 10:55:49" "00000" "2025-11-01 13:22:20" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00020524" "STXBP2" "transcript variant 1" "001" "NM_006949.2" "" "NP_008880.2" "" "" "" "-45" "1845" "1782" "7701991" "7712759" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 5 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00000" "Healthy/Control" "Healthy individual / control" "" "" "" "" "" "00000" "2012-07-26 17:29:43" "" "" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "03255" "FHL5" "lymphohistiocytosis, hemophagocytic, familial, type 5 (FHL-5)" "" "613101" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "05292" "IMD" "immunodeficiency (IMD)" "" "" "" "" "" "00006" "2017-06-24 18:16:32" "00006" "2017-10-24 17:01:05" "05793" "IMD74" "immunodeficiency, type 74, COVID19-related, X-linked" "XLR" "301051" "" "" "" "00006" "2020-07-24 22:16:50" "00006" "2025-08-26 15:50:59" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 1 "{{geneid}}" "{{diseaseid}}" "STXBP2" "03255" ## Individuals ## Do not remove or alter this header ## ## Count = 15 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00081065" "" "" "" "1" "" "01758" "{PMID:Trujillano 2017:27848944}" "unaffected parents" "" "" "" "" "0" "" "" "" "" "00164421" "" "" "" "1" "" "01807" "" "" "M" "" "(Germany)" "" "0" "" "" "" "" "00292210" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00292211" "" "" "" "26" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00308755" "" "" "" "1" "" "00004" "{PMID:Le 2019:31180159}" "analysis 305 unrelated individuals" "" "" "Viet Nam" "" "0" "" "" "" "" "00334361" "" "" "" "1" "" "04011" "{PMID:Luo 2021:33867526}, {DOI:Luo 2021:10.1038/s41431-021-00886-x}" "analysis 233 patients" "" "" "China" "" "" "" "" "" "" "00334477" "" "" "" "1" "" "04011" "{PMID:Luo 2021:33867526}, {DOI:Luo 2021:10.1038/s41431-021-00886-x}" "analysis 233 patients" "" "" "China" "" "" "" "" "" "" "00334495" "" "" "" "1" "" "04011" "{PMID:Luo 2021:33867526}, {DOI:Luo 2021:10.1038/s41431-021-00886-x}" "analysis 233 patients" "" "" "China" "" "" "" "" "" "" "00334506" "" "" "" "1" "" "04011" "{PMID:Luo 2021:33867526}, {DOI:Luo 2021:10.1038/s41431-021-00886-x}" "analysis 233 patients" "" "" "China" "" "" "" "" "" "" "00334546" "" "" "" "1" "" "04011" "{PMID:Luo 2021:33867526}, {DOI:Luo 2021:10.1038/s41431-021-00886-x}" "analysis 233 patients" "" "" "China" "" "" "" "" "" "" "00334842" "" "" "" "1" "" "04011" "{PMID:Luo 2021:33867526}, {DOI:Luo 2021:10.1038/s41431-021-00886-x}" "analysis 233 patients" "" "" "China" "" "" "" "" "" "" "00334858" "" "" "" "1" "" "04011" "{PMID:Luo 2021:33867526}, {DOI:Luo 2021:10.1038/s41431-021-00886-x}" "analysis 233 patients" "" "" "China" "" "" "" "" "" "" "00334872" "" "" "" "1" "" "04011" "{PMID:Luo 2021:33867526}, {DOI:Luo 2021:10.1038/s41431-021-00886-x}" "analysis 233 patients" "" "" "China" "" "" "" "" "" "" "00335028" "" "" "" "1" "" "04011" "{PMID:Luo 2021:33867526}, {DOI:Luo 2021:10.1038/s41431-021-00886-x}" "analysis 233 patients" "" "" "China" "" "" "" "" "" "" "00433106" "" "" "" "1" "" "00006" "{PMID:Stray-Pedersen 2017:27577878}" "" "F" "" "United States" "" "0" "" "" "Europe" "Pat83,1" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 15 "{{individualid}}" "{{diseaseid}}" "00081065" "03255" "00164421" "00198" "00292210" "00198" "00292211" "00198" "00308755" "00000" "00334361" "05793" "00334477" "05793" "00334495" "05793" "00334506" "05793" "00334546" "05793" "00334842" "05793" "00334858" "05793" "00334872" "05793" "00335028" "05793" "00433106" "05292" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00000, 00198, 03255, 05292, 05793 ## Count = 12 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000060634" "03255" "00081065" "01758" "Familial, autosomal recessive" "" "Hemophagocytic lymphohistiocytosis, familial, 5 (OMIM:613101)" "" "" "" "" "" "" "" "" "" "" "" "0000129480" "00198" "00164421" "01807" "Unknown" "" "HP:0001433 (Hepatosplenomegaly)" "" "" "" "" "" "" "" "" "" "" "" "0000253156" "05793" "00334361" "04011" "Unknown" "" "hospitalized after COVID-19 infection," "" "" "" "" "" "" "" "" "" "COVID-19" "" "0000253190" "05793" "00334477" "04011" "Unknown" "" "hospitalized after COVID-19 infection," "" "" "" "" "" "" "" "" "" "COVID-19" "" "0000253208" "05793" "00334495" "04011" "Unknown" "" "hospitalized after COVID-19 infection," "" "" "" "" "" "" "" "" "" "COVID-19" "" "0000253214" "05793" "00334506" "04011" "Unknown" "" "hospitalized after COVID-19 infection," "" "" "" "" "" "" "" "" "" "COVID-19" "" "0000253236" "05793" "00334546" "04011" "Unknown" "" "hospitalized after COVID-19 infection," "" "" "" "" "" "" "" "" "" "COVID-19" "" "0000253239" "05793" "00334842" "04011" "Unknown" "" "hospitalized after COVID-19 infection," "" "" "" "" "" "" "" "" "" "COVID-19" "" "0000253255" "05793" "00334858" "04011" "Unknown" "" "hospitalized after COVID-19 infection," "" "" "" "" "" "" "" "" "" "COVID-19" "" "0000253267" "05793" "00334872" "04011" "Unknown" "" "hospitalized after COVID-19 infection," "" "" "" "" "" "" "" "" "" "COVID-19" "" "0000253310" "05793" "00335028" "04011" "Unknown" "" "hospitalized after COVID-19 infection," "" "" "" "" "" "" "" "" "" "COVID-19" "" "0000323632" "05292" "00433106" "00006" "Familial, autosomal recessive" "9y" "defect in innate immunity including mucocutaneous candidiasis, hyper IgE syndrome, mendelian susceptibility to mycobacterial disease, and complement deficiency" "" "" "" "" "" "" "" "" "" "primary immunodeficiency disease" "" ## Screenings ## Do not remove or alter this header ## ## Count = 15 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000081177" "00081065" "1" "01758" "00006" "2016-09-07 13:24:08" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000165288" "00164421" "1" "01807" "01807" "2018-05-17 16:06:51" "" "" "SEQ" "DNA" "" "" "0000293378" "00292210" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000293379" "00292211" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000309900" "00308755" "1" "00004" "00006" "2020-08-27 15:56:29" "" "" "SEQ;SEQ-NG" "DNA" "" "105 WGS/200 WES" "0000335589" "00334361" "1" "04011" "04011" "2021-02-28 05:19:20" "00006" "2021-03-05 11:31:40" "SEQ-NG" "DNA" "PBMC" "WES" "0000335706" "00334477" "1" "04011" "04011" "2021-03-01 02:49:24" "00006" "2021-03-05 11:31:40" "SEQ-NG" "DNA" "PBMC" "WES" "0000335724" "00334495" "1" "04011" "04011" "2021-03-01 06:35:34" "00006" "2021-03-05 11:31:40" "SEQ-NG" "DNA" "PBMC" "WES" "0000335736" "00334506" "1" "04011" "04011" "2021-03-01 09:43:11" "00006" "2021-03-05 11:31:40" "SEQ-NG" "DNA" "PBMC" "WES" "0000335775" "00334546" "1" "04011" "04011" "2021-03-01 14:30:48" "00006" "2021-03-05 11:31:40" "SEQ-NG" "DNA" "PBMC" "WES" "0000336071" "00334842" "1" "04011" "04011" "2021-03-02 01:47:14" "00006" "2021-03-05 11:31:40" "SEQ-NG" "DNA" "PBMC" "WES" "0000336087" "00334858" "1" "04011" "04011" "2021-03-02 06:15:27" "00006" "2021-03-05 11:31:40" "SEQ-NG" "DNA" "PBMC" "WES" "0000336101" "00334872" "1" "04011" "04011" "2021-03-02 09:31:09" "00006" "2021-03-05 11:31:40" "SEQ-NG" "DNA" "PBMC" "WES" "0000336257" "00335028" "1" "04011" "04011" "2021-03-03 04:34:16" "00006" "2021-03-05 11:31:40" "SEQ-NG" "DNA" "PBMC" "WES" "0000434537" "00433106" "1" "00006" "00006" "2023-02-28 15:41:53" "" "" "SEQ-NG" "DNA" "" "" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 2 "{{screeningid}}" "{{geneid}}" "0000081177" "STXBP2" "0000309900" "STXBP2" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 90 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000130263" "3" "70" "19" "7711231" "7711231" "subst" "0" "01758" "STXBP2_000001" "g.7711231G>A" "" "{PMID:Trujillano 2017:27848944}" "" "" "" "Germline" "" "" "0" "" "" "g.7646345G>A" "" "likely pathogenic" "ACMG" "0000248216" "0" "10" "19" "7712277" "7712277" "subst" "0.634155" "02325" "STXBP2_000026" "g.7712277A>G" "" "" "" "STXBP2(NM_001272034.2):c.1609A>G (p.I537V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7647391A>G" "" "benign" "" "0000251641" "0" "10" "19" "7710210" "7710210" "subst" "0.422202" "02326" "STXBP2_000023" "g.7710210A>G" "" "" "" "STXBP2(NM_001272034.2):c.1389+18A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7645324A>G" "" "benign" "" "0000254604" "0" "30" "19" "7707654" "7707654" "subst" "0" "01943" "STXBP2_000017" "g.7707654A>G" "" "" "" "STXBP2(NM_001272034.1):c.938A>G (p.K313R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7642768A>G" "" "likely benign" "" "0000314209" "0" "30" "19" "7708058" "7708058" "subst" "0.0108658" "02326" "STXBP2_000018" "g.7708058C>T" "" "" "" "STXBP2(NM_001272034.2):c.1067C>T (p.T356M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7643172C>T" "" "likely benign" "" "0000314210" "0" "10" "19" "7708159" "7708159" "subst" "0.00880045" "02326" "STXBP2_000019" "g.7708159G>A" "" "" "" "STXBP2(NM_001272034.2):c.1140+28G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7643273G>A" "" "benign" "" "0000314211" "0" "30" "19" "7708167" "7708167" "subst" "0.00771807" "02326" "STXBP2_000020" "g.7708167C>T" "" "" "" "STXBP2(NM_001272034.2):c.1140+36C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7643281C>T" "" "likely benign" "" "0000314212" "0" "70" "19" "7710082" "7710082" "subst" "0.000192167" "02326" "STXBP2_000021" "g.7710082G>C" "" "" "" "STXBP2(NM_001272034.1):c.1280-1G>C, STXBP2(NM_001272034.2):c.1280-1G>C, STXBP2(NM_006949.2):c.1247-1G>C, STXBP2(NM_006949.4):c.1247-1G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7645196G>C" "" "likely pathogenic" "" "0000314213" "0" "10" "19" "7710134" "7710134" "subst" "0.00830671" "02326" "STXBP2_000022" "g.7710134C>T" "" "" "" "STXBP2(NM_001127396.3):c.1289C>T (p.A430V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7645248C>T" "" "benign" "" "0000314214" "0" "10" "19" "7711221" "7711221" "subst" "0.416815" "02326" "STXBP2_000024" "g.7711221T>C" "" "" "" "STXBP2(NM_006949.2):c.1443T>C (p.D481=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7646335T>C" "" "benign" "" "0000314215" "0" "10" "19" "7712291" "7712291" "subst" "0.00230834" "02326" "STXBP2_000027" "g.7712291G>A" "" "" "" "STXBP2(NM_006949.2):c.1590G>A (p.A530=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7647405G>A" "" "benign" "" "0000314216" "0" "30" "19" "7712633" "7712633" "subst" "2.84393E-5" "02326" "STXBP2_000029" "g.7712633G>A" "" "" "" "STXBP2(NM_006949.2):c.1719G>A (p.P573=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7647747G>A" "" "likely benign" "" "0000314217" "0" "30" "19" "7704711" "7704711" "subst" "0.00138828" "02326" "STXBP2_000004" "g.7704711C>T" "" "" "" "STXBP2(NM_001272034.2):c.246+18C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7639825C>T" "" "likely benign" "" "0000314218" "0" "10" "19" "7705027" "7705028" "del" "0" "02326" "STXBP2_000006" "g.7705027_7705028del" "" "" "" "STXBP2(NM_001272034.2):c.246+334_246+335delTG" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7640141_7640142del" "" "benign" "" "0000314219" "0" "10" "19" "7704754" "7704755" "del" "0" "02326" "STXBP2_000005" "g.7704754_7704755del" "" "" "" "STXBP2(NM_001272034.2):c.246+61_246+62delGT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7639868_7639869del" "" "benign" "" "0000314220" "0" "10" "19" "7705307" "7705307" "subst" "0" "02326" "STXBP2_000008" "g.7705307C>T" "" "" "" "STXBP2(NM_001272034.2):c.247-277C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7640421C>T" "" "benign" "" "0000314222" "0" "30" "19" "7705682" "7705682" "subst" "0.0001137" "02326" "STXBP2_000009" "g.7705682C>T" "" "" "" "STXBP2(NM_001272034.2):c.345C>T (p.I115=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7640796C>T" "" "likely benign" "" "0000314223" "0" "30" "19" "7705714" "7705714" "subst" "0" "02326" "STXBP2_000010" "g.7705714G>C" "" "" "" "STXBP2(NM_001272034.2):c.358+19G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7640828G>C" "" "likely benign" "" "0000314224" "0" "10" "19" "7703605" "7703605" "subst" "0.399661" "02326" "STXBP2_000003" "g.7703605C>T" "" "" "" "STXBP2(NM_006949.2):c.38-7C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7638719C>T" "" "benign" "" "0000314225" "0" "10" "19" "7706954" "7706954" "subst" "0.00272988" "02326" "STXBP2_000013" "g.7706954G>A" "" "" "" "STXBP2(NM_001272034.2):c.646G>A (p.V216I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7642068G>A" "" "benign" "" "0000314226" "0" "50" "19" "7707426" "7707426" "subst" "8.13471E-6" "02326" "STXBP2_000016" "g.7707426C>T" "" "" "" "STXBP2(NM_006949.2):c.902+4C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7642540C>T" "" "VUS" "" "0000315905" "0" "30" "19" "7712143" "7712143" "subst" "0.0017487" "01943" "STXBP2_000025" "g.7712143C>T" "" "" "" "STXBP2(NM_001272034.1):c.1571+10C>T, STXBP2(NM_001272034.2):c.1571+10C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7647257C>T" "" "likely benign" "" "0000315906" "0" "30" "19" "7702050" "7702050" "subst" "0" "01943" "STXBP2_000002" "g.7702050G>A" "" "" "" "STXBP2(NM_001272034.1):c.15G>A (p.G5=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7637164G>A" "" "likely benign" "" "0000315907" "0" "30" "19" "7712321" "7712321" "subst" "5.74269E-5" "01943" "STXBP2_000028" "g.7712321C>T" "" "" "" "STXBP2(NM_001272034.1):c.1653C>T (p.G551=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7647435C>T" "" "likely benign" "" "0000315908" "0" "30" "19" "7706655" "7706655" "subst" "4.66045E-5" "01943" "STXBP2_000011" "g.7706655G>A" "" "" "" "STXBP2(NM_001272034.1):c.527G>A (p.R176H), STXBP2(NM_001272034.2):c.527G>A (p.R176H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7641769G>A" "" "likely benign" "" "0000315909" "0" "30" "19" "7706707" "7706707" "subst" "0" "01943" "STXBP2_000012" "g.7706707C>G" "" "" "" "STXBP2(NM_001272034.1):c.579C>G (p.T193=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7641821C>G" "" "likely benign" "" "0000315910" "0" "30" "19" "7707169" "7707169" "subst" "1.21853E-5" "01943" "STXBP2_000014" "g.7707169G>A" "" "" "" "STXBP2(NM_001272034.1):c.777G>A (p.T259=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7642283G>A" "" "likely benign" "" "0000315911" "0" "50" "19" "7707201" "7707201" "subst" "1.6246E-5" "01943" "STXBP2_000015" "g.7707201T>C" "" "" "" "STXBP2(NM_001272034.1):c.809T>C (p.I270T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7642315T>C" "" "VUS" "" "0000338754" "0" "90" "19" "7711231" "7711231" "subst" "0" "02327" "STXBP2_000001" "g.7711231G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7646345G>A" "" "pathogenic" "" "0000338755" "0" "50" "19" "7712039" "7712039" "subst" "1.68603E-5" "02327" "STXBP2_000030" "g.7712039G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7647153G>A" "" "VUS" "" "0000340456" "0" "30" "19" "7712050" "7712050" "subst" "0.00112127" "02327" "STXBP2_000031" "g.7712050C>T" "" "" "" "STXBP2(NM_001272034.2):c.1488C>T (p.D496=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7647164C>T" "" "likely benign" "" "0000368946" "0" "90" "19" "7710082" "7710082" "subst" "0.000192167" "01807" "STXBP2_000021" "g.7710082G>C" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.7645196G>C" "" "pathogenic" "" "0000568859" "0" "50" "19" "7703623" "7703623" "subst" "0.000674079" "01943" "PET100_000007" "g.7703623G>A" "" "" "" "STXBP2(NM_001272034.1):c.49G>A (p.G17R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7638737G>A" "" "VUS" "" "0000568860" "0" "10" "19" "7703982" "7703982" "subst" "0.00196682" "01943" "PET100_000008" "g.7703982C>T" "" "" "" "STXBP2(NM_001272034.1):c.165C>T (p.I55=), STXBP2(NM_001272034.2):c.165C>T (p.I55=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7639096C>T" "" "benign" "" "0000568861" "0" "10" "19" "7705239" "7705240" "dup" "0" "02326" "PET100_000009" "g.7705239_7705240dup" "" "" "" "STXBP2(NM_001272034.2):c.247-345_247-344dupTG" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7640353_7640354dup" "" "benign" "" "0000568862" "0" "30" "19" "7708058" "7708058" "subst" "0.0108658" "02325" "STXBP2_000018" "g.7708058C>T" "" "" "" "STXBP2(NM_001272034.2):c.1067C>T (p.T356M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7643172C>T" "" "likely benign" "" "0000568863" "0" "90" "19" "7709564" "7709564" "del" "0" "02326" "STXBP2_000032" "g.7709564del" "" "" "" "STXBP2(NM_001127396.3):c.1163delC (p.P388Rfs*27)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7644678del" "" "pathogenic" "" "0000568864" "0" "90" "19" "7710082" "7710082" "subst" "0.000192167" "01943" "STXBP2_000021" "g.7710082G>C" "" "" "" "STXBP2(NM_001272034.1):c.1280-1G>C, STXBP2(NM_001272034.2):c.1280-1G>C, STXBP2(NM_006949.2):c.1247-1G>C, STXBP2(NM_006949.4):c.1247-1G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7645196G>C" "" "pathogenic" "" "0000568865" "0" "90" "19" "7710082" "7710082" "subst" "0.000192167" "02327" "STXBP2_000021" "g.7710082G>C" "" "" "" "STXBP2(NM_001272034.1):c.1280-1G>C, STXBP2(NM_001272034.2):c.1280-1G>C, STXBP2(NM_006949.2):c.1247-1G>C, STXBP2(NM_006949.4):c.1247-1G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7645196G>C" "" "pathogenic" "" "0000568866" "0" "30" "19" "7710205" "7710205" "subst" "0.000115941" "02326" "STXBP2_000033" "g.7710205C>T" "" "" "" "STXBP2(NM_001272034.2):c.1389+13C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7645319C>T" "" "likely benign" "" "0000568867" "0" "10" "19" "7712277" "7712277" "subst" "0.634155" "02327" "STXBP2_000026" "g.7712277A>G" "" "" "" "STXBP2(NM_001272034.2):c.1609A>G (p.I537V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7647391A>G" "" "benign" "" "0000568868" "0" "50" "19" "7712287" "7712287" "subst" "0.000106593" "02326" "STXBP2_000034" "g.7712287G>A" "" "" "" "STXBP2(NM_006949.2):c.1586G>A (p.R529Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7647401G>A" "" "VUS" "" "0000568869" "0" "50" "19" "7712322" "7712322" "subst" "0.000229868" "01943" "STXBP2_000035" "g.7712322G>A" "" "" "" "STXBP2(NM_001127396.3):c.1612G>A (p.G538S), STXBP2(NM_001272034.1):c.1654G>A (p.G552S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7647436G>A" "" "VUS" "" "0000568870" "0" "90" "19" "7712322" "7712322" "subst" "0.000229868" "02327" "STXBP2_000035" "g.7712322G>A" "" "" "" "STXBP2(NM_001127396.3):c.1612G>A (p.G538S), STXBP2(NM_001272034.1):c.1654G>A (p.G552S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7647436G>A" "" "pathogenic" "" "0000568871" "0" "90" "19" "7712322" "7712322" "subst" "0.000229868" "02326" "STXBP2_000035" "g.7712322G>A" "" "" "" "STXBP2(NM_001127396.3):c.1612G>A (p.G538S), STXBP2(NM_001272034.1):c.1654G>A (p.G552S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7647436G>A" "" "pathogenic" "" "0000617948" "0" "30" "19" "7706755" "7706756" "del" "0" "02326" "STXBP2_000036" "g.7706755_7706756del" "" "" "" "STXBP2(NM_001272034.2):c.611+16_611+17delAG" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7641869_7641870del" "" "likely benign" "" "0000617949" "0" "30" "19" "7707142" "7707142" "subst" "0.000154364" "01943" "STXBP2_000038" "g.7707142C>T" "" "" "" "STXBP2(NM_001272034.1):c.750C>T (p.P250=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7642256C>T" "" "likely benign" "" "0000624108" "0" "50" "19" "7707002" "7707002" "subst" "0.000134189" "01943" "STXBP2_000037" "g.7707002G>A" "" "" "" "STXBP2(NM_001272034.1):c.694G>A (p.E232K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7642116G>A" "" "VUS" "" "0000650067" "1" "50" "19" "7707105" "7707105" "subst" "1.62472E-5" "03575" "STXBP2_000039" "g.7707105G>A" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs200855062}" "Germline" "" "rs200855062" "0" "" "" "g.7642219G>A" "" "VUS" "" "0000650068" "1" "30" "19" "7710134" "7710134" "subst" "0.00830671" "03575" "STXBP2_000022" "g.7710134C>T" "26/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "26 heterozygous, no homozygous; {DB:CLININrs141309384}" "Germline" "" "rs141309384" "0" "" "" "g.7645248C>T" "" "likely benign" "" "0000658697" "0" "30" "19" "7707366" "7707366" "subst" "0.000284416" "02326" "STXBP2_000040" "g.7707366C>T" "" "" "" "STXBP2(NM_001272034.2):c.879C>T (p.D293=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7642480C>T" "" "likely benign" "" "0000658698" "0" "30" "19" "7709580" "7709580" "subst" "4.48222E-5" "01943" "STXBP2_000041" "g.7709580G>A" "" "" "" "STXBP2(NM_001272034.1):c.1221G>A (p.A407=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7644694G>A" "" "likely benign" "" "0000658699" "0" "30" "19" "7712143" "7712143" "subst" "0.0017487" "02326" "STXBP2_000025" "g.7712143C>T" "" "" "" "STXBP2(NM_001272034.1):c.1571+10C>T, STXBP2(NM_001272034.2):c.1571+10C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7647257C>T" "" "likely benign" "" "0000681546" "0" "50" "19" "7712287" "7712287" "subst" "0.00143081" "02325" "STXBP2_000042" "g.7712287G>C" "" "" "" "STXBP2(NM_001272034.2):c.1619G>C (p.R540P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000684802" "0" "10" "19" "7712364" "7712364" "subst" "0.00284555" "00004" "STXBP2_000043" "g.7712364A>G" "frequency 0.022" "{PMID:Le 2019:31180159}" "" "" "classification based on frequency in 305 unrelated individuals" "Germline" "" "" "0" "" "" "g.7647478A>G" "" "benign" "" "0000692918" "0" "30" "19" "7709520" "7709520" "subst" "0.00037979" "02326" "STXBP2_000044" "g.7709520C>T" "" "" "" "STXBP2(NM_001272034.2):c.1161C>T (p.D387=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727579" "0" "50" "19" "7705818" "7705818" "subst" "9.74564E-5" "01943" "PET100_000012" "g.7705818C>T" "" "" "" "STXBP2(NM_001272034.1):c.391C>T (p.R131C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000727580" "0" "30" "19" "7706659" "7706659" "subst" "4.00043E-5" "01943" "STXBP2_000045" "g.7706659G>A" "" "" "" "STXBP2(NM_001272034.1):c.531G>A (p.T177=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727581" "0" "50" "19" "7706729" "7706729" "subst" "0.00048883" "02325" "STXBP2_000046" "g.7706729C>T" "" "" "" "STXBP2(NM_006949.4):c.568C>T (p.R190C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000734178" "0" "70" "19" "7707702" "7707702" "subst" "0.000394238" "04011" "STXBP2_000047" "g.7707702C>T" "" "{PMID:Luo 2021:33867526}, {DOI:Luo 2021:10.1038/s41431-021-00886-x}" "" "" "" "Germline" "" "" "" "" "" "" "" "VUS" "" "0000734428" "0" "70" "19" "7711153" "7711153" "subst" "0.00450798" "04011" "STXBP2_000048" "g.7711153C>T" "" "{PMID:Luo 2021:33867526}, {DOI:Luo 2021:10.1038/s41431-021-00886-x}" "" "" "" "Germline" "" "" "" "" "" "" "" "VUS" "" "0000734495" "0" "70" "19" "7711153" "7711153" "subst" "0.00450798" "04011" "STXBP2_000048" "g.7711153C>T" "" "{PMID:Luo 2021:33867526}, {DOI:Luo 2021:10.1038/s41431-021-00886-x}" "" "" "" "Germline" "" "" "" "" "" "" "" "VUS" "" "0000734538" "0" "70" "19" "7709560" "7709560" "subst" "2.03508E-5" "04011" "STXBP2_000051" "g.7709560G>A" "" "{PMID:Luo 2021:33867526}, {DOI:Luo 2021:10.1038/s41431-021-00886-x}" "" "" "" "Germline" "" "" "" "" "" "" "" "VUS" "" "0000734665" "0" "70" "19" "7707702" "7707702" "subst" "0.000394238" "04011" "STXBP2_000047" "g.7707702C>T" "" "{PMID:Luo 2021:33867526}, {DOI:Luo 2021:10.1038/s41431-021-00886-x}" "" "" "" "Germline" "" "" "" "" "" "" "" "VUS" "" "0000734988" "0" "70" "19" "7711153" "7711153" "subst" "0.00450798" "04011" "STXBP2_000048" "g.7711153C>T" "" "{PMID:Luo 2021:33867526}, {DOI:Luo 2021:10.1038/s41431-021-00886-x}" "" "" "" "Germline" "" "" "" "" "" "" "" "VUS" "" "0000735081" "0" "70" "19" "7707702" "7707702" "subst" "0.000394238" "04011" "STXBP2_000047" "g.7707702C>T" "" "{PMID:Luo 2021:33867526}, {DOI:Luo 2021:10.1038/s41431-021-00886-x}" "" "" "" "Germline" "" "" "" "" "" "" "" "VUS" "" "0000735130" "0" "70" "19" "7706691" "7706691" "subst" "0" "04011" "STXBP2_000049" "g.7706691C>T" "" "{PMID:Luo 2021:33867526}, {DOI:Luo 2021:10.1038/s41431-021-00886-x}" "" "" "" "Germline" "" "" "" "" "" "" "" "VUS" "" "0000735482" "0" "70" "19" "7709527" "7709527" "subst" "8.15568E-6" "04011" "STXBP2_000050" "g.7709527G>A" "" "{PMID:Luo 2021:33867526}, {DOI:Luo 2021:10.1038/s41431-021-00886-x}" "" "" "" "Germline" "" "" "" "" "" "" "" "VUS" "" "0000809117" "0" "30" "19" "7705899" "7705899" "subst" "0" "01943" "PET100_000013" "g.7705899G>C" "" "" "" "STXBP2(NM_001272034.1):c.462+10G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809118" "0" "30" "19" "7707340" "7707340" "subst" "0.000414523" "02326" "STXBP2_000052" "g.7707340G>T" "" "" "" "STXBP2(NM_001272034.2):c.853G>T (p.A285S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000866361" "0" "30" "19" "7707414" "7707414" "subst" "0" "01943" "STXBP2_000053" "g.7707414T>C" "" "" "" "STXBP2(NM_001272034.1):c.927T>C (p.D309=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000866362" "0" "30" "19" "7710135" "7710135" "subst" "0.000189812" "01943" "STXBP2_000054" "g.7710135G>A" "" "" "" "STXBP2(NM_001272034.1):c.1332G>A (p.A444=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000866363" "0" "30" "19" "7712363" "7712363" "subst" "4.2712E-6" "01943" "STXBP2_000055" "g.7712363C>T" "" "" "" "STXBP2(NM_001272034.1):c.1695C>T (p.T565=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000895196" "0" "30" "19" "7707441" "7707441" "subst" "4.89364E-5" "02326" "STXBP2_000056" "g.7707441C>T" "" "" "" "STXBP2(NM_001272034.2):c.935+19C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000895197" "0" "90" "19" "7710082" "7710082" "subst" "0.000192167" "02329" "STXBP2_000021" "g.7710082G>C" "" "" "" "STXBP2(NM_001272034.1):c.1280-1G>C, STXBP2(NM_001272034.2):c.1280-1G>C, STXBP2(NM_006949.2):c.1247-1G>C, STXBP2(NM_006949.4):c.1247-1G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000895198" "0" "30" "19" "7712050" "7712050" "subst" "0.00112127" "02326" "STXBP2_000031" "g.7712050C>T" "" "" "" "STXBP2(NM_001272034.2):c.1488C>T (p.D496=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000915329" "0" "30" "19" "7703594" "7703594" "subst" "2.43639E-5" "02326" "PET100_000014" "g.7703594C>T" "" "" "" "STXBP2(NM_001272034.2):c.38-18C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000915330" "0" "90" "19" "7710082" "7710082" "subst" "0.000192167" "02325" "STXBP2_000021" "g.7710082G>C" "" "" "" "STXBP2(NM_001272034.1):c.1280-1G>C, STXBP2(NM_001272034.2):c.1280-1G>C, STXBP2(NM_006949.2):c.1247-1G>C, STXBP2(NM_006949.4):c.1247-1G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000920291" "1" "90" "19" "7709605" "7709605" "subst" "1.62955E-5" "00006" "STXBP2_000058" "g.7709605C>T" "" "{PMID:Stray-Pedersen 2017:27577878}" "" "" "" "De novo" "" "" "0" "" "" "g.7644719C>T" "" "pathogenic" "ACMG" "0000920351" "2" "90" "19" "7710082" "7710082" "subst" "0.000192167" "00006" "STXBP2_000021" "g.7710082G>C" "" "{PMID:Stray-Pedersen 2017:27577878}" "" "" "" "Germline" "" "" "0" "" "" "g.7645196G>C" "" "pathogenic" "ACMG" "0000926963" "0" "30" "19" "7706655" "7706655" "subst" "4.66045E-5" "02326" "STXBP2_000011" "g.7706655G>A" "" "" "" "STXBP2(NM_001272034.1):c.527G>A (p.R176H), STXBP2(NM_001272034.2):c.527G>A (p.R176H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000926964" "0" "30" "19" "7712270" "7712270" "subst" "0.000574793" "02326" "STXBP2_000059" "g.7712270G>A" "" "" "" "STXBP2(NM_001272034.2):c.1602G>A (p.K534=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000931133" "0" "50" "19" "7707162" "7707162" "subst" "0" "02325" "STXBP2_000060" "g.7707162A>T" "" "" "" "STXBP2(NM_006949.4):c.737A>T (p.E246V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000931134" "0" "30" "19" "7712758" "7712758" "subst" "0" "02326" "STXBP2_000061" "g.7712758C>T" "" "" "" "STXBP2(NR_073560.2):n.1859C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000951384" "0" "30" "19" "7707369" "7707369" "subst" "0.00305535" "02326" "STXBP2_000062" "g.7707369G>A" "" "" "" "STXBP2(NM_001272034.2):c.882G>A (p.E294=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000970045" "0" "10" "19" "7703982" "7703982" "subst" "0.00196682" "02326" "PET100_000008" "g.7703982C>T" "" "" "" "STXBP2(NM_001272034.1):c.165C>T (p.I55=), STXBP2(NM_001272034.2):c.165C>T (p.I55=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000970046" "0" "30" "19" "7707311" "7707311" "subst" "0.0117898" "02326" "STXBP2_000063" "g.7707311C>T" "" "" "" "STXBP2(NM_001127396.3):c.786-4C>T, STXBP2(NM_006949.2):c.795-4C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001043234" "0" "50" "19" "7706736" "7706736" "subst" "0" "01804" "STXBP2_000064" "g.7706736G>A" "" "" "" "STXBP2(NM_006949.4):c.575G>A (p.(Arg192His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001043235" "0" "50" "19" "7707013" "7707033" "del" "0" "02326" "STXBP2_000065" "g.7707013_7707033del" "" "" "" "STXBP2(NM_001272034.2):c.694_696+18delGAGGTGAGGGGGCGTGCTTGG" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001056455" "0" "10" "19" "7706656" "7706656" "subst" "0.00747261" "02327" "STXBP2_000066" "g.7706656C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes STXBP2 ## Count = 90 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000130263" "00020524" "70" "1452" "1" "1452" "1" "c.1452+1G>A" "r.spl?" "p.?" "" "0000248216" "00020524" "10" "1576" "0" "1576" "0" "c.1576A>G" "r.(?)" "p.(Ile526Val)" "" "0000251641" "00020524" "10" "1356" "18" "1356" "18" "c.1356+18A>G" "r.(=)" "p.(=)" "" "0000254604" "00020524" "30" "905" "0" "905" "0" "c.905A>G" "r.(?)" "p.(Lys302Arg)" "" "0000314209" "00020524" "30" "1034" "0" "1034" "0" "c.1034C>T" "r.(?)" "p.(Thr345Met)" "" "0000314210" "00020524" "10" "1107" "28" "1107" "28" "c.1107+28G>A" "r.(=)" "p.(=)" "" "0000314211" "00020524" "30" "1107" "36" "1107" "36" "c.1107+36C>T" "r.(=)" "p.(=)" "" "0000314212" "00020524" "70" "1247" "-1" "1247" "-1" "c.1247-1G>C" "r.spl?" "p.?" "" "0000314213" "00020524" "10" "1298" "0" "1298" "0" "c.1298C>T" "r.(?)" "p.(Ala433Val)" "" "0000314214" "00020524" "10" "1443" "0" "1443" "0" "c.1443T>C" "r.(?)" "p.(Asp481=)" "" "0000314215" "00020524" "10" "1590" "0" "1590" "0" "c.1590G>A" "r.(?)" "p.(Ala530=)" "" "0000314216" "00020524" "30" "1719" "0" "1719" "0" "c.1719G>A" "r.(?)" "p.(Pro573=)" "" "0000314217" "00020524" "30" "246" "18" "246" "18" "c.246+18C>T" "r.(=)" "p.(=)" "" "0000314218" "00020524" "10" "246" "334" "246" "335" "c.246+334_246+335del" "r.(=)" "p.(=)" "" "0000314219" "00020524" "10" "246" "61" "246" "62" "c.246+61_246+62del" "r.(=)" "p.(=)" "" "0000314220" "00020524" "10" "247" "-310" "247" "-310" "c.247-310C>T" "r.(=)" "p.(=)" "" "0000314222" "00020524" "30" "312" "0" "312" "0" "c.312C>T" "r.(?)" "p.(Ile104=)" "" "0000314223" "00020524" "30" "325" "19" "325" "19" "c.325+19G>C" "r.(=)" "p.(=)" "" "0000314224" "00020524" "10" "38" "-7" "38" "-7" "c.38-7C>T" "r.(=)" "p.(=)" "" "0000314225" "00020524" "10" "613" "0" "613" "0" "c.613G>A" "r.(?)" "p.(Val205Ile)" "" "0000314226" "00020524" "50" "902" "4" "902" "4" "c.902+4C>T" "r.spl?" "p.?" "" "0000315905" "00020524" "30" "1538" "10" "1538" "10" "c.1538+10C>T" "r.(=)" "p.(=)" "" "0000315906" "00020524" "30" "15" "0" "15" "0" "c.15G>A" "r.(?)" "p.(Gly5=)" "" "0000315907" "00020524" "30" "1620" "0" "1620" "0" "c.1620C>T" "r.(?)" "p.(Gly540=)" "" "0000315908" "00020524" "30" "494" "0" "494" "0" "c.494G>A" "r.(?)" "p.(Arg165His)" "" "0000315909" "00020524" "30" "546" "0" "546" "0" "c.546C>G" "r.(?)" "p.(Thr182=)" "" "0000315910" "00020524" "30" "744" "0" "744" "0" "c.744G>A" "r.(?)" "p.(Thr248=)" "" "0000315911" "00020524" "50" "776" "0" "776" "0" "c.776T>C" "r.(?)" "p.(Ile259Thr)" "" "0000338754" "00020524" "90" "1452" "1" "1452" "1" "c.1452+1G>A" "r.spl?" "p.?" "" "0000338755" "00020524" "50" "1453" "-9" "1453" "-9" "c.1453-9G>A" "r.(=)" "p.(=)" "" "0000340456" "00020524" "30" "1455" "0" "1455" "0" "c.1455C>T" "r.(?)" "p.(Asp485=)" "" "0000368946" "00020524" "90" "1247" "-1" "1247" "-1" "c.1247-1G>C" "r.spl" "p.?" "" "0000568859" "00020524" "50" "49" "0" "49" "0" "c.49G>A" "r.(?)" "p.(Gly17Arg)" "" "0000568860" "00020524" "10" "165" "0" "165" "0" "c.165C>T" "r.(?)" "p.(Ile55=)" "" "0000568861" "00020524" "10" "247" "-378" "247" "-377" "c.247-378_247-377dup" "r.(=)" "p.(=)" "" "0000568862" "00020524" "30" "1034" "0" "1034" "0" "c.1034C>T" "r.(?)" "p.(Thr345Met)" "" "0000568863" "00020524" "90" "1172" "0" "1172" "0" "c.1172del" "r.(?)" "p.(Pro391ArgfsTer27)" "" "0000568864" "00020524" "90" "1247" "-1" "1247" "-1" "c.1247-1G>C" "r.spl?" "p.?" "" "0000568865" "00020524" "90" "1247" "-1" "1247" "-1" "c.1247-1G>C" "r.spl?" "p.?" "" "0000568866" "00020524" "30" "1356" "13" "1356" "13" "c.1356+13C>T" "r.(=)" "p.(=)" "" "0000568867" "00020524" "10" "1576" "0" "1576" "0" "c.1576A>G" "r.(?)" "p.(Ile526Val)" "" "0000568868" "00020524" "50" "1586" "0" "1586" "0" "c.1586G>A" "r.(?)" "p.(Arg529Gln)" "" "0000568869" "00020524" "50" "1621" "0" "1621" "0" "c.1621G>A" "r.(?)" "p.(Gly541Ser)" "" "0000568870" "00020524" "90" "1621" "0" "1621" "0" "c.1621G>A" "r.(?)" "p.(Gly541Ser)" "" "0000568871" "00020524" "90" "1621" "0" "1621" "0" "c.1621G>A" "r.(?)" "p.(Gly541Ser)" "" "0000617948" "00020524" "30" "578" "16" "578" "17" "c.578+16_578+17del" "r.(=)" "p.(=)" "" "0000617949" "00020524" "30" "717" "0" "717" "0" "c.717C>T" "r.(?)" "p.(Pro239=)" "" "0000624108" "00020524" "50" "661" "0" "661" "0" "c.661G>A" "r.(?)" "p.(Glu221Lys)" "" "0000650067" "00020524" "50" "680" "0" "680" "0" "c.680G>A" "r.(?)" "p.(Arg227His)" "" "0000650068" "00020524" "30" "1298" "0" "1298" "0" "c.1298C>T" "r.(?)" "p.(Ala433Val)" "" "0000658697" "00020524" "30" "846" "0" "846" "0" "c.846C>T" "r.(?)" "p.(Asp282=)" "" "0000658698" "00020524" "30" "1188" "0" "1188" "0" "c.1188G>A" "r.(?)" "p.(Ala396=)" "" "0000658699" "00020524" "30" "1538" "10" "1538" "10" "c.1538+10C>T" "r.(=)" "p.(=)" "" "0000681546" "00020524" "50" "1586" "0" "1586" "0" "c.1586G>C" "r.(?)" "p.(Arg529Pro)" "" "0000684802" "00020524" "10" "1663" "0" "1663" "0" "c.1663A>G" "r.(?)" "p.(Arg555Gly)" "" "0000692918" "00020524" "30" "1128" "0" "1128" "0" "c.1128C>T" "r.(?)" "p.(Asp376=)" "" "0000727579" "00020524" "50" "358" "0" "358" "0" "c.358C>T" "r.(?)" "p.(Arg120Cys)" "" "0000727580" "00020524" "30" "498" "0" "498" "0" "c.498G>A" "r.(?)" "p.(Thr166=)" "" "0000727581" "00020524" "50" "568" "0" "568" "0" "c.568C>T" "r.(?)" "p.(Arg190Cys)" "" "0000734178" "00020524" "50" "953" "0" "953" "0" "c.953C>T" "r.(?)" "p.(Thr318Met)" "" "0000734428" "00020524" "50" "1375" "0" "1375" "0" "c.1375C>T" "r.(?)" "p.(Arg459Trp)" "" "0000734495" "00020524" "50" "1375" "0" "1375" "0" "c.1375C>T" "r.(?)" "p.(Arg459Trp)" "" "0000734538" "00020524" "50" "1168" "0" "1168" "0" "c.1168G>A" "r.(?)" "p.(Val390Ile)" "" "0000734665" "00020524" "50" "953" "0" "953" "0" "c.953C>T" "r.(?)" "p.(Thr318Met)" "" "0000734988" "00020524" "50" "1375" "0" "1375" "0" "c.1375C>T" "r.(?)" "p.(Arg459Trp)" "" "0000735081" "00020524" "50" "953" "0" "953" "0" "c.953C>T" "r.(?)" "p.(Thr318Met)" "" "0000735130" "00020524" "50" "530" "0" "530" "0" "c.530C>T" "r.(?)" "p.(Ala177Val)" "" "0000735482" "00020524" "50" "1135" "0" "1135" "0" "c.1135G>A" "r.(?)" "p.(Gly379Arg)" "" "0000809117" "00020524" "30" "429" "10" "429" "10" "c.429+10G>C" "r.(=)" "p.(=)" "" "0000809118" "00020524" "30" "820" "0" "820" "0" "c.820G>T" "r.(?)" "p.(Ala274Ser)" "" "0000866361" "00020524" "30" "894" "0" "894" "0" "c.894T>C" "r.(?)" "p.(Asp298=)" "" "0000866362" "00020524" "30" "1299" "0" "1299" "0" "c.1299G>A" "r.(?)" "p.(Ala433=)" "" "0000866363" "00020524" "30" "1662" "0" "1662" "0" "c.1662C>T" "r.(?)" "p.(Thr554=)" "" "0000895196" "00020524" "30" "902" "19" "902" "19" "c.902+19C>T" "r.(=)" "p.(=)" "" "0000895197" "00020524" "90" "1247" "-1" "1247" "-1" "c.1247-1G>C" "r.spl?" "p.?" "" "0000895198" "00020524" "30" "1455" "0" "1455" "0" "c.1455C>T" "r.(?)" "p.(Asp485=)" "" "0000915329" "00020524" "30" "38" "-18" "38" "-18" "c.38-18C>T" "r.(=)" "p.(=)" "" "0000915330" "00020524" "90" "1247" "-1" "1247" "-1" "c.1247-1G>C" "r.spl?" "p.?" "" "0000920291" "00020524" "90" "1213" "0" "1213" "0" "c.1213C>T" "r.(?)" "p.(Arg405Trp)" "14" "0000920351" "00020524" "90" "1247" "-1" "1247" "-1" "c.1247-1G>C" "r.spl" "p.?" "14i" "0000926963" "00020524" "30" "494" "0" "494" "0" "c.494G>A" "r.(?)" "p.(Arg165His)" "" "0000926964" "00020524" "30" "1569" "0" "1569" "0" "c.1569G>A" "r.(?)" "p.(Lys523=)" "" "0000931133" "00020524" "50" "737" "0" "737" "0" "c.737A>T" "r.(?)" "p.(Glu246Val)" "" "0000931134" "00020524" "30" "1844" "0" "1844" "0" "c.*62C>T" "r.(=)" "p.(=)" "" "0000951384" "00020524" "30" "849" "0" "849" "0" "c.849G>A" "r.(?)" "p.(=)" "" "0000970045" "00020524" "10" "165" "0" "165" "0" "c.165C>T" "r.(?)" "p.(Ile55=)" "" "0000970046" "00020524" "30" "795" "-4" "795" "-4" "c.795-4C>T" "r.spl?" "p.?" "" "0001043234" "00020524" "50" "575" "0" "575" "0" "c.575G>A" "r.(?)" "p.(Arg192His)" "" "0001043235" "00020524" "50" "663" "9" "663" "29" "c.663+9_663+29del" "r.(=)" "p.(=)" "" "0001056455" "00020524" "10" "495" "0" "495" "0" "c.495C>T" "r.(?)" "p.(=)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 16 "{{screeningid}}" "{{variantid}}" "0000081177" "0000130263" "0000165288" "0000368946" "0000293378" "0000650067" "0000293379" "0000650068" "0000309900" "0000684802" "0000335589" "0000734178" "0000335706" "0000734428" "0000335724" "0000734495" "0000335736" "0000734538" "0000335775" "0000734665" "0000336071" "0000734988" "0000336087" "0000735081" "0000336101" "0000735130" "0000336257" "0000735482" "0000434537" "0000920291" "0000434537" "0000920351"