### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ###
## Filter: (gene_public = SURF1)
# charset = UTF-8

## Genes ## Do not remove or alter this header ##
## Count = 1
"{{id}}"	"{{name}}"	"{{chromosome}}"	"{{chrom_band}}"	"{{imprinting}}"	"{{refseq_genomic}}"	"{{refseq_UD}}"	"{{reference}}"	"{{url_homepage}}"	"{{url_external}}"	"{{allow_download}}"	"{{id_hgnc}}"	"{{id_entrez}}"	"{{id_omim}}"	"{{show_hgmd}}"	"{{show_genecards}}"	"{{show_genetests}}"	"{{show_orphanet}}"	"{{note_index}}"	"{{note_listing}}"	"{{refseq}}"	"{{refseq_url}}"	"{{disclaimer}}"	"{{disclaimer_text}}"	"{{header}}"	"{{header_align}}"	"{{footer}}"	"{{footer_align}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"	"{{updated_by}}"	"{{updated_date}}"
"SURF1"	"surfeit 1"	"9"	"q33-q34"	"unknown"	"NG_008477.1"	"UD_132084395474"	""	"http://www.LOVD.nl/SURF1"	""	"1"	"11474"	"6834"	"185620"	"1"	"1"	"1"	"1"	"Establishment of the database was supported by the European Community\'s Seventh Framework Programme (FP7/2007-2013) under grant agreement No 200754 - the GEN2PHEN project."	""	"g"	"http://databases.lovd.nl/shared/refseq/SURF1_codingDNA.html"	"1"	""	""	"-1"	""	"-1"	"00001"	"2010-04-29 00:00:00"	"00006"	"2021-07-23 10:41:40"	"00006"	"2025-11-13 15:33:04"


## Transcripts ## Do not remove or alter this header ##
## Count = 1
"{{id}}"	"{{geneid}}"	"{{name}}"	"{{id_mutalyzer}}"	"{{id_ncbi}}"	"{{id_ensembl}}"	"{{id_protein_ncbi}}"	"{{id_protein_ensembl}}"	"{{id_protein_uniprot}}"	"{{remarks}}"	"{{position_c_mrna_start}}"	"{{position_c_mrna_end}}"	"{{position_c_cds_end}}"	"{{position_g_mrna_start}}"	"{{position_g_mrna_end}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"
"00024196"	"SURF1"	"transcript variant 1"	"002"	"NM_003172.3"	""	"NP_003163.1"	""	""	""	"-32"	"1011"	"903"	"136223361"	"136218660"	"00006"	"2016-11-12 09:51:30"	""	""


## Diseases ## Do not remove or alter this header ##
## Count = 8
"{{id}}"	"{{symbol}}"	"{{name}}"	"{{inheritance}}"	"{{id_omim}}"	"{{tissues}}"	"{{features}}"	"{{remarks}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"
"00038"	"LS"	"Leigh syndrome (LS)"	"AR;Mi"	"256000"	""	""	""	"00008"	"2012-08-30 16:26:44"	"00006"	"2025-01-31 09:48:07"
"00139"	"ID"	"intellectual disability (ID)"	""	""	""	""	""	"00084"	"2013-06-04 18:18:07"	"00006"	"2015-02-09 10:02:49"
"00198"	"?"	"unclassified / mixed"	""	""	""	""	""	"00006"	"2013-09-13 14:21:47"	"00006"	"2024-11-23 09:38:12"
"01740"	"MC4DN"	"mitochondrial complex IV deficiency (MCDN4)"	""	""	""	""	""	"00006"	"2014-09-25 23:29:40"	"00006"	"2021-07-23 10:38:44"
"05113"	"CMT"	"Charcot-Marie-Tooth disease (CMT)"	""	""	""	""	""	"00006"	"2016-01-11 01:40:57"	""	""
"05147"	"CPEO"	"ophthalmoplegia, external, progressive, chronic (CPEO)"	""	""	""	""	""	"00006"	"2016-03-27 15:38:04"	""	""
"05955"	"MC4DN1"	"mitochondrial complex IV deficiency, nuclear, type 1 (MC4DN1)"	"AR;Mi"	"220110"	""	""	""	"00006"	"2021-07-23 10:41:14"	"00006"	"2021-12-10 21:51:32"
"06807"	"CMT4K"	"Charcot-Marie-Tooth disease, type 4K"	"AR"	"616684"	""	""	""	"00006"	"2021-12-10 23:20:41"	""	""


## Genes_To_Diseases ## Do not remove or alter this header ##
## Count = 5
"{{geneid}}"	"{{diseaseid}}"
"SURF1"	"00038"
"SURF1"	"00139"
"SURF1"	"01740"
"SURF1"	"05955"
"SURF1"	"06807"


## Individuals ## Do not remove or alter this header ##
## Count = 41
"{{id}}"	"{{fatherid}}"	"{{motherid}}"	"{{panelid}}"	"{{panel_size}}"	"{{license}}"	"{{owned_by}}"	"{{Individual/Reference}}"	"{{Individual/Remarks}}"	"{{Individual/Gender}}"	"{{Individual/Consanguinity}}"	"{{Individual/Origin/Geographic}}"	"{{Individual/Age_of_death}}"	"{{Individual/VIP}}"	"{{Individual/Data_av}}"	"{{Individual/Treatment}}"	"{{Individual/Origin/Population}}"	"{{Individual/Individual_ID}}"
"00037218"	""	""	""	"1"	""	"01164"	""	""	""	""	"Germany"	""	"0"	""	""	""	""
"00037219"	""	""	""	"1"	""	"01164"	""	""	""	""	"Germany"	""	"0"	""	""	""	""
"00037220"	""	""	""	"1"	""	"01164"	""	""	""	""	"Germany"	""	"0"	""	""	""	""
"00037221"	""	""	""	"1"	""	"01164"	""	""	""	""	"Germany"	""	"0"	""	""	""	""
"00080808"	""	""	""	"1"	""	"01758"	"{PMID:Trujillano 2017:27848944}"	"unaffected parents"	""	""	""	""	"0"	""	""	""	""
"00087078"	""	""	""	"1"	""	"01805"	""	"leighs (SURF1)"	""	""	""	""	"0"	""	""	""	""
"00087101"	""	""	""	"1"	""	"01805"	""	""	"M"	"yes"	"India"	""	"0"	""	""	""	""
"00152532"	""	""	""	"1"	""	"01807"	""	""	"F"	""	"(Germany)"	""	"0"	""	""	""	""
"00205135"	""	""	""	"1"	""	"02978"	""	""	"F"	""	"United States"	""	"0"	""	""	"white"	""
"00205136"	""	""	""	"1"	""	"02978"	""	""	""	""	""	""	"0"	""	""	""	""
"00205137"	""	""	""	"1"	""	"02978"	""	""	"F"	""	"United States"	"3y6m"	"0"	""	""	"Pakistani"	""
"00205138"	""	""	""	"1"	""	"02978"	""	""	"M"	""	"United States"	""	"0"	""	""	"white"	""
"00205139"	""	""	""	"1"	""	"02978"	""	""	""	""	""	""	"0"	""	""	""	""
"00205140"	""	""	""	"1"	""	"02978"	""	""	""	""	"(Taiwan)"	""	"0"	""	""	""	""
"00205141"	""	""	""	"1"	""	"00634"	""	""	""	"?"	""	""	"0"	""	""	""	""
"00205142"	""	""	""	"1"	""	"00634"	""	""	""	"?"	""	""	"0"	""	""	""	""
"00205143"	""	""	""	"1"	""	"00634"	""	""	""	"?"	""	""	"0"	""	""	""	""
"00205144"	""	""	""	"1"	""	"00634"	""	""	""	"?"	""	""	"0"	""	""	""	""
"00205145"	""	""	""	"1"	""	"02978"	""	""	""	""	""	""	"0"	""	""	""	""
"00205146"	""	""	""	"1"	""	"02978"	""	""	"F"	""	"(United States)"	""	"0"	""	""	"Asian"	""
"00205147"	""	""	""	"1"	""	"00634"	""	""	""	"?"	""	""	"0"	""	""	""	""
"00205148"	""	""	""	"1"	""	"02978"	""	""	""	""	""	""	"0"	""	""	""	""
"00205149"	""	""	""	"1"	""	"02978"	""	"Lactic acidosis, increased pyruate, seiuzre"	"M"	""	"United States"	""	"0"	""	""	"white/Asian"	""
"00205150"	""	""	""	"1"	""	"02978"	""	""	""	""	""	""	"0"	""	""	""	""
"00205151"	""	""	""	"1"	""	"02978"	""	""	""	""	""	""	"0"	""	""	""	""
"00205152"	""	""	""	"1"	""	"00634"	""	""	""	"?"	""	""	"0"	""	""	""	""
"00205153"	""	""	""	"2"	""	"00634"	""	"1 Family, 2 patients"	""	"yes"	""	""	"0"	""	""	""	""
"00205154"	""	""	""	"1"	""	"02978"	""	""	""	""	""	""	"0"	""	""	""	""
"00205155"	""	""	""	"1"	""	"02978"	""	""	""	""	""	""	"0"	""	""	""	""
"00205156"	""	""	""	"1"	""	"02978"	""	""	"F"	""	"United States"	""	"0"	""	""	""	""
"00207784"	""	""	""	"1"	""	"01164"	""	""	"M"	""	"Germany"	""	"0"	""	""	""	""
"00228779"	""	""	""	"1"	""	"01864"	""	""	"F"	""	"China"	""	"0"	""	""	""	""
"00294788"	""	""	""	"1"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00374517"	""	""	""	"1"	""	"00006"	"{PMID:Ganapathy 2019:31069529}"	""	""	""	"India"	""	"0"	""	""	""	"S-3181"
"00374518"	""	""	""	"1"	""	"00006"	"{PMID:Ganapathy 2019:31069529}"	""	""	""	"India"	""	"0"	""	""	""	"S-3233"
"00387876"	""	""	""	"2"	""	"00006"	"{PMID:Hu 2019:29302074}"	"family, 2 affected individuals, first cousin parents"	""	"yes"	""	""	"0"	""	""	"Arab"	"M9000065"
"00398239"	""	""	""	"2"	""	"04217"	"{PMID:Echaniz-Laguna 2013:24027061}"	"2 generation family, 12 siblings, 2 affected (F, M)"	"M"	"yes"	"France"	">42y"	"0"	"?"	""	"Algeria"	"FamPatII10"
"00398311"	""	""	"00398239"	"1"	""	"04217"	"{PMID:Echaniz-Laguna 2013:24027061}"	"older sister"	"F"	"yes"	"France"	">57y"	"0"	""	""	"Algeria"	"FamPatII2"
"00398350"	""	""	""	"1"	""	"04217"	"{PMID:Echaniz-Laguna 2013:24027061}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	"F"	"no"	"France"	""	"0"	""	""	""	"Fam2Pat"
"00443912"	""	""	""	"1"	""	"04606"	""	"unaffected heterozygous carrier parents"	"F"	"no"	"Brazil"	""	"0"	""	"none"	"latin american"	""
"00469442"	""	""	""	"1"	""	"00006"	"{PMID:Retterer 2016:26633542}"	"analysis proband (1/3040)"	""	""	"United States"	""	"0"	""	""	""	""


## Individuals_To_Diseases ## Do not remove or alter this header ##
## Count = 35
"{{individualid}}"	"{{diseaseid}}"
"00080808"	"00038"
"00087078"	"00038"
"00152532"	"00198"
"00205135"	"00038"
"00205136"	"00038"
"00205137"	"00038"
"00205138"	"00038"
"00205139"	"00038"
"00205140"	"00038"
"00205141"	"00038"
"00205142"	"00038"
"00205143"	"00038"
"00205144"	"00038"
"00205145"	"00038"
"00205146"	"00038"
"00205147"	"00038"
"00205148"	"00038"
"00205149"	"00038"
"00205150"	"00038"
"00205151"	"00038"
"00205152"	"00038"
"00205153"	"00038"
"00205154"	"00038"
"00205155"	"00038"
"00205156"	"00038"
"00228779"	"00038"
"00294788"	"00198"
"00374517"	"00198"
"00374518"	"00198"
"00387876"	"00139"
"00398239"	"05113"
"00398311"	"05113"
"00398350"	"05113"
"00443912"	"05147"
"00469442"	"00198"


## Phenotypes ## Do not remove or alter this header ##
## Note: Only showing Phenotype columns active for Diseases 00038, 00139, 00198, 01740, 05113, 05147, 05955, 06807
## Count = 32
"{{id}}"	"{{diseaseid}}"	"{{individualid}}"	"{{owned_by}}"	"{{Phenotype/Inheritance}}"	"{{Phenotype/Age}}"	"{{Phenotype/Additional}}"	"{{Phenotype/Age/Onset}}"	"{{Phenotype/Age/Diagnosis}}"	"{{Phenotype/Onset}}"	"{{Phenotype/Protein}}"	"{{Phenotype/Tumor/MSI}}"	"{{Phenotype/Enzyme/CPK}}"	"{{Phenotype/Heart/Myocardium}}"	"{{Phenotype/Lung}}"	"{{Phenotype/Diagnosis/Definite}}"	"{{Phenotype/Diagnosis/Initial}}"	"{{Phenotype/Diagnosis/Criteria}}"
"0000060377"	"00038"	"00080808"	"01758"	"Familial, autosomal recessive"	""	"Leigh syndrome, COX IV deficiency (OMIM:256000)"	""	""	""	""	""	""	""	""	""	""	""
"0000066703"	"00038"	"00087078"	"01805"	"Familial, autosomal recessive"	""	"Leigh\'s disease"	""	""	""	""	""	""	""	""	""	""	""
"0000125493"	"00198"	"00152532"	"01807"	"Unknown"	""	"Mitochondrial encephalopathy (HP:0006789); Lactic acidosis (HP:0003128)"	""	""	""	""	""	""	""	""	""	""	""
"0000153329"	"00038"	"00205135"	"02978"	"-"	""	"Hypotonia, ataxia, ophthalmoplegia,nystagmus"	""	"4y"	""	""	""	""	""	""	""	""	""
"0000153330"	"00038"	"00205137"	"02978"	"-"	""	"Hypotonia, ataxia, myoclonic jerks, extrapyramidal movements"	""	"3y"	""	""	""	""	""	""	""	""	""
"0000153331"	"00038"	"00205138"	"02978"	"-"	""	"Hypotonia, ataxia, dystonia, Cerebellum, brainstem, and basal ganglia in MRI"	"2y"	""	""	""	""	""	""	""	""	""	""
"0000153332"	"00038"	"00205139"	"02978"	"-"	""	"atypical"	""	"1y9m"	""	""	""	""	""	""	""	""	""
"0000153333"	"00038"	"00205140"	"02978"	"-"	""	"hypotonia, ataxia, apnea"	""	""	""	""	""	""	""	""	""	""	""
"0000153334"	"00038"	"00205141"	"00634"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000153335"	"00038"	"00205142"	"00634"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000153336"	"00038"	"00205143"	"00634"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000153337"	"00038"	"00205144"	"00634"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000153338"	"00038"	"00205146"	"02978"	"-"	""	"atypical / Hypotonia, microcephaly, Leucodystrophy in MRI"	""	"2y"	""	""	""	""	""	""	""	""	""
"0000153339"	"00038"	"00205147"	"00634"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000153340"	"00038"	"00205148"	"02978"	"-"	""	"Hypotonia, ataxia, nystagmus"	""	""	""	""	""	""	""	""	""	""	""
"0000153341"	"00038"	"00205149"	"02978"	"-"	""	"abnormal MRI in basal ganglia"	""	""	""	""	""	""	""	""	""	""	""
"0000153342"	"00038"	"00205151"	"02978"	"-"	""	"Down syndrome, cardiovascular malformations, vertebral anomalies, hypotonia, muscle weakness, swallowing difficulties"	""	""	""	""	""	""	""	""	""	""	""
"0000153343"	"00038"	"00205152"	"00634"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000153344"	"00038"	"00205153"	"00634"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000153345"	"00038"	"00205156"	"02978"	"-"	""	""	""	"6y"	""	""	""	""	""	""	""	""	""
"0000153346"	"00038"	"00205145"	"02978"	"-"	""	"atypical"	""	""	""	""	""	""	""	""	""	""	""
"0000153347"	"00038"	"00205154"	"02978"	"-"	""	"atypical"	""	""	""	""	""	""	""	""	""	""	""
"0000155568"	"00198"	"00207784"	"01164"	"Unknown"	""	"HP:0100022 (Abnormality of movement)"	""	""	""	""	""	""	""	""	""	""	""
"0000172718"	"00038"	"00228779"	"01864"	"-"	""	"failure to thrive,psychomotor regression,seizures and vomiting,increased lactate"	""	""	""	""	""	""	""	""	"18m"	"Leigh syndrome"	""
"0000269727"	"00198"	"00374517"	"00006"	"Familial, autosomal recessive"	""	"Floppiness and inability to walk"	""	""	""	""	""	""	""	""	""	"Leigh syndrome"	""
"0000269728"	"00198"	"00374518"	"00006"	"Familial, autosomal recessive"	""	"Hypotonia in upper and lower limbs, developmental delay, mild facial dysmorphism and decreased reflexes. MRI showed bilateral cerebellar subcortical white matter with bilateral caudate lentiform"	""	""	""	""	""	""	""	""	""	"Leigh syndrome"	""
"0000281444"	"00139"	"00387876"	"00006"	"Familial, autosomal recessive"	""	"syndromic intellectual disability, no microcephaly"	""	""	""	""	""	""	""	""	""	"intellectual disability"	""
"0000291595"	"05113"	"00398239"	"04217"	"Familial, autosomal recessive"	"08y"	"see paper; ..., born at term, normal pregnancy, normal psychomotor development (-HP:0001263); 12m-walk; easy fatigability (HP:0003388); kyphoscoliosis (HP:0002571); hand muscle atrophy (HP:0009130); araflexia (HP:0001284); impaired pain sensation (HP:0007328); impaired vibration sensation lower limbs (HP:0002166); horizontal nystagmus (HP:0000666); hearing impairment (HP:0000365)"	"?"	"42y"	""	""	""	""	""	""	"CMT4K"	"Charcot-Marie-Tooth disease"	""
"0000291596"	"05113"	"00398311"	"04217"	"Familial, autosomal recessive"	"57y"	"see paper; ..., easy fatigability (HP:0003388); kyphoscoliosis (HP:0002571); muscle atrophy (HP:0009130); araflexia HP:0001284); impaired pain sensation (HP:0007328); impaired vibration sensation lower limbs (HP:0002166); ataxia (HP:0001251); horizontal nystagmus (HP:0000666); hearing impairment (HP:0000365)"	"10y?"	"57y"	"hand muscle atrophy(HP:0009130), araflexia HP:0001284), impaired pain sensation (HP:0007328)"	""	""	""	""	""	"CMT4K"	"Charcot-Marie-Tooth disease"	""
"0000291597"	"05113"	"00398350"	"04217"	"Familial, autosomal recessive"	"03y"	"see paper; ..., hand muscle atrophy (HP:0009130); araflexia (HP:0001284); impaired pain sensation (HP:0007328); impaired vibration sensation lower limbs (HP:0002166); abnormal brainstem morphology (HP:0002363); ataxia (HP:0001251)"	"03y"	">10y"	""	""	""	""	""	""	"CMT4K"	"Charcot-Marie-Tooth disease"	""
"0000333191"	"05147"	"00443912"	"04606"	"Familial, autosomal recessive"	"05y"	"ptosis (HP:0000508), Respiratory insufficiency due to muscle weakness (HP:0002747); Global developmental delay(HP:0001263); Hypotonia (HP:0001252) ;Weakness of facial musculature(HP:0030319); Ophthalmoparesis (HP:0000597); High palate (HP:0000218"	"01y06m"	""	"Fatigable weakness of bulbar muscles(HP:0030192)"	"SURF1"	""	""	""	""	"Pure mitochondrial myopathy"	"congenital myasthenia"	""
"0000354595"	"00198"	"00469442"	"00006"	"Unknown"	""	"hypotonia, failure to thrive, developmental delay, male undervirilization"	""	""	""	""	""	""	""	""	""	"abnormality of the nervous system"	""


## Screenings ## Do not remove or alter this header ##
## Count = 41
"{{id}}"	"{{individualid}}"	"{{variants_found}}"	"{{owned_by}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"	"{{Screening/Technique}}"	"{{Screening/Template}}"	"{{Screening/Tissue}}"	"{{Screening/Remarks}}"
"0000037288"	"00037218"	"1"	"01164"	"00008"	"2015-04-02 13:01:39"	""	""	"SEQ"	"DNA"	""	""
"0000037289"	"00037219"	"1"	"01164"	"00008"	"2015-04-02 13:01:39"	""	""	"SEQ"	"DNA"	""	""
"0000037290"	"00037220"	"1"	"01164"	"00008"	"2015-04-02 13:01:39"	""	""	"SEQ"	"DNA"	""	""
"0000037291"	"00037221"	"1"	"01164"	"00008"	"2015-04-02 13:01:39"	""	""	"SEQ"	"DNA"	""	""
"0000080920"	"00080808"	"1"	"01758"	"00006"	"2016-09-07 13:24:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000087238"	"00087101"	"1"	"01805"	"01805"	"2016-11-12 07:51:53"	""	""	"SEQ"	"DNA"	""	""
"0000087240"	"00087078"	"1"	"01805"	"01805"	"2016-11-12 09:41:19"	""	""	"SEQ"	"DNA"	""	""
"0000153389"	"00152532"	"0"	"01807"	"01807"	"2018-02-02 19:31:42"	""	""	"SEQ"	"DNA"	""	""
"0000206164"	"00205135"	"1"	"02978"	"02978"	"2012-02-29 05:20:34"	""	""	"RT-PCR;SEQ"	"DNA;RNA"	""	""
"0000206165"	"00205136"	"1"	"02978"	"02978"	"2012-02-20 16:20:22"	""	""	"RT-PCR"	"RNA"	""	""
"0000206166"	"00205137"	"1"	"02978"	"02978"	"2012-03-02 02:25:52"	""	""	"SEQ"	"DNA"	""	""
"0000206167"	"00205138"	"1"	"02978"	"02978"	"2012-03-02 02:33:25"	""	""	"RT-PCR;SEQ"	"DNA;RNA"	""	""
"0000206168"	"00205139"	"1"	"02978"	"02978"	"2012-02-18 04:52:23"	"00006"	"2012-02-19 13:28:38"	"SEQ"	"DNA"	""	""
"0000206169"	"00205140"	"1"	"02978"	"02978"	"2012-02-18 09:42:14"	"00006"	"2012-02-19 16:03:48"	"SEQ"	"DNA"	""	""
"0000206170"	"00205141"	"1"	"00634"	"00634"	"2014-01-21 15:45:18"	""	""	"RT-PCR;SEQ"	"DNA;RNA"	""	""
"0000206171"	"00205142"	"1"	"00634"	"00634"	"2014-01-21 15:53:56"	""	""	"RT-PCR;SEQ"	"DNA;RNA"	""	""
"0000206172"	"00205143"	"1"	"00634"	"00634"	"2014-01-21 16:04:39"	""	""	"RT-PCR;SEQ"	"DNA;RNA"	""	""
"0000206173"	"00205144"	"1"	"00634"	"00634"	"2014-01-21 16:34:14"	""	""	"RT-PCR;SEQ"	"DNA;RNA"	""	""
"0000206174"	"00205145"	"1"	"02978"	"02978"	"2012-02-20 16:07:57"	"00006"	"2012-03-02 21:13:19"	"RT-PCR;SEQ"	"RNA"	""	""
"0000206175"	"00205146"	"1"	"02978"	"02978"	"2012-02-29 05:15:51"	"00006"	"2012-03-02 21:16:23"	"SEQ"	"DNA"	""	""
"0000206176"	"00205147"	"1"	"00634"	"00634"	"2014-01-21 15:57:07"	""	""	"RT-PCR;SEQ"	"DNA;RNA"	""	""
"0000206177"	"00205148"	"1"	"02978"	"02978"	"2012-02-18 09:46:24"	""	""	"SEQ"	"DNA"	""	""
"0000206178"	"00205149"	"1"	"02978"	"02978"	"2012-02-29 05:06:28"	""	""	"RT-PCR;SEQ"	"DNA;RNA"	""	""
"0000206179"	"00205150"	"1"	"02978"	"02978"	"2012-02-18 04:57:38"	""	""	"SEQ"	"DNA"	""	""
"0000206180"	"00205151"	"1"	"02978"	"02978"	"2012-02-18 09:37:02"	"00006"	"2012-02-19 13:26:28"	"SEQ"	"DNA"	""	""
"0000206181"	"00205152"	"1"	"00634"	"00634"	"2014-01-21 15:52:05"	""	""	"RT-PCR;SEQ"	"DNA;RNA"	""	""
"0000206182"	"00205153"	"1"	"00634"	"00634"	"2014-01-21 16:03:20"	"00006"	"2014-01-25 14:45:55"	"RT-PCR;SEQ"	"DNA;RNA"	""	""
"0000206183"	"00205154"	"1"	"02978"	"02978"	"2012-02-18 04:43:31"	"00006"	"2012-02-19 13:31:13"	"SEQ"	"DNA"	""	""
"0000206184"	"00205155"	"1"	"02978"	"02978"	"2012-02-20 16:16:48"	""	""	"RT-PCR"	"RNA"	""	""
"0000206185"	"00205156"	"1"	"02978"	"02978"	"2012-02-29 05:25:43"	""	""	"SEQ"	"DNA"	""	""
"0000208825"	"00207784"	"1"	"01164"	"01164"	"2018-11-30 14:38:30"	""	""	"SEQ-NG"	"DNA"	""	""
"0000229868"	"00228779"	"1"	"01864"	"01864"	"2019-03-26 02:48:49"	""	""	"SEQ-NG"	"DNA"	""	""
"0000295956"	"00294788"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000375711"	"00374517"	"1"	"00006"	"00006"	"2021-05-24 20:06:48"	""	""	"SEQ-NG"	"DNA"	""	"TruSight One panel"
"0000375712"	"00374518"	"1"	"00006"	"00006"	"2021-05-24 20:06:48"	""	""	"SEQ-NG"	"DNA"	""	"TruSight One panel"
"0000389107"	"00387876"	"1"	"00006"	"00006"	"2021-10-31 12:02:46"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000399483"	"00398239"	"1"	"04217"	"04217"	"2022-01-02 23:04:13"	"04217"	"2022-01-03 21:55:23"	"microscope;PAGE;RT-PCR;Western"	"DNA;RNA;protein"	""	""
"0000399556"	"00398311"	"1"	"04217"	"04217"	"2022-01-03 21:50:41"	""	""	"microscope;PAGE;RT-PCR;Western"	"DNA;RNA;protein"	""	""
"0000399596"	"00398350"	"1"	"04217"	"04217"	"2022-01-05 00:54:49"	""	""	"?"	"?"	""	""
"0000445432"	"00443912"	"1"	"04606"	"04606"	"2023-12-07 20:18:38"	""	""	"SEQ-NG"	"DNA"	"oral epithelium"	"mendelics neuromuscular disorders gene panel"
"0000471110"	"00469442"	"1"	"00006"	"00006"	"2025-11-13 13:02:43"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"


## Screenings_To_Genes ## Do not remove or alter this header ##
## Count = 43
"{{screeningid}}"	"{{geneid}}"
"0000037288"	"SURF1"
"0000037289"	"SURF1"
"0000037290"	"SURF1"
"0000037291"	"SURF1"
"0000080920"	"SURF1"
"0000087238"	"SURF1"
"0000087240"	"SURF1"
"0000206164"	"SURF1"
"0000206165"	"SURF1"
"0000206166"	"SURF1"
"0000206167"	"SURF1"
"0000206168"	"SURF1"
"0000206169"	"SURF1"
"0000206170"	"SURF1"
"0000206171"	"SURF1"
"0000206172"	"SURF1"
"0000206173"	"SURF1"
"0000206174"	"SURF1"
"0000206175"	"SURF1"
"0000206176"	"SURF1"
"0000206177"	"SURF1"
"0000206178"	"SURF1"
"0000206179"	"SURF1"
"0000206180"	"SURF1"
"0000206181"	"SURF1"
"0000206182"	"SURF1"
"0000206183"	"SURF1"
"0000206184"	"SURF1"
"0000206185"	"SURF1"
"0000229868"	"SURF1"
"0000375711"	"SURF1"
"0000375712"	"SURF1"
"0000389107"	"SURF1"
"0000399483"	"SURF1"
"0000399556"	"SURF1"
"0000399596"	"GDAP1"
"0000399596"	"GJB1"
"0000399596"	"MPZ"
"0000399596"	"MTMR2"
"0000399596"	"PMP22"
"0000399596"	"PRX"
"0000399596"	"SH3TC2"
"0000399596"	"SURF1"


## Variants_On_Genome ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Count = 113
"{{id}}"	"{{allele}}"	"{{effectid}}"	"{{chromosome}}"	"{{position_g_start}}"	"{{position_g_end}}"	"{{type}}"	"{{average_frequency}}"	"{{owned_by}}"	"{{VariantOnGenome/DBID}}"	"{{VariantOnGenome/DNA}}"	"{{VariantOnGenome/Frequency}}"	"{{VariantOnGenome/Reference}}"	"{{VariantOnGenome/Restriction_site}}"	"{{VariantOnGenome/Published_as}}"	"{{VariantOnGenome/Remarks}}"	"{{VariantOnGenome/Genetic_origin}}"	"{{VariantOnGenome/Segregation}}"	"{{VariantOnGenome/dbSNP}}"	"{{VariantOnGenome/VIP}}"	"{{VariantOnGenome/Methylation}}"	"{{VariantOnGenome/ISCN}}"	"{{VariantOnGenome/DNA/hg38}}"	"{{VariantOnGenome/ClinVar}}"	"{{VariantOnGenome/ClinicalClassification}}"	"{{VariantOnGenome/ClinicalClassification/Method}}"
"0000064413"	"1"	"50"	"9"	"136218590"	"136218590"	"subst"	"0"	"01164"	"SURF1_000021"	"g.136218590C>G"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.133351735C>G"	""	"VUS"	""
"0000064414"	"1"	"50"	"9"	"136218591"	"136218591"	"subst"	"0"	"01164"	"SURF1_000020"	"g.136218591A>G"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.133351736A>G"	""	"VUS"	""
"0000064415"	"1"	"50"	"9"	"136219062"	"136219062"	"subst"	"0"	"01164"	"SURF1_000034"	"g.136219062T>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.133352207T>A"	""	"VUS"	""
"0000064416"	"1"	"90"	"9"	"136221740"	"136221740"	"del"	"0"	"01164"	"SURF1_000019"	"g.136221740del"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.133354885del"	""	"pathogenic"	""
"0000130006"	"3"	"70"	"9"	"136223302"	"136223318"	"del"	"0"	"01758"	"SURF1_000018"	"g.136223302_136223318del"	""	"{PMID:Trujillano 2017:27848944}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.133356426_133356442del"	""	"likely pathogenic"	""
"0000140363"	"3"	"70"	"9"	"136218822"	"136218825"	"dup"	"0"	"01805"	"SURF1_000022"	"g.136218822_136218825dup"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.133351967_133351970dup"	""	"likely pathogenic"	""
"0000140364"	"3"	"70"	"9"	"136218915"	"136218915"	"subst"	"0"	"01805"	"SURF1_000011"	"g.136218915C>T"	""	""	""	"g.4716G>A"	""	"Germline"	""	""	"0"	""	""	"g.133352060C>T"	""	"likely pathogenic"	""
"0000246812"	"0"	"10"	"9"	"136221557"	"136221557"	"subst"	"0.0371142"	"02330"	"SURF1_000029"	"g.136221557A>G"	""	""	""	"SURF1(NM_003172.4):c.280T>C (p.L94=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.133354702A>G"	""	"benign"	""
"0000246847"	"0"	"10"	"9"	"136219295"	"136219295"	"subst"	"0.00526256"	"02330"	"SURF1_000027"	"g.136219295A>G"	""	""	""	"SURF1(NM_003172.4):c.751+6T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.133352440A>G"	""	"benign"	""
"0000246848"	"0"	"30"	"9"	"136221658"	"136221658"	"subst"	"0.0023638"	"02330"	"SURF1_000030"	"g.136221658A>G"	""	""	""	"SURF1(NM_003172.4):c.240+21T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.133354803A>G"	""	"likely benign"	""
"0000308872"	"0"	"10"	"9"	"136221752"	"136221752"	"subst"	"0.00503578"	"02330"	"SURF1_000032"	"g.136221752G>C"	""	""	""	"SURF1(NM_003172.4):c.167C>G (p.A56G)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.133354897G>C"	""	"benign"	""
"0000308873"	"0"	"10"	"9"	"136219564"	"136219564"	"subst"	"0.0388175"	"02330"	"SURF1_000028"	"g.136219564G>C"	""	""	""	"SURF1(NM_003172.4):c.573C>G (p.T191=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.133352709G>C"	""	"benign"	""
"0000308874"	"0"	"10"	"9"	"136218903"	"136218903"	"subst"	"4.55061E-5"	"02330"	"SURF1_000023"	"g.136218903G>A"	""	""	""	"SURF1(NM_003172.4):c.833+13C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.133352048G>A"	""	"benign"	""
"0000311620"	"0"	"90"	"9"	"136221709"	"136221710"	"del"	"0"	"02325"	"SURF1_000031"	"g.136221709_136221710del"	""	""	""	"SURF1(NM_003172.4):c.209_210delCT (p.P70Rfs*31)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.133354854_133354855del"	""	"pathogenic"	""
"0000311621"	"0"	"10"	"9"	"136223246"	"136223266"	"del"	"0"	"02325"	"SURF1_000033"	"g.136223246_136223266del"	""	""	""	"SURF1(NM_003172.4):c.54+34_55-47delTGCGGGGTGCGGGGTGCGGGG"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.133356370_133356390del"	""	"benign"	""
"0000315931"	"0"	"50"	"9"	"136218926"	"136218926"	"subst"	"8.28089E-6"	"01943"	"SURF1_000024"	"g.136218926T>A"	""	""	""	"SURF1(NM_003172.3):c.823A>T (p.I275F)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.133352071T>A"	""	"VUS"	""
"0000332879"	"0"	"50"	"9"	"136220621"	"136220621"	"subst"	"4.07438E-6"	"01804"	"RPL7A_000008"	"g.136220621G>C"	""	""	""	"SURF1(NM_003172.2):c.498C>G (p.(Phe166Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.133353766G>C"	""	"VUS"	""
"0000332880"	"0"	"50"	"9"	"136220769"	"136220769"	"subst"	"0.000174734"	"01804"	"RPL7A_000010"	"g.136220769T>G"	""	""	""	"SURF1(NM_003172.2):c.350A>C (p.(Tyr117Ser)), SURF1(NM_003172.4):c.350A>C (p.Y117S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.133353914T>G"	""	"VUS"	""
"0000332881"	"0"	"90"	"9"	"136221516"	"136221524"	"del"	"8.12783E-6"	"01804"	"RPL7A_000011"	"g.136221516_136221524del"	""	""	""	"SURF1(NM_003172.2):c.313_321del (p.(Leu105_Ala107del)), SURF1(NM_003172.3):c.313_321delCTGCCAGCC (p.L105_A107del), SURF1(NM_003172.4):c.313_321delC..."	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.133354661_133354669del"	""	"pathogenic"	""
"0000332882"	"0"	"90"	"9"	"136221525"	"136221526"	"ins"	"0"	"01804"	"RPL7A_000012"	"g.136221525_136221526insT"	""	""	""	"SURF1(NM_003172.2):c.311_312insA (p.(Leu105SerfsTer14)), SURF1(NM_003172.3):c.311_312insA (p.L105Sfs*14), SURF1(NM_003172.4):c.311_312insA (p.L105...)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.133354670_133354671insT"	""	"pathogenic"	""
"0000332883"	"0"	"90"	"9"	"136221568"	"136221568"	"subst"	"0"	"01804"	"RPL7A_000014"	"g.136221568A>G"	""	""	""	"SURF1(NM_003172.2):c.269T>C (p.(Leu90Pro)), SURF1(NM_003172.3):c.269T>C (p.L90P), SURF1(NM_003172.4):c.269T>C (p.L90P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.133354713A>G"	""	"pathogenic"	""
"0000352488"	"0"	"90"	"9"	"136218829"	"136218830"	"del"	"0"	"01807"	"SURF1_000025"	"g.136218829_136218830del"	""	""	""	"845_846delCT"	""	"Unknown"	""	""	"0"	""	""	"g.133351974_133351975del"	""	"pathogenic"	""
"0000352489"	"0"	"90"	"9"	"136221516"	"136221525"	"del"	"0"	"01807"	"SURF1_000026"	"g.136221516_136221525delinsAT"	""	""	""	"312_321delGGCTGGCAGAinsAT"	""	"Unknown"	""	""	"0"	""	""	"g.133354661_133354670delinsAT"	""	"pathogenic"	""
"0000435574"	"2"	"95"	"9"	"136223176"	"136223176"	"subst"	"0"	"02978"	"SURF1_000010"	"g.136223176C>T"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.133356321C>T"	""	"pathogenic"	""
"0000435575"	"1"	"95"	"9"	"136223176"	"136223176"	"subst"	"0"	"02978"	"SURF1_000010"	"g.136223176C>T"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.133356321C>T"	""	"pathogenic"	""
"0000435576"	"3"	"95"	"9"	"136223123"	"136223123"	"subst"	"0"	"02978"	"SURF1_000012"	"g.136223123C>G"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.133356268C>G"	""	"pathogenic"	""
"0000435577"	"3"	"95"	"9"	"136223123"	"136223123"	"subst"	"0"	"02978"	"SURF1_000012"	"g.136223123C>G"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.133356268C>G"	""	"pathogenic"	""
"0000435578"	"3"	"95"	"9"	"136221814"	"136221814"	"subst"	"8.14591E-6"	"02978"	"SURF1_000013"	"g.136221814T>C"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.133354959T>C"	""	"pathogenic"	""
"0000435579"	"0"	"95"	"9"	"136221751"	"136221751"	"del"	"0"	"02978"	"SURF1_000002"	"g.136221751del"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.133354896del"	""	"pathogenic"	""
"0000435580"	"0"	"95"	"9"	"136221736"	"136221739"	"del"	"0"	"02978"	"SURF1_000006"	"g.136221736_136221739del"	""	""	""	"183_186delTCTT"	""	"Unknown"	""	""	"0"	""	""	"g.133354881_133354884del"	""	"pathogenic"	""
"0000435581"	"3"	"95"	"9"	"136221516"	"136221525"	"delins"	"0"	"00634"	"SURF1_000014"	"g.136221516_136221525delinsAT"	""	"Nesbitt et al., submitted"	""	""	"Protein change predicted from RNA"	"Germline"	"yes"	""	"0"	""	""	"g.133354661_133354670delinsAT"	""	"pathogenic"	""
"0000435582"	"3"	"95"	"9"	"136221516"	"136221525"	"delins"	"0"	"00634"	"SURF1_000014"	"g.136221516_136221525delinsAT"	""	"Nesbitt et al., submitted"	""	""	"Protein change predicted from RNA"	"Germline"	"yes"	""	"0"	""	""	"g.133354661_133354670delinsAT"	""	"pathogenic"	""
"0000435583"	"3"	"95"	"9"	"136221516"	"136221525"	"delins"	"0"	"00634"	"SURF1_000014"	"g.136221516_136221525delinsAT"	""	"Nesbitt et al., submitted"	""	""	"protein change predicted from RNA"	"Germline"	"yes"	""	"0"	""	""	"g.133354661_133354670delinsAT"	""	"pathogenic"	""
"0000435584"	"3"	"95"	"9"	"136221516"	"136221525"	"delins"	"0"	"00634"	"SURF1_000014"	"g.136221516_136221525delinsAT"	""	"Nesbitt et al., submitted"	""	""	"protein change predicted from RNA"	"Germline"	"yes"	""	"0"	""	""	"g.133354661_133354670delinsAT"	""	"pathogenic"	""
"0000435585"	"3"	"95"	"9"	"136220806"	"136220806"	"subst"	"1.62607E-5"	"02978"	"SURF1_000009"	"g.136220806A>C"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.133353951A>C"	""	"pathogenic"	""
"0000435586"	"3"	"95"	"9"	"136220806"	"136220806"	"subst"	"1.62607E-5"	"02978"	"SURF1_000009"	"g.136220806A>C"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.133353951A>C"	""	"pathogenic"	""
"0000435587"	"3"	"95"	"9"	"136220806"	"136220806"	"subst"	"1.62607E-5"	"00634"	"SURF1_000009"	"g.136220806A>C"	""	"Nesbitt et al., submitted"	""	""	"protein change predicted from RNA"	"Germline"	"yes"	""	"0"	""	""	"g.133353951A>C"	""	"pathogenic"	""
"0000435588"	"1"	"95"	"9"	"136220648"	"136220649"	"del"	"0"	"02978"	"SURF1_000007"	"g.136220648_136220649del"	""	""	""	"472_473delAG"	""	"Unknown"	""	""	"0"	""	""	"g.133353793_133353794del"	""	"pathogenic"	""
"0000435589"	"2"	"95"	"9"	"136219623"	"136219623"	"subst"	"2.08683E-5"	"02978"	"SURF1_000008"	"g.136219623T>C"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.133352768T>C"	""	"pathogenic"	""
"0000435590"	"1"	"95"	"9"	"136219623"	"136219623"	"subst"	"2.08683E-5"	"02978"	"SURF1_000008"	"g.136219623T>C"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.133352768T>C"	""	"pathogenic"	""
"0000435591"	"1"	"95"	"9"	"136219582"	"136219583"	"del"	"0"	"02978"	"SURF1_000003"	"g.136219582_136219583del"	""	""	""	"555_556delGA"	""	"Unknown"	""	""	"0"	""	""	"g.133352727_133352728del"	""	"pathogenic"	""
"0000435592"	"1"	"95"	"9"	"136219438"	"136219438"	"subst"	"0"	"02978"	"SURF1_000005"	"g.136219438C>T"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.133352583C>T"	""	"pathogenic"	""
"0000435593"	"2"	"95"	"9"	"136218980"	"136218980"	"subst"	"0"	"02978"	"SURF1_000004"	"g.136218980C>T"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.133352125C>T"	""	"pathogenic"	""
"0000435594"	"3"	"95"	"9"	"136218958"	"136218959"	"del"	"0"	"00634"	"SURF1_000017"	"g.136218958_136218959del"	""	"Nesbitt et al., submitted"	""	"792_793delAG"	"protein change predicted from RNA"	"Germline"	""	""	"0"	""	""	"g.133352103_133352104del"	""	"pathogenic"	""
"0000435595"	"3"	"95"	"9"	"136218951"	"136218952"	"del"	"0"	"00634"	"SURF1_000016"	"g.136218951_136218952del"	""	"Nesbitt et al., submitted"	""	"799_800delCT"	"protein change predicted from RNA"	"Germline"	"yes"	""	"0"	""	""	"g.133352096_133352097del"	""	"pathogenic"	""
"0000435596"	"0"	"95"	"9"	"0"	"0"	"delins"	"0"	"02978"	"SURF1_000001"	"g.?"	""	""	""	"c.807_810del4ins9"	"description variant incomplete (ins9)"	"Unknown"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000435597"	"3"	"95"	"9"	"136218915"	"136218915"	"subst"	"0"	"02978"	"SURF1_000011"	"g.136218915C>T"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.133352060C>T"	""	"pathogenic"	""
"0000435598"	"3"	"95"	"9"	"136218915"	"136218915"	"subst"	"0"	"02978"	"SURF1_000011"	"g.136218915C>T"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.133352060C>T"	""	"pathogenic"	""
"0000438806"	"3"	"70"	"9"	"136218922"	"136218923"	"del"	"0"	"01164"	"SURF1_000035"	"g.136218922_136218923del"	""	""	""	""	"Clinical Leigh-Syndrome, parents consanguineous (from Syria)"	"Germline"	""	""	"0"	""	""	"g.133352067_133352068del"	""	"likely pathogenic"	"ACMG"
"0000471104"	"11"	"90"	"9"	"136221597"	"136221597"	"subst"	"0"	"01864"	"SURF1_000036"	"g.136221597C>G"	""	""	""	""	""	"Uniparental disomy, paternal allele"	""	""	"0"	""	""	"g.133354742C>G"	""	"pathogenic"	""
"0000536941"	"0"	"10"	"9"	"136218788"	"136218788"	"subst"	"0.00112768"	"01943"	"RPL7A_000003"	"g.136218788G>A"	""	""	""	"SURF1(NM_003172.3):c.883C>T (p.R295C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.133351933G>A"	""	"benign"	""
"0000536944"	"0"	"50"	"9"	"136219307"	"136219307"	"subst"	"0.000316726"	"02330"	"RPL7A_000005"	"g.136219307T>C"	""	""	""	"SURF1(NM_003172.3):c.745A>G (p.N249D), SURF1(NM_003172.4):c.745A>G (p.N249D)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.133352452T>C"	""	"VUS"	""
"0000536946"	"0"	"10"	"9"	"136219564"	"136219564"	"subst"	"0.0388175"	"02327"	"SURF1_000028"	"g.136219564G>C"	""	""	""	"SURF1(NM_003172.4):c.573C>G (p.T191=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.133352709G>C"	""	"benign"	""
"0000536947"	"0"	"10"	"9"	"136219594"	"136219594"	"subst"	"0.0202171"	"02330"	"RPL7A_000007"	"g.136219594G>A"	""	""	""	"SURF1(NM_003172.4):c.543C>T (p.F181=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.133352739G>A"	""	"benign"	""
"0000536948"	"0"	"50"	"9"	"136220748"	"136220748"	"subst"	"0"	"02327"	"RPL7A_000009"	"g.136220748C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.133353893C>T"	""	"VUS"	""
"0000536949"	"0"	"90"	"9"	"136221516"	"136221524"	"del"	"8.12783E-6"	"01943"	"RPL7A_000011"	"g.136221516_136221524del"	""	""	""	"SURF1(NM_003172.2):c.313_321del (p.(Leu105_Ala107del)), SURF1(NM_003172.3):c.313_321delCTGCCAGCC (p.L105_A107del), SURF1(NM_003172.4):c.313_321delC..."	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.133354661_133354669del"	""	"pathogenic"	""
"0000536951"	"0"	"90"	"9"	"136221525"	"136221526"	"ins"	"0"	"02330"	"RPL7A_000012"	"g.136221525_136221526insT"	""	""	""	"SURF1(NM_003172.2):c.311_312insA (p.(Leu105SerfsTer14)), SURF1(NM_003172.3):c.311_312insA (p.L105Sfs*14), SURF1(NM_003172.4):c.311_312insA (p.L105...)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.133354670_133354671insT"	""	"pathogenic"	""
"0000536952"	"0"	"90"	"9"	"136221525"	"136221526"	"ins"	"0"	"01943"	"RPL7A_000012"	"g.136221525_136221526insT"	""	""	""	"SURF1(NM_003172.2):c.311_312insA (p.(Leu105SerfsTer14)), SURF1(NM_003172.3):c.311_312insA (p.L105Sfs*14), SURF1(NM_003172.4):c.311_312insA (p.L105...)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.133354670_133354671insT"	""	"pathogenic"	""
"0000536953"	"0"	"90"	"9"	"136221525"	"136221526"	"ins"	"0"	"02325"	"RPL7A_000012"	"g.136221525_136221526insT"	""	""	""	"SURF1(NM_003172.2):c.311_312insA (p.(Leu105SerfsTer14)), SURF1(NM_003172.3):c.311_312insA (p.L105Sfs*14), SURF1(NM_003172.4):c.311_312insA (p.L105...)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.133354670_133354671insT"	""	"pathogenic"	""
"0000536955"	"0"	"10"	"9"	"136221557"	"136221557"	"subst"	"0.0371142"	"02327"	"SURF1_000029"	"g.136221557A>G"	""	""	""	"SURF1(NM_003172.4):c.280T>C (p.L94=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.133354702A>G"	""	"benign"	""
"0000536956"	"0"	"70"	"9"	"136221568"	"136221568"	"subst"	"0"	"02327"	"RPL7A_000014"	"g.136221568A>G"	""	""	""	"SURF1(NM_003172.2):c.269T>C (p.(Leu90Pro)), SURF1(NM_003172.3):c.269T>C (p.L90P), SURF1(NM_003172.4):c.269T>C (p.L90P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.133354713A>G"	""	"likely pathogenic"	""
"0000536957"	"0"	"70"	"9"	"136221568"	"136221568"	"subst"	"0"	"02325"	"RPL7A_000014"	"g.136221568A>G"	""	""	""	"SURF1(NM_003172.2):c.269T>C (p.(Leu90Pro)), SURF1(NM_003172.3):c.269T>C (p.L90P), SURF1(NM_003172.4):c.269T>C (p.L90P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.133354713A>G"	""	"likely pathogenic"	""
"0000536959"	"0"	"50"	"9"	"136221779"	"136221779"	"subst"	"0"	"02330"	"RPL7A_000015"	"g.136221779G>C"	""	""	""	"SURF1(NM_003172.4):c.140C>G (p.S47C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.133354924G>C"	""	"VUS"	""
"0000536960"	"0"	"30"	"9"	"136223266"	"136223266"	"subst"	"0.00536398"	"02330"	"RPL7A_000016"	"g.136223266C>T"	""	""	""	"SURF1(NM_003172.4):c.54+10G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.133356390C>T"	""	"likely benign"	""
"0000536961"	"0"	"30"	"9"	"136223541"	"136223541"	"subst"	"0.0445838"	"01804"	"SURF1_000037"	"g.136223541C>T"	""	""	""	"SURF2(NM_001278928.1):c.73C>T (p.(Arg25Cys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.133356665C>T"	""	"likely benign"	""
"0000536963"	"0"	"30"	"9"	"136227285"	"136227285"	"subst"	"0.00468961"	"01804"	"SURF1_000039"	"g.136227285G>A"	""	""	""	"SURF2(NM_001278928.1):c.662G>A (p.(Arg221Gln))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.133360409G>A"	""	"likely benign"	""
"0000611949"	"0"	"50"	"9"	"136219307"	"136219307"	"subst"	"0.000316726"	"02326"	"RPL7A_000005"	"g.136219307T>C"	""	""	""	"SURF1(NM_003172.3):c.745A>G (p.N249D), SURF1(NM_003172.4):c.745A>G (p.N249D)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.133352452T>C"	""	"VUS"	""
"0000611950"	"0"	"70"	"9"	"136219623"	"136219623"	"subst"	"2.08683E-5"	"02327"	"SURF1_000008"	"g.136219623T>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.133352768T>C"	""	"likely pathogenic"	""
"0000652645"	"1"	"90"	"9"	"136220806"	"136220806"	"subst"	"2.03259E-5"	"03575"	"SURF1_000040"	"g.136220806A>G"	"1/2795 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"1 heterozygous, no homozygous; {DB:CLININrs375398247}"	"Germline"	""	"rs375398247"	"0"	""	""	"g.133353951A>G"	""	"pathogenic"	""
"0000656264"	"0"	"90"	"9"	"136221516"	"136221524"	"del"	"8.12783E-6"	"02330"	"RPL7A_000011"	"g.136221516_136221524del"	""	""	""	"SURF1(NM_003172.2):c.313_321del (p.(Leu105_Ala107del)), SURF1(NM_003172.3):c.313_321delCTGCCAGCC (p.L105_A107del), SURF1(NM_003172.4):c.313_321delC..."	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.133354661_133354669del"	""	"pathogenic"	""
"0000656265"	"0"	"90"	"9"	"136221516"	"136221524"	"del"	"8.12783E-6"	"02325"	"RPL7A_000011"	"g.136221516_136221524del"	""	""	""	"SURF1(NM_003172.2):c.313_321del (p.(Leu105_Ala107del)), SURF1(NM_003172.3):c.313_321delCTGCCAGCC (p.L105_A107del), SURF1(NM_003172.4):c.313_321delC..."	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.133354661_133354669del"	""	"pathogenic"	""
"0000656266"	"0"	"90"	"9"	"136221678"	"136221678"	"subst"	"2.84292E-5"	"02325"	"RPL7A_000017"	"g.136221678C>A"	""	""	""	"SURF1(NM_003172.4):c.240+1G>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.133354823C>A"	""	"pathogenic"	""
"0000678577"	"0"	"50"	"9"	"136219307"	"136219307"	"subst"	"0.000316726"	"01943"	"RPL7A_000005"	"g.136219307T>C"	""	""	""	"SURF1(NM_003172.3):c.745A>G (p.N249D), SURF1(NM_003172.4):c.745A>G (p.N249D)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000678578"	"0"	"10"	"9"	"136223043"	"136223043"	"subst"	"0"	"02330"	"RPL7A_000018"	"g.136223043C>G"	""	""	""	"SURF1(NM_003172.4):c.106+81G>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000678579"	"0"	"10"	"9"	"136223260"	"136223266"	"del"	"0"	"02330"	"RPL7A_000019"	"g.136223260_136223266del"	""	""	""	"SURF1(NM_003172.4):c.54+48_55-47delTGCGGGG"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000690450"	"0"	"30"	"9"	"136219374"	"136219374"	"subst"	"0"	"01943"	"RPL7A_000020"	"g.136219374G>A"	""	""	""	"SURF1(NM_003172.3):c.678C>T (p.H226=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000722346"	"0"	"50"	"9"	"136219604"	"136219604"	"subst"	"0"	"02330"	"RPL7A_000021"	"g.136219604T>C"	""	""	""	"SURF1(NM_003172.4):c.533A>G (p.N178S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000722347"	"0"	"50"	"9"	"136220769"	"136220769"	"subst"	"0.000174734"	"02325"	"RPL7A_000010"	"g.136220769T>G"	""	""	""	"SURF1(NM_003172.2):c.350A>C (p.(Tyr117Ser)), SURF1(NM_003172.4):c.350A>C (p.Y117S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000722348"	"0"	"70"	"9"	"136221568"	"136221568"	"subst"	"0"	"01943"	"RPL7A_000014"	"g.136221568A>G"	""	""	""	"SURF1(NM_003172.2):c.269T>C (p.(Leu90Pro)), SURF1(NM_003172.3):c.269T>C (p.L90P), SURF1(NM_003172.4):c.269T>C (p.L90P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000787062"	"3"	"90"	"9"	"136219602"	"136219602"	"dup"	"0"	"00006"	"SURF1_000042"	"g.136219602dup"	""	"{PMID:Ganapathy 2019:31069529}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.133352747dup"	""	"pathogenic"	""
"0000787063"	"3"	"90"	"9"	"136219301"	"136219301"	"subst"	"1.21819E-5"	"00006"	"SURF1_000041"	"g.136219301G>A"	""	"{PMID:Ganapathy 2019:31069529}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.133352446G>A"	""	"pathogenic"	""
"0000803936"	"0"	"30"	"9"	"136221789"	"136221789"	"subst"	"0"	"01943"	"RPL7A_000022"	"g.136221789A>T"	""	""	""	"SURF1(NM_003172.3):c.130T>A (p.C44S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000817900"	"3"	"70"	"9"	"136218979"	"136218979"	"subst"	"0"	"00006"	"SURF1_000043"	"g.136218979C>A"	""	"{PMID:Hu 2019:29302074}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.133352124C>A"	""	"likely pathogenic (recessive)"	"ACMG"
"0000832109"	"3"	"90"	"9"	"136221814"	"136221814"	"subst"	"8.14591E-6"	"04217"	"SURF1_000013"	"g.136221814T>C"	""	"{PMID:Echaniz-Laguna 2013:24027061}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.133354959T>C"	""	"pathogenic (recessive)"	""
"0000832112"	"3"	"90"	"9"	"136221814"	"136221814"	"subst"	"8.14591E-6"	"04217"	"SURF1_000013"	"g.136221814T>C"	""	"{PMID:Echaniz-Laguna 2013:24027061}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.133354959T>C"	""	"pathogenic (recessive)"	""
"0000832178"	"21"	"90"	"9"	"136219563"	"136219563"	"subst"	"1.22589E-5"	"04217"	"SURF1_000044"	"g.136219563G>A"	""	"{PMID:Echaniz-Laguna 2013:24027061}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.133352708G>A"	""	"pathogenic (recessive)"	""
"0000832179"	"11"	"90"	"9"	"136218951"	"136218952"	"del"	"4.18785E-6"	"04217"	"SURF1_000016"	"g.136218951_136218952del"	""	"{PMID:Echaniz-Laguna 2013:24027061}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.133352096_133352097del"	""	"pathogenic (recessive)"	""
"0000861534"	"0"	"50"	"9"	"136218943"	"136218943"	"subst"	"4.1708E-6"	"01943"	"RPL7A_000023"	"g.136218943T>A"	""	""	""	"SURF1(NM_003172.3):c.806A>T (p.N269I), SURF1(NM_003172.4):c.806A>T (p.(Asn269Ile))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000861535"	"0"	"10"	"9"	"136219448"	"136219448"	"subst"	"0.0138075"	"02330"	"RPL7A_000024"	"g.136219448C>G"	""	""	""	"SURF1(NM_003172.4):c.604G>C (p.D202H, p.(Asp202His))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000861536"	"0"	"30"	"9"	"136223267"	"136223267"	"subst"	"0"	"01943"	"RPL7A_000025"	"g.136223267G>C"	""	""	""	"SURF1(NM_003172.3):c.54+9C>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000924989"	"0"	"50"	"9"	"136220700"	"136220700"	"subst"	"0"	"02330"	"RPL7A_000026"	"g.136220700A>C"	""	""	""	"SURF1(NM_003172.4):c.419T>G (p.V140G)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000924990"	"0"	"50"	"9"	"136223132"	"136223132"	"subst"	"0"	"02330"	"RPL7A_000027"	"g.136223132G>A"	""	""	""	"SURF1(NM_003172.4):c.98C>T (p.P33L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000929548"	"0"	"90"	"9"	"136218915"	"136218915"	"subst"	"0"	"02327"	"SURF1_000011"	"g.136218915C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000929549"	"0"	"90"	"9"	"136221678"	"136221678"	"subst"	"2.84292E-5"	"02330"	"RPL7A_000017"	"g.136221678C>A"	""	""	""	"SURF1(NM_003172.4):c.240+1G>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000949217"	"0"	"50"	"9"	"136220661"	"136220663"	"del"	"0"	"02325"	"RPL7A_000028"	"g.136220661_136220663del"	""	""	""	"SURF1(NM_003172.4):c.462_464delCTC (p.S155del)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000952447"	"1"	"70"	"9"	"136219461"	"136219461"	"subst"	"4.06421E-5"	"04606"	"SURF1_000045"	"g.136219461A>T"	""	""	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.133352606A>T"	"856179"	"likely pathogenic (recessive)"	"ACMG"
"0000952545"	"2"	"90"	"9"	"136218829"	"136218830"	"del"	"0"	"04606"	"SURF1_000025"	"g.136218829_136218830del"	""	""	""	"845_846delCT"	""	"Germline"	"yes"	""	"0"	""	""	"g.133351974_133351975del"	"12770"	"pathogenic"	"ACMG"
"0000965240"	"0"	"90"	"9"	"136218829"	"136218830"	"del"	"0"	"02330"	"SURF1_000025"	"g.136218829_136218830del"	""	""	""	"SURF1(NM_003172.4):c.845_846delCT (p.S282Cfs*9)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000965242"	"0"	"10"	"9"	"136223246"	"136223266"	"del"	"0"	"02330"	"SURF1_000033"	"g.136223246_136223266del"	""	""	""	"SURF1(NM_003172.4):c.54+34_55-47delTGCGGGGTGCGGGGTGCGGGG"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000978483"	"0"	"30"	"9"	"136219448"	"136219448"	"subst"	"0.0138075"	"01804"	"RPL7A_000024"	"g.136219448C>G"	""	""	""	"SURF1(NM_003172.4):c.604G>C (p.D202H, p.(Asp202His))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000978484"	"0"	"30"	"9"	"136220584"	"136220584"	"subst"	"0"	"02330"	"RPL7A_000029"	"g.136220584C>T"	""	""	""	"SURF1(NM_003172.4):c.515+20G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000978485"	"0"	"50"	"9"	"136220784"	"136220784"	"subst"	"4.06425E-6"	"01804"	"RPL7A_000030"	"g.136220784A>G"	""	""	""	"SURF1(NM_003172.4):c.335T>C (p.(Leu112Pro))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000978486"	"0"	"30"	"9"	"136221516"	"136221516"	"subst"	"6.5029E-5"	"02330"	"RPL7A_000031"	"g.136221516G>A"	""	""	""	"SURF1(NM_003172.4):c.321C>T (p.A107=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000978487"	"0"	"30"	"9"	"136221670"	"136221670"	"subst"	"0.000154339"	"01804"	"RPL7A_000032"	"g.136221670G>A"	""	""	""	"SURF1(NM_003172.4):c.240+9C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000978488"	"0"	"30"	"9"	"136223266"	"136223266"	"subst"	"0.00536398"	"01804"	"RPL7A_000016"	"g.136223266C>T"	""	""	""	"SURF1(NM_003172.4):c.54+10G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000997599"	"0"	"90"	"9"	"136218829"	"136218830"	"del"	"0"	"02329"	"SURF1_000025"	"g.136218829_136218830del"	""	""	""	"SURF1(NM_003172.4):c.845_846delCT (p.S282Cfs*9)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000997600"	"0"	"90"	"9"	"136218998"	"136218998"	"subst"	"9.44662E-6"	"02329"	"RPL7A_000033"	"g.136218998C>G"	""	""	""	"SURF1(NM_003172.4):c.752-1G>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000997601"	"0"	"70"	"9"	"136220797"	"136220797"	"subst"	"4.06484E-6"	"02329"	"RPL7A_000034"	"g.136220797T>C"	""	""	""	"SURF1(NM_003172.4):c.324-2A>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000997602"	"0"	"50"	"9"	"136227303"	"136227303"	"subst"	"5.12707E-5"	"01804"	"SURF1_000046"	"g.136227303G>A"	""	""	""	"SURF2(NM_017503.4):c.680G>A (p.(Arg227His))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001014511"	"0"	"10"	"9"	"136219295"	"136219295"	"subst"	"0.00526256"	"02326"	"SURF1_000027"	"g.136219295A>G"	""	""	""	"SURF1(NM_003172.4):c.751+6T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0001037269"	"0"	"50"	"9"	"136218943"	"136218943"	"subst"	"4.1708E-6"	"01804"	"RPL7A_000023"	"g.136218943T>A"	""	""	""	"SURF1(NM_003172.3):c.806A>T (p.N269I), SURF1(NM_003172.4):c.806A>T (p.(Asn269Ile))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001037270"	"0"	"50"	"9"	"136219574"	"136219574"	"subst"	"0.000122516"	"01804"	"RPL7A_000035"	"g.136219574T>C"	""	""	""	"SURF1(NM_003172.4):c.563A>G (p.(Asn188Ser))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001059232"	"3"	"90"	"9"	"136218829"	"136218830"	"del"	"0"	"00006"	"SURF1_000025"	"g.136218829_136218830del"	""	"{PMID:Retterer 2016:26633542}"	""	"845_846delCT"	""	"Germline"	""	""	"0"	""	""	"g.133351974_133351975del"	""	"pathogenic (recessive)"	""


## Variants_On_Transcripts ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Note: Only showing Variants_On_Transcript columns active for Genes SURF1
## Count = 113
"{{id}}"	"{{transcriptid}}"	"{{effectid}}"	"{{position_c_start}}"	"{{position_c_start_intron}}"	"{{position_c_end}}"	"{{position_c_end_intron}}"	"{{VariantOnTranscript/DNA}}"	"{{VariantOnTranscript/RNA}}"	"{{VariantOnTranscript/Protein}}"	"{{VariantOnTranscript/Exon}}"
"0000064413"	"00024196"	"50"	"1081"	"0"	"1081"	"0"	"c.*178G>C"	"r.(=)"	"p.(=)"	"9_"
"0000064414"	"00024196"	"50"	"1080"	"0"	"1080"	"0"	"c.*177T>C"	"r.(=)"	"p.(=)"	"9_"
"0000064415"	"00024196"	"50"	"752"	"-65"	"752"	"-65"	"c.752-65A>T"	"r.(=)"	"p.(=)"	"7i"
"0000064416"	"00024196"	"90"	"180"	"0"	"180"	"0"	"c.180del"	"r.(?)"	"p.(Leu62Phefs*10)"	"3"
"0000130006"	"00024196"	"70"	"19"	"0"	"35"	"0"	"c.19_35del"	"r.(?)"	"p.(Leu7Glyfs*47)"	"1"
"0000140363"	"00024196"	"70"	"846"	"0"	"849"	"0"	"c.846_849dup"	"r.(?)"	"p.(Ala284Cysfs*9)"	""
"0000140364"	"00024196"	"00"	"833"	"1"	"833"	"1"	"c.833+1G>A"	"r.spl?"	"p.?"	"8i"
"0000246812"	"00024196"	"10"	"280"	"0"	"280"	"0"	"c.280T>C"	"r.(?)"	"p.(Leu94=)"	""
"0000246847"	"00024196"	"10"	"751"	"6"	"751"	"6"	"c.751+6T>C"	"r.(=)"	"p.(=)"	""
"0000246848"	"00024196"	"30"	"240"	"21"	"240"	"21"	"c.240+21T>C"	"r.(=)"	"p.(=)"	""
"0000308872"	"00024196"	"10"	"167"	"0"	"167"	"0"	"c.167C>G"	"r.(?)"	"p.(Ala56Gly)"	""
"0000308873"	"00024196"	"10"	"573"	"0"	"573"	"0"	"c.573C>G"	"r.(?)"	"p.(Thr191=)"	""
"0000308874"	"00024196"	"10"	"833"	"13"	"833"	"13"	"c.833+13C>T"	"r.(=)"	"p.(=)"	""
"0000311620"	"00024196"	"90"	"209"	"0"	"210"	"0"	"c.209_210del"	"r.(?)"	"p.(Pro70ArgfsTer31)"	""
"0000311621"	"00024196"	"10"	"54"	"34"	"55"	"-47"	"c.54+34_55-47del"	"r.?"	"p.?"	""
"0000315931"	"00024196"	"50"	"823"	"0"	"823"	"0"	"c.823A>T"	"r.(?)"	"p.(Ile275Phe)"	""
"0000332879"	"00024196"	"50"	"498"	"0"	"498"	"0"	"c.498C>G"	"r.(?)"	"p.(Phe166Leu)"	""
"0000332880"	"00024196"	"50"	"350"	"0"	"350"	"0"	"c.350A>C"	"r.(?)"	"p.(Tyr117Ser)"	""
"0000332881"	"00024196"	"90"	"313"	"0"	"321"	"0"	"c.313_321del"	"r.(?)"	"p.(Leu105_Ala107del)"	""
"0000332882"	"00024196"	"90"	"311"	"0"	"312"	"0"	"c.311_312insA"	"r.(?)"	"p.(Leu105SerfsTer14)"	""
"0000332883"	"00024196"	"90"	"269"	"0"	"269"	"0"	"c.269T>C"	"r.(?)"	"p.(Leu90Pro)"	""
"0000352488"	"00024196"	"90"	"845"	"0"	"846"	"0"	"c.845_846del"	"r.(?)"	"p.(Ser282Cysfs*9)"	""
"0000352489"	"00024196"	"90"	"312"	"0"	"321"	"0"	"c.312_321delinsAT"	"r.(?)"	"p.(Leu105*)"	""
"0000435574"	"00024196"	"95"	"55"	"-1"	"55"	"-1"	"c.55-1G>A"	"r.spl"	"p.?"	"1i"
"0000435575"	"00024196"	"95"	"55"	"-1"	"55"	"-1"	"c.55-1G>A"	"r.spl"	"p.?"	"1i"
"0000435576"	"00024196"	"95"	"106"	"1"	"106"	"1"	"c.106+1G>C"	"r.spl"	"p.?"	"2i"
"0000435577"	"00024196"	"95"	"106"	"1"	"106"	"1"	"c.106+1G>C"	"r.spl"	"p.?"	"2i"
"0000435578"	"00024196"	"95"	"107"	"-2"	"107"	"-2"	"c.107-2A>G"	"r.spl"	"p.?"	"2i"
"0000435579"	"00024196"	"95"	"169"	"0"	"169"	"0"	"c.169del"	"r.(?)"	"p.(Glu57Lysfs*15)"	"3"
"0000435580"	"00024196"	"95"	"183"	"0"	"186"	"0"	"c.183_186del"	"r.(?)"	"p.(Leu62Serfs*9)"	"3"
"0000435581"	"00024196"	"95"	"312"	"0"	"321"	"0"	"c.312_321delinsAT"	"r.312_321delinsau"	"p.Leu105*"	"4"
"0000435582"	"00024196"	"95"	"312"	"0"	"321"	"0"	"c.312_321delinsAT"	"r.312_321delinsau"	"p.Leu105*"	"4"
"0000435583"	"00024196"	"95"	"312"	"0"	"321"	"0"	"c.312_321delinsAT"	"r.312_321delinsau"	"p.Leu105*"	"4"
"0000435584"	"00024196"	"95"	"312"	"0"	"321"	"0"	"c.312_321delinsAT"	"r.312_321delinsau"	"p.Leu105*"	"4"
"0000435585"	"00024196"	"95"	"324"	"-11"	"324"	"-11"	"c.324-11T>G"	"r.spl?"	"p.(=)"	"4i"
"0000435586"	"00024196"	"95"	"324"	"-11"	"324"	"-11"	"c.324-11T>G"	"r.spl"	"p.(=)"	"4i"
"0000435587"	"00024196"	"95"	"324"	"-11"	"324"	"-11"	"c.324-11T>G"	"r.324_515del"	"p.Asp108_Gly172delinsGlu"	"4i"
"0000435588"	"00024196"	"95"	"472"	"0"	"473"	"0"	"c.472_473del"	"r.(?)"	"p.(Ser158Trpfs*21)"	"5"
"0000435589"	"00024196"	"95"	"516"	"-2"	"516"	"-2"	"c.516-2A>G"	"r.spl"	"p.?"	"5i"
"0000435590"	"00024196"	"95"	"516"	"-2"	"516"	"-2"	"c.516-2A>G"	"r.spl"	"p.?"	"5i"
"0000435591"	"00024196"	"95"	"555"	"0"	"556"	"0"	"c.555_556del"	"r.(?)"	"p.(Lys186Serfs*4)"	"6"
"0000435592"	"00024196"	"95"	"614"	"0"	"614"	"0"	"c.614G>A"	"r.(?)"	"p.(Gly205Glu)"	"7"
"0000435593"	"00024196"	"95"	"769"	"0"	"769"	"0"	"c.769G>A"	"r.(?)"	"p.(Gly257Arg)"	"8"
"0000435594"	"00024196"	"95"	"792"	"0"	"793"	"0"	"c.792_793del"	"r.792_793del"	"p.Arg264Serfs*27"	"8"
"0000435595"	"00024196"	"95"	"799"	"0"	"800"	"0"	"c.799_800del"	"r.799_800del"	"p.Leu267Glufs*24"	"8"
"0000435596"	"00024196"	"95"	"807"	"0"	"810"	"0"	"c.807_810delins9"	"r.(?)"	"p.?"	"8"
"0000435597"	"00024196"	"95"	"833"	"1"	"833"	"1"	"c.833+1G>A"	"r.spl"	"p.?"	"8i"
"0000435598"	"00024196"	"95"	"833"	"1"	"833"	"1"	"c.833+1G>A"	"r.spl"	"p.?"	"8i"
"0000438806"	"00024196"	"70"	"827"	"0"	"828"	"0"	"c.827_828del"	"r.(?)"	"p.Val276Aspfs*15"	""
"0000471104"	"00024196"	"90"	"241"	"-1"	"241"	"-1"	"c.241-1G>C"	"r.spl"	"p.?"	""
"0000536941"	"00024196"	"10"	"883"	"0"	"883"	"0"	"c.883C>T"	"r.(?)"	"p.(Arg295Cys)"	""
"0000536944"	"00024196"	"50"	"745"	"0"	"745"	"0"	"c.745A>G"	"r.(?)"	"p.(Asn249Asp)"	""
"0000536946"	"00024196"	"10"	"573"	"0"	"573"	"0"	"c.573C>G"	"r.(?)"	"p.(Thr191=)"	""
"0000536947"	"00024196"	"10"	"543"	"0"	"543"	"0"	"c.543C>T"	"r.(?)"	"p.(Phe181=)"	""
"0000536948"	"00024196"	"50"	"371"	"0"	"371"	"0"	"c.371G>A"	"r.(?)"	"p.(Gly124Glu)"	""
"0000536949"	"00024196"	"90"	"313"	"0"	"321"	"0"	"c.313_321del"	"r.(?)"	"p.(Leu105_Ala107del)"	""
"0000536951"	"00024196"	"90"	"311"	"0"	"312"	"0"	"c.311_312insA"	"r.(?)"	"p.(Leu105SerfsTer14)"	""
"0000536952"	"00024196"	"90"	"311"	"0"	"312"	"0"	"c.311_312insA"	"r.(?)"	"p.(Leu105SerfsTer14)"	""
"0000536953"	"00024196"	"90"	"311"	"0"	"312"	"0"	"c.311_312insA"	"r.(?)"	"p.(Leu105SerfsTer14)"	""
"0000536955"	"00024196"	"10"	"280"	"0"	"280"	"0"	"c.280T>C"	"r.(?)"	"p.(Leu94=)"	""
"0000536956"	"00024196"	"70"	"269"	"0"	"269"	"0"	"c.269T>C"	"r.(?)"	"p.(Leu90Pro)"	""
"0000536957"	"00024196"	"70"	"269"	"0"	"269"	"0"	"c.269T>C"	"r.(?)"	"p.(Leu90Pro)"	""
"0000536959"	"00024196"	"50"	"140"	"0"	"140"	"0"	"c.140C>G"	"r.(?)"	"p.(Ser47Cys)"	""
"0000536960"	"00024196"	"30"	"54"	"10"	"54"	"10"	"c.54+10G>A"	"r.(=)"	"p.(=)"	""
"0000536961"	"00024196"	"30"	"-212"	"0"	"-212"	"0"	"c.-212G>A"	"r.(?)"	"p.(=)"	""
"0000536963"	"00024196"	"30"	"-3956"	"0"	"-3956"	"0"	"c.-3956C>T"	"r.(?)"	"p.(=)"	""
"0000611949"	"00024196"	"50"	"745"	"0"	"745"	"0"	"c.745A>G"	"r.(?)"	"p.(Asn249Asp)"	""
"0000611950"	"00024196"	"70"	"516"	"-2"	"516"	"-2"	"c.516-2A>G"	"r.spl?"	"p.?"	""
"0000652645"	"00024196"	"90"	"324"	"-11"	"324"	"-11"	"c.324-11T>C"	"r.(=)"	"p.(=)"	""
"0000656264"	"00024196"	"90"	"313"	"0"	"321"	"0"	"c.313_321del"	"r.(?)"	"p.(Leu105_Ala107del)"	""
"0000656265"	"00024196"	"90"	"313"	"0"	"321"	"0"	"c.313_321del"	"r.(?)"	"p.(Leu105_Ala107del)"	""
"0000656266"	"00024196"	"90"	"240"	"1"	"240"	"1"	"c.240+1G>T"	"r.spl?"	"p.?"	""
"0000678577"	"00024196"	"50"	"745"	"0"	"745"	"0"	"c.745A>G"	"r.(?)"	"p.(Asn249Asp)"	""
"0000678578"	"00024196"	"10"	"106"	"81"	"106"	"81"	"c.106+81G>C"	"r.(=)"	"p.(=)"	""
"0000678579"	"00024196"	"10"	"54"	"48"	"55"	"-47"	"c.54+48_55-47del"	"r.(?)"	"p.(=)"	""
"0000690450"	"00024196"	"30"	"678"	"0"	"678"	"0"	"c.678C>T"	"r.(?)"	"p.(His226=)"	""
"0000722346"	"00024196"	"50"	"533"	"0"	"533"	"0"	"c.533A>G"	"r.(?)"	"p.(Asn178Ser)"	""
"0000722347"	"00024196"	"50"	"350"	"0"	"350"	"0"	"c.350A>C"	"r.(?)"	"p.(Tyr117Ser)"	""
"0000722348"	"00024196"	"70"	"269"	"0"	"269"	"0"	"c.269T>C"	"r.(?)"	"p.(Leu90Pro)"	""
"0000787062"	"00024196"	"90"	"535"	"0"	"535"	"0"	"c.535dup"	"r.(?)"	"p.(Arg179LysfsTer12)"	"6"
"0000787063"	"00024196"	"90"	"751"	"0"	"751"	"0"	"c.751C>T"	"r.(?)"	"p.(Gln251Ter)"	"7"
"0000803936"	"00024196"	"30"	"130"	"0"	"130"	"0"	"c.130T>A"	"r.(?)"	"p.(Cys44Ser)"	""
"0000817900"	"00024196"	"70"	"770"	"0"	"770"	"0"	"c.770G>T"	"r.(?)"	"p.(Gly257Val)"	""
"0000832109"	"00024196"	"90"	"107"	"-2"	"107"	"-2"	"c.107-2A>G"	"r.[107_240del,107-515del,107_119del,107_189del,106_107ins[107-51_107-3;gg],106_107ins[107-18_107-3;gg]]"	"p.?"	""
"0000832112"	"00024196"	"90"	"107"	"-2"	"107"	"-2"	"c.107-2A>G"	"r.[107_240del,107-515del,107_119del,107_189del,106_107ins[107-51_107-3;gg],106_107ins[107-18_107-3;gg]"	"p.?"	"2i"
"0000832178"	"00024196"	"90"	"574"	"0"	"574"	"0"	"c.574C>T"	"r.(?)"	"p.(Arg192Trp)"	""
"0000832179"	"00024196"	"90"	"799"	"0"	"800"	"0"	"c.799_800del"	"r.(?)"	"p.(Leu267Glufs*24)"	""
"0000861534"	"00024196"	"50"	"806"	"0"	"806"	"0"	"c.806A>T"	"r.(?)"	"p.(Asn269Ile)"	""
"0000861535"	"00024196"	"10"	"604"	"0"	"604"	"0"	"c.604G>C"	"r.(?)"	"p.(Asp202His)"	""
"0000861536"	"00024196"	"30"	"54"	"9"	"54"	"9"	"c.54+9C>G"	"r.(=)"	"p.(=)"	""
"0000924989"	"00024196"	"50"	"419"	"0"	"419"	"0"	"c.419T>G"	"r.(?)"	"p.(Val140Gly)"	""
"0000924990"	"00024196"	"50"	"98"	"0"	"98"	"0"	"c.98C>T"	"r.(?)"	"p.(Pro33Leu)"	""
"0000929548"	"00024196"	"90"	"833"	"1"	"833"	"1"	"c.833+1G>A"	"r.spl?"	"p.?"	""
"0000929549"	"00024196"	"90"	"240"	"1"	"240"	"1"	"c.240+1G>T"	"r.spl?"	"p.?"	""
"0000949217"	"00024196"	"50"	"462"	"0"	"464"	"0"	"c.462_464del"	"r.(?)"	"p.(Ser155del)"	""
"0000952447"	"00024196"	"70"	"591"	"0"	"591"	"0"	"c.591T>A"	"r.spl"	"p.?"	"7"
"0000952545"	"00024196"	"90"	"845"	"0"	"846"	"0"	"c.845_846del"	"r.(?)"	"p.(Ser282Cysfs*9)"	""
"0000965240"	"00024196"	"90"	"845"	"0"	"846"	"0"	"c.845_846del"	"r.(?)"	"p.(Ser282Cysfs*9)"	""
"0000965242"	"00024196"	"10"	"54"	"34"	"55"	"-47"	"c.54+34_55-47del"	"r.?"	"p.?"	""
"0000978483"	"00024196"	"30"	"604"	"0"	"604"	"0"	"c.604G>C"	"r.(?)"	"p.(Asp202His)"	""
"0000978484"	"00024196"	"30"	"515"	"20"	"515"	"20"	"c.515+20G>A"	"r.(=)"	"p.(=)"	""
"0000978485"	"00024196"	"50"	"335"	"0"	"335"	"0"	"c.335T>C"	"r.(?)"	"p.(Leu112Pro)"	""
"0000978486"	"00024196"	"30"	"321"	"0"	"321"	"0"	"c.321C>T"	"r.(?)"	"p.(=)"	""
"0000978487"	"00024196"	"30"	"240"	"9"	"240"	"9"	"c.240+9C>T"	"r.(=)"	"p.(=)"	""
"0000978488"	"00024196"	"30"	"54"	"10"	"54"	"10"	"c.54+10G>A"	"r.(=)"	"p.(=)"	""
"0000997599"	"00024196"	"90"	"845"	"0"	"846"	"0"	"c.845_846del"	"r.(?)"	"p.(Ser282Cysfs*9)"	""
"0000997600"	"00024196"	"90"	"752"	"-1"	"752"	"-1"	"c.752-1G>C"	"r.spl?"	"p.?"	""
"0000997601"	"00024196"	"70"	"324"	"-2"	"324"	"-2"	"c.324-2A>G"	"r.spl?"	"p.?"	""
"0000997602"	"00024196"	"50"	"-3974"	"0"	"-3974"	"0"	"c.-3974C>T"	"r.(?)"	"p.(=)"	""
"0001014511"	"00024196"	"10"	"751"	"6"	"751"	"6"	"c.751+6T>C"	"r.(=)"	"p.(=)"	""
"0001037269"	"00024196"	"50"	"806"	"0"	"806"	"0"	"c.806A>T"	"r.(?)"	"p.(Asn269Ile)"	""
"0001037270"	"00024196"	"50"	"563"	"0"	"563"	"0"	"c.563A>G"	"r.(?)"	"p.(Asn188Ser)"	""
"0001059232"	"00024196"	"90"	"845"	"0"	"846"	"0"	"c.845_846del"	"r.(?)"	"p.(Ser282CysfsTer9)"	""


## Screenings_To_Variants ## Do not remove or alter this header ##
## Count = 47
"{{screeningid}}"	"{{variantid}}"
"0000037288"	"0000064413"
"0000037289"	"0000064414"
"0000037290"	"0000064415"
"0000037291"	"0000064416"
"0000080920"	"0000130006"
"0000087238"	"0000140363"
"0000087240"	"0000140364"
"0000153389"	"0000352488"
"0000153389"	"0000352489"
"0000206164"	"0000435574"
"0000206164"	"0000435575"
"0000206165"	"0000435576"
"0000206166"	"0000435577"
"0000206167"	"0000435578"
"0000206168"	"0000435579"
"0000206169"	"0000435580"
"0000206170"	"0000435581"
"0000206171"	"0000435582"
"0000206172"	"0000435583"
"0000206173"	"0000435584"
"0000206174"	"0000435585"
"0000206175"	"0000435586"
"0000206176"	"0000435587"
"0000206177"	"0000435588"
"0000206178"	"0000435589"
"0000206178"	"0000435590"
"0000206179"	"0000435591"
"0000206179"	"0000435593"
"0000206180"	"0000435592"
"0000206181"	"0000435594"
"0000206182"	"0000435595"
"0000206183"	"0000435596"
"0000206184"	"0000435597"
"0000206185"	"0000435598"
"0000208825"	"0000438806"
"0000229868"	"0000471104"
"0000295956"	"0000652645"
"0000375711"	"0000787062"
"0000375712"	"0000787063"
"0000389107"	"0000817900"
"0000399483"	"0000832109"
"0000399556"	"0000832112"
"0000399596"	"0000832178"
"0000399596"	"0000832179"
"0000445432"	"0000952447"
"0000445432"	"0000952545"
"0000471110"	"0001059232"