### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = SYP) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "SYP" "synaptophysin" "X" "p11.23-p11.22" "unknown" "NG_012532.1" "UD_132118818760" "" "https://www.LOVD.nl/SYP" "" "1" "11506" "6855" "313475" "1" "1" "1" "1" "This gene sequence variant database has been initiated based on the data reported by Tarpey et al. (2009) A systematic, large-scale resequencing screen of the X-chromosome coding exons in mental retardation. Nat.Genet. 41: 535-543. Establishment of the database was supported by the European Community\'s Seventh Framework Programme (FP7/2007-2013) under grant agreement No 200754 - the GEN2PHEN project." "" "g" "https://databases.lovd.nl/shared/refseq/SYP_codingDNA.html" "1" "" "" "-1" "" "-1" "00000" "2009-03-06 00:00:00" "00006" "2020-05-11 17:01:57" "00000" "2025-11-01 13:22:20" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00001045" "SYP" "synaptophysin" "001" "NM_003179.2" "" "NP_003170.1" "" "" "" "-16" "2417" "942" "49044265" "49056661" "00000" "2012-09-13 13:09:38" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 5 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00139" "ID" "intellectual disability (ID)" "" "" "" "" "" "00084" "2013-06-04 18:18:07" "00006" "2015-02-09 10:02:49" "00187" "MRX;IDX" "mental retardation, X-linked (MRX, intellectual disability (IDX))" "" "" "" "X-linked" "" "00006" "2013-09-05 15:56:47" "00006" "2018-12-18 09:23:21" "01119" "MRX96" "mental retardation, X-linked, type 96 (MRX96)" "XLR" "300802" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2020-05-11 17:00:41" "01157" "CHTE" "Hypothyroidism, central, testicular enlargement (CHTE)" "XLR" "300888" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "05611" "NDD" "neurodevelopmental disorder (NDD)" "" "" "" "" "" "00006" "2019-06-19 12:27:20" "00006" "2024-12-13 11:12:21" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 2 "{{geneid}}" "{{diseaseid}}" "SYP" "00139" "SYP" "01119" ## Individuals ## Do not remove or alter this header ## ## Count = 5 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00000208" "" "" "" "1" "" "00037" "{PMID:Sun 2011:23143598}, {DOI:Sun 2011:10.1038/ng.2453}" "" "M" "no" "Netherlands" "" "0" "" "" "" "" "00000209" "" "" "" "1" "" "00037" "{PMID:Sun 2011:23143598}, {DOI:Sun 2011:10.1038/ng.2453}" "" "M" "no" "Netherlands" "" "0" "" "" "" "" "00172479" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "M" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377476-Pat?" "00399217" "" "" "" "9" "" "00006" "{PMID:Philips 2014:24721225}" "4-generation family, 9 affected (9M), unaffected heterozygous carrierfemales" "M" "" "Finland" "" "0" "" "" "" "FamD175" "00459411" "" "" "" "1" "" "03544" "" "" "M" "-" "- (not applicable)" "" "" "" "" "white" "" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 5 "{{individualid}}" "{{diseaseid}}" "00000208" "01157" "00000209" "01157" "00172479" "00187" "00399217" "00139" "00459411" "05611" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00139, 00187, 01119, 01157, 05611 ## Count = 5 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Birth/Gestational_age_wk}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "0000038983" "01157" "00000208" "00006" "Familial, X-linked recessive" "" "central hypothyroidism (FT4 0.50-0.99of lower limit normal), no prolactin deficiency, age sonographic determination testicular volume 17.64y, testicular volume right/left 21/20 (7.3–16ml)" "" "" "3w" "" "" "" "" "" "" "" "0000038984" "01157" "00000209" "00006" "Familial, X-linked recessive" "" "central hypothyroidism (FT4 0.50-0.99of lower limit normal), prolactin deficiency, age sonographic determination testicular volume 21.36y, testicular volume right/left 30/26 (8.5–18.3ml)" "" "" "07y04m" "" "" "" "" "" "" "" "0000137343" "00187" "00172479" "00124" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "MRX" "0000292305" "00139" "00399217" "00006" "Familial, X-linked recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "XLID96" "intellectual disability" "0000347487" "05611" "00459411" "03544" "Isolated (sporadic)" "" "HP:0000717, HP:0010864" "" "" "" "" "" "" "" "" "XLID96" "complex neurodevelopmental disorder" ## Screenings ## Do not remove or alter this header ## ## Count = 5 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000000209" "00000208" "1" "00037" "00001" "2012-09-13 12:02:03" "" "" "SEQ-NG-I" "DNA" "" "" "0000000210" "00000209" "1" "00037" "00001" "2012-09-13 12:09:36" "" "" "SEQ-NG-I" "DNA" "" "" "0000173362" "00172479" "1" "00124" "00006" "2009-05-08 12:40:34" "00006" "2009-05-19 12:33:15" "SEQ" "DNA" "" "" "0000400461" "00399217" "1" "00006" "00006" "2022-01-17 12:48:19" "" "" "SEQ;SEQ-NG" "DNA" "" "X-WES" "0000461034" "00459411" "1" "03544" "03544" "2024-12-27 07:55:57" "" "" "SEQ-NG-I" "DNA" "peripheral blood" "CES" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 1 "{{screeningid}}" "{{geneid}}" "0000173362" "TIMP1" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 35 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000006849" "20" "50" "X" "49047325" "49047325" "subst" "0" "00037" "SYP_000002" "g.49047325A>G" "" "" "" "" "" "Germline" "" "" "" "" "" "g.49190868=" "" "VUS" "" "0000006850" "20" "50" "X" "49047619" "49047619" "subst" "0" "00037" "SYP_000005" "g.49047619T>C" "" "" "" "" "" "Germline" "" "" "" "" "" "g.49191162=" "" "VUS" "" "0000008919" "20" "50" "X" "49047325" "49047325" "subst" "0" "00037" "SYP_000002" "g.49047325A>G" "" "" "" "" "" "Germline" "" "" "" "" "" "g.49190868=" "" "VUS" "" "0000008920" "20" "50" "X" "49047619" "49047619" "subst" "0" "00037" "SYP_000005" "g.49047619T>C" "" "" "" "" "" "Germline" "" "" "" "" "" "g.49191162=" "" "VUS" "" "0000010960" "20" "50" "X" "49046950" "49046954" "del" "0" "00037" "SYP_000008" "g.49046950_49046954del" "" "" "" "" "" "Germline" "" "" "" "" "" "g.49190493_49190497del" "" "VUS" "" "0000314335" "0" "10" "X" "49054340" "49054340" "subst" "1.82616E-5" "02326" "SYP_000013" "g.49054340G>T" "" "" "" "SYP(NM_003179.2):c.103-42C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.49197881G>T" "" "benign" "" "0000314336" "0" "30" "X" "49047959" "49047959" "subst" "0.00124752" "02326" "SYP_000009" "g.49047959C>T" "" "" "" "SYP(NM_003179.2):c.877G>A (p.G293S, p.(Gly293Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.49191502C>T" "" "likely benign" "" "0000316166" "0" "30" "X" "49047959" "49047959" "subst" "0.00124752" "01943" "SYP_000009" "g.49047959C>T" "" "" "" "SYP(NM_003179.2):c.877G>A (p.G293S, p.(Gly293Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.49191502C>T" "" "likely benign" "" "0000334073" "0" "30" "X" "49047959" "49047959" "subst" "0.00124752" "01804" "SYP_000009" "g.49047959C>T" "" "" "" "SYP(NM_003179.2):c.877G>A (p.G293S, p.(Gly293Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.49191502C>T" "" "likely benign" "" "0000334074" "0" "50" "X" "49047968" "49047968" "subst" "0.00035396" "01804" "SYP_000010" "g.49047968C>A" "" "" "" "SYP(NM_003179.2):c.868G>T (p.(Gly290Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.49191511C>A" "" "VUS" "" "0000334075" "0" "50" "X" "49047992" "49047992" "subst" "0.000115396" "01804" "SYP_000011" "g.49047992C>A" "" "" "" "SYP(NM_003179.2):c.844G>T (p.A282S, p.(Ala282Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.49191535C>A" "" "VUS" "" "0000347752" "0" "50" "X" "49049888" "49049888" "subst" "0" "02327" "SYP_000014" "g.49049888C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.49193431C>T" "" "VUS" "" "0000393219" "1" "50" "X" "49050772" "49050772" "dup" "0" "00124" "SYP_000015" "g.49050772dup" "1/208 cases" "{PMID:Tarpey 2009:19377476}" "" "274dupA" "found once, nonrecurrent change" "Germline" "" "" "0" "" "" "g.49194315dup" "" "VUS" "" "0000576334" "0" "50" "X" "49048049" "49048049" "subst" "0" "01943" "SYP_000016" "g.49048049C>T" "" "" "" "SYP(NM_003179.2):c.787G>A (p.G263R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.49191592C>T" "" "VUS" "" "0000576335" "0" "10" "X" "49049751" "49049751" "subst" "0.000135457" "01943" "SYP_000017" "g.49049751G>A" "" "" "" "SYP(NM_003179.2):c.593C>T (p.T198I), SYP(NM_003179.3):c.593C>T (p.T198I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.49193294G>A" "" "benign" "" "0000576337" "0" "30" "X" "49049751" "49049751" "subst" "0.000135457" "02325" "SYP_000017" "g.49049751G>A" "" "" "" "SYP(NM_003179.2):c.593C>T (p.T198I), SYP(NM_003179.3):c.593C>T (p.T198I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.49193294G>A" "" "likely benign" "" "0000576338" "0" "50" "X" "49049751" "49049751" "subst" "0.000135457" "02329" "SYP_000017" "g.49049751G>A" "" "" "" "SYP(NM_003179.2):c.593C>T (p.T198I), SYP(NM_003179.3):c.593C>T (p.T198I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.49193294G>A" "" "VUS" "" "0000576340" "0" "30" "X" "49050734" "49050734" "subst" "0.000263429" "02326" "SYP_000019" "g.49050734G>A" "" "" "" "SYP(NM_003179.2):c.312C>T (p.A104=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.49194277G>A" "" "likely benign" "" "0000576341" "0" "50" "X" "49054268" "49054268" "subst" "0" "02329" "SYP_000020" "g.49054268C>T" "" "" "" "SYP(NM_003179.3):c.133G>A (p.G45S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.49197809C>T" "" "VUS" "" "0000624641" "0" "30" "X" "49050788" "49050788" "subst" "0" "01943" "SYP_000021" "g.49050788G>C" "" "" "" "SYP(NM_003179.2):c.258C>G (p.T86=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.49194331G>C" "" "likely benign" "" "0000659351" "0" "30" "X" "49048017" "49048017" "subst" "0" "01943" "SYP_000022" "g.49048017G>A" "" "" "" "SYP(NM_003179.2):c.819C>T (p.G273=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.49191560G>A" "" "likely benign" "" "0000693633" "0" "30" "X" "49047992" "49047992" "subst" "0.000115396" "01943" "SYP_000011" "g.49047992C>A" "" "" "" "SYP(NM_003179.2):c.844G>T (p.A282S, p.(Ala282Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000810467" "0" "30" "X" "49048212" "49048212" "subst" "9.06143E-5" "01943" "SYP_000023" "g.49048212G>A" "" "" "" "SYP(NM_003179.2):c.624C>T (p.G208=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000810468" "0" "70" "X" "49050784" "49050784" "subst" "0" "02327" "SYP_000024" "g.49050784G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000833352" "21" "90" "X" "49047959" "49047959" "subst" "0.00124752" "00006" "SYP_000009" "g.49047959C>T" "" "{PMID:Philips 2014:24721225}" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000842132" "0" "70" "X" "49048152" "49048152" "subst" "0" "03779" "SYP_000025" "g.49048152C>T" "" "" "" "" "" "CLASSIFICATION record" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000856667" "0" "30" "X" "49054302" "49054302" "subst" "5.85466E-5" "01943" "SYP_000027" "g.49054302G>A" "" "" "" "SYP(NM_003179.2):c.103-4C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000856668" "0" "50" "X" "49056641" "49056641" "subst" "0.00012131" "01943" "CACNA1F_000472" "g.49056641A>T" "" "" "" "SYP(NM_003179.2):c.5T>A (p.L2Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000867425" "0" "50" "X" "49048005" "49048005" "subst" "0" "01943" "SYP_000026" "g.49048005G>T" "" "" "" "SYP(NM_003179.2):c.831C>A (p.D277E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000896267" "0" "50" "X" "49048056" "49048076" "del" "0" "02325" "SYP_000028" "g.49048056_49048076del" "" "" "" "SYP(NM_003179.3):c.762_782delCTACGGGCAGGGCCCCGGCGG (p.Q257_G263del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000931428" "0" "50" "X" "49050679" "49050679" "subst" "5.60171E-6" "02325" "SYP_000029" "g.49050679C>T" "" "" "" "SYP(NM_003179.3):c.367G>A (p.A123T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000971140" "0" "50" "X" "49054277" "49054277" "subst" "0" "02325" "SYP_000030" "g.49054277C>A" "" "" "" "SYP(NM_003179.3):c.124G>T (p.A42S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001020088" "21" "70" "X" "49049764" "49049765" "del" "0" "03544" "SYP_000031" "g.49049764_49049765del" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.49193307_49193308del" "{CV:3393445}" "likely pathogenic" "ACMG" "0001044377" "0" "30" "X" "49041069" "49041069" "subst" "0.00189561" "01804" "SYP_000032" "g.49041069G>A" "" "" "" "PRICKLE3(NM_006150.5):c.128+9C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001057330" "0" "50" "X" "49061611" "49061611" "subst" "1.13338E-5" "01804" "CACNA1F_000531" "g.49061611C>T" "" "" "" "CACNA1F(NM_001256789.3):c.5887G>A (p.(Val1963Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes SYP ## Count = 35 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000006849" "00001045" "50" "946" "565" "946" "565" "c.*4+565T>C" "r.(=)" "p.(=)" "" "0000006850" "00001045" "50" "946" "271" "946" "271" "c.*4+271A>G" "r.(=)" "p.(=)" "" "0000008919" "00001045" "50" "946" "565" "946" "565" "c.*4+565T>C" "r.(=)" "p.(=)" "" "0000008920" "00001045" "50" "946" "271" "946" "271" "c.*4+271A>G" "r.(=)" "p.(=)" "" "0000010960" "00001045" "50" "946" "938" "946" "942" "c.*4+938_*4+942del" "r.(=)" "p.(=)" "" "0000314335" "00001045" "10" "103" "-42" "103" "-42" "c.103-42C>A" "r.(=)" "p.(=)" "" "0000314336" "00001045" "30" "877" "0" "877" "0" "c.877G>A" "r.(?)" "p.(Gly293Ser)" "" "0000316166" "00001045" "30" "877" "0" "877" "0" "c.877G>A" "r.(?)" "p.(Gly293Ser)" "" "0000334073" "00001045" "30" "877" "0" "877" "0" "c.877G>A" "r.(?)" "p.(Gly293Ser)" "" "0000334074" "00001045" "50" "868" "0" "868" "0" "c.868G>T" "r.(?)" "p.(Gly290Trp)" "" "0000334075" "00001045" "50" "844" "0" "844" "0" "c.844G>T" "r.(?)" "p.(Ala282Ser)" "" "0000347752" "00001045" "50" "456" "0" "456" "0" "c.456G>A" "r.(?)" "p.(Met152Ile)" "" "0000393219" "00001045" "50" "274" "0" "274" "0" "c.274dup" "r.(?)" "p.(Thr92Asnfs*45)" "" "0000576334" "00001045" "50" "787" "0" "787" "0" "c.787G>A" "r.(?)" "p.(Gly263Arg)" "" "0000576335" "00001045" "10" "593" "0" "593" "0" "c.593C>T" "r.(?)" "p.(Thr198Ile)" "" "0000576337" "00001045" "30" "593" "0" "593" "0" "c.593C>T" "r.(?)" "p.(Thr198Ile)" "" "0000576338" "00001045" "50" "593" "0" "593" "0" "c.593C>T" "r.(?)" "p.(Thr198Ile)" "" "0000576340" "00001045" "30" "312" "0" "312" "0" "c.312C>T" "r.(?)" "p.(Ala104=)" "" "0000576341" "00001045" "50" "133" "0" "133" "0" "c.133G>A" "r.(?)" "p.(Gly45Ser)" "" "0000624641" "00001045" "30" "258" "0" "258" "0" "c.258C>G" "r.(?)" "p.(Thr86=)" "" "0000659351" "00001045" "30" "819" "0" "819" "0" "c.819C>T" "r.(?)" "p.(Gly273=)" "" "0000693633" "00001045" "30" "844" "0" "844" "0" "c.844G>T" "r.(?)" "p.(Ala282Ser)" "" "0000810467" "00001045" "30" "624" "0" "624" "0" "c.624C>T" "r.(?)" "p.(Gly208=)" "" "0000810468" "00001045" "70" "262" "0" "262" "0" "c.262C>T" "r.(?)" "p.(Arg88*)" "" "0000833352" "00001045" "90" "877" "0" "877" "0" "c.877G>A" "r.(?)" "p.(Gly293Ser)" "" "0000842132" "00001045" "70" "684" "0" "684" "0" "c.684G>A" "r.(?)" "p.(Trp228Ter)" "" "0000856667" "00001045" "30" "103" "-4" "103" "-4" "c.103-4C>T" "r.spl?" "p.?" "" "0000856668" "00001045" "50" "5" "0" "5" "0" "c.5T>A" "r.(?)" "p.(Leu2Gln)" "" "0000867425" "00001045" "50" "831" "0" "831" "0" "c.831C>A" "r.(?)" "p.(Asp277Glu)" "" "0000896267" "00001045" "50" "762" "0" "782" "0" "c.762_782del" "r.(?)" "p.(Gln257_Gly263del)" "" "0000931428" "00001045" "50" "367" "0" "367" "0" "c.367G>A" "r.(?)" "p.(Ala123Thr)" "" "0000971140" "00001045" "50" "124" "0" "124" "0" "c.124G>T" "r.(?)" "p.(Ala42Ser)" "" "0001020088" "00001045" "70" "583" "0" "584" "0" "c.583_584del" "r.(?)" "p.(Asp195Profs*29)" "5" "0001044377" "00001045" "30" "5613" "0" "5613" "0" "c.*4671C>T" "r.(=)" "p.(=)" "" "0001057330" "00001045" "50" "-4966" "0" "-4966" "0" "c.-4966G>A" "r.(?)" "p.(=)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 8 "{{screeningid}}" "{{variantid}}" "0000000209" "0000006849" "0000000209" "0000006850" "0000000210" "0000008919" "0000000210" "0000008920" "0000000210" "0000010960" "0000173362" "0000393219" "0000400461" "0000833352" "0000461034" "0001020088"