### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = TAF1) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "TAF1" "TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa" "X" "q13.1" "unknown" "NG_012771.2" "UD_132084722342" "" "http://www.LOVD.nl/TAF1" "" "1" "11535" "6872" "313650" "1" "1" "1" "1" "Establishment of this LSDB was supported by the European Community\'s Seventh Framework Programme (FP7/2007-2013) under grant agreement No 200754 - the GEN2PHEN project." "" "g" "http://databases.lovd.nl/shared/refseq/TAF1_codingDNA.html" "1" "" "" "-1" "" "-1" "00000" "2009-03-06 00:00:00" "00006" "2015-12-06 11:50:09" "00000" "2025-05-05 21:14:00" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00000810" "TAF1" "transcript variant 1" "001" "NM_004606.3" "" "NP_004597.2" "" "" "" "-51" "7641" "5682" "70586114" "70685855" "00000" "2012-09-13 12:53:45" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 9 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00139" "ID" "intellectual disability (ID)" "" "" "" "" "" "00084" "2013-06-04 18:18:07" "00006" "2015-02-09 10:02:49" "00187" "MRX;IDX" "mental retardation, X-linked (MRX, intellectual disability (IDX))" "" "" "" "X-linked" "" "00006" "2013-09-05 15:56:47" "00006" "2018-12-18 09:23:21" "00533" "DYT3" "dystonia, torsion, X-linked, type 3 (DYT-3, Parkinsonism)" "XLR" "314250" "" "" "" "00006" "2014-09-21 21:17:28" "00006" "2021-12-10 21:51:32" "01157" "CHTE" "Hypothyroidism, central, testicular enlargement (CHTE)" "XLR" "300888" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "04214" "-" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00001" "2023-03-09 14:26:26" "05240" "MRXS33" "mental retardation, X-linked, syndromic, type 33 (MRXS-33)" "XLD" "" "" "" "" "00006" "2017-03-19 12:57:32" "00006" "2021-12-10 21:51:32" "05521" "seizures" "seizures" "" "" "" "" "" "00006" "2018-11-18 17:02:13" "" "" "06848" "MRXS33" "Mental retardation, X-linked, syndromic 33" "XLR" "300966" "" "" "" "00006" "2021-12-10 23:20:41" "" "" "06906" "DEE" "encephalopathy, developmental and epileptic" "" "" "" "" "" "00006" "2022-04-07 09:24:23" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 3 "{{geneid}}" "{{diseaseid}}" "TAF1" "00533" "TAF1" "05240" "TAF1" "06848" ## Individuals ## Do not remove or alter this header ## ## Count = 38 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00000208" "" "" "" "1" "" "00037" "{PMID:Sun 2011:23143598}, {DOI:Sun 2011:10.1038/ng.2453}" "" "M" "no" "Netherlands" "" "0" "" "" "" "" "00000209" "" "" "" "1" "" "00037" "{PMID:Sun 2011:23143598}, {DOI:Sun 2011:10.1038/ng.2453}" "" "M" "no" "Netherlands" "" "0" "" "" "" "" "00054900" "" "" "" "2" "" "00006" "{DOI:O\'Rawe 2015:10.1016/j.ajhg.2015.11.005}" "3-generation family, 2 affected brothers, unaffected heterozygous carrier mother" "M" "" "United States" ">15y" "0" "" "" "European" "" "00054901" "" "" "00054900" "1" "" "00006" "{DOI:O\'Rawe 2015:10.1016/j.ajhg.2015.11.005}" "brother of Fam1Pat1A" "M" "" "United States" ">13y" "0" "" "" "European" "" "00054902" "" "" "" "1" "" "00006" "{DOI:O\'Rawe 2015:10.1016/j.ajhg.2015.11.005}" "2-generation family, 1 affected" "M" "" "United States" ">5y" "0" "" "" "European" "" "00054903" "" "" "" "1" "" "00006" "{DOI:O\'Rawe 2015:10.1016/j.ajhg.2015.11.005}" "2-generation family, 1 affected" "M" "" "Netherlands" ">6y" "0" "" "" "European" "" "00054904" "" "" "" "1" "" "00006" "{DOI:O\'Rawe 2015:10.1016/j.ajhg.2015.11.005}" "2-generation family, 1 affected" "M" "" "United States" ">9y" "0" "" "" "European" "" "00054905" "" "" "" "1" "" "00006" "{DOI:O\'Rawe 2015:10.1016/j.ajhg.2015.11.005}" "2-generation family, 1 affected, unaffected heterozygous carrier mother" "M" "" "Ecuador" ">3y" "0" "" "" "" "" "00054906" "" "" "" "1" "" "00006" "{DOI:O\'Rawe 2015:10.1016/j.ajhg.2015.11.005}" "2-generation family, 1 affected" "M" "" "France" ">22y" "0" "" "" "European" "" "00054907" "" "" "" "1" "" "00006" "{DOI:O\'Rawe 2015:10.1016/j.ajhg.2015.11.005}" "2-generation family, 1 affected" "M" "" "United Kingdom (Great Britain)" ">11y" "0" "" "" "" "" "00054908" "" "" "" "3" "" "00006" "{DOI:O\'Rawe 2015:10.1016/j.ajhg.2015.11.005}" "2-generation family, 3 affected brothers, unaffected heterozygous carrier mother" "M" "" "Colombia" ">9y" "0" "" "" "" "" "00054909" "" "" "00054908" "1" "" "00006" "{DOI:O\'Rawe 2015:10.1016/j.ajhg.2015.11.005}" "2nd brother of Fam8Pat8A" "M" "" "Colombia" ">04y" "0" "" "" "" "" "00054910" "" "" "00054908" "1" "" "00006" "{DOI:O\'Rawe 2015:10.1016/j.ajhg.2015.11.005}" "brother of Fam8Pat8A" "M" "" "Colombia" ">11y" "0" "" "" "" "" "00054911" "" "" "" "1" "" "00006" "{DOI:O\'Rawe 2015:10.1016/j.ajhg.2015.11.005}" "2-generation family, 1 affected" "M" "" "Spain" "3y" "0" "" "" "" "" "00054912" "" "" "" "6" "" "00006" "{DOI:O\'Rawe 2015:10.1016/j.ajhg.2015.11.005}" "4-generation family, 6 affected, 5 unaffected heterozygous carrier females" "M" "" "Albania" ">16y" "0" "" "" "" "" "00054913" "" "" "" "1" "" "00006" "{DOI:O\'Rawe 2015:10.1016/j.ajhg.2015.11.005}" "2-generation family, 1 affected" "M" "" "Greece" "8y" "0" "" "" "" "" "00065219" "" "" "" "2" "" "01604" "{PMID:O\'Rawe 2016:26637982}, {DOI:O\'Rawe 2016:10.1016/j.ajhg.2015.11.005}" "3-generation family, 2 affected brothers, unaffected heterozygous carrier mother" "M" "no" "United States" ">15y" "0" "" "" "European" "26637982-Fam1PatA" "00065221" "" "" "00065219" "1" "" "01604" "{PMID:O\'Rawe 2016:26637982}, {DOI:O\'Rawe 2016:10.1016/j.ajhg.2015.11.005}" "Family, 2-affected brothers, 1B" "M" "no" "" ">13y" "0" "" "" "European" "26637982-Fam1PatB" "00065223" "" "" "" "1" "" "01604" "{PMID:O\'Rawe 2016:26637982}, {DOI:O\'Rawe 2016:10.1016/j.ajhg.2015.11.005}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "no" "" ">05y" "0" "" "" "European" "26637982-Fam2PatA" "00065224" "" "" "" "1" "" "01604" "{PMID:O\'Rawe 2016:26637982}, {DOI:O\'Rawe 2016:10.1016/j.ajhg.2015.11.005}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "no" "" ">06y" "0" "" "" "European" "26637982-Fam3PatA" "00065225" "" "" "" "1" "" "01604" "{PMID:O\'Rawe 2016:26637982}, {DOI:O\'Rawe 2016:10.1016/j.ajhg.2015.11.005}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "no" "" ">09y" "0" "" "" "European" "26637982-Fam4PatA" "00065227" "" "" "" "1" "" "01604" "{PMID:O\'Rawe 2016:26637982}, {DOI:O\'Rawe 2016:10.1016/j.ajhg.2015.11.005}" "2-generation family, 1 affected, unaffected heterozygous carrier mother" "M" "no" "Ecuador" ">03y" "0" "" "" "Ecuadorian" "26637982-Fam5PatA" "00065228" "" "" "" "1" "" "01604" "{PMID:O\'Rawe 2016:26637982}, {DOI:O\'Rawe 2016:10.1016/j.ajhg.2015.11.005}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "no" "" ">22y" "0" "" "" "European" "26637982-Fam6PatA" "00065229" "" "" "" "1" "" "01604" "{PMID:O\'Rawe 2016:26637982}, {DOI:O\'Rawe 2016:10.1016/j.ajhg.2015.11.005}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "no" "United Kingdom (Great Britain)" ">11y" "0" "" "" "British" "26637982-Fam7PatA" "00101203" "" "" "" "3" "" "00006" "{PMID:O\'Rawe 2016:26637982}, {DOI:O\'Rawe 2016:10.1016/j.ajhg.2015.11.005}" "2-generation family, 3 affected brothers, unaffected heterozygous carrier mother" "M" "no" "Colombia" "" "0" "" "" "" "26637982-Fam8PatA/B/C" "00101204" "" "" "" "1" "" "00006" "{PMID:O\'Rawe 2016:26637982}, {DOI:O\'Rawe 2016:10.1016/j.ajhg.2015.11.005}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "no" "Spain" "" "0" "" "" "Spanish" "26637982-Fam9PatA" "00101205" "" "" "" "5" "" "00006" "{PMID:O\'Rawe 2016:26637982}, {DOI:O\'Rawe 2016:10.1016/j.ajhg.2015.11.005}" "2-generation family, 5 affected males, unaffected heterozygous carrier mothers" "M" "no" "Albania" "" "0" "" "" "" "26637982-Fam10PatA" "00101206" "" "" "" "1" "" "00006" "{PMID:O\'Rawe 2016:26637982}, {DOI:O\'Rawe 2016:10.1016/j.ajhg.2015.11.005}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "no" "Greece" "" "0" "" "" "" "26637982-Fam11PatA" "00183188" "" "" "" "2" "" "00006" "{PMID:Hu 2016:25644381}" "family, 2 affected, 2 unaffected heterozygous carrier females" "M" "" "" "" "0" "" "" "" "25644381-FamN67" "00183189" "" "" "" "2" "" "00006" "{PMID:Hu 2016:25644381}" "family, 2 affected, 7 unaffected heterozygous carrier females" "M" "" "" "" "0" "" "" "" "25644381-FamD185" "00183665" "" "" "" "1" "" "00006" "{PMID:Martinez 2017:27620904}, {DOI:Martinez 2017:10.1136/jmedgenet-2017-103964}" "" "" "" "Spain" "" "0" "" "" "" "27620904-Pat10" "00334783" "" "" "" "6" "" "00000" "{PMID:Maranhao 2015:26352687}" "analysis 25 Pedigrees" "" "" "Pakistan" "" "0" "" "" "" "" "00334784" "" "" "" "7" "" "00000" "{PMID:Maranhao 2015:26352687}" "analysis 25 Pedigrees" "" "" "Pakistan" "" "0" "" "" "" "" "00361669" "" "" "" "1" "" "00006" "{PMID:Anazi 2017:27431290}" "familial" "M" "yes" "Saudi Arabia" "" "0" "" "" "" "15DG2406" "00387706" "" "" "" "3" "" "00006" "{PMID:Hu 2019:29302074}" "family, 3 affected individuals, third cousin parents" "" "yes" "Iran" "" "0" "" "" "Persia" "M040" "00431534" "" "" "" "1" "" "01164" "" "" "M" "?" "Turkey" "" "0" "" "" "" "213999" "00438618" "" "" "" "1" "" "00006" "{PMID:Hamdan 2017:29100083}" "WGS analysis 197 individuals with unexplained DEE (unaffected parents)" "" "" "Canada" "" "0" "" "pharmaco-resistant seizures" "" "HSC0091" "00453440" "" "" "" "1" "" "03544" "" "" "M" "-" "- (not applicable)" "" "" "" "" "white" "" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 38 "{{individualid}}" "{{diseaseid}}" "00000208" "01157" "00000209" "01157" "00054900" "00139" "00054901" "00139" "00054902" "00139" "00054903" "00139" "00054904" "00139" "00054905" "00139" "00054906" "00139" "00054907" "00139" "00054908" "00139" "00054909" "00139" "00054910" "00139" "00054911" "00139" "00054912" "00139" "00054913" "00139" "00065219" "00139" "00065221" "00139" "00065223" "00139" "00065224" "00139" "00065225" "00139" "00065227" "00139" "00065228" "00139" "00065229" "00139" "00101203" "00139" "00101204" "00139" "00101205" "00139" "00101206" "00139" "00183188" "00187" "00183189" "00187" "00183665" "00139" "00334783" "04214" "00334784" "04214" "00361669" "00139" "00387706" "00139" "00431534" "06848" "00438618" "06906" "00453440" "05521" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00139, 00187, 00533, 01157, 04214, 05240, 05521, 06848, 06906 ## Count = 33 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Birth/Gestational_age_wk}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "0000038983" "01157" "00000208" "00006" "Familial, X-linked recessive" "" "central hypothyroidism (FT4 0.50-0.99of lower limit normal), no prolactin deficiency, age sonographic determination testicular volume 17.64y, testicular volume right/left 21/20 (7.3–16ml)" "" "" "3w" "" "" "" "" "" "" "" "0000038984" "01157" "00000209" "00006" "Familial, X-linked recessive" "" "central hypothyroidism (FT4 0.50-0.99of lower limit normal), prolactin deficiency, age sonographic determination testicular volume 21.36y, testicular volume right/left 30/26 (8.5–18.3ml)" "" "" "07y04m" "" "" "" "" "" "" "" "0000041567" "00139" "00054900" "00006" "Familial, X-linked recessive" "15y" "intrauterine growth retardation (HP:0001511); postnatal growth retardation (HP:0008897); delayed gross motor development (HP:0002194); delayed speech and language development (HP:0000750); oral-pharyngeal dysphagia (HP:0200136); prominent supraorbital ridges (HP:0000336); downslanted palpebral fissures (HP:0000494); deeply-set eye (HP:0000490); prominent forehead (HP:0011220); sagging cheeks; long philtrum (HP:0000343); low-set ears (HP:0000369); protruding ear (HP:0000411); thickened helices (large earlobe HP:0009748); long face (HP:0000276); microretrognathia (HP:0000308); thin upper lip (thin upper lip vermilion HP:0000219); pointed chin (HP:0000307); depigmentation (depigmentation/hyperpigmentation of skin HP:0007483); hypertelorism (HP:0000316) (on the scalp); aplasia cutis congenita (HP:0001057); toenail dysplasia (HP:0100797); hearing impairment (HP:0000365) (mixed, HP:0000410); chromic otitis media (HP:0000389); strabismus (HP:0000486); nasolacrimal duct obstruction (HP:0000579); oculomotor dysfuntion (abnormality of eye movement HP:0000496); microcephaly (HP:0000252); mild ventriculomegaly (HP:0002119); hypoplasia of the corpus callosum (HP:0002079), posterior>anterior; hypoplasia of the cerebellar vermis (HP:0001320); deficiency of the septum pellucidum (abnormality of the septum pellucidum HP:0007375); deficiency of the falx cerebri; generalized hypotonia (HP:0001290); gait abnormalities (gait disturbance HP:0001288); balance problem (gait imbalance HP:0002141); diplegia (spastic diplegia HP:0001264); ataxia (HP:0001251); osteopenia (HP:0000938); unusual gluteal crease with sacral caudal remnant/sacral dimple (abnormal sacral segmentatino, HP:0008468), prominent protruding coccyx (HP:0008472); joint hypermobility (HP:0001382), metacarpophalangeal joint hyperextensibility (HP:0006099), hyperextensibility at wrists (HP:0005072); spasticity (HP:0001257), lower extremity (HP:0002061); kyphosis (HP:0002808); short neck (HP:0000470); autistic behaviors (HP:0000729); attention deficit hyperactivity disorder (HP:0007018); anxiety (HP:0000739); intellectual disability (HP:0001249); not present -HP:0000463, -HP:0000414, -HP:0000545, -HP:0000639, -HP:0000960, -HP:0000964, -HP:0001007, -HP:0001250, -HP:0001315, -HP:0001337, -HP:0002019, -HP:0002020, -HP:0002650, -HP:0004696, -HP:0006979, -HP:0011927; placenta deterioration, birth 40w, caesarian section (HP:0011410), weight 2210" "" "placenta deterioration, 40w, caesarian section (HP:0011410), weight 2210" "" "" "" "" "" "" "" "" "0000041568" "00139" "00054901" "00006" "Familial, X-linked recessive" "13y" "neonatal jaundice, poor feeding (HP:0011968); intrauterine growth retardation (HP:0001511); postnatal growth retardation (HP:0008897); delayed gross motor development (HP:0002194); delayed speech and language development (HP:0000750); oral-pharyngeal dysphagia (HP:0200136); prominent supraorbital ridges (HP:0000336); downslanted palpebral fissures (HP:0000494); deeply-set eye (HP:0000490); prominent forehead (HP:0011220); sagging cheeks; long philtrum (HP:0000343); low-set ears (HP:0000369); protruding ear (HP:0000411); thickened helices (large earlobe HP:0009748); long face (HP:0000276); microretrognathia (HP:0000308); thin upper lip (thin upper lip vermilion HP:0000219); pointed chin (HP:0000307); depigmentation (depigmentation/hyperpigmentation of skin HP:0007483); aplasia cutis congenita (HP:0001057); frequent dermatitis & eczema (eczema HP:0000964); toenail dysplasia (HP:0100797); hearing impairment (HP:0000365) (mixed, HP:0000410); chromic otitis media (HP:0000389); strabismus (HP:0000486); nasolacrimal duct obstruction (HP:0000579); oculomotor dysfuntion (abnormality of eye movement HP:0000496); constipation (HP:0002019); gastroesophageal reflux (HP:0002020); microcephaly (HP:0000252); mild ventriculomegaly (HP:0002119); hypoplasia of the corpus callosum (HP:0002079), posterior>anterior; hypoplasia of the cerebellar vermis (HP:0001320); deficiency of the septum pellucidum (abnormality of the septum pellucidum HP:0007375); deficiency of the falx cerebri; generalized hypotonia (HP:0001290); gait abnormalities (gait disturbance HP:0001288); balance problem (gait imbalance HP:0002141); ataxia (HP:0001251); sleep-wake cycle disturbance (HP:0006979); unusual gluteal crease with sacral caudal remnant/sacral dimple (abnormal sacral segmentatino, HP:0008468), prominent protruding coccyx (HP:0008472); finger joint hypermobility (HP:0001382), hyperextensibility at wrists (HP:0005072); hip dysplasia; spasticity (HP:0001257), lower extremity (HP:0002061); thoracic kyphosis (HP:0002942); scoliosis (HP:0002650); short neck (HP:0000470); H/O asthma (HP:0002099); (H/O murmur (HP:0030148) without cardiovascular abnormalities); autistic behaviors (HP:0000729); attention deficit hyperactivity disorder (HP:0007018); anxiety (HP:0000739); intellectual disability (HP:0001249); overlapped toes (HP:), genu balgum (HP:); not present -HP:0000463, -HP:0000316, -HP:0000414, -HP:0000545, -HP:0000639, -HP:0000960, -HP:0001007, -HP:0001250, -HP:0001264, -HP:0001315, -HP:0001337, -HP:0004696, -HP:0011927; placenta deterioration, birth 37w, caesarian section (HP:0011410), weight 1760" "" "placenta deterioration, 37w, caesarian section (HP:0011410), weight 1760" "" "" "" "" "" "" "" "" "0000041569" "00139" "00054902" "00006" "Isolated (sporadic)" "05y" "poor feedings requiring NG tube (Nasogastric tube feeding in infancy, HP:0011470); postnatal growth retardation (HP:0008897); delayed gross motor development (HP:0002194); delayed speech and language development (HP:0000750); oral-pharyngeal dysphagia (HP:0200136); (short) downslanted palpebral fissures (HP:0000494); prominent forehead (HP:0011220); smooth philtrum HP:0000319; low-set ears (HP:0000369), p osteriorly rotated (HP:0000358); protruding ear (HP:0000411); high arched palate (high palate HP:0000218); microretrognathia (HP:0000308); broad upturned nose (anteverted nares HP:0000463); bulbous nasal tip (bulbous nose HP:0000414); aplasia cutis congenita (HP:0001057); hearing impairment (HP:0000365), ensorineural H(P:0000407); chromic otitis media (HP:0000389); strabismus (HP:0000486); myopia (HP:0000545); nystagmus (HP:0000639); oculomotor dysfuntion (abnormality of eye movement HP:0000496); constipation (HP:0002019); microcephaly (HP:0000252); mild ventriculomegaly (HP:0002119); hypoplasia of the corpus callosum (HP:0002079), anterior>posterior; severehypoplasia of the cerebellar vermis (HP:0001320); deficiency of the falx cerebri; generalized hypotonia (HP:0001290); gait abnormalities (gait disturbance HP:0001288); unusual gluteal crease with sacral caudal remnant/sacral dimple (abnormal sacral segmentatino, HP:0008468), prominent protruding coccyx (HP:0008472); talipes cavus equinovarus (HP:0004696); short digit (HP:0011927); atrial septum defect (HP:0001631), aortic coarctation (HP:0001680); cryptorchidism (HP:0000028), vesicoureteral reflux (HP:0000076); autistic behaviors (HP:0000729); intellectual disability (HP:0001249); not present -HP:0000219, -HP:0000276, -HP:0000307, -HP:0000316, -HP:0000336, -HP:0000470, -HP:0000490, -HP:0000579, -HP:0000739, -HP:0000938, -HP:0000960, -HP:0000964, -HP:0001007, -HP:0001250, -HP:0001251, -HP:0001257, -HP:0001264, -HP:0001337, -HP:0001382, -HP:0001511, -HP:0002020, -HP:0002141, -HP:0002650, -HP:0002808, -HP:0006979, -HP:0007018, -HP:0007375, -HP:0007483, -HP:0009748, -HP:0100797; full term, caesarian section (HP:0011410), weight 2340, height 47" "" "full term, caesarian section (HP:0011410), weight 2340, height 47" "" "" "" "" "" "" "" "" "0000041570" "00139" "00054903" "00006" "Isolated (sporadic)" "06y" "first week no abnormalities. After weeks increasing probem but this was due to the weakness caused by his heart condition; postnatal growth retardation (HP:0008897); does not walk independently; no words; oral-pharyngeal dysphagia (HP:0200136); prominent supraorbital ridges (HP:0000336); long philtrum (HP:0000343); low-set ears (HP:0000369); protruding ear (HP:0000411); high arched palate (high palate HP:0000218); broad upturned nose (anteverted nares HP:0000463); bulbous nasal tip (bulbous nose HP:0000414); synophrys (HP:0000664); pigmented spots on hands; _; aplasia cutis congenita (HP:0001057); frequent dermatitis & eczema (eczema HP:0000964); toenail dysplasia (HP:0100797); hearing impairment (HP:0000365) (mixed, HP:0000410); strabismus (HP:0000486); myopia (HP:0000545); nystagmus (HP:0000639); oculomotor dysfuntion (abnormality of eye movement HP:0000496); microcephaly (HP:0000252); generalized hypotonia (HP:0001290); balance problem (gait imbalance HP:0002141); NL; unusual gluteal crease with sacral caudal remnant/sacral dimple (abnormal sacral segmentatino, HP:0008468), prominent protruding coccyx (HP:0008472); joint hypermobility (HP:0001382); talipes cavus equinovarus (HP:0004696); lumbar kyphosis (HP:0002808); frequent penumonia; AVSD, coarctation, aberrant pulomonal vene; intellectual disability (HP:0001249); N/A; neonatal tooth and abnormal enamel of primary dentition, not toilet trained; not present -HP:0000219, -HP:0000276, -HP:0000307, -HP:0000308, -HP:0000389, -HP:0000470, -HP:0000490, -HP:0000494, -HP:0000579, -HP:0000729, -HP:0000739, -HP:0000767, -HP:0000960, -HP:0001007, -HP:0001250, -HP:0001251, -HP:0001257, -HP:0001264, -HP:0001288, -HP:0001337, -HP:0001511, -HP:0002019, -HP:0002020, -HP:0002650, -HP:0005469, -HP:0006979, -HP:0007018, -HP:0008070, -HP:0009748, -HP:0011220, -HP:0011927; birth 42w, weight 2990" "" "42w, weight 2990" "" "" "" "" "" "" "" "" "0000041571" "00139" "00054904" "00006" "Isolated (sporadic)" "09y" "decelerations, resuscitation; postnatal growth retardation (HP:0008897); delayed gross motor development (HP:0002194); delayed speech and language development (HP:0000750); downslanted palpebral fissures (HP:0000494); deeply-set eye (HP:0000490); prominent forehead (HP:0011220); long philtrum (HP:0000343); low-set ears (HP:0000369); protruding ear (HP:0000411); bifid uvula; thin upper lip (thin upper lip vermilion HP:0000219); pointed chin (HP:0000307); broad upturned nose (anteverted nares HP:0000463); synophrys (HP:0000664); hypertelorism (HP:0000316); sacral dimple (HP:0000960); hirsutism (HP:0001007); chromic otitis media (HP:0000389); constipation (HP:0002019); gastroesophageal reflux (HP:0002020); microcephaly (HP:0000252); generalized hypotonia (HP:0001290); clubfeet; unusual gluteal crease with sacral caudal remnant/sacral dimple (abnormal sacral segmentatino, HP:0008468), prominent protruding coccyx (HP:0008472); talipes cavus equinovarus (HP:0004696); spasticity (HP:0001257); short digit (HP:0011927); short neck (HP:0000470); secundum ASD at birth, enlarged ascending aorta and MPA; intellectual disability (HP:0001249); low set nipples, short stature; not present -HP:0000389; post dates, birth 42w, weight 2840, height 50.8" "" "post dates, 42w, weight 2840, height 50.8" "" "" "" "" "" "" "" "" "0000041572" "00139" "00054905" "00006" "Isolated (sporadic)" "03y" "respiratory & feeding issues; postnatal growth retardation (HP:0008897); delayed gross motor development (HP:0002194); delayed speech and language development (HP:0000750); oral-pharyngeal dysphagia (HP:0200136); downslanted palpebral fissures (HP:0000494); deeply-set eye (HP:0000490); prominent forehead (HP:0011220); sagging cheeks; long philtrum (HP:0000343); low-set ears (HP:0000369); protruding ear (HP:0000411); thickened helices (large earlobe HP:0009748); long face (HP:0000276); high arched palate (high palate HP:0000218); pointed chin (HP:0000307); broad upturned nose (anteverted nares HP:0000463); bulbous nasal tip (bulbous nose HP:0000414); depigmentation (depigmentation/hyperpigmentation of skin HP:0007483); aplasia cutis congenita (HP:0001057); hearing impairment (HP:0000365); chromic otitis media (HP:0000389); strabismus (HP:0000486); mild ventriculomegaly (HP:0002119); cerebellar atrophy, decreased white matter (cerebral white matter atrophy HP:0012762); hypoplasia of the corpus callosum (HP:0002079), posterior>anterior; generalized hypotonia (HP:0001290); low deep tendon reflexes (reduced tendon reflexes) HP:0001315); N/A; unusual gluteal crease with sacral caudal remnant/sacral dimple (abnormal sacral segmentatino, HP:0008468), prominent protruding coccyx (HP:0008472); finger distal joint hypermobility (HP:0001382); thoracic case deformities; pectus excavatum (HP:0000767); frequent cough; cryptorchidism (HP:0000028); ptosis (HP:0000508), vertical talus (rocker bottom foot HP:0001838); not present -HP:0000219, -HP:0000252, -HP:0000308, -HP:0000316, -HP:0000336, -HP:0000470, -HP:0000496, -HP:0000579, -HP:0000639, -HP:0000664, -HP:0000960, -HP:0000964, -HP:0001007, -HP:0001250, -HP:0001251, -HP:0001264, -HP:0001320, -HP:0001337, -HP:0002019, -HP:0002020, -HP:0002141, -HP:0002650, -HP:0002808, -HP:0004696, -HP:0005469, -HP:0007375, -HP:0008070, -HP:0011927, -HP:0100797; nuchal cord (HP:0012498), birth 36w, caesarian section (HP:0011410), weight 2270" "" "nuchal cord (HP:0012498), 36w, caesarian section (HP:0011410), weight 2270" "" "" "" "" "" "" "" "" "0000041573" "00139" "00054906" "00006" "Isolated (sporadic)" "22y" "intrauterine growth retardation (HP:0001511); delayed gross motor development (HP:0002194); delayed speech and language development (HP:0000750); prominent supraorbital ridges (HP:0000336); downslanted palpebral fissures (HP:0000494); deeply-set eye (HP:0000490); low-set ears (HP:0000369); thickened helices (large earlobe HP:0009748); long face (HP:0000276); high arched palate (high palate HP:0000218); microretrognathia (HP:0000308); pointed chin (HP:0000307); depigmentation (depigmentation/hyperpigmentation of skin HP:0007483); strabismus (HP:0000486); myopia (HP:0000545); UK; UK; hypoplasia of the corpus callosum (HP:0002079), dysgenesis with periventricular nodular heterotopia; generalized hypotonia (HP:0001290); gait abnormalities (gait disturbance HP:0001288); balance problem (gait imbalance HP:0002141); ataxia (HP:0001251), mild; sleep-wake cycle disturbance (HP:0006979); unusual gluteal crease with sacral caudal remnant/sacral dimple (abnormal sacral segmentatino, HP:0008468), prominent protruding coccyx (HP:0008472); thoracic case deformities, major scoliosis requiring surgery; severe bradykinesia and flessum of large joints; scoliosis (HP:0002650), major scoliosis requiring surgery; short neck (HP:0000470); tracheotomy; autistic behaviors (HP:0000729), stereotypies; anxiety (HP:0000739); intellectual disability (HP:0001249); NA; periventricular nodular heterotopias, long and thin habitus with arachnodactyly, facial asymetria, rigidity; not present -HP:0000463, -HP:0000219, -HP:0000252, -HP:0000316, -HP:0000343, -HP:0000365, -HP:0000389, -HP:0000411, -HP:0000414, -HP:0000496, -HP:0000579, -HP:0000639, -HP:0000664, -HP:0000767, -HP:0000964, -HP:0001007, -HP:0001057, -HP:0001250, -HP:0001264, -HP:0001320, -HP:0001337, -HP:0001382, -HP:0002119, -HP:0002808, -HP:0004696, -HP:0005469, -HP:0007375, -HP:0008070, -HP:0008897, -HP:0011220, -HP:0011927, -HP:0100797; birth 41w, weight 2500, height 45, OFC 33.5" "" "41w, weight 2500, height 45, OFC 33.5" "" "" "" "" "" "" "" "" "0000041574" "00139" "00054907" "00006" "Isolated (sporadic)" "11y" "vomiting, failure to thrive, marked feeding problems, Gastroesophageal reflux; intrauterine growth retardation (HP:0001511); +walked 2y; delayed speech and language development (HP:0000750), 2-word phrases at 25mo but unclear; long philtrum (HP:0000343); thickened helices (large earlobe HP:0009748); vomiting, failure to thrive, marked feeding problems, Gastroesophageal reflux; broad upturned nose (anteverted nares HP:0000463); bulbous nasal tip (bulbous nose HP:0000414); flat occiput (HP:0005469); synophrys (HP:0000664); hypertelorism (HP:0000316); chromic otitis media (HP:0000389); pale skin; constipation (HP:0002019), ixed; gastroesophageal reflux (HP:0002020); microcephaly (HP:0000252); not now; + as baby unusual gluteal crease with sacral caudal remnant/sacral dimple (abnormal sacral segmentatino, HP:0008468), prominent protruding coccyx (HP:0008472), now resolved; toes short digit (HP:0011927); tracheolaryngomalacia, laser aryepiglottopexy; aberrant innominate artery, atrial septal defect; autistic behaviors (HP:0000729); anxiety (HP:0000739); intellectual disability (HP:0001249); N/A; marked sensory aversions, hyperacusis, narrow extrenal ear canals, fetal finger pads, hypoplastic nipples, delayed loss of primary dentition; not present -HP:0000486, -HP:0000218, -HP:0000276, -HP:0000307, -HP:0000308, -HP:0000336, -HP:0000365, -HP:0000369, -HP:0000411, -HP:0000470, -HP:0000490, -HP:0000494, -HP:0000496, -HP:0000545, -HP:0000579, -HP:0000639, -HP:0000767, -HP:0000960, -HP:0000964, -HP:0001007, -HP:0001057, -HP:0001250, -HP:0001251, -HP:0001257, -HP:0001264, -HP:0001315, -HP:0001337, -HP:0001382, -HP:0002141, -HP:0002650, -HP:0002808, -HP:0004696, -HP:0006979, -HP:0007018, -HP:0007483, -HP:0008070, -HP:0008897, -HP:0011220, -HP:0100797, -HP:0200136; none at delivery. Maternal SPD and morning sickness in pregnancy, 40w, weight 2530 (0.4), OFC 32.1 (0.4)" "" "none at delivery. Maternal SPD and morning sickness in pregnancy, 40w, weight 2530 (0.4), OFC 32.1 (0.4)" "" "" "" "" "" "" "" "" "0000041575" "00139" "00054908" "00006" "Familial, X-linked recessive" "09y" "seizures (4 hours after birth), lactic acidosis.; postnatal growth retardation (HP:0008897); delayed gross motor development (HP:0002194); delayed speech and language development (HP:0000750); oral-pharyngeal dysphagia (HP:0200136); prominent supraorbital ridges (HP:0000336); downslanted palpebral fissures (HP:0000494); prominent forehead (HP:0011220); sagging cheeks; long philtrum (HP:0000343); low-set ears (HP:0000369); protruding ear (HP:0000411); thickened helices (large earlobe HP:0009748); long face (HP:0000276); high arched palate (high palate HP:0000218); thin upper lip (thin upper lip vermilion HP:0000219); pointed chin (HP:0000307); broad upturned nose (anteverted nares HP:0000463); hypertelorism (HP:0000316); sacral dimple (HP:0000960); hirsutism (HP:0001007); frequent dermatitis & eczema (eczema HP:0000964); toenail dysplasia (HP:0100797); hearing impairment (HP:0000365); chromic otitis media (HP:0000389); strabismus (HP:0000486); constipation (HP:0002019); gastroesophageal reflux (HP:0002020); microcephaly (HP:0000252); cerebellar atrophy (low cerebral white matter volume); hypoplasia of the corpus callosum (HP:0002079); seizures (HP:0001250); generalized hypotonia (HP:0001290); non-ambulatory; sleep-wake cycle disturbance (HP:0006979); osteopenia (HP:0000938); unusual gluteal crease with sacral caudal remnant/sacral dimple (abnormal sacral segmentatino, HP:0008468), prominent protruding coccyx (HP:0008472); distal joint hypermobility (HP:0001382); kyphosis (HP:0002808); scoliosis (HP:0002650); short neck (HP:0000470); hydronephrosis; autistic behaviors (HP:0000729); intellectual disability (HP:0001249); not present -HP:0000490, -HP:0000496, -HP:0000579, -HP:0000739, -HP:0001057, -HP:0001251, -HP:0001257, -HP:0001264, -HP:0001511, -HP:0002119, -HP:0002141, -HP:0007018, -HP:0007375; birth 36w, caesarian section (HP:0011410), weight 4480 (1.85), height 52 (0.48), OFC 36.5 (1.02)" "" "36w, caesarian section (HP:0011410), weight 4480 (1.85), height 52 (0.48), OFC 36.5 (1.02)" "" "" "" "" "" "" "MRXS-33" "intellectual disability" "0000041576" "00139" "00054909" "00006" "Familial, X-linked recessive" "04y" "seizures (2 hours after birth), lactic acidosis.; postnatal growth retardation (HP:0008897); delayed gross motor development (HP:0002194); delayed speech and language development (HP:0000750); oral-pharyngeal dysphagia (HP:0200136); prominent supraorbital ridges (HP:0000336); downslanted palpebral fissures (HP:0000494); prominent forehead (HP:0011220); sagging cheeks; long philtrum (HP:0000343); low-set ears (HP:0000369); protruding ear (HP:0000411); thickened helices (large earlobe HP:0009748); long face (HP:0000276); high arched palate (high palate HP:0000218); thin upper lip (thin upper lip vermilion HP:0000219); pointed chin (HP:0000307); broad upturned nose (anteverted nares HP:0000463); hypertelorism (HP:0000316); hirsutism (HP:0001007); frequent dermatitis & eczema (eczema HP:0000964); toenail dysplasia (HP:0100797); hearing impairment (HP:0000365); chromic otitis media (HP:0000389); constipation (HP:0002019); gastroesophageal reflux (HP:0002020); microcephaly (HP:0000252); cerebellar atrophy (low cerebral white matter volume); hypoplasia of the corpus callosum (HP:0002079); seizures (HP:0001250); generalized hypotonia (HP:0001290); non-ambulatory; sleep-wake cycle disturbance (HP:0006979); osteopenia (HP:0000938); unusual gluteal crease with sacral caudal remnant/sacral dimple (abnormal sacral segmentatino, HP:0008468), prominent protruding coccyx (HP:0008472); distal joint hypermobility (HP:0001382); kyphosis (HP:0002808); scoliosis (HP:0002650); short neck (HP:0000470); hydronephrosis; autistic behaviors (HP:0000729); intellectual disability (HP:0001249); not present -HP:0000486, -HP:0000490, -HP:0000496, -HP:0000579, -HP:0000739, -HP:0000960, -HP:0001057, -HP:0001251, -HP:0001257, -HP:0001264, -HP:0001511, -HP:0002119, -HP:0002141, -HP:0007018, -HP:0007375; oligohydramnios, birth 37w, weight 3000 (-1.16), height 49 (-1.02), OFC 33 (-1.73)" "" "oligohydramnios, 37w, weight 3000 (-1.16), height 49 (-1.02), OFC 33 (-1.73)" "" "" "" "" "" "" "" "" "0000041577" "00139" "00054910" "00006" "Familial, X-linked recessive" "11y" "seizures (24 hours after birth), lactic acidosis, hypoglycemia.; postnatal growth retardation (HP:0008897); delayed gross motor development (HP:0002194); delayed speech and language development (HP:0000750); oral-pharyngeal dysphagia (HP:0200136); prominent supraorbital ridges (HP:0000336); downslanted palpebral fissures (HP:0000494); deeply-set eye (HP:0000490); prominent forehead (HP:0011220); sagging cheeks; long philtrum (HP:0000343); low-set ears (HP:0000369); protruding ear (HP:0000411); thickened helices (large earlobe HP:0009748); long face (HP:0000276); high arched palate (high palate HP:0000218); thin upper lip (thin upper lip vermilion HP:0000219); pointed chin (HP:0000307); broad upturned nose (anteverted nares HP:0000463); hypertelorism (HP:0000316); sacral dimple (HP:0000960); hirsutism (HP:0001007); frequent dermatitis & eczema (eczema HP:0000964); toenail dysplasia (HP:0100797); hearing impairment (HP:0000365); chromic otitis media (HP:0000389); constipation (HP:0002019); gastroesophageal reflux (HP:0002020); microcephaly (HP:0000252); cerebellar atrophy (low cerebral white matter volume); hypoplasia of the corpus callosum (HP:0002079); seizures (HP:0001250); generalized hypotonia (HP:0001290); non-ambulatory; sleep-wake cycle disturbance (HP:0006979); osteopenia (HP:0000938); unusual gluteal crease with sacral caudal remnant/sacral dimple (abnormal sacral segmentatino, HP:0008468), prominent protruding coccyx (HP:0008472); distal joint hypermobility (HP:0001382); kyphosis (HP:0002808); scoliosis (HP:0002650); short neck (HP:0000470); autistic behaviors (HP:0000729); intellectual disability (HP:0001249); not present -HP:0000486, -HP:0000496, -HP:0000579, -HP:0000739, -HP:0001057, -HP:0001251, -HP:0001257, -HP:0001264, -HP:0001511, -HP:0002119, -HP:0002141, -HP:0007018, -HP:0007375; oligohydramnios, birth 37w, weight 3530 (-0.049), height 50.5 (-0.27), OFC 33 (-1.73)" "" "oligohydramnios, 37w, weight 3530 (-0.049), height 50.5 (-0.27), OFC 33 (-1.73)" "" "" "" "" "" "" "" "" "0000041578" "00139" "00054911" "00006" "Isolated (sporadic)" "03y" "low birth weight (small for gestational age HP:0001518); intrauterine growth retardation (HP:0001511); postnatal growth retardation (HP:0008897); delayed gross motor development (HP:0002194); N/A; prominent supraorbital ridges (HP:0000336); sagging cheeks; long philtrum (HP:0000343); low-set ears (HP:0000369); long face (HP:0000276); high arched palate (high palate HP:0000218); microretrognathia (HP:0000308); broad upturned nose (anteverted nares HP:0000463); bulbous nasal tip (bulbous nose HP:0000414); synophrys (HP:0000664); sparse hair (HP:0008070); depigmentation (depigmentation/hyperpigmentation of skin HP:0007483); aplasia cutis congenita (HP:0001057); hirsutism (HP:0001007); toenail dysplasia (HP:0100797),f ragile nails (HP:0001808); strabismus (HP:0000486); pseudoalbinism; constipation (HP:0002019); microcephaly (HP:0000252); hypoplasia of the corpus callosum (HP:0002079), dffuse; deficiency of the falx cerebri; generalized hypotonia (HP:0001290, axial), infantile axial hypotonia (HP:0009062); N/A; N/A; N/A; unusual gluteal crease with sacral caudal remnant/sacral dimple (abnormal sacral segmentatino, HP:0008468), prominent protruding coccyx (HP:0008472); joint hypermobility (HP:0001382); thoracic case deformities; spasticity (HP:0001257); pectus excavatum (HP:0000767); scoliosis (HP:0002650); short neck (HP:0000470); atrial septal defect (HP:0001631), aortic coarctation (HP:0001680), pulmonary hypertension (HP:0002092).; cryptorchidism (HP:0000028); intellectual disability (HP:0001249); 3y-dies from respiratory failure (HP:0004887) caused by pulmonary infection; not present -HP:0000219, -HP:0000307, -HP:0000316, -HP:0000365, -HP:0000389, -HP:0000411, -HP:0000490, -HP:0000494, -HP:0000639, -HP:0000729, -HP:0000739, -HP:0000960, -HP:0000964, -HP:0001250, -HP:0001320, -HP:0001337, -HP:0002020, -HP:0002119, -HP:0002808, -HP:0004696, -HP:0005469, -HP:0006979, -HP:0007018, -HP:0007375, -HP:0009748, -HP:0011220, -HP:0011927; increased nuchal translucency (HP:0010880), 37w, weight 1690g (<3rd), height 45 (10-25th), OFC 28 (<3rd)" "" "increased nuchal translucency (HP:0010880), 37w, weight 1690g (<3rd), height 45 (10-25th), OFC 28 (<3rd)" "" "" "" "" "" "" "" "" "0000041579" "00139" "00054912" "00006" "Isolated (sporadic)" "16y" "delayed gross motor development (HP:0002194); delayed speech and language development (HP:0000750); oral-pharyngeal dysphagia (HP:0200136); prominent supraorbital ridges (HP:0000336); downslanted palpebral fissures (HP:0000494); deeply-set eye (HP:0000490); sagging cheeks; long face (HP:0000276); high arched palate (high palate HP:0000218); thin upper lip (thin upper lip vermilion HP:0000219); pointed chin (HP:0000307); bulbous nasal tip (bulbous nose HP:0000414); strabismus (HP:0000486); myopia (HP:0000545); mild ventriculomegaly (HP:0002119); cerebellar atrophy; hypoplasia of the cerebellar vermis (HP:0001320); low deep tendon reflexes (reduced tendon reflexes) HP:0001315); gait abnormalities (gait disturbance HP:0001288); balance problem (gait imbalance HP:0002141); diplegia (spastic diplegia HP:0001264); autistic behaviors (HP:0000729); attention deficit hyperactivity disorder (HP:0007018); anxiety (HP:0000739); intellectual disability (HP:0001249); N/A; brain: periventricular white matter gliosis; not present -HP:0000463, -HP:0000252, -HP:0000308, -HP:0000316, -HP:0000343, -HP:0000369, -HP:0000411, -HP:0000470, -HP:0000639, -HP:0000664, -HP:0000767, -HP:0001007, -HP:0001057, -HP:0001250, -HP:0001257, -HP:0001290, -HP:0001337, -HP:0001382, -HP:0001511, -HP:0002650, -HP:0002808, -HP:0004696, -HP:0007375, -HP:0007483, -HP:0008070, -HP:0009748, -HP:0011220, -HP:0011927; full term, weight 2850 (<10th)" "" "full term, weight 2850 (<10th)" "" "" "" "" "" "" "" "" "0000041580" "00139" "00054913" "00006" "Isolated (sporadic)" "08y" "neonatal jaundice; postnatal growth retardation (HP:0008897); delayed gross motor development (HP:0002194); delayed speech and language development (HP:0000750); oral-pharyngeal dysphagia (HP:0200136); prominent supraorbital ridges (HP:0000336); deeply-set eye (HP:0000490); sagging cheeks; low-set ears (HP:0000369); protruding ear (HP:0000411); long face (HP:0000276); high arched palate (high palate HP:0000218); pointed chin (HP:0000307); broad upturned nose (anteverted nares HP:0000463); mild ventriculomegaly (HP:0002119); cerebellar atrophy; tremor (HP:0001337); generalized hypotonia (HP:0001290), postural; low deep tendon reflexes (reduced tendon reflexes) HP:0001315); non-ambulatory; diplegia (spastic diplegia HP:0001264); thoracic case deformities; spasticity (HP:0001257); kyphosis (HP:0002808); scoliosis (HP:0002650); autistic behaviors (HP:0000729); intellectual disability (HP:0001249); 8y-dies from infection, cardiopulmonary insufficiency; not present -HP:0000486, -HP:0000219, -HP:0000252, -HP:0000308, -HP:0000316, -HP:0000343, -HP:0000365, -HP:0000389, -HP:0000414, -HP:0000470, -HP:0000496, -HP:0000545, -HP:0000579, -HP:0000639, -HP:0000664, -HP:0000767, -HP:0000938, -HP:0001007, -HP:0001057, -HP:0001250, -HP:0001251, -HP:0001511, -HP:0002079, -HP:0005469, -HP:0007375, -HP:0007483, -HP:0008070, -HP:0008472, -HP:0009748, -HP:0011927, -HP:0100797; umbilical cord entrapment (abnormality of the umbilical cord HP:0010881), birth 38w, caesarian section (HP:0011410), weight 2830 (10th), height 49 (25th), OFC 34 (25th)" "" "umbilical cord entrapment (abnormality of the umbilical cord HP:0010881), 38w, caesarian section (HP:0011410), weight 2830 (10th), height 49 (25th), OFC 34 (25th)" "" "" "" "" "" "" "" "" "0000051326" "00139" "00065219" "01604" "Familial, X-linked" "" "Postnatal growth retardation (HP:0008897), Delayed gross motor development (HP:0002194), Delayed speech and language development (HP:0000750), Oral-pharyngeal dysphagia (HP:0200136), Prominent supraorbital ridges (HP:0000336), Downslanted palpebral fissures (HP:0000494), Sagging cheeks (HP:?), Long philtrum (HP:0000343), Low-set ears (HP:0000369), Protruding ears (HP:0000411), Long face (HP:0000276), Pointed chin (HP:0000307), No anteverted nares (-HP:0000463), Hearing impairment (HP:0000365), Chromic otitis media (HP:0000389), Strabismus (HP:0000486), Microcephaly (HP:0000252), Hypoplasia of the corpus callosum (HP:0002079), Generalized hypotonia (HP:0001290), Unusual gluteal crease with sacral caudal remnant and sacral dimple (abnormal sacral segmentation [HP:0008468] and prominent protruding coccyx [HP:0008472]), Joint hypermobility (HP:0001382), Autistic behaviors (HP:0000729), Intellectual disability (HP:0001249); intellectual disability (HP:0001249); global developmental delay (HP:0001263); speech delay (HP:0000750)" "" "" "" "" "" "" "" "" "" "" "0000051328" "00139" "00065221" "01604" "Familial, X-linked" "" "Postnatal growth retardation (HP:0008897), Delayed gross motor development (HP:0002194), Delayed speech and language development (HP:0000750), Oral-pharyngeal dysphagia (HP:0200136), Prominent supraorbital ridges (HP:0000336), Downslanted palpebral fissures (HP:0000494), Sagging cheeks (HP:?), Long philtrum (HP:0000343), Low-set ears (HP:0000369), Protruding ears (HP:0000411), Long face (HP:0000276), Pointed chin (HP:0000307), no anteverted nares (-HP:0000463), Hearing impairment (HP:0000365), Chromic otitis media (HP:0000389), Strabismus (HP:0000486), Microcephaly (HP:0000252), Hypoplasia of the corpus callosum (HP:0002079), Generalized hypotonia (HP:0001290), Unusual gluteal crease with sacral caudal remnant and sacral dimple (abnormal sacral segmentation [HP:0008468] and prominent protruding coccyx [HP:0008472]), Joint hypermobility (HP:0001382), Autistic behaviors (HP:0000729), Intellectual disability (HP:0001249); intellectual disability (HP:0001249); global developmental delay (HP:0001263); speech delay (HP:0000750)" "" "" "" "" "" "" "" "" "" "" "0000051329" "00139" "00065223" "01604" "Familial, X-linked" "" "Postnatal growth retardation (HP:0008897), Delayed gross motor development (HP:0002194), Delayed speech and language development (HP:0000750), Oral-pharyngeal dysphagia (HP:0200136), No prominent supraorbital ridges (-HP:0000336), Downslanted palpebral fissures (HP:0000494), No sagging cheeks (-HP:?), Long philtrum (HP:0000343), Low-set ears (HP:0000369), Protruding ears (HP:0000411), No long face (-HP:0000276), High palate (HP:0000218), No pointed chin (-HP:0000307), Anteverted nares (HP:0000463), Hearing impairment (HP:0000365), Chromic otitis media (HP:0000389), Strabismus (HP:0000486), Microcephaly (HP:0000252), Hypoplasia of the corpus callosum (HP:0002079), Generalized hypotonia (HP:0001290), Unusual gluteal crease with sacral caudal remnant and sacral dimple (abnormal sacral segmentation [HP:0008468] and prominent protruding coccyx [HP:0008472]), No joint hypermobility (-HP:0001382), Autistic behaviors (HP:0000729), Intellectual disability (HP:0001249); intellectual disability (HP:0001249); global developmental delay (HP:0001263); speech delay (HP:0000750)" "" "" "" "" "" "" "" "" "" "" "0000051331" "00139" "00065224" "01604" "Familial, X-linked" "" "Postnatal growth retardation (HP:0008897), Delayed gross motor development (HP:0002194), Delayed speech and language development (HP:0000750), Oral-pharyngeal dysphagia (HP:0200136), Prominent supraorbital ridges (HP:0000336), No downslanted palpebral fissures (-HP:0000494), No sagging cheeks (-HP:?), Long philtrum (HP:0000343), Low-set ears (HP:0000369), Protruding ears (HP:0000411), No long face (-HP:0000276), High palate (HP:0000218), No pointed chin (-HP:0000307), Anteverted nares (HP:0000463), Hearing impairment (HP:0000365), No chromic otitis media (-HP:0000389), Strabismus (HP:0000486), Microcephaly (HP:0000252), Generalized hypotonia (HP:0001290), Unusual gluteal crease with sacral caudal remnant and sacral dimple (abnormal sacral segmentation [HP:0008468] and prominent protruding coccyx [HP:0008472]), No joint hypermobility (HP:0001382), Autistic behaviors (HP:0000729), Intellectual disability (HP:0001249); intellectual disability (HP:0001249); global developmental delay (HP:0001263); speech delay (HP:0000750)" "" "" "" "" "" "" "" "" "" "" "0000051336" "00139" "00065229" "01604" "Familial, X-linked" "" "No postnatal growth retardation (-HP:0008897), Delayed gross motor development (HP:0002194), Delayed speech and language development (HP:0000750), No oral-pharyngeal dysphagia (-HP:0200136), No prominent supraorbital ridges (-HP:0000336), No downslanted palpebral fissures (-HP:0000494), No sagging cheeks (-HP:?), Long philtrum (HP:0000343), No low-set ears (-HP:0000369), No protruding ears (-HP:0000411), No long face (-HP:0000276), No high palate (-HP:0000218), No pointed chin (-HP:0000307), Anteverted nares (HP:0000463), No hearing impairment (-HP:0000365), Chromic otitis media (HP:0000389), No strabismus (-HP:0000486), Microcephaly (HP:0000252), No generalized hypotonia (-HP:0001290), Unusual gluteal crease with sacral caudal remnant and sacral dimple (abnormal sacral segmentation [HP:0008468] and prominent protruding coccyx [HP:0008472]), No joint hypermobility (-HP:0001382), Autistic behaviors (HP:0000729), Intellectual disability (HP:0001249); intellectual disability (HP:0001249); global developmental delay (HP:0001263); speech delay (HP:0000750)" "" "" "" "" "" "" "" "" "" "" "0000079441" "00139" "00101203" "00006" "Familial, X-linked" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "0000079442" "00139" "00101204" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "0000079443" "00139" "00101205" "00006" "Familial, X-linked recessive" "" "see paper; ..., prominent supraorbital ridges, down-slanted palpebral fissures, sagging cheeks, long face, high palate, pointed chin" "" "" "" "" "" "" "" "" "" "" "0000079444" "00139" "00101206" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "0000143942" "00187" "00183188" "00006" "Familial, X-linked recessive" "" "mild to severe ID, facial features" "" "" "" "" "" "" "" "" "" "mental retardation" "0000143943" "00187" "00183189" "00006" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "mental retardation" "0000144351" "00139" "00183665" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "MRXS-33" "intellectual disability" "0000257074" "00139" "00361669" "00006" "Familial" "3y6m" "syndromic; global developmental delay, small for age, dysmorphism, strabismus, hypotonia, kyphosis" "" "" "" "" "" "" "" "" "" "intellectual disability" "0000281274" "00139" "00387706" "00006" "Familial, autosomal recessive" "" "syndromic intellectual disability, no microcephaly" "" "" "" "" "" "" "" "" "" "intellectual disability" "0000322104" "06848" "00431534" "01164" "Unknown" "06y" "Coloboma, Microcephaly, Pendular nystagmus, Delayed speech and language development, Autistic behavior" "" "" "" "" "" "" "" "" "" "" "0000328521" "06906" "00438618" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "developmental and epileptic encephalopathy" "0000342104" "05521" "00453440" "03544" "Isolated (sporadic)" "" "HP: 0001250), HP:0011097, HP:0002376" "" "" "" "" "" "" "" "" "MRXS33" "" ## Screenings ## Do not remove or alter this header ## ## Count = 38 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000000209" "00000208" "1" "00037" "00001" "2012-09-13 12:02:03" "" "" "SEQ-NG-I" "DNA" "" "" "0000000210" "00000209" "1" "00037" "00001" "2012-09-13 12:09:36" "" "" "SEQ-NG-I" "DNA" "" "" "0000054853" "00054900" "1" "00006" "00006" "2015-12-07 12:50:28" "" "" "SEQ" "DNA" "" "" "0000054854" "00054901" "1" "00006" "00006" "2015-12-07 12:50:28" "" "" "SEQ" "DNA" "" "" "0000054855" "00054902" "1" "00006" "00006" "2015-12-07 12:50:28" "" "" "SEQ" "DNA" "" "" "0000054856" "00054903" "1" "00006" "00006" "2015-12-07 12:50:28" "" "" "SEQ" "DNA" "" "" "0000054857" "00054904" "1" "00006" "00006" "2015-12-07 12:50:28" "" "" "SEQ" "DNA" "" "" "0000054858" "00054905" "1" "00006" "00006" "2015-12-07 12:50:28" "" "" "SEQ" "DNA" "" "" "0000054859" "00054906" "1" "00006" "00006" "2015-12-07 12:50:28" "" "" "SEQ" "DNA" "" "" "0000054860" "00054907" "1" "00006" "00006" "2015-12-07 12:50:28" "" "" "SEQ" "DNA" "" "" "0000054861" "00054908" "1" "00006" "00006" "2015-12-07 12:50:28" "00006" "2018-04-10 22:13:34" "SEQ;SEQ-NG" "DNA" "" "WES" "0000054862" "00054909" "1" "00006" "00006" "2015-12-07 12:50:28" "" "" "SEQ" "DNA" "" "" "0000054863" "00054910" "1" "00006" "00006" "2015-12-07 12:50:28" "" "" "SEQ" "DNA" "" "" "0000054864" "00054911" "1" "00006" "00006" "2015-12-07 12:50:28" "" "" "SEQ" "DNA" "" "" "0000054865" "00054912" "1" "00006" "00006" "2015-12-07 12:50:28" "00006" "2015-12-09 10:16:40" "arraySNP" "DNA" "" "" "0000054866" "00054913" "1" "00006" "00006" "2015-12-07 12:50:28" "" "" "SEQ" "DNA" "" "" "0000065372" "00065219" "1" "01604" "01604" "2016-05-23 13:52:42" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000065373" "00065221" "1" "01604" "01604" "2016-05-23 14:04:06" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000065374" "00065223" "1" "01604" "01604" "2016-05-23 14:09:13" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000065376" "00065224" "1" "01604" "01604" "2016-05-23 14:13:56" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000065377" "00065225" "1" "01604" "01604" "2016-05-23 14:20:18" "" "" "DGGE;SEQ;SEQ-NG" "DNA" "" "" "0000065378" "00065227" "1" "01604" "01604" "2016-05-23 14:23:36" "00006" "2017-03-19 13:31:00" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "" "" "0000065379" "00065228" "1" "01604" "01604" "2016-05-23 14:29:28" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000065381" "00065229" "1" "01604" "01604" "2016-05-23 14:34:28" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000101626" "00101203" "1" "00006" "00006" "2017-03-19 13:37:26" "" "" "SEQ" "DNA" "" "" "0000101627" "00101204" "1" "00006" "00006" "2017-03-19 14:25:50" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000101628" "00101205" "1" "00006" "00006" "2017-03-19 15:37:56" "" "" "arraySNP;SEQ" "DNA" "" "" "0000101629" "00101206" "1" "00006" "00006" "2017-03-19 15:41:57" "" "" "arraySNP;SEQ" "DNA" "" "" "0000184146" "00183188" "1" "00006" "00006" "2018-10-14 12:07:53" "" "" "SEQ;SEQ-NG" "DNA" "" "WES-X chromosome" "0000184147" "00183189" "1" "00006" "00006" "2018-10-14 12:07:53" "" "" "SEQ;SEQ-NG" "DNA" "" "WES-X chromosome" "0000184633" "00183665" "1" "00006" "00006" "2018-10-27 10:06:27" "" "" "SEQ;SEQ-NG" "DNA" "" "1256 gene panel" "0000336012" "00334783" "1" "00000" "00006" "2021-03-01 16:58:55" "" "" "SEQ-NG" "DNA" "" "WES" "0000336013" "00334784" "1" "00000" "00006" "2021-03-01 16:58:55" "" "" "SEQ-NG" "DNA" "" "WES" "0000362897" "00361669" "1" "00006" "00006" "2021-04-07 19:07:03" "" "" "SEQ-NG" "DNA" "" "WES" "0000388937" "00387706" "1" "00006" "00006" "2021-10-31 12:02:46" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000432949" "00431534" "1" "01164" "01164" "2023-02-14 10:47:10" "" "" "SEQ-NG-I" "DNA" "" "" "0000440100" "00438618" "1" "00006" "00006" "2023-10-21 19:20:17" "" "" "SEQ;SEQ-NG" "DNA" "" "WGS" "0000455054" "00453440" "1" "03544" "03544" "2024-08-28 08:57:45" "" "" "SEQ-NG-I" "DNA" "peripheral blood" "CES" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 33 "{{screeningid}}" "{{geneid}}" "0000054853" "TAF1" "0000054854" "TAF1" "0000054855" "TAF1" "0000054856" "TAF1" "0000054857" "TAF1" "0000054858" "TAF1" "0000054859" "TAF1" "0000054860" "TAF1" "0000054861" "TAF1" "0000054862" "TAF1" "0000054863" "TAF1" "0000054864" "TAF1" "0000054865" "KANSL1" "0000054865" "TAF1" "0000054866" "TAF1" "0000065372" "TAF1" "0000065373" "TAF1" "0000065374" "TAF1" "0000065376" "TAF1" "0000065377" "TAF1" "0000065378" "TAF1" "0000065379" "TAF1" "0000065381" "TAF1" "0000101626" "TAF1" "0000101627" "TAF1" "0000101628" "TAF1" "0000101629" "TAF1" "0000184146" "TAF1" "0000184147" "TAF1" "0000184633" "TAF1" "0000362897" "TAF1" "0000388937" "TAF1" "0000432949" "TAF1" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 158 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000002008" "0" "50" "X" "70618209" "70618209" "dup" "0" "00037" "TAF1_000010" "g.70618209dup" "" "" "" "" "" "Germline" "" "" "" "" "" "g.71398359dup" "" "VUS" "" "0000002009" "0" "50" "X" "70626783" "70626783" "dup" "0" "00037" "TAF1_000011" "g.70626783dup" "" "" "" "" "" "Germline" "" "" "" "" "" "g.71406933dup" "" "VUS" "" "0000003042" "0" "50" "X" "70594925" "70594925" "del" "0" "00037" "TAF1_000015" "g.70594925del" "" "" "" "" "" "Germline" "" "" "" "" "" "g.71375075del" "" "VUS" "" "0000003043" "0" "50" "X" "70598955" "70598956" "del" "0" "00037" "TAF1_000013" "g.70598955_70598956del" "" "" "" "" "" "Germline" "" "" "" "" "" "g.71379105_71379106del" "" "VUS" "" "0000003044" "0" "50" "X" "70598955" "70598955" "del" "0" "00037" "TAF1_000012" "g.70598955del" "" "" "" "" "" "Germline" "" "" "" "" "" "g.71379105del" "" "VUS" "" "0000003045" "0" "50" "X" "70618209" "70618209" "dup" "0" "00037" "TAF1_000017" "g.70618209dup" "" "" "" "" "" "Germline" "" "" "" "" "" "g.71398359dup" "" "VUS" "" "0000007139" "20" "30" "X" "70617443" "70617443" "subst" "0" "00037" "TAF1_000009" "g.70617443A>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.71397593A>G" "" "likely benign" "" "0000009227" "0" "30" "X" "70594941" "70594941" "dup" "0" "00037" "TAF1_000008" "g.70594941dup" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.71375091dup" "" "likely benign" "" "0000009228" "20" "30" "X" "70617443" "70617443" "subst" "0" "00037" "TAF1_000009" "g.70617443A>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.71397593A>G" "" "likely benign" "" "0000011027" "0" "50" "X" "70594925" "70594925" "del" "0" "00037" "TAF1_000015" "g.70594925del" "" "" "" "" "" "Germline" "" "" "" "" "" "g.71375075del" "" "VUS" "" "0000011028" "0" "50" "X" "70609368" "70609368" "del" "0" "00037" "TAF1_000014" "g.70609368del" "" "" "" "" "" "Germline" "" "" "" "" "" "g.71389518del" "" "VUS" "" "0000084876" "21" "90" "X" "70621541" "70621541" "subst" "0" "00006" "TAF1_000016" "g.70621541T>C" "" "{DOI:O\'Rawe 2015:10.1016/j.ajhg.2015.11.005}" "" "" "" "Germline" "yes" "" "0" "" "" "g.71401691T>C" "" "pathogenic" "" "0000084877" "21" "90" "X" "70621541" "70621541" "subst" "0" "00006" "TAF1_000016" "g.70621541T>C" "" "{DOI:O\'Rawe 2015:10.1016/j.ajhg.2015.11.005}" "" "" "" "Germline" "yes" "" "0" "" "" "g.71401691T>C" "" "pathogenic" "" "0000084878" "0" "90" "X" "70607243" "70607243" "subst" "0" "00006" "TAF1_000018" "g.70607243T>C" "" "{DOI:O\'Rawe 2015:10.1016/j.ajhg.2015.11.005}" "" "" "" "De novo" "" "" "0" "" "" "g.71387393T>C" "" "pathogenic" "" "0000084879" "0" "90" "X" "70618477" "70618477" "subst" "0" "00006" "TAF1_000019" "g.70618477C>T" "" "{DOI:O\'Rawe 2015:10.1016/j.ajhg.2015.11.005}" "" "" "" "De novo" "" "" "0" "" "" "g.71398627C>T" "" "pathogenic" "" "0000084880" "0" "90" "X" "70601686" "70601686" "subst" "0" "00006" "TAF1_000020" "g.70601686T>A" "" "{DOI:O\'Rawe 2015:10.1016/j.ajhg.2015.11.005}" "" "" "" "De novo" "" "" "0" "" "" "g.71381836T>A" "" "pathogenic" "" "0000084881" "21" "90" "X" "70618449" "70618449" "subst" "0" "00006" "TAF1_000021" "g.70618449A>G" "" "{DOI:O\'Rawe 2015:10.1016/j.ajhg.2015.11.005}" "" "" "" "Germline" "" "" "0" "" "" "g.71398599A>G" "" "pathogenic" "" "0000084882" "0" "90" "X" "70643048" "70643048" "subst" "0" "00006" "TAF1_000022" "g.70643048A>C" "" "{DOI:O\'Rawe 2015:10.1016/j.ajhg.2015.11.005}" "" "4594A>C" "Variant Error [EREF/EREF]: This genomic variant does not match the reference sequence; the transcript variant does not match the reference sequence either. Please fix this entry and then remove this message." "De novo" "" "" "0" "" "" "" "" "pathogenic" "" "0000084883" "0" "90" "X" "70627912" "70627912" "subst" "0" "00006" "TAF1_000023" "g.70627912G>A" "" "{DOI:O\'Rawe 2015:10.1016/j.ajhg.2015.11.005}" "" "p.(Arg1431His)" "" "De novo" "" "" "0" "" "" "g.71408062G>A" "" "pathogenic" "" "0000084884" "21" "90" "X" "70602671" "70602671" "subst" "0" "00006" "TAF1_000024" "g.70602671C>T" "" "{DOI:O\'Rawe 2015:10.1016/j.ajhg.2015.11.005}" "" "" "" "Germline" "yes" "" "0" "" "" "g.71382821C>T" "" "pathogenic" "" "0000084885" "21" "90" "X" "70602671" "70602671" "subst" "0" "00006" "TAF1_000024" "g.70602671C>T" "" "{DOI:O\'Rawe 2015:10.1016/j.ajhg.2015.11.005}" "" "" "" "Germline" "yes" "" "0" "" "" "g.71382821C>T" "" "pathogenic" "" "0000084886" "21" "90" "X" "70602671" "70602671" "subst" "0" "00006" "TAF1_000024" "g.70602671C>T" "" "{DOI:O\'Rawe 2015:10.1016/j.ajhg.2015.11.005}" "" "" "" "Germline" "yes" "" "0" "" "" "g.71382821C>T" "" "pathogenic" "" "0000084887" "0" "90" "X" "70612503" "70612503" "subst" "0" "00006" "TAF1_000025" "g.70612503G>C" "" "{DOI:O\'Rawe 2015:10.1016/j.ajhg.2015.11.005}" "" "" "" "De novo" "" "" "0" "" "" "g.71392653G>C" "" "pathogenic" "" "0000086460" "21" "70" "X" "70370794" "70794385" "" "0" "00006" "TAF1_000000" "g.(70365000_70370794)_(70794385_70799000)dup" "" "{DOI:O\'Rawe 2015:10.1016/j.ajhg.2015.11.005}" "" "" "0.423 Mb duplication containing TAF1" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000086463" "0" "70" "X" "70287519" "70711110" "" "0" "00006" "TAF1_000000" "g.(70285000_70287519)_(70711110_70712000)dup" "" "{DOI:O\'Rawe 2015:10.1016/j.ajhg.2015.11.005}" "" "" "0.42 Mb duplication incl. NLGN3, GJB1, TAF1" "De novo" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000097048" "21" "90" "X" "70621541" "70621541" "subst" "0" "01604" "TAF1_000016" "g.70621541T>C" "" "{PMID:O\'Rawe 2016:26637982}, {DOI:O\'Rawe 2016:10.1016/j.ajhg.2015.11.005}" "" "" "" "Germline" "yes" "" "0" "" "" "g.71401691T>C" "" "pathogenic" "" "0000097049" "21" "90" "X" "70621541" "70621541" "subst" "0" "01604" "TAF1_000016" "g.70621541T>C" "" "{PMID:O\'Rawe 2016:26637982}, {DOI:O\'Rawe 2016:10.1016/j.ajhg.2015.11.005}" "" "" "" "Germline" "yes" "" "0" "" "" "g.71401691T>C" "" "pathogenic" "" "0000097051" "1" "90" "X" "70618477" "70618477" "subst" "0" "01604" "TAF1_000019" "g.70618477C>T" "" "{PMID:O\'Rawe 2016:26637982}, {DOI:O\'Rawe 2016:10.1016/j.ajhg.2015.11.005}" "" "" "" "De novo" "-" "" "0" "" "" "g.71398627C>T" "" "pathogenic" "" "0000164203" "0" "90" "X" "70607243" "70607243" "subst" "0" "00006" "TAF1_000018" "g.70607243T>C" "" "{PMID:O\'Rawe 2016:26637982}, {DOI:O\'Rawe 2016:10.1016/j.ajhg.2015.11.005}" "" "" "" "De novo" "-" "" "0" "" "" "g.71387393T>C" "" "pathogenic" "" "0000164204" "0" "90" "X" "70601686" "70601686" "subst" "0" "00006" "TAF1_000020" "g.70601686T>A" "" "{PMID:O\'Rawe 2016:26637982}, {DOI:O\'Rawe 2016:10.1016/j.ajhg.2015.11.005}" "" "" "" "De novo" "-" "" "0" "" "" "g.71381836T>A" "" "pathogenic" "" "0000164205" "0" "90" "X" "70643003" "70643003" "subst" "0" "00006" "TAF1_000026" "g.70643003A>C" "" "{PMID:O\'Rawe 2016:26637982}, {DOI:O\'Rawe 2016:10.1016/j.ajhg.2015.11.005}" "" "" "" "De novo" "-" "" "0" "" "" "g.71423153A>C" "" "pathogenic" "" "0000164206" "21" "90" "X" "70618449" "70618449" "subst" "0" "00006" "TAF1_000021" "g.70618449A>G" "" "{PMID:O\'Rawe 2016:26637982}, {DOI:O\'Rawe 2016:10.1016/j.ajhg.2015.11.005}" "" "" "" "Germline" "yes" "" "0" "" "" "g.71398599A>G" "" "pathogenic" "" "0000164207" "0" "90" "X" "70627912" "70627912" "subst" "0" "00006" "TAF1_000023" "g.70627912G>A" "" "{PMID:O\'Rawe 2016:26637982}, {DOI:O\'Rawe 2016:10.1016/j.ajhg.2015.11.005}" "" "" "" "Germline" "-" "" "0" "" "" "g.71408062G>A" "" "pathogenic" "" "0000164208" "21" "90" "X" "70602671" "70602671" "subst" "0" "00006" "TAF1_000024" "g.70602671C>T" "" "{PMID:O\'Rawe 2016:26637982}, {DOI:O\'Rawe 2016:10.1016/j.ajhg.2015.11.005}" "" "" "" "Germline" "yes" "" "0" "" "" "g.71382821C>T" "" "pathogenic" "" "0000164209" "0" "90" "X" "70612503" "70612503" "subst" "0" "00006" "TAF1_000025" "g.70612503G>C" "" "{PMID:O\'Rawe 2016:26637982}, {DOI:O\'Rawe 2016:10.1016/j.ajhg.2015.11.005}" "" "" "" "De novo" "-" "" "0" "" "" "g.71392653G>C" "" "pathogenic" "" "0000164210" "21" "90" "X" "70370794" "70794385" "" "0" "00006" "TAF1_000027" "g.(?_70370794)_(70794385_?)dup" "" "{PMID:O\'Rawe 2016:26637982}, {DOI:O\'Rawe 2016:10.1016/j.ajhg.2015.11.005}" "" "" "duplication includes NLGN3, GJB1, ZMYM3, NONO, and TAF1 genes" "Germline" "yes" "" "0" "" "arr Xq13.1(70,370,794-70,794,385)x2" "" "" "pathogenic" "" "0000164211" "0" "90" "X" "70287519" "70711110" "" "0" "00006" "TAF1_000027" "g.(?_70287519)_(70711110_?)dup" "" "{PMID:O\'Rawe 2016:26637982}, {DOI:O\'Rawe 2016:10.1016/j.ajhg.2015.11.005}" "" "" "duplication includes NLGN3, GJB1, SNX12, FOXO4, MED12, ZMY3, NONO and TAF1 genes" "De novo" "-" "" "0" "" "arr Xq13.1(70,287,519–70,711,110)x2" "" "" "pathogenic" "" "0000249415" "0" "30" "X" "70598123" "70598123" "subst" "0.000179049" "02325" "TAF1_000038" "g.70598123A>G" "" "" "" "TAF1(NM_004606.5):c.972A>G (p.Q324=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.71378273A>G" "" "likely benign" "" "0000249442" "0" "30" "X" "70598283" "70598283" "subst" "0" "02325" "TAF1_000039" "g.70598283A>T" "" "" "" "TAF1(NM_004606.5):c.1132A>T (p.I378L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.71378433A>T" "" "likely benign" "" "0000249590" "0" "30" "X" "70674016" "70674016" "subst" "0.000215836" "02325" "TAF1_000054" "g.70674016A>G" "" "" "" "TAF1(NM_001286074.1):c.4814-4A>G, TAF1(NM_001286074.2):c.4754-4A>G, TAF1(NM_004606.3):c.4814-4A>G (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.71454166A>G" "" "likely benign" "" "0000254378" "0" "30" "X" "70602447" "70602447" "subst" "1.12174E-5" "01943" "TAF1_000043" "g.70602447A>G" "" "" "" "TAF1(NM_001286074.1):c.1659A>G (p.E553=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.71382597A>G" "" "likely benign" "" "0000254909" "0" "30" "X" "70597568" "70597568" "subst" "0.000252099" "01943" "TAF1_000033" "g.70597568A>T" "" "" "" "TAF1(NM_001286074.1):c.890A>T (p.Q297L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.71377718A>T" "" "likely benign" "" "0000255139" "0" "30" "X" "70601663" "70601663" "subst" "0.00103273" "01943" "TAF1_000041" "g.70601663A>G" "" "" "" "TAF1(NM_001286074.1):c.1491A>G (p.V497=), TAF1(NM_001286074.2):c.1431A>G (p.V477=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.71381813A>G" "" "likely benign" "" "0000256309" "0" "50" "X" "70586225" "70586225" "subst" "0" "01943" "TAF1_000029" "g.70586225A>G" "" "" "" "TAF1(NM_004606.4):c.61A>G (p.M21V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.71366375A>G" "" "VUS" "" "0000311689" "0" "50" "X" "70586321" "70586321" "subst" "5.95185E-6" "02325" "TAF1_000030" "g.70586321G>C" "" "" "" "TAF1(NM_001286074.2):c.97G>C (p.E33Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.71366471G>C" "" "VUS" "" "0000311690" "0" "30" "X" "70608706" "70608706" "subst" "0.000473418" "02325" "TAF1_000044" "g.70608706G>A" "" "" "" "TAF1(NM_001286074.1):c.2748G>A (p.E916=), TAF1(NM_004606.5):c.2688G>A (p.E896=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.71388856G>A" "" "likely benign" "" "0000311691" "0" "10" "X" "70586196" "70586196" "subst" "0.00189809" "02325" "TAF1_000028" "g.70586196C>T" "" "" "" "TAF1(NM_001286074.1):c.32C>T (p.T11I), TAF1(NM_001286074.2):c.-29C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.71366346C>T" "" "benign" "" "0000311692" "0" "30" "X" "70627910" "70627910" "subst" "1.11876E-5" "02325" "TAF1_000050" "g.70627910C>A" "" "" "" "TAF1(NM_001286074.1):c.4353C>A (p.L1451=), TAF1(NM_004606.5):c.4293C>A (p.L1431=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.71408060C>A" "" "likely benign" "" "0000311693" "0" "30" "X" "70642954" "70642954" "subst" "0.0001289" "02325" "TAF1_000051" "g.70642954T>C" "" "" "" "TAF1(NM_004606.5):c.4453-13T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.71423104T>C" "" "likely benign" "" "0000311694" "0" "30" "X" "70644043" "70644043" "subst" "0.00184256" "02325" "TAF1_000053" "g.70644043C>T" "" "" "" "TAF1(NM_001286074.1):c.4768C>T (p.L1590=), TAF1(NM_004606.5):c.4708C>T (p.L1570=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.71424193C>T" "" "likely benign" "" "0000311695" "0" "10" "X" "70597631" "70597631" "subst" "0.0032165" "02325" "TAF1_000036" "g.70597631C>G" "" "" "" "TAF1(NM_001286074.2):c.893C>G (p.A298G), TAF1(NM_004606.5):c.893C>G (p.(Ala298Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.71377781C>G" "" "benign" "" "0000311696" "0" "30" "X" "70598069" "70598071" "del" "0" "02325" "TAF1_000037" "g.70598069_70598071del" "" "" "" "TAF1(NM_004606.5):c.934-16_934-14delCTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.71378219_71378221del" "" "likely benign" "" "0000316188" "0" "30" "X" "70598871" "70598871" "subst" "0.000330985" "01943" "TAF1_000040" "g.70598871T>C" "" "" "" "TAF1(NM_001286074.1):c.1410T>C (p.N470=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.71379021T>C" "" "likely benign" "" "0000316189" "0" "50" "X" "70587371" "70587371" "subst" "0.000156771" "01943" "TAF1_000031" "g.70587371G>A" "" "" "" "TAF1(NM_001286074.1):c.203G>A (p.G68D), TAF1(NM_004606.5):c.143G>A (p.G48D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.71367521G>A" "" "VUS" "" "0000316190" "0" "30" "X" "70613146" "70613146" "subst" "3.06769E-5" "01943" "TAF1_000045" "g.70613146C>T" "" "" "" "TAF1(NM_001286074.1):c.3112-5C>T, TAF1(NM_004606.5):c.3052-5C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.71393296C>T" "" "likely benign" "" "0000316191" "0" "30" "X" "70613911" "70613911" "subst" "0.000512324" "01943" "TAF1_000046" "g.70613911T>C" "" "" "" "TAF1(NM_001286074.1):c.3288-6T>C, TAF1(NM_001286074.2):c.3228-6T>C, TAF1(NM_004606.5):c.3228-6T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.71394061T>C" "" "likely benign" "" "0000316192" "0" "30" "X" "70614016" "70614016" "subst" "0.000111964" "01943" "TAF1_000047" "g.70614016G>A" "" "" "" "TAF1(NM_001286074.1):c.3387G>A (p.L1129=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.71394166G>A" "" "likely benign" "" "0000316193" "0" "30" "X" "70621416" "70621416" "subst" "0.00245557" "01943" "TAF1_000048" "g.70621416G>A" "" "" "" "TAF1(NM_004606.4):c.3885G>A (p.R1295=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.71401566G>A" "" "likely benign" "" "0000316194" "0" "30" "X" "70621470" "70621470" "subst" "3.35619E-5" "01943" "TAF1_000049" "g.70621470T>C" "" "" "" "TAF1(NM_004606.4):c.3939T>C (p.P1313=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.71401620T>C" "" "likely benign" "" "0000316195" "0" "30" "X" "70643035" "70643035" "subst" "0.00014542" "01943" "TAF1_000052" "g.70643035G>A" "" "" "" "TAF1(NM_001286074.1):c.4581G>A (p.A1527=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.71423185G>A" "" "likely benign" "" "0000316196" "0" "30" "X" "70680484" "70680484" "subst" "4.53412E-5" "01943" "TAF1_000055" "g.70680484C>T" "" "" "" "TAF1(NM_001286074.1):c.5296C>T (p.L1766=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.71460634C>T" "" "likely benign" "" "0000316197" "0" "10" "X" "70597546" "70597546" "subst" "0.0624503" "01943" "TAF1_000032" "g.70597546C>G" "" "" "" "TAF1(NM_004606.4):c.868C>G (p.L290V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.71377696C>G" "" "benign" "" "0000316198" "0" "30" "X" "70597614" "70597614" "subst" "0" "01943" "TAF1_000034" "g.70597614G>C" "" "" "" "TAF1(NM_001286074.1):c.936G>C (p.L312F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.71377764G>C" "" "likely benign" "" "0000316199" "0" "30" "X" "70597629" "70597629" "subst" "0.000253771" "01943" "TAF1_000035" "g.70597629C>T" "" "" "" "TAF1(NM_004606.4):c.951C>T (p.Y317=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.71377779C>T" "" "likely benign" "" "0000334587" "0" "50" "X" "70601760" "70601760" "subst" "0" "01804" "TAF1_000042" "g.70601760C>A" "" "" "" "TAF1(NM_004606.3):c.1588C>A (p.(Leu530Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.71381910C>A" "" "VUS" "" "0000341815" "0" "50" "X" "70618477" "70618477" "subst" "0" "02327" "TAF1_000019" "g.70618477C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.71398627C>T" "" "VUS" "" "0000341874" "0" "70" "X" "70626501" "70626501" "subst" "0" "02327" "TAF1_000057" "g.70626501C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.71406651C>T" "" "likely pathogenic" "" "0000347318" "0" "70" "X" "70607306" "70607306" "subst" "0" "02327" "TAF1_000056" "g.70607306C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.71387456C>G" "" "likely pathogenic" "" "0000408115" "21" "70" "X" "70601649" "70601649" "subst" "5.70982E-6" "00006" "TAF1_000059" "g.70601649A>G" "" "{PMID:Hu 2016:25644381}" "" "Asn493Asp" "" "Germline" "yes" "" "0" "" "" "g.71381799A>G" "" "likely pathogenic (recessive)" "" "0000408116" "21" "70" "X" "70617204" "70617204" "subst" "0" "00006" "TAF1_000058" "g.70617204C>T" "" "{PMID:Hu 2016:25644381}" "" "Arg1190Cys" "" "Germline" "yes" "" "0" "" "" "g.71397354C>T" "" "likely pathogenic (recessive)" "" "0000408756" "0" "90" "X" "70612503" "70612503" "subst" "0" "00006" "TAF1_000025" "g.70612503G>C" "" "{PMID:Martinez 2017:27620904}, {DOI:Martinez 2017:10.1136/jmedgenet-2017-103964}" "" "" "" "De novo" "" "" "0" "" "" "g.71392653G>C" "" "pathogenic (dominant)" "" "0000577290" "0" "30" "X" "70586193" "70586217" "dup" "0" "01943" "TAF1_000060" "g.70586193_70586217dup" "" "" "" "TAF1(NM_001286074.1):c.29_53dupGGACAGCAGCTACCATCACTGCTGC (p.A19Dfs*50)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.71366343_71366367dup" "" "likely benign" "" "0000577291" "0" "10" "X" "70586196" "70586196" "subst" "0.00189809" "01943" "TAF1_000028" "g.70586196C>T" "" "" "" "TAF1(NM_001286074.1):c.32C>T (p.T11I), TAF1(NM_001286074.2):c.-29C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.71366346C>T" "" "benign" "" "0000577293" "0" "30" "X" "70586311" "70586311" "subst" "0.00445193" "01943" "TAF1_000061" "g.70586311C>G" "" "" "" "TAF1(NM_001286074.1):c.147C>G (p.A49=), TAF1(NM_001286074.2):c.87C>G (p.A29=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.71366461C>G" "" "likely benign" "" "0000577294" "0" "30" "X" "70586311" "70586311" "subst" "0.00445193" "02329" "TAF1_000061" "g.70586311C>G" "" "" "" "TAF1(NM_001286074.1):c.147C>G (p.A49=), TAF1(NM_001286074.2):c.87C>G (p.A29=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.71366461C>G" "" "likely benign" "" "0000577295" "0" "50" "X" "70587360" "70587360" "subst" "0" "02327" "TAF1_000062" "g.70587360G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.71367510G>C" "" "VUS" "" "0000577296" "0" "30" "X" "70587965" "70587965" "subst" "0.000391582" "01943" "TAF1_000063" "g.70587965T>C" "" "" "" "TAF1(NM_001286074.1):c.357T>C (p.D119=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.71368115T>C" "" "likely benign" "" "0000577297" "0" "30" "X" "70595132" "70595132" "subst" "0" "01943" "TAF1_000064" "g.70595132T>A" "" "" "" "TAF1(NM_001286074.1):c.528T>A (p.T176=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.71375282T>A" "" "likely benign" "" "0000577299" "0" "30" "X" "70597580" "70597580" "subst" "0.000128727" "01943" "TAF1_000066" "g.70597580G>C" "" "" "" "TAF1(NM_001286074.1):c.902G>C (p.C301S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.71377730G>C" "" "likely benign" "" "0000577300" "0" "50" "X" "70598297" "70598297" "subst" "0" "01804" "TAF1_000067" "g.70598297G>T" "" "" "" "TAF1(NM_004606.3):c.1206G>T (p.(Met402Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.71378447G>T" "" "VUS" "" "0000577301" "0" "50" "X" "70598728" "70598728" "subst" "0" "02327" "TAF1_000068" "g.70598728T>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.71378878T>G" "" "VUS" "" "0000577303" "0" "30" "X" "70601705" "70601705" "subst" "0.0146532" "02329" "TAF1_000069" "g.70601705C>G" "" "" "" "TAF1(NM_001286074.2):c.1473C>G (p.A491=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.71381855C>G" "" "likely benign" "" "0000577304" "0" "50" "X" "70607258" "70607258" "subst" "0" "02327" "TAF1_000070" "g.70607258G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.71387408G>A" "" "VUS" "" "0000577305" "0" "50" "X" "70607289" "70607289" "subst" "6.15278E-5" "01943" "TAF1_000071" "g.70607289C>T" "" "" "" "TAF1(NM_001286074.1):c.2465C>T (p.T822M), TAF1(NM_004606.5):c.2405C>T (p.T802M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.71387439C>T" "" "VUS" "" "0000577306" "0" "30" "X" "70608706" "70608706" "subst" "0.000473418" "01943" "TAF1_000044" "g.70608706G>A" "" "" "" "TAF1(NM_001286074.1):c.2748G>A (p.E916=), TAF1(NM_004606.5):c.2688G>A (p.E896=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.71388856G>A" "" "likely benign" "" "0000577307" "0" "30" "X" "70613189" "70613189" "subst" "8.02196E-5" "01943" "TAF1_000072" "g.70613189G>A" "" "" "" "TAF1(NM_001286074.1):c.3150G>A (p.V1050=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.71393339G>A" "" "likely benign" "" "0000577309" "0" "50" "X" "70617240" "70617240" "subst" "0" "02327" "TAF1_000074" "g.70617240C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.71397390C>T" "" "VUS" "" "0000577310" "0" "50" "X" "70626532" "70626532" "subst" "0" "02325" "TAF1_000075" "g.70626532A>C" "" "" "" "TAF1(NM_001286074.2):c.4043A>C (p.K1348T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.71406682A>C" "" "VUS" "" "0000577311" "0" "70" "X" "70627998" "70627998" "subst" "0" "01804" "TAF1_000076" "g.70627998A>G" "" "" "" "TAF1(NM_004606.3):c.4441A>G (p.(Asn1481Asp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.71408148A>G" "" "likely pathogenic" "" "0000577312" "0" "30" "X" "70644098" "70644098" "del" "0" "01804" "TAF1_000077" "g.70644098del" "" "" "" "TAF1(NM_004606.3):c.4813+8delT (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.71424248del" "" "likely benign" "" "0000577313" "0" "30" "X" "70674016" "70674016" "subst" "0.000215836" "01943" "TAF1_000054" "g.70674016A>G" "" "" "" "TAF1(NM_001286074.1):c.4814-4A>G, TAF1(NM_001286074.2):c.4754-4A>G, TAF1(NM_004606.3):c.4814-4A>G (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.71454166A>G" "" "likely benign" "" "0000577314" "0" "30" "X" "70674016" "70674016" "subst" "0.000215836" "01804" "TAF1_000054" "g.70674016A>G" "" "" "" "TAF1(NM_001286074.1):c.4814-4A>G, TAF1(NM_001286074.2):c.4754-4A>G, TAF1(NM_004606.3):c.4814-4A>G (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.71454166A>G" "" "likely benign" "" "0000577315" "0" "50" "X" "70674038" "70674038" "subst" "0" "02329" "TAF1_000078" "g.70674038C>T" "" "" "" "TAF1(NM_001286074.1):c.4832C>T (p.T1611I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.71454188C>T" "" "VUS" "" "0000577316" "0" "50" "X" "70683768" "70683768" "subst" "0" "01943" "TAF1_000079" "g.70683768G>A" "" "" "" "TAF1(NM_001286074.1):c.5560G>A (p.D1854N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.71463918G>A" "" "VUS" "" "0000577317" "0" "50" "X" "70683779" "70683781" "del" "0" "01943" "TAF1_000080" "g.70683779_70683781del" "" "" "" "TAF1(NM_001286074.1):c.5571_5573delGGA (p.E1859del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.71463929_71463931del" "" "VUS" "" "0000619850" "0" "30" "X" "70597571" "70597573" "dup" "0" "01804" "TAF1_000082" "g.70597571_70597573dup" "" "" "" "TAF1(NM_004606.3):c.889_890insAGG (p.(Gln297_Glu298insGlu)), TAF1(NM_004606.5):c.833_835dupAGG (p.E278dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.71377721_71377723dup" "" "likely benign" "" "0000619851" "0" "30" "X" "70597584" "70597584" "subst" "0" "01943" "TAF1_000083" "g.70597584A>C" "" "" "" "TAF1(NM_001286074.1):c.906A>C (p.S302=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.71377734A>C" "" "likely benign" "" "0000619852" "0" "30" "X" "70601663" "70601663" "subst" "0.00103273" "02329" "TAF1_000041" "g.70601663A>G" "" "" "" "TAF1(NM_001286074.1):c.1491A>G (p.V497=), TAF1(NM_001286074.2):c.1431A>G (p.V477=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.71381813A>G" "" "likely benign" "" "0000619853" "0" "50" "X" "70679509" "70679509" "subst" "5.59453E-6" "01943" "TAF1_000085" "g.70679509T>A" "" "" "" "TAF1(NM_001286074.1):c.5238T>A (p.D1746E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.71459659T>A" "" "VUS" "" "0000619854" "0" "30" "X" "70680560" "70680560" "subst" "0.00374051" "01804" "TAF1_000086" "g.70680560A>G" "" "" "" "TAF1(NM_004606.3):c.5366A>G (p.(Asn1789Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.71460710A>G" "" "likely benign" "" "0000619855" "0" "50" "X" "70753179" "70753179" "subst" "0" "01943" "TAF1_000087" "g.70753179C>G" "" "" "" "OGT(NM_181673.2):c.30C>G (p.D10E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.71533329C>G" "" "VUS" "" "0000624704" "0" "30" "X" "70596796" "70596796" "subst" "0.000118451" "01943" "TAF1_000081" "g.70596796G>T" "" "" "" "TAF1(NM_001286074.1):c.533-4G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.71376946G>T" "" "likely benign" "" "0000624705" "0" "30" "X" "70641236" "70641239" "del" "0" "01943" "TAF1_000084" "g.70641236_70641239del" "" "" "" "TAF1(NM_001286074.1):c.4512+10_4512+13delTTAG" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.71421386_71421389del" "" "likely benign" "" "0000624706" "0" "30" "X" "70644043" "70644043" "subst" "0.00184256" "01943" "TAF1_000053" "g.70644043C>T" "" "" "" "TAF1(NM_001286074.1):c.4768C>T (p.L1590=), TAF1(NM_004606.5):c.4708C>T (p.L1570=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.71424193C>T" "" "likely benign" "" "0000659439" "0" "30" "X" "70601712" "70601712" "subst" "7.83274E-5" "01943" "TAF1_000088" "g.70601712C>T" "" "" "" "TAF1(NM_001286074.1):c.1540C>T (p.R514W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.71381862C>T" "" "likely benign" "" "0000682616" "0" "30" "X" "70597601" "70597601" "subst" "0" "01943" "TAF1_000089" "g.70597601G>A" "" "" "" "TAF1(NM_001286074.1):c.923G>A (p.S308N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000682617" "0" "30" "X" "70621419" "70621419" "subst" "7.83046E-5" "01943" "TAF1_000090" "g.70621419T>G" "" "" "" "TAF1(NM_001286074.1):c.3888T>G (p.T1296=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000693715" "0" "30" "X" "70602962" "70602962" "subst" "0" "01943" "TAF1_000091" "g.70602962C>T" "" "" "" "TAF1(NM_001286074.1):c.1955C>T (p.P652L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000693716" "0" "30" "X" "70602993" "70602993" "subst" "0" "01943" "TAF1_000092" "g.70602993G>A" "" "" "" "TAF1(NM_001286074.1):c.1986G>A (p.K662=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000693717" "0" "50" "X" "70612738" "70612738" "subst" "1.68749E-5" "01943" "TAF1_000093" "g.70612738C>T" "" "" "" "TAF1(NM_001286074.1):c.3005C>T (p.P1002L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000693718" "0" "30" "X" "70678134" "70678134" "subst" "4.48627E-5" "01943" "TAF1_000094" "g.70678134G>A" "" "" "" "TAF1(NM_001286074.1):c.5048G>A (p.R1683Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000693719" "0" "50" "X" "70680606" "70680606" "subst" "0" "01943" "TAF1_000095" "g.70680606G>C" "" "" "" "TAF1(NM_001286074.1):c.5418G>C (p.E1806D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000729158" "0" "30" "X" "70627910" "70627910" "subst" "1.11876E-5" "01943" "TAF1_000050" "g.70627910C>A" "" "" "" "TAF1(NM_001286074.1):c.4353C>A (p.L1451=), TAF1(NM_004606.5):c.4293C>A (p.L1431=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000729159" "0" "30" "X" "70680545" "70680545" "subst" "0" "01943" "TAF1_000096" "g.70680545G>A" "" "" "" "TAF1(NM_001286074.1):c.5357G>A (p.R1786H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000734924" "0" "30" "X" "70586354" "70586354" "subst" "0.00295934" "00000" "TAF1_000097" "g.70586354T>G" "6/25 families" "{PMID:Maranhao 2015:26352687}" "" "TAF1:c.180+10T>G" "" "Germline" "" "" "0" "" "" "" "" "likely benign" "" "0000734925" "0" "30" "X" "70586360" "70586360" "subst" "0.00858018" "00000" "TAF1_000098" "g.70586360T>G" "7/25 families" "{PMID:Maranhao 2015:26352687}" "" "TAF1:c.180+16T>G" "" "Germline" "" "" "0" "" "" "" "" "likely benign" "" "0000763271" "1" "70" "X" "70641168" "70641168" "subst" "0" "00006" "TAF1_000099" "g.70641168A>G" "" "{PMID:Anazi 2017:27431290}" "" "NM_138923.3:c.4391A>G" "ACMG PM2, PP1, PP2. PP3, PP4" "Germline" "" "" "0" "" "" "g.71421318A>G" "" "likely pathogenic" "ACMG" "0000810636" "0" "50" "X" "70596911" "70596911" "subst" "4.47891E-5" "02325" "TAF1_000100" "g.70596911C>T" "" "" "" "TAF1(NM_004606.5):c.584C>T (p.P195L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000810637" "0" "50" "X" "70598226" "70598226" "subst" "0" "01943" "TAF1_000101" "g.70598226G>C" "" "" "" "TAF1(NM_001286074.1):c.1135G>C (p.D379H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000810638" "0" "30" "X" "70612778" "70612778" "subst" "0.000419602" "01943" "TAF1_000102" "g.70612778C>T" "" "" "" "TAF1(NM_001286074.1):c.3045C>T (p.D1015=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000810639" "0" "30" "X" "70679406" "70679406" "subst" "7.85952E-5" "01943" "TAF1_000103" "g.70679406G>C" "" "" "" "TAF1(NM_001286074.1):c.5135G>C (p.G1712A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000810640" "0" "50" "X" "70680598" "70680598" "subst" "0" "02325" "TAF1_000104" "g.70680598T>C" "" "" "" "TAF1(NM_004606.5):c.5344T>C (p.S1782P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000817730" "3" "70" "X" "70607141" "70607141" "subst" "5.59384E-5" "00006" "TAF1_000105" "g.70607141A>G" "" "{PMID:Hu 2019:29302074}" "" "" "novel candidate disease gene" "Germline" "" "" "0" "" "" "g.71387291A>G" "" "likely pathogenic (recessive)" "" "0000856767" "0" "50" "X" "70597555" "70597555" "subst" "0" "02325" "TAF1_000106" "g.70597555G>C" "" "" "" "TAF1(NM_004606.5):c.817G>C (p.E273Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000856768" "0" "30" "X" "70607148" "70607148" "subst" "0" "01943" "TAF1_000107" "g.70607148T>C" "" "" "" "TAF1(NM_001286074.1):c.2324T>C (p.L775P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000867537" "0" "50" "X" "70608232" "70608232" "subst" "1.77048E-5" "01943" "TAF1_000108" "g.70608232G>A" "" "" "" "TAF1(NM_001286074.1):c.2629+4G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000877958" "0" "50" "X" "70614084" "70614084" "subst" "1.73073E-5" "03779" "TAF1_000109" "g.70614084G>A" "" "" "" "" "" "CLASSIFICATION record" "" "rs759643494" "0" "" "" "" "" "VUS" "" "0000896347" "0" "30" "X" "70613146" "70613146" "subst" "3.06769E-5" "02325" "TAF1_000045" "g.70613146C>T" "" "" "" "TAF1(NM_001286074.1):c.3112-5C>T, TAF1(NM_004606.5):c.3052-5C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000896348" "0" "30" "X" "70613911" "70613911" "subst" "0.000512324" "02329" "TAF1_000046" "g.70613911T>C" "" "" "" "TAF1(NM_001286074.1):c.3288-6T>C, TAF1(NM_001286074.2):c.3228-6T>C, TAF1(NM_004606.5):c.3228-6T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000896349" "0" "30" "X" "70627470" "70627470" "subst" "0" "02327" "TAF1_000110" "g.70627470C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000896350" "0" "50" "X" "70642977" "70642977" "subst" "5.59672E-6" "02327" "TAF1_000111" "g.70642977A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000915757" "0" "30" "X" "70607289" "70607289" "subst" "6.15278E-5" "02325" "TAF1_000071" "g.70607289C>T" "" "" "" "TAF1(NM_001286074.1):c.2465C>T (p.T822M), TAF1(NM_004606.5):c.2405C>T (p.T802M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000915758" "0" "50" "X" "70627924" "70627924" "subst" "0" "02325" "TAF1_000112" "g.70627924G>A" "" "" "" "TAF1(NM_004606.5):c.4307G>A (p.R1436H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000918568" "21" "50" "X" "70643885" "70643885" "subst" "0" "01164" "TAF1_000113" "g.70643885G>A" "" "" "" "" "ACMG: PM2_SUP, PP2, BP4" "Germline" "?" "" "" "" "" "" "" "VUS" "ACMG" "0000927415" "0" "30" "X" "70607141" "70607141" "subst" "5.59384E-5" "02327" "TAF1_000105" "g.70607141A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000927416" "0" "50" "X" "70627502" "70627502" "subst" "0" "02325" "TAF1_000114" "g.70627502G>A" "" "" "" "TAF1(NM_004606.5):c.4186G>A (p.D1396N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000927417" "0" "50" "X" "70680536" "70680536" "subst" "0" "02326" "TAF1_000115" "g.70680536A>G" "" "" "" "TAF1(NM_004606.4):c.5342A>G (p.K1781R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000931460" "0" "30" "X" "70597571" "70597573" "dup" "0" "02325" "TAF1_000082" "g.70597571_70597573dup" "" "" "" "TAF1(NM_004606.3):c.889_890insAGG (p.(Gln297_Glu298insGlu)), TAF1(NM_004606.5):c.833_835dupAGG (p.E278dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000936402" "0" "10" "X" "70643035" "70643035" "subst" "0.00014542" "00006" "TAF1_000052" "g.70643035G>A" "" "{PMID:Hamdan 2017:29100083}" "" "NM_138923:c.G4518A (A1506A)" "" "De novo" "" "" "0" "" "" "" "" "benign" "" "0000945966" "0" "50" "X" "70674677" "70674677" "subst" "0" "03779" "TAF1_000116" "g.70674677C>G" "" "" "" "" "" "CLASSIFICATION record" "" "" "0" "" "" "" "" "VUS" "" "0000951793" "0" "30" "X" "70587466" "70587466" "subst" "8.4142E-5" "02325" "TAF1_000117" "g.70587466G>A" "" "" "" "TAF1(NM_004606.5):c.235+3G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000971311" "0" "10" "X" "70613114" "70613115" "dup" "0" "02329" "TAF1_000118" "g.70613114_70613115dup" "" "" "" "TAF1(NM_001286074.2):c.3052-38_3052-37dupTG" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000990030" "21" "70" "X" "70586167" "70586167" "subst" "0" "03544" "TAF1_000119" "g.70586167G>T" "" "" "" "" "variant not detected in mother; partial genotype-phenotype correlation" "De novo" "-" "" "0" "" "" "g.71366317G>T" "" "likely pathogenic (!)" "ACMG" "0001006940" "0" "50" "X" "70597573" "70597573" "subst" "0" "01804" "TAF1_000120" "g.70597573G>C" "" "" "" "TAF1(NM_138923.2):c.832G>C (p.(Val278Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001006941" "0" "50" "X" "70598781" "70598781" "subst" "5.59422E-6" "02325" "TAF1_000121" "g.70598781G>C" "" "" "" "TAF1(NM_004606.5):c.1260G>C (p.E420D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001006942" "0" "50" "X" "70627446" "70627446" "subst" "5.59942E-6" "02325" "TAF1_000122" "g.70627446G>A" "" "" "" "TAF1(NM_004606.5):c.4130G>A (p.R1377Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001027529" "0" "50" "X" "70596844" "70596844" "subst" "0" "02325" "TAF1_000123" "g.70596844C>T" "" "" "" "TAF1(NM_004606.5):c.517C>T (p.P173S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001027530" "0" "50" "X" "70597514" "70597514" "subst" "0" "02329" "TAF1_000124" "g.70597514C>T" "" "" "" "TAF1(NM_001286074.2):c.776C>T (p.A259V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001044483" "0" "30" "X" "70587371" "70587371" "subst" "0.000156771" "02325" "TAF1_000031" "g.70587371G>A" "" "" "" "TAF1(NM_001286074.1):c.203G>A (p.G68D), TAF1(NM_004606.5):c.143G>A (p.G48D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001044484" "0" "30" "X" "70597631" "70597631" "subst" "0.0032165" "01804" "TAF1_000036" "g.70597631C>G" "" "" "" "TAF1(NM_001286074.2):c.893C>G (p.A298G), TAF1(NM_004606.5):c.893C>G (p.(Ala298Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001044485" "0" "30" "X" "70602920" "70602920" "subst" "2.24266E-5" "01804" "TAF1_000125" "g.70602920G>A" "" "" "" "TAF1(NM_004606.5):c.1853G>A (p.(Arg618His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001044486" "0" "30" "X" "70613911" "70613911" "subst" "0.000512324" "01804" "TAF1_000046" "g.70613911T>C" "" "" "" "TAF1(NM_001286074.1):c.3288-6T>C, TAF1(NM_001286074.2):c.3228-6T>C, TAF1(NM_004606.5):c.3228-6T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001044487" "0" "50" "X" "70627452" "70627452" "subst" "1.11934E-5" "02327" "TAF1_000126" "g.70627452G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001044488" "0" "30" "X" "70628587" "70628587" "subst" "0" "01804" "TAF1_000127" "g.70628587G>A" "" "" "" "TAF1(NM_004606.5):c.4384+586G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001044489" "0" "30" "X" "70672471" "70672471" "subst" "0" "01804" "TAF1_000128" "g.70672471C>T" "" "" "" "TAF1(NM_004606.5):c.4754-1549C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001044490" "0" "30" "X" "70672477" "70672477" "subst" "0" "01804" "TAF1_000129" "g.70672477G>A" "" "" "" "TAF1(NM_004606.5):c.4754-1543G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001044491" "0" "30" "X" "70689447" "70689447" "subst" "0" "01804" "TAF1_000130" "g.70689447C>T" "" "" "" "TAF1(NR_104387.2):n.5519+8794C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001044492" "0" "30" "X" "70747864" "70747864" "subst" "0" "01804" "TAF1_000131" "g.70747864A>C" "" "" "" "TAF1(NR_104387.2):n.5520-528A>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes TAF1 ## Count = 158 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000002008" "00000810" "50" "3681" "-213" "3681" "-213" "c.3681-213dup" "r.(=)" "p.(=)" "" "0000002009" "00000810" "50" "4167" "187" "4167" "187" "c.4167+187dup" "r.(=)" "p.(=)" "" "0000003042" "00000810" "50" "413" "-92" "413" "-92" "c.413-92del" "r.(=)" "p.(=)" "" "0000003043" "00000810" "50" "1420" "74" "1420" "75" "c.1420+74_1420+75del" "r.(=)" "p.(=)" "" "0000003044" "00000810" "50" "1420" "74" "1420" "74" "c.1420+74del" "r.(=)" "p.(=)" "" "0000003045" "00000810" "50" "3681" "-213" "3681" "-213" "c.3681-213dup" "r.(=)" "p.(=)" "" "0000007139" "00000810" "30" "3680" "127" "3680" "127" "c.3680+127A>G" "r.(?)" "p.(=)" "23i" "0000009227" "00000810" "30" "413" "-76" "413" "-76" "c.413-76dup" "r.(?)" "p.(=)" "3i" "0000009228" "00000810" "30" "3680" "127" "3680" "127" "c.3680+127A>G" "r.(?)" "p.(=)" "23i" "0000011027" "00000810" "50" "413" "-92" "413" "-92" "c.413-92del" "r.(=)" "p.(=)" "" "0000011028" "00000810" "50" "2761" "-67" "2761" "-67" "c.2761-67del" "r.(=)" "p.(=)" "" "0000084876" "00000810" "90" "4010" "0" "4010" "0" "c.4010T>C" "r.(?)" "p.(Ile1337Thr)" "26" "0000084877" "00000810" "90" "4010" "0" "4010" "0" "c.4010T>C" "r.(?)" "p.(Ile1337Thr)" "26" "0000084878" "00000810" "90" "2419" "0" "2419" "0" "c.2419T>C" "r.(?)" "p.(Cys807Arg)" "15" "0000084879" "00000810" "90" "3736" "0" "3736" "0" "c.3736C>T" "r.(?)" "p.(Arg1246Trp)" "24" "0000084880" "00000810" "90" "1514" "0" "1514" "0" "c.1514T>A" "r.(?)" "p.(Ile505Asn)" "9" "0000084881" "00000810" "90" "3708" "0" "3708" "0" "c.3708A>G" "r.[3708a>g,3681_3708del]" "p.[=,Arg1228Ilefs*16]" "24" "0000084882" "00000810" "90" "4594" "0" "4594" "0" "c.4594A>C" "r.(?)" "p.(Asn1517His)" "31" "0000084883" "00000810" "90" "4355" "0" "4355" "0" "c.4355G>A" "r.(?)" "p.(Arg1452His)" "28" "0000084884" "00000810" "90" "1786" "0" "1786" "0" "c.1786C>T" "r.(?)" "p.(Pro596Ser)" "12" "0000084885" "00000810" "90" "1786" "0" "1786" "0" "c.1786C>T" "r.(?)" "p.(Pro596Ser)" "12" "0000084886" "00000810" "90" "1786" "0" "1786" "0" "c.1786C>T" "r.(?)" "p.(Pro596Ser)" "12" "0000084887" "00000810" "90" "2926" "0" "2926" "0" "c.2926G>C" "r.(?)" "p.(Asp976His)" "19" "0000086460" "00000810" "70" "-215371" "0" "116171" "0" "c.(?_-215371)_(*110489_?)dup" "r.?" "p.?" "_1_38_" "0000086463" "00000810" "70" "0" "0" "0" "0" "c.(?_-298646)_(*27214_)?dup" "r.?" "p.?" "_1_38_" "0000097048" "00000810" "90" "4010" "0" "4010" "0" "c.4010T>C" "r.(?)" "p.(Ile1337Thr)" "25" "0000097049" "00000810" "90" "4010" "0" "4010" "0" "c.4010T>C" "r.(?)" "p.(Ile1337Thr)" "25" "0000097051" "00000810" "90" "3736" "0" "3736" "0" "c.3736C>T" "r.(?)" "p.(Arg1246Trp)" "24" "0000164203" "00000810" "90" "2419" "0" "2419" "0" "c.2419T>C" "r.(?)" "p.(Cys807Arg)" "15" "0000164204" "00000810" "90" "1514" "0" "1514" "0" "c.1514T>A" "r.(?)" "p.(Ile505Asn)" "9" "0000164205" "00000810" "90" "4549" "0" "4549" "0" "c.4549A>C" "r.(?)" "p.(Asn1517His)" "30" "0000164206" "00000810" "90" "3708" "0" "3708" "0" "c.3708A>G" "r.[=, 3681_3708del]" "p.[=, Arg1228Ilefs*16]" "24" "0000164207" "00000810" "90" "4355" "0" "4355" "0" "c.4355G>A" "r.(?)" "p.(Arg1452His)" "28" "0000164208" "00000810" "90" "1786" "0" "1786" "0" "c.1786C>T" "r.(?)" "p.(Pro596Ser)" "11" "0000164209" "00000810" "90" "2926" "0" "2926" "0" "c.2926G>C" "r.(?)" "p.(Asp976His)" "19" "0000164210" "00000810" "90" "-1" "0" "5683" "0" "c.(?_-1)_(*1_?)dup" "r.=" "p.=" "_1_38_" "0000164211" "00000810" "90" "-1" "0" "5683" "0" "c.(?_-1)_(*1_?)dup" "r.=" "p.=" "_1_38_" "0000249415" "00000810" "30" "1032" "0" "1032" "0" "c.1032A>G" "r.(?)" "p.(Gln344=)" "" "0000249442" "00000810" "30" "1192" "0" "1192" "0" "c.1192A>T" "r.(?)" "p.(Ile398Leu)" "" "0000249590" "00000810" "30" "4814" "-4" "4814" "-4" "c.4814-4A>G" "r.spl?" "p.?" "" "0000254378" "00000810" "30" "1659" "0" "1659" "0" "c.1659A>G" "r.(?)" "p.(Glu553=)" "" "0000254909" "00000810" "30" "890" "0" "890" "0" "c.890A>T" "r.(?)" "p.(Gln297Leu)" "" "0000255139" "00000810" "30" "1491" "0" "1491" "0" "c.1491A>G" "r.(?)" "p.(Val497=)" "" "0000256309" "00000810" "50" "61" "0" "61" "0" "c.61A>G" "r.(?)" "p.(Met21Val)" "" "0000311689" "00000810" "50" "157" "0" "157" "0" "c.157G>C" "r.(?)" "p.(Glu53Gln)" "" "0000311690" "00000810" "30" "2748" "0" "2748" "0" "c.2748G>A" "r.(?)" "p.(Glu916=)" "" "0000311691" "00000810" "10" "32" "0" "32" "0" "c.32C>T" "r.(?)" "p.(Thr11Ile)" "" "0000311692" "00000810" "30" "4353" "0" "4353" "0" "c.4353C>A" "r.(?)" "p.(Leu1451=)" "" "0000311693" "00000810" "30" "4513" "-13" "4513" "-13" "c.4513-13T>C" "r.(=)" "p.(=)" "" "0000311694" "00000810" "30" "4768" "0" "4768" "0" "c.4768C>T" "r.(?)" "p.(Leu1590=)" "" "0000311695" "00000810" "10" "953" "0" "953" "0" "c.953C>G" "r.(?)" "p.(Ala318Gly)" "" "0000311696" "00000810" "30" "994" "-16" "994" "-14" "c.994-16_994-14del" "r.(=)" "p.(=)" "" "0000316188" "00000810" "30" "1410" "0" "1410" "0" "c.1410T>C" "r.(?)" "p.(Asn470=)" "" "0000316189" "00000810" "50" "203" "0" "203" "0" "c.203G>A" "r.(?)" "p.(Gly68Asp)" "" "0000316190" "00000810" "30" "3112" "-5" "3112" "-5" "c.3112-5C>T" "r.spl?" "p.?" "" "0000316191" "00000810" "30" "3288" "-6" "3288" "-6" "c.3288-6T>C" "r.(=)" "p.(=)" "" "0000316192" "00000810" "30" "3387" "0" "3387" "0" "c.3387G>A" "r.(?)" "p.(Leu1129=)" "" "0000316193" "00000810" "30" "3885" "0" "3885" "0" "c.3885G>A" "r.(?)" "p.(Arg1295=)" "" "0000316194" "00000810" "30" "3939" "0" "3939" "0" "c.3939T>C" "r.(?)" "p.(Pro1313=)" "" "0000316195" "00000810" "30" "4581" "0" "4581" "0" "c.4581G>A" "r.(?)" "p.(Ala1527=)" "" "0000316196" "00000810" "30" "5290" "0" "5290" "0" "c.5290C>T" "r.(?)" "p.(Leu1764=)" "" "0000316197" "00000810" "10" "868" "0" "868" "0" "c.868C>G" "r.(?)" "p.(Leu290Val)" "" "0000316198" "00000810" "30" "936" "0" "936" "0" "c.936G>C" "r.(?)" "p.(Leu312Phe)" "" "0000316199" "00000810" "30" "951" "0" "951" "0" "c.951C>T" "r.(?)" "p.(Tyr317=)" "" "0000334587" "00000810" "50" "1588" "0" "1588" "0" "c.1588C>A" "r.(?)" "p.(Leu530Ile)" "" "0000341815" "00000810" "50" "3736" "0" "3736" "0" "c.3736C>T" "r.(?)" "p.(Arg1246Trp)" "" "0000341874" "00000810" "70" "4072" "0" "4072" "0" "c.4072C>T" "r.(?)" "p.(Arg1358Cys)" "" "0000347318" "00000810" "70" "2482" "0" "2482" "0" "c.2482C>G" "r.(?)" "p.(Leu828Val)" "" "0000408115" "00000810" "70" "1477" "0" "1477" "0" "c.1477A>G" "r.(?)" "p.(Asn493Asp)" "9" "0000408116" "00000810" "70" "3568" "0" "3568" "0" "c.3568C>T" "r.(?)" "p.(Arg1190Cys)" "23" "0000408756" "00000810" "90" "2926" "0" "2926" "0" "c.2926G>C" "r.(?)" "p.(Asp976His)" "19" "0000577290" "00000810" "30" "29" "0" "53" "0" "c.29_53dup" "r.(?)" "p.(Ala19AspfsTer50)" "" "0000577291" "00000810" "10" "32" "0" "32" "0" "c.32C>T" "r.(?)" "p.(Thr11Ile)" "" "0000577293" "00000810" "30" "147" "0" "147" "0" "c.147C>G" "r.(?)" "p.(Ala49=)" "" "0000577294" "00000810" "30" "147" "0" "147" "0" "c.147C>G" "r.(?)" "p.(Ala49=)" "" "0000577295" "00000810" "50" "192" "0" "192" "0" "c.192G>C" "r.(?)" "p.(Lys64Asn)" "" "0000577296" "00000810" "30" "357" "0" "357" "0" "c.357T>C" "r.(?)" "p.(Asp119=)" "" "0000577297" "00000810" "30" "528" "0" "528" "0" "c.528T>A" "r.(?)" "p.(Thr176=)" "" "0000577299" "00000810" "30" "902" "0" "902" "0" "c.902G>C" "r.(?)" "p.(Cys301Ser)" "" "0000577300" "00000810" "50" "1206" "0" "1206" "0" "c.1206G>T" "r.(?)" "p.(Met402Ile)" "" "0000577301" "00000810" "50" "1267" "0" "1267" "0" "c.1267T>G" "r.(?)" "p.(Phe423Val)" "" "0000577303" "00000810" "30" "1533" "0" "1533" "0" "c.1533C>G" "r.(?)" "p.(Ala511=)" "" "0000577304" "00000810" "50" "2434" "0" "2434" "0" "c.2434G>A" "r.(?)" "p.(Val812Ile)" "" "0000577305" "00000810" "50" "2465" "0" "2465" "0" "c.2465C>T" "r.(?)" "p.(Thr822Met)" "" "0000577306" "00000810" "30" "2748" "0" "2748" "0" "c.2748G>A" "r.(?)" "p.(Glu916=)" "" "0000577307" "00000810" "30" "3150" "0" "3150" "0" "c.3150G>A" "r.(?)" "p.(Val1050=)" "" "0000577309" "00000810" "50" "3604" "0" "3604" "0" "c.3604C>T" "r.(?)" "p.(Arg1202Cys)" "" "0000577310" "00000810" "50" "4103" "0" "4103" "0" "c.4103A>C" "r.(?)" "p.(Lys1368Thr)" "" "0000577311" "00000810" "70" "4441" "0" "4441" "0" "c.4441A>G" "r.(?)" "p.(Asn1481Asp)" "" "0000577312" "00000810" "30" "4813" "10" "4813" "10" "c.4813+10del" "r.(=)" "p.(=)" "" "0000577313" "00000810" "30" "4814" "-4" "4814" "-4" "c.4814-4A>G" "r.spl?" "p.?" "" "0000577314" "00000810" "30" "4814" "-4" "4814" "-4" "c.4814-4A>G" "r.spl?" "p.?" "" "0000577315" "00000810" "50" "4832" "0" "4832" "0" "c.4832C>T" "r.(?)" "p.(Thr1611Ile)" "" "0000577316" "00000810" "50" "5554" "0" "5554" "0" "c.5554G>A" "r.(?)" "p.(Asp1852Asn)" "" "0000577317" "00000810" "50" "5565" "0" "5567" "0" "c.5565_5567del" "r.(?)" "p.(Glu1857del)" "" "0000619850" "00000810" "30" "893" "0" "895" "0" "c.893_895dup" "r.(?)" "p.(Glu298dup)" "" "0000619851" "00000810" "30" "906" "0" "906" "0" "c.906A>C" "r.(?)" "p.(Ser302=)" "" "0000619852" "00000810" "30" "1491" "0" "1491" "0" "c.1491A>G" "r.(?)" "p.(Val497=)" "" "0000619853" "00000810" "50" "5232" "0" "5232" "0" "c.5232T>A" "r.(?)" "p.(Asp1744Glu)" "" "0000619854" "00000810" "30" "5366" "0" "5366" "0" "c.5366A>G" "r.(?)" "p.(Asn1789Ser)" "" "0000619855" "00000810" "50" "74965" "0" "74965" "0" "c.*69283C>G" "r.(=)" "p.(=)" "" "0000624704" "00000810" "30" "533" "-4" "533" "-4" "c.533-4G>T" "r.spl?" "p.?" "" "0000624705" "00000810" "30" "4512" "10" "4512" "13" "c.4512+10_4512+13del" "r.(=)" "p.(=)" "" "0000624706" "00000810" "30" "4768" "0" "4768" "0" "c.4768C>T" "r.(?)" "p.(Leu1590=)" "" "0000659439" "00000810" "30" "1540" "0" "1540" "0" "c.1540C>T" "r.(?)" "p.(Arg514Trp)" "" "0000682616" "00000810" "30" "923" "0" "923" "0" "c.923G>A" "r.(?)" "p.(Ser308Asn)" "" "0000682617" "00000810" "30" "3888" "0" "3888" "0" "c.3888T>G" "r.(?)" "p.(Thr1296=)" "" "0000693715" "00000810" "30" "1955" "0" "1955" "0" "c.1955C>T" "r.(?)" "p.(Pro652Leu)" "" "0000693716" "00000810" "30" "1986" "0" "1986" "0" "c.1986G>A" "r.(?)" "p.(Lys662=)" "" "0000693717" "00000810" "50" "3005" "0" "3005" "0" "c.3005C>T" "r.(?)" "p.(Pro1002Leu)" "" "0000693718" "00000810" "30" "5042" "0" "5042" "0" "c.5042G>A" "r.(?)" "p.(Arg1681Gln)" "" "0000693719" "00000810" "50" "5412" "0" "5412" "0" "c.5412G>C" "r.(?)" "p.(Glu1804Asp)" "" "0000729158" "00000810" "30" "4353" "0" "4353" "0" "c.4353C>A" "r.(?)" "p.(Leu1451=)" "" "0000729159" "00000810" "30" "5351" "0" "5351" "0" "c.5351G>A" "r.(?)" "p.(Arg1784His)" "" "0000734924" "00000810" "30" "180" "10" "180" "10" "c.180+10T>G" "r.(=)" "p.(=)" "" "0000734925" "00000810" "30" "180" "16" "180" "16" "c.180+16T>G" "r.(=)" "p.(=)" "" "0000763271" "00000810" "70" "4454" "0" "4454" "0" "c.4454A>G" "r.(?)" "p.(His1485Arg)" "" "0000810636" "00000810" "50" "644" "0" "644" "0" "c.644C>T" "r.(?)" "p.(Pro215Leu)" "" "0000810637" "00000810" "50" "1135" "0" "1135" "0" "c.1135G>C" "r.(?)" "p.(Asp379His)" "" "0000810638" "00000810" "30" "3045" "0" "3045" "0" "c.3045C>T" "r.(?)" "p.(Asp1015=)" "" "0000810639" "00000810" "30" "5129" "0" "5129" "0" "c.5129G>C" "r.(?)" "p.(Gly1710Ala)" "" "0000810640" "00000810" "50" "5404" "0" "5404" "0" "c.5404T>C" "r.(?)" "p.(Ser1802Pro)" "" "0000817730" "00000810" "70" "2317" "0" "2317" "0" "c.2317A>G" "r.(?)" "p.(Ile773Val)" "" "0000856767" "00000810" "50" "877" "0" "877" "0" "c.877G>C" "r.(?)" "p.(Glu293Gln)" "" "0000856768" "00000810" "30" "2324" "0" "2324" "0" "c.2324T>C" "r.(?)" "p.(Leu775Pro)" "" "0000867537" "00000810" "50" "2629" "4" "2629" "4" "c.2629+4G>A" "r.spl?" "p.?" "" "0000877958" "00000810" "50" "3395" "0" "3395" "0" "c.3395G>A" "r.(?)" "p.(Arg1132Gln)" "" "0000896347" "00000810" "30" "3112" "-5" "3112" "-5" "c.3112-5C>T" "r.spl?" "p.?" "" "0000896348" "00000810" "30" "3288" "-6" "3288" "-6" "c.3288-6T>C" "r.(=)" "p.(=)" "" "0000896349" "00000810" "30" "4214" "0" "4214" "0" "c.4214C>G" "r.(?)" "p.(Thr1405Arg)" "" "0000896350" "00000810" "50" "4523" "0" "4523" "0" "c.4523A>G" "r.(?)" "p.(Lys1508Arg)" "" "0000915757" "00000810" "30" "2465" "0" "2465" "0" "c.2465C>T" "r.(?)" "p.(Thr822Met)" "" "0000915758" "00000810" "50" "4367" "0" "4367" "0" "c.4367G>A" "r.(?)" "p.(Arg1456His)" "" "0000918568" "00000810" "50" "4697" "0" "4697" "0" "c.4697G>A" "r.(?)" "p.(Arg1566Gln)" "" "0000927415" "00000810" "30" "2317" "0" "2317" "0" "c.2317A>G" "r.(?)" "p.(Ile773Val)" "" "0000927416" "00000810" "50" "4246" "0" "4246" "0" "c.4246G>A" "r.(?)" "p.(Asp1416Asn)" "" "0000927417" "00000810" "50" "5342" "0" "5342" "0" "c.5342A>G" "r.(?)" "p.(Lys1781Arg)" "" "0000931460" "00000810" "30" "893" "0" "895" "0" "c.893_895dup" "r.(?)" "p.(Glu298dup)" "" "0000936402" "00000810" "10" "4581" "0" "4581" "0" "c.4581G>A" "r.(=)" "p.(=)" "" "0000945966" "00000810" "50" "4908" "0" "4908" "0" "c.4908C>G" "r.(?)" "p.(Asp1636Glu)" "" "0000951793" "00000810" "30" "295" "3" "295" "3" "c.295+3G>A" "r.spl?" "p.?" "" "0000971311" "00000810" "10" "3112" "-37" "3112" "-36" "c.3112-37_3112-36dup" "r.(=)" "p.(=)" "" "0000990030" "00000810" "70" "3" "0" "3" "0" "c.3G>T" "r.?" "p.?" "1" "0001006940" "00000810" "50" "895" "0" "895" "0" "c.895G>C" "r.(?)" "p.(Val299Leu)" "" "0001006941" "00000810" "50" "1320" "0" "1320" "0" "c.1320G>C" "r.(?)" "p.(Glu440Asp)" "" "0001006942" "00000810" "50" "4190" "0" "4190" "0" "c.4190G>A" "r.(?)" "p.(Arg1397Gln)" "" "0001027529" "00000810" "50" "577" "0" "577" "0" "c.577C>T" "r.(?)" "p.(Pro193Ser)" "" "0001027530" "00000810" "50" "836" "0" "836" "0" "c.836C>T" "r.(?)" "p.(Ala279Val)" "" "0001044483" "00000810" "30" "203" "0" "203" "0" "c.203G>A" "r.(?)" "p.(Gly68Asp)" "" "0001044484" "00000810" "30" "953" "0" "953" "0" "c.953C>G" "r.(?)" "p.(Ala318Gly)" "" "0001044485" "00000810" "30" "1913" "0" "1913" "0" "c.1913G>A" "r.(?)" "p.(Arg638His)" "" "0001044486" "00000810" "30" "3288" "-6" "3288" "-6" "c.3288-6T>C" "r.(=)" "p.(=)" "" "0001044487" "00000810" "50" "4196" "0" "4196" "0" "c.4196G>A" "r.(?)" "p.(Arg1399His)" "" "0001044488" "00000810" "30" "4444" "586" "4444" "586" "c.4444+586G>A" "r.(=)" "p.(=)" "" "0001044489" "00000810" "30" "4814" "-1549" "4814" "-1549" "c.4814-1549C>T" "r.(=)" "p.(=)" "" "0001044490" "00000810" "30" "4814" "-1543" "4814" "-1543" "c.4814-1543G>A" "r.(=)" "p.(=)" "" "0001044491" "00000810" "30" "11233" "0" "11233" "0" "c.*5551C>T" "r.(=)" "p.(=)" "" "0001044492" "00000810" "30" "69650" "0" "69650" "0" "c.*63968A>C" "r.(=)" "p.(=)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 47 "{{screeningid}}" "{{variantid}}" "0000000209" "0000002008" "0000000209" "0000002009" "0000000209" "0000003042" "0000000209" "0000003043" "0000000209" "0000003044" "0000000209" "0000003045" "0000000209" "0000007139" "0000000210" "0000009227" "0000000210" "0000009228" "0000000210" "0000011027" "0000000210" "0000011028" "0000054853" "0000084876" "0000054854" "0000084877" "0000054855" "0000084878" "0000054856" "0000084879" "0000054857" "0000084880" "0000054858" "0000084881" "0000054859" "0000084882" "0000054860" "0000084883" "0000054861" "0000084884" "0000054862" "0000084885" "0000054863" "0000084886" "0000054864" "0000084887" "0000054865" "0000086460" "0000054866" "0000086463" "0000065372" "0000097048" "0000065373" "0000097049" "0000065374" "0000164203" "0000065376" "0000097051" "0000065377" "0000164204" "0000065378" "0000164206" "0000065379" "0000164205" "0000065381" "0000164207" "0000101626" "0000164208" "0000101627" "0000164209" "0000101628" "0000164210" "0000101629" "0000164211" "0000184146" "0000408115" "0000184147" "0000408116" "0000184633" "0000408756" "0000336012" "0000734924" "0000336013" "0000734925" "0000362897" "0000763271" "0000388937" "0000817730" "0000432949" "0000918568" "0000440100" "0000936402" "0000455054" "0000990030"