### LOVD-version 3000-220 ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = TBC1D24) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{allow_index_wiki}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "TBC1D24" "TBC1 domain family, member 24" "16" "p13.3" "unknown" "NG_028170.1" "UD_132084544887" "" "" "" "1" "1" "29203" "57465" "613577" "1" "1" "1" "" "" "g" "http://databases.lovd.nl/shared/refseq/TBC1D24_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2012-12-14 00:00:00" "00081" "2015-08-05 02:07:01" "00006" "2019-02-24 22:41:07" ## Transcripts ## Do not remove or alter this header ## ## Count = 2 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00001779" "TBC1D24" "transcript variant 1" "001" "NM_001199107.1" "" "NP_001186036.1" "" "" "" "-140" "6455" "1680" "2525147" "2555734" "00001" "2012-12-14 09:58:12" "" "" "00023820" "TBC1D24" "transcript variant 2" "002" "NM_020705.2" "" "NP_065756.1" "" "" "" "-140" "6437" "1662" "2525147" "2555734" "00006" "2013-05-27 16:35:44" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 14 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00000" "Healthy/Control" "Healthy individual / control" "" "" "" "" "" "00000" "2012-07-26 17:29:43" "" "" "00097" "FIME" "epilepsy, myoclonic, infantile, familial (FIME)" "" "605021" "" "" "" "00001" "2012-12-14 10:00:34" "00006" "2015-12-08 23:54:35" "00139" "ID" "intellectual disability (ID)" "" "" "" "" "" "00084" "2013-06-04 18:18:07" "00006" "2015-02-09 10:02:49" "00283" "EIEE-16" "encephalopathy, epileptic, early infantile, type 16 (EIEE-16)" "" "615338" "" "" "" "00081" "2013-11-28 15:56:49" "00006" "2015-02-20 16:51:47" "00284" "-" "epilepsy, myoclonic, dystonia, hemiparesis, autonomic signs, lethargy, progressive diffuse cerebral atrophy" "" "" "" "" "" "00081" "2013-11-28 15:59:11" "00006" "2015-12-08 23:59:30" "00285" "-" "epilepsy, focal, dysarthria, intellectual disability, cortical thickening, cerebellar atrophy" "" "" "" "" "" "00081" "2013-11-28 15:59:54" "00006" "2019-02-14 14:51:22" "00286" "DOORS" "deafness, onychodystrophy, osteodystrophy, mental retardation syndrome (DOORS)" "" "220500" "" "" "" "00081" "2013-11-28 16:01:26" "00006" "2015-12-07 07:11:25" "00294" "DFNB-86" "deafness, nonsyndromic, autosomal recessive, type 86 (DFNB-86)" "" "614617" "" "" "" "00081" "2014-01-08 19:33:40" "00006" "2015-12-07 07:11:25" "00344" "EE" "encephalopathy, epileptic (EE)" "" "" "" "" "" "00006" "2014-03-12 21:57:45" "00006" "2015-12-07 07:11:25" "00350" "DFNA" "deafness, nonsyndromic (DFNA, autosomal dominant)" "" "124900" "" "" "" "00081" "2014-03-13 13:45:31" "00006" "2015-03-07 15:07:01" "03139" "-" "myoclonus epilepsy with ataxia, progressive" "" "612437" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2015-12-08 23:51:33" "04219" "DFNA-65" "deafness, autosomal dominant, type 65 (DFNA-65)" "" "616044" "" "" "" "00006" "2015-03-07 14:59:25" "" "" "05086" "HL" "hearing loss (HL)" "" "" "" "" "" "00006" "2015-10-23 11:41:05" "00006" "2015-10-23 11:43:00" "05315" "epilepsy, Rolandic" "epilepsy, Rolandic" "" "" "" "" "" "00006" "2017-08-11 13:02:50" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 8 "{{geneid}}" "{{diseaseid}}" "TBC1D24" "00097" "TBC1D24" "00139" "TBC1D24" "00283" "TBC1D24" "00284" "TBC1D24" "00285" "TBC1D24" "00286" "TBC1D24" "00294" "TBC1D24" "04219" ## Individuals ## Do not remove or alter this header ## ## Count = 37 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00000370" "" "" "" "1" "00059" "" "" "F" "-" "? (unknown)" "" "" "" "" "" "" "00004090" "" "" "" "1" "00081" "" "" "" "" "" "" "0" "" "" "Arab-Israeli" "" "00004091" "" "" "" "1" "00081" "{PMID:Falace A et al 2010:20727515}" "Falace A et al. Am J Hum Genet 2010; 87(3): 365-70." "" "" "" "" "0" "" "" "Italian" "" "00004092" "" "" "" "1" "00081" "{PMID:Guven A 2013:23343562}" "" "" "" "" "" "0" "" "" "Turkish" "" "00004093" "" "" "" "1" "00081" "{PMID:Campeau et al:24291220}" "1" "" "" "" "" "0" "" "" "" "" "00004094" "" "" "" "1" "00081" "{PMID:Campeau et al:24291220}" "2a" "" "" "" "" "0" "" "" "" "" "00004095" "" "" "" "1" "00081" "{PMID:Campeau et al:24291220}" "3" "" "" "" "" "0" "" "" "" "" "00004096" "" "" "" "1" "00081" "{PMID:Campeau et al:24291220}" "2b" "" "" "" "" "0" "" "" "" "" "00004097" "" "" "" "1" "00081" "{PMID:Campeau et al:24291220}" "4" "" "" "" "" "0" "" "" "" "" "00004098" "" "" "" "1" "00081" "{PMID:Campeau et al:24291220}" "5a" "" "" "" "" "0" "" "" "" "" "00004099" "" "" "" "1" "00081" "{PMID:Campeau et al:24291220}" "5b" "" "" "" "" "0" "" "" "" "" "00004100" "" "" "" "1" "00081" "{PMID:Campeau et al:24291220}" "6" "" "" "" "" "0" "" "" "" "" "00004101" "" "" "" "1" "00081" "{PMID:Campeau et al:24291220}" "7" "" "" "" "" "0" "" "" "" "" "00004102" "" "" "" "1" "00081" "{PMID:Campeau et al:24291220}" "8" "" "" "" "" "0" "" "" "" "" "00004103" "" "" "" "1" "00081" "{PMID:Campeau et al:24291220}" "9" "" "" "" "" "0" "" "" "" "" "00004158" "" "" "" "1" "00081" "{PMID:Rehman et al., 2014:24387994}" "" "F" "yes" "Pakistan" "" "0" "" "" "" "" "00004159" "" "" "" "1" "00081" "{PMID:Rehman et al., 2014:24387994}" "" "M" "yes" "Pakistan" "" "0" "" "" "" "" "00016188" "" "" "" "13" "00670" "{PMID:Azaiez 2014:24729539}" "4-generation family, 13 affecteds (5F, 8M)" "F;M" "no" "United States" "" "0" "" "" "Caucasian" "24729539-Fam" "00016189" "" "" "" "11" "00671" "{PMID:Zhang 2014:24729547}" "4-generation family, 11 affected (5F, 6M)" "F;M" "no" "China" "" "0" "" "" "Chinese" "" "00016322" "" "" "" "1" "00681" "" "" "M" "no" "Italy" "" "0" "" "" "" "" "00017865" "" "" "" "1" "00081" "" "" "M" "no" "Australia" "" "0" "" "" "" "" "00025006" "" "" "" "1" "00081" "{PMID:Muona et al:25401298}" "" "F" "?" "Afghanistan" "" "0" "" "" "" "" "00059050" "" "" "" "3" "01542" "Karen Avraham laboratory, Tel Aviv university, Israel, unpublished" "" "" "no" "Israel" "" "0" "" "" "Arab" "" "00116809" "" "" "" "1" "02192" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "individual from 567 controls" "" "" "" "" "0" "" "" "" "S_114:0/1:CONTROL" "00116855" "" "" "" "1" "02192" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "individual from 567 controls" "" "" "" "" "0" "" "" "" "S_20:0/1:CONTROL" "00116858" "" "" "" "1" "02192" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "individual from 567 controls" "" "" "" "" "0" "" "" "" "S_204:0/1:CONTROL" "00116891" "" "" "" "1" "02192" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "individual from 567 controls" "" "" "" "" "0" "" "" "" "S_285:0/1:CONTROL" "00116901" "" "" "" "1" "02192" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "individual from 567 controls" "" "" "" "" "0" "" "" "" "S_307:0/1:CONTROL" "00116970" "" "" "" "1" "02192" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "individual from 567 controls" "" "" "" "" "0" "" "" "" "S_478:0/1:CONTROL" "00116979" "" "" "" "1" "02192" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "individual from 567 controls" "" "" "" "" "0" "" "" "" "S_495:0/1:CONTROL" "00117012" "" "" "" "1" "02192" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "individual from 567 controls" "" "" "" "" "0" "" "" "" "S_561:0/1:CONTROL" "00117013" "" "" "" "1" "02192" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "individual from 567 controls" "" "" "" "" "0" "" "" "" "S_562:0/1:CONTROL" "00117019" "" "" "" "1" "02192" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "individual from 194 RE cases" "" "" "" "" "0" "" "" "" "S_569:0/1:TYPICAL_RE" "00117049" "" "" "" "1" "02192" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "individual from 194 RE cases" "" "" "" "" "0" "" "" "" "S_619:0/1:TYPICAL_RE" "00117056" "" "" "" "1" "02192" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "individual from 567 controls" "" "" "" "" "0" "" "" "" "S_63:0/1:CONTROL" "00163777" "" "" "" "1" "02393" "" "" "M" "yes" "" "" "0" "" "" "" "" "00208756" "" "" "" "1" "01164" "" "" "F" "" "Germany" "" "0" "" "" "" "" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 35 "{{individualid}}" "{{diseaseid}}" "00004090" "00285" "00004091" "00097" "00004092" "00284" "00004093" "00286" "00004094" "00286" "00004095" "00286" "00004096" "00286" "00004097" "00286" "00004098" "00286" "00004099" "00286" "00004100" "00286" "00004101" "00286" "00004102" "00286" "00004103" "00286" "00004158" "00294" "00004159" "00294" "00016188" "05086" "00016189" "00350" "00016322" "00344" "00017865" "00286" "00025006" "03139" "00059050" "00294" "00116809" "00000" "00116855" "00000" "00116858" "00000" "00116891" "00000" "00116901" "00000" "00116970" "00000" "00116979" "00000" "00117012" "00000" "00117013" "00000" "00117019" "05315" "00117049" "05315" "00117056" "00000" "00163777" "00294" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00000, 00097, 00139, 00283, 00284, 00285, 00286, 00294, 00344, 00350, 03139, 04219, 05086, 05315 ## Count = 9 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Birth/Gestational_age_wk}}" "{{Phenotype/Development/Speech/Delayed}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Development_delay_global/HPO_0001263}}" "{{Phenotype/Intellectual_dis/HPO_0001249}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "0000014935" "00344" "00016322" "00681" "Unknown" "" "diagnosis: epileptic encephalopathy and pervasive developmental disorder" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000016224" "00286" "00017865" "00081" "Unknown" "" "DOORS syndrome" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000021126" "03139" "00025006" "00081" "Familial, autosomal recessive" "" "Onset with tonic seizures at 36 hours. Developmental delay with later regression. Myoclonus noted from 8 months. TCS from 3.5 years. Ataxia, spasticity, supranuclear gaze palsy. Visual decline. Initially regarded as an epileptic encephalopathy but florid PME pattern apparent by age 9." "" "" "" "" "" "" "" "" "" "" "" "" "" "0000092291" "05315" "00117019" "02192" "Unknown" "" "typical Rolandic epilepsy" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000092314" "05315" "00117049" "02192" "Unknown" "" "typical Rolandic epilepsy" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000128900" "00294" "00163777" "02393" "Familial, autosomal recessive" "" "" "" "" "" "" "congenital" "" "" "" "" "" "" "" "" "0000142765" "05086" "00016188" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "DFNA-65" "progressive autosomal dominant non-syndromic hearing loss (ADNSHL)" "0000142766" "00350" "00016189" "00006" "Familial, autosomal dominant" "" "nonsyndromic, bilateral, slowly progressive hearing impairment, starting mildly in high frequencies; age onset late 20s, hearing impairment gradually progressed to all frequencies later, eventually reached severe-to-profound in seventh decade; absent or abnormal otoacoustic emission, no evidence of vestibular dysfunction, no inner ear malformation observed by CT scanning" "" "" "" "" "" "" "" "" "" "" "" "DFNA-65" "hearing impairment" "0000157374" "00198" "00208756" "01164" "Unknown" "" "HP:0002069 (Generalized tonic-clonic seizures); HP:0002121 (Absence seizures)" "" "" "" "" "" "" "" "" "" "" "" "" "" ## Screenings ## Do not remove or alter this header ## ## Count = 37 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000000391" "00000370" "1" "00059" "00059" "2013-02-11 13:19:42" "" "" "SEQ-NG" "DNA" "" "" "0000004012" "00004090" "1" "00081" "00081" "2013-11-28 15:45:23" "" "" "SEQ" "DNA" "" "" "0000004013" "00004091" "1" "00081" "00081" "2013-11-28 16:08:12" "" "" "SEQ" "DNA" "" "" "0000004014" "00004092" "1" "00081" "00081" "2013-11-28 17:06:16" "" "" "SEQ" "DNA" "" "" "0000004015" "00004093" "1" "00081" "00081" "2013-11-29 03:19:40" "" "" "SEQ" "DNA" "" "" "0000004016" "00004094" "1" "00081" "00081" "2013-11-29 03:25:10" "" "" "SEQ" "DNA" "" "" "0000004017" "00004095" "1" "00081" "00081" "2013-11-29 03:27:28" "" "" "SEQ" "DNA" "" "" "0000004018" "00004096" "1" "00081" "00081" "2013-11-29 03:33:42" "" "" "SEQ" "DNA" "" "" "0000004019" "00004097" "1" "00081" "00081" "2013-11-29 03:36:02" "" "" "SEQ" "DNA" "" "" "0000004020" "00004098" "1" "00081" "00081" "2013-11-29 03:40:03" "" "" "SEQ" "DNA" "" "" "0000004021" "00004099" "1" "00081" "00081" "2013-11-29 03:40:09" "" "" "SEQ" "DNA" "" "" "0000004022" "00004100" "1" "00081" "00081" "2013-11-29 03:40:15" "" "" "SEQ" "DNA" "" "" "0000004023" "00004101" "1" "00081" "00081" "2013-11-29 03:40:24" "" "" "SEQ" "DNA" "" "" "0000004024" "00004102" "1" "00081" "00081" "2013-11-29 03:40:27" "" "" "SEQ" "DNA" "" "" "0000004025" "00004103" "1" "00081" "00081" "2013-11-29 03:40:35" "" "" "SEQ" "DNA" "" "" "0000004086" "00004158" "1" "00081" "00081" "2014-01-08 19:37:16" "" "" "SEQ" "DNA" "" "" "0000004087" "00004159" "1" "00081" "00081" "2014-01-08 19:42:23" "" "" "SEQ" "DNA" "" "" "0000016107" "00016188" "1" "00670" "00670" "2014-02-27 23:02:16" "" "" "SEQ" "DNA" "" "" "0000016251" "00016322" "1" "00681" "00681" "2014-03-12 13:37:40" "00006" "2014-03-14 16:32:42" "SEQ;SEQ-NG-I" "DNA" "" "" "0000017846" "00017865" "1" "00081" "00081" "2014-07-09 21:30:10" "" "" "SEQ" "DNA" "" "" "0000025008" "00025006" "1" "00081" "00081" "2014-11-30 23:49:15" "" "" "SEQ-NG" "DNA" "" "" "0000059016" "00059050" "1" "01542" "01542" "2016-02-19 02:54:44" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000117277" "00116809" "1" "02192" "00006" "2017-08-03 15:16:01" "" "" "SEQ-NG" "DNA" "" "" "0000117323" "00116855" "1" "02192" "00006" "2017-08-03 15:16:01" "" "" "SEQ-NG" "DNA" "" "" "0000117326" "00116858" "1" "02192" "00006" "2017-08-03 15:16:01" "" "" "SEQ-NG" "DNA" "" "" "0000117359" "00116891" "1" "02192" "00006" "2017-08-03 15:16:01" "" "" "SEQ-NG" "DNA" "" "" "0000117369" "00116901" "1" "02192" "00006" "2017-08-03 15:16:01" "" "" "SEQ-NG" "DNA" "" "" "0000117438" "00116970" "1" "02192" "00006" "2017-08-03 15:16:01" "" "" "SEQ-NG" "DNA" "" "" "0000117447" "00116979" "1" "02192" "00006" "2017-08-03 15:16:01" "" "" "SEQ-NG" "DNA" "" "" "0000117480" "00117012" "1" "02192" "00006" "2017-08-03 15:16:01" "" "" "SEQ-NG" "DNA" "" "" "0000117481" "00117013" "1" "02192" "00006" "2017-08-03 15:16:01" "" "" "SEQ-NG" "DNA" "" "" "0000117491" "00117056" "1" "02192" "00006" "2017-08-03 15:16:01" "" "" "SEQ-NG" "DNA" "" "" "0000117502" "00117019" "1" "02192" "00006" "2017-08-03 15:16:01" "" "" "SEQ-NG" "DNA" "" "" "0000117525" "00117049" "1" "02192" "00006" "2017-08-03 15:16:01" "" "" "SEQ-NG" "DNA" "" "" "0000164640" "00163777" "1" "02393" "02393" "2018-04-11 09:15:10" "" "" "SEQ-NG" "DNA" "blood" "" "0000181308" "00016189" "1" "00006" "00006" "2018-09-05 21:23:14" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000209805" "00208756" "1" "01164" "01164" "2018-12-14 14:03:32" "" "" "SEQ-NG" "DNA" "" "" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 22 "{{screeningid}}" "{{geneid}}" "0000004012" "TBC1D24" "0000004013" "TBC1D24" "0000004014" "TBC1D24" "0000004015" "TBC1D24" "0000004016" "TBC1D24" "0000004017" "TBC1D24" "0000004018" "TBC1D24" "0000004019" "TBC1D24" "0000004020" "TBC1D24" "0000004021" "TBC1D24" "0000004022" "TBC1D24" "0000004023" "TBC1D24" "0000004024" "TBC1D24" "0000004025" "TBC1D24" "0000004086" "TBC1D24" "0000004087" "TBC1D24" "0000016107" "TBC1D24" "0000016251" "GPR98" "0000016251" "KCNQ2" "0000016251" "TBC1D24" "0000017846" "TBC1D24" "0000181308" "TBC1D24" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 188 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "0000017084" "21" "75" "16" "2546617" "2546617" "subst" "0" "00059" "TBC1D24_000002" "g.2546617C>A" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2496616C>A" "" "0000017085" "11" "75" "16" "2546835" "2546835" "subst" "0" "00059" "TBC1D24_000001" "g.2546835T>C" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2496834T>C" "" "0000022913" "3" "99" "16" "2546900" "2546900" "subst" "0" "00081" "TBC1D24_000003" "g.2546900T>C" "" "{PMID:Corbett MA et al, 2010:20797691}" "" "" "" "Germline" "yes" "" "0" "" "" "g.2496899T>C" "" "0000022914" "0" "55" "16" "2546588" "2546588" "subst" "0" "00081" "TBC1D24_000004" "g.2546588G>C" "" "{PMID:Falace A et al. 2010:20727515}" "" "" "" "Germline" "" "" "0" "" "" "g.2496587G>C" "" "0000022915" "0" "55" "16" "2550823" "2550823" "subst" "0" "00081" "TBC1D24_000005" "g.2550823C>T" "" "{PMID:Falace A et al. 2010:20727515}" "" "" "" "Germline" "" "" "0" "" "" "g.2500822C>T" "" "0000022916" "3" "99" "16" "2547714" "2547715" "del" "0" "00081" "TBC1D24_000006" "g.2547714_2547715delGT" "" "{PMID:Guven A et al. 2013:23343562}" "" "" "" "Germline" "yes" "" "0" "" "" "g.2497713_2497714delGT" "" "0000022917" "21" "77" "16" "2546873" "2546873" "subst" "0" "00081" "TBC1D24_000007" "g.2546873C>T" "" "{PMID:Campeau et al:24291220}" "pcampeau" "" "" "Germline" "" "" "0" "" "" "g.2496872C>T" "" "0000022918" "11" "55" "16" "2546267" "2546267" "subst" "0" "00081" "TBC1D24_000008" "g.2546267C>T" "" "{PMID:Campeau et al:24291220}" "pcampeau" "" "" "Germline" "yes" "" "0" "" "" "g.2496266C>T" "" "0000022919" "3" "77" "16" "2546873" "2546873" "subst" "0" "00081" "TBC1D24_000007" "g.2546873C>T" "" "{PMID:Campeau et al:24291220}" "pcampeau" "" "" "Germline" "" "" "0" "" "" "g.2496872C>T" "" "0000022921" "21" "55" "16" "2548263" "2548263" "del" "0" "00081" "TBC1D24_000009" "g.2548263delT" "" "{PMID:Campeau et al:24291220}" "pcampeau" "" "" "Germline" "yes" "" "0" "" "" "g.2498262delT" "" "0000022922" "11" "75" "16" "2549426" "2549426" "subst" "0" "00081" "TBC1D24_000010" "g.2549426G>A" "" "{PMID:Campeau et al:24291220}" "pcampeau" "" "" "Germline" "" "" "0" "" "" "g.2499425G>A" "" "0000022923" "3" "55" "16" "2546873" "2546873" "subst" "0" "00081" "TBC1D24_000007" "g.2546873C>T" "" "{PMID:Campeau et al:24291220}" "pcampeau" "" "" "Germline" "" "" "0" "" "" "g.2496872C>T" "" "0000022924" "3" "55" "16" "2546873" "2546873" "subst" "0" "00081" "TBC1D24_000007" "g.2546873C>T" "" "{PMID:Campeau et al:24291220}" "pcampeau" "" "" "Germline" "" "" "0" "" "" "g.2496872C>T" "" "0000022925" "21" "55" "16" "2546207" "2546207" "subst" "0" "00081" "TBC1D24_000019" "g.2546207C>T" "" "{PMID:Campeau et al:24291220}" "pcampeau" "" "" "Germline" "" "" "0" "pcampeau" "" "g.2496206C>T" "" "0000022926" "21" "55" "16" "2546207" "2546207" "subst" "0" "00081" "TBC1D24_000019" "g.2546207C>T" "" "{PMID:Campeau et al:24291220}" "pcampeau" "" "" "Germline" "" "" "0" "pcampeau" "" "g.2496206C>T" "" "0000022927" "21" "55" "16" "2548263" "2548263" "del" "0" "00081" "TBC1D24_000009" "g.2548263delT" "" "{PMID:Campeau et al:24291220}" "pcampeau" "" "" "Germline" "" "" "0" "" "" "g.2498262delT" "" "0000022928" "3" "55" "16" "2546873" "2546873" "subst" "0" "00081" "TBC1D24_000007" "g.2546873C>T" "" "{PMID:Campeau et al:24291220}" "pcampeau" "" "" "Germline" "" "" "0" "" "" "g.2496872C>T" "" "0000022929" "3" "55" "16" "2546268" "2546268" "subst" "0" "00081" "TBC1D24_000012" "g.2546268G>T" "" "{PMID:Campeau et al:24291220}" "pcampeau" "" "" "Germline" "" "" "0" "" "" "g.2496267G>T" "" "0000022930" "21" "55" "16" "2546477" "2546477" "subst" "0" "00081" "TBC1D24_000013" "g.2546477G>A" "" "{PMID:Campeau et al:24291220}" "pcampeau" "" "" "Germline" "" "" "0" "" "" "g.2496476G>A" "" "0000022931" "11" "55" "16" "2546873" "2546873" "subst" "0" "00081" "TBC1D24_000007" "g.2546873C>T" "" "{PMID:Campeau et al:24291220}" "pcampeau" "" "" "Germline" "" "" "0" "" "" "g.2496872C>T" "" "0000022932" "11" "55" "16" "2546873" "2546873" "subst" "0" "00081" "TBC1D24_000007" "g.2546873C>T" "" "{PMID:Campeau et al:24291220}" "pcampeau" "" "" "Germline" "" "" "0" "" "" "g.2496872C>T" "" "0000022933" "11" "55" "16" "2548254" "2548254" "subst" "0" "00081" "TBC1D24_000014" "g.2548254G>T" "" "{PMID:Campeau et al:24291220}" "pcampeau" "" "" "Germline" "" "" "0" "" "" "g.2498253G>T" "" "0000022996" "0" "55" "16" "2546357" "2546357" "subst" "0" "00081" "TBC1D24_000015" "g.2546357G>T" "" "{PMID:Rehman et al., 2014:24387994}" "" "" "" "Germline" "" "" "0" "" "" "g.2496356G>T" "" "0000022997" "3" "55" "16" "2547027" "2547027" "subst" "0" "00081" "TBC1D24_000016" "g.2547027G>C" "" "{PMID:Rehman et al., 2014:24387994}" "" "" "" "Germline" "yes" "" "0" "" "" "g.2497026G>C" "" "0000035784" "1" "75" "16" "2546682" "2546682" "subst" "0" "00670" "TBC1D24_000017" "g.2546682C>T" "" "{PMID:Azaiez 2014:24729539}" "" "" "" "Germline" "yes" "" "0" "" "" "g.2496681C>T" "" "0000035993" "11" "55" "16" "2546790" "2546790" "subst" "0.00109804" "00681" "TBC1D24_000018" "g.2546790G>A" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.2496789G>A" "" "0000038051" "0" "00" "16" "2550426" "2550426" "dup" "0" "00081" "TBC1D24_000020" "g.2550426dup" "" "" "" "" "" "Unknown" "?" "" "0" "" "" "g.2500425dup" "" "0000038052" "0" "00" "16" "2546462" "2546462" "subst" "0" "00081" "TBC1D24_000021" "g.2546462T>C" "" "" "" "" "" "Unknown" "?" "" "0" "" "" "g.2496461T>C" "" "0000047851" "3" "77" "16" "2548334" "2548334" "subst" "0" "00081" "TBC1D24_000022" "g.2548334G>T" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.2498333G>T" "" "0000089815" "3" "90" "16" "2546343" "2546343" "subst" "0" "01542" "TBC1D24_000023" "g.2546343G>T" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.2496342G>T" "" "0000188122" "0" "50" "16" "2546790" "2546790" "subst" "0.00109804" "02192" "TBC1D24_000018" "g.2546790G>A" "4/567 controls" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "" "" "" "Germline" "" "rs200324356" "0" "" "" "g.2496789G>A" "" "0000188168" "0" "50" "16" "2546790" "2546790" "subst" "0.00109804" "02192" "TBC1D24_000018" "g.2546790G>A" "4/567 controls" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "" "" "" "Germline" "" "rs200324356" "0" "" "" "g.2496789G>A" "" "0000188171" "0" "50" "16" "2550870" "2550870" "subst" "0" "02192" "TBC1D24_000029" "g.2550870G>A" "1/567 controls" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "" "" "" "Germline" "" "" "0" "" "" "g.2500869G>A" "" "0000188204" "0" "50" "16" "2546327" "2546327" "subst" "0.0000783208" "02192" "TBC1D24_000025" "g.2546327C>T" "1/567 controls" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "" "" "" "Germline" "" "rs373914077" "0" "" "" "g.2496326C>T" "" "0000188214" "0" "50" "16" "2546790" "2546790" "subst" "0.00109804" "02192" "TBC1D24_000018" "g.2546790G>A" "4/567 controls" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "" "" "" "Germline" "" "rs200324356" "0" "" "" "g.2496789G>A" "" "0000188283" "0" "50" "16" "2546474" "2546474" "subst" "0" "02192" "TBC1D24_000026" "g.2546474C>T" "1/567 controls" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "" "" "" "Germline" "" "rs372337277" "0" "" "" "g.2496473C>T" "" "0000188292" "0" "50" "16" "2548348" "2548348" "subst" "0" "02192" "TBC1D24_000028" "g.2548348C>T" "1/567 controls" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "" "" "stopgain variant" "Germline" "" "" "0" "" "" "g.2498347C>T" "" "0000188362" "0" "50" "16" "2546318" "2546318" "subst" "0.00195771" "02192" "TBC1D24_000024" "g.2546318C>T" "2/194 cases RE" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "" "" "" "Germline" "" "rs202162520" "0" "" "" "g.2496317C>T" "" "0000188506" "0" "50" "16" "2546790" "2546790" "subst" "0.00109804" "02192" "TBC1D24_000018" "g.2546790G>A" "4/567 controls" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "" "" "" "Germline" "" "rs200324356" "0" "" "" "g.2496789G>A" "" "0000188507" "0" "50" "16" "2546318" "2546318" "subst" "0.00195771" "02192" "TBC1D24_000024" "g.2546318C>T" "1/567 controls" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "" "" "" "Germline" "" "rs202162520" "0" "" "" "g.2496317C>T" "" "0000188515" "0" "50" "16" "2546318" "2546318" "subst" "0.00195771" "02192" "TBC1D24_000024" "g.2546318C>T" "2/194 cases RE" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "" "" "" "Germline" "" "rs202162520" "0" "" "" "g.2496317C>T" "" "0000188526" "0" "50" "16" "2546493" "2546493" "subst" "0" "02192" "TBC1D24_000027" "g.2546493G>T" "1/567 controls" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "" "" "" "Germline" "" "" "0" "" "" "g.2496492G>T" "" "0000256155" "0" "50" "16" "2546223" "2546223" "subst" "0" "02333" "TBC1D24_000032" "g.2546223A>G" "" "" "" "TBC1D24(NM_001199107.1):c.74A>G (p.K25R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000311722" "0" "30" "16" "2546143" "2546143" "subst" "0.00143426" "02333" "TBC1D24_000031" "g.2546143C>T" "" "" "" "TBC1D24(NM_001199107.1):c.-7C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000311723" "0" "30" "16" "2548257" "2548257" "subst" "0.00141509" "02325" "TBC1D24_000048" "g.2548257C>T" "" "" "" "TBC1D24(NM_001199107.1):c.1002C>T (p.A334=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000311724" "0" "30" "16" "2550466" "2550466" "subst" "0.00308993" "02325" "TBC1D24_000061" "g.2550466G>A" "" "" "" "TBC1D24(NM_001199107.1):c.1500G>A (p.A500=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000311725" "0" "30" "16" "2546353" "2546353" "subst" "0.000779059" "02325" "TBC1D24_000034" "g.2546353G>A" "" "" "" "TBC1D24(NM_001199107.1):c.204G>A (p.T68=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000311726" "0" "30" "16" "2547034" "2547034" "subst" "0.00828902" "02325" "TBC1D24_000042" "g.2547034C>G" "" "" "" "TBC1D24(NM_001199107.1):c.885C>G (p.F295L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000314385" "0" "30" "16" "2546072" "2546072" "subst" "0" "02333" "TBC1D24_000030" "g.2546072G>A" "" "" "" "TBC1D24(NM_001199107.1):c.-78G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000314386" "0" "30" "16" "2550995" "2550995" "subst" "0.0194269" "02333" "TBC1D24_000065" "g.2550995G>T" "" "" "" "TBC1D24(NM_001199107.1):c.*36G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000314387" "0" "70" "16" "2548348" "2548348" "subst" "0" "02333" "TBC1D24_000028" "g.2548348C>T" "" "" "" "TBC1D24(NM_001199107.1):c.1093C>T (p.Q365*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000314388" "0" "10" "16" "2549352" "2549352" "subst" "0.0198758" "02326" "TBC1D24_000052" "g.2549352C>T" "" "" "" "TBC1D24(NM_001199107.1):c.1143-6C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000314389" "0" "70" "16" "2549385" "2549385" "subst" "0" "02333" "TBC1D24_000053" "g.2549385G>T" "" "" "" "TBC1D24(NM_001199107.1):c.1170G>T (p.E390D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000314390" "0" "30" "16" "2549788" "2549788" "subst" "0.00630424" "02333" "TBC1D24_000055" "g.2549788C>T" "" "" "" "TBC1D24(NM_001199107.1):c.1207-48C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000314391" "0" "30" "16" "2550240" "2550240" "subst" "0" "02333" "TBC1D24_000056" "g.2550240C>T" "" "" "" "TBC1D24(NM_001199107.1):c.1303-29C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000314392" "0" "30" "16" "2550292" "2550292" "subst" "0.00424543" "02326" "TBC1D24_000057" "g.2550292C>T" "" "" "" "TBC1D24(NM_001199107.1):c.1326C>T (p.Y442=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000314393" "0" "30" "16" "2550466" "2550466" "subst" "0.00308993" "02326" "TBC1D24_000061" "g.2550466G>A" "" "" "" "TBC1D24(NM_001199107.1):c.1500G>A (p.A500=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000314394" "0" "30" "16" "2550475" "2550475" "subst" "0.00964841" "02326" "TBC1D24_000062" "g.2550475C>T" "" "" "" "TBC1D24(NM_001199107.1):c.1509C>T (p.S503=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000314395" "0" "30" "16" "2550785" "2550785" "subst" "0.0182755" "02326" "TBC1D24_000064" "g.2550785C>T" "" "" "" "TBC1D24(NM_001199107.1):c.1526-20C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000314396" "0" "30" "16" "2550781" "2550781" "subst" "0.0204464" "02333" "TBC1D24_000063" "g.2550781G>A" "" "" "" "TBC1D24(NM_001199107.1):c.1526-24G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000314397" "0" "30" "16" "2546341" "2546341" "subst" "0" "02333" "TBC1D24_000033" "g.2546341C>T" "" "" "" "TBC1D24(NM_001199107.1):c.192C>T (p.C64=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000314398" "0" "30" "16" "2546353" "2546353" "subst" "0.000779059" "02326" "TBC1D24_000034" "g.2546353G>A" "" "" "" "TBC1D24(NM_001199107.1):c.204G>A (p.T68=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000314400" "0" "30" "16" "2546970" "2546970" "subst" "0" "02333" "TBC1D24_000040" "g.2546970G>A" "" "" "" "TBC1D24(NM_001199107.1):c.821G>A (p.R274K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000314401" "0" "10" "16" "2547034" "2547034" "subst" "0.00828902" "02326" "TBC1D24_000042" "g.2547034C>G" "" "" "" "TBC1D24(NM_001199107.1):c.885C>G (p.F295L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000314402" "0" "30" "16" "2547154" "2547154" "subst" "0.00283953" "02333" "TBC1D24_000044" "g.2547154G>A" "" "" "" "TBC1D24(NM_001199107.1):c.965+40G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000314403" "0" "30" "16" "2547121" "2547121" "subst" "0" "02333" "TBC1D24_000043" "g.2547121C>T" "" "" "" "TBC1D24(NM_001199107.1):c.965+7C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000314404" "0" "10" "16" "2547867" "2547867" "subst" "0" "02333" "TBC1D24_000047" "g.2547867C>T" "" "" "" "TBC1D24(NM_001199107.1):c.983+139C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000314405" "0" "30" "16" "2547803" "2547803" "subst" "0" "02333" "TBC1D24_000045" "g.2547803T>G" "" "" "" "TBC1D24(NM_001199107.1):c.983+75T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000314406" "0" "30" "16" "2547823" "2547823" "subst" "0" "02333" "TBC1D24_000046" "g.2547823G>A" "" "" "" "TBC1D24(NM_001199107.1):c.983+95G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000316246" "0" "30" "16" "2548257" "2548257" "subst" "0.00141509" "01943" "TBC1D24_000048" "g.2548257C>T" "" "" "" "TBC1D24(NM_001199107.1):c.1002C>T (p.A334=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000316247" "0" "90" "16" "2548263" "2548263" "del" "0.000163399" "01943" "TBC1D24_000049" "g.2548263del" "" "" "" "TBC1D24(NM_001199107.1):c.1008del (p.(His336fs))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000316248" "0" "50" "16" "2548339" "2548339" "subst" "0" "02333" "TBC1D24_000051" "g.2548339G>A" "" "" "" "TBC1D24(NM_001199107.1):c.1084G>A (p.A362T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000316249" "0" "10" "16" "2549352" "2549352" "subst" "0.0198758" "01943" "TBC1D24_000052" "g.2549352C>T" "" "" "" "TBC1D24(NM_001199107.1):c.1143-6C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000316250" "0" "50" "16" "2549411" "2549411" "subst" "0.00278308" "01943" "TBC1D24_000054" "g.2549411C>T" "" "" "" "TBC1D24(NM_001199107.1):c.1196C>T (p.T399M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000316251" "0" "30" "16" "2550292" "2550292" "subst" "0.00424543" "01943" "TBC1D24_000057" "g.2550292C>T" "" "" "" "TBC1D24(NM_001199107.1):c.1326C>T (p.Y442=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000316252" "0" "30" "16" "2550333" "2550333" "subst" "0.000159008" "02333" "TBC1D24_000058" "g.2550333C>T" "" "" "" "TBC1D24(NM_001199107.1):c.1367C>T (p.P456L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000316253" "0" "50" "16" "2550377" "2550377" "subst" "0.0000795925" "02333" "TBC1D24_000059" "g.2550377G>A" "" "" "" "TBC1D24(NM_001199107.1):c.1411G>A (p.A471T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000316254" "0" "50" "16" "2550393" "2550393" "subst" "0.00302789" "02333" "TBC1D24_000060" "g.2550393C>A" "" "" "" "TBC1D24(NM_001199107.1):c.1427C>A (p.A476D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000316255" "0" "30" "16" "2550466" "2550466" "subst" "0.00308993" "01943" "TBC1D24_000061" "g.2550466G>A" "" "" "" "TBC1D24(NM_001199107.1):c.1500G>A (p.A500=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000316256" "0" "30" "16" "2550475" "2550475" "subst" "0.00964841" "01943" "TBC1D24_000062" "g.2550475C>T" "" "" "" "TBC1D24(NM_001199107.1):c.1509C>T (p.S503=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000316257" "0" "10" "16" "2550785" "2550785" "subst" "0.0182755" "01943" "TBC1D24_000064" "g.2550785C>T" "" "" "" "TBC1D24(NM_001199107.1):c.1526-20C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000316258" "0" "30" "16" "2546356" "2546356" "subst" "0.0596945" "02333" "TBC1D24_000035" "g.2546356T>C" "" "" "" "TBC1D24(NM_001199107.1):c.207T>C (p.=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000316259" "0" "30" "16" "2546695" "2546695" "subst" "0" "02333" "TBC1D24_000037" "g.2546695G>A" "" "" "" "TBC1D24(NM_001199107.1):c.546G>A (p.T182=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000316260" "0" "50" "16" "2546771" "2546788" "del" "0" "02333" "TBC1D24_000038" "g.2546771_2546788del" "" "" "" "TBC1D24(NM_001199107.1):c.622_639delGTCTATGCGGACTGGCAG (p.V208_Q213del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000316261" "0" "30" "16" "2546851" "2546851" "subst" "0.000314762" "02333" "TBC1D24_000039" "g.2546851G>A" "" "" "" "TBC1D24(NM_001199107.1):c.702G>A (p.V234=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000316262" "0" "50" "16" "2547015" "2547015" "subst" "0" "02333" "TBC1D24_000041" "g.2547015C>T" "" "" "" "TBC1D24(NM_001199107.1):c.866C>T (p.A289V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000316263" "0" "30" "16" "2547034" "2547034" "subst" "0.00828902" "01943" "TBC1D24_000042" "g.2547034C>G" "" "" "" "TBC1D24(NM_001199107.1):c.885C>G (p.F295L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000324492" "0" "50" "16" "2521796" "2521796" "subst" "0" "02333" "NTN3_000001" "g.2521796G>A" "" "" "" "NTN3(NM_006181.2):c.94G>A (p.(Asp32Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000324493" "0" "50" "16" "2521847" "2521900" "del" "0" "02333" "NTN3_000002" "g.2521847_2521900del" "" "" "" "NTN3(NM_006181.2):c.142_195del (p.(Leu49_Ala66del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000324495" "0" "30" "16" "2521923" "2521923" "subst" "0" "02333" "NTN3_000003" "g.2521923G>C" "" "" "" "NTN3(NM_006181.2):c.221G>C (p.(Arg74Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000324496" "0" "30" "16" "2522180" "2522180" "subst" "0.0000769941" "02333" "NTN3_000004" "g.2522180C>T" "" "" "" "NTN3(NM_006181.2):c.478C>T (p.(Arg160Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000324497" "0" "30" "16" "2522322" "2522322" "subst" "0" "02333" "NTN3_000005" "g.2522322G>A" "" "" "" "NTN3(NM_006181.2):c.620G>A (p.(Ser207Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000324498" "0" "30" "16" "2522323" "2522323" "subst" "0" "02333" "NTN3_000006" "g.2522323C>A" "" "" "" "NTN3(NM_006181.2):c.621C>A (p.(Ser207Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000324499" "0" "50" "16" "2522438" "2522457" "del" "0" "02333" "NTN3_000007" "g.2522438_2522457del" "" "" "" "NTN3(NM_006181.2):c.736_755del (p.(Ala246ArgfsTer32))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000324501" "0" "50" "16" "2522462" "2522469" "del" "0" "02333" "NTN3_000008" "g.2522462_2522469del" "" "" "" "NTN3(NM_006181.2):c.760_767del (p.(Arg254ValfsTer28))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000324502" "0" "50" "16" "2522473" "2522482" "del" "0" "02333" "NTN3_000009" "g.2522473_2522482del" "" "" "" "NTN3(NM_006181.2):c.771_780del (p.(Cys257TrpfsTer13))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000324503" "0" "50" "16" "2522486" "2522515" "del" "0" "02333" "NTN3_000010" "g.2522486_2522515del" "" "" "" "NTN3(NM_006181.2):c.783_812del (p.(Ser262_His271del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000324504" "0" "30" "16" "2522726" "2522726" "subst" "0" "02333" "NTN3_000011" "g.2522726G>A" "" "" "" "NTN3(NM_006181.2):c.953G>A (p.(Arg318His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000324505" "0" "50" "16" "2523787" "2523798" "del" "0" "02333" "NTN3_000012" "g.2523787_2523798del" "" "" "" "NTN3(NM_006181.2):c.1414_1425del (p.(Arg473_Ala476del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000324506" "0" "50" "16" "2546443" "2546443" "subst" "0" "02333" "TBC1D24_000036" "g.2546443C>A" "" "" "" "TBC1D24(NM_001199107.1):c.294C>A (p.(Asn98Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000324507" "0" "50" "16" "2548263" "2548263" "del" "0.000163399" "01804" "TBC1D24_000049" "g.2548263del" "" "" "" "TBC1D24(NM_001199107.1):c.1008del (p.(His336fs))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000324508" "0" "50" "16" "2548334" "2548334" "subst" "0" "01804" "TBC1D24_000050" "g.2548334G>A" "" "" "" "TBC1D24(NM_020705.2):c.1061G>A (p.Arg354His)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000337630" "0" "30" "16" "2551015" "2551015" "subst" "0" "02333" "TBC1D24_000069" "g.2551015C>T" "" "" "" "TBC1D24(NM_001199107.1):c.*56C>T (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000342716" "0" "50" "16" "2548334" "2548334" "subst" "0" "02327" "TBC1D24_000050" "g.2548334G>A" "" "" "" "TBC1D24(NM_020705.2):c.1061G>A (p.Arg354His)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000344471" "0" "30" "16" "2546171" "2546171" "subst" "0.0000790139" "02327" "TBC1D24_000066" "g.2546171T>C" "" "" "" "TBC1D24(NM_001199107.1):c.22T>C (p.Cys8Arg)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000349596" "0" "50" "16" "2546346" "2546346" "subst" "0.0000779788" "02333" "TBC1D24_000067" "g.2546346C>T" "" "" "" "TBC1D24(NM_001199107.1):c.197C-T (p.Thr66Met)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "0000368213" "3" "70" "16" "2546343" "2546343" "subst" "0" "02393" "TBC1D24_000023" "g.2546343G>T" "0/220 chromosomes" "" "" "" "" "Germline" "yes" "rs878853232" "0" "" "" "g.2496342G>T" "{CVvar:000225038.1}" "0000398607" "0" "70" "16" "2546768" "2546768" "subst" "0" "02550" "TBC1D24_000080" "g.2546768C>T" "" "" "" "c.619C>T" "" "Somatic" "yes" "" "0" "" "" "" "" "0000398608" "0" "70" "16" "2547015" "2547015" "subst" "0" "02550" "TBC1D24_000041" "g.2547015C>T" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "" "" "0000401452" "11" "70" "16" "2546265" "2546265" "subst" "0" "02550" "TBC1D24_000070" "g.2546265C>T" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "" "" "0000401453" "21" "70" "16" "2550465" "2550465" "subst" "0" "02550" "TBC1D24_000084" "g.2550465C>T" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "" "" "0000401454" "0" "70" "16" "2546265" "2546265" "subst" "0" "02550" "TBC1D24_000070" "g.2546265C>T" "" "" "" "" "" "Somatic" "" "" "0" "" "" "" "" "0000401455" "0" "70" "16" "2550465" "2550465" "subst" "0" "02550" "TBC1D24_000084" "g.2550465C>T" "" "" "" "" "" "Somatic" "" "" "0" "" "" "" "" "0000401456" "11" "70" "16" "2549368" "2549368" "subst" "0" "02550" "TBC1D24_000083" "g.2549368C>T" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "" "" "0000401457" "21" "70" "16" "2550465" "2550465" "subst" "0" "02550" "TBC1D24_000084" "g.2550465C>T" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "" "" "0000401458" "21" "70" "16" "2550465" "2550465" "subst" "0" "02550" "TBC1D24_000084" "g.2550465C>T" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "" "" "0000401459" "11" "70" "16" "2546874" "2546874" "subst" "0" "02550" "TBC1D24_000082" "g.2546874G>A" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "" "" "0000401460" "11" "70" "16" "2550483" "2550485" "del" "0" "02550" "TBC1D24_000085" "g.2550483_2550485del" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "" "" "0000401461" "21" "70" "16" "2546265" "2546265" "subst" "0" "02550" "TBC1D24_000070" "g.2546265C>T" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "" "" "0000401462" "21" "70" "16" "2546265" "2546265" "subst" "0" "02550" "TBC1D24_000070" "g.2546265C>T" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "" "" "0000401463" "11" "70" "16" "2546390" "2546401" "del" "0" "02550" "TBC1D24_000075" "g.2546390_2546401del" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "" "" "0000401464" "21" "70" "16" "2546553" "2546553" "subst" "0" "02550" "TBC1D24_000076" "g.2546553C>T" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "" "" "0000401465" "11" "70" "16" "2546606" "2546606" "subst" "0" "02550" "TBC1D24_000079" "g.2546606G>T" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "" "" "0000401466" "11" "70" "16" "2546591" "2546591" "subst" "0" "02550" "TBC1D24_000078" "g.2546591G>A" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "" "" "0000401467" "21" "70" "16" "2546580" "2546580" "subst" "0" "02550" "TBC1D24_000077" "g.2546580A>G" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "" "" "0000401468" "11" "70" "16" "2546378" "2546389" "del" "0" "02550" "TBC1D24_000074" "g.2546378_2546389del" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "" "" "0000401469" "21" "70" "16" "2549368" "2549368" "subst" "0" "02550" "TBC1D24_000083" "g.2549368C>T" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "" "" "0000401470" "21" "70" "16" "2546390" "2546401" "del" "0" "02550" "TBC1D24_000075" "g.2546390_2546401del" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "" "" "0000401471" "10" "70" "16" "2546288" "2546288" "subst" "0" "02550" "TBC1D24_000072" "g.2546288A>G" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "" "" "0000401472" "10" "70" "16" "2550823" "2550823" "subst" "0" "02550" "TBC1D24_000005" "g.2550823C>T" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "" "" "0000401473" "21" "70" "16" "2550465" "2550465" "subst" "0" "02550" "TBC1D24_000084" "g.2550465C>T" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "" "" "0000401474" "11" "70" "16" "2546268" "2546268" "subst" "0" "02550" "TBC1D24_000071" "g.2546268G>A" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "" "" "0000401475" "21" "70" "16" "2546390" "2546401" "del" "0" "02550" "TBC1D24_000075" "g.2546390_2546401del" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "" "" "0000401476" "21" "70" "16" "2546390" "2546401" "del" "0" "02550" "TBC1D24_000075" "g.2546390_2546401del" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "" "" "0000401477" "11" "70" "16" "2550803" "2550803" "subst" "0" "02550" "TBC1D24_000086" "g.2550803A>C" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "" "" "0000401478" "21" "70" "16" "2546553" "2546553" "subst" "0" "02550" "TBC1D24_000076" "g.2546553C>T" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "" "" "0000401479" "11" "70" "16" "2546828" "2546828" "subst" "0" "02550" "TBC1D24_000081" "g.2546828C>T" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "" "" "0000401481" "11" "70" "16" "2546265" "2546265" "subst" "0" "02550" "TBC1D24_000070" "g.2546265C>T" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "" "" "0000401483" "21" "70" "16" "2546390" "2546401" "del" "0" "02550" "TBC1D24_000075" "g.2546390_2546401del" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "" "" "0000401484" "11" "70" "16" "2546390" "2546401" "del" "0" "02550" "TBC1D24_000075" "g.2546390_2546401del" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "" "" "0000401485" "21" "70" "16" "2550465" "2550465" "subst" "0" "02550" "TBC1D24_000084" "g.2550465C>T" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "" "" "0000401486" "21" "70" "16" "2546265" "2546265" "subst" "0" "02550" "TBC1D24_000070" "g.2546265C>T" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "" "" "0000401487" "11" "70" "16" "2546390" "2546401" "del" "0" "02550" "TBC1D24_000075" "g.2546390_2546401del" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "" "" "0000401488" "11" "70" "16" "2546300" "2546300" "subst" "0" "02550" "TBC1D24_000073" "g.2546300C>T" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "" "" "0000401490" "21" "70" "16" "2546390" "2546401" "del" "0" "02550" "TBC1D24_000075" "g.2546390_2546401del" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "" "" "0000401491" "10" "70" "16" "2546768" "2546768" "subst" "0" "02550" "TBC1D24_000080" "g.2546768C>T" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "" "" "0000401492" "21" "70" "16" "2547015" "2547015" "subst" "0" "02550" "TBC1D24_000041" "g.2547015C>T" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "" "" "0000401493" "21" "70" "16" "2546265" "2546265" "subst" "0" "02550" "TBC1D24_000070" "g.2546265C>T" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "" "" "0000401494" "11" "70" "16" "2550465" "2550465" "subst" "0" "02550" "TBC1D24_000084" "g.2550465C>T" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "" "" "0000403833" "11" "70" "16" "2546268" "2546268" "subst" "0" "02550" "TBC1D24_000071" "g.2546268G>A" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "" "" "0000403834" "21" "70" "16" "2546390" "2546401" "del" "0" "02550" "TBC1D24_000075" "g.2546390_2546401del" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "" "" "0000403835" "21" "70" "16" "2546390" "2546401" "del" "0" "02550" "TBC1D24_000075" "g.2546390_2546401del" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "" "" "0000404995" "1" "75" "16" "2546682" "2546682" "subst" "0" "00671" "TBC1D24_000017" "g.2546682C>T" "" "{PMID:Zhang 2014:24729547}" "" "" "" "Germline" "yes" "" "0" "" "" "g.2496681C>T" "" "0000440023" "0" "50" "16" "2550957" "2550957" "subst" "0" "01164" "TBC1D24_000087" "g.2550957T>C" "" "" "" "" "not regarded causative for phenotype in this patient, AR and no second path variant detected in TBC1D24; co-occurrence with pathogenic variant in PRRT2 which segregates with phenotype in this family" "Germline" "" "" "0" "" "" "" "" "0000557668" "0" "50" "16" "2522122" "2522122" "subst" "0" "02333" "TBC1D24_000088" "g.2522122T>A" "" "" "" "NTN3(NM_006181.2):c.420T>A (p.(His140Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "0000557669" "0" "30" "16" "2522388" "2522388" "subst" "0" "02333" "TBC1D24_000089" "g.2522388C>G" "" "" "" "NTN3(NM_006181.2):c.686C>G (p.(Thr229Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "0000557670" "0" "30" "16" "2522771" "2522771" "subst" "0" "02333" "TBC1D24_000090" "g.2522771G>A" "" "" "" "NTN3(NM_006181.2):c.998G>A (p.(Arg333His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "0000557671" "0" "30" "16" "2546171" "2546171" "subst" "0.0000790139" "01804" "TBC1D24_000066" "g.2546171T>C" "" "" "" "TBC1D24(NM_001199107.1):c.22T>C (p.Cys8Arg)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "0000557672" "0" "50" "16" "2546267" "2546267" "subst" "0" "02333" "TBC1D24_000008" "g.2546267C>T" "" "" "" "TBC1D24(NM_001199107.1):c.118C>T (p.(Arg40Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "0000557673" "0" "50" "16" "2546318" "2546318" "subst" "0.00195771" "01943" "TBC1D24_000024" "g.2546318C>T" "" "" "" "TBC1D24(NM_001199107.1):c.169C>T (p.R57C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "0000557674" "0" "30" "16" "2546318" "2546318" "subst" "0.00195771" "01804" "TBC1D24_000024" "g.2546318C>T" "" "" "" "TBC1D24(NM_001199107.1):c.169C>T (p.R57C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "0000557675" "0" "30" "16" "2546318" "2546318" "subst" "0.00195771" "02326" "TBC1D24_000024" "g.2546318C>T" "" "" "" "TBC1D24(NM_001199107.1):c.169C>T (p.R57C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "0000557676" "0" "30" "16" "2546328" "2546328" "subst" "0.000391175" "02333" "TBC1D24_000091" "g.2546328G>A" "" "" "" "TBC1D24(NM_001199107.1):c.179G>A (p.R60Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "0000557677" "0" "30" "16" "2546353" "2546353" "subst" "0.000779059" "01943" "TBC1D24_000034" "g.2546353G>A" "" "" "" "TBC1D24(NM_001199107.1):c.204G>A (p.T68=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "0000557678" "0" "30" "16" "2546533" "2546533" "subst" "0" "02333" "TBC1D24_000092" "g.2546533C>T" "" "" "" "TBC1D24(NM_001199107.1):c.384C>T (p.I128=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "0000557679" "0" "50" "16" "2546558" "2546558" "subst" "0" "02333" "TBC1D24_000093" "g.2546558G>A" "" "" "" "TBC1D24(NM_001199107.1):c.409G>A (p.V137M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "0000557680" "0" "50" "16" "2546567" "2546567" "subst" "0" "02333" "TBC1D24_000094" "g.2546567C>G" "" "" "" "TBC1D24(NM_001199107.1):c.418C>G (p.L140V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "0000557681" "0" "30" "16" "2546587" "2546587" "subst" "0" "02333" "TBC1D24_000095" "g.2546587C>T" "" "" "" "TBC1D24(NM_001199107.1):c.438C>T (p.I146=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "0000557682" "0" "50" "16" "2546606" "2546606" "subst" "0.0000776639" "01804" "TBC1D24_000096" "g.2546606G>A" "" "" "" "TBC1D24(NM_020705.2):c.457G>A (p.Glu153Lys)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "0000557683" "0" "70" "16" "2546606" "2546606" "subst" "0.0000776639" "02327" "TBC1D24_000096" "g.2546606G>A" "" "" "" "TBC1D24(NM_020705.2):c.457G>A (p.Glu153Lys)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "0000557685" "0" "50" "16" "2546883" "2546883" "subst" "0.0000785669" "02333" "TBC1D24_000097" "g.2546883T>C" "" "" "" "TBC1D24(NM_001199107.1):c.734T>C (p.(Leu245Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "0000557686" "0" "30" "16" "2546934" "2546934" "subst" "0.00249688" "02333" "TBC1D24_000098" "g.2546934C>T" "" "" "" "TBC1D24(NM_001199107.1):c.785C>T (p.S262L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "0000557687" "0" "30" "16" "2547034" "2547034" "subst" "0.00828902" "01804" "TBC1D24_000042" "g.2547034C>G" "" "" "" "TBC1D24(NM_001199107.1):c.885C>G (p.F295L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "0000557688" "0" "30" "16" "2547124" "2547124" "subst" "0" "02333" "TBC1D24_000099" "g.2547124C>T" "" "" "" "TBC1D24(NM_001199107.1):c.965+10C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "0000557689" "0" "90" "16" "2548263" "2548263" "del" "0.000163399" "02327" "TBC1D24_000049" "g.2548263del" "" "" "" "TBC1D24(NM_001199107.1):c.1008del (p.(His336fs))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "0000557690" "0" "30" "16" "2548281" "2548281" "subst" "0.000156838" "02333" "TBC1D24_000100" "g.2548281G>A" "" "" "" "TBC1D24(NM_001199107.1):c.1026G>A (p.S342=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "0000557691" "0" "30" "16" "2548380" "2548380" "subst" "0" "02333" "TBC1D24_000101" "g.2548380C>T" "" "" "" "TBC1D24(NM_001199107.1):c.1125C>T (p.H375=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "0000557692" "0" "30" "16" "2549411" "2549411" "subst" "0.00278308" "02326" "TBC1D24_000054" "g.2549411C>T" "" "" "" "TBC1D24(NM_001199107.1):c.1196C>T (p.T399M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "0000557693" "0" "30" "16" "2549485" "2549506" "del" "0" "02333" "TBC1D24_000102" "g.2549485_2549506del" "" "" "" "TBC1D24(NM_001199107.1):c.1206+64_1206+85delCCAGGGCTGGCTCTGATGGGCT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "0000557694" "0" "50" "16" "2549873" "2549873" "subst" "0" "02333" "TBC1D24_000103" "g.2549873G>A" "" "" "" "TBC1D24(NM_001199107.1):c.1244G>A (p.R415K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "0000557695" "0" "90" "16" "2549877" "2549877" "del" "0" "02333" "TBC1D24_000104" "g.2549877del" "" "" "" "TBC1D24(NM_001199107.1):c.1248delT (p.N416Kfs*31)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "0000557696" "0" "50" "16" "2550287" "2550287" "subst" "0" "02333" "TBC1D24_000105" "g.2550287C>T" "" "" "" "TBC1D24(NM_001199107.1):c.1321C>T (p.R441C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "0000557697" "0" "10" "16" "2550406" "2550406" "subst" "0.0201401" "01943" "TBC1D24_000106" "g.2550406G>A" "" "" "" "TBC1D24(NM_001199107.1):c.1440G>A (p.S480=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "0000557698" "0" "10" "16" "2550406" "2550406" "subst" "0.0201401" "02326" "TBC1D24_000106" "g.2550406G>A" "" "" "" "TBC1D24(NM_001199107.1):c.1440G>A (p.S480=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "0000557699" "0" "30" "16" "2550508" "2550508" "subst" "0" "02333" "TBC1D24_000107" "g.2550508G>A" "" "" "" "TBC1D24(NM_001199107.1):c.1525+17G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "0000557700" "0" "30" "16" "2550849" "2550849" "subst" "0.0000783208" "02333" "TBC1D24_000108" "g.2550849C>T" "" "" "" "TBC1D24(NM_001199107.1):c.1570C>T (p.R524W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "0000557701" "0" "30" "16" "2550850" "2550850" "subst" "0" "02333" "TBC1D24_000109" "g.2550850G>A" "" "" "" "TBC1D24(NM_001199107.1):c.1571G>A (p.(Arg524Gln), p.(Arg518Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "0000557702" "0" "30" "16" "2550955" "2550955" "subst" "0" "02333" "TBC1D24_000110" "g.2550955A>G" "" "" "" "TBC1D24(NM_001199107.1):c.1676A>G (p.Q559R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes TBC1D24 ## Count = 362 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "{{VariantOnTranscript/Classification}}" "0000017084" "00001779" "75" "468" "0" "468" "0" "c.468C>A" "r.(?)" "p.(Cys156*)" "2" "" "0000017085" "00001779" "75" "686" "0" "686" "0" "c.686T>C" "r.(?)" "p.(Phe229Ser)" "2" "" "0000022913" "00023820" "55" "751" "0" "751" "0" "c.751T>C" "r.(?)" "p.(Phe251Leu)" "2" "" "0000022913" "00001779" "55" "751" "0" "751" "0" "c.751T>C" "r.(?)" "p.(Phe251Leu)" "2" "" "0000022914" "00023820" "55" "439" "0" "439" "0" "c.439G>C" "r.(?)" "p.(Asp147His)" "2" "" "0000022914" "00001779" "55" "439" "0" "439" "0" "c.439G>C" "r.(?)" "p.(Asp147His)" "2" "" "0000022915" "00023820" "55" "1526" "0" "1526" "0" "c.1526C>T" "r.(?)" "p.(Ala509Val)" "7" "" "0000022915" "00001779" "55" "1544" "0" "1544" "0" "c.1544C>T" "r.(?)" "p.(Ala515Val)" "8" "" "0000022916" "00001779" "55" "969" "0" "970" "0" "c.969_970delGT" "r.(?)" "p.(Ser324Thrfs*3)" "3" "" "0000022917" "00023820" "55" "724" "0" "724" "0" "c.724C>T" "r.(?)" "p.(Arg242Cys)" "2" "" "0000022917" "00001779" "55" "724" "0" "724" "0" "c.724C>T" "r.(?)" "p.(Arg242Cys)" "2" "" "0000022918" "00023820" "55" "118" "0" "118" "0" "c.118C>T" "r.(?)" "p.(Arg40Cys)" "2" "" "0000022918" "00001779" "55" "118" "0" "118" "0" "c.118C>T" "r.(?)" "p.(Arg40Cys)" "2" "" "0000022919" "00023820" "55" "724" "0" "724" "0" "c.724C>T" "r.(?)" "p.(Arg242Cys)" "2" "" "0000022919" "00001779" "55" "724" "0" "724" "0" "c.724C>T" "r.(?)" "p.(Arg242Cys)" "2" "" "0000022921" "00023820" "55" "990" "0" "990" "0" "c.990delT" "r.(?)" "p.(His330Glnfs*12)" "3" "" "0000022921" "00001779" "55" "1008" "0" "1008" "0" "c.1008delT" "r.(?)" "p.(His336Glnfs*12)" "4" "" "0000022922" "00023820" "55" "1188" "5" "1188" "5" "c.1188+5G>A" "r.spl" "p.?" "5" "" "0000022922" "00001779" "55" "1206" "5" "1206" "5" "c.1206+5G>A" "r.spl" "p.?" "5" "" "0000022923" "00023820" "55" "724" "0" "724" "0" "c.724C>T" "r.(?)" "p.(Arg242Cys)" "2" "" "0000022923" "00001779" "55" "724" "0" "724" "0" "c.724C>T" "r.(?)" "p.(Arg242Cys)" "2" "" "0000022924" "00023820" "55" "724" "0" "724" "0" "c.724C>T" "r.(?)" "p.(Arg242Cys)" "2" "" "0000022924" "00001779" "55" "724" "0" "724" "0" "c.724C>T" "r.(?)" "p.(Arg242Cys)" "2" "" "0000022925" "00023820" "55" "58" "0" "58" "0" "c.58C>T" "r.(?)" "p.(Gln20*)" "2" "" "0000022925" "00001779" "55" "58" "0" "58" "0" "c.58C>T" "r.(?)" "p.(Gln20*)" "2" "" "0000022926" "00023820" "55" "58" "0" "58" "0" "c.58C>T" "r.(?)" "p.(Gln20*)" "2" "" "0000022926" "00001779" "55" "58" "0" "58" "0" "c.58C>T" "r.(?)" "p.(Gln20*)" "2" "" "0000022927" "00023820" "55" "990" "0" "990" "0" "c.990delT" "r.(?)" "p.(His330Glnfs*12)" "3" "" "0000022927" "00001779" "55" "1008" "0" "1008" "0" "c.1008delT" "r.(?)" "p.(His336Glnfs*12)" "4" "" "0000022928" "00023820" "55" "724" "0" "724" "0" "c.724C>T" "r.(?)" "p.(Arg242Cys)" "2" "" "0000022928" "00001779" "55" "724" "0" "724" "0" "c.724C>T" "r.(?)" "p.(Arg242Cys)" "2" "" "0000022929" "00023820" "55" "119" "0" "119" "0" "c.119G>T" "r.(?)" "p.(Arg40Leu)" "2" "" "0000022929" "00001779" "55" "119" "0" "119" "0" "c.119G>T" "r.(?)" "p.(Arg40Leu)" "2" "" "0000022930" "00023820" "55" "328" "0" "328" "0" "c.328G>A" "r.(?)" "p.(Gly110Ser)" "2" "" "0000022930" "00001779" "55" "328" "0" "328" "0" "c.328G>A" "r.(?)" "p.(Gly110Ser)" "2" "" "0000022931" "00023820" "55" "724" "0" "724" "0" "c.724C>T" "r.(?)" "p.(Arg242Cys)" "2" "" "0000022931" "00001779" "55" "724" "0" "724" "0" "c.724C>T" "r.(?)" "p.(Arg242Cys)" "2" "" "0000022932" "00023820" "55" "724" "0" "724" "0" "c.724C>T" "r.(?)" "p.(Arg242Cys)" "2" "" "0000022932" "00001779" "55" "724" "0" "724" "0" "c.724C>T" "r.(?)" "p.(Arg242Cys)" "2" "" "0000022933" "00023820" "55" "981" "0" "981" "0" "c.981G>T" "r.(?)" "p.(Leu327Phe)" "3" "" "0000022933" "00001779" "55" "999" "0" "999" "0" "c.999G>T" "r.(?)" "p.(Leu333Phe)" "4" "" "0000022996" "00023820" "55" "208" "0" "208" "0" "c.208G>T" "r.(?)" "p.(Asp70Tyr)" "2" "" "0000022996" "00001779" "55" "208" "0" "208" "0" "c.208G>T" "r.(?)" "p.(Asp70Tyr)" "2" "" "0000022997" "00023820" "55" "878" "0" "878" "0" "c.878G>C" "r.(?)" "p.(Arg293Pro)" "2" "" "0000022997" "00001779" "55" "878" "0" "878" "0" "c.878G>C" "r.(?)" "p.(Arg293Pro)" "2" "" "0000035784" "00001779" "75" "533" "0" "533" "0" "c.533C>T" "r.(?)" "p.(Ser178Leu)" "2" "likely pathogenic (dominant)" "0000035993" "00023820" "55" "641" "0" "641" "0" "c.641G>A" "r.(?)" "p.(Arg214His)" "2" "" "0000038051" "00023820" "00" "1442" "0" "1442" "0" "c.1442dup" "r.(?)" "p.(His481Glnfs*71)" "" "" "0000038051" "00001779" "00" "1460" "0" "1460" "0" "c.1460dup" "r.(?)" "p.(His487Glnfs*71)" "" "" "0000038052" "00023820" "00" "313" "0" "313" "0" "c.313T>C" "r.(?)" "p.(Cys105Arg)" "" "" "0000038052" "00001779" "00" "313" "0" "313" "0" "c.313T>C" "r.(?)" "p.(Cys105Arg)" "" "" "0000047851" "00001779" "00" "1079" "0" "1079" "0" "c.1079G>T" "r.(?)" "p.(Arg360Leu)" "" "" "0000089815" "00001779" "90" "194" "0" "194" "0" "c.194G>T" "r.(?)" "p.(Arg65Leu)" "2" "" "0000188122" "00023820" "00" "641" "0" "641" "0" "c.641G>A" "r.(?)" "p.(Arg214His)" "" "" "0000188122" "00001779" "00" "641" "0" "641" "0" "c.641G>A" "r.(?)" "p.(Arg214His)" "" "" "0000188168" "00023820" "00" "641" "0" "641" "0" "c.641G>A" "r.(?)" "p.(Arg214His)" "" "" "0000188168" "00001779" "00" "641" "0" "641" "0" "c.641G>A" "r.(?)" "p.(Arg214His)" "" "" "0000188171" "00023820" "00" "1573" "0" "1573" "0" "c.1573G>A" "r.(?)" "p.(Asp525Asn)" "" "" "0000188171" "00001779" "00" "1591" "0" "1591" "0" "c.1591G>A" "r.(?)" "p.(Asp531Asn)" "" "" "0000188204" "00023820" "00" "178" "0" "178" "0" "c.178C>T" "r.(?)" "p.(Arg60Trp)" "" "" "0000188204" "00001779" "00" "178" "0" "178" "0" "c.178C>T" "r.(?)" "p.(Arg60Trp)" "" "" "0000188214" "00023820" "00" "641" "0" "641" "0" "c.641G>A" "r.(?)" "p.(Arg214His)" "" "" "0000188214" "00001779" "00" "641" "0" "641" "0" "c.641G>A" "r.(?)" "p.(Arg214His)" "" "" "0000188283" "00023820" "00" "325" "0" "325" "0" "c.325C>T" "r.(?)" "p.(Arg109Cys)" "" "" "0000188283" "00001779" "00" "325" "0" "325" "0" "c.325C>T" "r.(?)" "p.(Arg109Cys)" "" "" "0000188292" "00023820" "00" "1075" "0" "1075" "0" "c.1075C>T" "r.(?)" "p.(Gln359*)" "" "" "0000188292" "00001779" "00" "1093" "0" "1093" "0" "c.1093C>T" "r.(?)" "p.(Gln365*)" "" "" "0000188362" "00023820" "00" "169" "0" "169" "0" "c.169C>T" "r.(?)" "p.(Arg57Cys)" "" "" "0000188362" "00001779" "00" "169" "0" "169" "0" "c.169C>T" "r.(?)" "p.(Arg57Cys)" "" "" "0000188506" "00023820" "00" "641" "0" "641" "0" "c.641G>A" "r.(?)" "p.(Arg214His)" "" "" "0000188506" "00001779" "00" "641" "0" "641" "0" "c.641G>A" "r.(?)" "p.(Arg214His)" "" "" "0000188507" "00023820" "00" "169" "0" "169" "0" "c.169C>T" "r.(?)" "p.(Arg57Cys)" "" "" "0000188507" "00001779" "00" "169" "0" "169" "0" "c.169C>T" "r.(?)" "p.(Arg57Cys)" "" "" "0000188515" "00023820" "00" "169" "0" "169" "0" "c.169C>T" "r.(?)" "p.(Arg57Cys)" "" "" "0000188515" "00001779" "00" "169" "0" "169" "0" "c.169C>T" "r.(?)" "p.(Arg57Cys)" "" "" "0000188526" "00023820" "00" "344" "0" "344" "0" "c.344G>T" "r.(?)" "p.(Arg115Leu)" "" "" "0000188526" "00001779" "00" "344" "0" "344" "0" "c.344G>T" "r.(?)" "p.(Arg115Leu)" "" "" "0000256155" "00023820" "50" "74" "0" "74" "0" "c.74A>G" "r.(?)" "p.(Lys25Arg)" "" "VUS" "0000256155" "00001779" "50" "74" "0" "74" "0" "c.74A>G" "r.(?)" "p.(Lys25Arg)" "" "VUS" "0000311722" "00023820" "30" "-7" "0" "-7" "0" "c.-7C>T" "r.(?)" "p.(=)" "" "likely benign" "0000311722" "00001779" "30" "-7" "0" "-7" "0" "c.-7C>T" "r.(?)" "p.(=)" "" "likely benign" "0000311723" "00023820" "30" "984" "0" "984" "0" "c.984C>T" "r.(?)" "p.(=)" "" "likely benign" "0000311723" "00001779" "30" "1002" "0" "1002" "0" "c.1002C>T" "r.(?)" "p.(=)" "" "likely benign" "0000311724" "00023820" "30" "1482" "0" "1482" "0" "c.1482G>A" "r.(?)" "p.(=)" "" "likely benign" "0000311724" "00001779" "30" "1500" "0" "1500" "0" "c.1500G>A" "r.(?)" "p.(=)" "" "likely benign" "0000311725" "00023820" "30" "204" "0" "204" "0" "c.204G>A" "r.(?)" "p.(=)" "" "likely benign" "0000311725" "00001779" "30" "204" "0" "204" "0" "c.204G>A" "r.(?)" "p.(=)" "" "likely benign" "0000311726" "00023820" "30" "885" "0" "885" "0" "c.885C>G" "r.(?)" "p.(Phe295Leu)" "" "likely benign" "0000311726" "00001779" "30" "885" "0" "885" "0" "c.885C>G" "r.(?)" "p.(Phe295Leu)" "" "likely benign" "0000314385" "00023820" "30" "-78" "0" "-78" "0" "c.-78G>A" "r.(?)" "p.(=)" "" "likely benign" "0000314385" "00001779" "30" "-78" "0" "-78" "0" "c.-78G>A" "r.(?)" "p.(=)" "" "likely benign" "0000314386" "00023820" "30" "1698" "0" "1698" "0" "c.*36G>T" "r.(=)" "p.(=)" "" "likely benign" "0000314386" "00001779" "30" "1716" "0" "1716" "0" "c.*36G>T" "r.(=)" "p.(=)" "" "likely benign" "0000314387" "00023820" "70" "1075" "0" "1075" "0" "c.1075C>T" "r.(?)" "p.(Gln359*)" "" "likely pathogenic" "0000314387" "00001779" "70" "1093" "0" "1093" "0" "c.1093C>T" "r.(?)" "p.(Gln365*)" "" "likely pathogenic" "0000314388" "00023820" "10" "1125" "-6" "1125" "-6" "c.1125-6C>T" "r.(=)" "p.(=)" "" "benign" "0000314388" "00001779" "10" "1143" "-6" "1143" "-6" "c.1143-6C>T" "r.(=)" "p.(=)" "" "benign" "0000314389" "00023820" "70" "1152" "0" "1152" "0" "c.1152G>T" "r.(?)" "p.(Glu384Asp)" "" "likely pathogenic" "0000314389" "00001779" "70" "1170" "0" "1170" "0" "c.1170G>T" "r.(?)" "p.(Glu390Asp)" "" "likely pathogenic" "0000314390" "00023820" "30" "1189" "-48" "1189" "-48" "c.1189-48C>T" "r.(=)" "p.(=)" "" "likely benign" "0000314390" "00001779" "30" "1207" "-48" "1207" "-48" "c.1207-48C>T" "r.(=)" "p.(=)" "" "likely benign" "0000314391" "00023820" "30" "1285" "-29" "1285" "-29" "c.1285-29C>T" "r.(=)" "p.(=)" "" "likely benign" "0000314391" "00001779" "30" "1303" "-29" "1303" "-29" "c.1303-29C>T" "r.(=)" "p.(=)" "" "likely benign" "0000314392" "00023820" "30" "1308" "0" "1308" "0" "c.1308C>T" "r.(?)" "p.(=)" "" "likely benign" "0000314392" "00001779" "30" "1326" "0" "1326" "0" "c.1326C>T" "r.(?)" "p.(=)" "" "likely benign" "0000314393" "00023820" "30" "1482" "0" "1482" "0" "c.1482G>A" "r.(?)" "p.(=)" "" "likely benign" "0000314393" "00001779" "30" "1500" "0" "1500" "0" "c.1500G>A" "r.(?)" "p.(=)" "" "likely benign" "0000314394" "00023820" "30" "1491" "0" "1491" "0" "c.1491C>T" "r.(?)" "p.(=)" "" "likely benign" "0000314394" "00001779" "30" "1509" "0" "1509" "0" "c.1509C>T" "r.(?)" "p.(=)" "" "likely benign" "0000314395" "00023820" "30" "1508" "-20" "1508" "-20" "c.1508-20C>T" "r.(=)" "p.(=)" "" "likely benign" "0000314395" "00001779" "30" "1526" "-20" "1526" "-20" "c.1526-20C>T" "r.(=)" "p.(=)" "" "likely benign" "0000314396" "00023820" "30" "1508" "-24" "1508" "-24" "c.1508-24G>A" "r.(=)" "p.(=)" "" "likely benign" "0000314396" "00001779" "30" "1526" "-24" "1526" "-24" "c.1526-24G>A" "r.(=)" "p.(=)" "" "likely benign" "0000314397" "00023820" "30" "192" "0" "192" "0" "c.192C>T" "r.(?)" "p.(=)" "" "likely benign" "0000314397" "00001779" "30" "192" "0" "192" "0" "c.192C>T" "r.(?)" "p.(=)" "" "likely benign" "0000314398" "00023820" "30" "204" "0" "204" "0" "c.204G>A" "r.(?)" "p.(=)" "" "likely benign" "0000314398" "00001779" "30" "204" "0" "204" "0" "c.204G>A" "r.(?)" "p.(=)" "" "likely benign" "0000314400" "00023820" "30" "821" "0" "821" "0" "c.821G>A" "r.(?)" "p.(Arg274Lys)" "" "likely benign" "0000314400" "00001779" "30" "821" "0" "821" "0" "c.821G>A" "r.(?)" "p.(Arg274Lys)" "" "likely benign" "0000314401" "00023820" "10" "885" "0" "885" "0" "c.885C>G" "r.(?)" "p.(Phe295Leu)" "" "benign" "0000314401" "00001779" "10" "885" "0" "885" "0" "c.885C>G" "r.(?)" "p.(Phe295Leu)" "" "benign" "0000314402" "00023820" "30" "965" "40" "965" "40" "c.965+40G>A" "r.(=)" "p.(=)" "" "likely benign" "0000314402" "00001779" "30" "965" "40" "965" "40" "c.965+40G>A" "r.(=)" "p.(=)" "" "likely benign" "0000314403" "00023820" "30" "965" "7" "965" "7" "c.965+7C>T" "r.(=)" "p.(=)" "" "likely benign" "0000314403" "00001779" "30" "965" "7" "965" "7" "c.965+7C>T" "r.(=)" "p.(=)" "" "likely benign" "0000314404" "00023820" "10" "966" "-372" "966" "-372" "c.966-372C>T" "r.(=)" "p.(=)" "" "benign" "0000314404" "00001779" "10" "983" "139" "983" "139" "c.983+139C>T" "r.(=)" "p.(=)" "" "benign" "0000314405" "00023820" "30" "966" "-436" "966" "-436" "c.966-436T>G" "r.(=)" "p.(=)" "" "likely benign" "0000314405" "00001779" "30" "983" "75" "983" "75" "c.983+75T>G" "r.(=)" "p.(=)" "" "likely benign" "0000314406" "00023820" "30" "966" "-416" "966" "-416" "c.966-416G>A" "r.(=)" "p.(=)" "" "likely benign" "0000314406" "00001779" "30" "983" "95" "983" "95" "c.983+95G>A" "r.(=)" "p.(=)" "" "likely benign" "0000316246" "00023820" "30" "984" "0" "984" "0" "c.984C>T" "r.(?)" "p.(=)" "" "likely benign" "0000316246" "00001779" "30" "1002" "0" "1002" "0" "c.1002C>T" "r.(?)" "p.(=)" "" "likely benign" "0000316247" "00023820" "90" "990" "0" "990" "0" "c.990del" "r.(?)" "p.(His330Glnfs*12)" "" "pathogenic" "0000316247" "00001779" "90" "1008" "0" "1008" "0" "c.1008del" "r.(?)" "p.(His336Glnfs*12)" "" "pathogenic" "0000316248" "00023820" "50" "1066" "0" "1066" "0" "c.1066G>A" "r.(?)" "p.(Ala356Thr)" "" "VUS" "0000316248" "00001779" "50" "1084" "0" "1084" "0" "c.1084G>A" "r.(?)" "p.(Ala362Thr)" "" "VUS" "0000316249" "00023820" "10" "1125" "-6" "1125" "-6" "c.1125-6C>T" "r.(=)" "p.(=)" "" "benign" "0000316249" "00001779" "10" "1143" "-6" "1143" "-6" "c.1143-6C>T" "r.(=)" "p.(=)" "" "benign" "0000316250" "00023820" "50" "1178" "0" "1178" "0" "c.1178C>T" "r.(?)" "p.(Thr393Met)" "" "VUS" "0000316250" "00001779" "50" "1196" "0" "1196" "0" "c.1196C>T" "r.(?)" "p.(Thr399Met)" "" "VUS" "0000316251" "00023820" "30" "1308" "0" "1308" "0" "c.1308C>T" "r.(?)" "p.(=)" "" "likely benign" "0000316251" "00001779" "30" "1326" "0" "1326" "0" "c.1326C>T" "r.(?)" "p.(=)" "" "likely benign" "0000316252" "00023820" "30" "1349" "0" "1349" "0" "c.1349C>T" "r.(?)" "p.(Pro450Leu)" "" "likely benign" "0000316252" "00001779" "30" "1367" "0" "1367" "0" "c.1367C>T" "r.(?)" "p.(Pro456Leu)" "" "likely benign" "0000316253" "00023820" "50" "1393" "0" "1393" "0" "c.1393G>A" "r.(?)" "p.(Ala465Thr)" "" "VUS" "0000316253" "00001779" "50" "1411" "0" "1411" "0" "c.1411G>A" "r.(?)" "p.(Ala471Thr)" "" "VUS" "0000316254" "00023820" "50" "1409" "0" "1409" "0" "c.1409C>A" "r.(?)" "p.(Ala470Asp)" "" "VUS" "0000316254" "00001779" "50" "1427" "0" "1427" "0" "c.1427C>A" "r.(?)" "p.(Ala476Asp)" "" "VUS" "0000316255" "00023820" "30" "1482" "0" "1482" "0" "c.1482G>A" "r.(?)" "p.(=)" "" "likely benign" "0000316255" "00001779" "30" "1500" "0" "1500" "0" "c.1500G>A" "r.(?)" "p.(=)" "" "likely benign" "0000316256" "00023820" "30" "1491" "0" "1491" "0" "c.1491C>T" "r.(?)" "p.(=)" "" "likely benign" "0000316256" "00001779" "30" "1509" "0" "1509" "0" "c.1509C>T" "r.(?)" "p.(=)" "" "likely benign" "0000316257" "00023820" "10" "1508" "-20" "1508" "-20" "c.1508-20C>T" "r.(=)" "p.(=)" "" "benign" "0000316257" "00001779" "10" "1526" "-20" "1526" "-20" "c.1526-20C>T" "r.(=)" "p.(=)" "" "benign" "0000316258" "00023820" "30" "207" "0" "207" "0" "c.207T>C" "r.(?)" "p.(=)" "" "likely benign" "0000316258" "00001779" "30" "207" "0" "207" "0" "c.207T>C" "r.(?)" "p.(=)" "" "likely benign" "0000316259" "00023820" "30" "546" "0" "546" "0" "c.546G>A" "r.(?)" "p.(=)" "" "likely benign" "0000316259" "00001779" "30" "546" "0" "546" "0" "c.546G>A" "r.(?)" "p.(=)" "" "likely benign" "0000316260" "00023820" "50" "622" "0" "639" "0" "c.622_639del" "r.(?)" "p.(Val208_Gln213del)" "" "VUS" "0000316260" "00001779" "50" "622" "0" "639" "0" "c.622_639del" "r.(?)" "p.(Val208_Gln213del)" "" "VUS" "0000316261" "00023820" "30" "702" "0" "702" "0" "c.702G>A" "r.(?)" "p.(=)" "" "likely benign" "0000316261" "00001779" "30" "702" "0" "702" "0" "c.702G>A" "r.(?)" "p.(=)" "" "likely benign" "0000316262" "00023820" "50" "866" "0" "866" "0" "c.866C>T" "r.(?)" "p.(Ala289Val)" "" "VUS" "0000316262" "00001779" "50" "866" "0" "866" "0" "c.866C>T" "r.(?)" "p.(Ala289Val)" "" "VUS" "0000316263" "00023820" "30" "885" "0" "885" "0" "c.885C>G" "r.(?)" "p.(Phe295Leu)" "" "likely benign" "0000316263" "00001779" "30" "885" "0" "885" "0" "c.885C>G" "r.(?)" "p.(Phe295Leu)" "" "likely benign" "0000324492" "00023820" "50" "-3491" "0" "-3491" "0" "c.-3491G>A" "r.(?)" "p.(=)" "" "VUS" "0000324492" "00001779" "50" "-3491" "0" "-3491" "0" "c.-3491G>A" "r.(?)" "p.(=)" "" "VUS" "0000324493" "00023820" "50" "-3440" "0" "-3387" "0" "c.-3440_-3387del" "r.(?)" "p.(=)" "" "VUS" "0000324493" "00001779" "50" "-3440" "0" "-3387" "0" "c.-3440_-3387del" "r.(?)" "p.(=)" "" "VUS" "0000324495" "00023820" "30" "-3364" "0" "-3364" "0" "c.-3364G>C" "r.(?)" "p.(=)" "" "likely benign" "0000324495" "00001779" "30" "-3364" "0" "-3364" "0" "c.-3364G>C" "r.(?)" "p.(=)" "" "likely benign" "0000324496" "00023820" "30" "-3107" "0" "-3107" "0" "c.-3107C>T" "r.(?)" "p.(=)" "" "likely benign" "0000324496" "00001779" "30" "-3107" "0" "-3107" "0" "c.-3107C>T" "r.(?)" "p.(=)" "" "likely benign" "0000324497" "00023820" "30" "-2965" "0" "-2965" "0" "c.-2965G>A" "r.(?)" "p.(=)" "" "likely benign" "0000324497" "00001779" "30" "-2965" "0" "-2965" "0" "c.-2965G>A" "r.(?)" "p.(=)" "" "likely benign" "0000324498" "00023820" "30" "-2964" "0" "-2964" "0" "c.-2964C>A" "r.(?)" "p.(=)" "" "likely benign" "0000324498" "00001779" "30" "-2964" "0" "-2964" "0" "c.-2964C>A" "r.(?)" "p.(=)" "" "likely benign" "0000324499" "00023820" "50" "-2849" "0" "-2830" "0" "c.-2849_-2830del" "r.(?)" "p.(=)" "" "VUS" "0000324499" "00001779" "50" "-2849" "0" "-2830" "0" "c.-2849_-2830del" "r.(?)" "p.(=)" "" "VUS" "0000324501" "00023820" "50" "-2825" "0" "-2818" "0" "c.-2825_-2818del" "r.(?)" "p.(=)" "" "VUS" "0000324501" "00001779" "50" "-2825" "0" "-2818" "0" "c.-2825_-2818del" "r.(?)" "p.(=)" "" "VUS" "0000324502" "00023820" "50" "-2814" "0" "-2805" "0" "c.-2814_-2805del" "r.(?)" "p.(=)" "" "VUS" "0000324502" "00001779" "50" "-2814" "0" "-2805" "0" "c.-2814_-2805del" "r.(?)" "p.(=)" "" "VUS" "0000324503" "00023820" "50" "-2801" "0" "-2772" "0" "c.-2801_-2772del" "r.(?)" "p.(=)" "" "VUS" "0000324503" "00001779" "50" "-2801" "0" "-2772" "0" "c.-2801_-2772del" "r.(?)" "p.(=)" "" "VUS" "0000324504" "00023820" "30" "-2561" "0" "-2561" "0" "c.-2561G>A" "r.(?)" "p.(=)" "" "likely benign" "0000324504" "00001779" "30" "-2561" "0" "-2561" "0" "c.-2561G>A" "r.(?)" "p.(=)" "" "likely benign" "0000324505" "00023820" "50" "-1500" "0" "-1489" "0" "c.-1500_-1489del" "r.(?)" "p.(=)" "" "VUS" "0000324505" "00001779" "50" "-1500" "0" "-1489" "0" "c.-1500_-1489del" "r.(?)" "p.(=)" "" "VUS" "0000324506" "00023820" "50" "294" "0" "294" "0" "c.294C>A" "r.(?)" "p.(Asn98Lys)" "" "VUS" "0000324506" "00001779" "50" "294" "0" "294" "0" "c.294C>A" "r.(?)" "p.(Asn98Lys)" "" "VUS" "0000324507" "00023820" "50" "990" "0" "990" "0" "c.990del" "r.(?)" "p.(His330Glnfs*12)" "" "VUS" "0000324507" "00001779" "50" "1008" "0" "1008" "0" "c.1008del" "r.(?)" "p.(His336Glnfs*12)" "" "VUS" "0000324508" "00023820" "50" "1061" "0" "1061" "0" "c.1061G>A" "r.(?)" "p.(Arg354His)" "" "VUS" "0000324508" "00001779" "50" "1079" "0" "1079" "0" "c.1079G>A" "r.(?)" "p.(Arg360His)" "" "VUS" "0000337630" "00023820" "30" "1718" "0" "1718" "0" "c.*56C>T" "r.(=)" "p.(=)" "" "likely benign" "0000337630" "00001779" "30" "1736" "0" "1736" "0" "c.*56C>T" "r.(=)" "p.(=)" "" "likely benign" "0000342716" "00023820" "50" "1061" "0" "1061" "0" "c.1061G>A" "r.(?)" "p.(Arg354His)" "" "VUS" "0000342716" "00001779" "50" "1079" "0" "1079" "0" "c.1079G>A" "r.(?)" "p.(Arg360His)" "" "VUS" "0000344471" "00023820" "30" "22" "0" "22" "0" "c.22T>C" "r.(?)" "p.(Cys8Arg)" "" "likely benign" "0000344471" "00001779" "30" "22" "0" "22" "0" "c.22T>C" "r.(?)" "p.(Cys8Arg)" "" "likely benign" "0000349596" "00023820" "50" "197" "0" "197" "0" "c.197C>T" "r.(?)" "p.(Thr66Met)" "" "VUS" "0000349596" "00001779" "50" "197" "0" "197" "0" "c.197C>T" "r.(?)" "p.(Thr66Met)" "" "VUS" "0000368213" "00001779" "70" "194" "0" "194" "0" "c.194G>T" "r.(?)" "p.(Arg65Leu)" "2" "" "0000398607" "00001779" "70" "619" "0" "619" "0" "c.619C>T" "r.(?)" "p.(Gln207*)" "" "disease causing" "0000398608" "00001779" "70" "866" "0" "866" "0" "c.866C>T" "r.(?)" "p.(Ala289Val)" "" "" "0000401452" "00023820" "70" "116" "0" "116" "0" "c.116C>T" "r.(?)" "p.(Ala39Val)" "" "" "0000401452" "00001779" "70" "116" "0" "116" "0" "c.116C>T" "r.(?)" "p.(Ala39Val)" "" "" "0000401453" "00023820" "70" "1481" "0" "1481" "0" "c.1481C>T" "r.(?)" "p.(Ala494Val)" "" "" "0000401453" "00001779" "70" "1499" "0" "1499" "0" "c.1499C>T" "r.(?)" "p.(Ala500Val)" "" "" "0000401454" "00023820" "70" "116" "0" "116" "0" "c.116C>T" "r.(?)" "p.(Ala39Val)" "" "" "0000401454" "00001779" "70" "116" "0" "116" "0" "c.116C>T" "r.(?)" "p.(Ala39Val)" "" "" "0000401455" "00023820" "70" "1481" "0" "1481" "0" "c.1481C>T" "r.(?)" "p.(Ala494Val)" "" "" "0000401455" "00001779" "70" "1499" "0" "1499" "0" "c.1499C>T" "r.(?)" "p.(Ala500Val)" "" "" "0000401456" "00023820" "70" "1135" "0" "1135" "0" "c.1135C>T" "r.(?)" "p.(Gln379*)" "" "" "0000401456" "00001779" "70" "1153" "0" "1153" "0" "c.1153C>T" "r.(?)" "p.(Gln385*)" "" "" "0000401457" "00023820" "70" "1481" "0" "1481" "0" "c.1481C>T" "r.(?)" "p.(Ala494Val)" "" "" "0000401457" "00001779" "70" "1499" "0" "1499" "0" "c.1499C>T" "r.(?)" "p.(Ala500Val)" "" "" "0000401458" "00023820" "70" "1481" "0" "1481" "0" "c.1481C>T" "r.(?)" "p.(Ala494Val)" "" "" "0000401458" "00001779" "70" "1499" "0" "1499" "0" "c.1499C>T" "r.(?)" "p.(Ala500Val)" "" "" "0000401459" "00023820" "70" "725" "0" "725" "0" "c.725G>A" "r.(?)" "p.(Arg242His)" "" "" "0000401459" "00001779" "70" "725" "0" "725" "0" "c.725G>A" "r.(?)" "p.(Arg242His)" "" "" "0000401460" "00001779" "70" "1517" "0" "1519" "0" "c.1517_1519del" "r.(?)" "p.(Ile507del)" "" "" "0000401461" "00023820" "70" "116" "0" "116" "0" "c.116C>T" "r.(?)" "p.(Ala39Val)" "" "" "0000401461" "00001779" "70" "116" "0" "116" "0" "c.116C>T" "r.(?)" "p.(Ala39Val)" "" "" "0000401462" "00023820" "70" "116" "0" "116" "0" "c.116C>T" "r.(?)" "p.(Ala39Val)" "" "" "0000401462" "00001779" "70" "116" "0" "116" "0" "c.116C>T" "r.(?)" "p.(Ala39Val)" "" "" "0000401463" "00001779" "70" "241" "0" "252" "0" "c.241_252del" "r.(?)" "p.(Ile81_Lys84del)" "" "" "0000401464" "00023820" "70" "404" "0" "404" "0" "c.404C>T" "r.(?)" "p.(Pro135Leu)" "" "" "0000401464" "00001779" "70" "404" "0" "404" "0" "c.404C>T" "r.(?)" "p.(Pro135Leu)" "" "" "0000401465" "00023820" "70" "457" "0" "457" "0" "c.457G>T" "r.(?)" "p.(Glu153*)" "" "" "0000401465" "00001779" "70" "457" "0" "457" "0" "c.457G>T" "r.(?)" "p.(Glu153*)" "" "" "0000401466" "00023820" "70" "442" "0" "442" "0" "c.442G>A" "r.(?)" "p.(Glu148Lys)" "" "" "0000401466" "00001779" "70" "442" "0" "442" "0" "c.442G>A" "r.(?)" "p.(Glu148Lys)" "" "" "0000401467" "00023820" "70" "431" "0" "431" "0" "c.431A>G" "r.(?)" "p.(Tyr144Cys)" "" "" "0000401467" "00001779" "70" "431" "0" "431" "0" "c.431A>G" "r.(?)" "p.(Tyr144Cys)" "" "" "0000401468" "00001779" "70" "229" "0" "240" "0" "c.229_240del" "r.(?)" "p.(Ile81_Lys84del)" "" "" "0000401469" "00023820" "70" "1135" "0" "1135" "0" "c.1135C>T" "r.(?)" "p.(Gln379*)" "" "" "0000401469" "00001779" "70" "1153" "0" "1153" "0" "c.1153C>T" "r.(?)" "p.(Gln385*)" "" "" "0000401470" "00023820" "70" "241" "0" "252" "0" "c.241_252del" "r.(?)" "p.(Ile81_Lys84del)" "" "" "0000401470" "00001779" "70" "241" "0" "252" "0" "c.241_252del" "r.(?)" "p.(Ile81_Lys84del)" "" "" "0000401471" "00023820" "70" "139" "0" "139" "0" "c.139A>G" "r.(?)" "p.(Ser47Gly)" "" "" "0000401471" "00001779" "70" "139" "0" "139" "0" "c.139A>G" "r.(?)" "p.(Ser47Gly)" "" "" "0000401472" "00023820" "70" "1526" "0" "1526" "0" "c.1526C>T" "r.(?)" "p.(Ala509Val)" "" "" "0000401472" "00001779" "70" "1544" "0" "1544" "0" "c.1544C>T" "r.(?)" "p.(Ala515Val)" "" "" "0000401473" "00023820" "70" "1481" "0" "1481" "0" "c.1481C>T" "r.(?)" "p.(Ala494Val)" "" "" "0000401473" "00001779" "70" "1499" "0" "1499" "0" "c.1499C>T" "r.(?)" "p.(Ala500Val)" "" "" "0000401474" "00023820" "70" "119" "0" "119" "0" "c.119G>A" "r.(?)" "p.(Arg40His)" "" "" "0000401474" "00001779" "70" "119" "0" "119" "0" "c.119G>A" "r.(?)" "p.(Arg40His)" "" "" "0000401475" "00023820" "70" "241" "0" "252" "0" "c.241_252del" "r.(?)" "p.(Ile81_Lys84del)" "" "" "0000401475" "00001779" "70" "241" "0" "252" "0" "c.241_252del" "r.(?)" "p.(Ile81_Lys84del)" "" "" "0000401476" "00023820" "70" "241" "0" "252" "0" "c.241_252del" "r.(?)" "p.(Ile81_Lys84del)" "" "" "0000401476" "00001779" "70" "241" "0" "252" "0" "c.241_252del" "r.(?)" "p.(Ile81_Lys84del)" "" "" "0000401477" "00023820" "70" "1508" "-2" "1508" "-2" "c.1508-2A>C" "r.spl?" "p.?" "" "" "0000401477" "00001779" "70" "1526" "-2" "1526" "-2" "c.1526-2A>C" "r.spl?" "p.?" "" "" "0000401478" "00023820" "70" "404" "0" "404" "0" "c.404C>T" "r.(?)" "p.(Pro135Leu)" "" "" "0000401478" "00001779" "70" "404" "0" "404" "0" "c.404C>T" "r.(?)" "p.(Pro135Leu)" "" "" "0000401479" "00023820" "70" "679" "0" "679" "0" "c.679C>T" "r.(?)" "p.(Arg227Trp)" "" "" "0000401479" "00001779" "70" "679" "0" "679" "0" "c.679C>T" "r.(?)" "p.(Arg227Trp)" "" "" "0000401481" "00023820" "70" "116" "0" "116" "0" "c.116C>T" "r.(?)" "p.(Ala39Val)" "" "" "0000401481" "00001779" "70" "116" "0" "116" "0" "c.116C>T" "r.(?)" "p.(Ala39Val)" "" "" "0000401483" "00023820" "70" "241" "0" "252" "0" "c.241_252del" "r.(?)" "p.(Ile81_Lys84del)" "" "" "0000401483" "00001779" "70" "241" "0" "252" "0" "c.241_252del" "r.(?)" "p.(Ile81_Lys84del)" "" "" "0000401484" "00023820" "70" "241" "0" "252" "0" "c.241_252del" "r.(?)" "p.(Ile81_Lys84del)" "" "" "0000401484" "00001779" "70" "241" "0" "252" "0" "c.241_252del" "r.(?)" "p.(Ile81_Lys84del)" "" "" "0000401485" "00023820" "70" "1481" "0" "1481" "0" "c.1481C>T" "r.(?)" "p.(Ala494Val)" "" "" "0000401485" "00001779" "70" "1499" "0" "1499" "0" "c.1499C>T" "r.(?)" "p.(Ala500Val)" "" "" "0000401486" "00023820" "70" "116" "0" "116" "0" "c.116C>T" "r.(?)" "p.(Ala39Val)" "" "" "0000401486" "00001779" "70" "116" "0" "116" "0" "c.116C>T" "r.(?)" "p.(Ala39Val)" "" "" "0000401487" "00023820" "70" "241" "0" "252" "0" "c.241_252del" "r.(?)" "p.(Ile81_Lys84del)" "" "" "0000401487" "00001779" "70" "241" "0" "252" "0" "c.241_252del" "r.(?)" "p.(Ile81_Lys84del)" "" "" "0000401488" "00023820" "70" "151" "0" "151" "0" "c.151C>T" "r.(?)" "p.(Arg51Trp)" "" "" "0000401488" "00001779" "70" "151" "0" "151" "0" "c.151C>T" "r.(?)" "p.(Arg51Trp)" "" "" "0000401490" "00023820" "70" "241" "0" "252" "0" "c.241_252del" "r.(?)" "p.(Ile81_Lys84del)" "" "" "0000401490" "00001779" "70" "241" "0" "252" "0" "c.241_252del" "r.(?)" "p.(Ile81_Lys84del)" "" "" "0000401491" "00023820" "70" "619" "0" "619" "0" "c.619C>T" "r.(?)" "p.(Gln207*)" "" "" "0000401491" "00001779" "70" "619" "0" "619" "0" "c.619C>T" "r.(?)" "p.(Gln207*)" "" "" "0000401492" "00023820" "70" "866" "0" "866" "0" "c.866C>T" "r.(?)" "p.(Ala289Val)" "" "" "0000401492" "00001779" "70" "866" "0" "866" "0" "c.866C>T" "r.(?)" "p.(Ala289Val)" "" "" "0000401493" "00023820" "70" "116" "0" "116" "0" "c.116C>T" "r.(?)" "p.(Ala39Val)" "" "" "0000401493" "00001779" "70" "116" "0" "116" "0" "c.116C>T" "r.(?)" "p.(Ala39Val)" "" "" "0000401494" "00023820" "70" "1481" "0" "1481" "0" "c.1481C>T" "r.(?)" "p.(Ala494Val)" "" "" "0000401494" "00001779" "70" "1499" "0" "1499" "0" "c.1499C>T" "r.(?)" "p.(Ala500Val)" "" "" "0000403833" "00023820" "70" "119" "0" "119" "0" "c.119G>A" "r.(?)" "p.(Arg40His)" "" "" "0000403833" "00001779" "70" "119" "0" "119" "0" "c.119G>A" "r.(?)" "p.(Arg40His)" "" "" "0000403834" "00023820" "70" "241" "0" "252" "0" "c.241_252del" "r.(?)" "p.(Ile81_Lys84del)" "" "" "0000403834" "00001779" "70" "241" "0" "252" "0" "c.241_252del" "r.(?)" "p.(Ile81_Lys84del)" "" "" "0000403835" "00023820" "70" "241" "0" "252" "0" "c.241_252del" "r.(?)" "p.(Ile81_Lys84del)" "" "" "0000403835" "00001779" "70" "241" "0" "252" "0" "c.241_252del" "r.(?)" "p.(Ile81_Lys84del)" "" "" "0000404995" "00023820" "75" "533" "0" "533" "0" "c.533C>T" "r.(?)" "p.(Ser178Leu)" "2" "likely pathogenic (dominant)" "0000404995" "00001779" "75" "533" "0" "533" "0" "c.533C>T" "r.(?)" "p.(Ser178Leu)" "2" "likely pathogenic (dominant)" "0000440023" "00001779" "50" "1678" "0" "1678" "0" "c.1678T>C" "r.(?)" "p.*560Argext*6" "" "ACMG: 3" "0000557668" "00023820" "50" "-3165" "0" "-3165" "0" "c.-3165T>A" "r.(?)" "p.(=)" "" "VUS" "0000557668" "00001779" "50" "-3165" "0" "-3165" "0" "c.-3165T>A" "r.(?)" "p.(=)" "" "VUS" "0000557669" "00023820" "30" "-2899" "0" "-2899" "0" "c.-2899C>G" "r.(?)" "p.(=)" "" "likely benign" "0000557669" "00001779" "30" "-2899" "0" "-2899" "0" "c.-2899C>G" "r.(?)" "p.(=)" "" "likely benign" "0000557670" "00023820" "30" "-2516" "0" "-2516" "0" "c.-2516G>A" "r.(?)" "p.(=)" "" "likely benign" "0000557670" "00001779" "30" "-2516" "0" "-2516" "0" "c.-2516G>A" "r.(?)" "p.(=)" "" "likely benign" "0000557671" "00023820" "30" "22" "0" "22" "0" "c.22T>C" "r.(?)" "p.(Cys8Arg)" "" "likely benign" "0000557671" "00001779" "30" "22" "0" "22" "0" "c.22T>C" "r.(?)" "p.(Cys8Arg)" "" "likely benign" "0000557672" "00023820" "50" "118" "0" "118" "0" "c.118C>T" "r.(?)" "p.(Arg40Cys)" "" "VUS" "0000557672" "00001779" "50" "118" "0" "118" "0" "c.118C>T" "r.(?)" "p.(Arg40Cys)" "" "VUS" "0000557673" "00023820" "50" "169" "0" "169" "0" "c.169C>T" "r.(?)" "p.(Arg57Cys)" "" "VUS" "0000557673" "00001779" "50" "169" "0" "169" "0" "c.169C>T" "r.(?)" "p.(Arg57Cys)" "" "VUS" "0000557674" "00023820" "30" "169" "0" "169" "0" "c.169C>T" "r.(?)" "p.(Arg57Cys)" "" "likely benign" "0000557674" "00001779" "30" "169" "0" "169" "0" "c.169C>T" "r.(?)" "p.(Arg57Cys)" "" "likely benign" "0000557675" "00023820" "30" "169" "0" "169" "0" "c.169C>T" "r.(?)" "p.(Arg57Cys)" "" "likely benign" "0000557675" "00001779" "30" "169" "0" "169" "0" "c.169C>T" "r.(?)" "p.(Arg57Cys)" "" "likely benign" "0000557676" "00023820" "30" "179" "0" "179" "0" "c.179G>A" "r.(?)" "p.(Arg60Gln)" "" "likely benign" "0000557676" "00001779" "30" "179" "0" "179" "0" "c.179G>A" "r.(?)" "p.(Arg60Gln)" "" "likely benign" "0000557677" "00023820" "30" "204" "0" "204" "0" "c.204G>A" "r.(?)" "p.(=)" "" "likely benign" "0000557677" "00001779" "30" "204" "0" "204" "0" "c.204G>A" "r.(?)" "p.(=)" "" "likely benign" "0000557678" "00023820" "30" "384" "0" "384" "0" "c.384C>T" "r.(?)" "p.(=)" "" "likely benign" "0000557678" "00001779" "30" "384" "0" "384" "0" "c.384C>T" "r.(?)" "p.(=)" "" "likely benign" "0000557679" "00023820" "50" "409" "0" "409" "0" "c.409G>A" "r.(?)" "p.(Val137Met)" "" "VUS" "0000557679" "00001779" "50" "409" "0" "409" "0" "c.409G>A" "r.(?)" "p.(Val137Met)" "" "VUS" "0000557680" "00023820" "50" "418" "0" "418" "0" "c.418C>G" "r.(?)" "p.(Leu140Val)" "" "VUS" "0000557680" "00001779" "50" "418" "0" "418" "0" "c.418C>G" "r.(?)" "p.(Leu140Val)" "" "VUS" "0000557681" "00023820" "30" "438" "0" "438" "0" "c.438C>T" "r.(?)" "p.(=)" "" "likely benign" "0000557681" "00001779" "30" "438" "0" "438" "0" "c.438C>T" "r.(?)" "p.(=)" "" "likely benign" "0000557682" "00023820" "50" "457" "0" "457" "0" "c.457G>A" "r.(?)" "p.(Glu153Lys)" "" "VUS" "0000557682" "00001779" "50" "457" "0" "457" "0" "c.457G>A" "r.(?)" "p.(Glu153Lys)" "" "VUS" "0000557683" "00023820" "70" "457" "0" "457" "0" "c.457G>A" "r.(?)" "p.(Glu153Lys)" "" "likely pathogenic" "0000557683" "00001779" "70" "457" "0" "457" "0" "c.457G>A" "r.(?)" "p.(Glu153Lys)" "" "likely pathogenic" "0000557685" "00023820" "50" "734" "0" "734" "0" "c.734T>C" "r.(?)" "p.(Leu245Pro)" "" "VUS" "0000557685" "00001779" "50" "734" "0" "734" "0" "c.734T>C" "r.(?)" "p.(Leu245Pro)" "" "VUS" "0000557686" "00023820" "30" "785" "0" "785" "0" "c.785C>T" "r.(?)" "p.(Ser262Leu)" "" "likely benign" "0000557686" "00001779" "30" "785" "0" "785" "0" "c.785C>T" "r.(?)" "p.(Ser262Leu)" "" "likely benign" "0000557687" "00023820" "30" "885" "0" "885" "0" "c.885C>G" "r.(?)" "p.(Phe295Leu)" "" "likely benign" "0000557687" "00001779" "30" "885" "0" "885" "0" "c.885C>G" "r.(?)" "p.(Phe295Leu)" "" "likely benign" "0000557688" "00023820" "30" "965" "10" "965" "10" "c.965+10C>T" "r.(=)" "p.(=)" "" "likely benign" "0000557688" "00001779" "30" "965" "10" "965" "10" "c.965+10C>T" "r.(=)" "p.(=)" "" "likely benign" "0000557689" "00023820" "90" "990" "0" "990" "0" "c.990del" "r.(?)" "p.(His330Glnfs*12)" "" "pathogenic" "0000557689" "00001779" "90" "1008" "0" "1008" "0" "c.1008del" "r.(?)" "p.(His336Glnfs*12)" "" "pathogenic" "0000557690" "00023820" "30" "1008" "0" "1008" "0" "c.1008G>A" "r.(?)" "p.(=)" "" "likely benign" "0000557690" "00001779" "30" "1026" "0" "1026" "0" "c.1026G>A" "r.(?)" "p.(=)" "" "likely benign" "0000557691" "00023820" "30" "1107" "0" "1107" "0" "c.1107C>T" "r.(?)" "p.(=)" "" "likely benign" "0000557691" "00001779" "30" "1125" "0" "1125" "0" "c.1125C>T" "r.(?)" "p.(=)" "" "likely benign" "0000557692" "00023820" "30" "1178" "0" "1178" "0" "c.1178C>T" "r.(?)" "p.(Thr393Met)" "" "likely benign" "0000557692" "00001779" "30" "1196" "0" "1196" "0" "c.1196C>T" "r.(?)" "p.(Thr399Met)" "" "likely benign" "0000557693" "00023820" "30" "1188" "64" "1188" "85" "c.1188+64_1188+85del" "r.(=)" "p.(=)" "" "likely benign" "0000557693" "00001779" "30" "1206" "64" "1206" "85" "c.1206+64_1206+85del" "r.(=)" "p.(=)" "" "likely benign" "0000557694" "00023820" "50" "1226" "0" "1226" "0" "c.1226G>A" "r.(?)" "p.(Arg409Lys)" "" "VUS" "0000557694" "00001779" "50" "1244" "0" "1244" "0" "c.1244G>A" "r.(?)" "p.(Arg415Lys)" "" "VUS" "0000557695" "00023820" "90" "1230" "0" "1230" "0" "c.1230del" "r.(?)" "p.(Asn410Lysfs*31)" "" "pathogenic" "0000557695" "00001779" "90" "1248" "0" "1248" "0" "c.1248del" "r.(?)" "p.(Asn416Lysfs*31)" "" "pathogenic" "0000557696" "00023820" "50" "1303" "0" "1303" "0" "c.1303C>T" "r.(?)" "p.(Arg435Cys)" "" "VUS" "0000557696" "00001779" "50" "1321" "0" "1321" "0" "c.1321C>T" "r.(?)" "p.(Arg441Cys)" "" "VUS" "0000557697" "00023820" "10" "1422" "0" "1422" "0" "c.1422G>A" "r.(?)" "p.(=)" "" "benign" "0000557697" "00001779" "10" "1440" "0" "1440" "0" "c.1440G>A" "r.(?)" "p.(=)" "" "benign" "0000557698" "00023820" "10" "1422" "0" "1422" "0" "c.1422G>A" "r.(?)" "p.(=)" "" "benign" "0000557698" "00001779" "10" "1440" "0" "1440" "0" "c.1440G>A" "r.(?)" "p.(=)" "" "benign" "0000557699" "00023820" "30" "1507" "17" "1507" "17" "c.1507+17G>A" "r.(=)" "p.(=)" "" "likely benign" "0000557699" "00001779" "30" "1525" "17" "1525" "17" "c.1525+17G>A" "r.(=)" "p.(=)" "" "likely benign" "0000557700" "00023820" "30" "1552" "0" "1552" "0" "c.1552C>T" "r.(?)" "p.(Arg518Trp)" "" "likely benign" "0000557700" "00001779" "30" "1570" "0" "1570" "0" "c.1570C>T" "r.(?)" "p.(Arg524Trp)" "" "likely benign" "0000557701" "00023820" "30" "1553" "0" "1553" "0" "c.1553G>A" "r.(?)" "p.(Arg518Gln)" "" "likely benign" "0000557701" "00001779" "30" "1571" "0" "1571" "0" "c.1571G>A" "r.(?)" "p.(Arg524Gln)" "" "likely benign" "0000557702" "00023820" "30" "1658" "0" "1658" "0" "c.1658A>G" "r.(?)" "p.(Gln553Arg)" "" "likely benign" "0000557702" "00001779" "30" "1676" "0" "1676" "0" "c.1676A>G" "r.(?)" "p.(Gln559Arg)" "" "likely benign" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 45 "{{screeningid}}" "{{variantid}}" "0000000391" "0000017084" "0000000391" "0000017085" "0000004012" "0000022913" "0000004013" "0000022914" "0000004013" "0000022915" "0000004014" "0000022916" "0000004015" "0000022917" "0000004015" "0000022918" "0000004016" "0000022919" "0000004017" "0000022921" "0000004017" "0000022922" "0000004018" "0000022923" "0000004019" "0000022924" "0000004020" "0000022925" "0000004020" "0000022931" "0000004021" "0000022926" "0000004021" "0000022932" "0000004022" "0000022927" "0000004023" "0000022928" "0000004024" "0000022929" "0000004025" "0000022930" "0000004025" "0000022933" "0000004086" "0000022996" "0000004087" "0000022997" "0000016107" "0000035784" "0000016251" "0000035993" "0000017846" "0000038051" "0000017846" "0000038052" "0000025008" "0000047851" "0000059016" "0000089815" "0000117277" "0000188122" "0000117323" "0000188168" "0000117326" "0000188171" "0000117359" "0000188204" "0000117369" "0000188214" "0000117438" "0000188283" "0000117447" "0000188292" "0000117480" "0000188506" "0000117481" "0000188507" "0000117491" "0000188526" "0000117502" "0000188515" "0000117525" "0000188362" "0000164640" "0000368213" "0000181308" "0000404995" "0000209805" "0000440023"