### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = TBC1D24) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "TBC1D24" "TBC1 domain family, member 24" "16" "p13.3" "unknown" "NG_028170.1" "UD_132084544887" "" "" "" "1" "29203" "57465" "613577" "1" "1" "1" "1" "" "" "g" "http://databases.lovd.nl/shared/refseq/TBC1D24_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2012-12-14 00:00:00" "00081" "2015-08-05 02:07:01" "00000" "2026-04-10 15:44:03" ## Transcripts ## Do not remove or alter this header ## ## Count = 2 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00001779" "TBC1D24" "transcript variant 1" "001" "NM_001199107.1" "" "NP_001186036.1" "" "" "" "-140" "6455" "1680" "2525147" "2555734" "00001" "2012-12-14 09:58:12" "" "" "00023820" "TBC1D24" "transcript variant 2" "002" "NM_020705.2" "" "NP_065756.1" "" "" "" "-140" "6437" "1662" "2525147" "2555734" "00006" "2013-05-27 16:35:44" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 20 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00000" "Healthy/Control" "Healthy individual / control" "" "" "" "" "" "00000" "2012-07-26 17:29:43" "" "" "00097" "FIME" "epilepsy, myoclonic, infantile, familial (FIME)" "AR" "605021" "" "" "" "00001" "2012-12-14 10:00:34" "00006" "2021-12-10 21:51:32" "00139" "ID" "intellectual disability (ID)" "" "" "" "" "" "00084" "2013-06-04 18:18:07" "00006" "2015-02-09 10:02:49" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00283" "EIEE16" "encephalopathy, epileptic, early infantile, type 16 (EIEE-16)" "AR" "615338" "" "" "" "00081" "2013-11-28 15:56:49" "00006" "2021-12-10 21:51:32" "00284" "-" "epilepsy, myoclonic, dystonia, hemiparesis, autonomic signs, lethargy, progressive diffuse cerebral atrophy" "" "" "" "" "" "00081" "2013-11-28 15:59:11" "00006" "2015-12-08 23:59:30" "00285" "-" "epilepsy, focal, dysarthria, intellectual disability, cortical thickening, cerebellar atrophy" "" "" "" "" "" "00081" "2013-11-28 15:59:54" "00006" "2019-02-14 14:51:22" "00286" "DOORS" "deafness, onychodystrophy, osteodystrophy, mental retardation syndrome (DOORS)" "AR" "220500" "" "" "" "00081" "2013-11-28 16:01:26" "00006" "2021-12-10 21:51:32" "00294" "DFNB86" "deafness, nonsyndromic, autosomal recessive, type 86 (DFNB-86)" "AR" "614617" "" "" "" "00081" "2014-01-08 19:33:40" "00006" "2021-12-10 21:51:32" "00344" "EE" "encephalopathy, epileptic (EE)" "" "" "" "" "" "00006" "2014-03-12 21:57:45" "00006" "2015-12-07 07:11:25" "00350" "DFNA1" "deafness, autosomal dominant, type 1" "AD" "124900" "" "" "" "00081" "2014-03-13 13:45:31" "00006" "2021-12-10 21:51:32" "02087" "SIDS" "death, sudden, syndrome, infant (SIDS)" "AR" "272120" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "03139" "EPM1B" "epilepsy, progressive myoclonic, type 1B (EPM1B)" "AR" "612437" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-03-02 12:20:06" "04214" "-" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00001" "2023-03-09 14:26:26" "04219" "DFNA65" "deafness, autosomal dominant, type 65 (DFNA-65)" "AD" "616044" "" "" "" "00006" "2015-03-07 14:59:25" "00006" "2021-12-10 21:51:32" "05086" "HL" "hearing loss (HL)" "" "" "" "" "" "00006" "2015-10-23 11:41:05" "00006" "2015-10-23 11:43:00" "05166" "SUD" "death, sudden, unexplained (SUD)" "" "" "" "" "" "00006" "2016-05-19 16:34:23" "00006" "2018-09-11 12:14:13" "05315" "epilepsy, Rolandic" "epilepsy, Rolandic" "" "" "" "" "" "00006" "2017-08-11 13:02:50" "" "" "05835" "EPRPDC" "epilepsy, rolandic, with proxysmal exercise-induce dystonia and writer\'s cramp (EPRPDC)" "AR" "608105" "" "" "" "00006" "2020-09-18 16:18:07" "" "" "06906" "DEE" "encephalopathy, developmental and epileptic" "" "" "" "" "" "00006" "2022-04-07 09:24:23" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 9 "{{geneid}}" "{{diseaseid}}" "TBC1D24" "00097" "TBC1D24" "00139" "TBC1D24" "00283" "TBC1D24" "00284" "TBC1D24" "00285" "TBC1D24" "00286" "TBC1D24" "00294" "TBC1D24" "04219" "TBC1D24" "05835" ## Individuals ## Do not remove or alter this header ## ## Count = 54 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00000370" "" "" "" "1" "" "00059" "" "" "F" "-" "" "" "" "" "" "" "" "00004090" "" "" "" "1" "" "00081" "" "" "" "" "" "" "0" "" "" "Arab-Israeli" "" "00004091" "" "" "" "1" "" "00081" "{PMID:Falace A et al 2010:20727515}" "Falace A et al. Am J Hum Genet 2010; 87(3): 365-70." "" "" "" "" "0" "" "" "Italian" "" "00004092" "" "" "" "1" "" "00081" "{PMID:Guven A 2013:23343562}" "" "" "" "" "" "0" "" "" "Turkish" "" "00004093" "" "" "" "1" "" "00081" "{PMID:Campeau et al:24291220}" "1" "" "" "" "" "0" "" "" "" "" "00004094" "" "" "" "1" "" "00081" "{PMID:Campeau et al:24291220}" "2a" "" "" "" "" "0" "" "" "" "" "00004095" "" "" "" "1" "" "00081" "{PMID:Campeau et al:24291220}" "3" "" "" "" "" "0" "" "" "" "" "00004096" "" "" "" "1" "" "00081" "{PMID:Campeau et al:24291220}" "2b" "" "" "" "" "0" "" "" "" "" "00004097" "" "" "" "1" "" "00081" "{PMID:Campeau et al:24291220}" "4" "" "" "" "" "0" "" "" "" "" "00004098" "" "" "" "1" "" "00081" "{PMID:Campeau et al:24291220}" "5a" "" "" "" "" "0" "" "" "" "" "00004099" "" "" "" "1" "" "00081" "{PMID:Campeau et al:24291220}" "5b" "" "" "" "" "0" "" "" "" "" "00004100" "" "" "" "1" "" "00081" "{PMID:Campeau et al:24291220}" "6" "" "" "" "" "0" "" "" "" "" "00004101" "" "" "" "1" "" "00081" "{PMID:Campeau et al:24291220}" "7" "" "" "" "" "0" "" "" "" "" "00004102" "" "" "" "1" "" "00081" "{PMID:Campeau et al:24291220}" "8" "" "" "" "" "0" "" "" "" "" "00004103" "" "" "" "1" "" "00081" "{PMID:Campeau et al:24291220}" "9" "" "" "" "" "0" "" "" "" "" "00004158" "" "" "" "1" "" "00081" "{PMID:Rehman et al., 2014:24387994}" "" "F" "yes" "Pakistan" "" "0" "" "" "" "" "00004159" "" "" "" "1" "" "00081" "{PMID:Rehman et al., 2014:24387994}" "" "M" "yes" "Pakistan" "" "0" "" "" "" "" "00016188" "" "" "" "13" "" "00670" "{PMID:Azaiez 2014:24729539}" "4-generation family, 13 affecteds (5F, 8M)" "F;M" "no" "United States" "" "0" "" "" "white" "24729539-Fam" "00016189" "" "" "" "11" "" "00671" "{PMID:Zhang 2014:24729547}" "4-generation family, 11 affected (5F, 6M)" "F;M" "no" "China" "" "0" "" "" "Chinese" "" "00016322" "" "" "" "1" "" "00681" "" "" "M" "no" "Italy" "" "0" "" "" "" "" "00017865" "" "" "" "1" "" "00081" "" "" "M" "no" "Australia" "" "0" "" "" "" "" "00025006" "" "" "" "1" "" "00081" "{PMID:Muona et al:25401298}" "" "F" "?" "Afghanistan" "" "0" "" "" "" "" "00059050" "" "" "" "3" "" "01542" "Karen Avraham laboratory, Tel Aviv university, Israel, unpublished" "" "" "no" "Israel" "" "0" "" "" "Arab" "" "00065148" "" "" "" "1" "" "01602" "{PMID:Neubauer 2017:28074886} {DOI:Neubauer 2017:10.1038/ejhg.2016.199}" "" "F" "?" "Switzerland" "00y02m" "0" "" "" "Europe" "SIDS156" "00116809" "" "" "" "1" "" "02192" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "individual from 567 controls" "" "" "" "" "0" "" "" "" "S_114:0/1:CONTROL" "00116855" "" "" "" "1" "" "02192" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "individual from 567 controls" "" "" "" "" "0" "" "" "" "S_20:0/1:CONTROL" "00116858" "" "" "" "1" "" "02192" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "individual from 567 controls" "" "" "" "" "0" "" "" "" "S_204:0/1:CONTROL" "00116891" "" "" "" "1" "" "02192" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "individual from 567 controls" "" "" "" "" "0" "" "" "" "S_285:0/1:CONTROL" "00116901" "" "" "" "1" "" "02192" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "individual from 567 controls" "" "" "" "" "0" "" "" "" "S_307:0/1:CONTROL" "00116970" "" "" "" "1" "" "02192" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "individual from 567 controls" "" "" "" "" "0" "" "" "" "S_478:0/1:CONTROL" "00116979" "" "" "" "1" "" "02192" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "individual from 567 controls" "" "" "" "" "0" "" "" "" "S_495:0/1:CONTROL" "00117012" "" "" "" "1" "" "02192" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "individual from 567 controls" "" "" "" "" "0" "" "" "" "S_561:0/1:CONTROL" "00117013" "" "" "" "1" "" "02192" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "individual from 567 controls" "" "" "" "" "0" "" "" "" "S_562:0/1:CONTROL" "00117019" "" "" "" "1" "" "02192" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "individual from 194 RE cases" "" "" "" "" "0" "" "" "" "S_569:0/1:TYPICAL_RE" "00117049" "" "" "" "1" "" "02192" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "individual from 194 RE cases" "" "" "" "" "0" "" "" "" "S_619:0/1:TYPICAL_RE" "00117056" "" "" "" "1" "" "02192" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "individual from 567 controls" "" "" "" "" "0" "" "" "" "S_63:0/1:CONTROL" "00163777" "" "" "" "1" "" "02393" "" "" "M" "yes" "" "" "0" "" "" "" "" "00208756" "" "" "" "1" "" "01164" "" "" "F" "" "Germany" "" "0" "" "" "" "" "00291434" "" "" "" "152" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00291435" "" "" "" "55" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00304509" "" "" "" "2" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00304510" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00325389" "" "" "" "1" "" "00006" "{PMID:Hong 2020:33333793}" "" "M" "" "Taiwan" "" "0" "" "" "" "Pat2" "00325400" "" "" "" "1" "" "00006" "{PMID:Hong 2020:33333793}" "" "M" "" "Taiwan" "" "0" "" "" "" "Pat13" "00362244" "" "" "" "6" "" "04048" "" "" "M" "no" "Poland" ">30y" "0" "yes" "" "" "" "00362245" "" "" "" "12" "" "04048" "" "" "F" "no" "Poland" "" "" "yes" "" "" "" "00362246" "" "" "" "6" "" "04048" "" "" "F" "no" "Poland" "" "" "" "" "" "" "00362247" "" "" "" "5" "" "04048" "" "" "F" "no" "Poland" "" "" "" "" "" "" "00377956" "" "" "" "1" "" "00000" "{PMID:_Audo-2012:22277662}" "false positive, not found by Sanger" "" "" "" "" "0" "" "" "" "" "00401566" "" "" "" "1" "" "02494" "" "" "F" "no" "Spain" "" "" "" "" "" "154P" "00431568" "" "" "" "1" "" "01602" "" "" "M" "" "Switzerland" "50y" "0" "" "" "Europe" "SUDS068" "00438684" "" "" "" "1" "" "00006" "{PMID:Hamdan 2017:29100083}" "WGS analysis 197 individuals with unexplained DEE (unaffected parents)" "" "" "Canada" "" "0" "" "pharmaco-resistant seizures" "" "HSJ0682" "00441532" "" "" "" "1" "" "00006" "{PMID:Boucher 2020:33229591}" "" "" "" "France" "" "0" "" "" "" "6596†" "00441551" "" "" "" "1" "" "00006" "{PMID:Boucher 2020:33229591}" "control" "" "" "France" "" "0" "" "" "" "CIC4142" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 52 "{{individualid}}" "{{diseaseid}}" "00004090" "00285" "00004091" "00097" "00004092" "00284" "00004093" "00286" "00004094" "00286" "00004095" "00286" "00004096" "00286" "00004097" "00286" "00004098" "00286" "00004099" "00286" "00004100" "00286" "00004101" "00286" "00004102" "00286" "00004103" "00286" "00004158" "00294" "00004159" "00294" "00016188" "05086" "00016189" "00350" "00016322" "00344" "00017865" "00286" "00025006" "03139" "00059050" "00294" "00065148" "02087" "00116809" "00000" "00116855" "00000" "00116858" "00000" "00116891" "00000" "00116901" "00000" "00116970" "00000" "00116979" "00000" "00117012" "00000" "00117013" "00000" "00117019" "05315" "00117049" "05315" "00117056" "00000" "00163777" "00294" "00291434" "00198" "00291435" "00198" "00304509" "00198" "00304510" "00198" "00325389" "00198" "00325400" "00198" "00362244" "04219" "00362245" "04219" "00362246" "04219" "00362247" "04219" "00377956" "04214" "00401566" "00139" "00431568" "05166" "00438684" "06906" "00441532" "05086" "00441551" "00000" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00000, 00097, 00139, 00198, 00283, 00284, 00285, 00286, 00294, 00344, 00350, 02087, 03139, 04214, 04219, 05086, 05166, 05315, 05835, 06906 ## Count = 19 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000014935" "00344" "00016322" "00681" "Unknown" "" "diagnosis: epileptic encephalopathy and pervasive developmental disorder" "" "" "" "" "" "" "" "" "" "" "" "0000016224" "00286" "00017865" "00081" "Unknown" "" "DOORS syndrome" "" "" "" "" "" "" "" "" "" "" "" "0000021126" "03139" "00025006" "00081" "Familial, autosomal recessive" "" "Onset with tonic seizures at 36 hours. Developmental delay with later regression. Myoclonus noted from 8 months. TCS from 3.5 years. Ataxia, spasticity, supranuclear gaze palsy. Visual decline. Initially regarded as an epileptic encephalopathy but florid PME pattern apparent by age 9." "" "" "" "" "" "" "" "" "" "" "" "0000051253" "02087" "00065148" "01602" "Unknown" "" "SIDS" "" "" "" "" "" "" "" "" "" "" "" "0000092291" "05315" "00117019" "02192" "Unknown" "" "typical Rolandic epilepsy" "" "" "" "" "" "" "" "" "" "" "" "0000092314" "05315" "00117049" "02192" "Unknown" "" "typical Rolandic epilepsy" "" "" "" "" "" "" "" "" "" "" "" "0000128900" "00294" "00163777" "02393" "Familial, autosomal recessive" "" "" "" "" "congenital" "" "" "" "" "" "" "" "" "0000142765" "05086" "00016188" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "DFNA-65" "progressive autosomal dominant non-syndromic hearing loss (ADNSHL)" "" "0000142766" "00350" "00016189" "00006" "Familial, autosomal dominant" "" "nonsyndromic, bilateral, slowly progressive hearing impairment, starting mildly in high frequencies; age onset late 20s, hearing impairment gradually progressed to all frequencies later, eventually reached severe-to-profound in seventh decade; absent or abnormal otoacoustic emission, no evidence of vestibular dysfunction, no inner ear malformation observed by CT scanning" "" "" "" "" "" "" "" "" "DFNA-65" "hearing impairment" "" "0000157374" "00198" "00208756" "01164" "Unknown" "" "HP:0002069 (Generalized tonic-clonic seizures); HP:0002121 (Absence seizures)" "" "" "" "" "" "" "" "" "" "" "" "0000243876" "00198" "00325389" "00006" "Familial, autosomal recessive" "" "10m-onset seizures; multiple focal seizures, general, nonconvulsive status epilepticus; attention deficit. cognition delay" "" "2y" "" "" "" "" "" "" "" "developmental epileptic encephalopathy" "" "0000243887" "00198" "00325400" "00006" "Familial, autosomal recessive" "" "6m-onset seizures; multifocal seizures, myoclonus seizures; global developmental delay" "" "8m" "" "" "" "" "" "" "" "developmental epileptic encephalopathy" "" "0000257659" "04219" "00362245" "04048" "Familial, autosomal dominant" "" "Progressive sensorineural hearing impairment (HP:0000408)" "" "" "" "" "" "" "" "" "" "" "" "0000257660" "04219" "00362246" "04048" "Familial, autosomal dominant" "" "Progressive sensorineural hearing impairment (HP:0000408)" "" "" "" "" "" "" "" "" "" "" "" "0000257661" "04219" "00362247" "04048" "Familial, autosomal dominant" "" "Progressive sensorineural hearing impairment (HP:0000408)" "" "" "" "" "" "" "" "" "" "" "" "0000273102" "04214" "00377956" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000322141" "05166" "00431568" "01602" "Unknown" "" "SUD" "" "" "" "" "" "" "" "" "" "" "" "0000328587" "06906" "00438684" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "developmental and epileptic encephalopathy" "" "0000330970" "05086" "00441532" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "simplex/sporadic age-related hearing loss" "" ## Screenings ## Do not remove or alter this header ## ## Count = 54 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000000391" "00000370" "1" "00059" "00059" "2013-02-11 13:19:42" "" "" "SEQ-NG" "DNA" "" "" "0000004012" "00004090" "1" "00081" "00081" "2013-11-28 15:45:23" "" "" "SEQ" "DNA" "" "" "0000004013" "00004091" "1" "00081" "00081" "2013-11-28 16:08:12" "" "" "SEQ" "DNA" "" "" "0000004014" "00004092" "1" "00081" "00081" "2013-11-28 17:06:16" "" "" "SEQ" "DNA" "" "" "0000004015" "00004093" "1" "00081" "00081" "2013-11-29 03:19:40" "" "" "SEQ" "DNA" "" "" "0000004016" "00004094" "1" "00081" "00081" "2013-11-29 03:25:10" "" "" "SEQ" "DNA" "" "" "0000004017" "00004095" "1" "00081" "00081" "2013-11-29 03:27:28" "" "" "SEQ" "DNA" "" "" "0000004018" "00004096" "1" "00081" "00081" "2013-11-29 03:33:42" "" "" "SEQ" "DNA" "" "" "0000004019" "00004097" "1" "00081" "00081" "2013-11-29 03:36:02" "" "" "SEQ" "DNA" "" "" "0000004020" "00004098" "1" "00081" "00081" "2013-11-29 03:40:03" "" "" "SEQ" "DNA" "" "" "0000004021" "00004099" "1" "00081" "00081" "2013-11-29 03:40:09" "" "" "SEQ" "DNA" "" "" "0000004022" "00004100" "1" "00081" "00081" "2013-11-29 03:40:15" "" "" "SEQ" "DNA" "" "" "0000004023" "00004101" "1" "00081" "00081" "2013-11-29 03:40:24" "" "" "SEQ" "DNA" "" "" "0000004024" "00004102" "1" "00081" "00081" "2013-11-29 03:40:27" "" "" "SEQ" "DNA" "" "" "0000004025" "00004103" "1" "00081" "00081" "2013-11-29 03:40:35" "" "" "SEQ" "DNA" "" "" "0000004086" "00004158" "1" "00081" "00081" "2014-01-08 19:37:16" "" "" "SEQ" "DNA" "" "" "0000004087" "00004159" "1" "00081" "00081" "2014-01-08 19:42:23" "" "" "SEQ" "DNA" "" "" "0000016107" "00016188" "1" "00670" "00670" "2014-02-27 23:02:16" "" "" "SEQ" "DNA" "" "" "0000016251" "00016322" "1" "00681" "00681" "2014-03-12 13:37:40" "00006" "2014-03-14 16:32:42" "SEQ;SEQ-NG-I" "DNA" "" "" "0000017846" "00017865" "1" "00081" "00081" "2014-07-09 21:30:10" "" "" "SEQ" "DNA" "" "" "0000025008" "00025006" "1" "00081" "00081" "2014-11-30 23:49:15" "" "" "SEQ-NG" "DNA" "" "" "0000059016" "00059050" "1" "01542" "01542" "2016-02-19 02:54:44" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000117277" "00116809" "1" "02192" "00006" "2017-08-03 15:16:01" "" "" "SEQ-NG" "DNA" "" "" "0000117323" "00116855" "1" "02192" "00006" "2017-08-03 15:16:01" "" "" "SEQ-NG" "DNA" "" "" "0000117326" "00116858" "1" "02192" "00006" "2017-08-03 15:16:01" "" "" "SEQ-NG" "DNA" "" "" "0000117359" "00116891" "1" "02192" "00006" "2017-08-03 15:16:01" "" "" "SEQ-NG" "DNA" "" "" "0000117369" "00116901" "1" "02192" "00006" "2017-08-03 15:16:01" "" "" "SEQ-NG" "DNA" "" "" "0000117438" "00116970" "1" "02192" "00006" "2017-08-03 15:16:01" "" "" "SEQ-NG" "DNA" "" "" "0000117447" "00116979" "1" "02192" "00006" "2017-08-03 15:16:01" "" "" "SEQ-NG" "DNA" "" "" "0000117480" "00117012" "1" "02192" "00006" "2017-08-03 15:16:01" "" "" "SEQ-NG" "DNA" "" "" "0000117481" "00117013" "1" "02192" "00006" "2017-08-03 15:16:01" "" "" "SEQ-NG" "DNA" "" "" "0000117491" "00117056" "1" "02192" "00006" "2017-08-03 15:16:01" "" "" "SEQ-NG" "DNA" "" "" "0000117502" "00117019" "1" "02192" "00006" "2017-08-03 15:16:01" "" "" "SEQ-NG" "DNA" "" "" "0000117525" "00117049" "1" "02192" "00006" "2017-08-03 15:16:01" "" "" "SEQ-NG" "DNA" "" "" "0000164640" "00163777" "1" "02393" "02393" "2018-04-11 09:15:10" "" "" "SEQ-NG" "DNA" "blood" "" "0000181308" "00016189" "1" "00006" "00006" "2018-09-05 21:23:14" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000209805" "00208756" "1" "01164" "01164" "2018-12-14 14:03:32" "" "" "SEQ-NG" "DNA" "" "" "0000292602" "00291434" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000292603" "00291435" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000305638" "00304509" "1" "03575" "00006" "2020-06-24 11:55:42" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000305639" "00304510" "1" "03575" "00006" "2020-06-24 11:55:42" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000326600" "00325389" "1" "00006" "00006" "2021-01-02 12:18:38" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000326611" "00325400" "1" "00006" "00006" "2021-01-02 12:18:38" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000363473" "00362244" "1" "04048" "04048" "2021-04-16 14:16:09" "" "" "SEQ;SEQ-NG-I" "DNA" "" "" "0000363474" "00362245" "1" "04048" "04048" "2021-04-16 14:31:25" "" "" "SEQ;SEQ-NG-I" "DNA" "" "" "0000363475" "00362246" "1" "04048" "04048" "2021-04-16 14:40:08" "" "" "SEQ;SEQ-NG-I" "DNA" "" "" "0000363476" "00362247" "1" "04048" "04048" "2021-04-16 14:46:52" "" "" "SEQ;SEQ-NG-I" "DNA" "" "" "0000379160" "00377956" "1" "00000" "00008" "2021-08-02 20:37:33" "" "" "SEQ; SEQ-NG-S" "DNA" "blood" "" "0000402809" "00401566" "1" "02494" "02494" "2022-02-01 08:48:40" "" "" "SEQ-NG" "DNA" "" "WES" "0000433001" "00431568" "1" "01602" "01602" "2023-02-15 09:31:32" "" "" "SEQ-NG" "DNA" "" "" "0000433214" "00065148" "1" "01602" "01602" "2023-02-16 11:53:17" "" "" "SEQ-NG" "DNA" "" "" "0000440166" "00438684" "1" "00006" "00006" "2023-10-21 19:20:17" "" "" "SEQ;SEQ-NG" "DNA" "" "WGS" "0000443018" "00441532" "1" "00006" "00006" "2023-11-08 15:20:43" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000443037" "00441551" "1" "00006" "00006" "2023-11-08 15:20:43" "" "" "SEQ;SEQ-NG" "DNA" "" "" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 25 "{{screeningid}}" "{{geneid}}" "0000004012" "TBC1D24" "0000004013" "TBC1D24" "0000004014" "TBC1D24" "0000004015" "TBC1D24" "0000004016" "TBC1D24" "0000004017" "TBC1D24" "0000004018" "TBC1D24" "0000004019" "TBC1D24" "0000004020" "TBC1D24" "0000004021" "TBC1D24" "0000004022" "TBC1D24" "0000004023" "TBC1D24" "0000004024" "TBC1D24" "0000004025" "TBC1D24" "0000004086" "TBC1D24" "0000004087" "TBC1D24" "0000016107" "TBC1D24" "0000016251" "GPR98" "0000016251" "KCNQ2" "0000016251" "TBC1D24" "0000017846" "TBC1D24" "0000181308" "TBC1D24" "0000326600" "TBC1D24" "0000326611" "TBC1D24" "0000379160" "GUCY2D" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 240 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000017084" "21" "75" "16" "2546617" "2546617" "subst" "0" "00059" "TBC1D24_000002" "g.2546617C>A" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2496616C>A" "" "likely pathogenic" "" "0000017085" "11" "75" "16" "2546835" "2546835" "subst" "0" "00059" "TBC1D24_000001" "g.2546835T>C" "" "" "" "" "" "Unknown" "" "" "" "" "" "g.2496834T>C" "" "likely pathogenic" "" "0000022913" "3" "99" "16" "2546900" "2546900" "subst" "0" "00081" "TBC1D24_000003" "g.2546900T>C" "" "{PMID:Corbett MA et al, 2010:20797691}" "" "" "" "Germline" "yes" "" "0" "" "" "g.2496899T>C" "" "pathogenic" "" "0000022914" "0" "55" "16" "2546588" "2546588" "subst" "4.13005E-6" "00081" "TBC1D24_000004" "g.2546588G>C" "" "{PMID:Falace A et al. 2010:20727515}" "" "" "" "Germline" "" "" "0" "" "" "g.2496587G>C" "" "VUS" "" "0000022915" "0" "55" "16" "2550823" "2550823" "subst" "1.26348E-5" "00081" "TBC1D24_000005" "g.2550823C>T" "" "{PMID:Falace A et al. 2010:20727515}" "" "" "" "Germline" "" "" "0" "" "" "g.2500822C>T" "" "VUS" "" "0000022916" "3" "99" "16" "2547714" "2547715" "del" "0" "00081" "TBC1D24_000006" "g.2547714_2547715del" "" "{PMID:Guven A et al. 2013:23343562}" "" "" "" "Germline" "yes" "" "0" "" "" "g.2497713_2497714del" "" "pathogenic" "" "0000022917" "21" "77" "16" "2546873" "2546873" "subst" "1.2187E-5" "00081" "TBC1D24_000007" "g.2546873C>T" "" "{PMID:Campeau et al:24291220}" "pcampeau" "" "" "Germline" "" "" "0" "" "" "g.2496872C>T" "" "likely pathogenic" "" "0000022918" "11" "55" "16" "2546267" "2546267" "subst" "8.13101E-6" "00081" "TBC1D24_000008" "g.2546267C>T" "" "{PMID:Campeau et al:24291220}" "pcampeau" "" "" "Germline" "yes" "" "0" "" "" "g.2496266C>T" "" "VUS" "" "0000022919" "3" "77" "16" "2546873" "2546873" "subst" "1.2187E-5" "00081" "TBC1D24_000007" "g.2546873C>T" "" "{PMID:Campeau et al:24291220}" "pcampeau" "" "" "Germline" "" "" "0" "" "" "g.2496872C>T" "" "likely pathogenic" "" "0000022921" "21" "55" "16" "2548263" "2548263" "del" "7.89515E-5" "00081" "TBC1D24_000009" "g.2548263del" "" "{PMID:Campeau et al:24291220}" "pcampeau" "" "" "Germline" "yes" "" "0" "" "" "g.2498262del" "" "VUS" "" "0000022922" "11" "75" "16" "2549426" "2549426" "subst" "0" "00081" "TBC1D24_000010" "g.2549426G>A" "" "{PMID:Campeau et al:24291220}" "pcampeau" "" "" "Germline" "" "" "0" "" "" "g.2499425G>A" "" "likely pathogenic" "" "0000022923" "3" "55" "16" "2546873" "2546873" "subst" "1.2187E-5" "00081" "TBC1D24_000007" "g.2546873C>T" "" "{PMID:Campeau et al:24291220}" "pcampeau" "" "" "Germline" "" "" "0" "" "" "g.2496872C>T" "" "VUS" "" "0000022924" "3" "55" "16" "2546873" "2546873" "subst" "1.2187E-5" "00081" "TBC1D24_000007" "g.2546873C>T" "" "{PMID:Campeau et al:24291220}" "pcampeau" "" "" "Germline" "" "" "0" "" "" "g.2496872C>T" "" "VUS" "" "0000022925" "21" "55" "16" "2546207" "2546207" "subst" "6.50042E-5" "00081" "TBC1D24_000019" "g.2546207C>T" "" "{PMID:Campeau et al:24291220}" "pcampeau" "" "" "Germline" "" "" "0" "pcampeau" "" "g.2496206C>T" "" "VUS" "" "0000022926" "21" "55" "16" "2546207" "2546207" "subst" "6.50042E-5" "00081" "TBC1D24_000019" "g.2546207C>T" "" "{PMID:Campeau et al:24291220}" "pcampeau" "" "" "Germline" "" "" "0" "pcampeau" "" "g.2496206C>T" "" "VUS" "" "0000022927" "21" "55" "16" "2548263" "2548263" "del" "7.89515E-5" "00081" "TBC1D24_000009" "g.2548263del" "" "{PMID:Campeau et al:24291220}" "pcampeau" "" "" "Germline" "" "" "0" "" "" "g.2498262del" "" "VUS" "" "0000022928" "3" "55" "16" "2546873" "2546873" "subst" "1.2187E-5" "00081" "TBC1D24_000007" "g.2546873C>T" "" "{PMID:Campeau et al:24291220}" "pcampeau" "" "" "Germline" "" "" "0" "" "" "g.2496872C>T" "" "VUS" "" "0000022929" "3" "55" "16" "2546268" "2546268" "subst" "4.0663E-6" "00081" "TBC1D24_000012" "g.2546268G>T" "" "{PMID:Campeau et al:24291220}" "pcampeau" "" "" "Germline" "" "" "0" "" "" "g.2496267G>T" "" "VUS" "" "0000022930" "21" "55" "16" "2546477" "2546477" "subst" "0" "00081" "TBC1D24_000013" "g.2546477G>A" "" "{PMID:Campeau et al:24291220}" "pcampeau" "" "" "Germline" "" "" "0" "" "" "g.2496476G>A" "" "VUS" "" "0000022931" "11" "55" "16" "2546873" "2546873" "subst" "1.2187E-5" "00081" "TBC1D24_000007" "g.2546873C>T" "" "{PMID:Campeau et al:24291220}" "pcampeau" "" "" "Germline" "" "" "0" "" "" "g.2496872C>T" "" "VUS" "" "0000022932" "11" "55" "16" "2546873" "2546873" "subst" "1.2187E-5" "00081" "TBC1D24_000007" "g.2546873C>T" "" "{PMID:Campeau et al:24291220}" "pcampeau" "" "" "Germline" "" "" "0" "" "" "g.2496872C>T" "" "VUS" "" "0000022933" "11" "55" "16" "2548254" "2548254" "subst" "0" "00081" "TBC1D24_000014" "g.2548254G>T" "" "{PMID:Campeau et al:24291220}" "pcampeau" "" "" "Germline" "" "" "0" "" "" "g.2498253G>T" "" "VUS" "" "0000022996" "0" "55" "16" "2546357" "2546357" "subst" "4.07004E-6" "00081" "TBC1D24_000015" "g.2546357G>T" "" "{PMID:Rehman et al., 2014:24387994}" "" "" "" "Germline" "" "" "0" "" "" "g.2496356G>T" "" "VUS" "" "0000022997" "3" "55" "16" "2547027" "2547027" "subst" "8.14578E-6" "00081" "TBC1D24_000016" "g.2547027G>C" "" "{PMID:Rehman et al., 2014:24387994}" "" "" "" "Germline" "yes" "" "0" "" "" "g.2497026G>C" "" "VUS" "" "0000035784" "1" "75" "16" "2546682" "2546682" "subst" "8.14491E-6" "00670" "TBC1D24_000017" "g.2546682C>T" "" "{PMID:Azaiez 2014:24729539}" "" "" "" "Germline" "yes" "" "0" "" "" "g.2496681C>T" "" "likely pathogenic (dominant)" "" "0000035993" "11" "55" "16" "2546790" "2546790" "subst" "0.000972137" "00681" "TBC1D24_000018" "g.2546790G>A" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.2496789G>A" "" "VUS" "" "0000038051" "0" "00" "16" "2550426" "2550426" "dup" "0" "00081" "TBC1D24_000020" "g.2550426dup" "" "" "" "" "" "Unknown" "?" "" "0" "" "" "g.2500425dup" "" "" "" "0000038052" "0" "00" "16" "2546462" "2546462" "subst" "0" "00081" "TBC1D24_000021" "g.2546462T>C" "" "" "" "" "" "Unknown" "?" "" "0" "" "" "g.2496461T>C" "" "" "" "0000047851" "3" "77" "16" "2548334" "2548334" "subst" "4.22601E-6" "00081" "TBC1D24_000022" "g.2548334G>T" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.2498333G>T" "" "likely pathogenic" "" "0000089815" "3" "90" "16" "2546343" "2546343" "subst" "0" "01542" "TBC1D24_000023" "g.2546343G>T" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.2496342G>T" "" "pathogenic" "" "0000188122" "0" "50" "16" "2546790" "2546790" "subst" "0.000972137" "02192" "TBC1D24_000018" "g.2546790G>A" "4/567 controls" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "" "" "" "Germline" "" "rs200324356" "0" "" "" "g.2496789G>A" "" "VUS" "" "0000188168" "0" "50" "16" "2546790" "2546790" "subst" "0.000972137" "02192" "TBC1D24_000018" "g.2546790G>A" "4/567 controls" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "" "" "" "Germline" "" "rs200324356" "0" "" "" "g.2496789G>A" "" "VUS" "" "0000188171" "0" "50" "16" "2550870" "2550870" "subst" "8.17615E-6" "02192" "TBC1D24_000029" "g.2550870G>A" "1/567 controls" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "" "" "" "Germline" "" "" "0" "" "" "g.2500869G>A" "" "VUS" "" "0000188204" "0" "50" "16" "2546327" "2546327" "subst" "0.000231932" "02192" "TBC1D24_000025" "g.2546327C>T" "1/567 controls" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "" "" "" "Germline" "" "rs373914077" "0" "" "" "g.2496326C>T" "" "VUS" "" "0000188214" "0" "50" "16" "2546790" "2546790" "subst" "0.000972137" "02192" "TBC1D24_000018" "g.2546790G>A" "4/567 controls" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "" "" "" "Germline" "" "rs200324356" "0" "" "" "g.2496789G>A" "" "VUS" "" "0000188283" "0" "50" "16" "2546474" "2546474" "subst" "2.87869E-5" "02192" "TBC1D24_000026" "g.2546474C>T" "1/567 controls" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "" "" "" "Germline" "" "rs372337277" "0" "" "" "g.2496473C>T" "" "VUS" "" "0000188292" "0" "50" "16" "2548348" "2548348" "subst" "0" "02192" "TBC1D24_000028" "g.2548348C>T" "1/567 controls" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "" "" "stopgain variant" "Germline" "" "" "0" "" "" "g.2498347C>T" "" "VUS" "" "0000188362" "0" "50" "16" "2546318" "2546318" "subst" "0.00192434" "02192" "TBC1D24_000024" "g.2546318C>T" "2/194 cases RE" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "" "" "" "Germline" "" "rs202162520" "0" "" "" "g.2496317C>T" "" "VUS" "" "0000188506" "0" "50" "16" "2546790" "2546790" "subst" "0.000972137" "02192" "TBC1D24_000018" "g.2546790G>A" "4/567 controls" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "" "" "" "Germline" "" "rs200324356" "0" "" "" "g.2496789G>A" "" "VUS" "" "0000188507" "0" "50" "16" "2546318" "2546318" "subst" "0.00192434" "02192" "TBC1D24_000024" "g.2546318C>T" "1/567 controls" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "" "" "" "Germline" "" "rs202162520" "0" "" "" "g.2496317C>T" "" "VUS" "" "0000188515" "0" "50" "16" "2546318" "2546318" "subst" "0.00192434" "02192" "TBC1D24_000024" "g.2546318C>T" "2/194 cases RE" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "" "" "" "Germline" "" "rs202162520" "0" "" "" "g.2496317C>T" "" "VUS" "" "0000188526" "0" "50" "16" "2546493" "2546493" "subst" "4.12705E-6" "02192" "TBC1D24_000027" "g.2546493G>T" "1/567 controls" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "" "" "" "Germline" "" "" "0" "" "" "g.2496492G>T" "" "VUS" "" "0000256155" "0" "50" "16" "2546223" "2546223" "subst" "1.21884E-5" "01943" "TBC1D24_000032" "g.2546223A>G" "" "" "" "TBC1D24(NM_001199107.1):c.74A>G (p.K25R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2496222A>G" "" "VUS" "" "0000311722" "0" "30" "16" "2546143" "2546143" "subst" "0.00101714" "02325" "TBC1D24_000031" "g.2546143C>T" "" "" "" "TBC1D24(NM_001199107.2):c.-7C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2496142C>T" "" "likely benign" "" "0000311723" "0" "30" "16" "2548257" "2548257" "subst" "0.00131612" "02325" "TBC1D24_000048" "g.2548257C>T" "" "" "" "TBC1D24(NM_001199107.1):c.1002C>T (p.A334=), TBC1D24(NM_001199107.2):c.1002C>T (p.(Ala334=), p.A334=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2498256C>T" "" "likely benign" "" "0000311724" "0" "30" "16" "2550466" "2550466" "subst" "0.00315795" "02325" "TBC1D24_000061" "g.2550466G>A" "" "" "" "TBC1D24(NM_001199107.1):c.1500G>A (p.A500=), TBC1D24(NM_001199107.2):c.1500G>A (p.A500=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2500465G>A" "" "likely benign" "" "0000311725" "0" "30" "16" "2546353" "2546353" "subst" "0.00142891" "02325" "TBC1D24_000034" "g.2546353G>A" "" "" "" "TBC1D24(NM_001199107.1):c.204G>A (p.T68=), TBC1D24(NM_001199107.2):c.204G>A (p.T68=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2496352G>A" "" "likely benign" "" "0000311726" "0" "30" "16" "2547034" "2547034" "subst" "0.00531052" "02325" "TBC1D24_000042" "g.2547034C>G" "" "" "" "TBC1D24(NM_001199107.1):c.885C>G (p.F295L), TBC1D24(NM_001199107.2):c.885C>G (p.F295L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2497033C>G" "" "likely benign" "" "0000314385" "0" "30" "16" "2546072" "2546072" "subst" "0" "02326" "TBC1D24_000030" "g.2546072G>A" "" "" "" "TBC1D24(NM_001199107.2):c.-78G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2496071G>A" "" "likely benign" "" "0000314386" "0" "30" "16" "2550995" "2550995" "subst" "0.00488904" "02326" "TBC1D24_000065" "g.2550995G>T" "" "" "" "TBC1D24(NM_001199107.2):c.*36G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2500994G>T" "" "likely benign" "" "0000314387" "0" "70" "16" "2548348" "2548348" "subst" "0" "02326" "TBC1D24_000028" "g.2548348C>T" "" "" "" "TBC1D24(NM_001199107.2):c.1093C>T (p.(Gln365*), p.Q365*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2498347C>T" "" "likely pathogenic" "" "0000314388" "0" "10" "16" "2549352" "2549352" "subst" "0.00466252" "02326" "TBC1D24_000052" "g.2549352C>T" "" "" "" "TBC1D24(NM_001199107.1):c.1143-6C>T, TBC1D24(NM_001199107.2):c.1143-6C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2499351C>T" "" "benign" "" "0000314389" "0" "70" "16" "2549385" "2549385" "subst" "0" "02326" "TBC1D24_000053" "g.2549385G>T" "" "" "" "TBC1D24(NM_001199107.2):c.1170G>T (p.E390D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2499384G>T" "" "likely pathogenic" "" "0000314390" "0" "30" "16" "2549788" "2549788" "subst" "0.00492949" "02326" "TBC1D24_000055" "g.2549788C>T" "" "" "" "TBC1D24(NM_001199107.2):c.1207-48C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2499787C>T" "" "likely benign" "" "0000314391" "0" "30" "16" "2550240" "2550240" "subst" "9.04139E-5" "02326" "TBC1D24_000056" "g.2550240C>T" "" "" "" "TBC1D24(NM_001199107.2):c.1303-29C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2500239C>T" "" "likely benign" "" "0000314392" "0" "30" "16" "2550292" "2550292" "subst" "0.00264633" "02326" "TBC1D24_000057" "g.2550292C>T" "" "" "" "TBC1D24(NM_001199107.1):c.1326C>T (p.Y442=), TBC1D24(NM_001199107.2):c.1326C>T (p.Y442=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2500291C>T" "" "likely benign" "" "0000314393" "0" "30" "16" "2550466" "2550466" "subst" "0.00315795" "02326" "TBC1D24_000061" "g.2550466G>A" "" "" "" "TBC1D24(NM_001199107.1):c.1500G>A (p.A500=), TBC1D24(NM_001199107.2):c.1500G>A (p.A500=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2500465G>A" "" "likely benign" "" "0000314394" "0" "30" "16" "2550475" "2550475" "subst" "0.00422468" "02326" "TBC1D24_000062" "g.2550475C>T" "" "" "" "TBC1D24(NM_001199107.1):c.1509C>T (p.S503=), TBC1D24(NM_001199107.2):c.1509C>T (p.S503=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2500474C>T" "" "likely benign" "" "0000314395" "0" "30" "16" "2550785" "2550785" "subst" "0.00447777" "02326" "TBC1D24_000064" "g.2550785C>T" "" "" "" "TBC1D24(NM_001199107.1):c.1526-20C>T, TBC1D24(NM_001199107.2):c.1526-20C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2500784C>T" "" "likely benign" "" "0000314396" "0" "30" "16" "2550781" "2550781" "subst" "0.00490625" "02326" "TBC1D24_000063" "g.2550781G>A" "" "" "" "TBC1D24(NM_001199107.2):c.1526-24G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2500780G>A" "" "likely benign" "" "0000314397" "0" "30" "16" "2546341" "2546341" "subst" "4.06914E-6" "02326" "TBC1D24_000033" "g.2546341C>T" "" "" "" "TBC1D24(NM_001199107.2):c.192C>T (p.C64=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2496340C>T" "" "likely benign" "" "0000314398" "0" "30" "16" "2546353" "2546353" "subst" "0.00142891" "02326" "TBC1D24_000034" "g.2546353G>A" "" "" "" "TBC1D24(NM_001199107.1):c.204G>A (p.T68=), TBC1D24(NM_001199107.2):c.204G>A (p.T68=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2496352G>A" "" "likely benign" "" "0000314400" "0" "30" "16" "2546970" "2546970" "subst" "0" "02326" "TBC1D24_000040" "g.2546970G>A" "" "" "" "TBC1D24(NM_001199107.2):c.821G>A (p.R274K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2496969G>A" "" "likely benign" "" "0000314401" "0" "10" "16" "2547034" "2547034" "subst" "0.00531052" "02326" "TBC1D24_000042" "g.2547034C>G" "" "" "" "TBC1D24(NM_001199107.1):c.885C>G (p.F295L), TBC1D24(NM_001199107.2):c.885C>G (p.F295L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2497033C>G" "" "benign" "" "0000314402" "0" "30" "16" "2547154" "2547154" "subst" "0.000712" "02326" "TBC1D24_000044" "g.2547154G>A" "" "" "" "TBC1D24(NM_001199107.2):c.965+40G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2497153G>A" "" "likely benign" "" "0000314403" "0" "30" "16" "2547121" "2547121" "subst" "4.3936E-6" "02326" "TBC1D24_000043" "g.2547121C>T" "" "" "" "TBC1D24(NM_001199107.2):c.965+7C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2497120C>T" "" "likely benign" "" "0000314404" "0" "10" "16" "2547867" "2547867" "subst" "0" "02326" "TBC1D24_000047" "g.2547867C>T" "" "" "" "TBC1D24(NM_001199107.2):c.983+139C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2497866C>T" "" "benign" "" "0000314405" "0" "30" "16" "2547803" "2547803" "subst" "0" "02326" "TBC1D24_000045" "g.2547803T>G" "" "" "" "TBC1D24(NM_001199107.2):c.983+75T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2497802T>G" "" "likely benign" "" "0000314406" "0" "30" "16" "2547823" "2547823" "subst" "0" "02326" "TBC1D24_000046" "g.2547823G>A" "" "" "" "TBC1D24(NM_001199107.2):c.983+95G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2497822G>A" "" "likely benign" "" "0000316246" "0" "30" "16" "2548257" "2548257" "subst" "0.00131612" "01943" "TBC1D24_000048" "g.2548257C>T" "" "" "" "TBC1D24(NM_001199107.1):c.1002C>T (p.A334=), TBC1D24(NM_001199107.2):c.1002C>T (p.(Ala334=), p.A334=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2498256C>T" "" "likely benign" "" "0000316247" "0" "90" "16" "2548263" "2548263" "del" "7.89515E-5" "01943" "TBC1D24_000049" "g.2548263del" "" "" "" "TBC1D24(NM_001199107.1):c.1008del (p.(His336GlnfsTer12)), TBC1D24(NM_001199107.1):c.1008delT (p.H336Qfs*12), TBC1D24(NM_001199107.2):c.1008delT (p...)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2498262del" "" "pathogenic" "" "0000316248" "0" "50" "16" "2548339" "2548339" "subst" "0" "01943" "TBC1D24_000051" "g.2548339G>A" "" "" "" "TBC1D24(NM_001199107.1):c.1084G>A (p.A362T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2498338G>A" "" "VUS" "" "0000316249" "0" "10" "16" "2549352" "2549352" "subst" "0.00466252" "01943" "TBC1D24_000052" "g.2549352C>T" "" "" "" "TBC1D24(NM_001199107.1):c.1143-6C>T, TBC1D24(NM_001199107.2):c.1143-6C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2499351C>T" "" "benign" "" "0000316250" "0" "50" "16" "2549411" "2549411" "subst" "0.000589025" "01943" "TBC1D24_000054" "g.2549411C>T" "" "" "" "TBC1D24(NM_001199107.1):c.1196C>T (p.T399M), TBC1D24(NM_001199107.2):c.1196C>T (p.T399M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2499410C>T" "" "VUS" "" "0000316251" "0" "30" "16" "2550292" "2550292" "subst" "0.00264633" "01943" "TBC1D24_000057" "g.2550292C>T" "" "" "" "TBC1D24(NM_001199107.1):c.1326C>T (p.Y442=), TBC1D24(NM_001199107.2):c.1326C>T (p.Y442=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2500291C>T" "" "likely benign" "" "0000316252" "0" "30" "16" "2550333" "2550333" "subst" "7.67571E-5" "01943" "TBC1D24_000058" "g.2550333C>T" "" "" "" "TBC1D24(NM_001199107.1):c.1367C>T (p.P456L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2500332C>T" "" "likely benign" "" "0000316253" "0" "30" "16" "2550377" "2550377" "subst" "0.00021726" "01943" "TBC1D24_000059" "g.2550377G>A" "" "" "" "TBC1D24(NM_001199107.1):c.1411G>A (p.A471T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2500376G>A" "" "likely benign" "" "0000316254" "0" "50" "16" "2550393" "2550393" "subst" "0.000623685" "01943" "TBC1D24_000060" "g.2550393C>A" "" "" "" "TBC1D24(NM_001199107.1):c.1427C>A (p.A476D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2500392C>A" "" "VUS" "" "0000316255" "0" "30" "16" "2550466" "2550466" "subst" "0.00315795" "01943" "TBC1D24_000061" "g.2550466G>A" "" "" "" "TBC1D24(NM_001199107.1):c.1500G>A (p.A500=), TBC1D24(NM_001199107.2):c.1500G>A (p.A500=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2500465G>A" "" "likely benign" "" "0000316256" "0" "30" "16" "2550475" "2550475" "subst" "0.00422468" "01943" "TBC1D24_000062" "g.2550475C>T" "" "" "" "TBC1D24(NM_001199107.1):c.1509C>T (p.S503=), TBC1D24(NM_001199107.2):c.1509C>T (p.S503=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2500474C>T" "" "likely benign" "" "0000316257" "0" "10" "16" "2550785" "2550785" "subst" "0.00447777" "01943" "TBC1D24_000064" "g.2550785C>T" "" "" "" "TBC1D24(NM_001199107.1):c.1526-20C>T, TBC1D24(NM_001199107.2):c.1526-20C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2500784C>T" "" "benign" "" "0000316258" "0" "30" "16" "2546356" "2546356" "subst" "0.016215" "01943" "TBC1D24_000035" "g.2546356T>C" "" "" "" "TBC1D24(NM_001199107.1):c.207T>C (p.P69=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2496355T>C" "" "likely benign" "" "0000316259" "0" "30" "16" "2546695" "2546695" "subst" "0.000175063" "01943" "TBC1D24_000037" "g.2546695G>A" "" "" "" "TBC1D24(NM_001199107.1):c.546G>A (p.T182=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2496694G>A" "" "likely benign" "" "0000316260" "0" "50" "16" "2546771" "2546788" "del" "0" "01943" "TBC1D24_000038" "g.2546771_2546788del" "" "" "" "TBC1D24(NM_001199107.1):c.622_639delGTCTATGCGGACTGGCAG (p.V208_Q213del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2496770_2496787del" "" "VUS" "" "0000316261" "0" "30" "16" "2546851" "2546851" "subst" "0.00015439" "01943" "TBC1D24_000039" "g.2546851G>A" "" "" "" "TBC1D24(NM_001199107.1):c.702G>A (p.V234=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2496850G>A" "" "likely benign" "" "0000316262" "0" "50" "16" "2547015" "2547015" "subst" "0" "01943" "TBC1D24_000041" "g.2547015C>T" "" "" "" "TBC1D24(NM_001199107.1):c.866C>T (p.A289V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2497014C>T" "" "VUS" "" "0000316263" "0" "30" "16" "2547034" "2547034" "subst" "0.00531052" "01943" "TBC1D24_000042" "g.2547034C>G" "" "" "" "TBC1D24(NM_001199107.1):c.885C>G (p.F295L), TBC1D24(NM_001199107.2):c.885C>G (p.F295L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2497033C>G" "" "likely benign" "" "0000324492" "0" "50" "16" "2521796" "2521796" "subst" "0.00688525" "01804" "NTN3_000001" "g.2521796G>A" "" "" "" "NTN3(NM_006181.2):c.94G>A (p.(Asp32Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2471795G>A" "" "VUS" "" "0000324493" "0" "50" "16" "2521847" "2521900" "del" "0" "01804" "NTN3_000002" "g.2521847_2521900del" "" "" "" "NTN3(NM_006181.2):c.142_195del (p.(Leu49_Ala66del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2471846_2471899del" "" "VUS" "" "0000324499" "0" "50" "16" "2522438" "2522457" "del" "0.00152614" "01804" "NTN3_000007" "g.2522438_2522457del" "" "" "" "NTN3(NM_006181.2):c.736_755del (p.(Ala246ArgfsTer32))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2472437_2472456del" "" "VUS" "" "0000324501" "0" "50" "16" "2522462" "2522469" "del" "0.00159687" "01804" "NTN3_000008" "g.2522462_2522469del" "" "" "" "NTN3(NM_006181.2):c.760_767del (p.(Arg254ValfsTer28))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2472461_2472468del" "" "VUS" "" "0000324502" "0" "50" "16" "2522473" "2522482" "del" "0.00174459" "01804" "NTN3_000009" "g.2522473_2522482del" "" "" "" "NTN3(NM_006181.2):c.771_780del (p.(Cys257TrpfsTer13))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2472472_2472481del" "" "VUS" "" "0000324503" "0" "50" "16" "2522486" "2522515" "del" "0" "01804" "NTN3_000010" "g.2522486_2522515del" "" "" "" "NTN3(NM_006181.2):c.783_812del (p.(Ser262_His271del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2472485_2472514del" "" "VUS" "" "0000324505" "0" "50" "16" "2523787" "2523798" "del" "0" "01804" "NTN3_000012" "g.2523787_2523798del" "" "" "" "NTN3(NM_006181.2):c.1414_1425del (p.(Arg473_Ala476del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2473786_2473797del" "" "VUS" "" "0000324506" "0" "50" "16" "2546443" "2546443" "subst" "0" "01804" "TBC1D24_000036" "g.2546443C>A" "" "" "" "TBC1D24(NM_001199107.1):c.294C>A (p.(Asn98Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2496442C>A" "" "VUS" "" "0000324507" "0" "50" "16" "2548263" "2548263" "del" "7.89515E-5" "01804" "TBC1D24_000049" "g.2548263del" "" "" "" "TBC1D24(NM_001199107.1):c.1008del (p.(His336GlnfsTer12)), TBC1D24(NM_001199107.1):c.1008delT (p.H336Qfs*12), TBC1D24(NM_001199107.2):c.1008delT (p...)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2498262del" "" "VUS" "" "0000337630" "0" "30" "16" "2551015" "2551015" "subst" "0" "02327" "TBC1D24_000069" "g.2551015C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2501014C>T" "" "likely benign" "" "0000342716" "0" "50" "16" "2548334" "2548334" "subst" "1.2678E-5" "02327" "TBC1D24_000050" "g.2548334G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2498333G>A" "" "VUS" "" "0000349596" "0" "50" "16" "2546346" "2546346" "subst" "1.22103E-5" "02327" "TBC1D24_000067" "g.2546346C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.2496345C>T" "" "VUS" "" "0000368213" "3" "70" "16" "2546343" "2546343" "subst" "0" "02393" "TBC1D24_000023" "g.2546343G>T" "0/220 chromosomes" "" "" "" "" "Germline" "yes" "rs878853232" "0" "" "" "g.2496342G>T" "{CV:000225038.1}" "likely pathogenic" "" "0000398607" "0" "70" "16" "2546768" "2546768" "subst" "2.03259E-5" "02550" "TBC1D24_000080" "g.2546768C>T" "" "" "" "c.619C>T" "" "Somatic" "yes" "" "0" "" "" "g.2496767C>T" "" "pathogenic" "" "0000398608" "0" "70" "16" "2547015" "2547015" "subst" "0" "02550" "TBC1D24_000041" "g.2547015C>T" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "g.2497014C>T" "" "likely pathogenic" "" "0000401452" "11" "70" "16" "2546265" "2546265" "subst" "1.21968E-5" "02550" "TBC1D24_000070" "g.2546265C>T" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "g.2496264C>T" "" "likely pathogenic" "" "0000401453" "21" "70" "16" "2550465" "2550465" "subst" "0" "02550" "TBC1D24_000084" "g.2550465C>T" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "g.2500464C>T" "" "likely pathogenic" "" "0000401454" "0" "70" "16" "2546265" "2546265" "subst" "1.21968E-5" "02550" "TBC1D24_000070" "g.2546265C>T" "" "" "" "" "" "Somatic" "" "" "0" "" "" "g.2496264C>T" "" "likely pathogenic" "" "0000401455" "0" "70" "16" "2550465" "2550465" "subst" "0" "02550" "TBC1D24_000084" "g.2550465C>T" "" "" "" "" "" "Somatic" "" "" "0" "" "" "g.2500464C>T" "" "likely pathogenic" "" "0000401456" "11" "70" "16" "2549368" "2549368" "subst" "0" "02550" "TBC1D24_000083" "g.2549368C>T" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "g.2499367C>T" "" "likely pathogenic" "" "0000401457" "21" "70" "16" "2550465" "2550465" "subst" "0" "02550" "TBC1D24_000084" "g.2550465C>T" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "g.2500464C>T" "" "likely pathogenic" "" "0000401458" "21" "70" "16" "2550465" "2550465" "subst" "0" "02550" "TBC1D24_000084" "g.2550465C>T" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "g.2500464C>T" "" "likely pathogenic" "" "0000401459" "11" "70" "16" "2546874" "2546874" "subst" "1.62496E-5" "02550" "TBC1D24_000082" "g.2546874G>A" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "g.2496873G>A" "" "likely pathogenic" "" "0000401460" "11" "70" "16" "2550485" "2550487" "del" "0" "02550" "TBC1D24_000085" "g.2550485_2550487del" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "g.2500484_2500486del" "" "likely pathogenic" "" "0000401461" "21" "70" "16" "2546265" "2546265" "subst" "1.21968E-5" "02550" "TBC1D24_000070" "g.2546265C>T" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "g.2496264C>T" "" "likely pathogenic" "" "0000401462" "21" "70" "16" "2546265" "2546265" "subst" "1.21968E-5" "02550" "TBC1D24_000070" "g.2546265C>T" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "g.2496264C>T" "" "likely pathogenic" "" "0000401463" "11" "70" "16" "2546390" "2546401" "del" "0" "02550" "TBC1D24_000075" "g.2546390_2546401del" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "g.2496389_2496400del" "" "likely pathogenic" "" "0000401464" "21" "70" "16" "2546553" "2546553" "subst" "0" "02550" "TBC1D24_000076" "g.2546553C>T" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "g.2496552C>T" "" "likely pathogenic" "" "0000401465" "11" "70" "16" "2546606" "2546606" "subst" "4.11424E-6" "02550" "TBC1D24_000079" "g.2546606G>T" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "g.2496605G>T" "" "likely pathogenic" "" "0000401466" "11" "70" "16" "2546591" "2546591" "subst" "8.2498E-6" "02550" "TBC1D24_000078" "g.2546591G>A" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "g.2496590G>A" "" "likely pathogenic" "" "0000401467" "21" "70" "16" "2546580" "2546580" "subst" "0" "02550" "TBC1D24_000077" "g.2546580A>G" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "g.2496579A>G" "" "likely pathogenic" "" "0000401468" "11" "70" "16" "2546390" "2546401" "del" "0" "02550" "TBC1D24_000074" "g.2546390_2546401del" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "g.2496389_2496400del" "" "likely pathogenic" "" "0000401469" "21" "70" "16" "2549368" "2549368" "subst" "0" "02550" "TBC1D24_000083" "g.2549368C>T" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "g.2499367C>T" "" "likely pathogenic" "" "0000401470" "21" "70" "16" "2546390" "2546401" "del" "0" "02550" "TBC1D24_000075" "g.2546390_2546401del" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "g.2496389_2496400del" "" "likely pathogenic" "" "0000401471" "10" "70" "16" "2546288" "2546288" "subst" "0" "02550" "TBC1D24_000072" "g.2546288A>G" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "g.2496287A>G" "" "likely pathogenic" "" "0000401472" "10" "70" "16" "2550823" "2550823" "subst" "1.26348E-5" "02550" "TBC1D24_000005" "g.2550823C>T" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "g.2500822C>T" "" "likely pathogenic" "" "0000401473" "21" "70" "16" "2550465" "2550465" "subst" "0" "02550" "TBC1D24_000084" "g.2550465C>T" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "g.2500464C>T" "" "likely pathogenic" "" "0000401474" "11" "70" "16" "2546268" "2546268" "subst" "4.0663E-6" "02550" "TBC1D24_000071" "g.2546268G>A" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "g.2496267G>A" "" "likely pathogenic" "" "0000401475" "21" "70" "16" "2546390" "2546401" "del" "0" "02550" "TBC1D24_000075" "g.2546390_2546401del" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "g.2496389_2496400del" "" "likely pathogenic" "" "0000401476" "21" "70" "16" "2546390" "2546401" "del" "0" "02550" "TBC1D24_000075" "g.2546390_2546401del" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "g.2496389_2496400del" "" "likely pathogenic" "" "0000401477" "11" "70" "16" "2550803" "2550803" "subst" "0" "02550" "TBC1D24_000086" "g.2550803A>C" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "g.2500802A>C" "" "likely pathogenic" "" "0000401478" "21" "70" "16" "2546553" "2546553" "subst" "0" "02550" "TBC1D24_000076" "g.2546553C>T" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "g.2496552C>T" "" "likely pathogenic" "" "0000401479" "11" "70" "16" "2546828" "2546828" "subst" "1.21927E-5" "02550" "TBC1D24_000081" "g.2546828C>T" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "g.2496827C>T" "" "likely pathogenic" "" "0000401481" "11" "70" "16" "2546265" "2546265" "subst" "1.21968E-5" "02550" "TBC1D24_000070" "g.2546265C>T" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "g.2496264C>T" "" "likely pathogenic" "" "0000401483" "21" "70" "16" "2546390" "2546401" "del" "0" "02550" "TBC1D24_000075" "g.2546390_2546401del" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "g.2496389_2496400del" "" "likely pathogenic" "" "0000401484" "11" "70" "16" "2546390" "2546401" "del" "0" "02550" "TBC1D24_000075" "g.2546390_2546401del" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "g.2496389_2496400del" "" "likely pathogenic" "" "0000401485" "21" "70" "16" "2550465" "2550465" "subst" "0" "02550" "TBC1D24_000084" "g.2550465C>T" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "g.2500464C>T" "" "likely pathogenic" "" "0000401486" "21" "70" "16" "2546265" "2546265" "subst" "1.21968E-5" "02550" "TBC1D24_000070" "g.2546265C>T" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "g.2496264C>T" "" "likely pathogenic" "" "0000401487" "11" "70" "16" "2546390" "2546401" "del" "0" "02550" "TBC1D24_000075" "g.2546390_2546401del" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "g.2496389_2496400del" "" "likely pathogenic" "" "0000401488" "11" "70" "16" "2546300" "2546300" "subst" "8.1357E-6" "02550" "TBC1D24_000073" "g.2546300C>T" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "g.2496299C>T" "" "likely pathogenic" "" "0000401490" "21" "70" "16" "2546390" "2546401" "del" "0" "02550" "TBC1D24_000075" "g.2546390_2546401del" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "g.2496389_2496400del" "" "likely pathogenic" "" "0000401491" "10" "70" "16" "2546768" "2546768" "subst" "2.03259E-5" "02550" "TBC1D24_000080" "g.2546768C>T" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "g.2496767C>T" "" "likely pathogenic" "" "0000401492" "21" "70" "16" "2547015" "2547015" "subst" "0" "02550" "TBC1D24_000041" "g.2547015C>T" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "g.2497014C>T" "" "likely pathogenic" "" "0000401493" "21" "70" "16" "2546265" "2546265" "subst" "1.21968E-5" "02550" "TBC1D24_000070" "g.2546265C>T" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "g.2496264C>T" "" "likely pathogenic" "" "0000401494" "11" "70" "16" "2550465" "2550465" "subst" "0" "02550" "TBC1D24_000084" "g.2550465C>T" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "g.2500464C>T" "" "likely pathogenic" "" "0000403833" "11" "70" "16" "2546268" "2546268" "subst" "4.0663E-6" "02550" "TBC1D24_000071" "g.2546268G>A" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "g.2496267G>A" "" "likely pathogenic" "" "0000403834" "21" "70" "16" "2546390" "2546401" "del" "0" "02550" "TBC1D24_000075" "g.2546390_2546401del" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "g.2496389_2496400del" "" "likely pathogenic" "" "0000403835" "21" "70" "16" "2546390" "2546401" "del" "0" "02550" "TBC1D24_000075" "g.2546390_2546401del" "" "" "" "" "" "Somatic" "yes" "" "0" "" "" "g.2496389_2496400del" "" "likely pathogenic" "" "0000404995" "1" "75" "16" "2546682" "2546682" "subst" "8.14491E-6" "00671" "TBC1D24_000017" "g.2546682C>T" "" "{PMID:Zhang 2014:24729547}" "" "" "" "Germline" "yes" "" "0" "" "" "g.2496681C>T" "" "likely pathogenic (dominant)" "" "0000440023" "0" "50" "16" "2550957" "2550957" "subst" "0" "01164" "TBC1D24_000087" "g.2550957T>C" "" "" "" "" "not regarded causative for phenotype in this patient, AR and no second path variant detected in TBC1D24; co-occurrence with pathogenic variant in PRRT2 which segregates with phenotype in this family" "Germline" "" "" "0" "" "" "g.2500956T>C" "" "VUS" "ACMG" "0000557672" "0" "50" "16" "2546267" "2546267" "subst" "8.13101E-6" "02327" "TBC1D24_000008" "g.2546267C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2496266C>T" "" "VUS" "" "0000557673" "0" "50" "16" "2546318" "2546318" "subst" "0.00192434" "01943" "TBC1D24_000024" "g.2546318C>T" "" "" "" "TBC1D24(NM_001199107.1):c.169C>T (p.R57C, p.(Arg57Cys)), TBC1D24(NM_001199107.2):c.169C>T (p.R57C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2496317C>T" "" "VUS" "" "0000557674" "0" "30" "16" "2546318" "2546318" "subst" "0.00192434" "01804" "TBC1D24_000024" "g.2546318C>T" "" "" "" "TBC1D24(NM_001199107.1):c.169C>T (p.R57C, p.(Arg57Cys)), TBC1D24(NM_001199107.2):c.169C>T (p.R57C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2496317C>T" "" "likely benign" "" "0000557675" "0" "30" "16" "2546318" "2546318" "subst" "0.00192434" "02326" "TBC1D24_000024" "g.2546318C>T" "" "" "" "TBC1D24(NM_001199107.1):c.169C>T (p.R57C, p.(Arg57Cys)), TBC1D24(NM_001199107.2):c.169C>T (p.R57C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2496317C>T" "" "likely benign" "" "0000557676" "0" "30" "16" "2546328" "2546328" "subst" "0.000174973" "01943" "TBC1D24_000091" "g.2546328G>A" "" "" "" "TBC1D24(NM_001199107.1):c.179G>A (p.R60Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2496327G>A" "" "likely benign" "" "0000557677" "0" "30" "16" "2546353" "2546353" "subst" "0.00142891" "01943" "TBC1D24_000034" "g.2546353G>A" "" "" "" "TBC1D24(NM_001199107.1):c.204G>A (p.T68=), TBC1D24(NM_001199107.2):c.204G>A (p.T68=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2496352G>A" "" "likely benign" "" "0000557678" "0" "30" "16" "2546533" "2546533" "subst" "1.65526E-5" "01943" "TBC1D24_000092" "g.2546533C>T" "" "" "" "TBC1D24(NM_001199107.1):c.384C>T (p.I128=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2496532C>T" "" "likely benign" "" "0000557679" "0" "50" "16" "2546558" "2546558" "subst" "1.65473E-5" "02325" "TBC1D24_000093" "g.2546558G>A" "" "" "" "TBC1D24(NM_001199107.2):c.409G>A (p.V137M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2496557G>A" "" "VUS" "" "0000557680" "0" "50" "16" "2546567" "2546567" "subst" "0" "01943" "TBC1D24_000094" "g.2546567C>G" "" "" "" "TBC1D24(NM_001199107.1):c.418C>G (p.L140V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2496566C>G" "" "VUS" "" "0000557681" "0" "30" "16" "2546587" "2546587" "subst" "4.13295E-6" "01943" "TBC1D24_000095" "g.2546587C>T" "" "" "" "TBC1D24(NM_001199107.1):c.438C>T (p.I146=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2496586C>T" "" "likely benign" "" "0000557682" "0" "50" "16" "2546606" "2546606" "subst" "6.99422E-5" "01804" "TBC1D24_000096" "g.2546606G>A" "" "" "" "TBC1D24(NM_001199107.1):c.457G>A (p.E153K, p.(Glu153Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2496605G>A" "" "VUS" "" "0000557683" "0" "70" "16" "2546606" "2546606" "subst" "6.99422E-5" "02327" "TBC1D24_000096" "g.2546606G>A" "" "" "" "TBC1D24(NM_001199107.1):c.457G>A (p.E153K, p.(Glu153Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2496605G>A" "" "likely pathogenic" "" "0000557685" "0" "50" "16" "2546883" "2546883" "subst" "8.12427E-6" "02327" "TBC1D24_000097" "g.2546883T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2496882T>C" "" "VUS" "" "0000557686" "0" "30" "16" "2546934" "2546934" "subst" "0.000658028" "02326" "TBC1D24_000098" "g.2546934C>T" "" "" "" "TBC1D24(NM_001199107.1):c.785C>T (p.S262L), TBC1D24(NM_001199107.2):c.785C>T (p.S262L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2496933C>T" "" "likely benign" "" "0000557688" "0" "30" "16" "2547124" "2547124" "subst" "1.75242E-5" "01943" "TBC1D24_000099" "g.2547124C>T" "" "" "" "TBC1D24(NM_001199107.1):c.965+10C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2497123C>T" "" "likely benign" "" "0000557689" "0" "90" "16" "2548263" "2548263" "del" "7.89515E-5" "02327" "TBC1D24_000049" "g.2548263del" "" "" "" "TBC1D24(NM_001199107.1):c.1008del (p.(His336GlnfsTer12)), TBC1D24(NM_001199107.1):c.1008delT (p.H336Qfs*12), TBC1D24(NM_001199107.2):c.1008delT (p...)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2498262del" "" "pathogenic" "" "0000557690" "0" "30" "16" "2548281" "2548281" "subst" "0.000136732" "02326" "TBC1D24_000100" "g.2548281G>A" "" "" "" "TBC1D24(NM_001199107.2):c.1026G>A (p.S342=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2498280G>A" "" "likely benign" "" "0000557691" "0" "30" "16" "2548380" "2548380" "subst" "5.64628E-5" "01943" "TBC1D24_000101" "g.2548380C>T" "" "" "" "TBC1D24(NM_001199107.1):c.1125C>T (p.H375=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2498379C>T" "" "likely benign" "" "0000557692" "0" "30" "16" "2549411" "2549411" "subst" "0.000589025" "02326" "TBC1D24_000054" "g.2549411C>T" "" "" "" "TBC1D24(NM_001199107.1):c.1196C>T (p.T399M), TBC1D24(NM_001199107.2):c.1196C>T (p.T399M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2499410C>T" "" "likely benign" "" "0000557693" "0" "30" "16" "2549485" "2549506" "del" "0" "02326" "TBC1D24_000102" "g.2549485_2549506del" "" "" "" "TBC1D24(NM_001199107.2):c.1206+64_1206+85delCCAGGGCTGGCTCTGATGGGCT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2499484_2499505del" "" "likely benign" "" "0000557694" "0" "50" "16" "2549873" "2549873" "subst" "0" "01943" "TBC1D24_000103" "g.2549873G>A" "" "" "" "TBC1D24(NM_001199107.1):c.1244G>A (p.R415K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2499872G>A" "" "VUS" "" "0000557695" "0" "90" "16" "2549877" "2549877" "del" "0" "01943" "TBC1D24_000104" "g.2549877del" "" "" "" "TBC1D24(NM_001199107.1):c.1248delT (p.N416Kfs*31)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2499876del" "" "pathogenic" "" "0000557696" "0" "50" "16" "2550287" "2550287" "subst" "1.32367E-5" "01943" "TBC1D24_000105" "g.2550287C>T" "" "" "" "TBC1D24(NM_001199107.1):c.1321C>T (p.R441C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2500286C>T" "" "VUS" "" "0000557697" "0" "10" "16" "2550406" "2550406" "subst" "0.0319757" "01943" "TBC1D24_000106" "g.2550406G>A" "" "" "" "TBC1D24(NM_001199107.1):c.1440G>A (p.S480=), TBC1D24(NM_001199107.2):c.1440G>A (p.S480=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2500405G>A" "" "benign" "" "0000557698" "0" "10" "16" "2550406" "2550406" "subst" "0.0319757" "02326" "TBC1D24_000106" "g.2550406G>A" "" "" "" "TBC1D24(NM_001199107.1):c.1440G>A (p.S480=), TBC1D24(NM_001199107.2):c.1440G>A (p.S480=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2500405G>A" "" "benign" "" "0000557699" "0" "30" "16" "2550508" "2550508" "subst" "5.77242E-5" "02326" "TBC1D24_000107" "g.2550508G>A" "" "" "" "TBC1D24(NM_001199107.2):c.1525+17G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2500507G>A" "" "likely benign" "" "0000557700" "0" "30" "16" "2550849" "2550849" "subst" "0.000303739" "02326" "TBC1D24_000108" "g.2550849C>T" "" "" "" "TBC1D24(NM_001199107.2):c.1570C>T (p.R524W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2500848C>T" "" "likely benign" "" "0000557702" "0" "30" "16" "2550955" "2550955" "subst" "4.12483E-6" "01943" "TBC1D24_000110" "g.2550955A>G" "" "" "" "TBC1D24(NM_001199107.1):c.1676A>G (p.Q559R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2500954A>G" "" "likely benign" "" "0000615911" "0" "30" "16" "2546318" "2546318" "subst" "0.00192434" "02325" "TBC1D24_000024" "g.2546318C>T" "" "" "" "TBC1D24(NM_001199107.1):c.169C>T (p.R57C, p.(Arg57Cys)), TBC1D24(NM_001199107.2):c.169C>T (p.R57C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2496317C>T" "" "likely benign" "" "0000615912" "0" "50" "16" "2546327" "2546327" "subst" "0.000231932" "02325" "TBC1D24_000025" "g.2546327C>T" "" "" "" "TBC1D24(NM_001199107.1):c.178C>T (p.R60W), TBC1D24(NM_001199107.2):c.178C>T (p.R60W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2496326C>T" "" "VUS" "" "0000615913" "0" "30" "16" "2546374" "2546374" "subst" "1.62868E-5" "01943" "TBC1D24_000111" "g.2546374C>T" "" "" "" "TBC1D24(NM_001199107.1):c.225C>T (p.S75=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2496373C>T" "" "likely benign" "" "0000615914" "0" "50" "16" "2550280" "2550280" "subst" "0" "01943" "TBC1D24_000114" "g.2550280G>T" "" "" "" "TBC1D24(NM_001199107.1):c.1314G>T (p.E438D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2500279G>T" "" "VUS" "" "0000623431" "0" "30" "16" "2546596" "2546596" "subst" "3.71293E-5" "01943" "TBC1D24_000112" "g.2546596C>T" "" "" "" "TBC1D24(NM_001199107.1):c.447C>T (p.A149=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2496595C>T" "" "likely benign" "" "0000623432" "0" "50" "16" "2546934" "2546934" "subst" "0.000658028" "01943" "TBC1D24_000098" "g.2546934C>T" "" "" "" "TBC1D24(NM_001199107.1):c.785C>T (p.S262L), TBC1D24(NM_001199107.2):c.785C>T (p.S262L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2496933C>T" "" "VUS" "" "0000623433" "0" "30" "16" "2547125" "2547125" "subst" "0.000878813" "02326" "TBC1D24_000113" "g.2547125G>A" "" "" "" "TBC1D24(NM_001199107.2):c.965+11G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2497124G>A" "" "likely benign" "" "0000649291" "1" "30" "16" "2552534" "2552534" "subst" "0" "03575" "TBC1D24_000115" "g.2552534C>T" "152/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "152 heterozygous; {DB:CLININrs4786286}" "Germline" "" "rs4786286" "0" "" "" "g.2502533C>T" "" "likely benign" "" "0000649292" "1" "50" "16" "2555438" "2555438" "subst" "0" "03575" "TBC1D24_000116" "g.2555438C>T" "55/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "55 heterozygous; {DB:CLININrs1135527}" "Germline" "" "rs1135527" "0" "" "" "g.2505437C>T" "" "VUS" "" "0000657805" "0" "30" "16" "2546143" "2546143" "subst" "0.00101714" "02327" "TBC1D24_000031" "g.2546143C>T" "" "" "" "TBC1D24(NM_001199107.2):c.-7C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2496142C>T" "" "likely benign" "" "0000657806" "0" "50" "16" "2546474" "2546474" "subst" "2.87869E-5" "02325" "TBC1D24_000026" "g.2546474C>T" "" "" "" "TBC1D24(NM_001199107.2):c.325C>T (p.R109C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2496473C>T" "" "VUS" "" "0000657807" "0" "50" "16" "2547027" "2547027" "subst" "0.000191426" "01943" "TBC1D24_000117" "g.2547027G>A" "" "" "" "TBC1D24(NM_001199107.1):c.878G>A (p.R293H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.2497026G>A" "" "VUS" "" "0000669326" "3" "30" "16" "2552534" "2552534" "subst" "0" "03575" "TBC1D24_000115" "g.2552534C>T" "2/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "2 homozygous; {DB:CLININrs4786286}" "Germline" "" "rs4786286" "0" "" "" "g.2502533C>T" "" "likely benign" "" "0000669327" "3" "50" "16" "2555438" "2555438" "subst" "0" "03575" "TBC1D24_000116" "g.2555438C>T" "1/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 homozygous; {DB:CLININrs1135527}" "Germline" "" "rs1135527" "0" "" "" "g.2505437C>T" "" "VUS" "" "0000680506" "0" "50" "16" "2548270" "2548270" "subst" "0.000174139" "01943" "TBC1D24_000118" "g.2548270A>G" "" "" "" "TBC1D24(NM_001199107.1):c.1015A>G (p.N339D), TBC1D24(NM_001199107.2):c.1015A>G (p.N339D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000680507" "0" "30" "16" "2550418" "2550418" "subst" "0" "01943" "TBC1D24_000119" "g.2550418C>T" "" "" "" "TBC1D24(NM_001199107.1):c.1452C>T (p.A484=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000692030" "0" "30" "16" "2550271" "2550271" "subst" "5.54303E-5" "01943" "TBC1D24_000120" "g.2550271G>C" "" "" "" "TBC1D24(NM_001199107.1):c.1305G>C (p.L435=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000710185" "1" "90" "16" "2550465" "2550465" "subst" "0" "00006" "TBC1D24_000084" "g.2550465C>T" "" "{PMID:Hong 2020:33333793}" "" "" "" "Germline" "" "" "0" "" "" "g.2500464C>T" "" "pathogenic (recessive)" "" "0000710196" "1" "90" "16" "2546268" "2546268" "subst" "4.0663E-6" "00006" "TBC1D24_000071" "g.2546268G>A" "" "{PMID:Hong 2020:33333793}" "" "" "" "Germline" "" "" "0" "" "" "g.2496267G>A" "" "pathogenic (recessive)" "" "0000710208" "2" "90" "16" "2546390" "2546401" "del" "0" "00006" "TBC1D24_000074" "g.2546390_2546401del" "" "{PMID:Hong 2020:33333793}" "" "" "" "Germline" "" "" "0" "" "" "g.2496389_2496400del" "" "pathogenic (recessive)" "" "0000710209" "2" "90" "16" "2550465" "2550465" "subst" "0" "00006" "TBC1D24_000084" "g.2550465C>T" "" "{PMID:Hong 2020:33333793}" "" "" "" "Germline" "" "" "0" "" "" "g.2500464C>T" "" "pathogenic (recessive)" "" "0000725690" "0" "50" "16" "2546327" "2546327" "subst" "0.000231932" "01943" "TBC1D24_000025" "g.2546327C>T" "" "" "" "TBC1D24(NM_001199107.1):c.178C>T (p.R60W), TBC1D24(NM_001199107.2):c.178C>T (p.R60W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000725691" "0" "50" "16" "2546381" "2546381" "subst" "2.0359E-5" "01943" "TBC1D24_000121" "g.2546381G>A" "" "" "" "TBC1D24(NM_001199107.1):c.232G>A (p.V78M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000725692" "0" "50" "16" "2546466" "2546466" "subst" "0" "01943" "TBC1D24_000122" "g.2546466T>C" "" "" "" "TBC1D24(NM_001199107.1):c.317T>C (p.L106P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000725693" "0" "50" "16" "2546829" "2546829" "subst" "1.62594E-5" "01943" "TBC1D24_000123" "g.2546829G>A" "" "" "" "TBC1D24(NM_001199107.1):c.680G>A (p.R227Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000725694" "0" "90" "16" "2550317" "2550317" "subst" "0" "01943" "TBC1D24_000124" "g.2550317G>T" "" "" "" "TBC1D24(NM_001199107.1):c.1351G>T (p.E451*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000760943" "0" "50" "16" "2548294" "2548294" "subst" "2.48847E-5" "03779" "TBC1D24_000125" "g.2548294G>A" "" "" "" "" "" "CLASSIFICATION record" "" "rs371031447" "0" "" "" "" "" "VUS" "" "0000764157" "11" "70" "16" "2546682" "2546682" "subst" "8.14491E-6" "04048" "TBC1D24_000017" "g.2546682C>T" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.2496681C>T" "" "likely pathogenic (dominant)" "" "0000764158" "11" "70" "16" "2546702" "2546702" "subst" "0" "04048" "TBC1D24_000126" "g.2546702G>A" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.2496701G>A" "" "likely pathogenic (dominant)" "" "0000764159" "11" "70" "16" "2550427" "2550427" "subst" "0" "04048" "TBC1D24_000128" "g.2550427C>G" "" "" "" "" "" "Germline" "yes" "" "" "" "" "g.2500426C>G" "" "likely pathogenic (dominant)" "" "0000764160" "11" "70" "16" "2550426" "2550426" "subst" "0" "04048" "TBC1D24_000127" "g.2550426A>T" "" "" "" "" "" "Germline" "yes" "" "" "" "" "g.2500425A>T" "" "likely pathogenic (dominant)" "" "0000791064" "0" "50" "16" "2546754" "2546754" "subst" "0" "03779" "TBC1D24_000129" "g.2546754C>T" "" "" "" "" "" "CLASSIFICATION record" "" "rs796053400" "0" "" "" "" "" "VUS" "" "0000792266" "0" "90" "16" "2546790" "2546790" "subst" "0.000972137" "00000" "TBC1D24_000018" "g.2546790G>A" "" "{PMID:_Audo-2012:22277662}" "" "c.641G>A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000807296" "0" "70" "16" "2546606" "2546606" "subst" "6.99422E-5" "01943" "TBC1D24_000096" "g.2546606G>A" "" "" "" "TBC1D24(NM_001199107.1):c.457G>A (p.E153K, p.(Glu153Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000807297" "0" "50" "16" "2546750" "2546750" "subst" "3.66053E-5" "01943" "TBC1D24_000130" "g.2546750G>A" "" "" "" "TBC1D24(NM_001199107.1):c.601G>A (p.V201M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000807298" "0" "70" "16" "2546958" "2546958" "subst" "3.65595E-5" "01943" "TBC1D24_000131" "g.2546958G>A" "" "" "" "TBC1D24(NM_001199107.1):c.809G>A (p.R270H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000811020" "0" "70" "16" "2546342" "2546342" "subst" "1.22105E-5" "03779" "TBC1D24_000132" "g.2546342C>T" "" "" "" "" "" "CLASSIFICATION record" "" "rs750421791" "0" "" "" "" "" "likely pathogenic" "" "0000811021" "0" "50" "16" "2546832" "2546832" "subst" "1.62562E-5" "03779" "TBC1D24_000133" "g.2546832T>A" "" "" "" "" "" "CLASSIFICATION record" "" "rs778090075" "0" "" "" "" "" "VUS" "" "0000837046" "3" "70" "16" "2546790" "2546790" "subst" "0.000972137" "02494" "TBC1D24_000018" "g.2546790G>A" "" "" "" "" "" "Germline" "" "" "" "" "" "" "" "likely pathogenic (recessive)" "" "0000854438" "0" "30" "16" "2546590" "2546590" "subst" "0.000466464" "01943" "TBC1D24_000134" "g.2546590C>T" "" "" "" "TBC1D24(NM_001199107.1):c.441C>T (p.D147=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000854439" "0" "50" "16" "2546642" "2546642" "subst" "0.000600402" "01943" "TBC1D24_000135" "g.2546642G>A" "" "" "" "TBC1D24(NM_001199107.1):c.493G>A (p.G165S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000854440" "0" "50" "16" "2550423" "2550423" "subst" "0" "02325" "TBC1D24_000136" "g.2550423G>A" "" "" "" "TBC1D24(NM_001199107.2):c.1457G>A (p.R486H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000914596" "0" "70" "16" "2546682" "2546682" "subst" "8.14491E-6" "02327" "TBC1D24_000017" "g.2546682C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000918628" "0" "90" "16" "2546567" "2546567" "subst" "0" "01602" "TBC1D24_000094" "g.2546567C>G" "" "" "" "" "" "Unknown" "" "" "" "" "" "" "" "pathogenic" "ACMG" "0000918850" "0" "70" "16" "2549403" "2549403" "subst" "8.17214E-6" "01602" "TBC1D24_000137" "g.2549403C>G" "" "" "" "" "" "Unknown" "" "rs1387751971" "" "" "" "" "" "likely pathogenic" "ACMG" "0000930582" "0" "50" "16" "2548270" "2548270" "subst" "0.000174139" "02329" "TBC1D24_000118" "g.2548270A>G" "" "" "" "TBC1D24(NM_001199107.1):c.1015A>G (p.N339D), TBC1D24(NM_001199107.2):c.1015A>G (p.N339D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000936494" "21" "70" "16" "2546994" "2546994" "subst" "0.00017878" "00006" "TBC1D24_000138" "g.2546994C>G" "" "{PMID:Hamdan 2017:29100083}" "" "" "" "Germline" "" "" "0" "" "" "g.2496993C>G" "" "likely pathogenic (recessive)" "" "0000936495" "11" "90" "16" "2548263" "2548263" "del" "7.89515E-5" "00006" "TBC1D24_000009" "g.2548263del" "" "{PMID:Hamdan 2017:29100083}" "" "" "" "Germline" "" "" "0" "" "" "g.2498262del" "" "pathogenic (recessive)" "" "0000944377" "0" "70" "16" "2546883" "2546883" "subst" "8.12427E-6" "00006" "TBC1D24_000097" "g.2546883T>C" "" "{PMID:Boucher 2020:33229591}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.2496882T>C" "" "likely pathogenic (dominant)" "" "0000944396" "0" "90" "16" "2550491" "2550491" "subst" "2.00216E-5" "00006" "TBC1D24_000139" "g.2550491G>A" "" "{PMID:Boucher 2020:33229591}" "" "" "" "Germline" "" "" "0" "" "" "g.2500490G>A" "" "VUS" "" "0000944447" "0" "70" "16" "2546267" "2546267" "subst" "8.13101E-6" "00006" "TBC1D24_000008" "g.2546267C>T" "" "{PMID:Boucher 2020:33229591}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.2496266C>T" "" "likely pathogenic" "" "0000968299" "0" "50" "16" "2550849" "2550849" "subst" "0.000303739" "02325" "TBC1D24_000108" "g.2550849C>T" "" "" "" "TBC1D24(NM_001199107.2):c.1570C>T (p.R524W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000981804" "0" "10" "16" "2548257" "2548257" "subst" "0.00131612" "01804" "TBC1D24_000048" "g.2548257C>T" "" "" "" "TBC1D24(NM_001199107.1):c.1002C>T (p.A334=), TBC1D24(NM_001199107.2):c.1002C>T (p.(Ala334=), p.A334=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000981805" "0" "50" "16" "2550797" "2550809" "del" "0" "01804" "TBC1D24_000140" "g.2550797_2550809del" "" "" "" "TBC1D24(NM_001199107.2):c.1526-8_1530del" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001002125" "0" "50" "16" "2550399" "2550399" "subst" "0" "02327" "TBC1D24_000141" "g.2550399G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001015376" "0" "90" "16" "2548263" "2548263" "del" "7.89515E-5" "02325" "TBC1D24_000009" "g.2548263del" "" "" "" "TBC1D24(NM_001199107.1):c.1008del (p.(His336GlnfsTer12)), TBC1D24(NM_001199107.1):c.1008delT (p.H336Qfs*12), TBC1D24(NM_001199107.2):c.1008delT (p...)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001040986" "0" "50" "16" "2522475" "2522475" "subst" "8.30841E-6" "01804" "TBC1D24_000142" "g.2522475A>G" "" "" "" "NTN3(NM_006181.3):c.773A>G (p.(Asn258Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001040989" "0" "30" "16" "2523933" "2523933" "subst" "0" "01804" "TBC1D24_000143" "g.2523933C>A" "" "" "" "NTN3(NM_006181.3):c.1570C>A (p.(Arg524Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001040990" "0" "50" "16" "2550422" "2550422" "subst" "3.23254E-5" "01804" "TBC1D24_000144" "g.2550422C>T" "" "" "" "TBC1D24(NM_001199107.2):c.1456C>T (p.(Arg486Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001055386" "0" "70" "16" "2548348" "2548348" "subst" "0" "01804" "TBC1D24_000028" "g.2548348C>T" "" "" "" "TBC1D24(NM_001199107.2):c.1093C>T (p.(Gln365*), p.Q365*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001066378" "0" "50" "16" "2543593" "2543593" "subst" "0" "02325" "TBC1D24_000145" "g.2543593G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001066379" "0" "90" "16" "2546207" "2546207" "subst" "6.50042E-5" "02325" "TBC1D24_000019" "g.2546207C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001066380" "0" "30" "16" "2546328" "2546328" "subst" "0.000174973" "02325" "TBC1D24_000091" "g.2546328G>A" "" "" "" "TBC1D24(NM_001199107.1):c.179G>A (p.R60Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001066381" "0" "70" "16" "2546606" "2546606" "subst" "6.99422E-5" "02325" "TBC1D24_000096" "g.2546606G>A" "" "" "" "TBC1D24(NM_001199107.1):c.457G>A (p.E153K, p.(Glu153Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001072413" "0" "50" "16" "2550430" "2550430" "subst" "0" "03779" "TBC1D24_000146" "g.2550430C>A" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes TBC1D24 ## Count = 446 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000017084" "00001779" "75" "468" "0" "468" "0" "c.468C>A" "r.(?)" "p.(Cys156*)" "2" "0000017085" "00001779" "75" "686" "0" "686" "0" "c.686T>C" "r.(?)" "p.(Phe229Ser)" "2" "0000022913" "00023820" "55" "751" "0" "751" "0" "c.751T>C" "r.(?)" "p.(Phe251Leu)" "2" "0000022913" "00001779" "55" "751" "0" "751" "0" "c.751T>C" "r.(?)" "p.(Phe251Leu)" "2" "0000022914" "00023820" "55" "439" "0" "439" "0" "c.439G>C" "r.(?)" "p.(Asp147His)" "2" "0000022914" "00001779" "55" "439" "0" "439" "0" "c.439G>C" "r.(?)" "p.(Asp147His)" "2" "0000022915" "00023820" "55" "1526" "0" "1526" "0" "c.1526C>T" "r.(?)" "p.(Ala509Val)" "7" "0000022915" "00001779" "55" "1544" "0" "1544" "0" "c.1544C>T" "r.(?)" "p.(Ala515Val)" "8" "0000022916" "00001779" "55" "969" "0" "970" "0" "c.969_970del" "r.(?)" "p.(Ser324Thrfs*3)" "3" "0000022917" "00023820" "55" "724" "0" "724" "0" "c.724C>T" "r.(?)" "p.(Arg242Cys)" "2" "0000022917" "00001779" "55" "724" "0" "724" "0" "c.724C>T" "r.(?)" "p.(Arg242Cys)" "2" "0000022918" "00023820" "55" "118" "0" "118" "0" "c.118C>T" "r.(?)" "p.(Arg40Cys)" "2" "0000022918" "00001779" "55" "118" "0" "118" "0" "c.118C>T" "r.(?)" "p.(Arg40Cys)" "2" "0000022919" "00023820" "55" "724" "0" "724" "0" "c.724C>T" "r.(?)" "p.(Arg242Cys)" "2" "0000022919" "00001779" "55" "724" "0" "724" "0" "c.724C>T" "r.(?)" "p.(Arg242Cys)" "2" "0000022921" "00023820" "55" "990" "0" "990" "0" "c.990del" "r.(?)" "p.(His330Glnfs*12)" "3" "0000022921" "00001779" "55" "1008" "0" "1008" "0" "c.1008del" "r.(?)" "p.(His336Glnfs*12)" "4" "0000022922" "00023820" "55" "1188" "5" "1188" "5" "c.1188+5G>A" "r.spl" "p.?" "5" "0000022922" "00001779" "55" "1206" "5" "1206" "5" "c.1206+5G>A" "r.spl" "p.?" "5" "0000022923" "00023820" "55" "724" "0" "724" "0" "c.724C>T" "r.(?)" "p.(Arg242Cys)" "2" "0000022923" "00001779" "55" "724" "0" "724" "0" "c.724C>T" "r.(?)" "p.(Arg242Cys)" "2" "0000022924" "00023820" "55" "724" "0" "724" "0" "c.724C>T" "r.(?)" "p.(Arg242Cys)" "2" "0000022924" "00001779" "55" "724" "0" "724" "0" "c.724C>T" "r.(?)" "p.(Arg242Cys)" "2" "0000022925" "00023820" "55" "58" "0" "58" "0" "c.58C>T" "r.(?)" "p.(Gln20*)" "2" "0000022925" "00001779" "55" "58" "0" "58" "0" "c.58C>T" "r.(?)" "p.(Gln20*)" "2" "0000022926" "00023820" "55" "58" "0" "58" "0" "c.58C>T" "r.(?)" "p.(Gln20*)" "2" "0000022926" "00001779" "55" "58" "0" "58" "0" "c.58C>T" "r.(?)" "p.(Gln20*)" "2" "0000022927" "00023820" "55" "990" "0" "990" "0" "c.990del" "r.(?)" "p.(His330Glnfs*12)" "3" "0000022927" "00001779" "55" "1008" "0" "1008" "0" "c.1008del" "r.(?)" "p.(His336Glnfs*12)" "4" "0000022928" "00023820" "55" "724" "0" "724" "0" "c.724C>T" "r.(?)" "p.(Arg242Cys)" "2" "0000022928" "00001779" "55" "724" "0" "724" "0" "c.724C>T" "r.(?)" "p.(Arg242Cys)" "2" "0000022929" "00023820" "55" "119" "0" "119" "0" "c.119G>T" "r.(?)" "p.(Arg40Leu)" "2" "0000022929" "00001779" "55" "119" "0" "119" "0" "c.119G>T" "r.(?)" "p.(Arg40Leu)" "2" "0000022930" "00023820" "55" "328" "0" "328" "0" "c.328G>A" "r.(?)" "p.(Gly110Ser)" "2" "0000022930" "00001779" "55" "328" "0" "328" "0" "c.328G>A" "r.(?)" "p.(Gly110Ser)" "2" "0000022931" "00023820" "55" "724" "0" "724" "0" "c.724C>T" "r.(?)" "p.(Arg242Cys)" "2" "0000022931" "00001779" "55" "724" "0" "724" "0" "c.724C>T" "r.(?)" "p.(Arg242Cys)" "2" "0000022932" "00023820" "55" "724" "0" "724" "0" "c.724C>T" "r.(?)" "p.(Arg242Cys)" "2" "0000022932" "00001779" "55" "724" "0" "724" "0" "c.724C>T" "r.(?)" "p.(Arg242Cys)" "2" "0000022933" "00023820" "55" "981" "0" "981" "0" "c.981G>T" "r.(?)" "p.(Leu327Phe)" "3" "0000022933" "00001779" "55" "999" "0" "999" "0" "c.999G>T" "r.(?)" "p.(Leu333Phe)" "4" "0000022996" "00023820" "55" "208" "0" "208" "0" "c.208G>T" "r.(?)" "p.(Asp70Tyr)" "2" "0000022996" "00001779" "55" "208" "0" "208" "0" "c.208G>T" "r.(?)" "p.(Asp70Tyr)" "2" "0000022997" "00023820" "55" "878" "0" "878" "0" "c.878G>C" "r.(?)" "p.(Arg293Pro)" "2" "0000022997" "00001779" "55" "878" "0" "878" "0" "c.878G>C" "r.(?)" "p.(Arg293Pro)" "2" "0000035784" "00001779" "75" "533" "0" "533" "0" "c.533C>T" "r.(?)" "p.(Ser178Leu)" "2" "0000035993" "00023820" "55" "641" "0" "641" "0" "c.641G>A" "r.(?)" "p.(Arg214His)" "2" "0000038051" "00023820" "00" "1442" "0" "1442" "0" "c.1442dup" "r.(?)" "p.(His481Glnfs*71)" "" "0000038051" "00001779" "00" "1460" "0" "1460" "0" "c.1460dup" "r.(?)" "p.(His487Glnfs*71)" "" "0000038052" "00023820" "00" "313" "0" "313" "0" "c.313T>C" "r.(?)" "p.(Cys105Arg)" "" "0000038052" "00001779" "00" "313" "0" "313" "0" "c.313T>C" "r.(?)" "p.(Cys105Arg)" "" "0000047851" "00001779" "00" "1079" "0" "1079" "0" "c.1079G>T" "r.(?)" "p.(Arg360Leu)" "" "0000089815" "00001779" "90" "194" "0" "194" "0" "c.194G>T" "r.(?)" "p.(Arg65Leu)" "2" "0000188122" "00023820" "00" "641" "0" "641" "0" "c.641G>A" "r.(?)" "p.(Arg214His)" "" "0000188122" "00001779" "00" "641" "0" "641" "0" "c.641G>A" "r.(?)" "p.(Arg214His)" "" "0000188168" "00023820" "00" "641" "0" "641" "0" "c.641G>A" "r.(?)" "p.(Arg214His)" "" "0000188168" "00001779" "00" "641" "0" "641" "0" "c.641G>A" "r.(?)" "p.(Arg214His)" "" "0000188171" "00023820" "00" "1573" "0" "1573" "0" "c.1573G>A" "r.(?)" "p.(Asp525Asn)" "" "0000188171" "00001779" "00" "1591" "0" "1591" "0" "c.1591G>A" "r.(?)" "p.(Asp531Asn)" "" "0000188204" "00023820" "00" "178" "0" "178" "0" "c.178C>T" "r.(?)" "p.(Arg60Trp)" "" "0000188204" "00001779" "00" "178" "0" "178" "0" "c.178C>T" "r.(?)" "p.(Arg60Trp)" "" "0000188214" "00023820" "00" "641" "0" "641" "0" "c.641G>A" "r.(?)" "p.(Arg214His)" "" "0000188214" "00001779" "00" "641" "0" "641" "0" "c.641G>A" "r.(?)" "p.(Arg214His)" "" "0000188283" "00023820" "00" "325" "0" "325" "0" "c.325C>T" "r.(?)" "p.(Arg109Cys)" "" "0000188283" "00001779" "00" "325" "0" "325" "0" "c.325C>T" "r.(?)" "p.(Arg109Cys)" "" "0000188292" "00023820" "00" "1075" "0" "1075" "0" "c.1075C>T" "r.(?)" "p.(Gln359*)" "" "0000188292" "00001779" "00" "1093" "0" "1093" "0" "c.1093C>T" "r.(?)" "p.(Gln365*)" "" "0000188362" "00023820" "00" "169" "0" "169" "0" "c.169C>T" "r.(?)" "p.(Arg57Cys)" "" "0000188362" "00001779" "00" "169" "0" "169" "0" "c.169C>T" "r.(?)" "p.(Arg57Cys)" "" "0000188506" "00023820" "00" "641" "0" "641" "0" "c.641G>A" "r.(?)" "p.(Arg214His)" "" "0000188506" "00001779" "00" "641" "0" "641" "0" "c.641G>A" "r.(?)" "p.(Arg214His)" "" "0000188507" "00023820" "00" "169" "0" "169" "0" "c.169C>T" "r.(?)" "p.(Arg57Cys)" "" "0000188507" "00001779" "00" "169" "0" "169" "0" "c.169C>T" "r.(?)" "p.(Arg57Cys)" "" "0000188515" "00023820" "00" "169" "0" "169" "0" "c.169C>T" "r.(?)" "p.(Arg57Cys)" "" "0000188515" "00001779" "00" "169" "0" "169" "0" "c.169C>T" "r.(?)" "p.(Arg57Cys)" "" "0000188526" "00023820" "00" "344" "0" "344" "0" "c.344G>T" "r.(?)" "p.(Arg115Leu)" "" "0000188526" "00001779" "00" "344" "0" "344" "0" "c.344G>T" "r.(?)" "p.(Arg115Leu)" "" "0000256155" "00023820" "50" "74" "0" "74" "0" "c.74A>G" "r.(?)" "p.(Lys25Arg)" "" "0000256155" "00001779" "50" "74" "0" "74" "0" "c.74A>G" "r.(?)" "p.(Lys25Arg)" "" "0000311722" "00023820" "30" "-7" "0" "-7" "0" "c.-7C>T" "r.(?)" "p.(=)" "" "0000311722" "00001779" "30" "-7" "0" "-7" "0" "c.-7C>T" "r.(?)" "p.(=)" "" "0000311723" "00023820" "30" "984" "0" "984" "0" "c.984C>T" "r.(?)" "p.(Ala328=)" "" "0000311723" "00001779" "30" "1002" "0" "1002" "0" "c.1002C>T" "r.(?)" "p.(Ala334=)" "" "0000311724" "00023820" "30" "1482" "0" "1482" "0" "c.1482G>A" "r.(?)" "p.(Ala494=)" "" "0000311724" "00001779" "30" "1500" "0" "1500" "0" "c.1500G>A" "r.(?)" "p.(Ala500=)" "" "0000311725" "00023820" "30" "204" "0" "204" "0" "c.204G>A" "r.(?)" "p.(Thr68=)" "" "0000311725" "00001779" "30" "204" "0" "204" "0" "c.204G>A" "r.(?)" "p.(Thr68=)" "" "0000311726" "00023820" "30" "885" "0" "885" "0" "c.885C>G" "r.(?)" "p.(Phe295Leu)" "" "0000311726" "00001779" "30" "885" "0" "885" "0" "c.885C>G" "r.(?)" "p.(Phe295Leu)" "" "0000314385" "00023820" "30" "-78" "0" "-78" "0" "c.-78G>A" "r.(?)" "p.(=)" "" "0000314385" "00001779" "30" "-78" "0" "-78" "0" "c.-78G>A" "r.(?)" "p.(=)" "" "0000314386" "00023820" "30" "1698" "0" "1698" "0" "c.*36G>T" "r.(=)" "p.(=)" "" "0000314386" "00001779" "30" "1716" "0" "1716" "0" "c.*36G>T" "r.(=)" "p.(=)" "" "0000314387" "00023820" "70" "1075" "0" "1075" "0" "c.1075C>T" "r.(?)" "p.(Gln359Ter)" "" "0000314387" "00001779" "70" "1093" "0" "1093" "0" "c.1093C>T" "r.(?)" "p.(Gln365Ter)" "" "0000314388" "00023820" "10" "1125" "-6" "1125" "-6" "c.1125-6C>T" "r.(=)" "p.(=)" "" "0000314388" "00001779" "10" "1143" "-6" "1143" "-6" "c.1143-6C>T" "r.(=)" "p.(=)" "" "0000314389" "00023820" "70" "1152" "0" "1152" "0" "c.1152G>T" "r.(?)" "p.(Glu384Asp)" "" "0000314389" "00001779" "70" "1170" "0" "1170" "0" "c.1170G>T" "r.(?)" "p.(Glu390Asp)" "" "0000314390" "00023820" "30" "1189" "-48" "1189" "-48" "c.1189-48C>T" "r.(=)" "p.(=)" "" "0000314390" "00001779" "30" "1207" "-48" "1207" "-48" "c.1207-48C>T" "r.(=)" "p.(=)" "" "0000314391" "00023820" "30" "1285" "-29" "1285" "-29" "c.1285-29C>T" "r.(=)" "p.(=)" "" "0000314391" "00001779" "30" "1303" "-29" "1303" "-29" "c.1303-29C>T" "r.(=)" "p.(=)" "" "0000314392" "00023820" "30" "1308" "0" "1308" "0" "c.1308C>T" "r.(?)" "p.(Tyr436=)" "" "0000314392" "00001779" "30" "1326" "0" "1326" "0" "c.1326C>T" "r.(?)" "p.(Tyr442=)" "" "0000314393" "00023820" "30" "1482" "0" "1482" "0" "c.1482G>A" "r.(?)" "p.(Ala494=)" "" "0000314393" "00001779" "30" "1500" "0" "1500" "0" "c.1500G>A" "r.(?)" "p.(Ala500=)" "" "0000314394" "00023820" "30" "1491" "0" "1491" "0" "c.1491C>T" "r.(?)" "p.(Ser497=)" "" "0000314394" "00001779" "30" "1509" "0" "1509" "0" "c.1509C>T" "r.(?)" "p.(Ser503=)" "" "0000314395" "00023820" "30" "1508" "-20" "1508" "-20" "c.1508-20C>T" "r.(=)" "p.(=)" "" "0000314395" "00001779" "30" "1526" "-20" "1526" "-20" "c.1526-20C>T" "r.(=)" "p.(=)" "" "0000314396" "00023820" "30" "1508" "-24" "1508" "-24" "c.1508-24G>A" "r.(=)" "p.(=)" "" "0000314396" "00001779" "30" "1526" "-24" "1526" "-24" "c.1526-24G>A" "r.(=)" "p.(=)" "" "0000314397" "00023820" "30" "192" "0" "192" "0" "c.192C>T" "r.(?)" "p.(Cys64=)" "" "0000314397" "00001779" "30" "192" "0" "192" "0" "c.192C>T" "r.(?)" "p.(Cys64=)" "" "0000314398" "00023820" "30" "204" "0" "204" "0" "c.204G>A" "r.(?)" "p.(Thr68=)" "" "0000314398" "00001779" "30" "204" "0" "204" "0" "c.204G>A" "r.(?)" "p.(Thr68=)" "" "0000314400" "00023820" "30" "821" "0" "821" "0" "c.821G>A" "r.(?)" "p.(Arg274Lys)" "" "0000314400" "00001779" "30" "821" "0" "821" "0" "c.821G>A" "r.(?)" "p.(Arg274Lys)" "" "0000314401" "00023820" "10" "885" "0" "885" "0" "c.885C>G" "r.(?)" "p.(Phe295Leu)" "" "0000314401" "00001779" "10" "885" "0" "885" "0" "c.885C>G" "r.(?)" "p.(Phe295Leu)" "" "0000314402" "00023820" "30" "965" "40" "965" "40" "c.965+40G>A" "r.(=)" "p.(=)" "" "0000314402" "00001779" "30" "965" "40" "965" "40" "c.965+40G>A" "r.(=)" "p.(=)" "" "0000314403" "00023820" "30" "965" "7" "965" "7" "c.965+7C>T" "r.(=)" "p.(=)" "" "0000314403" "00001779" "30" "965" "7" "965" "7" "c.965+7C>T" "r.(=)" "p.(=)" "" "0000314404" "00023820" "10" "966" "-372" "966" "-372" "c.966-372C>T" "r.(=)" "p.(=)" "" "0000314404" "00001779" "10" "983" "139" "983" "139" "c.983+139C>T" "r.(=)" "p.(=)" "" "0000314405" "00023820" "30" "966" "-436" "966" "-436" "c.966-436T>G" "r.(=)" "p.(=)" "" "0000314405" "00001779" "30" "983" "75" "983" "75" "c.983+75T>G" "r.(=)" "p.(=)" "" "0000314406" "00023820" "30" "966" "-416" "966" "-416" "c.966-416G>A" "r.(=)" "p.(=)" "" "0000314406" "00001779" "30" "983" "95" "983" "95" "c.983+95G>A" "r.(=)" "p.(=)" "" "0000316246" "00023820" "30" "984" "0" "984" "0" "c.984C>T" "r.(?)" "p.(Ala328=)" "" "0000316246" "00001779" "30" "1002" "0" "1002" "0" "c.1002C>T" "r.(?)" "p.(Ala334=)" "" "0000316247" "00023820" "90" "990" "0" "990" "0" "c.990del" "r.(?)" "p.(His330GlnfsTer12)" "" "0000316247" "00001779" "90" "1008" "0" "1008" "0" "c.1008del" "r.(?)" "p.(His336GlnfsTer12)" "" "0000316248" "00023820" "50" "1066" "0" "1066" "0" "c.1066G>A" "r.(?)" "p.(Ala356Thr)" "" "0000316248" "00001779" "50" "1084" "0" "1084" "0" "c.1084G>A" "r.(?)" "p.(Ala362Thr)" "" "0000316249" "00023820" "10" "1125" "-6" "1125" "-6" "c.1125-6C>T" "r.(=)" "p.(=)" "" "0000316249" "00001779" "10" "1143" "-6" "1143" "-6" "c.1143-6C>T" "r.(=)" "p.(=)" "" "0000316250" "00023820" "50" "1178" "0" "1178" "0" "c.1178C>T" "r.(?)" "p.(Thr393Met)" "" "0000316250" "00001779" "50" "1196" "0" "1196" "0" "c.1196C>T" "r.(?)" "p.(Thr399Met)" "" "0000316251" "00023820" "30" "1308" "0" "1308" "0" "c.1308C>T" "r.(?)" "p.(Tyr436=)" "" "0000316251" "00001779" "30" "1326" "0" "1326" "0" "c.1326C>T" "r.(?)" "p.(Tyr442=)" "" "0000316252" "00023820" "30" "1349" "0" "1349" "0" "c.1349C>T" "r.(?)" "p.(Pro450Leu)" "" "0000316252" "00001779" "30" "1367" "0" "1367" "0" "c.1367C>T" "r.(?)" "p.(Pro456Leu)" "" "0000316253" "00023820" "30" "1393" "0" "1393" "0" "c.1393G>A" "r.(?)" "p.(Ala465Thr)" "" "0000316253" "00001779" "30" "1411" "0" "1411" "0" "c.1411G>A" "r.(?)" "p.(Ala471Thr)" "" "0000316254" "00023820" "50" "1409" "0" "1409" "0" "c.1409C>A" "r.(?)" "p.(Ala470Asp)" "" "0000316254" "00001779" "50" "1427" "0" "1427" "0" "c.1427C>A" "r.(?)" "p.(Ala476Asp)" "" "0000316255" "00023820" "30" "1482" "0" "1482" "0" "c.1482G>A" "r.(?)" "p.(Ala494=)" "" "0000316255" "00001779" "30" "1500" "0" "1500" "0" "c.1500G>A" "r.(?)" "p.(Ala500=)" "" "0000316256" "00023820" "30" "1491" "0" "1491" "0" "c.1491C>T" "r.(?)" "p.(Ser497=)" "" "0000316256" "00001779" "30" "1509" "0" "1509" "0" "c.1509C>T" "r.(?)" "p.(Ser503=)" "" "0000316257" "00023820" "10" "1508" "-20" "1508" "-20" "c.1508-20C>T" "r.(=)" "p.(=)" "" "0000316257" "00001779" "10" "1526" "-20" "1526" "-20" "c.1526-20C>T" "r.(=)" "p.(=)" "" "0000316258" "00023820" "30" "207" "0" "207" "0" "c.207T>C" "r.(?)" "p.(Pro69=)" "" "0000316258" "00001779" "30" "207" "0" "207" "0" "c.207T>C" "r.(?)" "p.(Pro69=)" "" "0000316259" "00023820" "30" "546" "0" "546" "0" "c.546G>A" "r.(?)" "p.(Thr182=)" "" "0000316259" "00001779" "30" "546" "0" "546" "0" "c.546G>A" "r.(?)" "p.(Thr182=)" "" "0000316260" "00023820" "50" "622" "0" "639" "0" "c.622_639del" "r.(?)" "p.(Val208_Gln213del)" "" "0000316260" "00001779" "50" "622" "0" "639" "0" "c.622_639del" "r.(?)" "p.(Val208_Gln213del)" "" "0000316261" "00023820" "30" "702" "0" "702" "0" "c.702G>A" "r.(?)" "p.(Val234=)" "" "0000316261" "00001779" "30" "702" "0" "702" "0" "c.702G>A" "r.(?)" "p.(Val234=)" "" "0000316262" "00023820" "50" "866" "0" "866" "0" "c.866C>T" "r.(?)" "p.(Ala289Val)" "" "0000316262" "00001779" "50" "866" "0" "866" "0" "c.866C>T" "r.(?)" "p.(Ala289Val)" "" "0000316263" "00023820" "30" "885" "0" "885" "0" "c.885C>G" "r.(?)" "p.(Phe295Leu)" "" "0000316263" "00001779" "30" "885" "0" "885" "0" "c.885C>G" "r.(?)" "p.(Phe295Leu)" "" "0000324492" "00023820" "50" "-3491" "0" "-3491" "0" "c.-3491G>A" "r.(?)" "p.(=)" "" "0000324492" "00001779" "50" "-3491" "0" "-3491" "0" "c.-3491G>A" "r.(?)" "p.(=)" "" "0000324493" "00023820" "50" "-3440" "0" "-3387" "0" "c.-3440_-3387del" "r.(?)" "p.(=)" "" "0000324493" "00001779" "50" "-3440" "0" "-3387" "0" "c.-3440_-3387del" "r.(?)" "p.(=)" "" "0000324499" "00023820" "50" "-2849" "0" "-2830" "0" "c.-2849_-2830del" "r.(?)" "p.(=)" "" "0000324499" "00001779" "50" "-2849" "0" "-2830" "0" "c.-2849_-2830del" "r.(?)" "p.(=)" "" "0000324501" "00023820" "50" "-2825" "0" "-2818" "0" "c.-2825_-2818del" "r.(?)" "p.(=)" "" "0000324501" "00001779" "50" "-2825" "0" "-2818" "0" "c.-2825_-2818del" "r.(?)" "p.(=)" "" "0000324502" "00023820" "50" "-2814" "0" "-2805" "0" "c.-2814_-2805del" "r.(?)" "p.(=)" "" "0000324502" "00001779" "50" "-2814" "0" "-2805" "0" "c.-2814_-2805del" "r.(?)" "p.(=)" "" "0000324503" "00023820" "50" "-2801" "0" "-2772" "0" "c.-2801_-2772del" "r.(?)" "p.(=)" "" "0000324503" "00001779" "50" "-2801" "0" "-2772" "0" "c.-2801_-2772del" "r.(?)" "p.(=)" "" "0000324505" "00023820" "50" "-1500" "0" "-1489" "0" "c.-1500_-1489del" "r.(?)" "p.(=)" "" "0000324505" "00001779" "50" "-1500" "0" "-1489" "0" "c.-1500_-1489del" "r.(?)" "p.(=)" "" "0000324506" "00023820" "50" "294" "0" "294" "0" "c.294C>A" "r.(?)" "p.(Asn98Lys)" "" "0000324506" "00001779" "50" "294" "0" "294" "0" "c.294C>A" "r.(?)" "p.(Asn98Lys)" "" "0000324507" "00023820" "50" "990" "0" "990" "0" "c.990del" "r.(?)" "p.(His330GlnfsTer12)" "" "0000324507" "00001779" "50" "1008" "0" "1008" "0" "c.1008del" "r.(?)" "p.(His336GlnfsTer12)" "" "0000337630" "00023820" "30" "1718" "0" "1718" "0" "c.*56C>T" "r.(=)" "p.(=)" "" "0000337630" "00001779" "30" "1736" "0" "1736" "0" "c.*56C>T" "r.(=)" "p.(=)" "" "0000342716" "00023820" "50" "1061" "0" "1061" "0" "c.1061G>A" "r.(?)" "p.(Arg354His)" "" "0000342716" "00001779" "50" "1079" "0" "1079" "0" "c.1079G>A" "r.(?)" "p.(Arg360His)" "" "0000349596" "00023820" "50" "197" "0" "197" "0" "c.197C>T" "r.(?)" "p.(Thr66Met)" "" "0000349596" "00001779" "50" "197" "0" "197" "0" "c.197C>T" "r.(?)" "p.(Thr66Met)" "" "0000368213" "00001779" "70" "194" "0" "194" "0" "c.194G>T" "r.(?)" "p.(Arg65Leu)" "2" "0000398607" "00001779" "70" "619" "0" "619" "0" "c.619C>T" "r.(?)" "p.(Gln207*)" "" "0000398608" "00001779" "70" "866" "0" "866" "0" "c.866C>T" "r.(?)" "p.(Ala289Val)" "" "0000401452" "00023820" "70" "116" "0" "116" "0" "c.116C>T" "r.(?)" "p.(Ala39Val)" "" "0000401452" "00001779" "70" "116" "0" "116" "0" "c.116C>T" "r.(?)" "p.(Ala39Val)" "" "0000401453" "00023820" "70" "1481" "0" "1481" "0" "c.1481C>T" "r.(?)" "p.(Ala494Val)" "" "0000401453" "00001779" "70" "1499" "0" "1499" "0" "c.1499C>T" "r.(?)" "p.(Ala500Val)" "" "0000401454" "00023820" "70" "116" "0" "116" "0" "c.116C>T" "r.(?)" "p.(Ala39Val)" "" "0000401454" "00001779" "70" "116" "0" "116" "0" "c.116C>T" "r.(?)" "p.(Ala39Val)" "" "0000401455" "00023820" "70" "1481" "0" "1481" "0" "c.1481C>T" "r.(?)" "p.(Ala494Val)" "" "0000401455" "00001779" "70" "1499" "0" "1499" "0" "c.1499C>T" "r.(?)" "p.(Ala500Val)" "" "0000401456" "00023820" "70" "1135" "0" "1135" "0" "c.1135C>T" "r.(?)" "p.(Gln379*)" "" "0000401456" "00001779" "70" "1153" "0" "1153" "0" "c.1153C>T" "r.(?)" "p.(Gln385*)" "" "0000401457" "00023820" "70" "1481" "0" "1481" "0" "c.1481C>T" "r.(?)" "p.(Ala494Val)" "" "0000401457" "00001779" "70" "1499" "0" "1499" "0" "c.1499C>T" "r.(?)" "p.(Ala500Val)" "" "0000401458" "00023820" "70" "1481" "0" "1481" "0" "c.1481C>T" "r.(?)" "p.(Ala494Val)" "" "0000401458" "00001779" "70" "1499" "0" "1499" "0" "c.1499C>T" "r.(?)" "p.(Ala500Val)" "" "0000401459" "00023820" "70" "725" "0" "725" "0" "c.725G>A" "r.(?)" "p.(Arg242His)" "" "0000401459" "00001779" "70" "725" "0" "725" "0" "c.725G>A" "r.(?)" "p.(Arg242His)" "" "0000401460" "00001779" "70" "1519" "0" "1521" "0" "c.1519_1521del" "r.(?)" "p.(Ile507del)" "" "0000401461" "00023820" "70" "116" "0" "116" "0" "c.116C>T" "r.(?)" "p.(Ala39Val)" "" "0000401461" "00001779" "70" "116" "0" "116" "0" "c.116C>T" "r.(?)" "p.(Ala39Val)" "" "0000401462" "00023820" "70" "116" "0" "116" "0" "c.116C>T" "r.(?)" "p.(Ala39Val)" "" "0000401462" "00001779" "70" "116" "0" "116" "0" "c.116C>T" "r.(?)" "p.(Ala39Val)" "" "0000401463" "00001779" "70" "241" "0" "252" "0" "c.241_252del" "r.(?)" "p.(Ile81_Lys84del)" "" "0000401464" "00023820" "70" "404" "0" "404" "0" "c.404C>T" "r.(?)" "p.(Pro135Leu)" "" "0000401464" "00001779" "70" "404" "0" "404" "0" "c.404C>T" "r.(?)" "p.(Pro135Leu)" "" "0000401465" "00023820" "70" "457" "0" "457" "0" "c.457G>T" "r.(?)" "p.(Glu153*)" "" "0000401465" "00001779" "70" "457" "0" "457" "0" "c.457G>T" "r.(?)" "p.(Glu153*)" "" "0000401466" "00023820" "70" "442" "0" "442" "0" "c.442G>A" "r.(?)" "p.(Glu148Lys)" "" "0000401466" "00001779" "70" "442" "0" "442" "0" "c.442G>A" "r.(?)" "p.(Glu148Lys)" "" "0000401467" "00023820" "70" "431" "0" "431" "0" "c.431A>G" "r.(?)" "p.(Tyr144Cys)" "" "0000401467" "00001779" "70" "431" "0" "431" "0" "c.431A>G" "r.(?)" "p.(Tyr144Cys)" "" "0000401468" "00001779" "70" "241" "0" "252" "0" "c.241_252del" "r.(?)" "p.(Ile81_Lys84del)" "" "0000401469" "00023820" "70" "1135" "0" "1135" "0" "c.1135C>T" "r.(?)" "p.(Gln379*)" "" "0000401469" "00001779" "70" "1153" "0" "1153" "0" "c.1153C>T" "r.(?)" "p.(Gln385*)" "" "0000401470" "00023820" "70" "241" "0" "252" "0" "c.241_252del" "r.(?)" "p.(Ile81_Lys84del)" "" "0000401470" "00001779" "70" "241" "0" "252" "0" "c.241_252del" "r.(?)" "p.(Ile81_Lys84del)" "" "0000401471" "00023820" "70" "139" "0" "139" "0" "c.139A>G" "r.(?)" "p.(Ser47Gly)" "" "0000401471" "00001779" "70" "139" "0" "139" "0" "c.139A>G" "r.(?)" "p.(Ser47Gly)" "" "0000401472" "00023820" "70" "1526" "0" "1526" "0" "c.1526C>T" "r.(?)" "p.(Ala509Val)" "" "0000401472" "00001779" "70" "1544" "0" "1544" "0" "c.1544C>T" "r.(?)" "p.(Ala515Val)" "" "0000401473" "00023820" "70" "1481" "0" "1481" "0" "c.1481C>T" "r.(?)" "p.(Ala494Val)" "" "0000401473" "00001779" "70" "1499" "0" "1499" "0" "c.1499C>T" "r.(?)" "p.(Ala500Val)" "" "0000401474" "00023820" "70" "119" "0" "119" "0" "c.119G>A" "r.(?)" "p.(Arg40His)" "" "0000401474" "00001779" "70" "119" "0" "119" "0" "c.119G>A" "r.(?)" "p.(Arg40His)" "" "0000401475" "00023820" "70" "241" "0" "252" "0" "c.241_252del" "r.(?)" "p.(Ile81_Lys84del)" "" "0000401475" "00001779" "70" "241" "0" "252" "0" "c.241_252del" "r.(?)" "p.(Ile81_Lys84del)" "" "0000401476" "00023820" "70" "241" "0" "252" "0" "c.241_252del" "r.(?)" "p.(Ile81_Lys84del)" "" "0000401476" "00001779" "70" "241" "0" "252" "0" "c.241_252del" "r.(?)" "p.(Ile81_Lys84del)" "" "0000401477" "00023820" "70" "1508" "-2" "1508" "-2" "c.1508-2A>C" "r.spl?" "p.?" "" "0000401477" "00001779" "70" "1526" "-2" "1526" "-2" "c.1526-2A>C" "r.spl?" "p.?" "" "0000401478" "00023820" "70" "404" "0" "404" "0" "c.404C>T" "r.(?)" "p.(Pro135Leu)" "" "0000401478" "00001779" "70" "404" "0" "404" "0" "c.404C>T" "r.(?)" "p.(Pro135Leu)" "" "0000401479" "00023820" "70" "679" "0" "679" "0" "c.679C>T" "r.(?)" "p.(Arg227Trp)" "" "0000401479" "00001779" "70" "679" "0" "679" "0" "c.679C>T" "r.(?)" "p.(Arg227Trp)" "" "0000401481" "00023820" "70" "116" "0" "116" "0" "c.116C>T" "r.(?)" "p.(Ala39Val)" "" "0000401481" "00001779" "70" "116" "0" "116" "0" "c.116C>T" "r.(?)" "p.(Ala39Val)" "" "0000401483" "00023820" "70" "241" "0" "252" "0" "c.241_252del" "r.(?)" "p.(Ile81_Lys84del)" "" "0000401483" "00001779" "70" "241" "0" "252" "0" "c.241_252del" "r.(?)" "p.(Ile81_Lys84del)" "" "0000401484" "00023820" "70" "241" "0" "252" "0" "c.241_252del" "r.(?)" "p.(Ile81_Lys84del)" "" "0000401484" "00001779" "70" "241" "0" "252" "0" "c.241_252del" "r.(?)" "p.(Ile81_Lys84del)" "" "0000401485" "00023820" "70" "1481" "0" "1481" "0" "c.1481C>T" "r.(?)" "p.(Ala494Val)" "" "0000401485" "00001779" "70" "1499" "0" "1499" "0" "c.1499C>T" "r.(?)" "p.(Ala500Val)" "" "0000401486" "00023820" "70" "116" "0" "116" "0" "c.116C>T" "r.(?)" "p.(Ala39Val)" "" "0000401486" "00001779" "70" "116" "0" "116" "0" "c.116C>T" "r.(?)" "p.(Ala39Val)" "" "0000401487" "00023820" "70" "241" "0" "252" "0" "c.241_252del" "r.(?)" "p.(Ile81_Lys84del)" "" "0000401487" "00001779" "70" "241" "0" "252" "0" "c.241_252del" "r.(?)" "p.(Ile81_Lys84del)" "" "0000401488" "00023820" "70" "151" "0" "151" "0" "c.151C>T" "r.(?)" "p.(Arg51Trp)" "" "0000401488" "00001779" "70" "151" "0" "151" "0" "c.151C>T" "r.(?)" "p.(Arg51Trp)" "" "0000401490" "00023820" "70" "241" "0" "252" "0" "c.241_252del" "r.(?)" "p.(Ile81_Lys84del)" "" "0000401490" "00001779" "70" "241" "0" "252" "0" "c.241_252del" "r.(?)" "p.(Ile81_Lys84del)" "" "0000401491" "00023820" "70" "619" "0" "619" "0" "c.619C>T" "r.(?)" "p.(Gln207*)" "" "0000401491" "00001779" "70" "619" "0" "619" "0" "c.619C>T" "r.(?)" "p.(Gln207*)" "" "0000401492" "00023820" "70" "866" "0" "866" "0" "c.866C>T" "r.(?)" "p.(Ala289Val)" "" "0000401492" "00001779" "70" "866" "0" "866" "0" "c.866C>T" "r.(?)" "p.(Ala289Val)" "" "0000401493" "00023820" "70" "116" "0" "116" "0" "c.116C>T" "r.(?)" "p.(Ala39Val)" "" "0000401493" "00001779" "70" "116" "0" "116" "0" "c.116C>T" "r.(?)" "p.(Ala39Val)" "" "0000401494" "00023820" "70" "1481" "0" "1481" "0" "c.1481C>T" "r.(?)" "p.(Ala494Val)" "" "0000401494" "00001779" "70" "1499" "0" "1499" "0" "c.1499C>T" "r.(?)" "p.(Ala500Val)" "" "0000403833" "00023820" "70" "119" "0" "119" "0" "c.119G>A" "r.(?)" "p.(Arg40His)" "" "0000403833" "00001779" "70" "119" "0" "119" "0" "c.119G>A" "r.(?)" "p.(Arg40His)" "" "0000403834" "00023820" "70" "241" "0" "252" "0" "c.241_252del" "r.(?)" "p.(Ile81_Lys84del)" "" "0000403834" "00001779" "70" "241" "0" "252" "0" "c.241_252del" "r.(?)" "p.(Ile81_Lys84del)" "" "0000403835" "00023820" "70" "241" "0" "252" "0" "c.241_252del" "r.(?)" "p.(Ile81_Lys84del)" "" "0000403835" "00001779" "70" "241" "0" "252" "0" "c.241_252del" "r.(?)" "p.(Ile81_Lys84del)" "" "0000404995" "00023820" "75" "533" "0" "533" "0" "c.533C>T" "r.(?)" "p.(Ser178Leu)" "2" "0000404995" "00001779" "75" "533" "0" "533" "0" "c.533C>T" "r.(?)" "p.(Ser178Leu)" "2" "0000440023" "00001779" "50" "1678" "0" "1678" "0" "c.1678T>C" "r.(?)" "p.*560Argext*6" "" "0000557672" "00023820" "50" "118" "0" "118" "0" "c.118C>T" "r.(?)" "p.(Arg40Cys)" "" "0000557672" "00001779" "50" "118" "0" "118" "0" "c.118C>T" "r.(?)" "p.(Arg40Cys)" "" "0000557673" "00023820" "50" "169" "0" "169" "0" "c.169C>T" "r.(?)" "p.(Arg57Cys)" "" "0000557673" "00001779" "50" "169" "0" "169" "0" "c.169C>T" "r.(?)" "p.(Arg57Cys)" "" "0000557674" "00023820" "30" "169" "0" "169" "0" "c.169C>T" "r.(?)" "p.(Arg57Cys)" "" "0000557674" "00001779" "30" "169" "0" "169" "0" "c.169C>T" "r.(?)" "p.(Arg57Cys)" "" "0000557675" "00023820" "30" "169" "0" "169" "0" "c.169C>T" "r.(?)" "p.(Arg57Cys)" "" "0000557675" "00001779" "30" "169" "0" "169" "0" "c.169C>T" "r.(?)" "p.(Arg57Cys)" "" "0000557676" "00023820" "30" "179" "0" "179" "0" "c.179G>A" "r.(?)" "p.(Arg60Gln)" "" "0000557676" "00001779" "30" "179" "0" "179" "0" "c.179G>A" "r.(?)" "p.(Arg60Gln)" "" "0000557677" "00023820" "30" "204" "0" "204" "0" "c.204G>A" "r.(?)" "p.(Thr68=)" "" "0000557677" "00001779" "30" "204" "0" "204" "0" "c.204G>A" "r.(?)" "p.(Thr68=)" "" "0000557678" "00023820" "30" "384" "0" "384" "0" "c.384C>T" "r.(?)" "p.(Ile128=)" "" "0000557678" "00001779" "30" "384" "0" "384" "0" "c.384C>T" "r.(?)" "p.(Ile128=)" "" "0000557679" "00023820" "50" "409" "0" "409" "0" "c.409G>A" "r.(?)" "p.(Val137Met)" "" "0000557679" "00001779" "50" "409" "0" "409" "0" "c.409G>A" "r.(?)" "p.(Val137Met)" "" "0000557680" "00023820" "50" "418" "0" "418" "0" "c.418C>G" "r.(?)" "p.(Leu140Val)" "" "0000557680" "00001779" "50" "418" "0" "418" "0" "c.418C>G" "r.(?)" "p.(Leu140Val)" "" "0000557681" "00023820" "30" "438" "0" "438" "0" "c.438C>T" "r.(?)" "p.(Ile146=)" "" "0000557681" "00001779" "30" "438" "0" "438" "0" "c.438C>T" "r.(?)" "p.(Ile146=)" "" "0000557682" "00023820" "50" "457" "0" "457" "0" "c.457G>A" "r.(?)" "p.(Glu153Lys)" "" "0000557682" "00001779" "50" "457" "0" "457" "0" "c.457G>A" "r.(?)" "p.(Glu153Lys)" "" "0000557683" "00023820" "70" "457" "0" "457" "0" "c.457G>A" "r.(?)" "p.(Glu153Lys)" "" "0000557683" "00001779" "70" "457" "0" "457" "0" "c.457G>A" "r.(?)" "p.(Glu153Lys)" "" "0000557685" "00023820" "50" "734" "0" "734" "0" "c.734T>C" "r.(?)" "p.(Leu245Pro)" "" "0000557685" "00001779" "50" "734" "0" "734" "0" "c.734T>C" "r.(?)" "p.(Leu245Pro)" "" "0000557686" "00023820" "30" "785" "0" "785" "0" "c.785C>T" "r.(?)" "p.(Ser262Leu)" "" "0000557686" "00001779" "30" "785" "0" "785" "0" "c.785C>T" "r.(?)" "p.(Ser262Leu)" "" "0000557688" "00023820" "30" "965" "10" "965" "10" "c.965+10C>T" "r.(=)" "p.(=)" "" "0000557688" "00001779" "30" "965" "10" "965" "10" "c.965+10C>T" "r.(=)" "p.(=)" "" "0000557689" "00023820" "90" "990" "0" "990" "0" "c.990del" "r.(?)" "p.(His330GlnfsTer12)" "" "0000557689" "00001779" "90" "1008" "0" "1008" "0" "c.1008del" "r.(?)" "p.(His336GlnfsTer12)" "" "0000557690" "00023820" "30" "1008" "0" "1008" "0" "c.1008G>A" "r.(?)" "p.(Ser336=)" "" "0000557690" "00001779" "30" "1026" "0" "1026" "0" "c.1026G>A" "r.(?)" "p.(Ser342=)" "" "0000557691" "00023820" "30" "1107" "0" "1107" "0" "c.1107C>T" "r.(?)" "p.(His369=)" "" "0000557691" "00001779" "30" "1125" "0" "1125" "0" "c.1125C>T" "r.(?)" "p.(His375=)" "" "0000557692" "00023820" "30" "1178" "0" "1178" "0" "c.1178C>T" "r.(?)" "p.(Thr393Met)" "" "0000557692" "00001779" "30" "1196" "0" "1196" "0" "c.1196C>T" "r.(?)" "p.(Thr399Met)" "" "0000557693" "00023820" "30" "1188" "64" "1188" "85" "c.1188+64_1188+85del" "r.(=)" "p.(=)" "" "0000557693" "00001779" "30" "1206" "64" "1206" "85" "c.1206+64_1206+85del" "r.(=)" "p.(=)" "" "0000557694" "00023820" "50" "1226" "0" "1226" "0" "c.1226G>A" "r.(?)" "p.(Arg409Lys)" "" "0000557694" "00001779" "50" "1244" "0" "1244" "0" "c.1244G>A" "r.(?)" "p.(Arg415Lys)" "" "0000557695" "00023820" "90" "1230" "0" "1230" "0" "c.1230del" "r.(?)" "p.(Asn410LysfsTer31)" "" "0000557695" "00001779" "90" "1248" "0" "1248" "0" "c.1248del" "r.(?)" "p.(Asn416LysfsTer31)" "" "0000557696" "00023820" "50" "1303" "0" "1303" "0" "c.1303C>T" "r.(?)" "p.(Arg435Cys)" "" "0000557696" "00001779" "50" "1321" "0" "1321" "0" "c.1321C>T" "r.(?)" "p.(Arg441Cys)" "" "0000557697" "00023820" "10" "1422" "0" "1422" "0" "c.1422G>A" "r.(?)" "p.(Ser474=)" "" "0000557697" "00001779" "10" "1440" "0" "1440" "0" "c.1440G>A" "r.(?)" "p.(Ser480=)" "" "0000557698" "00023820" "10" "1422" "0" "1422" "0" "c.1422G>A" "r.(?)" "p.(Ser474=)" "" "0000557698" "00001779" "10" "1440" "0" "1440" "0" "c.1440G>A" "r.(?)" "p.(Ser480=)" "" "0000557699" "00023820" "30" "1507" "17" "1507" "17" "c.1507+17G>A" "r.(=)" "p.(=)" "" "0000557699" "00001779" "30" "1525" "17" "1525" "17" "c.1525+17G>A" "r.(=)" "p.(=)" "" "0000557700" "00023820" "30" "1552" "0" "1552" "0" "c.1552C>T" "r.(?)" "p.(Arg518Trp)" "" "0000557700" "00001779" "30" "1570" "0" "1570" "0" "c.1570C>T" "r.(?)" "p.(Arg524Trp)" "" "0000557702" "00023820" "30" "1658" "0" "1658" "0" "c.1658A>G" "r.(?)" "p.(Gln553Arg)" "" "0000557702" "00001779" "30" "1676" "0" "1676" "0" "c.1676A>G" "r.(?)" "p.(Gln559Arg)" "" "0000615911" "00023820" "30" "169" "0" "169" "0" "c.169C>T" "r.(?)" "p.(Arg57Cys)" "" "0000615911" "00001779" "30" "169" "0" "169" "0" "c.169C>T" "r.(?)" "p.(Arg57Cys)" "" "0000615912" "00023820" "50" "178" "0" "178" "0" "c.178C>T" "r.(?)" "p.(Arg60Trp)" "" "0000615912" "00001779" "50" "178" "0" "178" "0" "c.178C>T" "r.(?)" "p.(Arg60Trp)" "" "0000615913" "00023820" "30" "225" "0" "225" "0" "c.225C>T" "r.(?)" "p.(Ser75=)" "" "0000615913" "00001779" "30" "225" "0" "225" "0" "c.225C>T" "r.(?)" "p.(Ser75=)" "" "0000615914" "00023820" "50" "1296" "0" "1296" "0" "c.1296G>T" "r.(?)" "p.(Glu432Asp)" "" "0000615914" "00001779" "50" "1314" "0" "1314" "0" "c.1314G>T" "r.(?)" "p.(Glu438Asp)" "" "0000623431" "00023820" "30" "447" "0" "447" "0" "c.447C>T" "r.(?)" "p.(Ala149=)" "" "0000623431" "00001779" "30" "447" "0" "447" "0" "c.447C>T" "r.(?)" "p.(Ala149=)" "" "0000623432" "00023820" "50" "785" "0" "785" "0" "c.785C>T" "r.(?)" "p.(Ser262Leu)" "" "0000623432" "00001779" "50" "785" "0" "785" "0" "c.785C>T" "r.(?)" "p.(Ser262Leu)" "" "0000623433" "00023820" "30" "965" "11" "965" "11" "c.965+11G>A" "r.(=)" "p.(=)" "" "0000623433" "00001779" "30" "965" "11" "965" "11" "c.965+11G>A" "r.(=)" "p.(=)" "" "0000649291" "00023820" "30" "3237" "0" "3237" "0" "c.*1575C>T" "r.(=)" "p.(=)" "" "0000649291" "00001779" "30" "3255" "0" "3255" "0" "c.*1575C>T" "r.(=)" "p.(=)" "" "0000649292" "00023820" "50" "6141" "0" "6141" "0" "c.*4479C>T" "r.(=)" "p.(=)" "" "0000649292" "00001779" "50" "6159" "0" "6159" "0" "c.*4479C>T" "r.(=)" "p.(=)" "" "0000657805" "00023820" "30" "-7" "0" "-7" "0" "c.-7C>T" "r.(?)" "p.(=)" "" "0000657805" "00001779" "30" "-7" "0" "-7" "0" "c.-7C>T" "r.(?)" "p.(=)" "" "0000657806" "00023820" "50" "325" "0" "325" "0" "c.325C>T" "r.(?)" "p.(Arg109Cys)" "" "0000657806" "00001779" "50" "325" "0" "325" "0" "c.325C>T" "r.(?)" "p.(Arg109Cys)" "" "0000657807" "00023820" "50" "878" "0" "878" "0" "c.878G>A" "r.(?)" "p.(Arg293His)" "" "0000657807" "00001779" "50" "878" "0" "878" "0" "c.878G>A" "r.(?)" "p.(Arg293His)" "" "0000669326" "00023820" "30" "3237" "0" "3237" "0" "c.*1575C>T" "r.(=)" "p.(=)" "" "0000669326" "00001779" "30" "3255" "0" "3255" "0" "c.*1575C>T" "r.(=)" "p.(=)" "" "0000669327" "00023820" "50" "6141" "0" "6141" "0" "c.*4479C>T" "r.(=)" "p.(=)" "" "0000669327" "00001779" "50" "6159" "0" "6159" "0" "c.*4479C>T" "r.(=)" "p.(=)" "" "0000680506" "00023820" "50" "997" "0" "997" "0" "c.997A>G" "r.(?)" "p.(Asn333Asp)" "" "0000680506" "00001779" "50" "1015" "0" "1015" "0" "c.1015A>G" "r.(?)" "p.(Asn339Asp)" "" "0000680507" "00023820" "30" "1434" "0" "1434" "0" "c.1434C>T" "r.(?)" "p.(Ala478=)" "" "0000680507" "00001779" "30" "1452" "0" "1452" "0" "c.1452C>T" "r.(?)" "p.(Ala484=)" "" "0000692030" "00023820" "30" "1287" "0" "1287" "0" "c.1287G>C" "r.(?)" "p.(Leu429=)" "" "0000692030" "00001779" "30" "1305" "0" "1305" "0" "c.1305G>C" "r.(?)" "p.(Leu435=)" "" "0000710185" "00001779" "90" "1499" "0" "1499" "0" "c.1499C>T" "r.(?)" "p.(Ala500Val)" "" "0000710196" "00001779" "90" "119" "0" "119" "0" "c.119G>A" "r.(?)" "p.(Arg40His)" "" "0000710208" "00001779" "90" "241" "0" "252" "0" "c.241_252del" "r.(?)" "p.(Ile81_Lys84del)" "" "0000710209" "00001779" "90" "1499" "0" "1499" "0" "c.1499C>T" "r.(?)" "p.(Ala500Val)" "" "0000725690" "00023820" "50" "178" "0" "178" "0" "c.178C>T" "r.(?)" "p.(Arg60Trp)" "" "0000725690" "00001779" "50" "178" "0" "178" "0" "c.178C>T" "r.(?)" "p.(Arg60Trp)" "" "0000725691" "00023820" "50" "232" "0" "232" "0" "c.232G>A" "r.(?)" "p.(Val78Met)" "" "0000725691" "00001779" "50" "232" "0" "232" "0" "c.232G>A" "r.(?)" "p.(Val78Met)" "" "0000725692" "00023820" "50" "317" "0" "317" "0" "c.317T>C" "r.(?)" "p.(Leu106Pro)" "" "0000725692" "00001779" "50" "317" "0" "317" "0" "c.317T>C" "r.(?)" "p.(Leu106Pro)" "" "0000725693" "00023820" "50" "680" "0" "680" "0" "c.680G>A" "r.(?)" "p.(Arg227Gln)" "" "0000725693" "00001779" "50" "680" "0" "680" "0" "c.680G>A" "r.(?)" "p.(Arg227Gln)" "" "0000725694" "00023820" "90" "1333" "0" "1333" "0" "c.1333G>T" "r.(?)" "p.(Glu445*)" "" "0000725694" "00001779" "90" "1351" "0" "1351" "0" "c.1351G>T" "r.(?)" "p.(Glu451*)" "" "0000760943" "00001779" "50" "1039" "0" "1039" "0" "c.1039G>A" "r.(?)" "p.(Val347Met)" "" "0000764157" "00001779" "70" "533" "0" "533" "0" "c.533C>T" "r.(?)" "p.(Ser178Leu)" "2" "0000764158" "00001779" "70" "553" "0" "553" "0" "c.553G>A" "r.(?)" "p.(Asp185Asn)" "2" "0000764159" "00001779" "70" "1461" "0" "1461" "0" "c.1461C>G" "r.(?)" "p.(His487Gln)" "7" "0000764160" "00001779" "70" "1460" "0" "1460" "0" "c.1460A>T" "r.(?)" "p.(His487Leu)" "7" "0000791064" "00001779" "50" "605" "0" "605" "0" "c.605C>T" "r.(?)" "p.(Ser202Leu)" "" "0000792266" "00001779" "90" "641" "0" "641" "0" "c.641G>A" "r.(?)" "p.(Arg214His)" "2" "0000807296" "00023820" "70" "457" "0" "457" "0" "c.457G>A" "r.(?)" "p.(Glu153Lys)" "" "0000807296" "00001779" "70" "457" "0" "457" "0" "c.457G>A" "r.(?)" "p.(Glu153Lys)" "" "0000807297" "00023820" "50" "601" "0" "601" "0" "c.601G>A" "r.(?)" "p.(Val201Met)" "" "0000807297" "00001779" "50" "601" "0" "601" "0" "c.601G>A" "r.(?)" "p.(Val201Met)" "" "0000807298" "00023820" "70" "809" "0" "809" "0" "c.809G>A" "r.(?)" "p.(Arg270His)" "" "0000807298" "00001779" "70" "809" "0" "809" "0" "c.809G>A" "r.(?)" "p.(Arg270His)" "" "0000811020" "00001779" "70" "193" "0" "193" "0" "c.193C>T" "r.(?)" "p.(Arg65Cys)" "" "0000811021" "00001779" "50" "683" "0" "683" "0" "c.683T>A" "r.(?)" "p.(Val228Asp)" "" "0000837046" "00001779" "70" "641" "0" "641" "0" "c.641G>A" "r.(?)" "p.(Arg214His)" "" "0000854438" "00023820" "30" "441" "0" "441" "0" "c.441C>T" "r.(?)" "p.(Asp147=)" "" "0000854438" "00001779" "30" "441" "0" "441" "0" "c.441C>T" "r.(?)" "p.(Asp147=)" "" "0000854439" "00023820" "50" "493" "0" "493" "0" "c.493G>A" "r.(?)" "p.(Gly165Ser)" "" "0000854439" "00001779" "50" "493" "0" "493" "0" "c.493G>A" "r.(?)" "p.(Gly165Ser)" "" "0000854440" "00023820" "50" "1439" "0" "1439" "0" "c.1439G>A" "r.(?)" "p.(Arg480His)" "" "0000854440" "00001779" "50" "1457" "0" "1457" "0" "c.1457G>A" "r.(?)" "p.(Arg486His)" "" "0000914596" "00023820" "70" "533" "0" "533" "0" "c.533C>T" "r.(?)" "p.(Ser178Leu)" "" "0000914596" "00001779" "70" "533" "0" "533" "0" "c.533C>T" "r.(?)" "p.(Ser178Leu)" "" "0000918628" "00001779" "90" "418" "0" "418" "0" "c.418C>G" "r.(?)" "p.(Leu140Val)" "" "0000918850" "00001779" "70" "1188" "0" "1188" "0" "c.1188C>G" "r.(?)" "p.(Ile396Met)" "" "0000930582" "00023820" "50" "997" "0" "997" "0" "c.997A>G" "r.(?)" "p.(Asn333Asp)" "" "0000930582" "00001779" "50" "1015" "0" "1015" "0" "c.1015A>G" "r.(?)" "p.(Asn339Asp)" "" "0000936494" "00023820" "70" "845" "0" "845" "0" "c.845C>G" "r.(?)" "p.(Pro282Arg)" "" "0000936494" "00001779" "70" "845" "0" "845" "0" "c.845C>G" "r.(?)" "p.(Pro282Arg)" "" "0000936495" "00023820" "90" "990" "0" "990" "0" "c.990del" "r.(?)" "p.(His330Glnfs*12)" "" "0000936495" "00001779" "90" "1008" "0" "1008" "0" "c.1008del" "r.(?)" "p.(His336Glnfs*12)" "" "0000944377" "00001779" "70" "734" "0" "734" "0" "c.734T>C" "r.(?)" "p.(Leu245Pro)" "" "0000944396" "00001779" "90" "1525" "0" "1525" "0" "c.1525G>A" "r.(?)" "p.(Gly509Arg)" "" "0000944447" "00001779" "70" "118" "0" "118" "0" "c.118C>T" "r.(?)" "p.(Arg40Cys)" "" "0000968299" "00023820" "50" "1552" "0" "1552" "0" "c.1552C>T" "r.(?)" "p.(Arg518Trp)" "" "0000968299" "00001779" "50" "1570" "0" "1570" "0" "c.1570C>T" "r.(?)" "p.(Arg524Trp)" "" "0000981804" "00023820" "10" "984" "0" "984" "0" "c.984C>T" "r.(?)" "p.(Ala328=)" "" "0000981804" "00001779" "10" "1002" "0" "1002" "0" "c.1002C>T" "r.(?)" "p.(Ala334=)" "" "0000981805" "00023820" "50" "1508" "-8" "1512" "0" "c.1508-8_1512del" "r.spl?" "p.?" "" "0000981805" "00001779" "50" "1526" "-8" "1530" "0" "c.1526-8_1530del" "r.spl?" "p.?" "" "0001002125" "00023820" "50" "1415" "0" "1415" "0" "c.1415G>T" "r.(?)" "p.(Arg472Leu)" "" "0001002125" "00001779" "50" "1433" "0" "1433" "0" "c.1433G>T" "r.(?)" "p.(Arg478Leu)" "" "0001015376" "00023820" "90" "990" "0" "990" "0" "c.990del" "r.(?)" "p.(His330GlnfsTer12)" "" "0001015376" "00001779" "90" "1008" "0" "1008" "0" "c.1008del" "r.(?)" "p.(His336GlnfsTer12)" "" "0001040986" "00023820" "50" "-2812" "0" "-2812" "0" "c.-2812A>G" "r.(?)" "p.(=)" "" "0001040986" "00001779" "50" "-2812" "0" "-2812" "0" "c.-2812A>G" "r.(?)" "p.(=)" "" "0001040989" "00023820" "30" "-1354" "0" "-1354" "0" "c.-1354C>A" "r.(?)" "p.(=)" "" "0001040989" "00001779" "30" "-1354" "0" "-1354" "0" "c.-1354C>A" "r.(?)" "p.(=)" "" "0001040990" "00023820" "50" "1438" "0" "1438" "0" "c.1438C>T" "r.(?)" "p.(Arg480Cys)" "" "0001040990" "00001779" "50" "1456" "0" "1456" "0" "c.1456C>T" "r.(?)" "p.(Arg486Cys)" "" "0001055386" "00023820" "70" "1075" "0" "1075" "0" "c.1075C>T" "r.(?)" "p.(Gln359Ter)" "" "0001055386" "00001779" "70" "1093" "0" "1093" "0" "c.1093C>T" "r.(?)" "p.(Gln365Ter)" "" "0001066378" "00023820" "50" "-115" "-2442" "-115" "-2442" "c.-115-2442G>T" "r.(=)" "p.(=)" "" "0001066378" "00001779" "50" "-115" "-2442" "-115" "-2442" "c.-115-2442G>T" "r.(=)" "p.(=)" "" "0001066379" "00023820" "90" "58" "0" "58" "0" "c.58C>T" "r.(?)" "p.(Gln20*)" "" "0001066379" "00001779" "90" "58" "0" "58" "0" "c.58C>T" "r.(?)" "p.(Gln20*)" "" "0001066380" "00023820" "30" "179" "0" "179" "0" "c.179G>A" "r.(?)" "p.(Arg60Gln)" "" "0001066380" "00001779" "30" "179" "0" "179" "0" "c.179G>A" "r.(?)" "p.(Arg60Gln)" "" "0001066381" "00023820" "70" "457" "0" "457" "0" "c.457G>A" "r.(?)" "p.(Glu153Lys)" "" "0001066381" "00001779" "70" "457" "0" "457" "0" "c.457G>A" "r.(?)" "p.(Glu153Lys)" "" "0001072413" "00001779" "50" "1464" "0" "1464" "0" "c.1464C>A" "r.(?)" "p.(Phe488Leu)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 66 "{{screeningid}}" "{{variantid}}" "0000000391" "0000017084" "0000000391" "0000017085" "0000004012" "0000022913" "0000004013" "0000022914" "0000004013" "0000022915" "0000004014" "0000022916" "0000004015" "0000022917" "0000004015" "0000022918" "0000004016" "0000022919" "0000004017" "0000022921" "0000004017" "0000022922" "0000004018" "0000022923" "0000004019" "0000022924" "0000004020" "0000022925" "0000004020" "0000022931" "0000004021" "0000022926" "0000004021" "0000022932" "0000004022" "0000022927" "0000004023" "0000022928" "0000004024" "0000022929" "0000004025" "0000022930" "0000004025" "0000022933" "0000004086" "0000022996" "0000004087" "0000022997" "0000016107" "0000035784" "0000016251" "0000035993" "0000017846" "0000038051" "0000017846" "0000038052" "0000025008" "0000047851" "0000059016" "0000089815" "0000117277" "0000188122" "0000117323" "0000188168" "0000117326" "0000188171" "0000117359" "0000188204" "0000117369" "0000188214" "0000117438" "0000188283" "0000117447" "0000188292" "0000117480" "0000188506" "0000117481" "0000188507" "0000117491" "0000188526" "0000117502" "0000188515" "0000117525" "0000188362" "0000164640" "0000368213" "0000181308" "0000404995" "0000209805" "0000440023" "0000292602" "0000649291" "0000292603" "0000649292" "0000305638" "0000669326" "0000305639" "0000669327" "0000326600" "0000710185" "0000326600" "0000710208" "0000326611" "0000710196" "0000326611" "0000710209" "0000363473" "0000764157" "0000363474" "0000764158" "0000363475" "0000764159" "0000363476" "0000764160" "0000379160" "0000792266" "0000402809" "0000837046" "0000433001" "0000918628" "0000433214" "0000918850" "0000440166" "0000936494" "0000440166" "0000936495" "0000443018" "0000944377" "0000443018" "0000944447" "0000443037" "0000944396"