### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = TCAP) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "TCAP" "titin-cap" "17" "q12" "unknown" "NC_000017.10" "UD_132085236843" "" "https://www.LOVD.nl/TCAP" "Leiden Muscular Dystrophy pages TCAP home page " "1" "11610" "8557" "604488" "1" "1" "1" "1" "This database is one of the gene variant databases from the:" "" "g" "https://databases.lovd.nl/shared/refseq/TCAP_codingDNA.html" "1" "" "This database is one of the gene variant databases from the Leiden Muscular Dystrophy pages" "-1" "" "-1" "00001" "2000-02-05 00:00:00" "00006" "2023-01-19 16:18:32" "00000" "2025-07-08 13:22:38" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00020870" "TCAP" "titin-cap (telethonin)" "001" "NM_003673.3" "" "NP_003664.1" "" "" "" "-14" "949" "504" "37821599" "37822807" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 14 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00000" "Healthy/Control" "Healthy individual / control" "" "" "" "" "" "00000" "2012-07-26 17:29:43" "" "" "00141" "LGMD2" "dystrophy, muscular, limb-girdle, autosomal recessive, type 2 (LGMD-2)" "" "" "" "" "" "00006" "2013-06-10 21:06:19" "00006" "2021-12-11 13:56:28" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00244" "MYOP" "myopathy (MYOP)" "" "" "" "" "" "00006" "2013-10-12 23:00:55" "00006" "2019-06-19 11:52:31" "00351" "CMH" "cardiomyopathy, hypertrophic (CMH)" "" "" "" "" "" "00006" "2014-03-13 16:15:54" "00006" "2015-03-06 17:16:01" "00352" "CMD" "cardiomyopathy, dilated (CMD)" "" "" "" "" "" "00006" "2014-03-13 16:16:15" "00006" "2015-03-06 17:18:25" "02405" "LGMDR7;LGMD2G" "dystrophy, muscular, limb-girdle, type 2G" "AR" "601954" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2023-01-19 16:08:09" "02667" "CMH25" "cardiomyopathy, hypertrophic, type 25 (CMD-25)" "AD" "607487" "" "autosomal dominant" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "04172" "CM" "cardiomyopathy (CM)" "" "" "" "" "" "00006" "2015-01-20 15:34:26" "00006" "2016-03-20 12:15:43" "05121" "MD" "dystrophy, muscular (MD)" "" "" "" "" "" "00006" "2016-01-24 01:27:29" "" "" "05126" "LGMD" "dystrophy, muscular, limb-girdle (LGMD)" "" "" "" "" "" "00006" "2016-01-26 06:05:36" "" "" "05166" "SUD" "death, sudden, unexplained (SUD)" "" "" "" "" "" "00006" "2016-05-19 16:34:23" "00006" "2018-09-11 12:14:13" "05324" "DMD" "dystrophy, muscular, Duchenne type (DMD)" "XLR" "310200" "" "" "" "00006" "2017-09-01 17:41:21" "00006" "2021-12-10 21:51:32" "05618" "NMD" "neuromuscular disorder (NMD)" "" "" "" "" "" "00006" "2019-07-02 19:46:12" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 4 "{{geneid}}" "{{diseaseid}}" "TCAP" "00351" "TCAP" "02405" "TCAP" "02667" "TCAP" "05126" ## Individuals ## Do not remove or alter this header ## ## Count = 148 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00064069" "" "" "" "1" "" "00006" "{PMID:Lopes 2013:23396983}, {DOI:Lopes 2013:10.1136/jmedgenet-2012-101270}" "analysis of 223 cases" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00064119" "" "" "" "1" "" "00006" "{PMID:Lopes 2013:23396983}, {DOI:Lopes 2013:10.1136/jmedgenet-2012-101270}" "analysis of 223 cases" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00064709" "" "" "" "1" "" "01601" "" "" "M" "" "Denmark" "26y" "0" "" "" "" "" "00064728" "" "" "" "1" "" "01601" "" "" "M" "" "Denmark" "33y" "0" "" "" "" "" "00174790" "" "" "" "1" "" "00006" "{PMID:Fichna 2018:29970176}" "" "F" "yes" "Poland" "" "0" "" "" "" "Pat270a" "00213378" "" "" "" "4" "" "00006" "Lima WMS2005 L.P.3.02" "4 affecteds 3 families" "" "" "Brazil" "" "0" "" "" "" "" "00213379" "" "" "" "2" "" "00006" "{PMID:Moreira:10655062}" "2 affecteds families" "M" "" "Brazil" "" "0" "" "" "" "" "00213380" "" "" "" "1" "" "00006" "{PMID:Moreira:10655062}" "" "" "" "" "" "0" "" "" "" "" "00213382" "" "" "" "1" "" "00006" "{PMID:Hayashi 2004:15582318}" "" "" "" "Japan;Korea" "" "0" "" "" "" "" "00213383" "" "" "" "1" "" "00006" "Perrot (Berlin), EJHFS2005" "" "F" "" "Germany" ">55y" "0" "" "" "" "" "00213385" "" "" "" "1" "" "00006" "{PMID:Bos 2006:16352453}" "" "F" "" "United States" ">65y" "0" "" "" "white" "15" "00213387" "" "" "" "1" "" "00006" "{PMID:Hayashi 2004:15582318}" "" "" "" "Japan;Korea" "" "0" "" "" "" "" "00213388" "" "" "" "1" "" "00006" "{PMID:Knoll 2002:12507422}" "" "F" "" "Germany" ">46y" "0" "" "" "" "" "00213389" "" "" "" "1" "" "00006" "{PMID:Bos 2006:16352453}" "" "F" "" "United States" ">45y" "0" "" "" "white" "16" "00213391" "" "" "" "1" "" "00006" "{PMID:Bos 2006:16352453}" "" "M" "" "United States" ">53y" "0" "" "" "white" "" "00213392" "" "" "" "2" "" "00006" "{PMID:Marziliano 2006:16650785}" "" "" "" "Italy" "" "0" "" "" "white" "" "00213393" "" "" "" "3" "" "00006" "{PMID:Perrot 2006:16490376}" "" "" "" "" "" "0" "" "" "white" "" "00213394" "" "" "" "1" "" "00006" "{PMID:Hayashi 2004:15582318}" "" "M" "" "Korea, South (Republic)" ">63y" "0" "" "" "" "" "00213395" "" "" "" "1" "" "00006" "{PMID:Hayashi 2004:15582318}" "affected mother and son" "M" "" "Japan" "29y" "0" "" "" "" "" "00213396" "" "" "" "1" "" "00006" "{PMID:Hayashi 2004:15582318}" "" "" "" "Japan;Korea" "" "0" "" "" "" "" "00213397" "" "" "" "1" "" "00006" "{PMID:Hayashi 2004:15582318}" "family, 4 affecteds" "M" "" "Japan" ">48y" "0" "" "" "" "" "00213398" "" "" "" "4" "" "00006" "{PMID:Marziliano 2006:16650785}" "" "" "" "Italy" "" "0" "" "" "white" "" "00213399" "" "" "" "1" "" "00006" "{PMID:Perrot 2006:16490376}" "" "" "" "" "" "0" "" "" "white" "" "00213400" "" "" "" "4" "" "00006" "{PMID:Perrot 2006:16490376}" "" "" "" "" "" "0" "" "" "white" "" "00213401" "" "" "" "1" "" "00464" "" "" "" "" "(United States)" "" "0" "" "" "" "" "00213402" "" "" "" "1" "" "00006" "{PMID:Mazzone 2008:18408010}" "" "M" "" "United States" ">42y" "0" "" "" "" "18408010-P1" "00213403" "" "" "" "3" "" "00006" "{PMID:Olive 2008:18948002}" "carrier parents and brother" "F" "" "Morocco" ">27y" "0" "" "" "" "18948002-P1" "00213404" "" "" "" "2" "" "00006" "{PMID:Andersen 2008:19035361}, {PMID:Andersen 2009:19035361}" "family, 3 carriers variant, affected father/child double carrier" "" "" "Denmark" "" "0" "" "" "" "PatO" "00213405" "" "" "" "2" "" "00006" "{PMID:Andersen 2009:19035361}" "only in index patients" "" "" "Denmark" "" "0" "" "" "" "19035361-PatM" "00213406" "" "" "" "3" "" "00006" "{PMID:Andersen 2009:19035361}" "3-generation family, 2 affecteds" "" "" "Denmark" "" "0" "" "" "" "19035361-PatZS" "00213407" "" "" "" "1" "" "00006" "{PMID:Hershberger 2009:19412328}" "" "" "" "United States" "" "0" "" "" "" "19412328-D1" "00213408" "" "" "" "1" "" "00006" "{PMID:Hershberger 2009:19412328}" "" "" "" "United States" "" "0" "" "" "" "19412328-D2" "00213409" "" "" "" "1" "" "00006" "{PMID:Parks 2008:18585512}" "D3 (19412328), B10 (20215591); 2-generation family, 1 affected;" "M" "" "United States" "" "0" "" "" "white" "18585512-PatR4" "00213410" "" "" "" "1" "" "00006" "{PMID:Hayashi 2004:15582318}" "affected mother and son" "F" "" "Japan" ">62y" "0" "" "" "" "" "00213411" "" "" "" "1" "" "00006" "{PMID:Hayashi 2004:15582318}" "family, 4 affecteds" "F" "" "Japan" "67y" "0" "" "" "" "" "00213412" "" "" "" "1" "" "00006" "{PMID:Hayashi 2004:15582318}" "family, 4 affecteds" "M" "" "Japan" "21y" "0" "" "" "" "" "00213413" "" "" "" "1" "" "00006" "{PMID:Hayashi 2004:15582318}" "family, 4 affecteds" "M" "" "Japan" "19y" "0" "" "" "" "" "00213414" "" "" "" "1" "" "00006" "{PMID:Andersen 2009:19035361}" "" "" "" "Denmark" "" "0" "" "" "" "19035361-c" "00213415" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "" "00213416" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "" "00213417" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "" "00213418" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "" "00213419" "" "" "" "3" "" "03163" "{PMID:Francis 2014:25055047}" "4-generation family, 3 affected (2F, M), unaffected heterozygous carrier parents/relatives" "M" "yes" "India" "" "0" "" "" "Dravidian" "Fa,F50-1" "00213420" "" "" "" "1" "" "03163" "{PMID:Francis 2014:25055047}" "5-generation family, 1 affected, unaffected heterozygous carrier parents/relatives" "M" "yes" "India" "" "0" "" "" "Dravidian" "FamF97-1" "00213421" "" "" "" "1" "" "03164" "{PMID:de Fuenmayor-Fernández de la Hoz 2016:27618135}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "yes" "Spain" "" "0" "" "" "" "patient 1" "00219495" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219527" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219658" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219773" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219994" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219996" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220137" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220230" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220351" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220433" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220586" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220637" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220907" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220952" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220957" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221064" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221081" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221083" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221139" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221235" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221258" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221283" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221286" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221396" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221455" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221461" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221673" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221788" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221830" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221911" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221914" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222059" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222224" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222302" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222377" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222513" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00228157" "" "" "" "1" "" "00006" "{PMID:Francis 2014:25055047}" "" "F;M" "" "India" "" "0" "" "" "" "cases/controls" "00228158" "" "" "" "2" "" "00006" "{PMID:Ikenberg 2017:28666572}" "6-generation family, 2 affected (F, M), unaffected heterozygous carrier parents/relatives" "F" "yes" "Germany" "" "0" "" "" "Turkey" "FamPat1/2" "00228159" "" "" "" "1" "" "00006" "{PMID:Brusa 2018:29759638}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "yes" "Greece" "" "0" "" "" "" "patient" "00228161" "" "" "" "2" "" "00006" "{PMID:Chamova 2018:29935994}" "2-generation family, affected sister/brother, unaffected heterozygous carrier parents/relatives" "F;M" "" "Bulgaria" "" "0" "" "" "muslim" "FamG2" "00228169" "" "" "" "1" "" "00006" "{PMID:Marston 2015:26406308}" "" "M" "" "Australia" "" "0" "" "" "" "D22" "00228170" "" "" "" "1" "" "00006" "{PMID:Barresi 2015:25724973}" "2-generation family, 1 affected, unaffected heterozygous carrier parents/relatives" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "India" "patient" "00228171" "" "" "" "1" "" "00006" "{PMID:Wang 2014:25119914}" "" "" "no" "China" "" "0" "" "" "" "patient" "00228172" "" "" "" "1" "" "00006" "{PMID:Hirtle-Lewis 2013:24037902}" "" "" "" "Canada" "" "0" "" "" "" "" "00228173" "" "" "" "1" "" "00006" "{PMID:Hirtle-Lewis 2013:24037902}" "" "" "" "Canada" "" "0" "" "" "" "" "00228174" "" "" "" "2" "" "00006" "{PMID:Hirtle-Lewis 2013:24037902}" "" "" "" "Canada" "" "0" "" "" "" "" "00228175" "" "" "" "1" "" "00006" "{PMID:Hirtle-Lewis 2013:24037902}" "" "" "" "Canada" "" "0" "" "" "" "" "00228176" "" "" "" "1" "" "00006" "{PMID:Hirtle-Lewis 2013:24037902}" "" "" "" "Canada" "" "0" "" "" "" "" "00228177" "" "" "" "1" "" "00006" "{PMID:Paim 2013:23479141}" "" "F" "no" "Brazil" "" "0" "" "" "" "patient" "00228178" "" "" "" "1" "" "00006" "{PMID:Ferreiro 2011:21530252}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "no" "France" "" "0" "" "" "" "patient" "00228179" "" "" "" "1" "" "00006" "{PMID:Negrao 2010:22029105}" "" "M" "no" "Portugal" "" "0" "" "" "white" "patient" "00228180" "" "" "" "2" "" "00006" "Waddell 2012, WMS-G.P.41" "2-generation family, affected brother/sister, unaffected heterozygous carrier parents" "F;M" "" "Australia" "" "0" "" "" "China;Cambodia" "" "00228181" "" "" "" "1" "" "00006" "Yee 2007, WMS-G.P.8.15" "" "" "" "China" "" "0" "" "" "" "" "00228182" "" "" "" "2" "" "00006" "Yee 2007, WMS-G.P.8.15" "family, 2 affected" "" "" "China" "" "0" "" "" "" "" "00228183" "" "" "" "1" "" "00006" "Yee 2007, WMS-G.P.8.15" "" "" "" "China" "" "0" "" "" "" "" "00228184" "" "" "" "1" "" "00006" "Yee 2007, WMS-G.P.8.15" "" "" "" "China" "" "0" "" "" "" "" "00228185" "" "" "" "1" "" "00006" "{PMID:Cotta 2014:25298746}" "" "M" "no" "Brazil" "" "0" "" "" "" "patient" "00228231" "" "" "" "4" "" "00006" "{PMID:Chamova 2018:29935994}" "3-generation family, 4 affected (4M), unaffected heterozygous carrier parents/relatives" "M" "" "Bulgaria" "" "0" "" "" "muslim" "FamG3Pat3/4/5/6" "00228232" "" "" "" "2" "" "00006" "{PMID:Chamova 2018:29935994}" "2-generation family, 2 affected (F,M), unaffected heterozygous carrier parents/relatives" "F;M" "" "Bulgaria" "" "0" "" "" "muslim" "FamG8Pat7/8" "00228233" "" "" "" "2" "" "00006" "{PMID:Chamova 2018:29935994}" "3-generation family, 2 affected (F,M), unaffected heterozygous carrier parents/relatives" "F;M" "" "Bulgaria" "" "0" "" "" "muslim" "FamG9Pat9/10" "00228234" "" "" "" "1" "" "00006" "{PMID:Chamova 2018:29935994}" "" "M" "" "Bulgaria" "" "0" "" "" "" "FamG1Pat11" "00228235" "" "" "" "1" "" "00006" "{PMID:Chamova 2018:29935994}" "" "F" "" "Bulgaria" "" "0" "" "" "" "FamG4Pat12" "00228236" "" "" "" "1" "" "00006" "{PMID:Chamova 2018:29935994}" "" "F" "" "Bulgaria" "" "0" "" "" "" "FamG5Pat13" "00228237" "" "" "" "1" "" "00006" "{PMID:Chamova 2018:29935994}" "" "M" "" "Bulgaria" "" "0" "" "" "" "FamG6Pat14" "00228238" "" "" "" "1" "" "00006" "{PMID:Chamova 2018:29935994}" "" "M" "" "Bulgaria" "" "0" "" "" "" "FamG7Pat15" "00228239" "" "" "" "1" "" "00006" "{PMID:Chamova 2018:29935994}" "" "M" "" "Bulgaria" "" "0" "" "" "" "FamG10Pat16" "00228240" "" "" "" "1" "" "00006" "{PMID:Chamova 2018:29935994}" "" "F" "" "Bulgaria" "" "0" "" "" "" "FamG11Pat17" "00228241" "" "" "" "1" "" "00006" "{PMID:Chamova 2018:29935994}" "" "F" "" "Bulgaria" "" "0" "" "" "" "FamG12Pat18" "00291693" "" "" "" "2" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00291694" "" "" "" "5" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00291695" "" "" "" "4" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00291696" "" "" "" "2" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00291697" "" "" "" "3" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00295280" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00299441" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" "" "00304574" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00314480" "" "" "" "2" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314481" "" "" "" "2" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314482" "" "" "" "2" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00317892" "" "" "" "2" "" "00006" "{PMID:Walsh 2017:27532257}" "" "" "" "United States" "" "0" "" "" "" "" "00317893" "" "" "" "1" "" "00006" "{PMID:Walsh 2017:27532257}" "" "" "" "United States" "" "0" "" "" "" "" "00317894" "" "" "" "1" "" "00006" "{PMID:Walsh 2017:27532257}" "" "" "" "United States" "" "0" "" "" "" "" "00317895" "" "" "" "2" "" "00006" "{PMID:Walsh 2017:27532257}" "" "" "" "United States" "" "0" "" "" "" "" "00317896" "" "" "" "1" "" "00006" "{PMID:Walsh 2017:27532257}" "" "" "" "United States" "" "0" "" "" "" "" "00376407" "" "" "" "1" "" "00006" "{PMID:Nguyen 2021:34011823}" "" "" "" "Viet Nam" "" "0" "" "" "" "Pat081" "00388682" "" "" "" "1" "" "00006" "{PMID:Chakravorty 2020:33250842}" "" "M" "" "India" "" "0" "" "" "India" "Pat121" "00388683" "" "" "" "1" "" "00006" "{PMID:Chakravorty 2020:33250842}" "" "F" "" "India" "" "0" "" "" "India" "Pat122" "00392009" "" "" "" "1" "" "03501" "{PMID:Karthikeyan 2024:39548682}" "" "M" "no" "India" "" "0" "yes" "" "" "MDCRC/1881/DBI-1515" "00395517" "" "" "" "1" "" "00006" "{PMID:Liang 2020:32576226}" "" "F" "" "Taiwan" "" "0" "" "" "" "Pat27" "00395518" "" "" "" "1" "" "00006" "{PMID:Liang 2020:32576226}" "" "M" "" "Taiwan" "" "0" "" "" "" "Pat28" "00395519" "" "" "" "1" "" "00006" "{PMID:Liang 2020:32576226}" "" "M" "" "Taiwan" "" "0" "" "" "" "Pat29" "00395520" "" "" "" "1" "" "00006" "{PMID:Liang 2020:32576226}" "" "F" "" "Taiwan" "" "0" "" "" "" "Pat30" "00430370" "" "" "" "1" "" "00006" "{PMID:Chen 2023:36463458}" "2-generation family, 1 affected, unaffected parents/relatives" "M" "no" "China" "" "0" "" "" "Asia-SE" "Pat1" "00430371" "" "" "" "1" "" "00006" "{PMID:Chen 2023:36463458}" "" "M" "" "Singapore" "" "0" "" "" "Asia-SE" "Pat2" "00430372" "" "" "" "1" "" "00006" "{PMID:Chen 2023:36463458}" "" "F" "" "Singapore" "" "0" "" "" "Asia-SE" "Pat3" "00430373" "" "" "" "1" "" "00006" "{PMID:Chen 2023:36463458}" "" "M" "" "China" "" "0" "" "" "Asia-SE" "Pat4" "00430407" "" "" "" "1" "" "00006" "{PMID:Cavdarli 2023:36575883}" "analysis 146 neuromuscular disease patients" "F" "" "Turkey" "" "0" "" "" "" "D18" "00430894" "" "" "" "2" "" "00006" "{PMID:Lv 2021:32761539}" "4-generation family, 2 affected sisters" "F" "yes" "China" "" "0" "" "" "" "Fam1PatIV2/3" "00430895" "" "" "" "1" "" "00006" "{PMID:Lv 2021:32761539}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "yes" "China" "" "0" "" "" "" "Fam2PatII2" "00430896" "" "" "" "2" "" "00006" "{PMID:Lv 2021:32761539}" "6-generation family, 2 affected (brother/sister), unaffected heterozygous carrier parents" "F;M" "yes" "China" "" "0" "" "" "" "Fam4PatVI1/2" "00430897" "" "" "" "1" "" "00006" "{PMID:Lv 2021:32761539}" "2-generation family, 1 affected, unaffected parents" "M" "" "China" "" "0" "" "" "" "Fam3PatII1" "00438485" "" "" "" "1" "" "00006" "{PMID:Cavdarli 2023:36575883}" "analysis 67 patients muscular dystrophy/myopathy (not DMD)" "F" "" "Turkey" "" "0" "" "" "" "D18" "00442777" "" "" "" "1" "" "00006" "{PMID:Westra 2019:31127727}" "" "F" "" "" "" "0" "" "" "" "Pat149" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 148 "{{individualid}}" "{{diseaseid}}" "00064069" "00351" "00064119" "00351" "00064709" "05166" "00064728" "05166" "00174790" "05126" "00213378" "05126" "00213379" "05126" "00213380" "05126" "00213382" "00000" "00213383" "00198" "00213385" "00351" "00213387" "00000" "00213388" "00198" "00213389" "00351" "00213391" "00198" "00213392" "00351" "00213393" "00351" "00213394" "00352" "00213395" "00351" "00213396" "00000" "00213397" "00351" "00213398" "00198" "00213399" "00352" "00213400" "00000" "00213401" "05126" "00213402" "00198" "00213403" "05126" "00213404" "00351" "00213405" "00351" "00213406" "00351" "00213407" "00352" "00213408" "00352" "00213409" "00352" "00213410" "00351" "00213411" "00351" "00213412" "00351" "00213413" "00351" "00213414" "00000" "00213415" "00198" "00213416" "00198" "00213417" "00198" "00213418" "00198" "00213419" "02405" "00213420" "02405" "00213421" "05126" "00219495" "05126" "00219527" "05126" "00219658" "05126" "00219773" "05126" "00219994" "05126" "00219996" "05126" "00220137" "05126" "00220230" "05126" "00220351" "05126" "00220433" "05126" "00220586" "05126" "00220637" "05126" "00220907" "05126" "00220952" "05126" "00220957" "05126" "00221064" "05126" "00221081" "05126" "00221083" "05126" "00221139" "05126" "00221235" "05126" "00221258" "05126" "00221283" "05126" "00221286" "05126" "00221396" "05126" "00221455" "05126" "00221461" "05126" "00221673" "05126" "00221788" "05126" "00221830" "05126" "00221911" "05126" "00221914" "05126" "00222059" "05126" "00222224" "05126" "00222302" "05126" "00222377" "05126" "00222513" "05126" "00228157" "00141" "00228158" "00141" "00228159" "00141" "00228161" "00141" "00228169" "00352" "00228170" "05126" "00228171" "05126" "00228172" "00352" "00228173" "00352" "00228174" "00352" "00228175" "00352" "00228176" "00352" "00228177" "05126" "00228178" "05121" "00228179" "05126" "00228180" "05126" "00228181" "05126" "00228182" "05126" "00228183" "00000" "00228184" "00000" "00228185" "05126" "00228231" "05126" "00228232" "05126" "00228233" "05126" "00228234" "05126" "00228235" "05126" "00228236" "05126" "00228237" "05126" "00228238" "05126" "00228239" "05126" "00228240" "05126" "00228241" "05126" "00291693" "00198" "00291694" "00198" "00291695" "00198" "00291696" "00198" "00291697" "00198" "00295280" "00198" "00299441" "00198" "00304574" "00198" "00314480" "05126" "00314481" "05126" "00314482" "05126" "00317892" "04172" "00317893" "04172" "00317894" "04172" "00317895" "04172" "00317896" "04172" "00376407" "00352" "00388682" "00244" "00388683" "00244" "00392009" "05324" "00395517" "05126" "00395518" "05126" "00395519" "05126" "00395520" "05126" "00430370" "05121" "00430371" "05121" "00430372" "05121" "00430373" "05121" "00430407" "05618" "00430894" "00244" "00430895" "00244" "00430896" "00244" "00430897" "00244" "00438485" "05121" "00442777" "05618" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00000, 00141, 00198, 00244, 00351, 00352, 02405, 02667, 04172, 05121, 05126, 05166, 05324, 05618 ## Count = 90 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000050585" "00351" "00064069" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000050635" "00351" "00064119" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000053237" "05166" "00064709" "01601" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000053255" "05166" "00064728" "01601" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000139617" "05126" "00174790" "00006" "Isolated (sporadic)" "17y" "onset overt symptoms early childhood; CPK raised 1.4x; limb-girdle weakness; generalized muscle atrophy, contractures in lower limbs; ambulation preserved" "" "" "" "" "" "" "" "" "" "limb-girdle muscular dystrophy" "" "0000161847" "05126" "00213378" "00006" "Familial" "" "" "" "" "" "WB no TCAP" "" "" "" "" "LGMD2G" "limb-girdle muscular dystrophy" "" "0000161848" "05126" "00213379" "00006" "Unknown" "" "" "" "" "" "WB and IHC no TCAP" "" "" "" "" "LGMD2G" "limb-girdle muscular dystrophy" "" "0000161849" "05126" "00213380" "00006" "Familial" "" "" "" "" "" "WB and IHC no TCAP" "" "" "" "" "LGMD2G" "limb-girdle muscular dystrophy" "" "0000161851" "00198" "00213383" "00006" "Unknown" "" "cardiomyopathy, hypertrophic 9 ?" "" "45y" "" "" "" "" "" "" "" "" "" "0000161853" "00351" "00213385" "00006" "Familial" "" "dyspnea, atric fibrilation" "" "44y" "" "" "" "" "" "" "CMH-25" "hypertrophic cardiomyopathy" "" "0000161855" "00198" "00213388" "00006" "Unknown" "" "cardiomyopathy, dilated 1N ?" "" "" "" "" "" "" "" "" "" "" "" "0000161856" "00351" "00213389" "00006" "Isolated (sporadic)" "" "dyspnea, angina, presyncope" "" "26y" "" "" "" "" "" "" "CMH-25" "hypertrophic cardiomyopathy" "" "0000161858" "00198" "00213391" "00006" "Isolated (sporadic)" "" "CMH, dyspnea, (pre)syncope" "" "47y" "" "" "" "" "" "" "" "" "" "0000161859" "00351" "00213392" "00006" "Unknown" "" "CMH or CMD ?" "" "" "" "" "" "" "" "" "CMH-25" "hypertrophic cardiomyopathy" "" "0000161860" "00351" "00213393" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "CMH-25" "hypertrophic cardiomyopathy" "" "0000161861" "00352" "00213394" "00006" "Unknown" "" "heart failure 34y, hear transplantation 35y" "" "" "" "" "" "" "" "" "CMH-25" "dilated cardiomyopathy" "" "0000161862" "00351" "00213395" "00006" "Familial" "" "" "" "" "" "" "" "" "" "" "CMH-25" "hypertrophic cardiomyopathy" "" "0000161863" "00351" "00213397" "00006" "Familial" "" "" "" "" "" "" "" "" "" "" "CMH-25" "hypertrophic cardiomyopathy" "" "0000161864" "00198" "00213398" "00006" "Unknown" "" "CMH or CMD ?" "" "" "" "" "" "" "" "" "" "" "" "0000161865" "00352" "00213399" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "CMH-25" "dilated cardiomyopathy" "" "0000161866" "05126" "00213401" "00464" "Unknown" "" "" "" "" "" "" "" "" "" "" "LGMD2G" "limb-girdle muscular dystrophy" "" "0000161867" "00198" "00213402" "00006" "Unknown" "" "primary intestinal pseudo-obstruction, sleep apnea, no overt cardiac phenotype (incl. ECG)" "" "" "" "" "" "" "" "" "" "atypical phenotype" "" "0000161868" "05126" "00213403" "00006" "Isolated (sporadic)" "" "progressive proximal limb weakness lower extremities/distal anterior leg compartment, painful cramps calf muscles; no cardiac or respiratory symptoms; CPK 1826" "15y" "" "bilateral proximal weakness lower extremities" "" "" "" "" "" "LGMD2G" "limb-girdle muscular dystrophy" "" "0000161869" "00351" "00213404" "00006" "Familial" "" "" "" "" "" "" "" "" "" "" "CMH-25" "hypertrophic cardiomyopathy" "" "0000161870" "00351" "00213405" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "CMH-25" "hypertrophic cardiomyopathy" "" "0000161871" "00351" "00213406" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "CMH-25" "hypertrophic cardiomyopathy" "" "0000161872" "00352" "00213407" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "CMH-25" "idiopathic dilated cardiomyopathy" "" "0000161873" "00352" "00213408" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "CMH-25" "idiopathic dilated cardiomyopathy" "" "0000161874" "00352" "00213409" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "CMD-1N" "dilated cardiomyopathy" "" "0000161875" "00351" "00213410" "00006" "Familial" "" "" "" "" "" "" "" "" "" "" "CMH-25" "hypertrophic cardiomyopathy" "" "0000161876" "00351" "00213411" "00006" "Familial" "" "" "" "" "" "" "" "" "" "" "CMH-25" "hypertrophic cardiomyopathy" "" "0000161877" "00351" "00213412" "00006" "Familial" "" "" "" "" "" "" "" "" "" "" "CMH-25" "hypertrophic cardiomyopathy" "" "0000161878" "00351" "00213413" "00006" "Familial" "" "" "" "" "" "" "" "" "" "" "CMH-25" "hypertrophic cardiomyopathy" "" "0000161879" "00198" "00213415" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000161880" "00198" "00213416" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000161881" "00198" "00213417" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000161882" "00198" "00213418" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000161883" "02405" "00213419" "03163" "Familial, autosomal recessive" "" "see paper; ..., CPK 3729" "12y" "" "" "" "" "" "" "" "LGMD-2G" "limb-girdle muscular dystrophy" "" "0000161884" "02405" "00213420" "03163" "Familial, autosomal recessive" "" "see paper; ..., CPK 1583" "09y" "" "" "" "" "" "" "" "LGMD-2G" "limb-girdle muscular dystrophy" "" "0000161885" "05126" "00213421" "03164" "Familial, autosomal recessive" "" "weakness and atrophy in proximal muscles of lower limbs, milder weakness proximal upper limbs, weakness, distal lower extremities mostly tibialis anterior muscle, bilateral Achilles and patellar contractures, bilateral scapular winging, asymmetric calves (left hypertrophy; right atrophy), positive Beevor sign, waddling and equinus gait; able to walk; CPK raised 300-700; no intellectual disability" "2y" "28y" "" "WB" "" "" "" "" "LGMD2G" "limb-girdle muscular dystrophy" "" "0000172070" "00141" "00228158" "00006" "Familial, autosomal recessive" "" "see paper; ..." "02y" "" "" "" "" "" "" "" "LGMD-2G" "limb-girdle muscular dystrophy" "" "0000172071" "00141" "00228159" "00006" "Familial, autosomal recessive" "28y" "see paper; ..., disto-proximal lower limb weakness, no cardiac problems, no respiratory\r\ninvolvement; muscle biopsy myopathic changes with type I fibre hypotrophy, cytoplasmic vacuoles, lipid overload, multiple central nuclei, fibre splittings; ultrastructural examination showed metabolic abnormalities" "17y" "" "muscle weakness" "" "" "" "" "" "LGMD-2G" "limb-girdle muscular dystrophy" "" "0000172073" "00141" "00228161" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "LGMD-2G" "limb-girdle muscular dystrophy" "" "0000172081" "00352" "00228169" "00006" "Familial" "19y" "" "" "" "" "" "" "" "" "" "" "dilated cardiomyopathy, familial" "" "0000172082" "05126" "00228170" "00006" "Familial, autosomal recessive" "49y" "see aper; ..., normal motor milestones, became noticeably slower in early teens; 44y-wheelchair bound" "08y" "" "" "" "" "" "" "" "LGMD2G" "limb-girdle muscular dystrophy" "" "0000172083" "05126" "00228171" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "LGMD2G" "limb-girdle muscular dystrophy" "" "0000172084" "00352" "00228172" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "dilated cardiomyopathy" "" "0000172085" "05126" "00228177" "00006" "Familial, autosomal recessive" "54y" "8y-tiptoe walking, left lower limb deformity, frequent falls; 41y-ambulation loss; 54y pelvic girdle atrophy, winging scapula, foot deformity with incapacity to perform ankle dorsiflexion, absent tendon reflexes; atypical histopathological muscle pattern (nemaline rods, type 1 fiber predominance, nuclear internalization, lobulated fibers, mitochondrial paracrystalline inclusion)" "08y" "" "tiptoe walking" "" "" "" "" "" "LGMD2G" "limb-girdle muscular dystrophy" "" "0000172086" "05121" "00228178" "00006" "Familial, autosomal recessive" "" "see paper; ..., onset infancy, weakness proximal and distal anterior; joint retractions ankles, hip, lumbar spine; calf\r\nhypertrophy, distal joint laxity; muscle biopsy dystrophic, no vacuoles" "" "" "" "" "" "" "" "" "LGMD-2G" "muscular dystrophy, congenital" "" "0000172087" "05126" "00228179" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "LGMD2G" "limb-girdle muscular dystrophy" "" "0000172088" "05126" "00228181" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "LGMD2G" "limb-girdle muscular dystrophy" "" "0000172089" "05126" "00228182" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "LGMD2G" "limb-girdle muscular dystrophy" "" "0000172090" "05126" "00228185" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "LGMD2G" "limb-girdle muscular dystrophy" "" "0000172161" "05126" "00228231" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "LGMD2G" "limb-girdle muscular dystrophy" "" "0000172162" "05126" "00228232" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "LGMD2G" "limb-girdle muscular dystrophy" "" "0000172163" "05126" "00228233" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "LGMD2G" "limb-girdle muscular dystrophy" "" "0000172164" "05126" "00228234" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "LGMD2G" "limb-girdle muscular dystrophy" "" "0000172165" "05126" "00228235" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "LGMD2G" "limb-girdle muscular dystrophy" "" "0000172166" "05126" "00228236" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "LGMD2G" "limb-girdle muscular dystrophy" "" "0000172167" "05126" "00228237" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "LGMD2G" "limb-girdle muscular dystrophy" "" "0000172168" "05126" "00228238" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "LGMD2G" "limb-girdle muscular dystrophy" "" "0000172169" "05126" "00228239" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "LGMD2G" "limb-girdle muscular dystrophy" "" "0000172170" "05126" "00228240" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "LGMD2G" "limb-girdle muscular dystrophy" "" "0000172171" "05126" "00228241" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "LGMD2G" "limb-girdle muscular dystrophy" "" "0000226751" "00198" "00299441" "01164" "Unknown" "" "Abnormality of muscle morphology (HP:0011805); Myopathy (HP:0003198)" "" "" "" "" "" "" "" "" "" "" "" "0000241638" "04172" "00317892" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "dilated cardiomyopathy" "" "0000241639" "04172" "00317893" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "dilated cardiomyopathy" "" "0000241640" "04172" "00317894" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "dilated cardiomyopathy" "" "0000241641" "04172" "00317895" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "dilated cardiomyopathy" "" "0000241642" "04172" "00317896" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "dilated cardiomyopathy" "" "0000271615" "00352" "00376407" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "dilated cardiomyopathy" "" "0000282222" "00244" "00388682" "00006" "Familial, autosomal recessive" "21y" "proximal muscle weakness; CK level 619 IU/L; tripping on small objects, Foot-drop with weak quadriceps and scapular-winging; Most-affected muscles: Knee extensors and ankle dorsiflexors" "15y" "" "" "" "" "" "" "" "" "" "" "0000282223" "00244" "00388683" "00006" "Familial, autosomal recessive" "28y" "distal muscle weakness; CK level 854 IU/L; tripping on small objects, Foot-drop with weak quadriceps and scapular-winging; Most-affected muscles: Knee extensors and ankle dorsiflexors" "23y" "" "" "" "" "" "" "" "" "" "" "0000285299" "05324" "00392009" "03501" "Unknown" "23y" "calf muscle hypertrophy (HP:0008981), Gowers sign (HP:0003391), difficulty climbing stairs (HP:0003551), difficulty walking (HP:0002355), waddling gait (HP:0002515), proximal muscle weakness (HP:0003701)" "5y" "" "" "" "" "" "" "" "muscular dystrophy" "DMD" "" "0000288716" "05126" "00395517" "00006" "Familial, autosomal recessive" "61y" "initial proximal weakness, no calf hypertrophy, no calf atrophy, 42y-loss of ambulation, no cardiac involvement, pulmonary involvement, 55y-CK level 474 IU/L" "12y" "" "" "" "" "" "" "" "LGMD2G" "limb-girdle muscular dystrophy" "" "0000288717" "05126" "00395518" "00006" "Familial, autosomal recessive" "59y" "initial proximal weakness, 33y-loss of ambulation, cardiac involvement, pulmonary involvement" "15y" "" "" "" "" "" "" "" "LGMD2G" "limb-girdle muscular dystrophy" "" "0000288718" "05126" "00395519" "00006" "Familial, autosomal recessive" "35y" "initial proximal weakness, calf hypertrophy, no calf atrophy, 33y-loss of ambulation, no cardiac involvement, no pulmonary involvement, 24y-CK level 1441 IU/L" "21y" "" "" "" "" "" "" "" "LGMD2G" "limb-girdle muscular dystrophy" "" "0000288719" "05126" "00395520" "00006" "Familial, autosomal recessive" "36y" "initial proximal and distal weakness, calf hypertrophy, no calf atrophystill ambulant, no cardiac involvement, no pulmonary involvement, 33y-CK level 1403 IU/L" "30y" "" "" "" "" "" "" "" "LGMD2G" "limb-girdle muscular dystrophy" "" "0000321167" "05121" "00430370" "00006" "Familial, autosomal recessive" "32y" "see paper; ..., limb-girdle muscle weakness; upper limbs not involved; lower limbs proximal; asymmetric; no facial muscles involved; no scapular winging; no abdominal weakness; hyper-lordosis; no limb abnormalities; calf hypertrophy; CK 1036 U/l; no muscle fibrosis; rimmed vacuoles, lobulated fibres; histology myofibrillar changes, cytoplasmic bodies; IHC TCAP reduced; e lectron microscopy Z-disc disarray, filamentous subsarcolemmal inclusions" "20y" "" "proximal lower limbs" "" "" "" "" "" "LGMDR7;LGMD2G" "limb-girdle muscle weakness" "" "0000321168" "05121" "00430371" "00006" "Familial, autosomal recessive" "" "facial scapular humeral muscle weakness; upper limbs humeral; lower limbs proximal>distal; no asymmetry; facial muscles involved, eye closure, lower facial; scapular winging, high riding; abdominal weakness; no spine anomalies; contractures knee; calf hypertrophy; 29y-requiring ambulatroy aids; CK 2212 U/l; muscle fibrosis; rimmed vacuoles, no lobulated fibres; no histological features; IHC TCAP absent, WB TCAP absent; electron microscopy normal" "21y" "" "proximal lower limbs" "" "" "" "" "" "LGMDR7;LGMD2G" "facial scapular humeral muscle weakness" "" "0000321169" "05121" "00430372" "00006" "Familial, autosomal recessive" "" "limb-girdle muscle weakness; upper limbs proximal>distal; lower limbs proximal>distal; no asymmetry; no facial muscles involved; no scapular winging; no abdominal weakness; hyper-lordosis; no limb abnormalities; calf hypertrophy; CK 992 U/l; electron microscopy normal" "33y" "" "proximal lower limbs" "" "" "" "" "" "LGMDR7;LGMD2G" "limb-girdle muscle weakness" "" "0000321170" "05121" "00430373" "00006" "Familial, autosomal recessive" "54y" "see paper; ..., facial scapular humeral muscle weakness; upper limbs humeral; lower limbs proximal>distal; asymmetric; facial muscles involved, eye closure, lower facial (late); scapular winging, high riding; abdominal weakness; hyper-lordosis; contracure ankle/knee; no calf hypertrophy; 44y-requiring ambulatroy aids; CK 1800 U/l; MRI muscle facial-scapular humeral pattern; muscle fibrosis; rimmed vacuoles, lobulated fibres; no histological features; IHC TCAP absent; electron microscopy focal subsarcolemmal myofibrillar and mitochondrial inclusions" "14y" "" "Achilles contracture" "" "" "" "" "" "LGMDR7;LGMD2G" "facial scapular humeral muscle weakness" "" "0000321204" "05618" "00430407" "00006" "Familial, autosomal recessive" "38y" "muscle weakness" "" "" "" "" "" "" "" "" "" "neuromuscular disorder" "" "0000321502" "05126" "00228180" "00006" "Familial, autosomal recessive" "32y" "late teenage slowly progressive muscle weakness; 27y-bilateral Achilles contractures, mild calf hypertrophy, asymmetric scapular winging, normal facial strength except mild weakness eye closure; moderate weakness hip movements/knee extension, mild weakness most other muscle groups, except hand/wrist movement" "" "" "" "" "" "" "" "" "LGMDR7;GMD2G" "limb-girdle muscular dystrophy" "" "0000321503" "00244" "00430894" "00006" "Familial, autosomal recessive" "" "see paper" "" "" "" "" "" "" "" "" "" "distal myopathy" "" "0000321504" "00244" "00430895" "00006" "Familial, autosomal recessive" "" "see paper" "" "" "" "" "" "" "" "" "" "distal myopathy" "" "0000321505" "00244" "00430896" "00006" "Familial, autosomal recessive" "" "see paper" "" "" "" "" "" "" "" "" "" "distal myopathy" "" "0000321506" "00244" "00430897" "00006" "Familial, autosomal recessive" "" "see paper" "" "" "" "" "" "" "" "" "" "distal myopathy" "" "0000328388" "05121" "00438485" "00006" "Familial, autosomal recessive" "38y" "muscle weakness" "" "" "" "" "" "" "" "" "" "muscular dystrophy/myopathy" "" "0000332124" "05618" "00442777" "00006" "Unknown" "" "Limb girdle muscle weakness with dilating cardiomyopathy" "" "" "" "" "" "" "" "" "" "limb girdle muscle weakenss" "" ## Screenings ## Do not remove or alter this header ## ## Count = 148 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000064202" "00064069" "1" "00006" "00006" "2016-04-27 08:53:12" "" "" "SEQ" "DNA" "" "" "0000064252" "00064119" "1" "00006" "00006" "2016-04-27 08:53:12" "" "" "SEQ" "DNA" "" "" "0000064848" "00064709" "1" "01601" "01601" "2016-05-10 11:31:54" "" "" "SEQ-NG-I" "DNA" "" "" "0000064867" "00064728" "1" "01601" "01601" "2016-05-10 12:31:47" "" "" "SEQ-NG-I" "DNA" "" "" "0000175681" "00174790" "1" "00006" "00006" "2018-08-10 19:10:48" "" "" "SEQ-NG" "DNA" "" "WES" "0000214448" "00213378" "1" "00006" "00006" "2005-10-29 21:33:03" "00006" "2012-03-09 19:03:40" "SEQ" "DNA" "" "" "0000214449" "00213379" "1" "00006" "00006" "2013-02-01 19:44:13" "00006" "2013-02-01 19:44:13" "SEQ" "RNA;DNA" "" "" "0000214450" "00213380" "1" "00006" "00006" "2012-03-09 19:03:40" "00006" "2012-03-09 19:03:40" "SEQ" "RNA;DNA" "" "" "0000214452" "00213382" "1" "00006" "00006" "2006-02-11 16:25:57" "00006" "2013-02-01 19:44:13" "SEQ" "DNA" "" "" "0000214453" "00213383" "1" "00006" "00006" "2006-05-25 23:28:35" "00006" "2013-02-01 19:44:13" "SEQ" "DNA" "" "" "0000214455" "00213385" "1" "00006" "00006" "2006-02-11 17:31:35" "00006" "2012-03-04 15:57:58" "DHPLC;SEQ" "DNA" "" "" "0000214457" "00213387" "1" "00006" "00006" "2006-02-11 16:29:56" "00006" "2013-02-01 19:44:13" "SEQ" "DNA" "" "" "0000214458" "00213388" "1" "00006" "00006" "2003-02-02 16:07:57" "00006" "2013-02-01 19:44:13" "SSCA;SEQ" "DNA" "" "" "0000214459" "00213389" "1" "00006" "00006" "2006-02-11 17:34:42" "00006" "2012-03-09 19:08:25" "DHPLC;SEQ" "DNA" "" "" "0000214461" "00213391" "1" "00006" "00006" "2006-02-11 17:26:45" "00006" "2012-03-09 19:08:25" "DHPLC;SEQ" "DNA" "" "" "0000214462" "00213392" "1" "00006" "00006" "2006-05-25 23:14:04" "00006" "2013-02-01 19:44:13" "DHPLC;SEQ" "DNA" "" "" "0000214463" "00213393" "1" "00006" "00006" "2006-07-12 19:29:34" "00006" "2013-02-01 19:44:13" "SSCA;SEQ" "DNA" "" "" "0000214464" "00213394" "1" "00006" "00006" "2006-02-11 16:49:09" "00006" "2013-02-01 19:44:13" "SEQ" "DNA" "" "" "0000214465" "00213395" "1" "00006" "00006" "2006-02-11 16:39:20" "00006" "2012-03-04 15:57:58" "SEQ" "DNA" "" "" "0000214466" "00213396" "1" "00006" "00006" "2006-02-11 16:32:41" "00006" "2013-02-01 19:44:13" "SEQ" "DNA" "" "" "0000214467" "00213397" "1" "00006" "00006" "2006-02-11 16:43:24" "00006" "2012-03-04 15:57:58" "SEQ" "DNA" "" "" "0000214468" "00213398" "1" "00006" "00006" "2006-05-25 23:14:04" "00006" "2013-02-01 19:44:13" "DHPLC;SEQ" "DNA" "" "" "0000214469" "00213399" "1" "00006" "00006" "2006-07-12 19:29:34" "00006" "2013-02-01 19:44:13" "SSCA;SEQ" "DNA" "" "" "0000214470" "00213400" "1" "00006" "00006" "2006-07-12 19:29:34" "00006" "2013-02-01 19:44:13" "SSCA;SEQ" "DNA" "" "" "0000214471" "00213401" "1" "00464" "00006" "2009-11-18 21:49:47" "00006" "2013-02-01 19:44:13" "SEQ" "DNA" "" "" "0000214472" "00213402" "1" "00006" "00006" "2009-11-22 21:27:13" "00006" "2013-02-01 19:44:13" "DHPLC;SEQ" "DNA" "" "" "0000214473" "00213403" "1" "00006" "00006" "2009-11-22 21:27:13" "00006" "2012-03-09 18:27:00" "SEQ" "DNA" "" "" "0000214474" "00213404" "1" "00006" "00006" "2009-11-22 21:27:13" "00006" "2012-03-27 20:35:13" "SEQ" "DNA" "" "" "0000214475" "00213405" "1" "00006" "00006" "2009-11-22 21:27:13" "00006" "2012-03-27 20:09:52" "SEQ" "DNA" "" "" "0000214476" "00213406" "1" "00006" "00006" "2009-11-22 21:27:13" "00006" "2012-03-27 20:11:43" "SEQ" "DNA" "" "" "0000214477" "00213407" "1" "00006" "00006" "2009-11-22 21:27:13" "00006" "2013-02-01 19:44:13" "SEQ" "DNA" "" "" "0000214478" "00213408" "1" "00006" "00006" "2009-11-22 21:27:13" "00006" "2013-02-01 19:44:13" "SEQ" "DNA" "" "" "0000214479" "00213409" "1" "00006" "00006" "2009-11-22 21:27:13" "00006" "2019-01-15 21:38:23" "SEQ" "DNA" "" "" "0000214480" "00213410" "1" "00006" "00006" "2006-02-11 16:39:20" "00006" "2012-03-04 15:57:58" "SEQ" "DNA" "" "" "0000214481" "00213411" "1" "00006" "00006" "2006-02-11 16:43:24" "00006" "2012-03-04 15:57:58" "SEQ" "DNA" "" "" "0000214482" "00213412" "1" "00006" "00006" "2006-02-11 16:43:24" "00006" "2012-03-04 15:57:58" "SEQ" "DNA" "" "" "0000214483" "00213413" "1" "00006" "00006" "2006-02-11 16:43:24" "00006" "2012-03-04 15:57:58" "SEQ" "DNA" "" "" "0000214484" "00213414" "1" "00006" "00006" "2009-11-22 21:27:13" "00006" "2013-02-01 19:44:13" "SEQ" "DNA" "" "" "0000214485" "00213415" "1" "00430" "00006" "2012-10-26 15:27:10" "" "" "SEQ" "DNA" "" "" "0000214486" "00213416" "1" "00430" "00006" "2012-10-26 15:27:10" "" "" "SEQ" "DNA" "" "" "0000214487" "00213417" "1" "00430" "00006" "2012-10-26 15:27:10" "" "" "SEQ" "DNA" "" "" "0000214488" "00213418" "1" "00430" "00006" "2012-10-26 15:27:10" "" "" "SEQ" "DNA" "" "" "0000214489" "00213419" "1" "03163" "00006" "2014-05-31 12:02:11" "00006" "2014-06-02 12:32:15" "SEQ" "DNA" "" "" "0000214490" "00213420" "1" "03163" "00006" "2014-05-31 12:18:08" "00006" "2014-06-02 12:31:20" "SEQ" "DNA" "" "" "0000214491" "00213421" "1" "03164" "00006" "2016-01-11 22:07:11" "00006" "2016-01-12 00:19:33" "SEQ-NG" "DNA" "" "" "0000220566" "00219495" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220598" "00219527" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220729" "00219658" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220844" "00219773" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221065" "00219994" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221067" "00219996" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221208" "00220137" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221301" "00220230" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221422" "00220351" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221504" "00220433" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221657" "00220586" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221708" "00220637" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221978" "00220907" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222023" "00220952" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222028" "00220957" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222135" "00221064" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222152" "00221081" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222154" "00221083" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222210" "00221139" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222306" "00221235" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222329" "00221258" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222354" "00221283" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222357" "00221286" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222467" "00221396" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222526" "00221455" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222532" "00221461" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222744" "00221673" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222859" "00221788" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222901" "00221830" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222982" "00221911" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222985" "00221914" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223130" "00222059" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223295" "00222224" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223373" "00222302" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223448" "00222377" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223584" "00222513" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000229246" "00228157" "1" "00006" "00006" "2019-03-19 12:01:55" "" "" "SEQ" "DNA" "" "" "0000229247" "00228158" "1" "00006" "00006" "2019-03-19 12:28:03" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000229248" "00228159" "1" "00006" "00006" "2019-03-19 12:36:23" "" "" "SEQ-NG" "DNA" "" "89 gene panel" "0000229250" "00228161" "1" "00006" "00006" "2019-03-19 12:53:15" "" "" "SEQ" "DNA" "" "" "0000229258" "00228169" "1" "00006" "00006" "2019-03-19 21:31:00" "" "" "SEQ" "DNA" "" "58-gene panel" "0000229259" "00228170" "1" "00006" "00006" "2019-03-19 21:38:12" "" "" "SEQ" "DNA" "" "" "0000229260" "00228171" "1" "00006" "00006" "2019-03-19 21:42:44" "" "" "SEQ" "DNA" "" "" "0000229261" "00228172" "1" "00006" "00006" "2019-03-19 21:53:36" "" "" "SEQ" "DNA" "" "" "0000229262" "00228173" "1" "00006" "00006" "2019-03-19 22:00:23" "" "" "SEQ" "DNA" "" "" "0000229263" "00228174" "1" "00006" "00006" "2019-03-19 22:03:19" "" "" "SEQ" "DNA" "" "" "0000229264" "00228175" "1" "00006" "00006" "2019-03-19 22:05:07" "" "" "SEQ" "DNA" "" "" "0000229265" "00228176" "1" "00006" "00006" "2019-03-19 22:07:27" "" "" "SEQ" "DNA" "" "" "0000229266" "00228177" "1" "00006" "00006" "2019-03-19 22:18:09" "" "" "SEQ" "DNA" "" "" "0000229267" "00228178" "1" "00006" "00006" "2019-03-19 22:34:27" "" "" "SEQ" "DNA" "" "" "0000229268" "00228179" "1" "00006" "00006" "2019-03-19 22:45:37" "" "" "SEQ" "DNA" "" "" "0000229269" "00228180" "1" "00006" "00006" "2019-03-19 22:55:50" "" "" "SEQ" "DNA" "" "" "0000229270" "00228181" "1" "00006" "00006" "2019-03-19 22:59:50" "" "" "SEQ" "DNA" "" "" "0000229271" "00228182" "1" "00006" "00006" "2019-03-19 23:02:31" "" "" "SEQ" "DNA" "" "" "0000229272" "00228183" "1" "00006" "00006" "2019-03-19 23:04:34" "" "" "SEQ" "DNA" "" "" "0000229273" "00228184" "1" "00006" "00006" "2019-03-19 23:06:13" "" "" "SEQ" "DNA" "" "" "0000229274" "00228185" "1" "00006" "00006" "2019-03-19 23:12:01" "" "" "SEQ" "DNA" "" "" "0000229321" "00228231" "1" "00006" "00006" "2019-03-22 09:47:35" "" "" "SEQ" "DNA" "" "" "0000229322" "00228232" "1" "00006" "00006" "2019-03-22 09:47:35" "" "" "SEQ" "DNA" "" "" "0000229323" "00228233" "1" "00006" "00006" "2019-03-22 09:47:35" "" "" "SEQ" "DNA" "" "" "0000229324" "00228234" "1" "00006" "00006" "2019-03-22 09:47:35" "" "" "SEQ" "DNA" "" "" "0000229325" "00228235" "1" "00006" "00006" "2019-03-22 09:47:35" "" "" "SEQ" "DNA" "" "" "0000229326" "00228236" "1" "00006" "00006" "2019-03-22 09:47:35" "" "" "SEQ" "DNA" "" "" "0000229327" "00228237" "1" "00006" "00006" "2019-03-22 09:47:35" "" "" "SEQ" "DNA" "" "" "0000229328" "00228238" "1" "00006" "00006" "2019-03-22 09:47:35" "" "" "SEQ" "DNA" "" "" "0000229329" "00228239" "1" "00006" "00006" "2019-03-22 09:47:35" "" "" "SEQ" "DNA" "" "" "0000229330" "00228240" "1" "00006" "00006" "2019-03-22 09:47:35" "" "" "SEQ" "DNA" "" "" "0000229331" "00228241" "1" "00006" "00006" "2019-03-22 09:47:35" "" "" "SEQ" "DNA" "" "" "0000292861" "00291693" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000292862" "00291694" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000292863" "00291695" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000292864" "00291696" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000292865" "00291697" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000296448" "00295280" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000300551" "00299441" "1" "01164" "01164" "2020-04-16 09:58:01" "" "" "SEQ-NG-S" "DNA" "" "" "0000305703" "00304574" "1" "03575" "00006" "2020-06-24 11:55:42" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000315653" "00314480" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315654" "00314481" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315655" "00314482" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000319074" "00317892" "1" "00006" "00006" "2020-11-03 19:57:35" "" "" "SEQ;SEQ-NG" "DNA" "" "cardiomyopathy gene panel" "0000319075" "00317893" "1" "00006" "00006" "2020-11-03 19:57:35" "" "" "SEQ;SEQ-NG" "DNA" "" "cardiomyopathy gene panel" "0000319076" "00317894" "1" "00006" "00006" "2020-11-03 19:57:35" "" "" "SEQ;SEQ-NG" "DNA" "" "cardiomyopathy gene panel" "0000319077" "00317895" "1" "00006" "00006" "2020-11-03 19:57:35" "" "" "SEQ;SEQ-NG" "DNA" "" "cardiomyopathy gene panel" "0000319078" "00317896" "1" "00006" "00006" "2020-11-03 19:57:35" "" "" "SEQ;SEQ-NG" "DNA" "" "cardiomyopathy gene panel" "0000377612" "00376407" "1" "00006" "00006" "2021-06-22 13:15:11" "" "" "SEQ-NG" "DNA" "" "58-gene panel" "0000389924" "00388682" "1" "00006" "00006" "2021-11-04 20:51:09" "" "" "SEQ-NG" "DNA" "" "WES" "0000389925" "00388683" "1" "00006" "00006" "2021-11-04 20:51:09" "" "" "SEQ-NG" "DNA" "" "WES" "0000393251" "00392009" "1" "03501" "00006" "2021-11-19 15:49:45" "" "" "SEQ-NG" "DNA" "" "screened DMD, COL6A2, TCAP" "0000396755" "00395517" "1" "00006" "00006" "2021-12-06 20:03:57" "" "" "SEQ;SEQ-NG" "DNA" "" "247-gene panel" "0000396756" "00395518" "1" "00006" "00006" "2021-12-06 20:03:57" "" "" "SEQ;SEQ-NG" "DNA" "" "247-gene panel" "0000396757" "00395519" "1" "00006" "00006" "2021-12-06 20:03:57" "" "" "SEQ;SEQ-NG" "DNA" "" "247-gene panel" "0000396758" "00395520" "1" "00006" "00006" "2021-12-06 20:03:57" "" "" "SEQ;SEQ-NG" "DNA" "" "247-gene panel" "0000431779" "00430370" "1" "00006" "00006" "2023-01-19 16:20:48" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000431780" "00430371" "1" "00006" "00006" "2023-01-19 16:20:48" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000431781" "00430372" "1" "00006" "00006" "2023-01-19 16:20:48" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000431782" "00430373" "1" "00006" "00006" "2023-01-19 16:20:48" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000431816" "00430407" "1" "00006" "00006" "2023-01-20 11:39:52" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000432305" "00430894" "1" "00006" "00006" "2023-01-24 19:41:19" "" "" "SEQ" "DNA" "" "" "0000432306" "00430895" "1" "00006" "00006" "2023-01-24 19:46:41" "" "" "SEQ" "DNA" "" "" "0000432307" "00430896" "1" "00006" "00006" "2023-01-24 19:50:18" "" "" "SEQ" "DNA" "" "" "0000432308" "00430897" "1" "00006" "00006" "2023-01-24 19:54:16" "" "" "SEQ" "DNA" "" "" "0000439967" "00438485" "1" "00006" "00006" "2023-10-21 14:47:26" "" "" "SEQ;SEQ-NG" "DNA" "" "47-gene panel" "0000444261" "00442777" "1" "00006" "00006" "2023-11-23 18:48:51" "" "" "SEQ-NG" "DNA" "" "WES" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 92 "{{screeningid}}" "{{geneid}}" "0000064202" "TTN" "0000064252" "TTN" "0000214448" "TCAP" "0000214449" "TCAP" "0000214450" "TCAP" "0000214452" "TCAP" "0000214453" "TCAP" "0000214455" "TCAP" "0000214457" "TCAP" "0000214458" "TCAP" "0000214459" "TCAP" "0000214461" "TCAP" "0000214462" "TCAP" "0000214463" "TCAP" "0000214464" "TCAP" "0000214465" "TCAP" "0000214466" "TCAP" "0000214467" "TCAP" "0000214468" "TCAP" "0000214469" "TCAP" "0000214470" "TCAP" "0000214471" "TCAP" "0000214472" "TCAP" "0000214473" "TCAP" "0000214474" "TCAP" "0000214475" "TCAP" "0000214476" "TCAP" "0000214477" "TCAP" "0000214478" "TCAP" "0000214479" "LMNA" "0000214479" "TCAP" "0000214480" "TCAP" "0000214481" "TCAP" "0000214482" "TCAP" "0000214483" "TCAP" "0000214484" "TCAP" "0000214485" "TCAP" "0000214486" "TCAP" "0000214487" "TCAP" "0000214488" "TCAP" "0000214489" "TCAP" "0000214490" "TCAP" "0000214491" "TCAP" "0000229246" "TCAP" "0000229247" "TCAP" "0000229248" "TCAP" "0000229250" "TCAP" "0000229258" "TCAP" "0000229259" "TCAP" "0000229260" "TCAP" "0000229261" "TCAP" "0000229262" "TCAP" "0000229263" "TCAP" "0000229264" "TCAP" "0000229265" "TCAP" "0000229266" "TCAP" "0000229267" "TCAP" "0000229268" "TCAP" "0000229269" "TCAP" "0000229270" "TCAP" "0000229271" "TCAP" "0000229272" "TCAP" "0000229273" "TCAP" "0000229274" "TCAP" "0000229321" "TCAP" "0000229322" "TCAP" "0000229323" "TCAP" "0000229324" "TCAP" "0000229325" "TCAP" "0000229326" "TCAP" "0000229327" "TCAP" "0000229328" "TCAP" "0000229329" "TCAP" "0000229330" "TCAP" "0000229331" "TCAP" "0000315653" "TCAP" "0000315654" "TCAP" "0000315655" "TCAP" "0000319074" "TCAP" "0000319075" "TCAP" "0000319076" "TCAP" "0000319077" "TCAP" "0000319078" "TCAP" "0000377612" "TCAP" "0000396755" "TCAP" "0000396756" "TCAP" "0000396757" "TCAP" "0000396758" "TCAP" "0000432305" "TCAP" "0000432306" "TCAP" "0000432307" "TCAP" "0000432308" "TCAP" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 276 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000095190" "0" "50" "17" "37821616" "37821616" "subst" "0" "00006" "TCAP_000035" "g.37821616G>A" "1/223 cases HCM" "{PMID:Lopes 2013:23396983}, {DOI:Lopes 2013:10.1136/jmedgenet-2012-101270}" "" "NM_003673:c.G4A" "" "Germline" "" "" "0" "" "" "g.39665363G>A" "" "VUS" "" "0000095387" "0" "50" "17" "37821649" "37821651" "del" "0" "00006" "TCAP_000010" "g.37821649_37821651del" "1/223 cases HCM" "{PMID:Lopes 2013:23396983}, {DOI:Lopes 2013:10.1136/jmedgenet-2012-101270}" "" "NM_003673:c.37_39del" "" "Germline" "" "" "0" "" "" "g.39665396_39665398del" "" "VUS" "" "0000096494" "0" "50" "17" "37822174" "37822174" "subst" "0.023843" "01601" "TCAP_000016" "g.37822174C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.39665921C>T" "" "VUS" "" "0000096520" "0" "50" "17" "37822174" "37822174" "subst" "0.023843" "01601" "TCAP_000016" "g.37822174C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.39665921C>T" "" "VUS" "" "0000247422" "0" "10" "17" "37822311" "37822311" "subst" "0.66981" "02330" "TCAP_000004" "g.37822311A>C" "" "" "" "TCAP(NM_003673.3):c.453A>C (p.A151=), TCAP(NM_003673.4):c.453A>C (p.A151=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.39666058A>C" "" "benign" "" "0000247468" "0" "30" "17" "37821600" "37821600" "subst" "3.65874E-5" "02330" "TCAP_000037" "g.37821600A>G" "" "" "" "TCAP(NM_003673.4):c.-13A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.39665347A>G" "" "likely benign" "" "0000247836" "0" "10" "17" "37822311" "37822311" "subst" "0.66981" "02325" "TCAP_000004" "g.37822311A>C" "" "" "" "TCAP(NM_003673.3):c.453A>C (p.A151=), TCAP(NM_003673.4):c.453A>C (p.A151=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.39666058A>C" "" "benign" "" "0000249594" "0" "70" "17" "37822332" "37822345" "dup" "0" "02325" "TCAP_000036" "g.37822332_37822345dup" "" "" "" "TCAP(NM_003673.4):c.474_487dupCTCCATGTCCCAGG (p.E163Afs*30), TCAP(NM_003673.4):c.488delAinsCTCCATGTCCCAGGA (p.E163Afs*30)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.39666079_39666092dup" "" "likely pathogenic" "" "0000250618" "0" "10" "17" "37822311" "37822311" "subst" "0.66981" "02326" "TCAP_000004" "g.37822311A>C" "" "" "" "TCAP(NM_003673.3):c.453A>C (p.A151=), TCAP(NM_003673.4):c.453A>C (p.A151=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.39666058A>C" "" "benign" "" "0000251963" "0" "30" "17" "37822016" "37822016" "subst" "0" "02326" "TCAP_000048" "g.37822016A>G" "" "" "" "TCAP(NM_003673.3):c.158A>G (p.Q53R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.39665763A>G" "" "likely benign" "" "0000252970" "0" "10" "17" "37822311" "37822311" "subst" "0.66981" "01943" "TCAP_000004" "g.37822311A>C" "" "" "" "TCAP(NM_003673.3):c.453A>C (p.A151=), TCAP(NM_003673.4):c.453A>C (p.A151=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.39666058A>C" "" "benign" "" "0000309082" "0" "10" "17" "37821737" "37821737" "subst" "0" "02330" "TCAP_000045" "g.37821737G>C" "" "" "" "TCAP(NM_003673.4):c.110+15G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.39665484G>C" "" "benign" "" "0000309083" "0" "10" "17" "37822044" "37822044" "subst" "0" "02330" "TCAP_000049" "g.37822044G>A" "" "" "" "TCAP(NM_003673.4):c.186G>A (p.Q62=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.39665791G>A" "" "benign" "" "0000309084" "0" "50" "17" "37822046" "37822046" "subst" "1.28688E-5" "02330" "TCAP_000050" "g.37822046G>A" "" "" "" "TCAP(NM_003673.3):c.188G>A (p.R63H), TCAP(NM_003673.4):c.188G>A (p.R63H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.39665793G>A" "" "VUS" "" "0000309085" "0" "10" "17" "37822049" "37822049" "subst" "0.000761081" "02330" "TCAP_000023" "g.37822049C>T" "" "" "" "TCAP(NM_003673.3):c.191C>T (p.S64L), TCAP(NM_003673.4):c.191C>T (p.S64L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.39665796C>T" "" "benign" "" "0000309086" "0" "10" "17" "37822125" "37822125" "subst" "4.18323E-6" "02330" "TCAP_000055" "g.37822125G>A" "" "" "" "TCAP(NM_003673.4):c.267G>A (p.L89=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.39665872G>A" "" "benign" "" "0000309087" "0" "10" "17" "37822128" "37822128" "subst" "5.84458E-5" "02330" "TCAP_000056" "g.37822128G>A" "" "" "" "TCAP(NM_003673.3):c.270G>A (p.P90=), TCAP(NM_003673.4):c.270G>A (p.P90=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.39665875G>A" "" "benign" "" "0000309088" "0" "50" "17" "37822171" "37822171" "subst" "0.000110384" "02330" "TCAP_000057" "g.37822171G>A" "" "" "" "TCAP(NM_003673.4):c.313G>A (p.E105K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.39665918G>A" "" "VUS" "" "0000309089" "0" "10" "17" "37822174" "37822174" "subst" "0.023843" "02330" "TCAP_000016" "g.37822174C>T" "" "" "" "TCAP(NM_003673.3):c.316C>T (p.R106C, p.(Arg106Cys)), TCAP(NM_003673.4):c.316C>T (p.R106C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.39665921C>T" "" "benign" "" "0000309090" "0" "10" "17" "37821644" "37821644" "subst" "0.000251928" "02330" "TCAP_000038" "g.37821644C>T" "" "" "" "TCAP(NM_003673.3):c.32C>T (p.S11L), TCAP(NM_003673.4):c.32C>T (p.S11L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.39665391C>T" "" "benign" "" "0000309091" "0" "30" "17" "37821649" "37821651" "del" "0" "02330" "TCAP_000010" "g.37821649_37821651del" "" "" "" "TCAP(NM_003673.3):c.37_39del (p.(Glu13del)), TCAP(NM_003673.3):c.37_39delGAG (p.E13del), TCAP(NM_003673.4):c.37_39delGAG (p.E13del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.39665396_39665398del" "" "likely benign" "" "0000309092" "0" "50" "17" "37822247" "37822247" "subst" "0" "02330" "TCAP_000059" "g.37822247G>A" "" "" "" "TCAP(NM_003673.4):c.389G>A (p.R130H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.39665994G>A" "" "VUS" "" "0000309093" "0" "10" "17" "37822281" "37822281" "subst" "8.23086E-6" "02330" "TCAP_000060" "g.37822281C>T" "" "" "" "TCAP(NM_003673.4):c.423C>T (p.P141=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.39666028C>T" "" "benign" "" "0000309094" "0" "50" "17" "37822306" "37822306" "subst" "4.99792E-5" "02330" "TCAP_000061" "g.37822306G>A" "" "" "" "TCAP(NM_003673.4):c.448G>A (p.G150S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.39666053G>A" "" "VUS" "" "0000309095" "0" "50" "17" "37822315" "37822315" "subst" "1.67386E-5" "02330" "TCAP_000063" "g.37822315C>T" "" "" "" "TCAP(NM_003673.4):c.457C>T (p.R153C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.39666062C>T" "" "VUS" "" "0000309096" "0" "50" "17" "37821671" "37821671" "subst" "0" "02330" "TCAP_000042" "g.37821671C>T" "" "" "" "TCAP(NM_003673.4):c.59C>T (p.A20V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.39665418C>T" "" "VUS" "" "0000311753" "0" "30" "17" "37821732" "37821732" "subst" "0" "02325" "TCAP_000044" "g.37821732G>C" "" "" "" "TCAP(NM_003673.4):c.110+10G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.39665479G>C" "" "likely benign" "" "0000311754" "0" "30" "17" "37821953" "37821953" "subst" "0.000407284" "02325" "TCAP_000046" "g.37821953C>G" "" "" "" "TCAP(NM_003673.3):c.111-16C>G, TCAP(NM_003673.4):c.111-16C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.39665700C>G" "" "likely benign" "" "0000311755" "0" "50" "17" "37822067" "37822067" "subst" "2.55957E-5" "02325" "TCAP_000053" "g.37822067G>A" "" "" "" "TCAP(NM_003673.4):c.209G>A (p.(Arg70Gln), p.R70Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.39665814G>A" "" "VUS" "" "0000311756" "0" "30" "17" "37822174" "37822174" "subst" "0.023843" "02325" "TCAP_000016" "g.37822174C>T" "" "" "" "TCAP(NM_003673.3):c.316C>T (p.R106C, p.(Arg106Cys)), TCAP(NM_003673.4):c.316C>T (p.R106C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.39665921C>T" "" "likely benign" "" "0000311757" "0" "30" "17" "37821651" "37821651" "subst" "0" "02325" "TCAP_000040" "g.37821651G>A" "" "" "" "TCAP(NM_003673.4):c.39G>A (p.E13=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.39665398G>A" "" "likely benign" "" "0000311759" "0" "30" "17" "37821672" "37821672" "subst" "0.000292583" "02325" "TCAP_000043" "g.37821672C>G" "" "" "" "TCAP(NM_003673.3):c.60C>G (p.A20=, p.(Ala20=)), TCAP(NM_003673.4):c.60C>G (p.A20=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.39665419C>G" "" "likely benign" "" "0000314452" "0" "30" "17" "37822438" "37822438" "subst" "0" "02326" "TCAP_000027" "g.37822438G>T" "" "" "" "TCAP(NM_003673.3):c.*76G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.39666185G>T" "" "likely benign" "" "0000314453" "0" "10" "17" "37822049" "37822049" "subst" "0.000761081" "02326" "TCAP_000023" "g.37822049C>T" "" "" "" "TCAP(NM_003673.3):c.191C>T (p.S64L), TCAP(NM_003673.4):c.191C>T (p.S64L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.39665796C>T" "" "benign" "" "0000314454" "0" "50" "17" "37822066" "37822066" "subst" "4.27859E-5" "02326" "TCAP_000011" "g.37822066C>T" "" "" "" "TCAP(NM_003673.3):c.208C>T (p.R70W), TCAP(NM_003673.4):c.208C>T (p.R70W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.39665813C>T" "" "VUS" "" "0000314455" "0" "70" "17" "37822111" "37822134" "del" "0" "02326" "TCAP_000054" "g.37822111_37822134del" "" "" "" "TCAP(NM_003673.3):c.253_276delTACCAGCGGGTACTGCCGCTGCCC (p.Y85_P92del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.39665858_39665881del" "" "likely pathogenic" "" "0000314456" "0" "30" "17" "37822174" "37822174" "subst" "0.023843" "02326" "TCAP_000016" "g.37822174C>T" "" "" "" "TCAP(NM_003673.3):c.316C>T (p.R106C, p.(Arg106Cys)), TCAP(NM_003673.4):c.316C>T (p.R106C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.39665921C>T" "" "likely benign" "" "0000314457" "0" "30" "17" "37821649" "37821651" "del" "0" "02326" "TCAP_000010" "g.37821649_37821651del" "" "" "" "TCAP(NM_003673.3):c.37_39del (p.(Glu13del)), TCAP(NM_003673.3):c.37_39delGAG (p.E13del), TCAP(NM_003673.4):c.37_39delGAG (p.E13del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.39665396_39665398del" "" "likely benign" "" "0000314458" "0" "50" "17" "37821664" "37821664" "subst" "1.62522E-5" "02326" "TCAP_000041" "g.37821664C>T" "" "" "" "TCAP(NM_003673.3):c.52C>T (p.R18W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.39665411C>T" "" "VUS" "" "0000316321" "0" "50" "17" "37822046" "37822046" "subst" "1.28688E-5" "01943" "TCAP_000050" "g.37822046G>A" "" "" "" "TCAP(NM_003673.3):c.188G>A (p.R63H), TCAP(NM_003673.4):c.188G>A (p.R63H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.39665793G>A" "" "VUS" "" "0000316322" "0" "10" "17" "37822049" "37822049" "subst" "0.000761081" "01943" "TCAP_000023" "g.37822049C>T" "" "" "" "TCAP(NM_003673.3):c.191C>T (p.S64L), TCAP(NM_003673.4):c.191C>T (p.S64L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.39665796C>T" "" "benign" "" "0000316323" "0" "30" "17" "37822174" "37822174" "subst" "0.023843" "01943" "TCAP_000016" "g.37822174C>T" "" "" "" "TCAP(NM_003673.3):c.316C>T (p.R106C, p.(Arg106Cys)), TCAP(NM_003673.4):c.316C>T (p.R106C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.39665921C>T" "" "likely benign" "" "0000316324" "0" "50" "17" "37822195" "37822195" "subst" "0.000146858" "01943" "TCAP_000058" "g.37822195C>T" "" "" "" "TCAP(NM_003673.3):c.337C>T (p.L113F), TCAP(NM_003673.4):c.337C>T (p.L113F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.39665942C>T" "" "VUS" "" "0000316325" "0" "10" "17" "37822314" "37822314" "subst" "0" "01943" "TCAP_000062" "g.37822314T>C" "" "" "" "TCAP(NM_003673.3):c.456T>C (p.L152=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.39666061T>C" "" "benign" "" "0000339931" "0" "10" "17" "37822311" "37822311" "subst" "0.66981" "02327" "TCAP_000004" "g.37822311A>C" "" "" "" "TCAP(NM_003673.3):c.453A>C (p.A151=), TCAP(NM_003673.4):c.453A>C (p.A151=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.39666058A>C" "" "benign" "" "0000398563" "3" "90" "17" "37822218" "37822219" "del" "0" "00006" "TCAP_000052" "g.37822218_37822219del" "" "{PMID:Fichna 2018:29970176}" "" "360_361delGA" "ACMG grading: PVS1, PS4, PM2, PM3; additional variants in NEB X3, SYNE1, BVES, TTN x2" "Germline" "" "" "0" "" "" "g.39665965_39665966del" "" "pathogenic" "ACMG" "0000446729" "3" "90" "17" "37822015" "37822015" "subst" "0" "00006" "TCAP_000002" "g.37822015C>T" "" "Lima WMS2005 L.P.3.02" "BfaI+" "" "" "Germline" "" "" "0" "" "" "g.39665762C>T" "" "pathogenic (recessive)" "" "0000446731" "3" "90" "17" "37822015" "37822015" "subst" "0" "00006" "TCAP_000002" "g.37822015C>T" "" "{PMID:Moreira:10655062}, {OMIM604488:0001}" "BfaI+" "" "" "Germline" "" "" "0" "" "" "g.39665762C>T" "" "pathogenic (recessive)" "" "0000446733" "1" "90" "17" "37821722" "37821723" "del" "0" "00006" "TCAP_000001" "g.37821722_37821723del" "" "{PMID:Moreira:10655062}, {OMIM604488:0002}" "" "109_110del" "" "Germline" "" "" "0" "" "" "g.39665469_39665470del" "" "pathogenic (recessive)" "" "0000446734" "2" "90" "17" "37822015" "37822015" "subst" "0" "00006" "TCAP_000002" "g.37822015C>T" "" "{PMID:Moreira:10655062}, {OMIM604488:0001}" "BfaI+" "" "" "Germline" "" "" "0" "" "" "g.39665762C>T" "" "pathogenic (recessive)" "" "0000446736" "1" "10" "17" "37822014" "37822014" "subst" "0" "00006" "TCAP_000005" "g.37822014C>T" "4" "{PMID:Hayashi 2004:15582318}" "" "" ">600 chromosomes tested" "Germline" "" "" "0" "" "" "g.39665761C>T" "" "benign" "" "0000446737" "1" "50" "17" "37822029" "37822029" "subst" "2.11309E-5" "00006" "TCAP_000018" "g.37822029C>G" "" "Perrot (Berlin), EJHFS2005" "" "" "not in 400 control chromosomes" "Germline" "" "" "0" "" "" "g.39665776C>G" "" "VUS" "" "0000446739" "1" "90" "17" "37822066" "37822066" "subst" "4.27859E-5" "00006" "TCAP_000011" "g.37822066C>T" "" "{PMID:Bos 2006:16352453}" "" "" "not in 400 control chromosomes" "Germline" "" "" "0" "" "" "g.39665813C>T" "" "pathogenic (recessive)" "" "0000446741" "1" "10" "17" "37822083" "37822083" "subst" "0" "00006" "TCAP_000006" "g.37822083C>A" "3" "{PMID:Hayashi 2004:15582318}" "" "" ">600 chromosomes tested" "Germline" "" "" "0" "" "" "g.39665830C>A" "" "benign" "" "0000446742" "1" "50" "17" "37822118" "37822118" "subst" "4.19999E-6" "00006" "TCAP_000003" "g.37822118G>A" "" "{PMID:Knoll 2002:12507422}, {OMIM604488:0003}" "" "" "not in 400 control chromosomes" "Germline" "" "" "0" "" "" "g.39665865G>A" "" "VUS" "" "0000446743" "1" "90" "17" "37822127" "37822127" "subst" "0" "00006" "TCAP_000012" "g.37822127C>T" "" "{PMID:Bos 2006:16352453}" "" "" "not in 400 control chromosomes" "Germline" "" "" "0" "" "" "g.39665874C>T" "" "pathogenic (recessive)" "" "0000446745" "1" "50" "17" "37821649" "37821651" "del" "0" "00006" "TCAP_000010" "g.37821649_37821651del" "" "{PMID:Bos 2006:16352453}" "" "" "not in 400 control chromosomes" "Germline" "" "" "0" "" "" "g.39665396_39665398del" "" "VUS" "" "0000446746" "1" "50" "17" "37821649" "37821651" "del" "0" "00006" "TCAP_000010" "g.37821649_37821651del" "2/324" "{PMID:Marziliano 2006:16650785}" "" "" "0/144 DCM patients" "Germline" "" "" "0" "" "" "g.39665396_39665398del" "" "VUS" "" "0000446747" "1" "10" "17" "37821649" "37821651" "del" "0" "00006" "TCAP_000010" "g.37821649_37821651del" "3/350" "{PMID:Perrot 2006:16490376}" "" "" "" "Germline" "" "" "0" "" "" "g.39665396_39665398del" "" "benign" "" "0000446748" "1" "90" "17" "37822252" "37822252" "subst" "4.08617E-6" "00006" "TCAP_000009" "g.37822252G>C" "" "{PMID:Hayashi 2004:15582318}" "" "" "not in >600 control chromosomes" "Germline" "" "" "0" "" "" "g.39665999G>C" "" "pathogenic (recessive)" "" "0000446749" "1" "90" "17" "37822268" "37822268" "subst" "0" "00006" "TCAP_000007" "g.37822268C>T" "" "{PMID:Hayashi 2004:15582318}" "" "" "not in >600 control chromosomes" "Germline" "" "" "0" "" "" "g.39666015C>T" "" "pathogenic (recessive)" "" "0000446750" "1" "10" "17" "37822311" "37822311" "subst" "0.66981" "00006" "TCAP_000004" "g.37822311A>C" "0.44" "{PMID:Hayashi 2004:15582318}" "" "" ">600 chromosomes tested" "Germline" "" "rs1053651" "0" "" "" "g.39666058A>C" "" "benign" "" "0000446751" "1" "90" "17" "37822316" "37822316" "subst" "0.00022662" "00006" "TCAP_000008" "g.37822316G>A" "" "{PMID:Hayashi 2004:15582318}" "" "" "not in >600 control chromosomes" "Germline" "" "" "0" "" "" "g.39666063G>A" "" "pathogenic (recessive)" "" "0000446752" "1" "50" "17" "37821649" "37821651" "del" "0" "00006" "TCAP_000010" "g.37821649_37821651del" "4/1000" "{PMID:Marziliano 2006:16650785}" "" "" "" "Germline" "" "" "0" "" "" "g.39665396_39665398del" "" "VUS" "" "0000446753" "1" "10" "17" "37821649" "37821651" "del" "0" "00006" "TCAP_000010" "g.37821649_37821651del" "1/400" "{PMID:Perrot 2006:16490376}" "" "" "" "Germline" "" "" "0" "" "" "g.39665396_39665398del" "" "benign" "" "0000446754" "1" "10" "17" "37821649" "37821651" "del" "0" "00006" "TCAP_000010" "g.37821649_37821651del" "4/800" "{PMID:Perrot 2006:16490376}" "" "" "" "Germline" "" "" "0" "" "" "g.39665396_39665398del" "" "benign" "" "0000446755" "0" "90" "17" "37821722" "37821723" "del" "0" "00464" "TCAP_000001" "g.37821722_37821723del" "" "" "" "109_110delGG" "" "Germline" "" "" "0" "" "" "g.39665469_39665470del" "" "pathogenic (recessive)" "" "0000446756" "1" "90" "17" "37822084" "37822084" "subst" "5.53003E-5" "00006" "TCAP_000030" "g.37822084C>T" "" "{PMID:Mazzone 2008:18408010}" "" "" "" "Germline" "" "" "0" "" "" "g.39665831C>T" "" "pathogenic (recessive)" "" "0000446757" "11" "90" "17" "37821687" "37821687" "subst" "2.03209E-5" "00006" "TCAP_000026" "g.37821687G>A" "" "{PMID:Olive 2008:18948002}" "" "" "not in 308 control chromosomes; FKRP normal" "Germline" "" "" "0" "" "" "g.39665434G>A" "" "pathogenic (recessive)" "" "0000446758" "21" "90" "17" "37821687" "37821687" "subst" "2.03209E-5" "00006" "TCAP_000026" "g.37821687G>A" "" "{PMID:Olive 2008:18948002}" "" "" "not in 308 control chromosomes; FKRP normal" "Germline" "" "" "0" "" "" "g.39665434G>A" "" "pathogenic (recessive)" "" "0000446759" "1" "70" "17" "37822174" "37822174" "subst" "0.023843" "00006" "TCAP_000016" "g.37822174C>T" "" "{PMID:Andersen 2008:19035361}, {PMID:Andersen 2009:19035361}" "" "" "not in 200 control chromosomes" "Germline" "" "rs45578741" "0" "" "" "g.39665921C>T" "" "likely pathogenic" "" "0000446760" "1" "30" "17" "37822438" "37822438" "subst" "0" "00006" "TCAP_000027" "g.37822438G>T" "" "{PMID:Andersen 2009:19035361}" "" "g.826G>T" "not in 200 control chromosomes" "Germline" "" "" "0" "" "" "g.39666185G>T" "" "likely benign" "" "0000446761" "1" "90" "17" "37821649" "37821651" "del" "0" "00006" "TCAP_000010" "g.37821649_37821651del" "" "{PMID:Andersen 2009:19035361}" "" "g.36_38del" "segregates" "Germline" "" "" "0" "" "" "g.39665396_39665398del" "" "pathogenic (recessive)" "" "0000446762" "1" "70" "17" "37821665" "37821665" "subst" "2.43799E-5" "00006" "TCAP_000028" "g.37821665G>A" "" "{PMID:Hershberger 2009:19412328}" "" "1630G>A (Arg18Gln)" "" "Germline" "" "" "0" "" "" "g.39665412G>A" "" "likely pathogenic" "" "0000446763" "1" "70" "17" "37822003" "37822003" "subst" "3.35314E-5" "00006" "TCAP_000029" "g.37822003G>A" "" "{PMID:Hershberger 2009:19412328}" "" "1968G>A (Glu49Lys)" "" "Germline" "" "" "0" "" "" "g.39665750G>A" "" "likely pathogenic" "" "0000446764" "1" "30" "17" "37822279" "37822279" "subst" "2.87848E-5" "00006" "TCAP_000025" "g.37822279C>G" "" "{PMID:Hershberger 2009:19412328}" "" "2244C>G (Pro141Ala)" "does not segregate, carries likely pathogenic LMNA variant" "Germline" "" "" "0" "" "" "g.39666026C>G" "" "likely benign" "" "0000446765" "1" "90" "17" "37822268" "37822268" "subst" "0" "00006" "TCAP_000007" "g.37822268C>T" "" "{PMID:Hayashi 2004:15582318}" "" "" "not in >600 control chromosomes" "Germline" "" "" "0" "" "" "g.39666015C>T" "" "pathogenic (recessive)" "" "0000446766" "1" "90" "17" "37822316" "37822316" "subst" "0.00022662" "00006" "TCAP_000008" "g.37822316G>A" "" "{PMID:Hayashi 2004:15582318}" "" "" "not in >600 control chromosomes" "Germline" "" "" "0" "" "" "g.39666063G>A" "" "pathogenic (recessive)" "" "0000446767" "1" "90" "17" "37822316" "37822316" "subst" "0.00022662" "00006" "TCAP_000008" "g.37822316G>A" "" "{PMID:Hayashi 2004:15582318}" "" "" "not in >600 control chromosomes" "Germline" "" "" "0" "" "" "g.39666063G>A" "" "pathogenic (recessive)" "" "0000446768" "1" "90" "17" "37822316" "37822316" "subst" "0.00022662" "00006" "TCAP_000008" "g.37822316G>A" "" "{PMID:Hayashi 2004:15582318}" "" "" "not in >600 control chromosomes" "Germline" "" "" "0" "" "" "g.39666063G>A" "" "pathogenic (recessive)" "" "0000446769" "1" "50" "17" "37821649" "37821651" "del" "0" "00006" "TCAP_000010" "g.37821649_37821651del" "1/200" "{PMID:Andersen 2009:19035361}" "" "" "" "Germline" "" "" "0" "" "" "g.39665396_39665398del" "" "VUS" "" "0000446770" "0" "10" "17" "37821770" "37821770" "subst" "0.0389201" "00430" "TCAP_000024" "g.37821770C>T" "" "from website {DBsub-Emory}" "" "" "" "Unknown" "" "rs2941510" "0" "" "" "g.39665517C>T" "" "benign" "" "0000446771" "0" "50" "17" "37822116" "37822116" "subst" "0" "00430" "TCAP_000031" "g.37822116G>A" "" "from website {DBsub-Emory}" "" "" "" "Unknown" "" "" "0" "" "" "g.39665863G>A" "" "VUS" "" "0000446772" "0" "50" "17" "37822174" "37822174" "subst" "0.023843" "00430" "TCAP_000016" "g.37822174C>T" "" "from website {DBsub-Emory}" "" "" "" "Unknown" "" "rs45578741" "0" "" "" "g.39665921C>T" "" "VUS" "" "0000446773" "0" "10" "17" "37822311" "37822311" "subst" "0.66981" "00430" "TCAP_000004" "g.37822311A>C" "" "from website {DBsub-Emory}" "" "" "" "Unknown" "" "rs1053651" "0" "" "" "g.39666058A>C" "" "benign" "" "0000446774" "3" "70" "17" "37821644" "37821644" "subst" "0" "03163" "TCAP_000032" "g.37821644C>A" "" "{PMID:Francis 2014:25055047}" "" "" "not in 334 control chromosomes" "Germline" "yes" "" "0" "" "" "g.39665391C>A" "" "likely pathogenic (recessive)" "" "0000446776" "3" "90" "17" "37821638" "37821645" "dup" "0" "03163" "TCAP_000033" "g.37821638_37821645dup" "1/10 cases" "{PMID:Francis 2014:25055047}" "" "26_33dupAGGTGTCG" "" "Germline" "yes" "" "0" "" "" "g.39665385_39665392dup" "" "pathogenic (recessive)" "" "0000446778" "3" "90" "17" "37822113" "37822113" "subst" "0" "03164" "TCAP_000034" "g.37822113C>A" "" "{PMID:de Fuenmayor-Fernández de la Hoz 2016:27618135}" "" "Tyr85X" "" "Germline" "yes" "" "0" "" "" "g.39665860C>A" "" "pathogenic (recessive)" "" "0000446780" "1" "10" "17" "37821435" "37821435" "subst" "0" "00006" "TCAP_000013" "g.37821435G>T" "0.10-0.71" "" "" "" "" "Germline" "" "rs931992" "0" "" "" "g.39665182G>T" "" "benign" "" "0000446781" "1" "10" "17" "37822757" "37822757" "subst" "0" "00006" "TCAP_000014" "g.37822757C>T" "0.00-0.01" "" "" "" "" "Germline" "" "rs45540732" "0" "" "" "g.39666504C>T" "" "benign" "" "0000446782" "1" "10" "17" "37822561" "37822561" "subst" "0" "00006" "TCAP_000015" "g.37822561G>T" "0.00-0.01" "" "" "" "" "Germline" "" "rs45503594" "0" "" "" "g.39666308G>T" "" "benign" "" "0000446783" "1" "10" "17" "37822739" "37822739" "subst" "0" "00006" "TCAP_000021" "g.37822739G>C" "0.00-0.08" "" "" "" "" "Germline" "" "rs3194794" "0" "" "" "g.39666486G>C" "" "benign" "" "0000446784" "1" "10" "17" "37822305" "37822305" "subst" "5.41391E-5" "00006" "TCAP_000022" "g.37822305C>T" "0.00-0.03" "" "" "" "" "Germline" "" "rs45614332" "0" "" "" "g.39666052C>T" "" "benign" "" "0000446785" "1" "10" "17" "37822049" "37822049" "subst" "0.000761081" "00006" "TCAP_000023" "g.37822049C>T" "0.00-0.02" "" "" "" "" "Germline" "" "rs45458802" "0" "" "" "g.39665796C>T" "" "benign" "" "0000466654" "1" "50" "17" "37822318" "37822318" "subst" "2.51809E-5" "00430" "TCAP_000074" "g.37822318C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant in TCAP" "Germline" "" "" "0" "" "" "g.39666065C>T" "" "VUS" "" "0000466655" "1" "50" "17" "37821649" "37821651" "del" "0" "00430" "TCAP_000010" "g.37821649_37821651del" "" "{PMID:Nallamilli 2018:30564623}" "" "37_39delGAG" "no second variant in TCAP, hypertrophic cardiomyopathy-associated variants" "Germline" "" "" "0" "" "" "g.39665396_39665398del" "" "VUS" "" "0000466656" "0" "50" "17" "37821709" "37821709" "subst" "6.50782E-5" "00430" "TCAP_000066" "g.37821709C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.39665456C>T" "" "VUS" "" "0000466657" "1" "50" "17" "37822066" "37822066" "subst" "4.27859E-5" "00430" "TCAP_000011" "g.37822066C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.39665813C>T" "" "VUS" "" "0000466658" "1" "50" "17" "37822211" "37822211" "subst" "0.000220352" "00430" "TCAP_000071" "g.37822211C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.39665958C>T" "" "VUS" "" "0000466659" "1" "50" "17" "37822067" "37822067" "subst" "2.55957E-5" "00430" "TCAP_000053" "g.37822067G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.39665814G>A" "" "VUS" "" "0000466660" "1" "50" "17" "37821971" "37821971" "subst" "0.000114673" "00430" "TCAP_000067" "g.37821971G>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.39665718G>T" "" "VUS" "" "0000466661" "1" "50" "17" "37822171" "37822171" "subst" "0.000498774" "00430" "TCAP_000069" "g.37822171G>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.39665918G>C" "" "VUS" "" "0000466662" "1" "50" "17" "37822211" "37822211" "subst" "0.000220352" "00430" "TCAP_000071" "g.37822211C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.39665958C>T" "" "VUS" "" "0000466663" "1" "50" "17" "37822211" "37822211" "subst" "0.000220352" "00430" "TCAP_000071" "g.37822211C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.39665958C>T" "" "VUS" "" "0000466664" "1" "50" "17" "37822246" "37822246" "subst" "6.94053E-5" "00430" "TCAP_000072" "g.37822246C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.39665993C>T" "" "VUS" "" "0000466665" "1" "50" "17" "37822171" "37822171" "subst" "0.000498774" "00430" "TCAP_000069" "g.37822171G>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.39665918G>C" "" "VUS" "" "0000466666" "1" "50" "17" "37822128" "37822128" "subst" "5.84458E-5" "00430" "TCAP_000056" "g.37822128G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.39665875G>A" "" "VUS" "" "0000466667" "1" "50" "17" "37821709" "37821709" "subst" "6.50782E-5" "00430" "TCAP_000066" "g.37821709C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.39665456C>T" "" "VUS" "" "0000466668" "3" "90" "17" "37821678" "37821678" "subst" "0" "00430" "TCAP_000065" "g.37821678G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "variant apparently homozygous" "Germline" "" "" "0" "" "" "g.39665425G>A" "" "pathogenic" "" "0000466669" "1" "50" "17" "37822211" "37822211" "subst" "0.000220352" "00430" "TCAP_000071" "g.37822211C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.39665958C>T" "" "VUS" "" "0000466670" "1" "90" "17" "37821655" "37821661" "dup" "0" "00430" "TCAP_000064" "g.37821655_37821661dup" "" "{PMID:Nallamilli 2018:30564623}" "" "43_49dupTGTGAGC" "no second variant" "Germline" "" "" "0" "" "" "g.39665402_39665408dup" "" "pathogenic" "" "0000466671" "1" "50" "17" "37822211" "37822211" "subst" "0.000220352" "00430" "TCAP_000071" "g.37822211C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.39665958C>T" "" "VUS" "" "0000466672" "1" "50" "17" "37822098" "37822098" "subst" "4.22333E-6" "00430" "TCAP_000068" "g.37822098G>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.39665845G>T" "" "VUS" "" "0000466673" "1" "50" "17" "37822312" "37822312" "subst" "0" "00430" "TCAP_000073" "g.37822312C>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.39666059C>G" "" "VUS" "" "0000466674" "1" "50" "17" "37822171" "37822171" "subst" "0.000498774" "00430" "TCAP_000069" "g.37822171G>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.39665918G>C" "" "VUS" "" "0000466675" "1" "50" "17" "37821664" "37821664" "subst" "1.62522E-5" "00430" "TCAP_000041" "g.37821664C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.39665411C>T" "" "VUS" "" "0000466676" "1" "50" "17" "37821971" "37821971" "subst" "0.000114673" "00430" "TCAP_000067" "g.37821971G>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.39665718G>T" "" "VUS" "" "0000466677" "1" "50" "17" "37822067" "37822067" "subst" "2.55957E-5" "00430" "TCAP_000053" "g.37822067G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.39665814G>A" "" "VUS" "" "0000466678" "1" "50" "17" "37822192" "37822192" "subst" "0" "00430" "TCAP_000070" "g.37822192C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.39665939C>T" "" "VUS" "" "0000466679" "1" "50" "17" "37822171" "37822171" "subst" "0.000110384" "00430" "TCAP_000057" "g.37822171G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.39665918G>A" "" "VUS" "" "0000466680" "1" "50" "17" "37822211" "37822211" "subst" "0.000220352" "00430" "TCAP_000071" "g.37822211C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.39665958C>T" "" "VUS" "" "0000466681" "1" "50" "17" "37822211" "37822211" "subst" "0.000220352" "00430" "TCAP_000071" "g.37822211C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.39665958C>T" "" "VUS" "" "0000466682" "1" "50" "17" "37822246" "37822246" "subst" "6.94053E-5" "00430" "TCAP_000072" "g.37822246C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.39665993C>T" "" "VUS" "" "0000466683" "1" "50" "17" "37822211" "37822211" "subst" "0.000220352" "00430" "TCAP_000071" "g.37822211C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.39665958C>T" "" "VUS" "" "0000466684" "1" "50" "17" "37822171" "37822171" "subst" "0.000498774" "00430" "TCAP_000069" "g.37822171G>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.39665918G>C" "" "VUS" "" "0000466685" "1" "50" "17" "37822211" "37822211" "subst" "0.000220352" "00430" "TCAP_000071" "g.37822211C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.39665958C>T" "" "VUS" "" "0000466686" "1" "50" "17" "37822171" "37822171" "subst" "0.000498774" "00430" "TCAP_000069" "g.37822171G>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.39665918G>C" "" "VUS" "" "0000466687" "1" "50" "17" "37822171" "37822171" "subst" "0.000498774" "00430" "TCAP_000069" "g.37822171G>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.39665918G>C" "" "VUS" "" "0000466688" "1" "50" "17" "37821971" "37821971" "subst" "0.000114673" "00430" "TCAP_000067" "g.37821971G>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.39665718G>T" "" "VUS" "" "0000466689" "1" "50" "17" "37822067" "37822067" "subst" "2.55957E-5" "00430" "TCAP_000053" "g.37822067G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.39665814G>A" "" "VUS" "" "0000470395" "0" "10" "17" "37821435" "37821435" "subst" "0" "00006" "TCAP_000013" "g.37821435G>T" "" "{PMID:Francis 2014:25055047}" "" "" "found in cases and controls" "Germline" "" "" "0" "" "" "g.39665182G>T" "" "benign" "" "0000470396" "0" "10" "17" "37822311" "37822311" "subst" "0.66981" "00006" "TCAP_000004" "g.37822311A>C" "" "{PMID:Francis 2014:25055047}" "" "" "found in cases and controls" "Germline" "no" "" "0" "" "" "g.39666058A>C" "" "benign" "" "0000470397" "3" "90" "17" "37821702" "37821703" "del" "0" "00006" "TCAP_000075" "g.37821702_37821703del" "" "{PMID:Ikenberg 2017:28666572}" "" "" "" "Germline" "" "" "0" "" "" "g.39665449_39665450del" "" "pathogenic (recessive)" "" "0000470398" "3" "90" "17" "37821702" "37821703" "del" "0" "00006" "TCAP_000075" "g.37821702_37821703del" "" "{PMID:Brusa 2018:29759638}" "" "" "" "Germline" "" "" "0" "" "" "g.39665449_39665450del" "" "pathogenic (recessive)" "" "0000470402" "3" "90" "17" "37821687" "37821687" "subst" "2.03209E-5" "00006" "TCAP_000026" "g.37821687G>A" "" "{PMID:Chamova 2018:29935994}" "" "" "" "Germline" "yes" "" "0" "" "" "g.39665434G>A" "" "pathogenic (recessive)" "" "0000470414" "0" "50" "17" "37822174" "37822174" "subst" "0.023843" "00006" "TCAP_000016" "g.37822174C>T" "" "{PMID:Marston 2015:26406308}" "" "R106C" "" "Germline" "" "" "0" "" "" "g.39665921C>T" "" "VUS" "" "0000470415" "0" "90" "17" "37822102" "37822102" "subst" "0" "00006" "TCAP_000076" "g.37822102C>T" "" "{PMID:Barresi 2015:25724973}" "" "" "" "Germline" "" "" "0" "" "" "g.39665849C>T" "" "pathogenic (recessive)" "" "0000470416" "1" "90" "17" "37821714" "37821714" "del" "0" "00006" "TCAP_000077" "g.37821714del" "" "{PMID:Wang 2014:25119914}" "" "100delC" "" "Germline" "" "" "0" "" "" "g.39665461del" "" "pathogenic (recessive)" "" "0000470417" "2" "90" "17" "37822023" "37822023" "dup" "0" "00006" "TCAP_000078" "g.37822023dup" "" "{PMID:Wang 2014:25119914}" "" "166insG" "" "Germline" "" "" "0" "" "" "g.39665770dup" "" "pathogenic (recessive)" "" "0000470418" "0" "70" "17" "37821649" "37821651" "del" "0" "00006" "TCAP_000010" "g.37821649_37821651del" "" "{PMID:Hirtle-Lewis 2013:24037902}" "" "" "" "Germline" "" "" "0" "" "" "g.39665396_39665398del" "" "likely pathogenic" "" "0000470419" "0" "50" "17" "37822171" "37822171" "subst" "0.000110384" "00006" "TCAP_000057" "g.37822171G>A" "" "{PMID:Hirtle-Lewis 2013:24037902}" "" "" "" "Germline" "" "rs146906267" "0" "" "" "g.39665918G>A" "" "VUS" "" "0000470420" "0" "50" "17" "37822174" "37822174" "subst" "0.023843" "00006" "TCAP_000016" "g.37822174C>T" "" "{PMID:Hirtle-Lewis 2013:24037902}" "" "" "" "Germline" "" "rs45578741" "0" "" "" "g.39665921C>T" "" "VUS" "" "0000470421" "0" "50" "17" "37822211" "37822211" "subst" "0.000220352" "00006" "TCAP_000071" "g.37822211C>T" "" "{PMID:Hirtle-Lewis 2013:24037902}" "" "" "" "Germline" "" "rs143233087" "0" "" "" "g.39665958C>T" "" "VUS" "" "0000470422" "0" "70" "17" "37822330" "37822330" "subst" "0" "00006" "TCAP_000079" "g.37822330C>T" "" "{PMID:Hirtle-Lewis 2013:24037902}" "" "" "" "Germline" "" "" "0" "" "" "g.39666077C>T" "" "likely pathogenic" "" "0000470423" "3" "90" "17" "37822015" "37822015" "subst" "0" "00006" "TCAP_000002" "g.37822015C>T" "" "{PMID:Paim 2013:23479141}, Almeida 2012 WMS-G.P.40" "" "" "" "Germline" "" "" "0" "" "" "g.39665762C>T" "" "pathogenic (recessive)" "" "0000470424" "3" "90" "17" "37822030" "37822030" "subst" "0" "00006" "TCAP_000080" "g.37822030C>T" "" "{PMID:Ferreiro 2011:21530252}" "" "" "" "Germline" "" "" "0" "" "" "g.39665777C>T" "" "pathogenic (recessive)" "" "0000470425" "3" "90" "17" "37822015" "37822015" "subst" "0" "00006" "TCAP_000002" "g.37822015C>T" "" "{PMID:Negrao 2010:22029105}" "" "" "" "Germline" "" "" "0" "" "" "g.39665762C>T" "" "pathogenic (recessive)" "" "0000470426" "3" "90" "17" "37821638" "37821645" "dup" "0" "00006" "TCAP_000033" "g.37821638_37821645dup" "" "Waddell 2012, WMS-G.P.41" "" "26_33dupAGGTGTCG" "" "Germline" "yes" "" "0" "" "" "g.39665385_39665392dup" "" "pathogenic (recessive)" "" "0000470427" "3" "90" "17" "37821638" "37821645" "dup" "0" "00006" "TCAP_000033" "g.37821638_37821645dup" "" "Yee 2007, WMS-G.P.8.15" "" "" "" "Germline" "" "" "0" "" "" "g.39665385_39665392dup" "" "pathogenic (recessive)" "" "0000470428" "3" "90" "17" "37821638" "37821645" "dup" "0" "00006" "TCAP_000033" "g.37821638_37821645dup" "" "Yee 2007, WMS-G.P.8.15" "" "" "" "Germline" "" "" "0" "" "" "g.39665385_39665392dup" "" "pathogenic (recessive)" "" "0000470429" "1" "90" "17" "37821638" "37821645" "dup" "0" "00006" "TCAP_000033" "g.37821638_37821645dup" "1/100 controls" "Yee 2007, WMS-G.P.8.15" "" "" "" "Germline" "" "" "0" "" "" "g.39665385_39665392dup" "" "pathogenic (recessive)" "" "0000470430" "1" "90" "17" "37821657" "37821658" "del" "0" "00006" "TCAP_000081" "g.37821657_37821658del" "1/100 controls" "Yee 2007, WMS-G.P.8.15" "" "45_46delTG" "" "Germline" "" "" "0" "" "" "g.39665404_39665405del" "" "pathogenic (recessive)" "" "0000470431" "3" "90" "17" "37822015" "37822015" "subst" "0" "00006" "TCAP_000002" "g.37822015C>T" "" "{PMID:Cotta 2014:25298746}" "" "" "" "Germline" "" "" "0" "" "" "g.39665762C>T" "" "pathogenic (recessive)" "" "0000470506" "3" "90" "17" "37821687" "37821687" "subst" "2.03209E-5" "00006" "TCAP_000026" "g.37821687G>A" "" "{PMID:Chamova 2018:29935994}" "" "" "" "Germline" "" "" "0" "" "" "g.39665434G>A" "" "pathogenic (recessive)" "" "0000470507" "3" "90" "17" "37821687" "37821687" "subst" "2.03209E-5" "00006" "TCAP_000026" "g.37821687G>A" "" "{PMID:Chamova 2018:29935994}" "" "" "" "Germline" "" "" "0" "" "" "g.39665434G>A" "" "pathogenic (recessive)" "" "0000470508" "3" "90" "17" "37821687" "37821687" "subst" "2.03209E-5" "00006" "TCAP_000026" "g.37821687G>A" "" "{PMID:Chamova 2018:29935994}" "" "" "" "Germline" "" "" "0" "" "" "g.39665434G>A" "" "pathogenic (recessive)" "" "0000470509" "3" "90" "17" "37821687" "37821687" "subst" "2.03209E-5" "00006" "TCAP_000026" "g.37821687G>A" "" "{PMID:Chamova 2018:29935994}" "" "" "" "Germline" "" "" "0" "" "" "g.39665434G>A" "" "pathogenic (recessive)" "" "0000470510" "3" "90" "17" "37821687" "37821687" "subst" "2.03209E-5" "00006" "TCAP_000026" "g.37821687G>A" "" "{PMID:Chamova 2018:29935994}" "" "" "" "Germline" "" "" "0" "" "" "g.39665434G>A" "" "pathogenic (recessive)" "" "0000470511" "3" "90" "17" "37821687" "37821687" "subst" "2.03209E-5" "00006" "TCAP_000026" "g.37821687G>A" "" "{PMID:Chamova 2018:29935994}" "" "" "" "Germline" "" "" "0" "" "" "g.39665434G>A" "" "pathogenic (recessive)" "" "0000470512" "3" "90" "17" "37821687" "37821687" "subst" "2.03209E-5" "00006" "TCAP_000026" "g.37821687G>A" "" "{PMID:Chamova 2018:29935994}" "" "" "" "Germline" "" "" "0" "" "" "g.39665434G>A" "" "pathogenic (recessive)" "" "0000470513" "3" "90" "17" "37821687" "37821687" "subst" "2.03209E-5" "00006" "TCAP_000026" "g.37821687G>A" "" "{PMID:Chamova 2018:29935994}" "" "" "" "Germline" "" "" "0" "" "" "g.39665434G>A" "" "pathogenic (recessive)" "" "0000470514" "3" "90" "17" "37821687" "37821687" "subst" "2.03209E-5" "00006" "TCAP_000026" "g.37821687G>A" "" "{PMID:Chamova 2018:29935994}" "" "" "" "Germline" "" "" "0" "" "" "g.39665434G>A" "" "pathogenic (recessive)" "" "0000470515" "3" "90" "17" "37821687" "37821687" "subst" "2.03209E-5" "00006" "TCAP_000026" "g.37821687G>A" "" "{PMID:Chamova 2018:29935994}" "" "" "" "Germline" "" "" "0" "" "" "g.39665434G>A" "" "pathogenic (recessive)" "" "0000470516" "3" "90" "17" "37821687" "37821687" "subst" "2.03209E-5" "00006" "TCAP_000026" "g.37821687G>A" "" "{PMID:Chamova 2018:29935994}" "" "" "" "Germline" "" "" "0" "" "" "g.39665434G>A" "" "pathogenic (recessive)" "" "0000561210" "0" "30" "17" "37820176" "37820176" "subst" "0" "02327" "STARD3_000003" "g.37820176C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39663923C>T" "" "likely benign" "" "0000561211" "0" "30" "17" "37820981" "37820981" "subst" "0" "02327" "STARD3_000004" "g.37820981A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39664728A>G" "" "likely benign" "" "0000561212" "0" "50" "17" "37821170" "37821170" "subst" "0" "02327" "STARD3_000005" "g.37821170C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39664917C>T" "" "VUS" "" "0000561213" "0" "50" "17" "37821649" "37821651" "del" "0" "01943" "TCAP_000010" "g.37821649_37821651del" "" "" "" "TCAP(NM_003673.3):c.37_39del (p.(Glu13del)), TCAP(NM_003673.3):c.37_39delGAG (p.E13del), TCAP(NM_003673.4):c.37_39delGAG (p.E13del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39665396_39665398del" "" "VUS" "" "0000561214" "0" "30" "17" "37821649" "37821651" "del" "0" "02325" "TCAP_000010" "g.37821649_37821651del" "" "" "" "TCAP(NM_003673.3):c.37_39del (p.(Glu13del)), TCAP(NM_003673.3):c.37_39delGAG (p.E13del), TCAP(NM_003673.4):c.37_39delGAG (p.E13del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39665396_39665398del" "" "likely benign" "" "0000561215" "0" "30" "17" "37821649" "37821651" "del" "0" "01804" "TCAP_000010" "g.37821649_37821651del" "" "" "" "TCAP(NM_003673.3):c.37_39del (p.(Glu13del)), TCAP(NM_003673.3):c.37_39delGAG (p.E13del), TCAP(NM_003673.4):c.37_39delGAG (p.E13del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39665396_39665398del" "" "likely benign" "" "0000561216" "0" "30" "17" "37821672" "37821672" "subst" "0.000292583" "01943" "TCAP_000043" "g.37821672C>G" "" "" "" "TCAP(NM_003673.3):c.60C>G (p.A20=, p.(Ala20=)), TCAP(NM_003673.4):c.60C>G (p.A20=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39665419C>G" "" "likely benign" "" "0000561217" "0" "30" "17" "37821699" "37821699" "subst" "8.13074E-6" "02327" "STARD3_000006" "g.37821699A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39665446A>C" "" "likely benign" "" "0000561218" "0" "10" "17" "37821737" "37821737" "subst" "0" "02330" "STARD3_000007" "g.37821737G>T" "" "" "" "TCAP(NM_003673.4):c.110+15G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39665484G>T" "" "benign" "" "0000561219" "0" "10" "17" "37821770" "37821770" "subst" "0.0389201" "02327" "TCAP_000024" "g.37821770C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39665517C>T" "" "benign" "" "0000561220" "0" "30" "17" "37821953" "37821953" "subst" "0.000407284" "02327" "TCAP_000046" "g.37821953C>G" "" "" "" "TCAP(NM_003673.3):c.111-16C>G, TCAP(NM_003673.4):c.111-16C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39665700C>G" "" "likely benign" "" "0000561221" "0" "50" "17" "37821971" "37821971" "subst" "0.000114673" "02330" "TCAP_000067" "g.37821971G>T" "" "" "" "TCAP(NM_003673.3):c.113G>T (p.C38F), TCAP(NM_003673.4):c.113G>T (p.C38F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39665718G>T" "" "VUS" "" "0000561222" "0" "10" "17" "37821990" "37821990" "subst" "0.000109307" "02330" "TCAP_000047" "g.37821990C>T" "" "" "" "TCAP(NM_003673.4):c.132C>T (p.D44=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39665737C>T" "" "benign" "" "0000561223" "0" "50" "17" "37822019" "37822019" "subst" "0" "01943" "STARD3_000008" "g.37822019A>C" "" "" "" "TCAP(NM_003673.3):c.161A>C (p.Q54P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39665766A>C" "" "VUS" "" "0000561224" "0" "30" "17" "37822046" "37822046" "subst" "1.28688E-5" "02327" "TCAP_000050" "g.37822046G>A" "" "" "" "TCAP(NM_003673.3):c.188G>A (p.R63H), TCAP(NM_003673.4):c.188G>A (p.R63H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39665793G>A" "" "likely benign" "" "0000561225" "0" "30" "17" "37822066" "37822066" "subst" "4.27859E-6" "01943" "STARD3_000009" "g.37822066C>A" "" "" "" "TCAP(NM_003673.3):c.208C>A (p.R70=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39665813C>A" "" "likely benign" "" "0000561226" "0" "30" "17" "37822066" "37822066" "subst" "4.27859E-5" "02327" "TCAP_000011" "g.37822066C>T" "" "" "" "TCAP(NM_003673.3):c.208C>T (p.R70W), TCAP(NM_003673.4):c.208C>T (p.R70W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39665813C>T" "" "likely benign" "" "0000561227" "0" "50" "17" "37822084" "37822084" "subst" "5.53003E-5" "01943" "TCAP_000030" "g.37822084C>T" "" "" "" "TCAP(NM_003673.3):c.226C>T (p.R76C), TCAP(NM_003673.4):c.226C>T (p.R76C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39665831C>T" "" "VUS" "" "0000561228" "0" "50" "17" "37822168" "37822168" "subst" "0" "02327" "STARD3_000010" "g.37822168G>A" "" "" "" "TCAP(NM_003673.3):c.310G>A (p.E104K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39665915G>A" "" "VUS" "" "0000561229" "0" "30" "17" "37822171" "37822171" "subst" "0.000498774" "02330" "TCAP_000069" "g.37822171G>C" "" "" "" "TCAP(NM_003673.3):c.313G>C (p.E105Q, p.(Glu105Gln)), TCAP(NM_003673.4):c.313G>C (p.E105Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39665918G>C" "" "likely benign" "" "0000561230" "0" "30" "17" "37822171" "37822171" "subst" "0.000498774" "01943" "TCAP_000069" "g.37822171G>C" "" "" "" "TCAP(NM_003673.3):c.313G>C (p.E105Q, p.(Glu105Gln)), TCAP(NM_003673.4):c.313G>C (p.E105Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39665918G>C" "" "likely benign" "" "0000561231" "0" "50" "17" "37822171" "37822171" "subst" "0.000498774" "01804" "TCAP_000069" "g.37822171G>C" "" "" "" "TCAP(NM_003673.3):c.313G>C (p.E105Q, p.(Glu105Gln)), TCAP(NM_003673.4):c.313G>C (p.E105Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39665918G>C" "" "VUS" "" "0000561232" "0" "30" "17" "37822171" "37822171" "subst" "0.000498774" "02325" "TCAP_000069" "g.37822171G>C" "" "" "" "TCAP(NM_003673.3):c.313G>C (p.E105Q, p.(Glu105Gln)), TCAP(NM_003673.4):c.313G>C (p.E105Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39665918G>C" "" "likely benign" "" "0000561233" "0" "30" "17" "37822171" "37822171" "subst" "0.000498774" "02326" "TCAP_000069" "g.37822171G>C" "" "" "" "TCAP(NM_003673.3):c.313G>C (p.E105Q, p.(Glu105Gln)), TCAP(NM_003673.4):c.313G>C (p.E105Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39665918G>C" "" "likely benign" "" "0000561234" "0" "30" "17" "37822195" "37822195" "subst" "0.000146858" "02325" "TCAP_000058" "g.37822195C>T" "" "" "" "TCAP(NM_003673.3):c.337C>T (p.L113F), TCAP(NM_003673.4):c.337C>T (p.L113F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39665942C>T" "" "likely benign" "" "0000561235" "0" "30" "17" "37822195" "37822195" "subst" "0.000146858" "02326" "TCAP_000058" "g.37822195C>T" "" "" "" "TCAP(NM_003673.3):c.337C>T (p.L113F), TCAP(NM_003673.4):c.337C>T (p.L113F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39665942C>T" "" "likely benign" "" "0000561236" "0" "50" "17" "37822244" "37822244" "subst" "0" "02327" "STARD3_000011" "g.37822244A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39665991A>G" "" "VUS" "" "0000561237" "0" "50" "17" "37822246" "37822246" "subst" "6.94053E-5" "02330" "TCAP_000072" "g.37822246C>T" "" "" "" "TCAP(NM_003673.4):c.388C>T (p.R130C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39665993C>T" "" "VUS" "" "0000561238" "0" "50" "17" "37822299" "37822299" "subst" "0" "02325" "STARD3_000012" "g.37822299C>G" "" "" "" "TCAP(NM_003673.4):c.441C>G (p.S147R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39666046C>G" "" "VUS" "" "0000561239" "0" "30" "17" "37822317" "37822317" "subst" "0" "02327" "STARD3_000013" "g.37822317T>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39666064T>G" "" "likely benign" "" "0000561240" "0" "50" "17" "37822330" "37822330" "subst" "0" "02325" "TCAP_000079" "g.37822330C>T" "" "" "" "TCAP(NM_003673.4):c.472C>T (p.R158C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39666077C>T" "" "VUS" "" "0000561241" "0" "30" "17" "37822438" "37822438" "subst" "0" "02327" "TCAP_000027" "g.37822438G>T" "" "" "" "TCAP(NM_003673.3):c.*76G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39666185G>T" "" "likely benign" "" "0000561242" "0" "10" "17" "37822440" "37822440" "subst" "0" "02327" "PGAP3_000023" "g.37822440T>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39666187T>G" "" "benign" "" "0000561243" "0" "30" "17" "37822561" "37822561" "subst" "0" "02327" "TCAP_000015" "g.37822561G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39666308G>T" "" "likely benign" "" "0000561244" "0" "30" "17" "37822739" "37822739" "subst" "0" "02327" "TCAP_000021" "g.37822739G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39666486G>C" "" "likely benign" "" "0000561245" "0" "10" "17" "37822757" "37822757" "subst" "0" "02327" "PGAP3_000024" "g.37822757C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39666504C>A" "" "benign" "" "0000616483" "0" "30" "17" "37821644" "37821644" "subst" "0.000251928" "01943" "TCAP_000038" "g.37821644C>T" "" "" "" "TCAP(NM_003673.3):c.32C>T (p.S11L), TCAP(NM_003673.4):c.32C>T (p.S11L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39665391C>T" "" "likely benign" "" "0000616484" "0" "30" "17" "37821644" "37821644" "subst" "0.000251928" "02325" "TCAP_000038" "g.37821644C>T" "" "" "" "TCAP(NM_003673.3):c.32C>T (p.S11L), TCAP(NM_003673.4):c.32C>T (p.S11L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39665391C>T" "" "likely benign" "" "0000616485" "0" "30" "17" "37821649" "37821651" "del" "0" "02327" "TCAP_000010" "g.37821649_37821651del" "" "" "" "TCAP(NM_003673.3):c.37_39del (p.(Glu13del)), TCAP(NM_003673.3):c.37_39delGAG (p.E13del), TCAP(NM_003673.4):c.37_39delGAG (p.E13del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39665396_39665398del" "" "likely benign" "" "0000616486" "0" "30" "17" "37821971" "37821971" "subst" "0.000114673" "02327" "TCAP_000067" "g.37821971G>T" "" "" "" "TCAP(NM_003673.3):c.113G>T (p.C38F), TCAP(NM_003673.4):c.113G>T (p.C38F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39665718G>T" "" "likely benign" "" "0000616487" "0" "30" "17" "37822050" "37822050" "subst" "2.99125E-5" "02327" "STARD3_000014" "g.37822050G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39665797G>A" "" "likely benign" "" "0000616488" "0" "50" "17" "37822067" "37822067" "subst" "2.55957E-5" "02327" "TCAP_000053" "g.37822067G>A" "" "" "" "TCAP(NM_003673.4):c.209G>A (p.(Arg70Gln), p.R70Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39665814G>A" "" "VUS" "" "0000616490" "0" "10" "17" "37822171" "37822171" "subst" "0.000498774" "02327" "TCAP_000069" "g.37822171G>C" "" "" "" "TCAP(NM_003673.3):c.313G>C (p.E105Q, p.(Glu105Gln)), TCAP(NM_003673.4):c.313G>C (p.E105Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39665918G>C" "" "benign" "" "0000616492" "0" "50" "17" "37822195" "37822195" "subst" "0.000146858" "02327" "TCAP_000058" "g.37822195C>T" "" "" "" "TCAP(NM_003673.3):c.337C>T (p.L113F), TCAP(NM_003673.4):c.337C>T (p.L113F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39665942C>T" "" "VUS" "" "0000616493" "0" "30" "17" "37822281" "37822281" "subst" "8.23086E-6" "02327" "TCAP_000060" "g.37822281C>T" "" "" "" "TCAP(NM_003673.4):c.423C>T (p.P141=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39666028C>T" "" "likely benign" "" "0000616494" "0" "50" "17" "37822300" "37822300" "subst" "0" "02327" "STARD3_000015" "g.37822300A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39666047A>C" "" "VUS" "" "0000649550" "1" "10" "17" "37822049" "37822049" "subst" "0.000761081" "03575" "TCAP_000023" "g.37822049C>T" "2/2787 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "2 heterozygous, no homozygous; {DB:CLININrs45458802}" "Germline" "" "rs45458802" "0" "" "" "g.39665796C>T" "" "benign" "" "0000649551" "1" "50" "17" "37822066" "37822066" "subst" "4.27859E-5" "03575" "TCAP_000011" "g.37822066C>T" "5/2774 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "5 heterozygous; {DB:CLININrs775636212}" "Germline" "" "rs775636212" "0" "" "" "g.39665813C>T" "" "VUS" "" "0000649552" "1" "50" "17" "37822067" "37822067" "subst" "2.55957E-5" "03575" "TCAP_000053" "g.37822067G>A" "4/2781 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 4 heterozygous, no homozygous; {DB:CLININrs552865793}" "Germline" "" "rs552865793" "0" "" "" "g.39665814G>A" "" "VUS" "" "0000649553" "1" "30" "17" "37822117" "37822117" "subst" "3.79209E-5" "03575" "TCAP_000082" "g.37822117C>T" "2/2770 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "2 heterozygous, no homozygous; {DB:CLININrs777518512}" "Germline" "" "rs777518512" "0" "" "" "g.39665864C>T" "" "likely benign" "" "0000649554" "1" "50" "17" "37822316" "37822316" "subst" "0.00022662" "03575" "TCAP_000008" "g.37822316G>A" "3/2754 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "3 heterozygous, no homozygous; {DB:CLININrs149585781}" "Germline" "" "rs149585781" "0" "" "" "g.39666063G>A" "" "VUS" "" "0000653137" "1" "30" "17" "37822174" "37822174" "subst" "0.023843" "03575" "TCAP_000016" "g.37822174C>T" "1/2790 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs45578741}" "Germline" "" "rs45578741" "0" "" "" "g.39665921C>T" "" "likely benign" "" "0000658094" "0" "10" "17" "37821717" "37821717" "subst" "0" "02330" "STARD3_000016" "g.37821717G>A" "" "" "" "TCAP(NM_003673.4):c.105G>A (p.E35=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39665464G>A" "" "benign" "" "0000658095" "0" "50" "17" "37822195" "37822195" "subst" "0.000146858" "02330" "TCAP_000058" "g.37822195C>T" "" "" "" "TCAP(NM_003673.3):c.337C>T (p.L113F), TCAP(NM_003673.4):c.337C>T (p.L113F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.39665942C>T" "" "VUS" "" "0000663264" "3" "70" "17" "37822093" "37822093" "subst" "0" "01164" "TCAP_000083" "g.37822093C>T" "" "" "" "" "ACMG grading: PVS1,PM2" "Germline" "" "" "0" "" "" "g.39665840C>T" "" "likely pathogenic" "ACMG" "0000669391" "3" "50" "17" "37822066" "37822066" "subst" "4.27859E-5" "03575" "TCAP_000011" "g.37822066C>T" "1/2774 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 homozygous; {DB:CLININrs775636212}" "Germline" "" "rs775636212" "0" "" "" "g.39665813C>T" "" "VUS" "" "0000680838" "0" "30" "17" "37821672" "37821672" "subst" "0.000292583" "02327" "TCAP_000043" "g.37821672C>G" "" "" "" "TCAP(NM_003673.3):c.60C>G (p.A20=, p.(Ala20=)), TCAP(NM_003673.4):c.60C>G (p.A20=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000680839" "0" "50" "17" "37822319" "37822319" "subst" "2.51906E-5" "01943" "STARD3_000017" "g.37822319G>A" "" "" "" "TCAP(NM_003673.3):c.461G>A (p.R154H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000692325" "0" "50" "17" "37822246" "37822246" "subst" "6.94053E-5" "02325" "TCAP_000072" "g.37822246C>T" "" "" "" "TCAP(NM_003673.4):c.388C>T (p.R130C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000697742" "0" "70" "17" "37821687" "37821687" "subst" "2.03209E-5" "00006" "TCAP_000026" "g.37821687G>A" "2/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.39665434G>A" "" "likely pathogenic" "" "0000697743" "0" "70" "17" "37822015" "37822015" "subst" "0" "00006" "TCAP_000002" "g.37822015C>T" "2/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.39665762C>T" "" "likely pathogenic" "" "0000697744" "0" "70" "17" "37822111" "37822134" "del" "0" "00006" "TCAP_000054" "g.37822111_37822134del" "2/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.39665858_39665881del" "" "likely pathogenic" "" "0000701680" "0" "50" "17" "37821649" "37821651" "del" "0" "00006" "TCAP_000010" "g.37821649_37821651del" "2/590 cases" "{PMID:Walsh 2017:27532257}" "" "37_39delGAG" "" "Germline" "" "" "0" "" "" "g.39665396_39665398del" "" "VUS" "" "0000701681" "0" "50" "17" "37822127" "37822127" "subst" "0" "00006" "TCAP_000012" "g.37822127C>T" "1/590 cases" "{PMID:Walsh 2017:27532257}" "" "" "VUS favour pathogenic" "Germline" "" "" "0" "" "" "g.39665874C>T" "" "VUS" "" "0000701682" "0" "50" "17" "37822246" "37822246" "subst" "6.94053E-5" "00006" "TCAP_000072" "g.37822246C>T" "1/590 cases" "{PMID:Walsh 2017:27532257}" "" "" "VUS favour pathogenic" "Germline" "" "" "0" "" "" "g.39665993C>T" "" "VUS" "" "0000701683" "0" "50" "17" "37822330" "37822330" "subst" "0" "00006" "TCAP_000084" "g.37822330C>A" "2/590 cases" "{PMID:Walsh 2017:27532257}" "" "" "VUS favour pathogenic" "Germline" "" "" "0" "" "" "g.39666077C>A" "" "VUS" "" "0000701684" "0" "50" "17" "37822351" "37822351" "subst" "0" "00006" "TCAP_000085" "g.37822351C>G" "1/590 cases" "{PMID:Walsh 2017:27532257}" "" "" "VUS favour pathogenic" "Germline" "" "" "0" "" "" "g.39666098C>G" "" "VUS" "" "0000726322" "0" "50" "17" "37822066" "37822066" "subst" "4.27859E-5" "02330" "TCAP_000011" "g.37822066C>T" "" "" "" "TCAP(NM_003673.3):c.208C>T (p.R70W), TCAP(NM_003673.4):c.208C>T (p.R70W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000726323" "0" "50" "17" "37822168" "37822168" "subst" "0" "01943" "STARD3_000010" "g.37822168G>A" "" "" "" "TCAP(NM_003673.3):c.310G>A (p.E104K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000726324" "0" "50" "17" "37822171" "37822171" "subst" "0.000110384" "02329" "TCAP_000057" "g.37822171G>A" "" "" "" "TCAP(NM_003673.4):c.313G>A (p.E105K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000790017" "1" "70" "17" "37822330" "37822330" "subst" "0" "00006" "TCAP_000079" "g.37822330C>T" "" "{PMID:Nguyen 2021:34011823}" "" "" "ACMG PM2 PM5 PP2 PP3; no genotypes reported" "Germline" "" "" "0" "" "" "g.39666077C>T" "" "likely pathogenic" "" "0000807928" "0" "50" "17" "37821613" "37821613" "subst" "0" "01943" "PNMT_000002" "g.37821613A>G" "" "" "" "TCAP(NM_003673.3):c.1A>G (p.M1?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000807929" "0" "50" "17" "37822084" "37822084" "subst" "5.53003E-5" "02330" "TCAP_000030" "g.37822084C>T" "" "" "" "TCAP(NM_003673.3):c.226C>T (p.R76C), TCAP(NM_003673.4):c.226C>T (p.R76C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000819195" "3" "70" "17" "37821626" "37821627" "del" "0" "00006" "TCAP_000086" "g.37821626_37821627del" "" "{PMID:Chakravorty 2020:33250842}" "" "c.14_15delAG" "" "Germline" "" "" "0" "" "" "g.39665373_39665374del" "" "likely pathogenic (recessive)" "ACMG" "0000819196" "3" "70" "17" "37822102" "37822102" "subst" "0" "00006" "TCAP_000076" "g.37822102C>T" "" "{PMID:Chakravorty 2020:33250842}" "" "" "" "Germline" "" "" "0" "" "" "g.39665849C>T" "" "likely pathogenic (recessive)" "ACMG" "0000823972" "0" "50" "17" "37822012" "37822012" "subst" "4.19301E-6" "03501" "TCAP_000087" "g.37822012C>G" "" "{PMID:Karthikeyan 2024:39548682}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.39665759C>G" "" "VUS" "" "0000828407" "3" "90" "17" "37821638" "37821645" "dup" "0" "00006" "TCAP_000033" "g.37821638_37821645dup" "" "{PMID:Liang 2020:32576226}" "" "" "" "Germline" "" "" "0" "" "" "g.39665385_39665392dup" "" "pathogenic" "" "0000828408" "3" "90" "17" "37821638" "37821645" "dup" "0" "00006" "TCAP_000033" "g.37821638_37821645dup" "" "{PMID:Liang 2020:32576226}" "" "" "" "Germline" "" "" "0" "" "" "g.39665385_39665392dup" "" "pathogenic" "" "0000828409" "3" "90" "17" "37821638" "37821645" "dup" "0" "00006" "TCAP_000033" "g.37821638_37821645dup" "" "{PMID:Liang 2020:32576226}" "" "" "" "Germline" "" "" "0" "" "" "g.39665385_39665392dup" "" "pathogenic" "" "0000828410" "3" "90" "17" "37821638" "37821645" "dup" "0" "00006" "TCAP_000033" "g.37821638_37821645dup" "" "{PMID:Liang 2020:32576226}" "" "" "" "Germline" "" "" "0" "" "" "g.39665385_39665392dup" "" "pathogenic" "" "0000854855" "0" "10" "17" "37821672" "37821672" "subst" "0.000292583" "02330" "TCAP_000043" "g.37821672C>G" "" "" "" "TCAP(NM_003673.3):c.60C>G (p.A20=, p.(Ala20=)), TCAP(NM_003673.4):c.60C>G (p.A20=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000865185" "0" "30" "17" "37821672" "37821672" "subst" "0.000292583" "02326" "TCAP_000043" "g.37821672C>G" "" "" "" "TCAP(NM_003673.3):c.60C>G (p.A20=, p.(Ala20=)), TCAP(NM_003673.4):c.60C>G (p.A20=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000865186" "0" "50" "17" "37822006" "37822006" "subst" "0" "01804" "STARD3_000018" "g.37822006A>G" "" "" "" "TCAP(NM_003673.3):c.148A>G (p.(Thr50Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000865187" "0" "30" "17" "37822174" "37822174" "subst" "0.023843" "01804" "TCAP_000016" "g.37822174C>T" "" "" "" "TCAP(NM_003673.3):c.316C>T (p.R106C, p.(Arg106Cys)), TCAP(NM_003673.4):c.316C>T (p.R106C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000893509" "0" "50" "17" "37822046" "37822046" "subst" "1.28688E-5" "02326" "TCAP_000050" "g.37822046G>A" "" "" "" "TCAP(NM_003673.3):c.188G>A (p.R63H), TCAP(NM_003673.4):c.188G>A (p.R63H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000893510" "0" "30" "17" "37822128" "37822128" "subst" "5.84458E-5" "02326" "TCAP_000056" "g.37822128G>A" "" "" "" "TCAP(NM_003673.3):c.270G>A (p.P90=), TCAP(NM_003673.4):c.270G>A (p.P90=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000893511" "0" "30" "17" "37822158" "37822158" "subst" "8.21578E-6" "02326" "STARD3_000019" "g.37822158C>T" "" "" "" "TCAP(NM_003673.3):c.300C>T (p.G100=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000914798" "0" "30" "17" "37821672" "37821672" "subst" "0.000292583" "01804" "TCAP_000043" "g.37821672C>G" "" "" "" "TCAP(NM_003673.3):c.60C>G (p.A20=, p.(Ala20=)), TCAP(NM_003673.4):c.60C>G (p.A20=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000914799" "0" "50" "17" "37822118" "37822118" "subst" "4.19999E-6" "02326" "TCAP_000003" "g.37822118G>A" "" "" "" "TCAP(NM_003673.3):c.260G>A (p.R87Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000917066" "1" "90" "17" "37821638" "37821645" "dup" "0" "00006" "TCAP_000033" "g.37821638_37821645dup" "" "{PMID:Chen 2023:36463458}" "" "23_24insCGAGGTGT" "" "Germline" "" "" "0" "" "" "g.39665385_39665392dup" "" "pathogenic (recessive)" "" "0000917067" "3" "90" "17" "37821638" "37821645" "dup" "0" "00006" "TCAP_000033" "g.37821638_37821645dup" "" "{PMID:Chen 2023:36463458}" "" "26_33AGGTGTCG" "" "Germline" "" "" "0" "" "" "g.39665385_39665392dup" "" "pathogenic (recessive)" "" "0000917068" "3" "90" "17" "37821638" "37821645" "dup" "0" "00006" "TCAP_000033" "g.37821638_37821645dup" "" "{PMID:Chen 2023:36463458}" "" "26_33AGGTGTCG" "" "Germline" "" "" "0" "" "" "g.39665385_39665392dup" "" "pathogenic (recessive)" "" "0000917069" "3" "90" "17" "37821638" "37821645" "dup" "0" "00006" "TCAP_000033" "g.37821638_37821645dup" "" "{PMID:Chen 2023:36463458}" "" "26_33AGGTGTCG" "" "Germline" "" "" "0" "" "" "g.39665385_39665392dup" "" "pathogenic (recessive)" "" "0000917070" "2" "90" "17" "37821727" "37821727" "subst" "0" "00006" "TCAP_000088" "g.37821727G>A" "" "{PMID:Chen 2023:36463458}" "" "" "" "Germline" "" "" "0" "" "" "g.39665474G>A" "" "likely pathogenic (recessive)" "" "0000917106" "3" "70" "17" "37821702" "37821703" "del" "0" "00006" "TCAP_000075" "g.37821702_37821703del" "" "{PMID:Cavdarli 2023:36575883}" "" "90_91delGT" "ACMG PVS1 PM2" "Germline" "" "rs155560697" "0" "" "" "g.39665449_39665450del" "" "likely pathogenic (recessive)" "ACMG" "0000917712" "3" "90" "17" "37822023" "37822023" "dup" "0" "00006" "TCAP_000078" "g.37822023dup" "" "{PMID:Lv 2021:32761539}" "" "165_166insG" "" "Germline" "yes" "" "0" "" "" "g.39665770dup" "" "pathogenic (recessive)" "" "0000917713" "3" "90" "17" "37822023" "37822023" "dup" "0" "00006" "TCAP_000078" "g.37822023dup" "" "{PMID:Lv 2021:32761539}" "" "" "" "Germline" "" "" "0" "" "" "g.39665770dup" "" "pathogenic (recessive)" "" "0000917714" "3" "90" "17" "37822023" "37822023" "dup" "0" "00006" "TCAP_000078" "g.37822023dup" "" "{PMID:Lv 2021:32761539}" "" "165_166insG" "" "Germline" "yes" "" "0" "" "" "g.39665770dup" "" "pathogenic (recessive)" "" "0000917715" "1" "90" "17" "37821714" "37821714" "del" "0" "00006" "TCAP_000077" "g.37821714del" "" "{PMID:Lv 2021:32761539}" "" "100delC" "" "Germline" "" "" "0" "" "" "g.39665461del" "" "pathogenic (recessive)" "" "0000917716" "2" "70" "17" "37821727" "37821727" "subst" "0" "00006" "TCAP_000088" "g.37821727G>A" "" "{PMID:Lv 2021:32761539}" "" "" "" "Germline" "" "" "0" "" "" "g.39665474G>A" "" "likely pathogenic (recessive)" "" "0000930741" "0" "30" "17" "37817254" "37817254" "subst" "0.00155274" "01804" "STARD3_000020" "g.37817254G>A" "" "" "" "STARD3(NM_001165937.1):c.1055G>A (p.(Arg352His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000930742" "0" "10" "17" "37821953" "37821953" "subst" "0.000407284" "02326" "TCAP_000046" "g.37821953C>G" "" "" "" "TCAP(NM_003673.3):c.111-16C>G, TCAP(NM_003673.4):c.111-16C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000936111" "3" "70" "17" "37821702" "37821703" "del" "0" "00006" "TCAP_000075" "g.37821702_37821703del" "" "{PMID:Cavdarli 2023:36575883}" "" "c.90_91delGT" "ACMG PVS1 PM2" "Germline" "" "rs1555606976" "0" "" "" "g.39665449_39665450del" "" "likely pathogenic (recessive)" "ACMG" "0000946202" "0" "50" "17" "37822066" "37822066" "subst" "4.27859E-5" "00006" "TCAP_000011" "g.37822066C>T" "" "{PMID:Westra 2019:31127727}" "" "" "not present in second cousin with long QT" "Germline/De novo (untested)" "" "" "0" "" "" "g.39665813C>T" "" "VUS" "" "0000968844" "0" "30" "17" "37821644" "37821644" "subst" "0.000251928" "02326" "TCAP_000038" "g.37821644C>T" "" "" "" "TCAP(NM_003673.3):c.32C>T (p.S11L), TCAP(NM_003673.4):c.32C>T (p.S11L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000968845" "0" "50" "17" "37822175" "37822175" "subst" "4.08497E-5" "02330" "STARD3_000021" "g.37822175G>A" "" "" "" "TCAP(NM_003673.4):c.317G>A (p.R106H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000982452" "0" "50" "17" "37822067" "37822067" "subst" "2.55957E-5" "01804" "TCAP_000053" "g.37822067G>A" "" "" "" "TCAP(NM_003673.4):c.209G>A (p.(Arg70Gln), p.R70Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001003164" "0" "10" "17" "37821714" "37821714" "subst" "0" "02330" "STARD3_000022" "g.37821714C>T" "" "" "" "TCAP(NM_003673.4):c.102C>T (p.P34=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001003165" "0" "50" "17" "37822279" "37822279" "subst" "2.87848E-5" "02326" "TCAP_000025" "g.37822279C>G" "" "" "" "TCAP(NM_003673.3):c.421C>G (p.P141A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001026872" "0" "50" "17" "37822330" "37822330" "subst" "0" "02330" "TCAP_000079" "g.37822330C>T" "" "" "" "TCAP(NM_003673.4):c.472C>T (p.R158C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001041802" "0" "50" "17" "37822342" "37822342" "del" "0" "02330" "STARD3_000023" "g.37822342del" "" "" "" "TCAP(NM_003673.4):c.484delC (p.Q162Rfs*26)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001046619" "0" "30" "17" "37821971" "37821971" "subst" "0.000114673" "02326" "TCAP_000067" "g.37821971G>T" "" "" "" "TCAP(NM_003673.3):c.113G>T (p.C38F), TCAP(NM_003673.4):c.113G>T (p.C38F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes TCAP ## Count = 276 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000095190" "00020870" "50" "4" "0" "4" "0" "c.4G>A" "r.(?)" "p.(Ala2Thr)" "1" "0000095387" "00020870" "50" "37" "0" "39" "0" "c.37_39del" "r.(?)" "p.(Glu13del)" "1" "0000096494" "00020870" "50" "316" "0" "316" "0" "c.316C>T" "r.(?)" "p.(Arg106Cys)" "2" "0000096520" "00020870" "50" "316" "0" "316" "0" "c.316C>T" "r.(?)" "p.(Arg106Cys)" "2" "0000247422" "00020870" "10" "453" "0" "453" "0" "c.453A>C" "r.(?)" "p.(Ala151=)" "" "0000247468" "00020870" "30" "-13" "0" "-13" "0" "c.-13A>G" "r.(?)" "p.(=)" "" "0000247836" "00020870" "10" "453" "0" "453" "0" "c.453A>C" "r.(?)" "p.(Ala151=)" "" "0000249594" "00020870" "70" "474" "0" "487" "0" "c.474_487dup" "r.(?)" "p.(Glu163AlafsTer30)" "" "0000250618" "00020870" "10" "453" "0" "453" "0" "c.453A>C" "r.(?)" "p.(Ala151=)" "" "0000251963" "00020870" "30" "158" "0" "158" "0" "c.158A>G" "r.(?)" "p.(Gln53Arg)" "" "0000252970" "00020870" "10" "453" "0" "453" "0" "c.453A>C" "r.(?)" "p.(Ala151=)" "" "0000309082" "00020870" "10" "110" "15" "110" "15" "c.110+15G>C" "r.(=)" "p.(=)" "" "0000309083" "00020870" "10" "186" "0" "186" "0" "c.186G>A" "r.(?)" "p.(Gln62=)" "" "0000309084" "00020870" "50" "188" "0" "188" "0" "c.188G>A" "r.(?)" "p.(Arg63His)" "" "0000309085" "00020870" "10" "191" "0" "191" "0" "c.191C>T" "r.(?)" "p.(Ser64Leu)" "" "0000309086" "00020870" "10" "267" "0" "267" "0" "c.267G>A" "r.(?)" "p.(Leu89=)" "" "0000309087" "00020870" "10" "270" "0" "270" "0" "c.270G>A" "r.(?)" "p.(Pro90=)" "" "0000309088" "00020870" "50" "313" "0" "313" "0" "c.313G>A" "r.(?)" "p.(Glu105Lys)" "" "0000309089" "00020870" "10" "316" "0" "316" "0" "c.316C>T" "r.(?)" "p.(Arg106Cys)" "" "0000309090" "00020870" "10" "32" "0" "32" "0" "c.32C>T" "r.(?)" "p.(Ser11Leu)" "" "0000309091" "00020870" "30" "37" "0" "39" "0" "c.37_39del" "r.(?)" "p.(Glu13del)" "" "0000309092" "00020870" "50" "389" "0" "389" "0" "c.389G>A" "r.(?)" "p.(Arg130His)" "" "0000309093" "00020870" "10" "423" "0" "423" "0" "c.423C>T" "r.(?)" "p.(Pro141=)" "" "0000309094" "00020870" "50" "448" "0" "448" "0" "c.448G>A" "r.(?)" "p.(Gly150Ser)" "" "0000309095" "00020870" "50" "457" "0" "457" "0" "c.457C>T" "r.(?)" "p.(Arg153Cys)" "" "0000309096" "00020870" "50" "59" "0" "59" "0" "c.59C>T" "r.(?)" "p.(Ala20Val)" "" "0000311753" "00020870" "30" "110" "10" "110" "10" "c.110+10G>C" "r.(=)" "p.(=)" "" "0000311754" "00020870" "30" "111" "-16" "111" "-16" "c.111-16C>G" "r.(=)" "p.(=)" "" "0000311755" "00020870" "50" "209" "0" "209" "0" "c.209G>A" "r.(?)" "p.(Arg70Gln)" "" "0000311756" "00020870" "30" "316" "0" "316" "0" "c.316C>T" "r.(?)" "p.(Arg106Cys)" "" "0000311757" "00020870" "30" "39" "0" "39" "0" "c.39G>A" "r.(?)" "p.(Glu13=)" "" "0000311759" "00020870" "30" "60" "0" "60" "0" "c.60C>G" "r.(?)" "p.(Ala20=)" "" "0000314452" "00020870" "30" "580" "0" "580" "0" "c.*76G>T" "r.(=)" "p.(=)" "" "0000314453" "00020870" "10" "191" "0" "191" "0" "c.191C>T" "r.(?)" "p.(Ser64Leu)" "" "0000314454" "00020870" "50" "208" "0" "208" "0" "c.208C>T" "r.(?)" "p.(Arg70Trp)" "" "0000314455" "00020870" "70" "253" "0" "276" "0" "c.253_276del" "r.(?)" "p.(Tyr85_Pro92del)" "" "0000314456" "00020870" "30" "316" "0" "316" "0" "c.316C>T" "r.(?)" "p.(Arg106Cys)" "" "0000314457" "00020870" "30" "37" "0" "39" "0" "c.37_39del" "r.(?)" "p.(Glu13del)" "" "0000314458" "00020870" "50" "52" "0" "52" "0" "c.52C>T" "r.(?)" "p.(Arg18Trp)" "" "0000316321" "00020870" "50" "188" "0" "188" "0" "c.188G>A" "r.(?)" "p.(Arg63His)" "" "0000316322" "00020870" "10" "191" "0" "191" "0" "c.191C>T" "r.(?)" "p.(Ser64Leu)" "" "0000316323" "00020870" "30" "316" "0" "316" "0" "c.316C>T" "r.(?)" "p.(Arg106Cys)" "" "0000316324" "00020870" "50" "337" "0" "337" "0" "c.337C>T" "r.(?)" "p.(Leu113Phe)" "" "0000316325" "00020870" "10" "456" "0" "456" "0" "c.456T>C" "r.(?)" "p.(Leu152=)" "" "0000339931" "00020870" "10" "453" "0" "453" "0" "c.453A>C" "r.(?)" "p.(Ala151=)" "" "0000398563" "00020870" "90" "360" "0" "361" "0" "c.360_361del" "r.(?)" "p.(Glu120Aspfs*15)" "" "0000446729" "00020870" "90" "157" "0" "157" "0" "c.157C>T" "r.(?)" "p.(Gln53*)" "2" "0000446731" "00020870" "90" "157" "0" "157" "0" "c.157C>T" "r.157c>u" "p.Gln53*" "2" "0000446733" "00020870" "90" "110" "0" "110" "1" "c.110_110+1del" "r.spl" "p.?" "1" "0000446734" "00020870" "90" "157" "0" "157" "0" "c.157C>T" "r.157c>u" "p.Gln53*" "2" "0000446736" "00020870" "10" "156" "0" "156" "0" "c.156C>T" "r.(?)" "p.(=)" "2" "0000446737" "00020870" "50" "171" "0" "171" "0" "c.171C>G" "r.(?)" "p.(Cys57Trp)" "2" "0000446739" "00020870" "90" "208" "0" "208" "0" "c.208C>T" "r.(?)" "p.(Arg70Trp)" "2" "0000446741" "00020870" "10" "225" "0" "225" "0" "c.225C>A" "r.(?)" "p.(=)" "2" "0000446742" "00020870" "50" "260" "0" "260" "0" "c.260G>A" "r.(?)" "p.(Arg87Gln)" "2" "0000446743" "00020870" "90" "269" "0" "269" "0" "c.269C>T" "r.(?)" "p.(Pro90Leu)" "2" "0000446745" "00020870" "50" "37" "0" "39" "0" "c.37_39del" "r.(?)" "p.(Glu13del)" "1" "0000446746" "00020870" "50" "37" "0" "39" "0" "c.37_39del" "r.(?)" "p.(Glu13del)" "1" "0000446747" "00020870" "10" "37" "0" "39" "0" "c.37_39del" "r.(?)" "p.(Glu13del)" "1" "0000446748" "00020870" "90" "394" "0" "394" "0" "c.394G>C" "r.(?)" "p.(Glu132Gln)" "2" "0000446749" "00020870" "90" "410" "0" "410" "0" "c.410C>T" "r.(?)" "p.(Thr137Ile)" "2" "0000446750" "00020870" "10" "453" "0" "453" "0" "c.453A>C" "r.(?)" "p.(=)" "2" "0000446751" "00020870" "90" "458" "0" "458" "0" "c.458G>A" "r.(?)" "p.(Arg153His)" "2" "0000446752" "00020870" "50" "37" "0" "39" "0" "c.37_39del" "r.(?)" "p.(Glu13del)" "1" "0000446753" "00020870" "10" "37" "0" "39" "0" "c.37_39del" "r.(?)" "p.(Glu13del)" "1" "0000446754" "00020870" "10" "37" "0" "39" "0" "c.37_39del" "r.(?)" "p.(Glu13del)" "1" "0000446755" "00020870" "90" "110" "0" "110" "1" "c.110_110+1del" "r.spl" "p.(Gly37Leufs*5)" "1" "0000446756" "00020870" "90" "226" "0" "226" "0" "c.226C>T" "r.(?)" "p.(Arg76Cys)" "2" "0000446757" "00020870" "90" "75" "0" "75" "0" "c.75G>A" "r.(?)" "p.(Trp25*)" "1" "0000446758" "00020870" "90" "75" "0" "75" "0" "c.75G>A" "r.(?)" "p.(Trp25*)" "1" "0000446759" "00020870" "70" "316" "0" "316" "0" "c.316C>T" "r.(?)" "p.(Arg106Cys)" "2" "0000446760" "00020870" "30" "580" "0" "580" "0" "c.*76G>T" "r.(?)" "p.(=)" "2" "0000446761" "00020870" "90" "37" "0" "39" "0" "c.37_39del" "r.(?)" "p.(Glu13del)" "1" "0000446762" "00020870" "70" "53" "0" "53" "0" "c.53G>A" "r.(?)" "p.(Arg18Gln)" "1" "0000446763" "00020870" "70" "145" "0" "145" "0" "c.145G>A" "r.(?)" "p.(Glu49Lys)" "2" "0000446764" "00020870" "30" "421" "0" "421" "0" "c.421C>G" "r.(?)" "p.(Pro141Ala)" "2" "0000446765" "00020870" "90" "410" "0" "410" "0" "c.410C>T" "r.(?)" "p.(Thr137Ile)" "2" "0000446766" "00020870" "90" "458" "0" "458" "0" "c.458G>A" "r.(?)" "p.(Arg153His)" "2" "0000446767" "00020870" "90" "458" "0" "458" "0" "c.458G>A" "r.(?)" "p.(Arg153His)" "2" "0000446768" "00020870" "90" "458" "0" "458" "0" "c.458G>A" "r.(?)" "p.(Arg153His)" "2" "0000446769" "00020870" "50" "37" "0" "39" "0" "c.37_39del" "r.(?)" "p.(Glu13del)" "1" "0000446770" "00020870" "10" "110" "48" "110" "48" "c.110+48C>T" "r.(?)" "p.(=)" "1i" "0000446771" "00020870" "50" "258" "0" "258" "0" "c.258G>A" "r.(?)" "p.(=)" "2" "0000446772" "00020870" "50" "316" "0" "316" "0" "c.316C>T" "r.(?)" "p.(Arg106Cys)" "2" "0000446773" "00020870" "10" "453" "0" "453" "0" "c.453A>C" "r.(?)" "p.(=)" "2" "0000446774" "00020870" "70" "32" "0" "32" "0" "c.32C>A" "r.(?)" "p.(Ser11*)" "1" "0000446776" "00020870" "90" "26" "0" "33" "0" "c.26_33dup" "r.(?)" "p.(Glu12Argfs*20)" "1" "0000446778" "00020870" "90" "255" "0" "255" "0" "c.255C>A" "r.(?)" "p.(Tyr85*)" "2" "0000446780" "00020870" "10" "-178" "0" "-178" "0" "c.-178G>T" "r.(?)" "p.(=)" "1" "0000446781" "00020870" "10" "899" "0" "899" "0" "c.*395C>T" "r.(?)" "p.(=)" "2" "0000446782" "00020870" "10" "703" "0" "703" "0" "c.*199G>T" "r.(?)" "p.(=)" "2" "0000446783" "00020870" "10" "881" "0" "881" "0" "c.*377G>C" "r.(?)" "p.(=)" "2" "0000446784" "00020870" "10" "447" "0" "447" "0" "c.447C>T" "r.(?)" "p.(=)" "2" "0000446785" "00020870" "10" "191" "0" "191" "0" "c.191C>T" "r.(?)" "p.(Ser64Leu)" "2" "0000466654" "00020870" "50" "460" "0" "460" "0" "c.460C>T" "r.(?)" "p.(Arg154Cys)" "2" "0000466655" "00020870" "50" "37" "0" "39" "0" "c.37_39del" "r.(?)" "p.(Glu13del)" "1" "0000466656" "00020870" "50" "97" "0" "97" "0" "c.97C>T" "r.(?)" "p.(Arg33Trp)" "1" "0000466657" "00020870" "50" "208" "0" "208" "0" "c.208C>T" "r.(?)" "p.(Arg70Trp)" "2" "0000466658" "00020870" "50" "353" "0" "353" "0" "c.353C>T" "r.(?)" "p.(Ala118Val)" "2" "0000466659" "00020870" "50" "209" "0" "209" "0" "c.209G>A" "r.(?)" "p.(Arg70Gln)" "2" "0000466660" "00020870" "50" "113" "0" "113" "0" "c.113G>T" "r.(?)" "p.(Cys38Phe)" "2" "0000466661" "00020870" "50" "313" "0" "313" "0" "c.313G>C" "r.spl" "p.(Glu105Gln)" "2" "0000466662" "00020870" "50" "353" "0" "353" "0" "c.353C>T" "r.(?)" "p.(Ala118Val)" "2" "0000466663" "00020870" "50" "353" "0" "353" "0" "c.353C>T" "r.(?)" "p.(Ala118Val)" "2" "0000466664" "00020870" "50" "388" "0" "388" "0" "c.388C>T" "r.(?)" "p.(Arg130Cys)" "2" "0000466665" "00020870" "50" "313" "0" "313" "0" "c.313G>C" "r.(?)" "p.(Glu105Gln)" "2" "0000466666" "00020870" "50" "270" "0" "270" "0" "c.270G>A" "r.(?)" "p.(=)" "2" "0000466667" "00020870" "50" "97" "0" "97" "0" "c.97C>T" "r.(?)" "p.(Arg33Trp)" "1" "0000466668" "00020870" "90" "66" "0" "66" "0" "c.66G>A" "r.(?)" "p.(Trp22*)" "1" "0000466669" "00020870" "50" "353" "0" "353" "0" "c.353C>T" "r.(?)" "p.(Ala118Val)" "2" "0000466670" "00020870" "90" "43" "0" "49" "0" "c.43_49dup" "r.(?)" "p.(Arg17Leufs*2)" "1" "0000466671" "00020870" "50" "353" "0" "353" "0" "c.353C>T" "r.(?)" "p.(Ala118Val)" "2" "0000466672" "00020870" "50" "240" "0" "240" "0" "c.240G>T" "r.(?)" "p.(Glu80Asp)" "2" "0000466673" "00020870" "50" "454" "0" "454" "0" "c.454C>G" "r.(?)" "p.(Leu152Val)" "2" "0000466674" "00020870" "50" "313" "0" "313" "0" "c.313G>C" "r.(?)" "p.(Glu105Gln)" "2" "0000466675" "00020870" "50" "52" "0" "52" "0" "c.52C>T" "r.(?)" "p.(Arg18Trp)" "1" "0000466676" "00020870" "50" "113" "0" "113" "0" "c.113G>T" "r.(?)" "p.(Cys38Phe)" "2" "0000466677" "00020870" "50" "209" "0" "209" "0" "c.209G>A" "r.(?)" "p.(Arg70Gln)" "2" "0000466678" "00020870" "50" "334" "0" "334" "0" "c.334C>T" "r.(?)" "p.(Gln112*)" "2" "0000466679" "00020870" "50" "313" "0" "313" "0" "c.313G>A" "r.(?)" "p.(Glu105Lys)" "2" "0000466680" "00020870" "50" "353" "0" "353" "0" "c.353C>T" "r.(?)" "p.(Ala118Val)" "2" "0000466681" "00020870" "50" "353" "0" "353" "0" "c.353C>T" "r.(?)" "p.(Ala118Val)" "2" "0000466682" "00020870" "50" "388" "0" "388" "0" "c.388C>T" "r.(?)" "p.(Arg130Cys)" "2" "0000466683" "00020870" "50" "353" "0" "353" "0" "c.353C>T" "r.(?)" "p.(Ala118Val)" "2" "0000466684" "00020870" "50" "313" "0" "313" "0" "c.313G>C" "r.(?)" "p.(Glu105Gln)" "2" "0000466685" "00020870" "50" "353" "0" "353" "0" "c.353C>T" "r.(?)" "p.(Ala118Val)" "2" "0000466686" "00020870" "50" "313" "0" "313" "0" "c.313G>C" "r.(?)" "p.(Glu105Gln)" "2" "0000466687" "00020870" "50" "313" "0" "313" "0" "c.313G>C" "r.(?)" "p.(Glu105Gln)" "2" "0000466688" "00020870" "50" "113" "0" "113" "0" "c.113G>T" "r.(?)" "p.(Cys38Phe)" "2" "0000466689" "00020870" "50" "209" "0" "209" "0" "c.209G>A" "r.(?)" "p.(Arg70Gln)" "2" "0000470395" "00020870" "10" "-178" "0" "-178" "0" "c.-178G>T" "r.(=)" "p.(=)" "" "0000470396" "00020870" "10" "453" "0" "453" "0" "c.453A>C" "r.(=)" "p.(=)" "" "0000470397" "00020870" "90" "90" "0" "91" "0" "c.90_91del" "r.(?)" "p.(Ser31Hisfs*11)" "" "0000470398" "00020870" "90" "90" "0" "91" "0" "c.90_91del" "r.(?)" "p.(Ser31Hisfs*11)" "" "0000470402" "00020870" "90" "75" "0" "75" "0" "c.75G>A" "r.(?)" "p.(Trp25*)" "" "0000470414" "00020870" "50" "316" "0" "316" "0" "c.316C>T" "r.(?)" "p.(Arg106Cys)" "" "0000470415" "00020870" "90" "244" "0" "244" "0" "c.244C>T" "r.(?)" "p.(Gln82*)" "" "0000470416" "00020870" "90" "102" "0" "102" "0" "c.102del" "r.(?)" "p.(Glu35Argfs*33)" "" "0000470417" "00020870" "90" "165" "0" "165" "0" "c.165dup" "r.(?)" "p.(Gln56Alafs*52)" "" "0000470418" "00020870" "70" "37" "0" "39" "0" "c.37_39del" "r.(?)" "p.(Glu13del)" "" "0000470419" "00020870" "50" "313" "0" "313" "0" "c.313G>A" "r.(?)" "p.(Glu105Lys)" "" "0000470420" "00020870" "50" "316" "0" "316" "0" "c.316C>T" "r.(?)" "p.(Arg106Cys)" "" "0000470421" "00020870" "50" "353" "0" "353" "0" "c.353C>T" "r.(?)" "p.(Ala118Val)" "" "0000470422" "00020870" "70" "472" "0" "472" "0" "c.472C>T" "r.(?)" "p.(Arg158Cys)" "" "0000470423" "00020870" "90" "157" "0" "157" "0" "c.157C>T" "r.(?)" "p.(Gln53*)" "" "0000470424" "00020870" "90" "172" "0" "172" "0" "c.172C>T" "r.(?)" "p.(Gln58*)" "" "0000470425" "00020870" "90" "157" "0" "157" "0" "c.157C>T" "r.(?)" "p.(Gln53*)" "2" "0000470426" "00020870" "90" "26" "0" "33" "0" "c.26_33dup" "r.(?)" "p.(Glu12Argfs*20)" "" "0000470427" "00020870" "90" "26" "0" "33" "0" "c.26_33dup" "r.(?)" "p.(Glu12Argfs*20)" "" "0000470428" "00020870" "90" "26" "0" "33" "0" "c.26_33dup" "r.(?)" "p.(Glu12Argfs*20)" "" "0000470429" "00020870" "90" "26" "0" "33" "0" "c.26_33dup" "r.(?)" "p.(Glu12Argfs*20)" "" "0000470430" "00020870" "90" "45" "0" "46" "0" "c.45_46del" "r.(?)" "p.(Cys15*)" "" "0000470431" "00020870" "90" "157" "0" "157" "0" "c.157C>T" "r.(?)" "p.(Gln53*)" "" "0000470506" "00020870" "90" "75" "0" "75" "0" "c.75G>A" "r.(?)" "p.(Trp25*)" "" "0000470507" "00020870" "90" "75" "0" "75" "0" "c.75G>A" "r.(?)" "p.(Trp25*)" "" "0000470508" "00020870" "90" "75" "0" "75" "0" "c.75G>A" "r.(?)" "p.(Trp25*)" "" "0000470509" "00020870" "90" "75" "0" "75" "0" "c.75G>A" "r.(?)" "p.(Trp25*)" "" "0000470510" "00020870" "90" "75" "0" "75" "0" "c.75G>A" "r.(?)" "p.(Trp25*)" "" "0000470511" "00020870" "90" "75" "0" "75" "0" "c.75G>A" "r.(?)" "p.(Trp25*)" "" "0000470512" "00020870" "90" "75" "0" "75" "0" "c.75G>A" "r.(?)" "p.(Trp25*)" "" "0000470513" "00020870" "90" "75" "0" "75" "0" "c.75G>A" "r.(?)" "p.(Trp25*)" "" "0000470514" "00020870" "90" "75" "0" "75" "0" "c.75G>A" "r.(?)" "p.(Trp25*)" "" "0000470515" "00020870" "90" "75" "0" "75" "0" "c.75G>A" "r.(?)" "p.(Trp25*)" "" "0000470516" "00020870" "90" "75" "0" "75" "0" "c.75G>A" "r.(?)" "p.(Trp25*)" "" "0000561210" "00020870" "30" "-1437" "0" "-1437" "0" "c.-1437C>T" "r.(?)" "p.(=)" "" "0000561211" "00020870" "30" "-632" "0" "-632" "0" "c.-632A>G" "r.(?)" "p.(=)" "" "0000561212" "00020870" "50" "-443" "0" "-443" "0" "c.-443C>T" "r.(?)" "p.(=)" "" "0000561213" "00020870" "50" "37" "0" "39" "0" "c.37_39del" "r.(?)" "p.(Glu13del)" "" "0000561214" "00020870" "30" "37" "0" "39" "0" "c.37_39del" "r.(?)" "p.(Glu13del)" "" "0000561215" "00020870" "30" "37" "0" "39" "0" "c.37_39del" "r.(?)" "p.(Glu13del)" "" "0000561216" "00020870" "30" "60" "0" "60" "0" "c.60C>G" "r.(?)" "p.(Ala20=)" "" "0000561217" "00020870" "30" "87" "0" "87" "0" "c.87A>C" "r.(?)" "p.(Thr29=)" "" "0000561218" "00020870" "10" "110" "15" "110" "15" "c.110+15G>T" "r.(=)" "p.(=)" "" "0000561219" "00020870" "10" "110" "48" "110" "48" "c.110+48C>T" "r.(=)" "p.(=)" "" "0000561220" "00020870" "30" "111" "-16" "111" "-16" "c.111-16C>G" "r.(=)" "p.(=)" "" "0000561221" "00020870" "50" "113" "0" "113" "0" "c.113G>T" "r.(?)" "p.(Cys38Phe)" "" "0000561222" "00020870" "10" "132" "0" "132" "0" "c.132C>T" "r.(?)" "p.(Asp44=)" "" "0000561223" "00020870" "50" "161" "0" "161" "0" "c.161A>C" "r.(?)" "p.(Gln54Pro)" "" "0000561224" "00020870" "30" "188" "0" "188" "0" "c.188G>A" "r.(?)" "p.(Arg63His)" "" "0000561225" "00020870" "30" "208" "0" "208" "0" "c.208C>A" "r.(?)" "p.(Arg70=)" "" "0000561226" "00020870" "30" "208" "0" "208" "0" "c.208C>T" "r.(?)" "p.(Arg70Trp)" "" "0000561227" "00020870" "50" "226" "0" "226" "0" "c.226C>T" "r.(?)" "p.(Arg76Cys)" "" "0000561228" "00020870" "50" "310" "0" "310" "0" "c.310G>A" "r.(?)" "p.(Glu104Lys)" "" "0000561229" "00020870" "30" "313" "0" "313" "0" "c.313G>C" "r.(?)" "p.(Glu105Gln)" "" "0000561230" "00020870" "30" "313" "0" "313" "0" "c.313G>C" "r.(?)" "p.(Glu105Gln)" "" "0000561231" "00020870" "50" "313" "0" "313" "0" "c.313G>C" "r.(?)" "p.(Glu105Gln)" "" "0000561232" "00020870" "30" "313" "0" "313" "0" "c.313G>C" "r.(?)" "p.(Glu105Gln)" "" "0000561233" "00020870" "30" "313" "0" "313" "0" "c.313G>C" "r.(?)" "p.(Glu105Gln)" "" "0000561234" "00020870" "30" "337" "0" "337" "0" "c.337C>T" "r.(?)" "p.(Leu113Phe)" "" "0000561235" "00020870" "30" "337" "0" "337" "0" "c.337C>T" "r.(?)" "p.(Leu113Phe)" "" "0000561236" "00020870" "50" "386" "0" "386" "0" "c.386A>G" "r.(?)" "p.(Asp129Gly)" "" "0000561237" "00020870" "50" "388" "0" "388" "0" "c.388C>T" "r.(?)" "p.(Arg130Cys)" "" "0000561238" "00020870" "50" "441" "0" "441" "0" "c.441C>G" "r.(?)" "p.(Ser147Arg)" "" "0000561239" "00020870" "30" "459" "0" "459" "0" "c.459T>G" "r.(?)" "p.(Arg153=)" "" "0000561240" "00020870" "50" "472" "0" "472" "0" "c.472C>T" "r.(?)" "p.(Arg158Cys)" "" "0000561241" "00020870" "30" "580" "0" "580" "0" "c.*76G>T" "r.(=)" "p.(=)" "" "0000561242" "00020870" "10" "582" "0" "582" "0" "c.*78T>G" "r.(=)" "p.(=)" "" "0000561243" "00020870" "30" "703" "0" "703" "0" "c.*199G>T" "r.(=)" "p.(=)" "" "0000561244" "00020870" "30" "881" "0" "881" "0" "c.*377G>C" "r.(=)" "p.(=)" "" "0000561245" "00020870" "10" "899" "0" "899" "0" "c.*395C>A" "r.(=)" "p.(=)" "" "0000616483" "00020870" "30" "32" "0" "32" "0" "c.32C>T" "r.(?)" "p.(Ser11Leu)" "" "0000616484" "00020870" "30" "32" "0" "32" "0" "c.32C>T" "r.(?)" "p.(Ser11Leu)" "" "0000616485" "00020870" "30" "37" "0" "39" "0" "c.37_39del" "r.(?)" "p.(Glu13del)" "" "0000616486" "00020870" "30" "113" "0" "113" "0" "c.113G>T" "r.(?)" "p.(Cys38Phe)" "" "0000616487" "00020870" "30" "192" "0" "192" "0" "c.192G>A" "r.(?)" "p.(Ser64=)" "" "0000616488" "00020870" "50" "209" "0" "209" "0" "c.209G>A" "r.(?)" "p.(Arg70Gln)" "" "0000616490" "00020870" "10" "313" "0" "313" "0" "c.313G>C" "r.(?)" "p.(Glu105Gln)" "" "0000616492" "00020870" "50" "337" "0" "337" "0" "c.337C>T" "r.(?)" "p.(Leu113Phe)" "" "0000616493" "00020870" "30" "423" "0" "423" "0" "c.423C>T" "r.(?)" "p.(Pro141=)" "" "0000616494" "00020870" "50" "442" "0" "442" "0" "c.442A>C" "r.(?)" "p.(Lys148Gln)" "" "0000649550" "00020870" "10" "191" "0" "191" "0" "c.191C>T" "r.(?)" "p.(Ser64Leu)" "" "0000649551" "00020870" "50" "208" "0" "208" "0" "c.208C>T" "r.(?)" "p.(Arg70Trp)" "" "0000649552" "00020870" "50" "209" "0" "209" "0" "c.209G>A" "r.(?)" "p.(Arg70Gln)" "" "0000649553" "00020870" "30" "259" "0" "259" "0" "c.259C>T" "r.(?)" "p.(Arg87Trp)" "" "0000649554" "00020870" "50" "458" "0" "458" "0" "c.458G>A" "r.(?)" "p.(Arg153His)" "" "0000653137" "00020870" "30" "316" "0" "316" "0" "c.316C>T" "r.(?)" "p.(Arg106Cys)" "" "0000658094" "00020870" "10" "105" "0" "105" "0" "c.105G>A" "r.(?)" "p.(Glu35=)" "" "0000658095" "00020870" "50" "337" "0" "337" "0" "c.337C>T" "r.(?)" "p.(Leu113Phe)" "" "0000663264" "00020870" "70" "235" "0" "235" "0" "c.235C>T" "r.(?)" "p.(Gln79*)" "" "0000669391" "00020870" "50" "208" "0" "208" "0" "c.208C>T" "r.(?)" "p.(Arg70Trp)" "" "0000680838" "00020870" "30" "60" "0" "60" "0" "c.60C>G" "r.(?)" "p.(Ala20=)" "" "0000680839" "00020870" "50" "461" "0" "461" "0" "c.461G>A" "r.(?)" "p.(Arg154His)" "" "0000692325" "00020870" "50" "388" "0" "388" "0" "c.388C>T" "r.(?)" "p.(Arg130Cys)" "" "0000697742" "00020870" "70" "75" "0" "75" "0" "c.75G>A" "r.(?)" "p.(Trp25*)" "" "0000697743" "00020870" "70" "157" "0" "157" "0" "c.157C>T" "r.(?)" "p.(Gln53*)" "" "0000697744" "00020870" "70" "253" "0" "276" "0" "c.253_276del" "r.(?)" "p.(Tyr85_Pro92del)" "" "0000701680" "00020870" "50" "37" "0" "39" "0" "c.37_39del" "r.(?)" "p.(Glu13del)" "" "0000701681" "00020870" "50" "269" "0" "269" "0" "c.269C>T" "r.(?)" "p.(Pro90Leu)" "" "0000701682" "00020870" "50" "388" "0" "388" "0" "c.388C>T" "r.(?)" "p.(Arg130Cys)" "" "0000701683" "00020870" "50" "472" "0" "472" "0" "c.472C>A" "r.(?)" "p.(Arg158Ser)" "" "0000701684" "00020870" "50" "493" "0" "493" "0" "c.493C>G" "r.(?)" "p.(Gln165Glu)" "" "0000726322" "00020870" "50" "208" "0" "208" "0" "c.208C>T" "r.(?)" "p.(Arg70Trp)" "" "0000726323" "00020870" "50" "310" "0" "310" "0" "c.310G>A" "r.(?)" "p.(Glu104Lys)" "" "0000726324" "00020870" "50" "313" "0" "313" "0" "c.313G>A" "r.(?)" "p.(Glu105Lys)" "" "0000790017" "00020870" "70" "472" "0" "472" "0" "c.472C>T" "r.(?)" "p.(Arg158Cys)" "" "0000807928" "00020870" "50" "1" "0" "1" "0" "c.1A>G" "r.(?)" "p.(Met1?)" "" "0000807929" "00020870" "50" "226" "0" "226" "0" "c.226C>T" "r.(?)" "p.(Arg76Cys)" "" "0000819195" "00020870" "70" "14" "0" "15" "0" "c.14_15del" "r.(?)" "p.(Glu5AlafsTer11)" "" "0000819196" "00020870" "70" "244" "0" "244" "0" "c.244C>T" "r.(?)" "p.(Gln82Ter)" "" "0000823972" "00020870" "50" "154" "0" "154" "0" "c.154C>G" "r.(?)" "p.(His52Asp)" "2" "0000828407" "00020870" "90" "26" "0" "33" "0" "c.26_33dup" "r.(?)" "p.(Glu12ArgfsTer20)" "" "0000828408" "00020870" "90" "26" "0" "33" "0" "c.26_33dup" "r.(?)" "p.(Glu12ArgfsTer20)" "" "0000828409" "00020870" "90" "26" "0" "33" "0" "c.26_33dup" "r.(?)" "p.(Glu12ArgfsTer20)" "" "0000828410" "00020870" "90" "26" "0" "33" "0" "c.26_33dup" "r.(?)" "p.(Glu12ArgfsTer20)" "" "0000854855" "00020870" "10" "60" "0" "60" "0" "c.60C>G" "r.(?)" "p.(Ala20=)" "" "0000865185" "00020870" "30" "60" "0" "60" "0" "c.60C>G" "r.(?)" "p.(Ala20=)" "" "0000865186" "00020870" "50" "148" "0" "148" "0" "c.148A>G" "r.(?)" "p.(Thr50Ala)" "" "0000865187" "00020870" "30" "316" "0" "316" "0" "c.316C>T" "r.(?)" "p.(Arg106Cys)" "" "0000893509" "00020870" "50" "188" "0" "188" "0" "c.188G>A" "r.(?)" "p.(Arg63His)" "" "0000893510" "00020870" "30" "270" "0" "270" "0" "c.270G>A" "r.(?)" "p.(Pro90=)" "" "0000893511" "00020870" "30" "300" "0" "300" "0" "c.300C>T" "r.(?)" "p.(Gly100=)" "" "0000914798" "00020870" "30" "60" "0" "60" "0" "c.60C>G" "r.(?)" "p.(Ala20=)" "" "0000914799" "00020870" "50" "260" "0" "260" "0" "c.260G>A" "r.(?)" "p.(Arg87Gln)" "" "0000917066" "00020870" "90" "26" "0" "33" "0" "c.26_33dup" "r.(?)" "p.(Glu12ArgfsTer20)" "" "0000917067" "00020870" "90" "26" "0" "33" "0" "c.26_33dup" "r.(?)" "p.(Glu12ArgfsTer20)" "" "0000917068" "00020870" "90" "26" "0" "33" "0" "c.26_33dup" "r.(?)" "p.(Glu12ArgfsTer20)" "" "0000917069" "00020870" "90" "26" "0" "33" "0" "c.26_33dup" "r.(?)" "p.(Glu12ArgfsTer20)" "" "0000917070" "00020870" "90" "110" "5" "110" "5" "c.110+5G>A" "r.spl" "p.?" "" "0000917106" "00020870" "70" "90" "0" "91" "0" "c.90_91del" "r.(?)" "p.(Ser31HisfsTer11)" "" "0000917712" "00020870" "90" "165" "0" "165" "0" "c.165dup" "r.(?)" "p.(Gln56Alafs*52)" "" "0000917713" "00020870" "90" "165" "0" "165" "0" "c.165dup" "r.(?)" "p.(Gln56Alafs*52)" "" "0000917714" "00020870" "90" "165" "0" "165" "0" "c.165dup" "r.(?)" "p.(Gln56Alafs*52)" "" "0000917715" "00020870" "90" "102" "0" "102" "0" "c.102del" "r.(?)" "p.(Glu35Argfs*33)" "" "0000917716" "00020870" "70" "110" "5" "110" "5" "c.110+5G>A" "r.spl?" "p.?" "" "0000930741" "00020870" "30" "-4359" "0" "-4359" "0" "c.-4359G>A" "r.(?)" "p.(=)" "" "0000930742" "00020870" "10" "111" "-16" "111" "-16" "c.111-16C>G" "r.(=)" "p.(=)" "" "0000936111" "00020870" "70" "90" "0" "91" "0" "c.90_91del" "r.(?)" "p.(Ser31HisfsTer11)" "" "0000946202" "00020870" "50" "208" "0" "208" "0" "c.208C>T" "r.(?)" "p.(Arg70Trp)" "" "0000968844" "00020870" "30" "32" "0" "32" "0" "c.32C>T" "r.(?)" "p.(Ser11Leu)" "" "0000968845" "00020870" "50" "317" "0" "317" "0" "c.317G>A" "r.(?)" "p.(Arg106His)" "" "0000982452" "00020870" "50" "209" "0" "209" "0" "c.209G>A" "r.(?)" "p.(Arg70Gln)" "" "0001003164" "00020870" "10" "102" "0" "102" "0" "c.102C>T" "r.(?)" "p.(=)" "" "0001003165" "00020870" "50" "421" "0" "421" "0" "c.421C>G" "r.(?)" "p.(Pro141Ala)" "" "0001026872" "00020870" "50" "472" "0" "472" "0" "c.472C>T" "r.(?)" "p.(Arg158Cys)" "" "0001041802" "00020870" "50" "484" "0" "484" "0" "c.484del" "r.(?)" "p.(Gln162Argfs*26)" "" "0001046619" "00020870" "30" "113" "0" "113" "0" "c.113G>T" "r.(?)" "p.(Cys38Phe)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 154 "{{screeningid}}" "{{variantid}}" "0000064202" "0000095190" "0000064252" "0000095387" "0000064848" "0000096494" "0000064867" "0000096520" "0000175681" "0000398563" "0000214448" "0000446729" "0000214449" "0000446731" "0000214450" "0000446733" "0000214450" "0000446734" "0000214452" "0000446736" "0000214453" "0000446737" "0000214455" "0000446739" "0000214457" "0000446741" "0000214458" "0000446742" "0000214459" "0000446743" "0000214461" "0000446745" "0000214462" "0000446746" "0000214463" "0000446747" "0000214464" "0000446748" "0000214465" "0000446749" "0000214466" "0000446750" "0000214467" "0000446751" "0000214468" "0000446752" "0000214469" "0000446753" "0000214470" "0000446754" "0000214471" "0000446755" "0000214472" "0000446756" "0000214473" "0000446757" "0000214473" "0000446758" "0000214474" "0000446759" "0000214475" "0000446760" "0000214476" "0000446761" "0000214477" "0000446762" "0000214478" "0000446763" "0000214479" "0000446764" "0000214480" "0000446765" "0000214481" "0000446766" "0000214482" "0000446767" "0000214483" "0000446768" "0000214484" "0000446769" "0000214485" "0000446770" "0000214486" "0000446771" "0000214487" "0000446772" "0000214488" "0000446773" "0000214489" "0000446774" "0000214490" "0000446776" "0000214491" "0000446778" "0000220566" "0000466654" "0000220598" "0000466655" "0000220729" "0000466656" "0000220844" "0000466657" "0000221065" "0000466658" "0000221067" "0000466659" "0000221208" "0000466688" "0000221301" "0000466660" "0000221422" "0000466661" "0000221504" "0000466662" "0000221657" "0000466663" "0000221708" "0000466664" "0000221978" "0000466665" "0000222023" "0000466689" "0000222028" "0000466666" "0000222135" "0000466667" "0000222152" "0000466668" "0000222154" "0000466669" "0000222210" "0000466670" "0000222306" "0000466671" "0000222329" "0000466672" "0000222354" "0000466673" "0000222357" "0000466674" "0000222467" "0000466675" "0000222526" "0000466676" "0000222532" "0000466677" "0000222744" "0000466678" "0000222859" "0000466679" "0000222901" "0000466680" "0000222982" "0000466681" "0000222985" "0000466682" "0000223130" "0000466683" "0000223295" "0000466684" "0000223373" "0000466685" "0000223448" "0000466686" "0000223584" "0000466687" "0000229246" "0000470395" "0000229246" "0000470396" "0000229247" "0000470397" "0000229248" "0000470398" "0000229250" "0000470402" "0000229258" "0000470414" "0000229259" "0000470415" "0000229260" "0000470416" "0000229260" "0000470417" "0000229261" "0000470418" "0000229262" "0000470419" "0000229263" "0000470420" "0000229264" "0000470421" "0000229265" "0000470422" "0000229266" "0000470423" "0000229267" "0000470424" "0000229268" "0000470425" "0000229269" "0000470426" "0000229270" "0000470427" "0000229271" "0000470428" "0000229272" "0000470429" "0000229273" "0000470430" "0000229274" "0000470431" "0000229321" "0000470506" "0000229322" "0000470507" "0000229323" "0000470508" "0000229324" "0000470509" "0000229325" "0000470510" "0000229326" "0000470511" "0000229327" "0000470512" "0000229328" "0000470513" "0000229329" "0000470514" "0000229330" "0000470515" "0000229331" "0000470516" "0000292861" "0000649550" "0000292862" "0000649551" "0000292863" "0000649552" "0000292864" "0000649553" "0000292865" "0000649554" "0000296448" "0000653137" "0000300551" "0000663264" "0000305703" "0000669391" "0000315653" "0000697742" "0000315654" "0000697743" "0000315655" "0000697744" "0000319074" "0000701680" "0000319075" "0000701681" "0000319076" "0000701682" "0000319077" "0000701683" "0000319078" "0000701684" "0000377612" "0000790017" "0000389924" "0000819195" "0000389925" "0000819196" "0000393251" "0000823972" "0000396755" "0000828407" "0000396756" "0000828408" "0000396757" "0000828409" "0000396758" "0000828410" "0000431779" "0000917066" "0000431779" "0000917070" "0000431780" "0000917067" "0000431781" "0000917068" "0000431782" "0000917069" "0000431816" "0000917106" "0000432305" "0000917712" "0000432306" "0000917713" "0000432307" "0000917714" "0000432308" "0000917715" "0000432308" "0000917716" "0000439967" "0000936111" "0000444261" "0000946202"