### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = TMC8) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "TMC8" "transmembrane channel-like 8" "17" "q25.3" "unknown" "LRG_119" "UD_132118997219" "" "https://www.LOVD.nl/TMC8" "" "1" "20474" "147138" "605829" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was performed by Johan den Dunnen, supported by Global Variome." "" "g" "https://databases.lovd.nl/shared/refseq/TMC8_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2019-09-16 16:59:00" "00000" "2024-04-19 20:27:30" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00021226" "TMC8" "transmembrane channel-like 8" "001" "NM_152468.4" "" "NP_689681.2" "" "" "" "-382" "4037" "2181" "76126859" "76139049" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 3 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "01772" "EV" "epidermodysplasia verruciformis, susceptibiity to (EV)" "" "" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2019-09-16 16:48:32" "05654" "EV2" "epidermodysplasia verruciformis, susceptibiity to 2 (EV-2)" "AR" "618231" "" "" "" "00006" "2019-09-16 16:50:24" "00006" "2021-12-10 21:51:32" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 2 "{{geneid}}" "{{diseaseid}}" "TMC8" "01772" "TMC8" "05654" ## Individuals ## Do not remove or alter this header ## ## Count = 10 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00264024" "" "" "" "1" "" "02484" "" "" "M" "yes" "Brazil" "14y" "0" "" "" "Unknown" "" "00264025" "" "" "" "1" "" "02484" "" "" "M" "yes" "China" "24y" "0" "" "" "Unknown" "" "00264026" "" "" "" "1" "" "02484" "" "" "M" "yes" "Colombia" "32y" "0" "" "" "" "" "00264027" "" "" "" "1" "" "02484" "{PMID:Youssefian 2019:30036492}" "2-generation family, 1 affected, unaffected heterozygous carrier first cousin parents" "M" "yes" "Iran" "?" "0" "" "" "Unknown" "Fam2Pat" "00264028" "" "" "" "1" "" "02484" "" "" "M" "no" "Mexico" "22y" "0" "" "" "Unknown" "" "00264029" "" "" "" "1" "" "02484" "" "" "M" "yes" "" "60y" "0" "" "" "Europe-C" "" "00264030" "" "" "" "1" "" "02484" "" "" "M" "no" "" "58y" "0" "" "" "Europe-C" "" "00264031" "" "" "" "1" "" "02484" "" "" "M" "yes" "Algeria" "28y" "0" "" "" "Unknown" "" "00264032" "" "" "" "1" "" "02484" "{PMID:Youssefian 2019:30036492}" "" "?" "yes" "Iran" "?" "0" "" "" "" "Fam1Pat1" "00291864" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 10 "{{individualid}}" "{{diseaseid}}" "00264024" "01772" "00264025" "01772" "00264026" "01772" "00264027" "01772" "00264028" "01772" "00264029" "01772" "00264030" "01772" "00264031" "01772" "00264032" "01772" "00291864" "00198" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00198, 01772, 05654 ## Count = 9 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000201880" "01772" "00264024" "02484" "Familial, autosomal recessive" "" "Flat warts, PV-like lesions, actinic keratoses. SCC." "" "" "" "" "" "" "" "" "Epidermodysplasia verruciformis" "" "" "0000201881" "01772" "00264025" "02484" "Familial, autosomal recessive" "" "Small red macules like flat warts, lesions resembling pityriasis versicolor" "" "" "" "" "" "" "" "" "Epidermodysplasia verruciformis" "" "" "0000201882" "01772" "00264026" "02484" "Familial, autosomal recessive" "" "Persistent flat wart-like lesions and pityriasis versicolor-like lesions disseminated." "" "" "" "" "" "" "" "" "Epidermodysplasia verruciformis" "" "" "0000201883" "01772" "00264027" "02484" "Familial, autosomal recessive" "" "Flat warts in hands and feet, tinea versicolor-like lesions on the face and neck" "" "" "" "" "" "" "" "" "Epidermodysplasia verruciformis" "" "" "0000201884" "01772" "00264028" "02484" "Familial, autosomal recessive" "" "Disseminated erythema-tous papules and plaques, some with scale and crust; several flat wartlike papule. SCC. BCC" "" "" "" "" "" "" "" "" "Epidermodysplasia verruciformis" "" "" "0000201885" "01772" "00264029" "02484" "Familial, autosomal recessive" "" "Plucked hair bulbs, AK, Bowenoid lesion. BCC, SCC" "" "" "" "" "" "" "" "" "Epidermodysplasia verruciformis" "" "" "0000201886" "01772" "00264030" "02484" "Familial, autosomal recessive" "" "Erythematous and hyperkeratotic plaques. Bowen disease, BCC, SCC" "" "" "" "" "" "" "" "" "Epidermodysplasia verruciformis" "" "" "0000201887" "01772" "00264031" "02484" "Familial, autosomal recessive" "" "Persistent flat wart-like lesions and pityriasis versicolor-like lesions disseminated. BCC and SCC" "" "" "" "" "" "" "" "" "Epidermodysplasia verruciformis" "" "" "0000201888" "01772" "00264032" "02484" "Familial, autosomal recessive" "" "Flat warts in hands and feet, tinea versicolor-like lesions on the face and neck. SCC and Basosquamous carcinoma" "" "" "" "" "" "" "" "" "Epidermodysplasia verruciformis" "" "" ## Screenings ## Do not remove or alter this header ## ## Count = 10 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000265146" "00264024" "1" "02484" "02484" "2019-09-05 21:56:12" "" "" "PCR" "DNA" "" "" "0000265147" "00264025" "1" "02484" "02484" "2019-09-05 22:03:37" "" "" "PCR" "DNA" "" "" "0000265148" "00264026" "1" "02484" "02484" "2019-09-05 22:07:51" "" "" "PCR" "DNA" "" "" "0000265149" "00264027" "1" "02484" "02484" "2019-09-05 22:18:06" "" "" "SEQ-NG" "DNA" "" "WES" "0000265150" "00264028" "1" "02484" "02484" "2019-09-05 22:22:11" "" "" "PCR" "DNA" "" "" "0000265151" "00264029" "1" "02484" "02484" "2019-09-05 22:27:18" "" "" "PCR" "DNA" "" "" "0000265152" "00264030" "1" "02484" "02484" "2019-09-05 22:31:37" "" "" "PCR" "DNA" "" "" "0000265153" "00264031" "1" "02484" "02484" "2019-09-05 22:34:43" "" "" "PCR" "DNA" "" "" "0000265154" "00264032" "1" "02484" "02484" "2019-09-05 22:39:31" "" "" "SEQ-NG" "DNA" "" "WES" "0000293032" "00291864" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 7 "{{screeningid}}" "{{geneid}}" "0000265146" "TMC8" "0000265147" "TMC8" "0000265148" "TMC8" "0000265150" "TMC8" "0000265151" "TMC8" "0000265152" "TMC8" "0000265153" "TMC8" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 152 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000248863" "0" "10" "17" "76130575" "76130575" "subst" "0.51203" "02325" "TMC8_000003" "g.76130575A>T" "" "" "" "TMC8(NM_152468.5):c.917A>T (p.N306I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.78134494A>T" "" "benign" "" "0000248947" "0" "10" "17" "76121864" "76121864" "subst" "0.237553" "02325" "TMC6_000015" "g.76121864A>G" "" "" "" "TMC6(NM_001127198.5):c.373T>C (p.W125R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.78125783A>G" "" "benign" "" "0000249231" "0" "10" "17" "76120065" "76120065" "subst" "0.343263" "02325" "TMC6_000009" "g.76120065A>G" "" "" "" "TMC6(NM_001127198.5):c.1082+5T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.78123984A>G" "" "benign" "" "0000311860" "0" "10" "17" "76118834" "76118834" "subst" "0.0924337" "02325" "TMC6_000008" "g.76118834G>C" "" "" "" "TMC6(NM_001127198.5):c.1083-4C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.78122753G>C" "" "benign" "" "0000311861" "0" "10" "17" "76137198" "76137198" "subst" "0.995745" "02325" "TMC8_000016" "g.76137198T>G" "" "" "" "TMC8(NM_152468.5):c.*5T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.78141117T>G" "" "benign" "" "0000311862" "0" "10" "17" "76131070" "76131070" "subst" "0.536501" "02325" "TMC8_000006" "g.76131070G>A" "" "" "" "TMC8(NM_152468.5):c.1107G>A (p.E369=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.78134989G>A" "" "benign" "" "0000311863" "0" "10" "17" "76134828" "76134828" "subst" "0.580271" "02325" "TMC8_000013" "g.76134828C>A" "" "" "" "TMC8(NM_152468.5):c.1823+15C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.78138747C>A" "" "benign" "" "0000311864" "0" "10" "17" "76129636" "76129636" "subst" "0.22751" "02325" "TMC8_000001" "g.76129636T>C" "" "" "" "TMC8(NM_152468.5):c.668+13T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.78133555T>C" "" "benign" "" "0000314528" "0" "30" "17" "76117124" "76117124" "subst" "0.0085412" "02326" "TMC6_000006" "g.76117124G>A" "" "" "" "TMC6(NM_007267.6):c.1505C>T (p.P502L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.78121043G>A" "" "likely benign" "" "0000314529" "0" "30" "17" "76115479" "76115479" "del" "0.0879539" "02326" "TMC6_000004" "g.76115479del" "" "" "" "TMC6(NM_001127198.5):c.1716-6delA" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.78119398del" "" "likely benign" "" "0000314530" "0" "50" "17" "76113739" "76113739" "subst" "0.00287875" "02326" "TMC6_000003" "g.76113739C>T" "" "" "" "TMC6(NM_001127198.5):c.2022-14G>A, TMC6(NM_007267.6):c.2022-14G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.78117658C>T" "" "VUS" "" "0000314531" "0" "10" "17" "76109296" "76109296" "subst" "0.0115247" "02326" "TMC6_000001" "g.76109296C>T" "" "" "" "TMC6(NM_001127198.5):c.2355-4G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.78113215C>T" "" "benign" "" "0000314532" "0" "30" "17" "76121922" "76121922" "subst" "0.000947811" "02326" "TMC6_000016" "g.76121922C>T" "" "" "" "TMC6(NM_001127198.5):c.315G>A (p.(Thr105=)), TMC6(NM_007267.6):c.315G>A (p.T105=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.78125841C>T" "" "likely benign" "" "0000314533" "0" "30" "17" "76120993" "76120993" "subst" "0.00251951" "02326" "TMC6_000011" "g.76120993G>A" "" "" "" "TMC6(NM_001127198.2):c.610C>T (p.R204W), TMC6(NM_001127198.5):c.610C>T (p.R204W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.78124912G>A" "" "likely benign" "" "0000314534" "0" "10" "17" "76130987" "76130987" "subst" "0.0245807" "02326" "TMC8_000005" "g.76130987G>T" "" "" "" "TMC8(NM_152468.4):c.1024G>T (p.G342W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.78134906G>T" "" "benign" "" "0000314535" "0" "30" "17" "76133356" "76133356" "subst" "0.00101998" "02326" "TMC8_000007" "g.76133356G>A" "" "" "" "TMC8(NM_152468.4):c.1168G>A (p.V390I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.78137275G>A" "" "likely benign" "" "0000314536" "0" "10" "17" "76134072" "76134072" "subst" "0.0366756" "02326" "TMC8_000008" "g.76134072T>G" "" "" "" "TMC8(NM_152468.4):c.1350-14T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.78137991T>G" "" "benign" "" "0000314537" "0" "10" "17" "76134237" "76134237" "subst" "0.0378463" "02326" "TMC8_000009" "g.76134237G>A" "" "" "" "TMC8(NM_152468.4):c.1501G>A (p.V501I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.78138156G>A" "" "benign" "" "0000314538" "0" "10" "17" "76134650" "76134650" "subst" "0.0376484" "02326" "TMC8_000011" "g.76134650G>T" "" "" "" "TMC8(NM_152468.4):c.1665-5G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.78138569G>T" "" "benign" "" "0000314539" "0" "10" "17" "76129930" "76129930" "subst" "0.0316868" "02326" "TMC8_000002" "g.76129930G>C" "" "" "" "TMC8(NM_152468.4):c.669-4G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.78133849G>C" "" "benign" "" "0000314540" "0" "10" "17" "76127746" "76127746" "subst" "0.0324812" "02326" "TMC6_000018" "g.76127746T>C" "" "" "" "TMC8(NM_152468.4):c.77T>C (p.M26T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.78131665T>C" "" "benign" "" "0000314541" "0" "10" "17" "76130947" "76130947" "subst" "0.000630584" "02326" "TMC8_000004" "g.76130947G>A" "" "" "" "TMC8(NM_152468.4):c.988-4G>A, TMC8(NM_152468.5):c.988-4G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.78134866G>A" "" "benign" "" "0000316655" "0" "30" "17" "76120081" "76120081" "subst" "0.000174783" "01943" "TMC6_000010" "g.76120081G>A" "" "" "" "TMC6(NM_001127198.2):c.1071C>T (p.T357=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.78124000G>A" "" "likely benign" "" "0000316656" "0" "30" "17" "76122651" "76122651" "subst" "0.000207331" "01943" "TMC6_000017" "g.76122651C>T" "" "" "" "TMC6(NM_001127198.2):c.135G>A (p.T45=), TMC6(NM_007267.6):c.135G>A (p.T45=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.78126570C>T" "" "likely benign" "" "0000316657" "0" "30" "17" "76116917" "76116917" "subst" "0.00334572" "01943" "TMC6_000005" "g.76116917C>T" "" "" "" "TMC6(NM_001127198.2):c.1536-4G>A, TMC6(NM_007267.6):c.1536-4G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.78120836C>T" "" "likely benign" "" "0000316658" "0" "10" "17" "76121844" "76121844" "subst" "0.000639676" "01943" "TMC6_000014" "g.76121844G>A" "" "" "" "TMC6(NM_001127198.2):c.393C>T (p.Y131=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.78125763G>A" "" "benign" "" "0000316659" "0" "10" "17" "76121318" "76121318" "subst" "0.133295" "01943" "TMC6_000013" "g.76121318G>A" "" "" "" "TMC6(NM_001127198.2):c.457C>T (p.L153F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.78125237G>A" "" "benign" "" "0000316660" "0" "50" "17" "76121279" "76121279" "subst" "0" "01943" "TMC6_000012" "g.76121279G>A" "" "" "" "TMC6(NM_001127198.2):c.496C>T (p.R166C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.78125198G>A" "" "VUS" "" "0000316661" "0" "30" "17" "76134467" "76134467" "subst" "0.00203493" "01943" "TMC8_000010" "g.76134467C>T" "" "" "" "TMC8(NM_152468.4):c.1571C>T (p.P524L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.78138386C>T" "" "likely benign" "" "0000316662" "0" "30" "17" "76134715" "76134715" "subst" "0.00123932" "01943" "TMC8_000012" "g.76134715C>T" "" "" "" "TMC8(NM_152468.4):c.1725C>T (p.V575=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.78138634C>T" "" "likely benign" "" "0000316663" "0" "30" "17" "76136908" "76136910" "del" "0" "01943" "TMC8_000014" "g.76136908_76136910del" "" "" "" "TMC8(NM_152468.4):c.1903-7_1903-5delCTC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.78140827_78140829del" "" "likely benign" "" "0000316664" "0" "30" "17" "76136926" "76136926" "subst" "1.28259E-5" "01943" "TMC8_000015" "g.76136926G>A" "" "" "" "TMC8(NM_152468.4):c.1914G>A (p.E638=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.78140845G>A" "" "likely benign" "" "0000325656" "0" "30" "17" "76117754" "76117754" "subst" "0" "01804" "TMC6_000007" "g.76117754C>G" "" "" "" "TMC6(NM_001127198.1):c.1266G>C (p.(Arg422Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.78121673C>G" "" "likely benign" "" "0000338721" "0" "10" "17" "76115301" "76115301" "subst" "0" "02327" "TMC6_000020" "g.76115301G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.78119220G>A" "" "benign" "" "0000338722" "0" "10" "17" "76115353" "76115353" "subst" "0.622194" "02327" "TMC6_000021" "g.76115353T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.78119272T>C" "" "benign" "" "0000338723" "0" "10" "17" "76120065" "76120065" "subst" "0.343263" "02327" "TMC6_000009" "g.76120065A>G" "" "" "" "TMC6(NM_001127198.5):c.1082+5T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.78123984A>G" "" "benign" "" "0000338724" "0" "30" "17" "76120588" "76120588" "subst" "0.00351988" "02327" "TMC6_000022" "g.76120588T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.78124507T>C" "" "likely benign" "" "0000338725" "0" "10" "17" "76129636" "76129636" "subst" "0.22751" "02327" "TMC8_000001" "g.76129636T>C" "" "" "" "TMC8(NM_152468.5):c.668+13T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.78133555T>C" "" "benign" "" "0000338726" "0" "10" "17" "76130947" "76130947" "subst" "0.0783877" "02327" "TMC8_000017" "g.76130947G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.78134866G>T" "" "benign" "" "0000338727" "0" "30" "17" "76134302" "76134302" "subst" "0.0010509" "02327" "TMC8_000018" "g.76134302G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.78138221G>A" "" "likely benign" "" "0000338728" "0" "10" "17" "76134828" "76134828" "subst" "0.580271" "02327" "TMC8_000013" "g.76134828C>A" "" "" "" "TMC8(NM_152468.5):c.1823+15C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.78138747C>A" "" "benign" "" "0000338729" "0" "10" "17" "76137198" "76137198" "subst" "0.995745" "02327" "TMC8_000016" "g.76137198T>G" "" "" "" "TMC8(NM_152468.5):c.*5T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.78141117T>G" "" "benign" "" "0000340440" "0" "10" "17" "76131070" "76131070" "subst" "0.536501" "02327" "TMC8_000006" "g.76131070G>A" "" "" "" "TMC8(NM_152468.5):c.1107G>A (p.E369=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.78134989G>A" "" "benign" "" "0000343698" "0" "10" "17" "76130575" "76130575" "subst" "0.51203" "02327" "TMC8_000003" "g.76130575A>T" "" "" "" "TMC8(NM_152468.5):c.917A>T (p.N306I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.78134494A>T" "" "benign" "" "0000563256" "0" "30" "17" "76109301" "76109301" "subst" "0.00029126" "01943" "TMC6_000023" "g.76109301A>G" "" "" "" "TMC6(NM_001127198.2):c.2355-9T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.78113220A>G" "" "likely benign" "" "0000563257" "0" "10" "17" "76113838" "76113838" "subst" "0.00195773" "02327" "TMC6_000025" "g.76113838C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.78117757C>A" "" "benign" "" "0000563258" "0" "10" "17" "76113954" "76113954" "subst" "0.137905" "02327" "TMC6_000026" "g.76113954G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.78117873G>A" "" "benign" "" "0000563259" "0" "30" "17" "76115094" "76115094" "subst" "2.64644E-5" "01943" "TMC6_000027" "g.76115094G>A" "" "" "" "TMC6(NM_001127198.2):c.1845C>T (p.A615=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.78119013G>A" "" "likely benign" "" "0000563260" "0" "10" "17" "76115181" "76115181" "subst" "0" "02327" "TMC6_000028" "g.76115181A>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.78119100A>T" "" "benign" "" "0000563261" "0" "10" "17" "76117001" "76117001" "subst" "0" "02327" "TMC6_000029" "g.76117001C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.78120920C>T" "" "benign" "" "0000563262" "0" "30" "17" "76117201" "76117201" "subst" "8.4151E-6" "01943" "TMC6_000030" "g.76117201G>A" "" "" "" "TMC6(NM_001127198.2):c.1428C>T (p.P476=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.78121120G>A" "" "likely benign" "" "0000563263" "0" "30" "17" "76117727" "76117727" "subst" "1.34261E-5" "01943" "TMC6_000031" "g.76117727C>A" "" "" "" "TMC6(NM_001127198.2):c.1293G>T (p.A431=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.78121646C>A" "" "likely benign" "" "0000563264" "0" "10" "17" "76117744" "76117744" "subst" "0.0010435" "01943" "TMC6_000032" "g.76117744C>T" "" "" "" "TMC6(NM_001127198.2):c.1276G>A (p.G426R), TMC6(NM_001127198.5):c.1276G>A (p.G426R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.78121663C>T" "" "benign" "" "0000563265" "0" "30" "17" "76120166" "76120166" "subst" "0.000252242" "01943" "TMC6_000033" "g.76120166G>A" "" "" "" "TMC6(NM_001127198.2):c.986C>T (p.T329I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.78124085G>A" "" "likely benign" "" "0000563266" "0" "10" "17" "76120637" "76120637" "subst" "0.00371749" "02327" "TMC6_000034" "g.76120637C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.78124556C>T" "" "benign" "" "0000563267" "0" "10" "17" "76120993" "76120993" "subst" "0.00251951" "01943" "TMC6_000011" "g.76120993G>A" "" "" "" "TMC6(NM_001127198.2):c.610C>T (p.R204W), TMC6(NM_001127198.5):c.610C>T (p.R204W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.78124912G>A" "" "benign" "" "0000563268" "0" "30" "17" "76121018" "76121018" "subst" "0" "01943" "TMC6_000035" "g.76121018G>A" "" "" "" "TMC6(NM_001127198.2):c.585C>T (p.S195=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.78124937G>A" "" "likely benign" "" "0000563269" "0" "50" "17" "76121843" "76121843" "subst" "0" "01943" "TMC6_000036" "g.76121843C>T" "" "" "" "TMC6(NM_001127198.2):c.394G>A (p.D132N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.78125762C>T" "" "VUS" "" "0000563270" "0" "10" "17" "76121864" "76121864" "subst" "0.237553" "02327" "TMC6_000015" "g.76121864A>G" "" "" "" "TMC6(NM_001127198.5):c.373T>C (p.W125R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.78125783A>G" "" "benign" "" "0000563271" "0" "30" "17" "76121883" "76121883" "subst" "1.87338E-5" "01943" "TMC6_000037" "g.76121883C>T" "" "" "" "TMC6(NM_001127198.2):c.354G>A (p.G118=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.78125802C>T" "" "likely benign" "" "0000563272" "0" "50" "17" "76128039" "76128039" "subst" "0.000266662" "01943" "TMC6_000038" "g.76128039C>T" "" "" "" "TMC8(NM_152468.4):c.226C>T (p.R76C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.78131958C>T" "" "VUS" "" "0000563274" "0" "30" "17" "76128069" "76128069" "subst" "0.000161776" "01943" "TMC6_000040" "g.76128069C>G" "" "" "" "TMC8(NM_152468.4):c.256C>G (p.R86G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.78131988C>G" "" "likely benign" "" "0000563275" "0" "10" "17" "76128092" "76128092" "subst" "0.00133515" "01943" "TMC6_000041" "g.76128092G>A" "" "" "" "TMC8(NM_152468.4):c.279G>A (p.G93=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.78132011G>A" "" "benign" "" "0000563276" "0" "30" "17" "76128900" "76128900" "subst" "0.000272099" "01943" "TMC6_000042" "g.76128900G>A" "" "" "" "TMC8(NM_152468.4):c.480G>A (p.P160=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.78132819G>A" "" "likely benign" "" "0000563277" "0" "50" "17" "76129619" "76129619" "subst" "0.00188775" "01943" "TMC6_000043" "g.76129619C>T" "" "" "" "TMC8(NM_152468.4):c.664C>T (p.R222W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.78133538C>T" "" "VUS" "" "0000563278" "0" "30" "17" "76129985" "76129985" "subst" "8.13584E-5" "01943" "TMC6_000044" "g.76129985G>A" "" "" "" "TMC8(NM_152468.4):c.720G>A (p.A240=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.78133904G>A" "" "likely benign" "" "0000563279" "0" "30" "17" "76130091" "76130091" "subst" "0.000101733" "01943" "TMC6_000045" "g.76130091C>T" "" "" "" "TMC8(NM_152468.4):c.816+10C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.78134010C>T" "" "likely benign" "" "0000563280" "0" "10" "17" "76133908" "76133908" "subst" "0.113072" "02327" "TMC8_000019" "g.76133908G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.78137827G>A" "" "benign" "" "0000563281" "0" "30" "17" "76134100" "76134100" "subst" "0.00123705" "01943" "TMC8_000020" "g.76134100G>A" "" "" "" "TMC8(NM_152468.4):c.1364G>A (p.R455Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.78138019G>A" "" "likely benign" "" "0000563282" "0" "10" "17" "76134525" "76134525" "subst" "0.00151066" "01943" "TMC8_000021" "g.76134525T>C" "" "" "" "TMC8(NM_152468.4):c.1629T>C (p.L543=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.78138444T>C" "" "benign" "" "0000563283" "0" "50" "17" "76135305" "76135305" "subst" "4.48127E-5" "01943" "TMC8_000022" "g.76135305G>T" "" "" "" "TMC8(NM_152468.4):c.1886G>T (p.R629L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.78139224G>T" "" "VUS" "" "0000563284" "0" "30" "17" "76136994" "76136994" "subst" "0.00341064" "01943" "TMC8_000023" "g.76136994C>T" "" "" "" "TMC8(NM_152468.4):c.1982C>T (p.P661L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.78140913C>T" "" "likely benign" "" "0000595722" "3" "90" "17" "76128001" "76128001" "subst" "0" "02484" "TMC8_000024" "g.76128001G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.78131920G>A" "" "pathogenic (recessive)" "" "0000595723" "3" "90" "17" "76129523" "76129523" "subst" "4.06336E-6" "02484" "TMC8_000027" "g.76129523C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.78133442C>T" "" "pathogenic (recessive)" "" "0000595724" "3" "90" "17" "76131047" "76131047" "subst" "8.12341E-6" "02484" "TMC8_000029" "g.76131047G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.78134966G>T" "" "pathogenic (recessive)" "" "0000595725" "3" "90" "17" "76133421" "76133421" "subst" "0" "02484" "TMC8_000030" "g.76133421C>A" "" "{PMID:Youssefian 2019:30036492}" "" "g.6571C>A" "" "Germline" "" "" "0" "" "" "g.78137340C>A" "" "pathogenic (recessive)" "" "0000595726" "3" "90" "17" "76129516" "76129538" "del" "2.03138E-5" "02484" "TMC8_000026" "g.76129516_76129538del" "" "" "" "561_583delTGCGTACCGAGTGGGGCCGGAGA" "" "Germline" "" "" "0" "" "" "g.78133435_78133457del" "" "pathogenic (recessive)" "" "0000595727" "3" "90" "17" "76128467" "76128479" "del" "0" "02484" "TMC8_000025" "g.76128467_76128479del" "" "" "" "325_337delTACTTCACCTTCC" "" "Germline" "" "" "0" "" "" "g.78132386_78132398del" "" "pathogenic (recessive)" "" "0000595728" "3" "90" "17" "76129526" "76129526" "del" "0" "02484" "TMC8_000031" "g.76129526del" "" "" "" "571_571delG" "" "Germline" "" "" "0" "" "" "g.78133445del" "" "pathogenic (recessive)" "" "0000595729" "3" "90" "17" "76130020" "76130020" "del" "0" "02484" "TMC8_000028" "g.76130020del" "" "" "" "754_755delT" "" "Germline" "" "" "0" "" "" "g.78133939del" "" "pathogenic (recessive)" "" "0000595730" "3" "90" "17" "76134222" "76134230" "dup" "0" "02484" "TMC8_000032" "g.76134222_76134230dup" "" "{PMID:Youssefian 2019:30036492}" "" "1447ins9 (Cys492_Pro493insProLeuLeu)" "" "Germline" "" "" "0" "" "" "g.78138141_78138149dup" "" "pathogenic (recessive)" "" "0000616850" "0" "50" "17" "76116758" "76116758" "subst" "3.24884E-5" "01943" "TMC8_000034" "g.76116758G>A" "" "" "" "TMC6(NM_001127198.2):c.1691C>T (p.T564M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.78120677G>A" "" "VUS" "" "0000616851" "0" "30" "17" "76122886" "76122886" "subst" "1.63201E-5" "01943" "TMC8_000037" "g.76122886C>T" "" "" "" "TMC6(NM_001127198.2):c.28G>A (p.D10N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.78126805C>T" "" "likely benign" "" "0000616852" "0" "10" "17" "76127857" "76127857" "dup" "0" "02327" "TMC8_000038" "g.76127857dup" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.78131776dup" "" "benign" "" "0000616853" "0" "50" "17" "76128420" "76128420" "subst" "0" "01943" "TMC8_000039" "g.76128420A>T" "" "" "" "TMC6(NM_007267.6):c.-75+2T>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.78132339A>T" "" "VUS" "" "0000616854" "0" "30" "17" "76130576" "76130576" "subst" "0.00112948" "01943" "TMC8_000040" "g.76130576C>T" "" "" "" "TMC8(NM_152468.4):c.918C>T (p.N306=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.78134495C>T" "" "likely benign" "" "0000616855" "0" "30" "17" "76133356" "76133356" "subst" "0.00101998" "01943" "TMC8_000007" "g.76133356G>A" "" "" "" "TMC8(NM_152468.4):c.1168G>A (p.V390I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.78137275G>A" "" "likely benign" "" "0000616856" "0" "50" "17" "76134096" "76134096" "subst" "6.10496E-5" "02325" "TMC8_000041" "g.76134096G>T" "" "" "" "TMC8(NM_152468.5):c.1360G>T (p.D454Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.78138015G>T" "" "VUS" "" "0000616857" "0" "30" "17" "76137137" "76137137" "subst" "1.32357E-5" "01943" "TMC8_000042" "g.76137137C>T" "" "" "" "TMC8(NM_152468.4):c.2125C>T (p.H709Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.78141056C>T" "" "likely benign" "" "0000623771" "0" "30" "17" "76113639" "76113639" "subst" "0" "01943" "TMC8_000033" "g.76113639G>A" "" "" "" "TMC6(NM_001127198.2):c.2108C>T (p.A703V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.78117558G>A" "" "likely benign" "" "0000623772" "0" "30" "17" "76120954" "76120954" "subst" "0.0014146" "02326" "TMC8_000035" "g.76120954G>A" "" "" "" "TMC6(NM_007267.6):c.633+16C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.78124873G>A" "" "likely benign" "" "0000623773" "0" "30" "17" "76122599" "76122599" "subst" "0.000712605" "02326" "TMC8_000036" "g.76122599G>A" "" "" "" "TMC6(NM_007267.6):c.181+6C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.78126518G>A" "" "likely benign" "" "0000649721" "1" "50" "17" "76131047" "76131047" "subst" "8.12341E-6" "03575" "TMC8_000029" "g.76131047G>T" "1/2791 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "risk factor; 1 heterozygous, no homozygous; {DB:CLININrs121908330.1}" "Germline" "" "rs121908330" "0" "" "" "g.78134966G>T" "" "VUS" "" "0000658268" "0" "30" "17" "76116917" "76116917" "subst" "0.00334572" "02326" "TMC6_000005" "g.76116917C>T" "" "" "" "TMC6(NM_001127198.2):c.1536-4G>A, TMC6(NM_007267.6):c.1536-4G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.78120836C>T" "" "likely benign" "" "0000658269" "0" "30" "17" "76130947" "76130947" "subst" "0.000630584" "02325" "TMC8_000004" "g.76130947G>A" "" "" "" "TMC8(NM_152468.4):c.988-4G>A, TMC8(NM_152468.5):c.988-4G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.78134866G>A" "" "likely benign" "" "0000658270" "0" "30" "17" "76134467" "76134467" "subst" "0.00203493" "02326" "TMC8_000010" "g.76134467C>T" "" "" "" "TMC8(NM_152468.4):c.1571C>T (p.P524L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.78138386C>T" "" "likely benign" "" "0000658271" "0" "30" "17" "76134495" "76134495" "subst" "0" "02326" "TMC8_000043" "g.76134495C>T" "" "" "" "TMC8(NM_152468.4):c.1599C>T (p.F533=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.78138414C>T" "" "likely benign" "" "0000658272" "0" "30" "17" "76135295" "76135295" "subst" "1.62807E-5" "01943" "TMC8_000044" "g.76135295C>T" "" "" "" "TMC8(NM_152468.4):c.1876C>T (p.H626Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.78139214C>T" "" "likely benign" "" "0000681041" "0" "70" "17" "76113548" "76113548" "subst" "0" "02325" "TMC8_000045" "g.76113548C>T" "" "" "" "TMC6(NM_001127198.5):c.2198+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000681042" "0" "30" "17" "76115441" "76115441" "subst" "0.000499476" "02326" "TMC8_000046" "g.76115441C>T" "" "" "" "TMC6(NM_007267.6):c.1748G>A (p.R583Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000681043" "0" "50" "17" "76120790" "76120790" "subst" "4.30317E-5" "02325" "TMC8_000047" "g.76120790G>A" "" "" "" "TMC6(NM_001127198.5):c.706C>T (p.R236C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000681044" "0" "50" "17" "76129514" "76129514" "subst" "8.12585E-6" "02325" "TMC8_000048" "g.76129514G>A" "" "" "" "TMC8(NM_152468.5):c.559G>A (p.G187S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000692482" "0" "30" "17" "76114034" "76114034" "subst" "4.98688E-5" "02326" "TMC8_000049" "g.76114034G>A" "" "" "" "TMC6(NM_007267.6):c.1888-18C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000692483" "0" "50" "17" "76116837" "76116837" "subst" "0" "01943" "TMC8_000050" "g.76116837C>A" "" "" "" "TMC6(NM_001127198.2):c.1612G>T (p.G538C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000692484" "0" "50" "17" "76120069" "76120069" "subst" "0" "01943" "TMC8_000051" "g.76120069C>T" "" "" "" "TMC6(NM_001127198.2):c.1082+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000692485" "0" "30" "17" "76129534" "76129534" "subst" "5.28193E-5" "01943" "TMC8_000052" "g.76129534G>A" "" "" "" "TMC8(NM_152468.4):c.579G>A (p.P193=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000692486" "0" "50" "17" "76130484" "76130484" "subst" "0" "01943" "TMC8_000053" "g.76130484G>A" "" "" "" "TMC8(NM_152468.4):c.826G>A (p.E276K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000692487" "0" "50" "17" "76137063" "76137063" "subst" "0" "01943" "TMC8_000054" "g.76137063C>A" "" "" "" "TMC8(NM_152468.4):c.2051C>A (p.P684Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000726705" "0" "30" "17" "76113942" "76113942" "subst" "0" "02325" "TMC8_000055" "g.76113942C>T" "" "" "" "TMC6(NM_007267.7):c.1962G>A (p.T654=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000726706" "0" "30" "17" "76117744" "76117744" "subst" "0.0010435" "02326" "TMC6_000032" "g.76117744C>T" "" "" "" "TMC6(NM_001127198.2):c.1276G>A (p.G426R), TMC6(NM_001127198.5):c.1276G>A (p.G426R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000726707" "0" "30" "17" "76117751" "76117751" "subst" "2.92352E-5" "01943" "TMC8_000056" "g.76117751G>A" "" "" "" "TMC6(NM_001127198.2):c.1269C>T (p.S423=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000726708" "0" "30" "17" "76128092" "76128092" "subst" "0.00133515" "02326" "TMC6_000041" "g.76128092G>A" "" "" "" "TMC8(NM_152468.4):c.279G>A (p.G93=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000808281" "0" "30" "17" "76109263" "76109263" "subst" "0.000316436" "01943" "TMC8_000057" "g.76109263G>A" "" "" "" "TMC6(NM_001127198.2):c.2384C>T (p.P795L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000808282" "0" "50" "17" "76115394" "76115394" "subst" "0.000129948" "01943" "TMC8_000058" "g.76115394C>A" "" "" "" "TMC6(NM_001127198.2):c.1795G>T (p.G599W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000808283" "0" "50" "17" "76117783" "76117783" "subst" "0.0007095" "02325" "TMC8_000059" "g.76117783C>G" "" "" "" "TMC6(NM_007267.6):c.1237G>C (p.A413P), TMC6(NM_007267.7):c.1237G>C (p.A413P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000808284" "0" "30" "17" "76129615" "76129615" "subst" "0.000754609" "01943" "TMC8_000060" "g.76129615T>C" "" "" "" "TMC8(NM_152468.4):c.660T>C (p.T220=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000855121" "0" "30" "17" "76116924" "76116924" "subst" "0.000245539" "02326" "TMC8_000061" "g.76116924C>T" "" "" "" "TMC6(NM_007267.6):c.1536-11G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000855122" "0" "30" "17" "76120614" "76120614" "subst" "0" "01943" "TMC8_000062" "g.76120614G>A" "" "" "" "TMC6(NM_001127198.2):c.882C>T (p.L294=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000855123" "0" "50" "17" "76121860" "76121860" "subst" "0" "02325" "TMC8_000065" "g.76121860G>A" "" "" "" "TMC6(NM_007267.7):c.377C>T (p.P126L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000855124" "0" "50" "17" "76121897" "76121897" "subst" "0.000251162" "02325" "TMC8_000066" "g.76121897G>A" "" "" "" "TMC6(NM_007267.7):c.340C>T (p.R114W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000855125" "0" "30" "17" "76129615" "76129615" "subst" "0.000754609" "02326" "TMC8_000060" "g.76129615T>C" "" "" "" "TMC8(NM_152468.4):c.660T>C (p.T220=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000855126" "0" "30" "17" "76134100" "76134100" "subst" "0.00123705" "02326" "TMC8_000020" "g.76134100G>A" "" "" "" "TMC8(NM_152468.4):c.1364G>A (p.R455Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000855127" "0" "30" "17" "76134198" "76134198" "subst" "0.00115" "01943" "TMC8_000071" "g.76134198G>A" "" "" "" "TMC8(NM_152468.4):c.1462G>A (p.G488S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000855128" "0" "30" "17" "76134636" "76134636" "subst" "0.000427124" "02326" "TMC8_000072" "g.76134636C>T" "" "" "" "TMC8(NM_152468.4):c.1665-19C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000865519" "0" "50" "17" "76120673" "76120673" "subst" "7.06309E-5" "01943" "TMC8_000063" "g.76120673C>A" "" "" "" "TMC6(NM_001127198.2):c.823G>T (p.V275F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000865520" "0" "50" "17" "76121249" "76121249" "subst" "0.000336912" "01943" "TMC8_000064" "g.76121249G>A" "" "" "" "TMC6(NM_001127198.2):c.526C>T (p.R176C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000865521" "0" "30" "17" "76127956" "76127956" "subst" "0" "02326" "TMC8_000067" "g.76127956C>T" "" "" "" "TMC8(NM_152468.4):c.150-7C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000865522" "0" "30" "17" "76130475" "76130475" "subst" "0" "01943" "TMC8_000068" "g.76130475G>A" "" "" "" "TMC8(NM_152468.4):c.817G>A (p.V273M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000865523" "0" "30" "17" "76130534" "76130534" "subst" "0.00010171" "01943" "TMC8_000069" "g.76130534G>A" "" "" "" "TMC8(NM_152468.4):c.876G>A (p.T292=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000865524" "0" "30" "17" "76134078" "76134078" "subst" "0.00116938" "02326" "TMC8_000070" "g.76134078C>T" "" "" "" "TMC8(NM_152468.4):c.1350-8C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000894312" "0" "50" "17" "76109657" "76109657" "subst" "2.03074E-5" "02325" "TMC8_000073" "g.76109657C>T" "" "" "" "TMC6(NM_007267.7):c.2326G>A (p.E776K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000894313" "0" "30" "17" "76113452" "76113463" "del" "0" "02326" "TMC8_000074" "g.76113452_76113463del" "" "" "" "TMC6(NM_007267.6):c.2199-31_2199-20delTGGGCCCTGCCC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000894314" "0" "30" "17" "76113654" "76113654" "subst" "6.58428E-5" "02326" "TMC8_000075" "g.76113654A>G" "" "" "" "TMC6(NM_007267.6):c.2093T>C (p.V698A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000894315" "0" "30" "17" "76121868" "76121868" "subst" "0.000845816" "02326" "TMC8_000076" "g.76121868G>A" "" "" "" "TMC6(NM_007267.6):c.369C>T (p.S123=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000894316" "0" "30" "17" "76122351" "76122351" "subst" "0.000286902" "02326" "TMC8_000077" "g.76122351C>T" "" "" "" "TMC6(NM_007267.6):c.271+7G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000894317" "0" "30" "17" "76130091" "76130091" "subst" "0.000101733" "02326" "TMC6_000045" "g.76130091C>T" "" "" "" "TMC8(NM_152468.4):c.816+10C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000894318" "0" "50" "17" "76134666" "76134666" "subst" "1.21939E-5" "02327" "TMC8_000078" "g.76134666C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000914984" "0" "30" "17" "76113352" "76113352" "subst" "4.88138E-5" "02326" "TMC8_000079" "g.76113352T>C" "" "" "" "TMC6(NM_007267.6):c.2275A>G (p.N759D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000926647" "0" "30" "17" "76120809" "76120809" "subst" "0.000256728" "02326" "TMC8_000080" "g.76120809C>T" "" "" "" "TMC6(NM_007267.6):c.687G>A (p.P229=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000926648" "0" "30" "17" "76121981" "76121981" "subst" "0.000646259" "02326" "TMC8_000081" "g.76121981G>C" "" "" "" "TMC6(NM_007267.6):c.272-16C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000926649" "0" "30" "17" "76130576" "76130576" "subst" "0.00112948" "02326" "TMC8_000040" "g.76130576C>T" "" "" "" "TMC8(NM_152468.4):c.918C>T (p.N306=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000926650" "0" "10" "17" "76133397" "76133397" "subst" "0.00127141" "02326" "TMC8_000082" "g.76133397G>A" "" "" "" "TMC8(NM_152468.4):c.1209G>A (p.K403=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000930893" "0" "30" "17" "76116882" "76116882" "subst" "0" "02326" "TMC8_000083" "g.76116882T>C" "" "" "" "TMC6(NM_007267.6):c.1567A>G (p.T523A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000930894" "0" "30" "17" "76117783" "76117783" "subst" "0.0007095" "02326" "TMC8_000059" "g.76117783C>G" "" "" "" "TMC6(NM_007267.6):c.1237G>C (p.A413P), TMC6(NM_007267.7):c.1237G>C (p.A413P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000930895" "0" "30" "17" "76121885" "76121885" "subst" "0" "02326" "TMC8_000084" "g.76121885C>T" "" "" "" "TMC6(NM_007267.6):c.352G>A (p.G118R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000930896" "0" "50" "17" "76133406" "76133406" "subst" "6.49878E-5" "02325" "TMC8_000085" "g.76133406T>G" "" "" "" "TMC8(NM_152468.5):c.1218T>G (p.C406W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000930897" "0" "30" "17" "76134525" "76134525" "subst" "0.00151066" "02326" "TMC8_000021" "g.76134525T>C" "" "" "" "TMC8(NM_152468.4):c.1629T>C (p.L543=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000930898" "0" "30" "17" "76136989" "76136989" "subst" "7.44974E-5" "02326" "TMC8_000086" "g.76136989G>A" "" "" "" "TMC8(NM_152468.4):c.1977G>A (p.P659=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000951050" "0" "30" "17" "76122651" "76122651" "subst" "0.000207331" "02326" "TMC6_000017" "g.76122651C>T" "" "" "" "TMC6(NM_001127198.2):c.135G>A (p.T45=), TMC6(NM_007267.6):c.135G>A (p.T45=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000969243" "0" "10" "17" "76120792" "76120792" "subst" "0.00490971" "02326" "TMC6_000055" "g.76120792T>C" "" "" "" "TMC6(NM_007267.6):c.704A>G (p.K235R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000982825" "0" "10" "17" "76117158" "76117158" "subst" "0.00116273" "02326" "TMC8_000087" "g.76117158G>A" "" "" "" "TMC6(NM_007267.6):c.1471C>T (p.R491C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000982826" "0" "30" "17" "76121922" "76121922" "subst" "0.000947811" "01804" "TMC6_000016" "g.76121922C>T" "" "" "" "TMC6(NM_001127198.5):c.315G>A (p.(Thr105=)), TMC6(NM_007267.6):c.315G>A (p.T105=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes TMC8 ## Count = 152 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000248863" "00021226" "10" "917" "0" "917" "0" "c.917A>T" "r.(?)" "p.(Asn306Ile)" "" "0000248947" "00021226" "10" "-5377" "0" "-5377" "0" "c.-5377A>G" "r.(?)" "p.(=)" "" "0000249231" "00021226" "10" "-7176" "0" "-7176" "0" "c.-7176A>G" "r.(?)" "p.(=)" "" "0000311860" "00021226" "10" "-8407" "0" "-8407" "0" "c.-8407G>C" "r.(?)" "p.(=)" "" "0000311861" "00021226" "10" "2186" "0" "2186" "0" "c.*5T>G" "r.(=)" "p.(=)" "" "0000311862" "00021226" "10" "1107" "0" "1107" "0" "c.1107G>A" "r.(?)" "p.(Glu369=)" "" "0000311863" "00021226" "10" "1823" "15" "1823" "15" "c.1823+15C>A" "r.(=)" "p.(=)" "" "0000311864" "00021226" "10" "668" "13" "668" "13" "c.668+13T>C" "r.(=)" "p.(=)" "" "0000314528" "00021226" "30" "-10117" "0" "-10117" "0" "c.-10117G>A" "r.(?)" "p.(=)" "" "0000314529" "00021226" "30" "-11762" "0" "-11762" "0" "c.-11762del" "r.(?)" "p.(=)" "" "0000314530" "00021226" "50" "-13502" "0" "-13502" "0" "c.-13502C>T" "r.(?)" "p.(=)" "" "0000314531" "00021226" "10" "-17945" "0" "-17945" "0" "c.-17945C>T" "r.(?)" "p.(=)" "" "0000314532" "00021226" "30" "-5319" "0" "-5319" "0" "c.-5319C>T" "r.(?)" "p.(=)" "" "0000314533" "00021226" "30" "-6248" "0" "-6248" "0" "c.-6248G>A" "r.(?)" "p.(=)" "" "0000314534" "00021226" "10" "1024" "0" "1024" "0" "c.1024G>T" "r.(?)" "p.(Gly342Trp)" "" "0000314535" "00021226" "30" "1168" "0" "1168" "0" "c.1168G>A" "r.(?)" "p.(Val390Ile)" "" "0000314536" "00021226" "10" "1350" "-14" "1350" "-14" "c.1350-14T>G" "r.(=)" "p.(=)" "" "0000314537" "00021226" "10" "1501" "0" "1501" "0" "c.1501G>A" "r.(?)" "p.(Val501Ile)" "" "0000314538" "00021226" "10" "1665" "-5" "1665" "-5" "c.1665-5G>T" "r.spl?" "p.?" "" "0000314539" "00021226" "10" "669" "-4" "669" "-4" "c.669-4G>C" "r.spl?" "p.?" "" "0000314540" "00021226" "10" "77" "0" "77" "0" "c.77T>C" "r.(?)" "p.(Met26Thr)" "" "0000314541" "00021226" "10" "988" "-4" "988" "-4" "c.988-4G>A" "r.spl?" "p.?" "" "0000316655" "00021226" "30" "-7160" "0" "-7160" "0" "c.-7160G>A" "r.(?)" "p.(=)" "" "0000316656" "00021226" "30" "-4590" "0" "-4590" "0" "c.-4590C>T" "r.(?)" "p.(=)" "" "0000316657" "00021226" "30" "-10324" "0" "-10324" "0" "c.-10324C>T" "r.(?)" "p.(=)" "" "0000316658" "00021226" "10" "-5397" "0" "-5397" "0" "c.-5397G>A" "r.(?)" "p.(=)" "" "0000316659" "00021226" "10" "-5923" "0" "-5923" "0" "c.-5923G>A" "r.(?)" "p.(=)" "" "0000316660" "00021226" "50" "-5962" "0" "-5962" "0" "c.-5962G>A" "r.(?)" "p.(=)" "" "0000316661" "00021226" "30" "1571" "0" "1571" "0" "c.1571C>T" "r.(?)" "p.(Pro524Leu)" "" "0000316662" "00021226" "30" "1725" "0" "1725" "0" "c.1725C>T" "r.(?)" "p.(Val575=)" "" "0000316663" "00021226" "30" "1903" "-7" "1903" "-5" "c.1903-7_1903-5del" "r.spl?" "p.?" "" "0000316664" "00021226" "30" "1914" "0" "1914" "0" "c.1914G>A" "r.(?)" "p.(Glu638=)" "" "0000325656" "00021226" "30" "-9487" "0" "-9487" "0" "c.-9487C>G" "r.(?)" "p.(=)" "" "0000338721" "00021226" "10" "-11940" "0" "-11940" "0" "c.-11940G>A" "r.(?)" "p.(=)" "" "0000338722" "00021226" "10" "-11888" "0" "-11888" "0" "c.-11888T>C" "r.(?)" "p.(=)" "" "0000338723" "00021226" "10" "-7176" "0" "-7176" "0" "c.-7176A>G" "r.(?)" "p.(=)" "" "0000338724" "00021226" "30" "-6653" "0" "-6653" "0" "c.-6653T>C" "r.(?)" "p.(=)" "" "0000338725" "00021226" "10" "668" "13" "668" "13" "c.668+13T>C" "r.(=)" "p.(=)" "" "0000338726" "00021226" "10" "988" "-4" "988" "-4" "c.988-4G>T" "r.spl?" "p.?" "" "0000338727" "00021226" "30" "1533" "33" "1533" "33" "c.1533+33G>A" "r.(=)" "p.(=)" "" "0000338728" "00021226" "10" "1823" "15" "1823" "15" "c.1823+15C>A" "r.(=)" "p.(=)" "" "0000338729" "00021226" "10" "2186" "0" "2186" "0" "c.*5T>G" "r.(=)" "p.(=)" "" "0000340440" "00021226" "10" "1107" "0" "1107" "0" "c.1107G>A" "r.(?)" "p.(Glu369=)" "" "0000343698" "00021226" "10" "917" "0" "917" "0" "c.917A>T" "r.(?)" "p.(Asn306Ile)" "" "0000563256" "00021226" "30" "-17940" "0" "-17940" "0" "c.-17940A>G" "r.(?)" "p.(=)" "" "0000563257" "00021226" "10" "-13403" "0" "-13403" "0" "c.-13403C>A" "r.(?)" "p.(=)" "" "0000563258" "00021226" "10" "-13287" "0" "-13287" "0" "c.-13287G>A" "r.(?)" "p.(=)" "" "0000563259" "00021226" "30" "-12147" "0" "-12147" "0" "c.-12147G>A" "r.(?)" "p.(=)" "" "0000563260" "00021226" "10" "-12060" "0" "-12060" "0" "c.-12060A>T" "r.(?)" "p.(=)" "" "0000563261" "00021226" "10" "-10240" "0" "-10240" "0" "c.-10240C>T" "r.(?)" "p.(=)" "" "0000563262" "00021226" "30" "-10040" "0" "-10040" "0" "c.-10040G>A" "r.(?)" "p.(=)" "" "0000563263" "00021226" "30" "-9514" "0" "-9514" "0" "c.-9514C>A" "r.(?)" "p.(=)" "" "0000563264" "00021226" "10" "-9497" "0" "-9497" "0" "c.-9497C>T" "r.(?)" "p.(=)" "" "0000563265" "00021226" "30" "-7075" "0" "-7075" "0" "c.-7075G>A" "r.(?)" "p.(=)" "" "0000563266" "00021226" "10" "-6604" "0" "-6604" "0" "c.-6604C>T" "r.(?)" "p.(=)" "" "0000563267" "00021226" "10" "-6248" "0" "-6248" "0" "c.-6248G>A" "r.(?)" "p.(=)" "" "0000563268" "00021226" "30" "-6223" "0" "-6223" "0" "c.-6223G>A" "r.(?)" "p.(=)" "" "0000563269" "00021226" "50" "-5398" "0" "-5398" "0" "c.-5398C>T" "r.(?)" "p.(=)" "" "0000563270" "00021226" "10" "-5377" "0" "-5377" "0" "c.-5377A>G" "r.(?)" "p.(=)" "" "0000563271" "00021226" "30" "-5358" "0" "-5358" "0" "c.-5358C>T" "r.(?)" "p.(=)" "" "0000563272" "00021226" "50" "226" "0" "226" "0" "c.226C>T" "r.(?)" "p.(Arg76Cys)" "" "0000563274" "00021226" "30" "256" "0" "256" "0" "c.256C>G" "r.(?)" "p.(Arg86Gly)" "" "0000563275" "00021226" "10" "279" "0" "279" "0" "c.279G>A" "r.(?)" "p.(Gly93=)" "" "0000563276" "00021226" "30" "480" "0" "480" "0" "c.480G>A" "r.(?)" "p.(Pro160=)" "" "0000563277" "00021226" "50" "664" "0" "664" "0" "c.664C>T" "r.(?)" "p.(Arg222Trp)" "" "0000563278" "00021226" "30" "720" "0" "720" "0" "c.720G>A" "r.(?)" "p.(Ala240=)" "" "0000563279" "00021226" "30" "816" "10" "816" "10" "c.816+10C>T" "r.(=)" "p.(=)" "" "0000563280" "00021226" "10" "1349" "13" "1349" "13" "c.1349+13G>A" "r.(=)" "p.(=)" "" "0000563281" "00021226" "30" "1364" "0" "1364" "0" "c.1364G>A" "r.(?)" "p.(Arg455Gln)" "" "0000563282" "00021226" "10" "1629" "0" "1629" "0" "c.1629T>C" "r.(?)" "p.(Leu543=)" "" "0000563283" "00021226" "50" "1886" "0" "1886" "0" "c.1886G>T" "r.(?)" "p.(Arg629Leu)" "" "0000563284" "00021226" "30" "1982" "0" "1982" "0" "c.1982C>T" "r.(?)" "p.(Pro661Leu)" "" "0000595722" "00021226" "90" "188" "0" "188" "0" "c.188G>A" "r.(?)" "p.(Trp63*)" "3" "0000595723" "00021226" "90" "568" "0" "568" "0" "c.568C>T" "r.(?)" "p.(Arg190*)" "6" "0000595724" "00021226" "90" "1084" "0" "1084" "0" "c.1084G>T" "r.(?)" "p.(Glu362*)" "9" "0000595725" "00021226" "90" "1233" "0" "1233" "0" "c.1233C>A" "r.(?)" "p.(Tyr411*)" "10" "0000595726" "00021226" "90" "561" "0" "583" "0" "c.561_583del" "r.(?)" "p.(Ala188Glnfs*71)" "6" "0000595727" "00021226" "90" "326" "0" "338" "0" "c.326_338del" "r.(?)" "p.(Tyr109Serfs*10)" "4" "0000595728" "00021226" "90" "571" "0" "571" "0" "c.571del" "r.(?)" "p.(Val191Trpfs*35)" "7" "0000595729" "00021226" "90" "755" "0" "755" "0" "c.755del" "r.(?)" "p.(Phe252Serfs*32)" "8" "0000595730" "00021226" "90" "1486" "0" "1494" "0" "c.1486_1494dup" "r.(?)" "p.(Pro496_Leu498dup)" "12" "0000616850" "00021226" "50" "-10483" "0" "-10483" "0" "c.-10483G>A" "r.(?)" "p.(=)" "" "0000616851" "00021226" "30" "-4355" "0" "-4355" "0" "c.-4355C>T" "r.(?)" "p.(=)" "" "0000616852" "00021226" "10" "149" "39" "149" "39" "c.149+39dup" "r.(=)" "p.(=)" "" "0000616853" "00021226" "50" "299" "-20" "299" "-20" "c.299-20A>T" "r.(=)" "p.(=)" "" "0000616854" "00021226" "30" "918" "0" "918" "0" "c.918C>T" "r.(?)" "p.(Asn306=)" "" "0000616855" "00021226" "30" "1168" "0" "1168" "0" "c.1168G>A" "r.(?)" "p.(Val390Ile)" "" "0000616856" "00021226" "50" "1360" "0" "1360" "0" "c.1360G>T" "r.(?)" "p.(Asp454Tyr)" "" "0000616857" "00021226" "30" "2125" "0" "2125" "0" "c.2125C>T" "r.(?)" "p.(His709Tyr)" "" "0000623771" "00021226" "30" "-13602" "0" "-13602" "0" "c.-13602G>A" "r.(?)" "p.(=)" "" "0000623772" "00021226" "30" "-6287" "0" "-6287" "0" "c.-6287G>A" "r.(?)" "p.(=)" "" "0000623773" "00021226" "30" "-4642" "0" "-4642" "0" "c.-4642G>A" "r.(?)" "p.(=)" "" "0000649721" "00021226" "50" "1084" "0" "1084" "0" "c.1084G>T" "r.(?)" "p.(Glu362*)" "" "0000658268" "00021226" "30" "-10324" "0" "-10324" "0" "c.-10324C>T" "r.(?)" "p.(=)" "" "0000658269" "00021226" "30" "988" "-4" "988" "-4" "c.988-4G>A" "r.spl?" "p.?" "" "0000658270" "00021226" "30" "1571" "0" "1571" "0" "c.1571C>T" "r.(?)" "p.(Pro524Leu)" "" "0000658271" "00021226" "30" "1599" "0" "1599" "0" "c.1599C>T" "r.(?)" "p.(Phe533=)" "" "0000658272" "00021226" "30" "1876" "0" "1876" "0" "c.1876C>T" "r.(?)" "p.(His626Tyr)" "" "0000681041" "00021226" "70" "-13693" "0" "-13693" "0" "c.-13693C>T" "r.(?)" "p.(=)" "" "0000681042" "00021226" "30" "-11800" "0" "-11800" "0" "c.-11800C>T" "r.(?)" "p.(=)" "" "0000681043" "00021226" "50" "-6451" "0" "-6451" "0" "c.-6451G>A" "r.(?)" "p.(=)" "" "0000681044" "00021226" "50" "559" "0" "559" "0" "c.559G>A" "r.(?)" "p.(Gly187Ser)" "" "0000692482" "00021226" "30" "-13207" "0" "-13207" "0" "c.-13207G>A" "r.(?)" "p.(=)" "" "0000692483" "00021226" "50" "-10404" "0" "-10404" "0" "c.-10404C>A" "r.(?)" "p.(=)" "" "0000692484" "00021226" "50" "-7172" "0" "-7172" "0" "c.-7172C>T" "r.(?)" "p.(=)" "" "0000692485" "00021226" "30" "579" "0" "579" "0" "c.579G>A" "r.(?)" "p.(Pro193=)" "" "0000692486" "00021226" "50" "826" "0" "826" "0" "c.826G>A" "r.(?)" "p.(Glu276Lys)" "" "0000692487" "00021226" "50" "2051" "0" "2051" "0" "c.2051C>A" "r.(?)" "p.(Pro684Gln)" "" "0000726705" "00021226" "30" "-13299" "0" "-13299" "0" "c.-13299C>T" "r.(?)" "p.(=)" "" "0000726706" "00021226" "30" "-9497" "0" "-9497" "0" "c.-9497C>T" "r.(?)" "p.(=)" "" "0000726707" "00021226" "30" "-9490" "0" "-9490" "0" "c.-9490G>A" "r.(?)" "p.(=)" "" "0000726708" "00021226" "30" "279" "0" "279" "0" "c.279G>A" "r.(?)" "p.(Gly93=)" "" "0000808281" "00021226" "30" "-17978" "0" "-17978" "0" "c.-17978G>A" "r.(?)" "p.(=)" "" "0000808282" "00021226" "50" "-11847" "0" "-11847" "0" "c.-11847C>A" "r.(?)" "p.(=)" "" "0000808283" "00021226" "50" "-9458" "0" "-9458" "0" "c.-9458C>G" "r.(?)" "p.(=)" "" "0000808284" "00021226" "30" "660" "0" "660" "0" "c.660T>C" "r.(?)" "p.(Thr220=)" "" "0000855121" "00021226" "30" "-10317" "0" "-10317" "0" "c.-10317C>T" "r.(?)" "p.(=)" "" "0000855122" "00021226" "30" "-6627" "0" "-6627" "0" "c.-6627G>A" "r.(?)" "p.(=)" "" "0000855123" "00021226" "50" "-5381" "0" "-5381" "0" "c.-5381G>A" "r.(?)" "p.(=)" "" "0000855124" "00021226" "50" "-5344" "0" "-5344" "0" "c.-5344G>A" "r.(?)" "p.(=)" "" "0000855125" "00021226" "30" "660" "0" "660" "0" "c.660T>C" "r.(?)" "p.(Thr220=)" "" "0000855126" "00021226" "30" "1364" "0" "1364" "0" "c.1364G>A" "r.(?)" "p.(Arg455Gln)" "" "0000855127" "00021226" "30" "1462" "0" "1462" "0" "c.1462G>A" "r.(?)" "p.(Gly488Ser)" "" "0000855128" "00021226" "30" "1665" "-19" "1665" "-19" "c.1665-19C>T" "r.(=)" "p.(=)" "" "0000865519" "00021226" "50" "-6568" "0" "-6568" "0" "c.-6568C>A" "r.(?)" "p.(=)" "" "0000865520" "00021226" "50" "-5992" "0" "-5992" "0" "c.-5992G>A" "r.(?)" "p.(=)" "" "0000865521" "00021226" "30" "150" "-7" "150" "-7" "c.150-7C>T" "r.(=)" "p.(=)" "" "0000865522" "00021226" "30" "817" "0" "817" "0" "c.817G>A" "r.(?)" "p.(Val273Met)" "" "0000865523" "00021226" "30" "876" "0" "876" "0" "c.876G>A" "r.(?)" "p.(Thr292=)" "" "0000865524" "00021226" "30" "1350" "-8" "1350" "-8" "c.1350-8C>T" "r.(=)" "p.(=)" "" "0000894312" "00021226" "50" "-17584" "0" "-17584" "0" "c.-17584C>T" "r.(?)" "p.(=)" "" "0000894313" "00021226" "30" "-13789" "0" "-13778" "0" "c.-13789_-13778del" "r.(?)" "p.(=)" "" "0000894314" "00021226" "30" "-13587" "0" "-13587" "0" "c.-13587A>G" "r.(?)" "p.(=)" "" "0000894315" "00021226" "30" "-5373" "0" "-5373" "0" "c.-5373G>A" "r.(?)" "p.(=)" "" "0000894316" "00021226" "30" "-4890" "0" "-4890" "0" "c.-4890C>T" "r.(?)" "p.(=)" "" "0000894317" "00021226" "30" "816" "10" "816" "10" "c.816+10C>T" "r.(=)" "p.(=)" "" "0000894318" "00021226" "50" "1676" "0" "1676" "0" "c.1676C>T" "r.(?)" "p.(Ser559Phe)" "" "0000914984" "00021226" "30" "-13889" "0" "-13889" "0" "c.-13889T>C" "r.(?)" "p.(=)" "" "0000926647" "00021226" "30" "-6432" "0" "-6432" "0" "c.-6432C>T" "r.(?)" "p.(=)" "" "0000926648" "00021226" "30" "-5260" "0" "-5260" "0" "c.-5260G>C" "r.(?)" "p.(=)" "" "0000926649" "00021226" "30" "918" "0" "918" "0" "c.918C>T" "r.(?)" "p.(Asn306=)" "" "0000926650" "00021226" "10" "1209" "0" "1209" "0" "c.1209G>A" "r.(?)" "p.(Lys403=)" "" "0000930893" "00021226" "30" "-10359" "0" "-10359" "0" "c.-10359T>C" "r.(?)" "p.(=)" "" "0000930894" "00021226" "30" "-9458" "0" "-9458" "0" "c.-9458C>G" "r.(?)" "p.(=)" "" "0000930895" "00021226" "30" "-5356" "0" "-5356" "0" "c.-5356C>T" "r.(?)" "p.(=)" "" "0000930896" "00021226" "50" "1218" "0" "1218" "0" "c.1218T>G" "r.(?)" "p.(Cys406Trp)" "" "0000930897" "00021226" "30" "1629" "0" "1629" "0" "c.1629T>C" "r.(?)" "p.(Leu543=)" "" "0000930898" "00021226" "30" "1977" "0" "1977" "0" "c.1977G>A" "r.(?)" "p.(=)" "" "0000951050" "00021226" "30" "-4590" "0" "-4590" "0" "c.-4590C>T" "r.(?)" "p.(=)" "" "0000969243" "00021226" "10" "-6449" "0" "-6449" "0" "c.-6449T>C" "r.(?)" "p.(=)" "" "0000982825" "00021226" "10" "-10083" "0" "-10083" "0" "c.-10083G>A" "r.(?)" "p.(=)" "" "0000982826" "00021226" "30" "-5319" "0" "-5319" "0" "c.-5319C>T" "r.(?)" "p.(=)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 10 "{{screeningid}}" "{{variantid}}" "0000265146" "0000595722" "0000265147" "0000595723" "0000265148" "0000595724" "0000265149" "0000595725" "0000265150" "0000595726" "0000265151" "0000595727" "0000265152" "0000595728" "0000265153" "0000595729" "0000265154" "0000595730" "0000293032" "0000649721"