### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = TMX2) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "TMX2" "thioredoxin-related transmembrane protein 2" "11" "q12.1" "unknown" "NG_052993.1" "UD_132464866802" "" "https://www.LOVD.nl/TMX2" "" "1" "30739" "51075" "616715" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was performed by Johan den Dunnen, supported by Global Variome." "" "g" "https://databases.lovd.nl/shared/refseq/TMX2_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2019-12-07 12:32:32" "00000" "2026-01-20 18:57:21" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00021533" "TMX2" "transcript variant 1" "002" "NM_015959.3" "" "NP_057043.1" "" "" "" "-96" "1619" "891" "57479995" "57508445" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 3 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00139" "ID" "intellectual disability (ID)" "" "" "" "" "" "00084" "2013-06-04 18:18:07" "00006" "2015-02-09 10:02:49" "06153" "NEDMCMS" "Neurodevelopmental disorder with microcephaly, cortical malformations, and spasticity" "AR" "618730" "" "" "" "00006" "2021-12-10 23:20:41" "" "" "06982" "microlissencephaly" "microlissencephaly" "" "" "" "" "" "00006" "2022-12-05 13:17:25" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 1 "{{geneid}}" "{{diseaseid}}" "TMX2" "06153" ## Individuals ## Do not remove or alter this header ## ## Count = 22 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00269828" "" "" "" "1" "" "00006" "{PMID:Vandervore 2019:31735293}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "no" "Netherlands" "14d" "0" "" "" "" "Fam1Pat1" "00269829" "" "" "" "1" "" "00006" "{PMID:Vandervore 2019:31735293}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "no" "Portugal" "" "0" "" "" "" "Fam2Pat2" "00269830" "" "" "" "1" "" "00006" "{PMID:Vandervore 2019:31735293}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "no" "Australia;United Kingdom (Great Britain)" "" "0" "" "" "white" "Fam3Pat3" "00269831" "" "" "" "2" "" "00006" "{PMID:Vandervore 2019:31735293}" "2-generation family, 2 affected (F, M), unaffected heterozygous carrier parents" "M" "" "Puerto Rico" "" "0" "" "" "" "Fam4Pat4" "00269832" "" "" "00269831" "1" "" "00006" "{PMID:Vandervore 2019:31735293}" "" "F" "" "Puerto Rico" "" "0" "" "" "" "Fam4Pat5" "00269833" "" "" "" "2" "" "00006" "{PMID:Vandervore 2019:31735293}" "2-generation family, 2 affected (F, M), unaffected heterozygous carrier parents" "F" "no" "Spain" "" "0" "" "" "" "Fam5Pat6" "00269834" "" "" "00269833" "1" "" "00006" "{PMID:Vandervore 2019:31735293}" "" "M" "no" "Spain" "" "0" "" "" "" "Fam5Pat7" "00269835" "" "" "" "2" "" "00006" "{PMID:Vandervore 2019:31735293}" "2-generation family, 2 affected (2F), unaffected heterozygous carrier parents" "F" "yes" "" "6y" "0" "" "" "Arab" "Fam6Pat8" "00269836" "" "" "00269835" "1" "" "00006" "{PMID:Vandervore 2019:31735293}" "" "F" "yes" "" "" "0" "" "" "Arab" "Fam6Pat9" "00269837" "" "" "" "1" "" "00006" "{PMID:Vandervore 2019:31735293}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "no" "Netherlands" "7d" "0" "" "" "" "Fam7Pat10" "00269838" "" "" "" "2" "" "00006" "{PMID:Vandervore 2019:31735293}" "2-generation family, 2 affected (2M), unaffected heterozygous carrier parents/relatives" "M" "yes" "Iraq" "" "0" "" "" "" "Fam8Pat11" "00269839" "" "" "00269838" "1" "" "00006" "{PMID:Vandervore 2019:31735293}" "" "M" "yes" "Iraq" "" "0" "" "" "" "Fam8Pat12" "00269840" "" "" "" "1" "" "00006" "{PMID:Vandervore 2019:31735293}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "yes" "Pakistan" "" "0" "" "" "" "Fam9Pat13" "00269841" "" "" "" "1" "" "00006" "{PMID:Vandervore 2019:31735293}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "" "Mexico;Spain" "" "0" "" "" "" "Fam10Pat14" "00427091" "" "" "" "1" "" "00006" "{PMID:Ghosh 2020:31586943}" "3-generation family, 1 affected, unaffected heterozygous carrier parents/relatives" "F" "yes" "Saudi Arabia" "" "0" "" "" "" "Fam1673PatIII1" "00427092" "" "" "" "2" "" "00006" "{PMID:Ghosh 2020:31586943}" "2-generation family, 2 affected sisters, unaffected heterozygous carrier parents/relatives" "F" "yes" "Pakistan" "4y" "0" "" "" "" "Fam2525PatIII2" "00427093" "" "" "00427092" "1" "" "00006" "{PMID:Ghosh 2020:31586943}" "sister" "F" "yes" "Pakistan" "" "0" "" "" "" "Fam2525PatIII3" "00427094" "" "" "" "3" "" "00006" "{PMID:Ghosh 2020:31586943}" "3-generation family, 3 affected (F, 2M), unaffected heterozygous carrier parents/relatives" "M" "yes" "Egypt" "5y" "0" "" "" "" "Fam4984PatIII1" "00427095" "" "" "00427094" "1" "" "00006" "{PMID:Ghosh 2020:31586943}" "sister" "F" "yes" "Egypt" "" "0" "" "" "" "Fam4984PatIII3" "00427096" "" "" "00427094" "1" "" "00006" "{PMID:Ghosh 2020:31586943}" "brother" "M" "yes" "Egypt" "" "0" "" "" "" "Fam4984PatIII4" "00427097" "" "" "" "2" "" "00006" "{PMID:Ghosh 2020:31586943}" "2-generation family, affected brother/sister, unaffected heterozygous carrier parents/relatives" "M" "yes" "Kuwait" "" "0" "" "" "" "Fam3501PatIII6" "00427098" "" "" "00427097" "1" "" "00006" "{PMID:Ghosh 2020:31586943}" "sister" "F" "yes" "Kuwait" "" "0" "" "" "" "Fam3501PatIII7" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 22 "{{individualid}}" "{{diseaseid}}" "00269828" "00139" "00269829" "00139" "00269830" "00139" "00269831" "00139" "00269832" "00139" "00269833" "00139" "00269834" "00139" "00269835" "00139" "00269836" "00139" "00269837" "00139" "00269838" "00139" "00269839" "00139" "00269840" "00139" "00269841" "00139" "00427091" "06982" "00427092" "06982" "00427093" "06982" "00427094" "06982" "00427095" "06982" "00427096" "06982" "00427097" "06982" "00427098" "06982" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00139, 06153, 06982 ## Count = 22 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "0000207619" "00139" "00269828" "00006" "Familial, autosomal recessive" "00y00m14d" "see paper; ..., 2w-deceased; primary microcephaly (-3 SD birth), no developmental milestones; generalized apnea, status epilepticus; polymicrogyria; unlayered polymicrogyria and complete cortical disorganization" "" "" "" "" "" "" "" "" "intellectual disability" "0000207620" "00139" "00269829" "00006" "Familial, autosomal recessive" "07y" "see paper; ..., microcephaly (-4.5 SD 7y), signs of cerebral palsy, no speech, nonambulant; generalized epilepsy, absence, spasms; polymicrogyria" "" "" "" "" "" "" "" "" "intellectual disability" "0000207621" "00139" "00269830" "00006" "Familial, autosomal recessive" "09y" "see paper; ... primary microcephaly (-2.5 SD at birth; -6.7 SD 9y), signs of cerebral palsy, no speech, nonambulant; generalized epilepsy, seizures; polymicrogyria" "" "" "" "" "" "" "" "" "intellectual disability" "0000207622" "00139" "00269831" "00006" "Familial, autosomal recessive" "28y" "see paper; ... borderline microcephaly (-2.5 SD 28y), signs of cerebral palsy, no speech, nonambulant; focal seizures; progressive brain atrophy" "" "" "" "" "" "" "" "" "intellectual disability" "0000207623" "00139" "00269832" "00006" "Familial, autosomal recessive" "25y" "see paper; ..., microcephaly (-3 SD 25y), signs of cerebral palsy, no speech, nonambulant; myoclonic epilepsy, absence, generalized tonic clonic seizures; progressive brain atrophy" "" "" "" "" "" "" "" "" "intellectual disability" "0000207624" "00139" "00269833" "00006" "Familial, autosomal recessive" "13y" "see paper; ..., microcephaly (-2 SD birth, -4 SD 13y), signs of cerebral palsy, no speech, nonambulant; no seizures; pachygyria" "" "" "" "" "" "" "" "" "intellectual disability" "0000207625" "00139" "00269834" "00006" "Familial, autosomal recessive" "11y" "see paper; ..., microcephaly (-3.5 SD 11y), signs of cerebral palsy, no speech, nonambulant; generalized tonic clonic seizures; pachygyria" "" "" "" "" "" "" "" "" "intellectual disability" "0000207626" "00139" "00269835" "00006" "Familial, autosomal recessive" "06y" "see paper; ..., 6y-deceased; signs of cerebral palsy, no speech, nonambulant; generalized tonic clonic seizures; severe brain atrophy" "" "" "" "" "" "" "" "" "intellectual disability" "0000207627" "00139" "00269836" "00006" "Familial, autosomal recessive" "01y06m" "see paper; ..., microcephaly (0 SD birth, -5.5 SD 1y6m), signs of cerebral palsy, no speech, nonambulant; focal seizures; severe brain atrophy" "" "" "" "" "" "" "" "" "intellectual disability" "0000207628" "00139" "00269837" "00006" "Familial, autosomal recessive" "00y00m07d" "see paper; ..., 7d-deceased; microcephaly (-2.5 SD birth), no developmental milestones; apnea, diaphragmatic myoclonia, diffuse polymicrogyria, cobblestone-like malformation" "" "" "" "" "" "" "" "" "intellectual disability" "0000207629" "00139" "00269838" "00006" "Familial, autosomal recessive" "10y" "see paper; ..., microcephaly (-4.5 SD 10y); speech few words, nonambulant; generalized tonic epilepsy, myoclonic seizures" "" "" "" "" "" "" "" "" "intellectual disability" "0000207630" "00139" "00269839" "00006" "Familial, autosomal recessive" "05y" "see paper; ..., microcephaly (-2.5 SD birth, -3.5 SD 5y); no speech, nonambulant; generalized tonic clonic seizures; polymicrogyria" "" "" "" "" "" "" "" "" "intellectual disability" "0000207631" "00139" "00269840" "00006" "Familial, autosomal recessive" "04y10m" "see paper; ..., microcephaly (-0.5 SD 4y10m); speech few words, walk with support; myoclonic status epilepticus; hemihypertrophy, frontal dysgyria" "" "" "" "" "" "" "" "" "intellectual disability" "0000207632" "00139" "00269841" "00006" "Familial, autosomal recessive" "11y06m" "see paper; ..., microcephaly (-0.8 SD 11y6m); IQ 62, language disorder, hyperactive behavior, able to walk; no seizures; brain MRI normal" "" "" "" "" "" "" "" "" "intellectual disability" "0000318108" "06982" "00427091" "00006" "Familial, autosomal recessive" "11y" "birth full term, weight 2990g, OFC -2SD; weight 20kg, height 125cm, OFC -3SD; no gross motor delay, no fine motor delay, no speech delay, normal social development; neonatal seizures, generalized tonic-clonic seizures (2/w), refractory, EEG multifocal spike/wave; lissencephaly spectrum; cerebral mantle thickening; no subcortical band heterotopia; corpus callosum hypogenesis; no cerebellar atrophy; no brainstem hypoplasia; ventriculomegly; reduced white matter; severe intellectual disability; hypertonia; no hypotonia; Increased deep tendon reflexes; spastic tetraplegia; no ataxia; vision fixes/follows; hearing responds to noise; no dysmorphism" "" "" "" "" "" "" "" "NEDMCMS" "microlissencephaly" "0000318109" "06982" "00427092" "00006" "Familial, autosomal recessive" "7y" "4y-died (seizures); birth full term, weight 3300g, OFC -3SD; weight 17kg, height 112cm, OFC -3SD; gross motor delay, no fine motor delay, no speech delay, delayed social development; 2w-seizures, generalized tonic-clonic seizures (2/w), refractory, EEG multifocal spike/wave; lissencephaly spectrum; no cerebral mantle thickening; no subcortical band heterotopia; corpus callosum hypogenesis; no cerebellar atrophy; no brainstem hypoplasia; ventriculomegly; reduced white matter; severe intellectual disability; hypertonia; no hypotonia; Increased deep tendon reflexes; spastic tetraplegia; no ataxia; vision fixes/follows; hearing responds to noise; no dysmorphism" "" "" "" "" "" "" "" "NEDMCMS" "microlissencephaly" "0000318110" "06982" "00427093" "00006" "Familial, autosomal recessive" "5y" "birth full term, weight 3200g, OFC -2SD; weight 10kg, height 90 cm, OFC -4SD; gross motor delay, no fine motor delay, no speech delay, normal social development; 3w-seizures, generalized tonic-clonic seizures (1/w), refractory, EEG multifocal spike/wave; lissencephaly spectrum; no cerebral mantle thickening; no subcortical band heterotopia; corpus callosum hypogenesis; no cerebellar atrophy; no brainstem hypoplasia; ventriculomegly; reduced white matter; severe intellectual disability; hypertonia; no hypotonia; Increased deep tendon reflexes; spastic tetraplegia; no ataxia; vision fixes/follows; hearing responds to noise; no dysmorphism" "" "" "" "" "" "" "" "NEDMCMS" "microlissencephaly" "0000318111" "06982" "00427094" "00006" "Familial, autosomal recessive" "4y" "5y-died (pneumonia); birth full term, weight 3100g, OFC -1SD; weight 11kg, height 92cm, OFC -4SD; gross motor delay, no fine motor delay, speech delayed (babbles), normal social development; 1m-seizures, generalized tonic-clonic seizures (1/m), refractory, EEG multifocal spike/wave; severe intellectual disability; hypertonia; no hypotonia; Increased deep tendon reflexes; spastic tetraplegia; no ataxia; vision fixes/follows; hearing responds to noise; no dysmorphism" "" "" "" "" "" "" "" "NEDMCMS" "microlissencephaly" "0000318112" "06982" "00427095" "00006" "Familial, autosomal recessive" "2y" "birth-36w, weight 2800g,; weight 8kg, height 75cm, OFC -3SD; gross motor delay, no fine motor delay, no speech delay, normal social development; 1m-seizures, generalized tonic-clonic seizures (1/m), refractory, EEG multifocal spike/wave; lissencephaly spectrum; no cerebral mantle thickening; no subcortical band heterotopia; corpus callosum hypogenesis; cerebellar atrophy; brainstem hypoplasia; ventriculomegly; reduced white matter; severe intellectual disability; hypertonia; no hypotonia; Increased deep tendon reflexes; spastic tetraplegia; no ataxia; EMG normal; vision fixes/follows; hearing responds to noise; no dysmorphism" "" "" "" "" "" "" "" "NEDMCMS" "microlissencephaly" "0000318113" "06982" "00427096" "00006" "Familial, autosomal recessive" "1y" "birth-36w, weight 2900g, OFC -2SD; weight 7kg, height 65cm, OFC -4SD; no gross motor delay, no fine motor delay, speech delayed (babbles), normal social development; 6w-seizures, generalized tonic-clonic seizures (2/m), refractory, EEG multifocal spike/wave; severe intellectual disability; hypertonia; no hypotonia; Increased deep tendon reflexes; spastic tetraplegia; no ataxia; EMG normal; vision fixes/follows; hearing responds to noise; no dysmorphism" "" "" "" "" "" "" "" "NEDMCMS" "microlissencephaly" "0000318114" "06982" "00427097" "00006" "Familial, autosomal recessive" "8y" "birth full term, weight 3100g, OFC -2SD; weight 22kg, height 110cm, OFC -4SD; gross motor delay, no fine motor delay, no speech delay, normal social development; 2m-seizures, generalized tonic-clonic seizures (4/m), refractory, EEG multifocal spike/wave; lissencephaly spectrum; cerebral mantle thickening; no subcortical band heterotopia; corpus callosum hypogenesis; cerebellar atrophy; brainstem hypoplasia; ventriculomegly; reduced white matter; severe intellectual disability; hypertonia; no hypotonia; Increased deep tendon reflexes; spastic tetraplegia; no ataxia; vision fixes/follows; hearing responds to noise; no dysmorphism" "" "" "" "" "" "" "" "NEDMCMS" "microlissencephaly" "0000318115" "06982" "00427098" "00006" "Familial, autosomal recessive" "6y" "birth full term, weight 3100g, OFC -2SD; weight 12kg, height 85cm, OFC -3SD; no gross motor delay, no fine motor delay, speech delayed, delayed social development; 2m-seizures, generalized tonic-clonic seizures (2/m), refractory, EEG multifocal spike/wave; lissencephaly spectrum; cerebral mantle thickening; no subcortical band heterotopia; corpus callosum hypogenesis; cerebellar atrophy; brainstem hypoplasia; ventriculomegly; reduced white matter; severe intellectual disability; hypertonia; no hypotonia; Increased deep tendon reflexes; spastic tetraplegia; no ataxia; vision fixes/follows; hearing responds to noise; no dysmorphism" "" "" "" "" "" "" "" "NEDMCMS" "microlissencephaly" ## Screenings ## Do not remove or alter this header ## ## Count = 22 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000270980" "00269828" "1" "00006" "00006" "2019-12-07 13:20:49" "00006" "2019-12-07 16:14:02" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "" "WES" "0000270981" "00269829" "1" "00006" "00006" "2019-12-07 13:20:49" "00006" "2019-12-07 16:14:56" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "" "WES" "0000270982" "00269830" "1" "00006" "00006" "2019-12-07 13:20:49" "00006" "2019-12-07 16:21:41" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "" "WES" "0000270983" "00269831" "1" "00006" "00006" "2019-12-07 13:20:49" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000270984" "00269832" "1" "00006" "00006" "2019-12-07 13:20:49" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000270985" "00269833" "1" "00006" "00006" "2019-12-07 13:20:49" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000270986" "00269834" "1" "00006" "00006" "2019-12-07 13:20:49" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000270987" "00269835" "1" "00006" "00006" "2019-12-07 13:20:49" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000270988" "00269836" "1" "00006" "00006" "2019-12-07 13:20:49" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000270989" "00269837" "1" "00006" "00006" "2019-12-07 13:20:49" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000270990" "00269838" "1" "00006" "00006" "2019-12-07 13:20:49" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000270991" "00269839" "1" "00006" "00006" "2019-12-07 13:20:49" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000270992" "00269840" "1" "00006" "00006" "2019-12-07 13:20:49" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000270993" "00269841" "1" "00006" "00006" "2019-12-07 13:20:49" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000428411" "00427091" "1" "00006" "00006" "2022-12-05 13:20:21" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000428412" "00427092" "1" "00006" "00006" "2022-12-05 13:20:21" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000428413" "00427093" "1" "00006" "00006" "2022-12-05 13:20:21" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000428414" "00427094" "1" "00006" "00006" "2022-12-05 13:20:21" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000428415" "00427095" "1" "00006" "00006" "2022-12-05 13:20:21" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000428416" "00427096" "1" "00006" "00006" "2022-12-05 13:20:21" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000428417" "00427097" "1" "00006" "00006" "2022-12-05 13:20:21" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000428418" "00427098" "1" "00006" "00006" "2022-12-05 13:20:21" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 14 "{{screeningid}}" "{{geneid}}" "0000270980" "TMX2" "0000270981" "TMX2" "0000270982" "TMX2" "0000270983" "TMX2" "0000270984" "TMX2" "0000270985" "TMX2" "0000270986" "TMX2" "0000270987" "TMX2" "0000270988" "TMX2" "0000270989" "TMX2" "0000270990" "TMX2" "0000270991" "TMX2" "0000270992" "TMX2" "0000270993" "TMX2" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 105 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000255892" "0" "90" "11" "57480254" "57480254" "subst" "8.13286E-6" "01943" "TMX2_000002" "g.57480254A>C" "" "" "" "TMX2(NM_015959.4):c.164A>C (p.D55A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.57712782A>C" "" "pathogenic" "" "0000267192" "0" "50" "11" "57574441" "57574441" "subst" "0.000309862" "02325" "TMX2-CTNND1_000004" "g.57574441C>T" "" "" "" "CTNND1(NM_001085458.1):c.1949C>T (p.T650M), CTNND1(NM_001085458.2):c.1949C>T (p.T650M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.57806969C>T" "" "VUS" "" "0000267193" "0" "50" "11" "57575877" "57575877" "subst" "0.000119003" "02325" "TMX2-CTNND1_000005" "g.57575877C>T" "" "" "" "CTNND1(NM_001085458.2):c.2107C>T (p.R703C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.57808405C>T" "" "VUS" "" "0000274585" "0" "90" "11" "57569620" "57569620" "subst" "0" "01943" "CTNND1_000001" "g.57569620C>T" "" "" "" "CTNND1(NM_001085458.1):c.1372C>T (p.R458*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.57802148C>T" "" "pathogenic" "" "0000274586" "0" "50" "11" "57577619" "57577619" "subst" "4.48537E-5" "01943" "TMX2-CTNND1_000007" "g.57577619T>C" "" "" "" "CTNND1(NM_001085458.1):c.2474T>C (p.V825A, p.(Val825Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.57810147T>C" "" "VUS" "" "0000322248" "0" "50" "11" "57505879" "57505879" "subst" "0" "01804" "TMX2-CTNND1_000003" "g.57505879T>C" "" "" "" "TMX2(NM_001144012.2):c.304T>C (p.(Tyr102His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.57738407T>C" "" "VUS" "" "0000544635" "0" "30" "11" "57480232" "57480232" "subst" "0.00302759" "01943" "C11orf31_000002" "g.57480232G>C" "" "" "" "TMX2(NM_015959.4):c.142G>C (p.G48R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.57712760G>C" "" "likely benign" "" "0000544636" "0" "50" "11" "57480270" "57480270" "subst" "0.00107137" "01943" "C11orf31_000003" "g.57480270C>G" "" "" "" "TMX2(NM_001347890.1):c.180C>G (p.D60E), TMX2(NM_015959.4):c.180C>G (p.D60E, p.(Asp60Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.57712798C>G" "" "VUS" "" "0000544637" "0" "90" "11" "57505852" "57505852" "dup" "0" "01943" "C11orf31_000004" "g.57505852dup" "" "" "" "TMX2(NM_015959.4):c.391dupC (p.L131Pfs*6)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.57738380dup" "" "pathogenic" "" "0000544638" "0" "30" "11" "57558849" "57558849" "subst" "0" "01943" "C11orf31_000005" "g.57558849C>G" "" "" "" "CTNND1(NM_001085458.1):c.-94-8C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.57791377C>G" "" "likely benign" "" "0000544639" "0" "30" "11" "57558992" "57558992" "subst" "0.000116607" "01943" "C11orf31_000006" "g.57558992C>T" "" "" "" "CTNND1(NM_001085458.1):c.42C>T (p.A14=), CTNND1(NM_001085458.2):c.42C>T (p.A14=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.57791520C>T" "" "likely benign" "" "0000544640" "0" "30" "11" "57559050" "57559050" "subst" "0.00014041" "01943" "C11orf31_000007" "g.57559050C>G" "" "" "" "CTNND1(NM_001085458.1):c.100C>G (p.R34G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.57791578C>G" "" "likely benign" "" "0000544641" "0" "30" "11" "57563080" "57563080" "subst" "0" "01804" "C11orf31_000008" "g.57563080C>T" "" "" "" "CTNND1(NM_001085458.1):c.299C>T (p.(Pro100Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.57795608C>T" "" "likely benign" "" "0000544642" "0" "50" "11" "57564380" "57564380" "subst" "1.27185E-5" "01943" "C11orf31_000009" "g.57564380A>G" "" "" "" "CTNND1(NM_001085458.1):c.872A>G (p.Y291C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.57796908A>G" "" "VUS" "" "0000544643" "0" "30" "11" "57571209" "57571209" "subst" "0.000451873" "01943" "C11orf31_000010" "g.57571209A>G" "" "" "" "CTNND1(NM_001085458.1):c.1537A>G (p.N513D), CTNND1(NM_001085458.2):c.1537A>G (p.N513D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.57803737A>G" "" "likely benign" "" "0000544644" "0" "30" "11" "57573960" "57573961" "ins" "0" "01943" "C11orf31_000011" "g.57573960_57573961insA" "" "" "" "CTNND1(NM_001085458.1):c.1894+10_1894+11insA" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.57806488_57806489insA" "" "likely benign" "" "0000544645" "0" "30" "11" "57576944" "57576944" "subst" "0.000539919" "01943" "C11orf31_000012" "g.57576944C>G" "" "" "" "CTNND1(NM_001085458.1):c.2435+6C>G, CTNND1(NM_001085458.2):c.2435+6C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.57809472C>G" "" "likely benign" "" "0000544646" "0" "30" "11" "57578951" "57578951" "subst" "3.67209E-5" "01943" "C11orf31_000013" "g.57578951A>G" "" "" "" "CTNND1(NM_001085458.1):c.2631A>G (p.Q877=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.57811479A>G" "" "likely benign" "" "0000613458" "0" "30" "11" "57506518" "57506518" "subst" "3.24915E-5" "01943" "C11orf31_000014" "g.57506518A>G" "" "" "" "TMX2(NM_015959.4):c.614+7A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.57739046A>G" "" "likely benign" "" "0000613459" "0" "50" "11" "57571096" "57571096" "subst" "8.30558E-6" "01943" "C11orf31_000017" "g.57571096C>T" "" "" "" "CTNND1(NM_001085458.1):c.1424C>T (p.T475I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.57803624C>T" "" "VUS" "" "0000622642" "0" "30" "11" "57558974" "57558974" "subst" "0.000308933" "01943" "C11orf31_000015" "g.57558974G>C" "" "" "" "CTNND1(NM_001085458.1):c.24G>C (p.S8=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.57791502G>C" "" "likely benign" "" "0000622643" "0" "10" "11" "57561543" "57561543" "subst" "0.00121429" "01943" "C11orf31_000016" "g.57561543A>G" "" "" "" "CTNND1(NM_001085458.1):c.257A>G (p.N86S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.57794071A>G" "" "benign" "" "0000624809" "1" "90" "11" "57480254" "57480254" "subst" "8.13286E-6" "00006" "TMX2_000002" "g.57480254A>C" "" "{PMID:Vandervore 2019:31735293}" "" "" "" "Germline" "" "" "0" "" "" "g.57712782A>C" "" "pathogenic (recessive)" "" "0000624810" "3" "90" "11" "57506511" "57506511" "subst" "4.06138E-5" "00006" "TMX2_000003" "g.57506511G>A" "" "{PMID:Vandervore 2019:31735293}" "" "" "" "Germline" "" "" "0" "" "" "g.57739039G>A" "" "pathogenic (recessive)" "" "0000624811" "1" "90" "11" "57480247" "57480247" "subst" "2.43926E-5" "00006" "TMX2_000004" "g.57480247C>T" "" "{PMID:Vandervore 2019:31735293}" "" "" "" "Germline" "" "" "0" "" "" "g.57712775C>T" "" "pathogenic (recessive)" "" "0000624812" "3" "90" "11" "57480256" "57480256" "subst" "4.06805E-5" "00006" "TMX2_000006" "g.57480256G>C" "" "{PMID:Vandervore 2019:31735293}" "" "" "" "Germline" "" "" "0" "" "" "g.57712784G>C" "" "pathogenic (recessive)" "" "0000624813" "3" "90" "11" "57480256" "57480256" "subst" "4.06805E-5" "00006" "TMX2_000006" "g.57480256G>C" "" "{PMID:Vandervore 2019:31735293}" "" "" "" "Germline" "" "" "0" "" "" "g.57712784G>C" "" "pathogenic (recessive)" "" "0000624814" "1" "90" "11" "57505460" "57505460" "subst" "8.12328E-6" "00006" "TMX2_000007" "g.57505460A>G" "" "{PMID:Vandervore 2019:31735293}" "" "" "" "Germline" "" "" "0" "" "" "g.57737988A>G" "" "pathogenic (recessive)" "" "0000624815" "1" "90" "11" "57505460" "57505460" "subst" "8.12328E-6" "00006" "TMX2_000007" "g.57505460A>G" "" "{PMID:Vandervore 2019:31735293}" "" "" "" "Germline" "" "" "0" "" "" "g.57737988A>G" "" "pathogenic (recessive)" "" "0000624816" "3" "90" "11" "57506226" "57506226" "subst" "0" "00006" "TMX2_000009" "g.57506226G>A" "" "{PMID:Vandervore 2019:31735293}" "" "" "" "Germline" "" "" "0" "" "" "g.57738754G>A" "" "pathogenic (recessive)" "" "0000624817" "3" "90" "11" "57506226" "57506226" "subst" "0" "00006" "TMX2_000009" "g.57506226G>A" "" "{PMID:Vandervore 2019:31735293}" "" "" "" "Germline" "" "" "0" "" "" "g.57738754G>A" "" "pathogenic (recessive)" "" "0000624818" "1" "90" "11" "57480254" "57480254" "subst" "8.13286E-6" "00006" "TMX2_000002" "g.57480254A>C" "" "{PMID:Vandervore 2019:31735293}" "" "" "" "Germline" "" "" "0" "" "" "g.57712782A>C" "" "pathogenic (recessive)" "" "0000624819" "3" "90" "11" "57480274" "57480274" "subst" "0" "00006" "TMX2_000011" "g.57480274G>C" "" "{PMID:Vandervore 2019:31735293}" "" "" "" "Germline" "" "" "0" "" "" "g.57712802G>C" "" "pathogenic (recessive)" "" "0000624820" "3" "90" "11" "57480274" "57480274" "subst" "0" "00006" "TMX2_000011" "g.57480274G>C" "" "{PMID:Vandervore 2019:31735293}" "" "" "" "Germline" "" "" "0" "" "" "g.57712802G>C" "" "pathogenic (recessive)" "" "0000624821" "3" "90" "11" "57480268" "57480268" "subst" "0" "00006" "TMX2_000012" "g.57480268G>A" "" "{PMID:Vandervore 2019:31735293}" "" "" "" "Germline" "" "" "0" "" "" "g.57712796G>A" "" "pathogenic (recessive)" "" "0000624822" "1" "90" "11" "57505483" "57505483" "subst" "4.07608E-6" "00006" "TMX2_000013" "g.57505483A>G" "" "{PMID:Vandervore 2019:31735293}" "" "" "" "Germline" "" "" "0" "" "" "g.57738011A>G" "" "pathogenic (recessive)" "" "0000624823" "2" "90" "11" "57505852" "57505852" "dup" "0" "00006" "TMX2_000001" "g.57505852dup" "" "{PMID:Vandervore 2019:31735293}" "" "" "RNA expression 0.02-0.03" "Germline" "" "" "0" "" "" "g.57738380dup" "" "pathogenic (recessive)" "" "0000624824" "2" "90" "11" "57507583" "57507583" "subst" "4.06802E-6" "00006" "TMX2_000005" "g.57507583C>T" "" "{PMID:Vandervore 2019:31735293}" "" "" "RNA expression 0.23" "Germline" "" "" "0" "" "" "g.57740111C>T" "" "pathogenic (recessive)" "" "0000624825" "2" "90" "11" "57506679" "57506679" "subst" "1.62423E-5" "00006" "TMX2_000008" "g.57506679C>T" "" "{PMID:Vandervore 2019:31735293}" "" "" "" "Germline" "" "" "0" "" "" "g.57739207C>T" "" "pathogenic (recessive)" "" "0000624826" "2" "90" "11" "57506679" "57506679" "subst" "1.62423E-5" "00006" "TMX2_000008" "g.57506679C>T" "" "{PMID:Vandervore 2019:31735293}" "" "" "" "Germline" "" "" "0" "" "" "g.57739207C>T" "" "pathogenic (recessive)" "" "0000624827" "2" "50" "11" "57506506" "57506526" "del" "0" "00006" "TMX2_000010" "g.57506506_57506526del" "" "{PMID:Vandervore 2019:31735293}" "" "" "" "Germline" "" "" "0" "" "" "g.57739034_57739054del" "" "pathogenic (recessive)" "" "0000624828" "2" "50" "11" "57506679" "57506679" "subst" "1.62423E-5" "00006" "TMX2_000008" "g.57506679C>T" "" "{PMID:Vandervore 2019:31735293}" "" "" "" "Germline" "" "" "0" "" "" "g.57739207C>T" "" "pathogenic (recessive)" "" "0000656819" "0" "30" "11" "57561544" "57561544" "subst" "0" "01943" "C11orf31_000018" "g.57561544C>T" "" "" "" "CTNND1(NM_001085458.1):c.258C>T (p.N86=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.57794072C>T" "" "likely benign" "" "0000679229" "0" "30" "11" "57573454" "57573454" "subst" "0" "01943" "C11orf31_000019" "g.57573454C>G" "" "" "" "CTNND1(NM_001085458.1):c.1823C>G (p.A608G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000679230" "0" "30" "11" "57576792" "57576792" "subst" "4.06438E-6" "01943" "C11orf31_000020" "g.57576792G>A" "" "" "" "CTNND1(NM_001085458.1):c.2289G>A (p.Q763=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000723498" "0" "50" "11" "57480270" "57480270" "subst" "0.00107137" "02329" "C11orf31_000003" "g.57480270C>G" "" "" "" "TMX2(NM_001347890.1):c.180C>G (p.D60E), TMX2(NM_015959.4):c.180C>G (p.D60E, p.(Asp60Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000723499" "0" "30" "11" "57506500" "57506500" "subst" "4.06108E-5" "01943" "C11orf31_000021" "g.57506500T>C" "" "" "" "TMX2(NM_001347895.1):c.321T>C (p.D107=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000723500" "0" "30" "11" "57569457" "57569457" "subst" "0.000121852" "01943" "C11orf31_000022" "g.57569457C>T" "" "" "" "CTNND1(NM_001085458.1):c.1209C>T (p.D403=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000723501" "0" "30" "11" "57572259" "57572259" "subst" "0" "01943" "C11orf31_000023" "g.57572259G>T" "" "" "" "CTNND1(NM_001085458.1):c.1722+7G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000723502" "0" "50" "11" "57574441" "57574441" "subst" "0.000309862" "01943" "TMX2-CTNND1_000004" "g.57574441C>T" "" "" "" "CTNND1(NM_001085458.1):c.1949C>T (p.T650M), CTNND1(NM_001085458.2):c.1949C>T (p.T650M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000723503" "0" "30" "11" "57576852" "57576852" "subst" "0.00058538" "01943" "C11orf31_000024" "g.57576852C>T" "" "" "" "CTNND1(NM_001085458.1):c.2349C>T (p.N783=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000723504" "0" "30" "11" "57582878" "57582878" "subst" "0.000340536" "01943" "C11orf31_000025" "g.57582878C>A" "" "" "" "CTNND1(NM_001085458.1):c.2714C>A (p.S905Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000805197" "0" "30" "11" "57563967" "57563967" "subst" "4.06832E-6" "01943" "C11orf31_000026" "g.57563967A>G" "" "" "" "CTNND1(NM_001085458.1):c.459A>G (p.V153=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000853033" "0" "50" "11" "57492041" "57492041" "subst" "0" "01943" "C11orf31_000027" "g.57492041C>T" "" "" "" "TMX2(NM_001347891.1):c.196C>T (p.R66C), TMX2(NM_001347891.2):c.196C>T (p.(Arg66Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000853034" "0" "30" "11" "57561488" "57561488" "subst" "0.000393833" "01943" "C11orf31_000028" "g.57561488C>T" "" "" "" "CTNND1(NM_001085458.1):c.202C>T (p.R68W), CTNND1(NM_001085458.2):c.202C>T (p.R68W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000853035" "0" "50" "11" "57569438" "57569438" "subst" "8.12447E-6" "02325" "C11orf31_000029" "g.57569438A>G" "" "" "" "CTNND1(NM_001085458.2):c.1190A>G (p.N397S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000853036" "0" "30" "11" "57569667" "57569667" "subst" "2.07691E-5" "01943" "C11orf31_000030" "g.57569667C>T" "" "" "" "CTNND1(NM_001085458.1):c.1419C>T (p.T473=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000853037" "0" "30" "11" "57578943" "57578943" "subst" "0.000693283" "01943" "C11orf31_000032" "g.57578943C>T" "" "" "" "CTNND1(NM_001085458.1):c.2623C>T (p.R875W), CTNND1(NM_001085458.2):c.2623C>T (p.R875W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000862588" "0" "50" "11" "57575929" "57575929" "subst" "8.14266E-6" "01943" "C11orf31_000031" "g.57575929C>A" "" "" "" "CTNND1(NM_001085458.1):c.2159C>A (p.T720N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000889992" "0" "50" "11" "57563136" "57563136" "subst" "0" "02325" "C11orf31_000033" "g.57563136G>C" "" "" "" "CTNND1(NM_001085458.2):c.355G>C (p.G119R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000889993" "0" "30" "11" "57578974" "57578974" "subst" "0.00039487" "02326" "C11orf31_000034" "g.57578974G>A" "" "" "" "CTNND1(NM_001085458.2):c.2638+16G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000889994" "0" "30" "11" "57581818" "57581818" "subst" "0.000387434" "02326" "C11orf31_000035" "g.57581818A>G" "" "" "" "CTNND1(NM_001085458.2):c.2674A>G (p.N892D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000906205" "3" "90" "11" "57506511" "57506511" "subst" "4.06138E-5" "00006" "TMX2_000003" "g.57506511G>A" "" "{PMID:Ghosh 2020:31586943}" "" "500G>A (Arg205Gln)" "" "Germline" "" "" "0" "" "" "g.57739039G>A" "" "pathogenic (recessive)" "" "0000906206" "3" "90" "11" "57506511" "57506511" "subst" "4.06138E-5" "00006" "TMX2_000003" "g.57506511G>A" "" "{PMID:Ghosh 2020:31586943}" "" "500G>A (Arg205Gln)" "" "Germline" "yes" "" "0" "" "" "g.57739039G>A" "" "pathogenic (recessive)" "" "0000906207" "3" "90" "11" "57506511" "57506511" "subst" "4.06138E-5" "00006" "TMX2_000003" "g.57506511G>A" "" "{PMID:Ghosh 2020:31586943}" "" "500G>A (Arg205Gln)" "" "Germline" "yes" "" "0" "" "" "g.57739039G>A" "" "pathogenic (recessive)" "" "0000906208" "3" "90" "11" "57506511" "57506511" "subst" "4.06138E-5" "00006" "TMX2_000003" "g.57506511G>A" "" "{PMID:Ghosh 2020:31586943}" "" "500G>A (Arg205Gln)" "" "Germline" "yes" "" "0" "" "" "g.57739039G>A" "" "pathogenic (recessive)" "" "0000906209" "3" "90" "11" "57506511" "57506511" "subst" "4.06138E-5" "00006" "TMX2_000003" "g.57506511G>A" "" "{PMID:Ghosh 2020:31586943}" "" "500G>A (Arg205Gln)" "" "Germline" "yes" "" "0" "" "" "g.57739039G>A" "" "pathogenic (recessive)" "" "0000906210" "3" "90" "11" "57506511" "57506511" "subst" "4.06138E-5" "00006" "TMX2_000003" "g.57506511G>A" "" "{PMID:Ghosh 2020:31586943}" "" "500G>A (Arg205Gln)" "" "Germline" "yes" "" "0" "" "" "g.57739039G>A" "" "pathogenic (recessive)" "" "0000906211" "3" "90" "11" "57506511" "57506511" "subst" "4.06138E-5" "00006" "TMX2_000003" "g.57506511G>A" "" "{PMID:Ghosh 2020:31586943}" "" "500G>A (Arg205Gln)" "" "Germline" "yes" "" "0" "" "" "g.57739039G>A" "" "pathogenic (recessive)" "" "0000906212" "3" "90" "11" "57506511" "57506511" "subst" "4.06138E-5" "00006" "TMX2_000003" "g.57506511G>A" "" "{PMID:Ghosh 2020:31586943}" "" "500G>A (Arg205Gln)" "" "Germline" "yes" "" "0" "" "" "g.57739039G>A" "" "pathogenic (recessive)" "" "0000913627" "0" "30" "11" "57558992" "57558992" "subst" "0.000116607" "02326" "C11orf31_000006" "g.57558992C>T" "" "" "" "CTNND1(NM_001085458.1):c.42C>T (p.A14=), CTNND1(NM_001085458.2):c.42C>T (p.A14=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000925439" "0" "30" "11" "57575943" "57575943" "subst" "0.000933102" "02325" "C11orf31_000036" "g.57575943C>T" "" "" "" "CTNND1(NM_001085458.2):c.2173C>T (p.R725W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000929920" "0" "50" "11" "57571246" "57571246" "subst" "0" "02325" "C11orf31_000037" "g.57571246C>T" "" "" "" "CTNND1(NM_001085458.2):c.1574C>T (p.S525L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000979654" "0" "30" "11" "57492041" "57492041" "subst" "0" "01804" "C11orf31_000027" "g.57492041C>T" "" "" "" "TMX2(NM_001347891.1):c.196C>T (p.R66C), TMX2(NM_001347891.2):c.196C>T (p.(Arg66Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000979655" "0" "50" "11" "57561488" "57561488" "subst" "0.000393833" "02325" "C11orf31_000028" "g.57561488C>T" "" "" "" "CTNND1(NM_001085458.1):c.202C>T (p.R68W), CTNND1(NM_001085458.2):c.202C>T (p.R68W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000979656" "0" "30" "11" "57563118" "57563118" "subst" "0.000167381" "01804" "C11orf31_000038" "g.57563118A>C" "" "" "" "CTNND1(NM_001085458.2):c.337A>C (p.(Thr113Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000979657" "0" "50" "11" "57564328" "57564328" "subst" "2.04322E-5" "01804" "C11orf31_000039" "g.57564328C>T" "" "" "" "CTNND1(NM_001085458.2):c.820C>T (p.(Arg274Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000979658" "0" "50" "11" "57564457" "57564457" "subst" "4.01662E-5" "02325" "C11orf31_000040" "g.57564457C>T" "" "" "" "CTNND1(NM_001085458.2):c.949C>T (p.R317C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000979659" "0" "30" "11" "57571209" "57571209" "subst" "0.000451873" "02326" "C11orf31_000010" "g.57571209A>G" "" "" "" "CTNND1(NM_001085458.1):c.1537A>G (p.N513D), CTNND1(NM_001085458.2):c.1537A>G (p.N513D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000979660" "0" "30" "11" "57573468" "57573468" "subst" "7.44503E-5" "02325" "C11orf31_000041" "g.57573468C>T" "" "" "" "CTNND1(NM_001085458.2):c.1837C>T (p.P613S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000999148" "0" "50" "11" "57506506" "57506526" "del" "0" "01804" "TMX2_000010" "g.57506506_57506526del" "" "" "" "TMX2(NM_015959.3):c.609_614+15delTACGCGGTATGTAAAGACCTG (p.(Ser203_Thr204del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000999149" "0" "50" "11" "57507701" "57507701" "dup" "0" "01804" "C11orf31_000042" "g.57507701dup" "" "" "" "TMX2(NM_015959.3):c.875dupA (p.(Asn292fs))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000999150" "0" "50" "11" "57507702" "57507702" "subst" "3.41775E-5" "01804" "C11orf31_000043" "g.57507702C>G" "" "" "" "TMX2(NM_015959.3):c.876C>G (p.(Asn292Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000999151" "0" "50" "11" "57564126" "57564126" "subst" "0" "01804" "C11orf31_000044" "g.57564126C>G" "" "" "" "CTNND1(NM_001085458.1):c.618C>G (p.(Phe206Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000999152" "0" "30" "11" "57564142" "57564142" "subst" "0" "01804" "C11orf31_000045" "g.57564142G>A" "" "" "" "CTNND1(NM_001085458.1):c.634G>A (p.(Gly212Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000999153" "0" "70" "11" "57564292" "57564292" "subst" "0" "01804" "C11orf31_000046" "g.57564292C>T" "" "" "" "CTNND1(NM_001085458.1):c.784C>T (p.(Gln262*))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000999154" "0" "30" "11" "57564326" "57564326" "subst" "0" "01804" "C11orf31_000047" "g.57564326A>G" "" "" "" "CTNND1(NM_001085458.1):c.818A>G (p.(His273Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000999155" "0" "30" "11" "57564365" "57564365" "subst" "1.24281E-5" "01804" "C11orf31_000048" "g.57564365A>G" "" "" "" "CTNND1(NM_001085458.1):c.857A>G (p.(Gln286Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000999156" "0" "30" "11" "57564439" "57564439" "subst" "0" "01804" "C11orf31_000049" "g.57564439C>T" "" "" "" "CTNND1(NM_001085458.1):c.931C>T (p.(Pro311Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000999157" "0" "50" "11" "57573381" "57573381" "subst" "0" "01804" "C11orf31_000050" "g.57573381C>T" "" "" "" "CTNND1(NM_001085458.1):c.1750C>T (p.(Arg584Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000999158" "0" "70" "11" "57575686" "57575686" "dup" "0" "01804" "C11orf31_000051" "g.57575686dup" "" "" "" "CTNND1(NM_001085458.1):c.2013dupT (p.(Leu672fs))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000999159" "0" "30" "11" "57577619" "57577619" "subst" "4.48537E-5" "01804" "TMX2-CTNND1_000007" "g.57577619T>C" "" "" "" "CTNND1(NM_001085458.1):c.2474T>C (p.V825A, p.(Val825Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000999160" "0" "30" "11" "57578943" "57578943" "subst" "0.000693283" "02325" "C11orf31_000032" "g.57578943C>T" "" "" "" "CTNND1(NM_001085458.1):c.2623C>T (p.R875W), CTNND1(NM_001085458.2):c.2623C>T (p.R875W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001038522" "0" "50" "11" "57505378" "57505379" "del" "0" "01804" "C11orf31_000052" "g.57505378_57505379del" "" "" "" "TMX2(NM_015959.4):c.251-7_251-6del" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001038523" "0" "30" "11" "57564167" "57564167" "subst" "2.43667E-5" "02325" "C11orf31_000053" "g.57564167G>A" "" "" "" "CTNND1(NM_001085458.2):c.659G>A (p.G220D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001038524" "0" "30" "11" "57571227" "57571227" "subst" "4.08627E-5" "01804" "C11orf31_000054" "g.57571227C>T" "" "" "" "CTNND1(NM_001085458.2):c.1555C>T (p.(Arg519Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001038525" "0" "30" "11" "57571243" "57571243" "subst" "2.05081E-5" "01804" "C11orf31_000055" "g.57571243A>T" "" "" "" "CTNND1(NM_001085458.2):c.1571A>T (p.(Glu524Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001038526" "0" "50" "11" "57575754" "57575754" "subst" "0" "01804" "C11orf31_000056" "g.57575754G>C" "" "" "" "CTNND1(NM_001085458.2):c.2081G>C (p.(Gly694Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001038527" "0" "30" "11" "57576944" "57576944" "subst" "0.000539919" "01804" "C11orf31_000012" "g.57576944C>G" "" "" "" "CTNND1(NM_001085458.1):c.2435+6C>G, CTNND1(NM_001085458.2):c.2435+6C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001038528" "0" "30" "11" "57576944" "57576944" "subst" "0.000539919" "02325" "C11orf31_000012" "g.57576944C>G" "" "" "" "CTNND1(NM_001085458.1):c.2435+6C>G, CTNND1(NM_001085458.2):c.2435+6C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001038529" "0" "30" "11" "57578864" "57578864" "subst" "2.44884E-5" "01804" "C11orf31_000057" "g.57578864C>T" "" "" "" "CTNND1(NM_001085458.2):c.2551-7C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001038530" "0" "30" "11" "57582859" "57582859" "dup" "0" "01804" "C11orf31_000058" "g.57582859dup" "" "" "" "CTNND1(NM_001085458.2):c.2702-7dup" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001046318" "0" "90" "11" "57573393" "57573397" "del" "0" "02325" "C11orf31_000059" "g.57573393_57573397del" "" "" "" "CTNND1(NM_001085458.2):c.1762_1766delTATCA (p.Y588Sfs*38)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001053892" "0" "30" "11" "57480270" "57480270" "subst" "0.00107137" "01804" "C11orf31_000003" "g.57480270C>G" "" "" "" "TMX2(NM_001347890.1):c.180C>G (p.D60E), TMX2(NM_015959.4):c.180C>G (p.D60E, p.(Asp60Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001065472" "0" "50" "11" "57564073" "57564073" "subst" "0" "02325" "C11orf31_000060" "g.57564073G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes TMX2 ## Count = 105 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000255892" "00021533" "90" "164" "0" "164" "0" "c.164A>C" "r.(?)" "p.(Asp55Ala)" "" "0000267192" "00021533" "50" "67615" "0" "67615" "0" "c.*66724C>T" "r.(=)" "p.(=)" "" "0000267193" "00021533" "50" "69051" "0" "69051" "0" "c.*68160C>T" "r.(=)" "p.(=)" "" "0000274585" "00021533" "90" "62794" "0" "62794" "0" "c.*61903C>T" "r.(=)" "p.(=)" "" "0000274586" "00021533" "50" "70793" "0" "70793" "0" "c.*69902T>C" "r.(=)" "p.(=)" "" "0000322248" "00021533" "50" "418" "0" "418" "0" "c.418T>C" "r.(?)" "p.(Tyr140His)" "" "0000544635" "00021533" "30" "142" "0" "142" "0" "c.142G>C" "r.(?)" "p.(Gly48Arg)" "" "0000544636" "00021533" "50" "180" "0" "180" "0" "c.180C>G" "r.(?)" "p.(Asp60Glu)" "" "0000544637" "00021533" "90" "391" "0" "391" "0" "c.391dup" "r.(?)" "p.(Leu131ProfsTer6)" "" "0000544638" "00021533" "30" "52023" "0" "52023" "0" "c.*51132C>G" "r.(=)" "p.(=)" "" "0000544639" "00021533" "30" "52166" "0" "52166" "0" "c.*51275C>T" "r.(=)" "p.(=)" "" "0000544640" "00021533" "30" "52224" "0" "52224" "0" "c.*51333C>G" "r.(=)" "p.(=)" "" "0000544641" "00021533" "30" "56254" "0" "56254" "0" "c.*55363C>T" "r.(=)" "p.(=)" "" "0000544642" "00021533" "50" "57554" "0" "57554" "0" "c.*56663A>G" "r.(=)" "p.(=)" "" "0000544643" "00021533" "30" "64383" "0" "64383" "0" "c.*63492A>G" "r.(=)" "p.(=)" "" "0000544644" "00021533" "30" "67134" "0" "67135" "0" "c.*66243_*66244insA" "r.(=)" "p.(=)" "" "0000544645" "00021533" "30" "70118" "0" "70118" "0" "c.*69227C>G" "r.(=)" "p.(=)" "" "0000544646" "00021533" "30" "72125" "0" "72125" "0" "c.*71234A>G" "r.(=)" "p.(=)" "" "0000613458" "00021533" "30" "614" "7" "614" "7" "c.614+7A>G" "r.(=)" "p.(=)" "" "0000613459" "00021533" "50" "64270" "0" "64270" "0" "c.*63379C>T" "r.(=)" "p.(=)" "" "0000622642" "00021533" "30" "52148" "0" "52148" "0" "c.*51257G>C" "r.(=)" "p.(=)" "" "0000622643" "00021533" "10" "54717" "0" "54717" "0" "c.*53826A>G" "r.(=)" "p.(=)" "" "0000624809" "00021533" "90" "164" "0" "164" "0" "c.164A>C" "r.164a>c" "p.Asp55Ala" "" "0000624810" "00021533" "90" "614" "0" "614" "0" "c.614G>A" "r.[604_614del,549_614del,=]" "p.(Arg205Gln)" "" "0000624811" "00021533" "90" "157" "0" "157" "0" "c.157C>T" "r.157c>u" "p.Arg53Cys" "" "0000624812" "00021533" "90" "166" "0" "166" "0" "c.166G>C" "r.(?)" "p.(Gly56Arg)" "" "0000624813" "00021533" "90" "166" "0" "166" "0" "c.166G>C" "r.(?)" "p.(Gly56Arg)" "" "0000624814" "00021533" "90" "326" "0" "326" "0" "c.326A>G" "r.(?)" "p.(Asp109Gly)" "" "0000624815" "00021533" "90" "326" "0" "326" "0" "c.326A>G" "r.(?)" "p.(Asp109Gly)" "" "0000624816" "00021533" "90" "532" "0" "532" "0" "c.532G>A" "r.(?)" "p.(Ala178Thr)" "" "0000624817" "00021533" "90" "532" "0" "532" "0" "c.532G>A" "r.(?)" "p.(Ala178Thr)" "" "0000624818" "00021533" "90" "164" "0" "164" "0" "c.164A>C" "r.(?)" "p.(Asp55Ala)" "" "0000624819" "00021533" "90" "184" "0" "184" "0" "c.184G>C" "r.(?)" "p.(Asp62His)" "" "0000624820" "00021533" "90" "184" "0" "184" "0" "c.184G>C" "r.(?)" "p.(Asp62His)" "" "0000624821" "00021533" "90" "178" "0" "178" "0" "c.178G>A" "r.(?)" "p.(Asp60Asn)" "" "0000624822" "00021533" "90" "349" "0" "349" "0" "c.349A>G" "r.(?)" "p.(Ile117Val)" "" "0000624823" "00021533" "90" "391" "0" "391" "0" "c.391dup" "r.dup" "p.Leu131Profs*6" "" "0000624824" "00021533" "90" "757" "0" "757" "0" "c.757C>T" "r.757c>u" "p.Arg253*" "" "0000624825" "00021533" "90" "691" "0" "691" "0" "c.691C>T" "r.(?)" "p.(Arg231Trp)" "" "0000624826" "00021533" "90" "691" "0" "691" "0" "c.691C>T" "r.(?)" "p.(Arg231Trp)" "" "0000624827" "00021533" "90" "609" "0" "614" "15" "c.609_614+15del" "r.spl" "p.?" "" "0000624828" "00021533" "90" "691" "0" "691" "0" "c.691C>T" "r.(?)" "p.(Arg231Trp)" "" "0000656819" "00021533" "30" "54718" "0" "54718" "0" "c.*53827C>T" "r.(=)" "p.(=)" "" "0000679229" "00021533" "30" "66628" "0" "66628" "0" "c.*65737C>G" "r.(=)" "p.(=)" "" "0000679230" "00021533" "30" "69966" "0" "69966" "0" "c.*69075G>A" "r.(=)" "p.(=)" "" "0000723498" "00021533" "50" "180" "0" "180" "0" "c.180C>G" "r.(?)" "p.(Asp60Glu)" "" "0000723499" "00021533" "30" "603" "0" "603" "0" "c.603T>C" "r.(?)" "p.(Asp201=)" "" "0000723500" "00021533" "30" "62631" "0" "62631" "0" "c.*61740C>T" "r.(=)" "p.(=)" "" "0000723501" "00021533" "30" "65433" "0" "65433" "0" "c.*64542G>T" "r.(=)" "p.(=)" "" "0000723502" "00021533" "50" "67615" "0" "67615" "0" "c.*66724C>T" "r.(=)" "p.(=)" "" "0000723503" "00021533" "30" "70026" "0" "70026" "0" "c.*69135C>T" "r.(=)" "p.(=)" "" "0000723504" "00021533" "30" "76052" "0" "76052" "0" "c.*75161C>A" "r.(=)" "p.(=)" "" "0000805197" "00021533" "30" "57141" "0" "57141" "0" "c.*56250A>G" "r.(=)" "p.(=)" "" "0000853033" "00021533" "50" "189" "11762" "189" "11762" "c.189+11762C>T" "r.(=)" "p.(=)" "" "0000853034" "00021533" "30" "54662" "0" "54662" "0" "c.*53771C>T" "r.(=)" "p.(=)" "" "0000853035" "00021533" "50" "62612" "0" "62612" "0" "c.*61721A>G" "r.(=)" "p.(=)" "" "0000853036" "00021533" "30" "62841" "0" "62841" "0" "c.*61950C>T" "r.(=)" "p.(=)" "" "0000853037" "00021533" "30" "72117" "0" "72117" "0" "c.*71226C>T" "r.(=)" "p.(=)" "" "0000862588" "00021533" "50" "69103" "0" "69103" "0" "c.*68212C>A" "r.(=)" "p.(=)" "" "0000889992" "00021533" "50" "56310" "0" "56310" "0" "c.*55419G>C" "r.(=)" "p.(=)" "" "0000889993" "00021533" "30" "72148" "0" "72148" "0" "c.*71257G>A" "r.(=)" "p.(=)" "" "0000889994" "00021533" "30" "74992" "0" "74992" "0" "c.*74101A>G" "r.(=)" "p.(=)" "" "0000906205" "00021533" "90" "614" "0" "614" "0" "c.614G>A" "r.(?)" "p.(Arg205Gln)" "" "0000906206" "00021533" "90" "614" "0" "614" "0" "c.614G>A" "r.(?)" "p.(Arg205Gln)" "" "0000906207" "00021533" "90" "614" "0" "614" "0" "c.614G>A" "r.(?)" "p.(Arg205Gln)" "" "0000906208" "00021533" "90" "614" "0" "614" "0" "c.614G>A" "r.(?)" "p.(Arg205Gln)" "" "0000906209" "00021533" "90" "614" "0" "614" "0" "c.614G>A" "r.(?)" "p.(Arg205Gln)" "" "0000906210" "00021533" "90" "614" "0" "614" "0" "c.614G>A" "r.(?)" "p.(Arg205Gln)" "" "0000906211" "00021533" "90" "614" "0" "614" "0" "c.614G>A" "r.(?)" "p.(Arg205Gln)" "" "0000906212" "00021533" "90" "614" "0" "614" "0" "c.614G>A" "r.(?)" "p.(Arg205Gln)" "" "0000913627" "00021533" "30" "52166" "0" "52166" "0" "c.*51275C>T" "r.(=)" "p.(=)" "" "0000925439" "00021533" "30" "69117" "0" "69117" "0" "c.*68226C>T" "r.(=)" "p.(=)" "" "0000929920" "00021533" "50" "64420" "0" "64420" "0" "c.*63529C>T" "r.(=)" "p.(=)" "" "0000979654" "00021533" "30" "189" "11762" "189" "11762" "c.189+11762C>T" "r.(=)" "p.(=)" "" "0000979655" "00021533" "50" "54662" "0" "54662" "0" "c.*53771C>T" "r.(=)" "p.(=)" "" "0000979656" "00021533" "30" "56292" "0" "56292" "0" "c.*55401A>C" "r.(=)" "p.(=)" "" "0000979657" "00021533" "50" "57502" "0" "57502" "0" "c.*56611C>T" "r.(=)" "p.(=)" "" "0000979658" "00021533" "50" "57631" "0" "57631" "0" "c.*56740C>T" "r.(=)" "p.(=)" "" "0000979659" "00021533" "30" "64383" "0" "64383" "0" "c.*63492A>G" "r.(=)" "p.(=)" "" "0000979660" "00021533" "30" "66642" "0" "66642" "0" "c.*65751C>T" "r.(=)" "p.(=)" "" "0000999148" "00021533" "50" "609" "0" "614" "15" "c.609_614+15del" "r.spl?" "p.?" "" "0000999149" "00021533" "50" "875" "0" "875" "0" "c.875dup" "r.(?)" "p.(Asn292Lysfs*5)" "" "0000999150" "00021533" "50" "876" "0" "876" "0" "c.876C>G" "r.(?)" "p.(Asn292Lys)" "" "0000999151" "00021533" "50" "57300" "0" "57300" "0" "c.*56409C>G" "r.(=)" "p.(=)" "" "0000999152" "00021533" "30" "57316" "0" "57316" "0" "c.*56425G>A" "r.(=)" "p.(=)" "" "0000999153" "00021533" "70" "57466" "0" "57466" "0" "c.*56575C>T" "r.(=)" "p.(=)" "" "0000999154" "00021533" "30" "57500" "0" "57500" "0" "c.*56609A>G" "r.(=)" "p.(=)" "" "0000999155" "00021533" "30" "57539" "0" "57539" "0" "c.*56648A>G" "r.(=)" "p.(=)" "" "0000999156" "00021533" "30" "57613" "0" "57613" "0" "c.*56722C>T" "r.(=)" "p.(=)" "" "0000999157" "00021533" "50" "66555" "0" "66555" "0" "c.*65664C>T" "r.(=)" "p.(=)" "" "0000999158" "00021533" "70" "68860" "0" "68860" "0" "c.*67969dup" "r.(?)" "p.(=)" "" "0000999159" "00021533" "30" "70793" "0" "70793" "0" "c.*69902T>C" "r.(=)" "p.(=)" "" "0000999160" "00021533" "30" "72117" "0" "72117" "0" "c.*71226C>T" "r.(=)" "p.(=)" "" "0001038522" "00021533" "50" "251" "-7" "251" "-6" "c.251-7_251-6del" "r.(=)" "p.(=)" "" "0001038523" "00021533" "30" "57341" "0" "57341" "0" "c.*56450G>A" "r.(=)" "p.(=)" "" "0001038524" "00021533" "30" "64401" "0" "64401" "0" "c.*63510C>T" "r.(=)" "p.(=)" "" "0001038525" "00021533" "30" "64417" "0" "64417" "0" "c.*63526A>T" "r.(=)" "p.(=)" "" "0001038526" "00021533" "50" "68928" "0" "68928" "0" "c.*68037G>C" "r.(=)" "p.(=)" "" "0001038527" "00021533" "30" "70118" "0" "70118" "0" "c.*69227C>G" "r.(=)" "p.(=)" "" "0001038528" "00021533" "30" "70118" "0" "70118" "0" "c.*69227C>G" "r.(=)" "p.(=)" "" "0001038529" "00021533" "30" "72038" "0" "72038" "0" "c.*71147C>T" "r.(=)" "p.(=)" "" "0001038530" "00021533" "30" "76033" "0" "76033" "0" "c.*75142dup" "r.(?)" "p.(=)" "" "0001046318" "00021533" "90" "66567" "0" "66571" "0" "c.*65676_*65680del" "r.(=)" "p.(=)" "" "0001053892" "00021533" "30" "180" "0" "180" "0" "c.180C>G" "r.(?)" "p.(Asp60Glu)" "" "0001065472" "00021533" "50" "57247" "0" "57247" "0" "c.*56356G>A" "r.(=)" "p.(=)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 28 "{{screeningid}}" "{{variantid}}" "0000270980" "0000624809" "0000270980" "0000624823" "0000270981" "0000624810" "0000270982" "0000624811" "0000270982" "0000624824" "0000270983" "0000624812" "0000270984" "0000624813" "0000270985" "0000624814" "0000270985" "0000624825" "0000270986" "0000624815" "0000270986" "0000624826" "0000270987" "0000624816" "0000270988" "0000624817" "0000270989" "0000624818" "0000270989" "0000624827" "0000270990" "0000624819" "0000270991" "0000624820" "0000270992" "0000624821" "0000270993" "0000624822" "0000270993" "0000624828" "0000428411" "0000906205" "0000428412" "0000906206" "0000428413" "0000906207" "0000428414" "0000906208" "0000428415" "0000906209" "0000428416" "0000906210" "0000428417" "0000906211" "0000428418" "0000906212"