### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = TP53) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "TP53" "tumor protein p53" "17" "p13.1" "unknown" "NG_017013.2" "UD_134408361366" "" "https://www.LOVD.nl/TP53" "http://p53.iarc.fr" "1" "11998" "7157" "191170" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "" "g" "http://databases.lovd.nl/shared/refseq/TP53_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00140" "2017-06-09 09:14:28" "00000" "2026-01-20 18:57:21" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00021656" "TP53" "transcript variant 1" "002" "NM_000546.5" "" "NP_000537.3" "" "" "" "-202" "2389" "1182" "7590868" "7571720" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 24 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00000" "Healthy/Control" "Healthy individual / control" "" "" "" "" "" "00000" "2012-07-26 17:29:43" "" "" "00091" "CRC" "cancer, colorectal, susceptibility to (CRC)" "AD;SMu" "114500" "" "" "" "00001" "2012-12-07 10:49:46" "00006" "2021-12-10 21:51:32" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00318" "cancer, breast" "cancer, breast" "" "" "" "" "" "00006" "2014-02-02 14:42:53" "00006" "2019-08-28 08:24:47" "00423" "-" "cancer, endometrial" "AD;SMu" "608089" "" "" "" "00006" "2014-06-18 09:01:15" "00006" "2021-12-10 21:51:32" "00424" "cancer, ovarian" "cancer, ovarian" "" "167000" "" "" "" "00006" "2014-06-18 09:01:54" "" "" "00681" "cancer, pancreatic" "cancer, pancreatic" "" "260350" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2019-08-28 08:24:29" "00683" "cancer, breast" "cancer, breast, susceptibility" "" "114480" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-30 17:21:12" "01221" "cancer, liver" "cancer, hepatocellular (HCC)" "" "114550" "liver" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "01347" "GLM1" "glioma, susceptibility, type 1 (GLM1)" "" "137800" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-08-30 08:34:32" "01415" "LFS" "Li-Fraumeni syndrome (LFS)" "AD" "151623" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "01524" "cancer, prostate" "cancer, prostate" "AD;SMu" "176807" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "01633" "ADCC" "Adrenocortical carcinoma, hereditary" "AD" "202300" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "01989" "OSTEOSARCOMA" "osteosarcoma" "SMu" "259500" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "02001" "CPP" "Choroid plexus papilloma" "AD" "260500" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "02632" "NPCA" "Nasopharyngeal carcinoma" "" "607107" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "02638" "meningioma" "meningioma, familial, susceptibility to" "AD" "607174" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2019-12-26 15:18:15" "03716" "BCC7" "Basal cell carcinoma, susceptibility to, 7" "AD" "614740" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "04148" "BROVCA" "cancer, breast-ovarian, familial, susceptibility to" "" "" "" "" "" "00006" "2014-11-02 11:19:07" "00006" "2017-08-28 21:33:05" "04296" "MINAS" "neoplasia, multiple inherited alleles (MINAS)" "AD;AR;SMo" "" "" "" "" "00006" "2015-07-02 09:20:44" "00006" "2021-12-10 21:51:32" "05093" "cancer" "cancer" "" "" "" "" "" "00006" "2015-10-23 13:34:05" "" "" "05154" "cancer, skin" "cancer, skin" "" "" "" "" "" "00006" "2016-04-14 15:55:23" "" "" "05489" "cancer, colon" "cancer, colon" "" "" "" "" "" "00006" "2018-10-26 16:33:57" "" "" "06361" "BMFS5" "Bone marrow failure syndrome 5" "AD" "618165" "" "" "" "00006" "2021-12-10 23:20:41" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 12 "{{geneid}}" "{{diseaseid}}" "TP53" "00091" "TP53" "00681" "TP53" "00683" "TP53" "01221" "TP53" "01347" "TP53" "01415" "TP53" "01633" "TP53" "01989" "TP53" "02001" "TP53" "02632" "TP53" "03716" "TP53" "06361" ## Individuals ## Do not remove or alter this header ## ## Count = 547 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00003293" "" "" "" "1" "" "00552" "" "" "" "" "" "" "0" "" "" "" "" "00046287" "" "" "" "1" "" "01339" "" "1 breast-ovarian cancer families (kConFab)" "" "" "Australia;New Zealand" "" "0" "" "" "" "" "00046288" "" "" "" "1" "" "01339" "" "1 breast-ovarian cancer families (kConFab)" "" "" "Australia;New Zealand" "" "0" "" "" "" "" "00046289" "" "" "" "1" "" "01339" "" "1 breast-ovarian cancer families (kConFab)" "" "" "Australia;New Zealand" "" "0" "" "" "" "" "00046290" "" "" "" "2" "" "01339" "" "2 breast-ovarian cancer families (kConFab)" "" "" "Australia;New Zealand" "" "0" "" "" "" "" "00046291" "" "" "" "2" "" "01339" "" "2 breast-ovarian cancer families (kConFab)" "" "" "Australia;New Zealand" "" "0" "" "" "" "" "00046292" "" "" "" "1" "" "01339" "" "1 breast-ovarian cancer families (kConFab)" "" "" "Australia;New Zealand" "" "0" "" "" "" "" "00046293" "" "" "" "1" "" "01339" "" "1 breast-ovarian cancer families (kConFab)" "" "" "Australia;New Zealand" "" "0" "" "" "" "" "00046294" "" "" "" "1" "" "01339" "" "1 breast-ovarian cancer families (kConFab)" "" "" "Australia;New Zealand" "" "0" "" "" "" "" "00046295" "" "" "" "1" "" "01339" "" "1 breast-ovarian cancer families (kConFab)" "" "" "Australia;New Zealand" "" "0" "" "" "" "" "00046296" "" "" "" "1" "" "01339" "" "1 breast-ovarian cancer families (kConFab)" "" "" "Australia;New Zealand" "" "0" "" "" "" "" "00046320" "" "" "" "1" "" "01339" "" "1 breast-ovarian cancer families (kConFab)" "" "" "Australia;New Zealand" "" "0" "" "" "" "" "00047321" "" "" "" "1" "" "00727" "{PMID:Manoukian 2007:17224268}" "" "F" "" "(Italy)" "" "0" "" "" "" "" "00047322" "" "" "" "1" "" "00727" "{PMID:Monnerat 2007:17624602}" "" "F" "" "(France)" "" "0" "" "" "" "" "00047328" "" "" "" "1" "" "00727" "{PMID:Plon 2008:18669439}" "" "F" "" "(United States)" "" "0" "" "" "" "" "00048061" "" "" "" "1" "" "00727" "" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00074654" "" "" "" "1" "" "01694" "" "" "F" "no" "Spain" ">35y" "0" "yes" "surgery and chemotherapy" "white" "" "00079875" "" "" "" "1" "" "01738" "" "" "F" "no" "Ireland" "" "0" "" "" "white" "" "00090869" "" "" "" "6" "" "01816" "" "gene panel study on colon cancer cases" "" "" "United States" "" "0" "data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database" "" "" "" "00090870" "" "" "" "1" "" "01816" "" "gene panel study on colon cancer cases" "" "" "United States" "" "0" "data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database" "" "" "" "00090871" "" "" "" "1" "" "01816" "" "gene panel study on colon cancer cases" "" "" "United States" "" "0" "data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database" "" "" "" "00090872" "" "" "" "1" "" "01816" "" "gene panel study on colon cancer cases" "" "" "United States" "" "0" "data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database" "" "" "" "00090873" "" "" "" "1" "" "01816" "" "gene panel study on colon cancer cases" "" "" "United States" "" "0" "data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database" "" "" "" "00090874" "" "" "" "1" "" "01816" "" "gene panel study on colon cancer cases" "" "" "United States" "" "0" "data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database" "" "" "" "00090875" "" "" "" "1" "" "01816" "" "gene panel study on colon cancer cases" "" "" "United States" "" "0" "data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database" "" "" "" "00090876" "" "" "" "1" "" "01816" "" "gene panel study on colon cancer cases" "" "" "United States" "" "0" "data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database" "" "" "" "00090877" "" "" "" "1" "" "01816" "" "gene panel study on colon cancer cases" "" "" "United States" "" "0" "data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database" "" "" "" "00090878" "" "" "" "1" "" "01816" "" "gene panel study on colon cancer cases" "" "" "United States" "" "0" "data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database" "" "" "" "00090879" "" "" "" "7" "" "01816" "" "gene panel study on colon cancer cases" "" "" "United States" "" "0" "data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database" "" "" "" "00155624" "" "" "" "1" "" "01873" "contributed by Dept. of Dr Vaccaro" "" "" "" "Argentina" "" "0" "" "" "" "" "00178553" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00178554" "" "" "" "4" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00178555" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00178556" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00178557" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00178558" "" "" "" "2" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00178559" "" "" "" "2" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00178560" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00178561" "" "" "" "2" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00178562" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00178563" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00178564" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00178565" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00178566" "" "" "" "2" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00178567" "" "" "" "4" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00178568" "" "" "" "2" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00178569" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00178570" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00178571" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00178572" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00178573" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00178574" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00178575" "" "" "" "2" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00178576" "" "" "" "5" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00178577" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00178578" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00178579" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00178580" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00178581" "" "" "" "6" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00178582" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00178583" "" "" "" "4" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00178584" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00178585" "" "" "" "3" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00178586" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00178587" "" "" "" "19" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00178588" "" "" "" "17" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00178589" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00178590" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00178591" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00178592" "" "" "" "2" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00178593" "" "" "" "2" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00178594" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00178595" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00178596" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00178597" "" "" "" "2" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00178598" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00178599" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00178600" "" "" "" "4" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00178601" "" "" "" "7" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00178602" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00178603" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00178604" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00178605" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00178606" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00178607" "" "" "" "2" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00178608" "" "" "" "1210" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00178609" "" "" "" "2070" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00178610" "" "" "" "2" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00178611" "" "" "" "2" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00178612" "" "" "" "36" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00178613" "" "" "" "49" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00178614" "" "" "" "3" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00178615" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00178616" "" "" "" "4" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00178617" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00178618" "" "" "" "36" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00178619" "" "" "" "85" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00178620" "" "" "" "91" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00178621" "" "" "" "138" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00178622" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00178623" "" "" "" "95" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00178624" "" "" "" "172" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00178625" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00178626" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00178627" "" "" "" "3" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00178628" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00178629" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "30287823-controls-F" "00180838" "" "" "" "2920" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00180839" "" "" "" "4585" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "-con-F" "00180840" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "-con-F" "00180841" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "-con-F" "00180842" "" "" "" "3" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00180843" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "-con-F" "00180844" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 7051 female breast cancer cases" "F" "" "Japan" "" "0" "" "" "" "30287823-cases-F" "00180845" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 11241 controls" "F" "" "Japan" "" "0" "" "" "" "-con-F" "00181618" "" "" "" "27" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 53 male breast cancer cases" "M" "" "Japan" "" "0" "" "" "" "-cases-M" "00181619" "" "" "" "23" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 53 male breast cancer cases" "M" "" "Japan" "" "0" "" "" "" "-cases-M" "00181620" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 53 male breast cancer cases" "M" "" "Japan" "" "0" "" "" "" "-cases-M" "00181621" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 53 male breast cancer cases" "M" "" "Japan" "" "0" "" "" "" "-cases-M" "00182817" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182818" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182819" "" "" "" "2" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182820" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182821" "" "" "" "3" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182822" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182823" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182824" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182825" "" "" "" "4" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182826" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182827" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182828" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182829" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182830" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182831" "" "" "" "4" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182832" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182833" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182834" "" "" "" "4" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182835" "" "" "" "22" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182836" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182837" "" "" "" "3" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182838" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182839" "" "" "" "4" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182840" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182841" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182842" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182843" "" "" "" "2" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182844" "" "" "" "5013" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182845" "" "" "" "5837" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182846" "" "" "" "3" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182847" "" "" "" "2" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182848" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182849" "" "" "" "68" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182850" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182851" "" "" "" "2" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182852" "" "" "" "88" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182853" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182854" "" "" "" "146" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182855" "" "" "" "184" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182856" "" "" "" "2" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182857" "" "" "" "3" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00182858" "" "" "" "1" "" "01714" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "analysis 12490 male controls" "M" "" "Japan" "" "0" "" "" "" "-controls-M" "00228277" "" "" "" "1" "" "01807" "" "" "?" "" "" "" "0" "" "" "" "" "00231303" "" "" "" "2" "" "03273" "{PMID:Gallardo-Alvarado 2019:30709381}" "3-generation family, 2 affected sisters" "F" "no" "Mexico" "" "0" "" "" "Puebla" "" "00240476" "" "" "" "1" "" "03337" "" "" "M" "?" "Croatia (Hrvatska)" "72y" "0" "" "none" "white" "" "00240477" "" "" "" "1" "" "03337" "" "" "F" "?" "Croatia (Hrvatska)" ">54y" "0" "" "" "white" "" "00240478" "" "" "" "1" "" "03337" "" "" "F" "?" "(Croatia (Hrvatska))" ">54y" "0" "" "" "white" "" "00240480" "" "" "" "1" "" "03337" "" "" "M" "?" "(Croatia (Hrvatska))" "65y" "0" "" "" "white" "" "00240482" "" "" "" "1" "" "03337" "" "" "F" "?" "Croatia (Hrvatska)" "55y" "0" "" "" "white" "" "00240483" "" "" "" "1" "" "03337" "" "" "F" "?" "Croatia (Hrvatska)" "47y" "0" "" "" "white" "" "00240485" "" "" "" "1" "" "03337" "" "" "F" "?" "(Croatia (Hrvatska))" "62y" "0" "" "" "" "" "00240488" "" "" "" "1" "" "03337" "" "" "M" "?" "Croatia (Hrvatska)" "71y" "0" "" "" "white" "" "00240493" "" "" "" "1" "" "03337" "" "" "M" "?" "Croatia (Hrvatska)" "40y" "0" "" "" "white" "" "00240498" "" "" "" "1" "" "03337" "" "" "F" "" "Croatia (Hrvatska)" "63y" "0" "" "" "white" "" "00240502" "" "" "" "1" "" "03337" "" "" "M" "" "" "62y" "0" "" "" "white" "" "00240504" "" "" "" "1" "" "03337" "" "" "F" "" "Croatia (Hrvatska)" "67y" "0" "" "" "" "" "00241235" "" "" "" "1" "" "03337" "" "" "F" "" "Croatia (Hrvatska)" "63y" "0" "" "" "white" "" "00241239" "" "" "" "1" "" "03337" "" "" "F" "?" "(Croatia (Hrvatska))" "74y" "0" "" "" "white" "" "00241241" "" "" "" "1" "" "03337" "" "" "M" "?" "(Croatia (Hrvatska))" "45y" "0" "" "" "white" "" "00241242" "" "" "" "1" "" "03337" "" "" "F" "?" "(Croatia (Hrvatska))" "74y" "0" "" "" "white" "" "00241244" "" "" "" "1" "" "03337" "" "" "M" "?" "Croatia (Hrvatska)" "75y" "0" "" "" "white" "" "00241246" "" "" "" "1" "" "03337" "" "" "M" "?" "Croatia (Hrvatska)" "32y" "0" "" "" "" "" "00241248" "" "" "" "1" "" "03337" "" "" "M" "?" "Croatia (Hrvatska)" "77y" "0" "" "" "white" "" "00241251" "" "" "" "1" "" "03337" "" "" "F" "?" "Croatia (Hrvatska)" "71y" "0" "" "" "" "" "00241253" "" "" "" "1" "" "03337" "" "" "F" "?" "Croatia (Hrvatska)" "64y" "0" "" "" "white" "" "00241255" "" "" "" "1" "" "03337" "" "" "F" "?" "Croatia (Hrvatska)" "" "0" "" "" "" "" "00241257" "" "" "" "1" "" "03337" "" "" "F" "?" "Croatia (Hrvatska)" "73y" "0" "" "" "white" "" "00241259" "" "" "" "1" "" "03337" "" "" "F" "?" "Croatia (Hrvatska)" "67y" "0" "" "" "" "" "00241260" "" "" "" "1" "" "03337" "" "" "F" "?" "Croatia (Hrvatska)" "79y" "0" "" "" "" "" "00241261" "" "" "" "1" "" "03337" "" "" "F" "" "Croatia (Hrvatska)" "61y" "0" "" "" "" "" "00246551" "" "" "" "1" "" "00643" "{PMID:Fostira 2020:31300551}" "" "" "" "Greece" "" "0" "" "" "" "" "00246552" "" "" "" "1" "" "00643" "{PMID:Fostira 2020:31300551}" "" "" "" "Greece" "" "0" "" "" "" "" "00246553" "" "" "" "1" "" "00643" "{PMID:Fostira 2020:31300551}" "" "" "" "Greece" "" "0" "" "" "" "" "00246554" "" "" "" "1" "" "00643" "{PMID:Fostira 2020:31300551}" "" "" "" "Greece" "" "0" "" "" "" "" "00246555" "" "" "" "1" "" "00643" "{PMID:Fostira 2020:31300551}" "" "" "" "Greece" "" "0" "" "" "" "" "00246556" "" "" "" "1" "" "00643" "{PMID:Fostira 2020:31300551}" "" "" "" "Greece" "" "0" "" "" "" "" "00246557" "" "" "" "1" "" "00643" "{PMID:Fostira 2020:31300551}" "" "" "" "Greece" "" "0" "" "" "" "" "00246558" "" "" "" "1" "" "00643" "{PMID:Fostira 2020:31300551}" "" "" "" "Greece" "" "0" "" "" "" "" "00266410" "" "" "" "1" "" "03452" "" "" "" "" "Argentina" "" "0" "" "" "" "contributed by Dept. of Dr Vaccaro" "00266474" "" "" "" "1" "" "02337" "" "" "" "" "Argentina" "" "0" "" "" "" "" "00266475" "" "" "" "1" "" "02337" "" "" "" "" "Argentina" "" "0" "" "" "Spain" "" "00266479" "" "" "" "1" "" "02337" "" "" "" "" "Argentina" "" "0" "" "" "Argentina" "" "00266481" "" "" "" "1" "" "02337" "" "" "" "" "Argentina" "" "0" "" "" "" "" "00266485" "" "" "" "1" "" "02337" "" "" "" "" "Argentina" "" "0" "" "" "Italy" "" "00291857" "" "" "" "51" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00291858" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00291859" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00291860" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00291861" "" "" "" "3" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00295164" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00295286" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00295287" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00295288" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00295289" "" "" "" "3" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00295564" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" "" "00295744" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" "" "00295748" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" "" "00295890" "" "" "" "1" "" "03629" "" "" "F" "-" "Brazil" "" "0" "" "" "" "P-76" "00336225" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00336328" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00336329" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341749" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341750" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341751" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341752" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341753" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341754" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341755" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341756" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341757" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341758" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341759" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341760" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341761" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341762" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341763" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341764" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341765" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341766" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341767" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341768" "" "" "" "5" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341769" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341770" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341771" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341772" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341773" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341774" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341775" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341776" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341777" "" "" "" "5" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341778" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341779" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341780" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341781" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341782" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341783" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341784" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341785" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341786" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341787" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341788" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341789" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341790" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341791" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341792" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341793" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341794" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341795" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00341796" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00342350" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00342351" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00342352" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00342353" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00342354" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00342355" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00342356" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00342575" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00342582" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00342583" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00342584" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348988" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348989" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348990" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348991" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348992" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348993" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348994" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348995" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348996" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348997" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348998" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00348999" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349000" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349001" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349002" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349003" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349004" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349005" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349006" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349007" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349008" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349009" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349010" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349011" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349012" "" "" "" "5" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349013" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349014" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349015" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349016" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349017" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349018" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349019" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349020" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349021" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349022" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349023" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349024" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349025" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349026" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349027" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349028" "" "" "" "6" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349029" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349030" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349031" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349032" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349033" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349034" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349035" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349036" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349037" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349038" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349039" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349040" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349041" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349042" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349043" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349044" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349045" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349046" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349047" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349048" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349049" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349050" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349051" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349052" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349053" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349054" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349055" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349056" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349057" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349058" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349059" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349060" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349061" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349062" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349063" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349064" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349065" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349066" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349067" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349068" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349069" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349070" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349071" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349072" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349073" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349074" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349075" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349076" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349077" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349078" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349079" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349080" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349081" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349082" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349083" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349084" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349085" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349086" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349087" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349088" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349089" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349090" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349091" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349092" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349093" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349094" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00349095" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353858" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353859" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353860" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353861" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353862" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353863" "" "" "" "14" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353864" "" "" "" "9" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353865" "" "" "" "10" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353866" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353867" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353868" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353869" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353870" "" "" "" "5" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353871" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353872" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353873" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353874" "" "" "" "5" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353875" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353876" "" "" "" "6" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353877" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353878" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353879" "" "" "" "10" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353880" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353881" "" "" "" "7" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353882" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353883" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353884" "" "" "" "45" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353885" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353886" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353887" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353888" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353889" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353890" "" "" "" "5" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353891" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353892" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353893" "" "" "" "5" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353894" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353895" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353896" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353897" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353898" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353899" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353900" "" "" "" "9" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353901" "" "" "" "7" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353902" "" "" "" "5" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353903" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353904" "" "" "" "6" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353905" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353906" "" "" "" "55" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353907" "" "" "" "16" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353908" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00353909" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358634" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358635" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358636" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358637" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358638" "" "" "" "6" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358639" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358640" "" "" "" "6" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358641" "" "" "" "14" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358642" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358643" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358644" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358645" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358646" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358647" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358648" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358649" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358650" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358651" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358652" "" "" "" "7" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358653" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358654" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358655" "" "" "" "15" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358656" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358657" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358658" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358659" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358660" "" "" "" "36" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358661" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358662" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358663" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358664" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358665" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358666" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358667" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358668" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358669" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358670" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358671" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358672" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358673" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358674" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358675" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358676" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358677" "" "" "" "5" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358678" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358679" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358680" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358681" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358682" "" "" "" "41" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358683" "" "" "" "9" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358684" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00358685" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" "" "00376159" "" "" "" "1" "" "00585" "" "" "M" "" "Belgium" "" "0" "" "" "" "" "00399592" "" "" "" "1" "" "00006" "{PMID:Evans 2022:33758026}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat11" "00399593" "" "" "" "1" "" "00006" "{PMID:Evans 2022:33758026}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat12" "00399594" "" "" "" "1" "" "00006" "{PMID:Evans 2022:33758026}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat13" "00399595" "" "" "" "1" "" "00006" "{PMID:Evans 2022:33758026}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat14" "00399596" "" "" "" "1" "" "00006" "{PMID:Evans 2022:33758026}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat15" "00399597" "" "" "" "1" "" "00006" "{PMID:Evans 2022:33758026}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat16" "00399598" "" "" "" "1" "" "00006" "{PMID:Evans 2022:33758026}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat17" "00399707" "" "" "" "1" "" "00006" "{PMID:Evans 2022:33758026}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat126" "00399708" "" "" "" "1" "" "00006" "{PMID:Evans 2022:33758026}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat127" "00399709" "" "" "" "1" "" "00006" "{PMID:Evans 2022:33758026}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat128" "00399710" "" "" "" "1" "" "00006" "{PMID:Evans 2022:33758026}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat129" "00399711" "" "" "" "1" "" "00006" "{PMID:Evans 2022:33758026}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat130" "00399712" "" "" "" "1" "" "00006" "{PMID:Evans 2022:33758026}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat131" "00399713" "" "" "" "1" "" "00006" "{PMID:Evans 2022:33758026}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat132" "00399714" "" "" "" "1" "" "00006" "{PMID:Evans 2022:33758026}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat133" "00399715" "" "" "" "1" "" "00006" "{PMID:Evans 2022:33758026}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat134" "00399716" "" "" "" "1" "" "00006" "{PMID:Evans 2022:33758026}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat135" "00399717" "" "" "" "1" "" "00006" "{PMID:Evans 2022:33758026}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat136" "00399718" "" "" "" "1" "" "00006" "{PMID:Evans 2022:33758026}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat137" "00399719" "" "" "" "1" "" "00006" "{PMID:Evans 2022:33758026}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat138" "00399720" "" "" "" "1" "" "00006" "{PMID:Evans 2022:33758026}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat139" "00399721" "" "" "" "1" "" "00006" "{PMID:Evans 2022:33758026}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat140" "00406997" "" "" "" "2" "" "00006" "{PMID:Jiang 2022:33563768}" "analysis 486 colorectal cancer patients" "" "" "China" "" "0" "" "" "" "" "00410557" "" "" "" "1" "" "00006" "{PMID:Schuermans 2022:35606766}" "analysis 329 adult patients suffering from undiagnosed rare disease" "M" "" "Belgium" "" "0" "" "" "" "Pat19" "00430358" "" "" "" "1" "" "01082" "" "" "M" "?" "Brazil" "" "" "" "" "" "MINAS_20" "00430362" "" "" "" "1" "" "01082" "" "" "M" "" "Brazil" "" "" "" "" "" "MINAS_28" "00431557" "" "" "" "1" "" "04467" "" "" "" "" "" "" "" "" "" "" "" "00432987" "" "" "" "1" "" "01082" "" "" "F" "" "Brazil" "" "" "" "" "" "MINAS_12" "00432996" "" "" "" "1" "" "01082" "" "" "F" "" "Brazil" "" "" "" "" "" "MINAS_29" "00433152" "" "" "" "1" "" "03628" "{PMID:Butz 2023:37653074}" "" "M" "" "Hungary" "" "0" "" "" "" "Pat20" "00433153" "" "" "" "1" "" "03628" "{PMID:Butz 2023:37653074}" "" "F" "" "Hungary" "" "0" "" "" "" "Pat19" "00433157" "" "" "" "1" "" "03628" "{PMID:Butz 2023:37653074}" "" "F" "" "Hungary" "" "0" "" "" "" "Pat14" "00433158" "" "" "" "1" "" "03628" "{PMID:Butz 2023:37653074}" "" "M" "" "Hungary" "" "0" "" "" "" "Pat3" "00433159" "" "" "" "1" "" "03628" "{PMID:Butz 2023:37653074}" "" "F" "" "Hungary" "" "0" "" "" "" "Pat15" "00433160" "" "" "" "1" "" "03628" "{PMID:Butz 2023:37653074}" "" "F" "" "Hungary" "" "0" "" "" "" "Pat4" "00433161" "" "" "" "1" "" "03628" "{PMID:Butz 2023:37653074}" "" "F" "" "Hungary" "" "0" "" "" "" "Pat21" "00433178" "" "" "" "1" "" "03628" "{PMID:Butz 2023:37653074}" "" "M" "" "Hungary" "" "0" "" "" "" "Pat22" "00433179" "" "" "" "1" "" "03628" "{PMID:Butz 2023:37653074}" "" "F" "" "Hungary" "" "0" "" "" "" "Pat9" "00433180" "" "" "" "1" "" "03628" "{PMID:Butz 2023:37653074}" "" "F" "" "Hungary" "" "0" "" "" "" "Pat5" "00433181" "" "" "" "1" "" "03628" "{PMID:Butz 2023:37653074}" "" "F" "" "Hungary" "" "0" "" "" "" "Pat2" "00433182" "" "" "" "1" "" "03628" "{PMID:Butz 2023:37653074}" "" "F" "" "Hungary" "" "0" "" "" "" "Pat18" "00433183" "" "" "" "1" "" "03628" "{PMID:Butz 2023:37653074}" "" "M" "" "Hungary" "" "0" "" "" "" "Pat1" "00433187" "" "" "" "1" "" "03628" "{PMID:Butz 2023:37653074}" "" "F" "" "Hungary" "" "0" "" "" "" "Pat17" "00433189" "" "" "" "1" "" "03628" "{PMID:Butz 2023:37653074}" "" "F" "" "Hungary" "" "0" "" "" "" "Pat13" "00443728" "" "" "" "1" "" "04599" "" "" "F" "" "Mexico" "" "" "" "" "Mexican" "UCDMX024" "00443729" "" "" "" "1" "" "04599" "" "" "M" "" "Mexico" "" "" "" "" "Mexican" "UCDMX022" "00448048" "" "" "" "1" "" "03628" "{PMID:Butz 2023:37653074}" "" "M" "" "Hungary" "" "0" "" "" "" "Pat16" "00449725" "" "" "" "1" "" "04685" "" "" "F" "" "Denmark" "" "" "" "" "" "" "00449739" "" "" "" "1" "cc_by_4.0;1" "04685" "" "" "F" "" "Denmark" "" "0" "" "" "" "" "00457360" "" "" "" "1" "" "04749" "Yuen (unpublished)" "" "F" "" "Singapore" "" "0" "" "" "Malaysia" "MINAS_07" "00464409" "" "" "" "1" "" "00006" "{PMID:Williams 1998:9510848}" "" "" "" "Sweden" "" "0" "" "" "" "14D3" "00464410" "" "" "" "1" "" "00006" "{PMID:Williams 1998:9510848}" "" "" "" "Sweden" "" "0" "" "" "" "27D2" "00468043" "" "" "" "3" "" "04265" "{PMID:Cherbal 2025:41232303}, {DOI:Cherbal 2025:10.1016/j.cancergen.2025.11.00}" "" "F" "no" "(Algeria)" "" "0" "" "" "" "LFS2422" "00470623" "" "" "" "1" "" "00006" "{PMID:Wai 2020:32123317}" "studied effect of variant on RNA" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat252" "00470624" "" "" "" "1" "" "00006" "{PMID:Wai 2020:32123317}" "studied effect of variant on RNA" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat253" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 548 "{{individualid}}" "{{diseaseid}}" "00046287" "00318" "00046288" "00318" "00046289" "00318" "00046290" "00318" "00046291" "00318" "00046292" "00318" "00046293" "00318" "00046294" "00318" "00046295" "00318" "00046296" "00318" "00046320" "00318" "00047321" "04296" "00047322" "04296" "00047328" "04296" "00048061" "04296" "00074654" "05093" "00079875" "05093" "00090869" "00091" "00090870" "00091" "00090871" "00091" "00090872" "00091" "00090873" "00091" "00090874" "00091" "00090875" "00091" "00090876" "00091" "00090877" "00091" "00090878" "00091" "00090879" "00091" "00155624" "00198" "00178553" "00318" "00178554" "00000" "00178555" "00000" "00178556" "00318" "00178557" "00000" "00178558" "00318" "00178559" "00000" "00178560" "00318" "00178561" "00000" "00178562" "00318" "00178563" "00000" "00178564" "00000" "00178565" "00318" "00178566" "00318" "00178567" "00000" "00178568" "00318" "00178569" "00318" "00178570" "00318" "00178571" "00000" "00178572" "00000" "00178573" "00000" "00178574" "00318" "00178575" "00318" "00178576" "00318" "00178577" "00000" "00178578" "00000" "00178579" "00000" "00178580" "00000" "00178581" "00000" "00178582" "00000" "00178583" "00000" "00178584" "00318" "00178585" "00000" "00178586" "00318" "00178587" "00318" "00178588" "00000" "00178589" "00318" "00178590" "00318" "00178591" "00318" "00178592" "00318" "00178593" "00000" "00178594" "00318" "00178595" "00000" "00178596" "00000" "00178597" "00318" "00178598" "00000" "00178599" "00318" "00178600" "00318" "00178601" "00000" "00178602" "00318" "00178603" "00000" "00178604" "00000" "00178605" "00318" "00178606" "00318" "00178607" "00000" "00178608" "00318" "00178609" "00000" "00178610" "00318" "00178611" "00000" "00178612" "00318" "00178613" "00000" "00178614" "00318" "00178615" "00000" "00178616" "00318" "00178617" "00000" "00178618" "00318" "00178619" "00000" "00178620" "00318" "00178621" "00000" "00178622" "00000" "00178623" "00318" "00178624" "00000" "00178625" "00000" "00178626" "00318" "00178627" "00000" "00178628" "00318" "00178629" "00000" "00180838" "00318" "00180839" "00000" "00180840" "00000" "00180841" "00000" "00180842" "00318" "00180843" "00000" "00180844" "00318" "00180845" "00000" "00181618" "00318" "00181619" "00318" "00181620" "00318" "00181621" "00318" "00182817" "00000" "00182818" "00000" "00182819" "00000" "00182820" "00000" "00182821" "00000" "00182822" "00000" "00182823" "00000" "00182824" "00000" "00182825" "00000" "00182826" "00000" "00182827" "00000" "00182828" "00000" "00182829" "00000" "00182830" "00000" "00182831" "00000" "00182832" "00000" "00182833" "00000" "00182834" "00000" "00182835" "00000" "00182836" "00000" "00182837" "00000" "00182838" "00000" "00182839" "00000" "00182840" "00000" "00182841" "00000" "00182842" "00000" "00182843" "00000" "00182844" "00000" "00182845" "00000" "00182846" "00000" "00182847" "00000" "00182848" "00000" "00182849" "00000" "00182850" "00000" "00182851" "00000" "00182852" "00000" "00182853" "00000" "00182854" "00000" "00182855" "00000" "00182856" "00000" "00182857" "00000" "00182858" "00000" "00228277" "00198" "00231303" "00318" "00240476" "02638" "00240477" "02638" "00240478" "02638" "00240480" "02638" "00240482" "02638" "00240483" "02638" "00240485" "02638" "00240488" "02638" "00240493" "02638" "00240498" "02638" "00240502" "02638" "00240504" "02638" "00241235" "02638" "00241239" "02638" "00241241" "02638" "00241242" "02638" "00241244" "02638" "00241246" "02638" "00241248" "02638" "00241251" "02638" "00241253" "02638" "00241255" "02638" "00241257" "02638" "00241259" "02638" "00241260" "02638" "00241261" "02638" "00246551" "00318" "00246552" "00318" "00246553" "00318" "00246554" "00318" "00246555" "00318" "00246556" "00318" "00246557" "00318" "00246558" "00318" "00266410" "05489" "00266474" "05489" "00266475" "05489" "00266479" "05093" "00266481" "00318" "00266485" "00318" "00291857" "00198" "00291858" "00198" "00291859" "00198" "00291860" "00198" "00291861" "00198" "00295164" "00198" "00295286" "00198" "00295287" "00198" "00295288" "00198" "00295289" "00198" "00295564" "00198" "00295744" "00198" "00295748" "00198" "00295890" "00683" "00336225" "00000" "00336328" "00000" "00336329" "00000" "00341749" "00000" "00341750" "00000" "00341751" "00000" "00341752" "00000" "00341753" "00000" "00341754" "00000" "00341755" "00000" "00341756" "00000" "00341757" "00000" "00341758" "00000" "00341759" "00000" "00341760" "00000" "00341761" "00000" "00341762" "00000" "00341763" "00000" "00341764" "00000" "00341765" "00000" "00341766" "00000" "00341767" "00000" "00341768" "00000" "00341769" "00000" "00341770" "00000" "00341771" "00000" "00341772" "00000" "00341773" "00000" "00341774" "00000" "00341775" "00000" "00341776" "00000" "00341777" "00000" "00341778" "00000" "00341779" "00000" "00341780" "00000" "00341781" "00000" "00341782" "00000" "00341783" "00000" "00341784" "00000" "00341785" "00000" "00341786" "00000" "00341787" "00000" "00341788" "00000" "00341789" "00000" "00341790" "00000" "00341791" "00000" "00341792" "00000" "00341793" "00000" "00341794" "00000" "00341795" "00000" "00341796" "00000" "00342350" "00318" "00342351" "00318" "00342352" "00318" "00342353" "00318" "00342354" "00318" "00342355" "00318" "00342356" "00318" "00342575" "00318" "00342582" "00318" "00342583" "00318" "00342584" "00318" "00348988" "00318" "00348989" "00318" "00348990" "00318" "00348991" "00318" "00348992" "00318" "00348993" "00318" "00348994" "00318" "00348995" "00318" "00348996" "00318" "00348997" "00318" "00348998" "00318" "00348999" "00318" "00349000" "00318" "00349001" "00318" "00349002" "00318" "00349003" "00318" "00349004" "00318" "00349005" "00318" "00349006" "00318" "00349007" "00318" "00349008" "00318" "00349009" "00318" "00349010" "00318" "00349011" "00318" "00349012" "00318" "00349013" "00318" "00349014" "00318" "00349015" "00318" "00349016" "00318" "00349017" "00318" "00349018" "00318" "00349019" "00318" "00349020" "00318" "00349021" "00318" "00349022" "00318" "00349023" "00318" "00349024" "00318" "00349025" "00318" "00349026" "00318" "00349027" "00318" "00349028" "00318" "00349029" "00318" "00349030" "00318" "00349031" "00318" "00349032" "00318" "00349033" "00318" "00349034" "00318" "00349035" "00318" "00349036" "00318" "00349037" "00318" "00349038" "00318" "00349039" "00318" "00349040" "00318" "00349041" "00318" "00349042" "00318" "00349043" "00318" "00349044" "00318" "00349045" "00318" "00349046" "00318" "00349047" "00318" "00349048" "00318" "00349049" "00318" "00349050" "00318" "00349051" "00318" "00349052" "00318" "00349053" "00318" "00349054" "00318" "00349055" "00318" "00349056" "00318" "00349057" "00318" "00349058" "00318" "00349059" "00318" "00349060" "00318" "00349061" "00318" "00349062" "00318" "00349063" "00318" "00349064" "00318" "00349065" "00318" "00349066" "00318" "00349067" "00318" "00349068" "00318" "00349069" "00318" "00349070" "00318" "00349071" "00318" "00349072" "00318" "00349073" "00318" "00349074" "00318" "00349075" "00318" "00349076" "00318" "00349077" "00318" "00349078" "00318" "00349079" "00318" "00349080" "00318" "00349081" "00318" "00349082" "00318" "00349083" "00318" "00349084" "00318" "00349085" "00318" "00349086" "00318" "00349087" "00318" "00349088" "00318" "00349089" "00318" "00349090" "00318" "00349091" "00318" "00349092" "00318" "00349093" "00318" "00349094" "00318" "00349095" "00318" "00353858" "00318" "00353859" "00318" "00353860" "00318" "00353861" "00318" "00353862" "00318" "00353863" "00318" "00353864" "00318" "00353865" "00318" "00353866" "00318" "00353867" "00318" "00353868" "00318" "00353869" "00318" "00353870" "00318" "00353871" "00318" "00353872" "00318" "00353873" "00318" "00353874" "00318" "00353875" "00318" "00353876" "00318" "00353877" "00318" "00353878" "00318" "00353879" "00318" "00353880" "00318" "00353881" "00318" "00353882" "00318" "00353883" "00318" "00353884" "00318" "00353885" "00318" "00353886" "00318" "00353887" "00318" "00353888" "00318" "00353889" "00318" "00353890" "00318" "00353891" "00318" "00353892" "00318" "00353893" "00318" "00353894" "00318" "00353895" "00318" "00353896" "00318" "00353897" "00318" "00353898" "00318" "00353899" "00318" "00353900" "00318" "00353901" "00318" "00353902" "00318" "00353903" "00318" "00353904" "00318" "00353905" "00318" "00353906" "00318" "00353907" "00318" "00353908" "00318" "00353909" "00318" "00358634" "00000" "00358635" "00000" "00358636" "00000" "00358637" "00000" "00358638" "00000" "00358639" "00000" "00358640" "00000" "00358641" "00000" "00358642" "00000" "00358643" "00000" "00358644" "00000" "00358645" "00000" "00358646" "00000" "00358647" "00000" "00358648" "00000" "00358649" "00000" "00358650" "00000" "00358651" "00000" "00358652" "00000" "00358653" "00000" "00358654" "00000" "00358655" "00000" "00358656" "00000" "00358657" "00000" "00358658" "00000" "00358659" "00000" "00358660" "00000" "00358661" "00000" "00358662" "00000" "00358663" "00000" "00358664" "00000" "00358665" "00000" "00358666" "00000" "00358667" "00000" "00358668" "00000" "00358669" "00000" "00358670" "00000" "00358671" "00000" "00358672" "00000" "00358673" "00000" "00358674" "00000" "00358675" "00000" "00358676" "00000" "00358677" "00000" "00358678" "00000" "00358679" "00000" "00358680" "00000" "00358681" "00000" "00358682" "00000" "00358683" "00000" "00358684" "00000" "00358685" "00000" "00376159" "00681" "00399592" "00318" "00399593" "00318" "00399594" "00318" "00399595" "00318" "00399596" "00318" "00399597" "00318" "00399598" "00318" "00399707" "00318" "00399708" "00318" "00399709" "00318" "00399710" "00318" "00399711" "00318" "00399712" "00318" "00399713" "00318" "00399714" "00318" "00399715" "00318" "00399716" "00318" "00399717" "00318" "00399718" "00318" "00399719" "00318" "00399720" "00318" "00399721" "00318" "00406997" "05489" "00410557" "00198" "00430358" "04296" "00430362" "04296" "00431557" "01524" "00432987" "04296" "00432996" "04296" "00433152" "00318" "00433153" "00318" "00433157" "00318" "00433157" "04148" "00433157" "05154" "00433158" "05093" "00433159" "00318" "00433160" "05093" "00433161" "05093" "00433178" "01524" "00433179" "00318" "00433180" "00318" "00433181" "05093" "00433182" "05093" "00433183" "05093" "00433187" "05093" "00433189" "05093" "00443728" "05489" "00443729" "05489" "00448048" "05093" "00449725" "00423" "00449739" "00424" "00457360" "04296" "00464409" "00000" "00464410" "00000" "00468043" "01415" "00470623" "00198" "00470624" "00198" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00000, 00091, 00198, 00318, 00423, 00424, 00681, 00683, 01221, 01347, 01415, 01524, 01633, 01989, 02001, 02632, 02638, 03716, 04148, 04296, 05093, 05154, 05489, 06361 ## Count = 98 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Cysts}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Cancer/Sub_type}}" "{{Phenotype/Eye/Retina}}" "{{Phenotype/Neoplasm}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000034678" "04296" "00047321" "00727" "Unknown" "" "breast cancer 31y; breast cancer 66y; leiomyosarcoma of chest wall 71y (in breast radiotherapy field)" "" "" "" "" "" "" "" "" "" "" "" "" "" "neoplasia, multiple inherited alleles (MINAS)" "" "0000034751" "04296" "00047328" "00006" "Unknown" "" "lipoma; abdominal wall 0y; Haemangiomas 1y; Macrocephaly; Ovarian granulosa cell tumour 1y (No somatic PTEN or TP53 mutations. LOH PTEN . No LOH TP53); Xanthoastrocytoma. Temporal lobe 3y (No somatic PTEN or TP53 mutations. No LOH PTEN or TP53); Pelvic liposarcoma 4y (No somatic PTEN or TP53 mutations. LOH PTEN . No LOH TP53)" "" "" "" "" "" "" "" "" "" "" "" "" "" "neoplasia, multiple inherited alleles (MINAS)" "" "0000034767" "04296" "00047322" "00006" "Unknown" "" "cutaneous malignant melanoma 65y; Breast cancer 69y; Ovarian cancer 69y; Colon cancer 74y" "" "" "" "" "" "" "" "" "" "" "" "" "" "neoplasia, multiple inherited alleles (MINAS)" "" "0000034768" "04296" "00048061" "00006" "Unknown" "" "rectal carcinoma 27 y; Gastroesophageal adenocarcinoma 32y; Chromophobe renal cell carcinoma 32y; Facial fibrofolliculomas." "" "" "" "" "" "" "" "" "" "" "" "" "" "neoplasia, multiple inherited alleles (MINAS)" "" "0000059588" "05093" "00079875" "01738" "Complex" "" "31y-multiple uterine fibroids, 52y-papillary renal cell carcinoma: maternal 1st cousin cutaneous leiomyomas and multiple fibroids" "" "" "" "" "" "" "" "" "" "RCC" "" "" "" "" "" "0000172212" "00198" "00228277" "01807" "Unknown" "" "Abnormality of adrenal physiology (HP:0011733); Breast carcinoma (HP:0003002)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000173740" "00318" "00231303" "03273" "Familial" "28y" "Breast cancer" "" "" "" "" "" "" "" "" "" "" "" "" "" "Early-onset breast cancer" "" "0000185375" "02638" "00240476" "03337" "Unknown" "" "ORPHA:2495 meningioma" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000185376" "02638" "00240477" "03337" "Unknown" "" "ORPHA:2495 meningioma" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000185377" "02638" "00240478" "03337" "Unknown" "" "ORPHA:2495 meningioma" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000185378" "02638" "00240480" "03337" "Unknown" "" "ORPHA:2495 meningioma" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000185379" "02638" "00240482" "03337" "Unknown" "" "ORPHA:2495 meningioma" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000185380" "02638" "00240483" "03337" "Unknown" "" "ORPHA:2495 meningioma" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000185381" "02638" "00240485" "03337" "Unknown" "" "ORPHA:2495 meningioma" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000185382" "02638" "00240488" "03337" "Unknown" "" "ORPHA:2495 meningioma" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000185383" "02638" "00240493" "03337" "Unknown" "" "ORPHA:2495 meningioma" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000185384" "02638" "00240498" "03337" "Unknown" "" "ORPHA:2495 meningioma" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000185385" "02638" "00240502" "03337" "Unknown" "" "ORPHA:2495 meningioma" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000185386" "02638" "00240504" "03337" "Unknown" "" "ORPHA:2495 meningioma" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000185387" "02638" "00241235" "03337" "Unknown" "" "ORPHA:2495 meningioma" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000185388" "02638" "00241239" "03337" "Unknown" "" "ORPHA:2495 meningioma" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000185389" "02638" "00241241" "03337" "Unknown" "" "ORPHA:2495 meningioma" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000185390" "02638" "00241242" "03337" "Unknown" "" "ORPHA:2495 meningioma" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000185391" "02638" "00241244" "03337" "Unknown" "" "ORPHA:2495 meningioma" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000185392" "02638" "00241246" "03337" "Unknown" "" "ORPHA:2495 meningioma" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000185393" "02638" "00241248" "03337" "Unknown" "" "ORPHA:2495 meningioma" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000185394" "02638" "00241251" "03337" "Unknown" "" "ORPHA:2495 meningioma" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000185395" "02638" "00241253" "03337" "Unknown" "" "ORPHA:2495 meningioma" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000185396" "02638" "00241255" "03337" "Unknown" "" "ORPHA:2495 meningioma" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000185397" "02638" "00241257" "03337" "Unknown" "" "ORPHA:2495 meningioma" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000185398" "02638" "00241259" "03337" "Unknown" "" "ORPHA:2495 meningioma" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000185399" "02638" "00241260" "03337" "Unknown" "" "ORPHA:2495 meningioma" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000185400" "02638" "00241261" "03337" "Unknown" "" "ORPHA:2495 meningioma" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000186402" "00318" "00246551" "00643" "Unknown" "" "no family history; no triple-negative breast cancer; 29y first breast cancer" "" "" "" "" "" "" "" "" "" "" "" "" "" "breast cancer" "" "0000186403" "00318" "00246552" "00643" "Unknown" "" "family history; triple-negative breast cancer; 20y first breast cancer" "" "" "" "" "" "" "" "" "" "" "" "" "" "breast cancer" "" "0000186404" "00318" "00246553" "00643" "Unknown" "" "family history; no triple-negative breast cancer; 24y first breast cancer, 36y second breast cancer; 33y ovarian cancer" "" "" "" "" "" "" "" "" "" "" "" "" "" "breast cancer" "" "0000186405" "00318" "00246554" "00643" "Unknown" "" "family history; no triple-negative breast cancer; 30y first breast cancer" "" "" "" "" "" "" "" "" "" "" "" "" "" "breast cancer" "" "0000186406" "00318" "00246555" "00643" "Unknown" "" "family history; triple-negative breast cancer; 24y first breast cancer, 30y second breast cancer" "" "" "" "" "" "" "" "" "" "" "" "" "" "breast cancer" "" "0000186407" "00318" "00246556" "00643" "Unknown" "" "family history; no triple-negative breast cancer; 31y first breast cancer" "" "" "" "" "" "" "" "" "" "" "" "" "" "breast cancer" "" "0000186408" "00318" "00246557" "00643" "Unknown" "" "family history; no triple-negative breast cancer; 36y first breast cancer" "" "" "" "" "" "" "" "" "" "" "" "" "" "breast cancer" "" "0000186409" "00318" "00246558" "00643" "Unknown" "" "family history; no triple-negative breast cancer; 35y first breast cancer, 40y second breast cancer" "" "" "" "" "" "" "" "" "" "" "" "" "" "breast cancer" "" "0000204208" "05489" "00266474" "02337" "Familial" "" "family history" "" "" "" "" "" "" "" "" "" "" "" "" "" "colon cancer" "" "0000204209" "05489" "00266475" "02337" "Familial" "" "family history" "" "" "" "" "" "" "" "" "" "" "" "" "" "colon cancer" "" "0000204213" "05093" "00266479" "02337" "Unknown" "" "posterior fossa hemangioblastoma; no family history" "" "" "" "" "" "" "" "" "" "" "" "" "" "hemangioblastoma" "" "0000204215" "00318" "00266481" "02337" "Familial" "" "family history" "" "" "" "" "" "" "" "" "" "" "" "" "" "breast cancer" "" "0000204219" "00318" "00266485" "02337" "Familial" "" "family history" "" "" "" "" "" "" "" "" "" "" "" "" "" "breast cancer" "" "0000223129" "00198" "00295564" "01164" "Unknown" "" "Neoplasm of the small intestine (HP:0100833); Neoplasm by anatomical site (HP:0011793)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000223262" "00198" "00295744" "01164" "Unknown" "" "Uterine leiomyosarcoma (HP:0002891); Neoplasm of the genitourinary tract (HP:0007379)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000223266" "00198" "00295748" "01164" "Unknown" "" "Ductal carcinoma in situ (HP:0030075)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000271370" "00681" "00376159" "00585" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "pancreatic ductal adenocarcinoma" "" "0000292698" "00318" "00399592" "00006" "Familial, autosomal dominant" "" "familial breast cancer, ductal carcinoma in situ" "<26y" "" "" "" "" "" "" "" "" "" "" "" "" "breast cancer" "" "0000292699" "00318" "00399593" "00006" "Familial, autosomal dominant" "" "familial breast cancer, bilateral, ductal carcinoma in situ" "<26y" "" "" "" "" "" "" "" "" "" "" "" "" "breast cancer" "" "0000292700" "00318" "00399594" "00006" "Familial, autosomal dominant" "" "sporadic breast cancer, invasive breast cancer, grade 3, ER+/HER2+" "<26y" "" "" "" "" "" "" "" "" "" "" "" "" "breast cancer" "" "0000292701" "00318" "00399595" "00006" "Familial, autosomal dominant" "" "sporadic breast cancer, bilateral, lobular breast cancer, ER+/HER2+" "<26y" "" "" "" "" "" "" "" "" "" "" "" "" "breast cancer" "" "0000292702" "00318" "00399596" "00006" "Familial, autosomal dominant" "" "familial breast cancer, invasive breast cancer, grade 3, ER+/HER2-" "<26y" "" "" "" "" "" "" "" "" "" "" "" "" "breast cancer" "" "0000292703" "00318" "00399597" "00006" "Familial, autosomal dominant" "" "sporadic breast cancer, bilateral, invasive breast cancer, grade 3" "<26y" "" "" "" "" "" "" "" "" "" "" "" "" "breast cancer" "" "0000292704" "00318" "00399598" "00006" "Familial, autosomal dominant" "" "sporadic breast cancer, invasive breast cancer, grade 3, ER+/HER2+" "<26y" "" "" "" "" "" "" "" "" "" "" "" "" "breast cancer" "" "0000292813" "00318" "00399707" "00006" "Familial, autosomal dominant" "" "sporadic breast cancer, invasive breast cancer, grade 3, ER-/HER2-" "26y-30y" "" "" "" "" "" "" "" "" "" "" "" "" "breast cancer" "" "0000292814" "00318" "00399708" "00006" "Familial, autosomal dominant" "" "sporadic breast cancer, invasive breast cancer, grade 3, ER-/HER2+" "26y-30y" "" "" "" "" "" "" "" "" "" "" "" "" "breast cancer" "" "0000292815" "00318" "00399709" "00006" "Familial, autosomal dominant" "" "sporadic breast cancer, bilateral, ductal carcinoma in situ" "26y-30y" "" "" "" "" "" "" "" "" "" "" "" "" "breast cancer" "" "0000292816" "00318" "00399710" "00006" "Familial, autosomal dominant" "" "sporadic breast cancer, ductal carcinoma in situ" "26y-30y" "" "" "" "" "" "" "" "" "" "" "" "" "breast cancer" "" "0000292817" "00318" "00399711" "00006" "Familial, autosomal dominant" "" "sporadic breast cancer, bilateral, invasive breast cancer, grade 3, ER+/HER2+" "26y-30y" "" "" "" "" "" "" "" "" "" "" "" "" "breast cancer" "" "0000292818" "00318" "00399712" "00006" "Familial, autosomal dominant" "" "familial breast cancer, invasive breast cancer, grade 3, ER+" "26y-30y" "" "" "" "" "" "" "" "" "" "" "" "" "breast cancer" "" "0000292819" "00318" "00399713" "00006" "Familial, autosomal dominant" "" "familial breast cancer, bilateral, invasive breast cancer, grade 3, ER-/HER2+" "26y-30y" "" "" "" "" "" "" "" "" "" "" "" "" "breast cancer" "" "0000292820" "00318" "00399714" "00006" "Familial, autosomal dominant" "" "sporadic breast cancer, bilateral, NOS" "26y-30y" "" "" "" "" "" "" "" "" "" "" "" "" "breast cancer" "" "0000292821" "00318" "00399715" "00006" "Familial, autosomal dominant" "" "familial breast cancer, ductal carcinoma in situ" "26y-30y" "" "" "" "" "" "" "" "" "" "" "" "" "breast cancer" "" "0000292822" "00318" "00399716" "00006" "Familial, autosomal dominant" "" "familial breast cancer, bilateral, ductal carcinoma in situ" "26y-30y" "" "" "" "" "" "" "" "" "" "" "" "" "breast cancer" "" "0000292823" "00318" "00399717" "00006" "Familial, autosomal dominant" "" "familial breast cancer, invasive breast cancer, grade 3, ER-/HER2-" "26y-30y" "" "" "" "" "" "" "" "" "" "" "" "" "breast cancer" "" "0000292824" "00318" "00399718" "00006" "Familial, autosomal dominant" "" "familial breast cancer, invasive breast cancer, grade 3, ER-/HER2+" "26y-30y" "" "" "" "" "" "" "" "" "" "" "" "" "breast cancer" "" "0000292825" "00318" "00399719" "00006" "Familial, autosomal dominant" "" "sporadic breast cancer, invasive breast cancer, grade 3, ER-/HER2-" "26y-30y" "" "" "" "" "" "" "" "" "" "" "" "" "breast cancer" "" "0000292826" "00318" "00399720" "00006" "Familial, autosomal dominant" "" "sporadic breast cancer, bilateral, invasive breast cancer, grade 3, ER+/HER2+" "26y-30y" "" "" "" "" "" "" "" "" "" "" "" "" "breast cancer" "" "0000292827" "00318" "00399721" "00006" "Familial, autosomal dominant" "" "familial breast cancer, bilateral, invasive breast cancer, grade 3, ER+/HER2-" "26y-30y" "" "" "" "" "" "" "" "" "" "" "" "" "breast cancer" "" "0000302660" "00198" "00410557" "00006" "Unknown" "" "see paper; ..., onset adulthood, neurofibromas, liposarcoma, prostate carcinoma, low-grade glioma; mother neurofibromas" "" "" "" "" "" "" "" "" "" "" "" "" "NF1;LFS" "" "" "0000321160" "04296" "00430358" "01082" "Familial, autosomal dominant" "" "Gastric adenocarcinoma (HP:0033770); Non-Hodking Lymphoma (HP:0012539)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000322135" "04296" "00430362" "01082" "Familial" "" "Glioma (HP:0009733)" "" "" "46y" "" "" "" "" "" "" "" "" "" "" "" "" "0000323684" "04296" "00432987" "01082" "Familial, autosomal dominant" "" "Breast cancer (HP:0003002)" "" "36y" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000323693" "04296" "00432996" "01082" "Familial, autosomal dominant" "" "Breast cancer (HP:0003002)" "48y" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000323695" "00318" "00433152" "03628" "Familial" "" "" "" "61y" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000323699" "00318" "00433153" "03628" "Familial" "" "" "" "49y" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000323704" "00318" "00433157" "03628" "Familial" "" "HP:0012056 Cutaneous melanoma\r\nOMIM:114480 Breast cancer (bilateral)" "" "35y" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000323705" "05093" "00433158" "03628" "Familial" "" "Pulmonary malignant pecoma\r\nsinonasal carcinoma \r\nprostate leiomyosarcoma" "" "38y" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000323706" "00318" "00433159" "03628" "Familial" "" "breast cancer\r\nattenuated LFS" "" "36y" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000323707" "05093" "00433160" "03628" "Familial" "" "ORPHA:1501 adrenocortical carcinoma" "" "01y" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000323708" "05093" "00433161" "03628" "Familial" "" "OMIM:114480 breast cancer" "" "54y" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000323709" "01524" "00433178" "03628" "Unknown" "" "Attenuated Li-Fraumeni Syndrome" "64y" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000323710" "00318" "00433179" "03628" "Familial" "" "OMIM:114480 breast cancer" "28y" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000323711" "00318" "00433180" "03628" "Familial" "" "OMIM:151623 Li-Fraumeni syndrome" "24y" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000323712" "05093" "00433181" "03628" "Familial" "" "ovarian dermoid cyst (21y), retroperitoneal leiomyosarcoma (41y), breast cancer (41y), parathyroid cancer (41y)\r\nOMIM:151623 Li-Fraumeni syndrome" "21y" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000323713" "05093" "00433182" "03628" "Familial" "" "bilateral breast cancer (56, 63y)\r\nattenuated Li-Fraumeni sy" "56y" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000323714" "05093" "00433183" "03628" "Familial" "" "acute lymphoid leukemia (10y), parotid mucoepidermal carcinoma (28y), soft tissue leiomyosarcoma (28y), spinocellular carcinoma (33y)\r\nOMIM:151623 Li-Fraumeni syndrome" "10y" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000323715" "05093" "00433183" "03628" "Familial" "60y" "OMIM:167000 Ovarian cancer\r\nattenuated LFS" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000323719" "05093" "00433187" "03628" "Familial" "" "OMIM:114480 Breast cancer\r\nattenuated Li-Fraumeni sy" "58y" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000323721" "05093" "00433189" "03628" "Familial" "" "bilateral breast cancer (33, 35y)\r\nOMIM:151623 Li-Fraumeni syndrome" "33y" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000333009" "05489" "00443728" "04599" "Unknown" "17" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000333010" "05489" "00443729" "04599" "Unknown" "40" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000337237" "05093" "00448048" "03628" "Familial" "60y" "OMIM:167000 Ovarian cancer; attenuated LFS" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000345822" "04296" "00457360" "04749" "Unknown" "" "Clinical dx NF1 Temporal diffuse astrocytoma 3y Optic nerve glioma MPNST 8y" "" "" "" "" "" "" "" "" "" "" "" "" "" "MINAS" "" "0000353195" "01415" "00468043" "04265" "Familial, autosomal dominant" "" "Rhabdomyosarcoma" "03y" "03y" "Rhabdomyosarcoma" "" "" "" "" "" "" "" "" "" "" "" "" ## Screenings ## Do not remove or alter this header ## ## Count = 549 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000003211" "00003293" "1" "00552" "00552" "2013-11-05 19:07:01" "" "" "SEQ-NG-I" "DNA" "" "" "0000046392" "00046287" "1" "01339" "00008" "2015-07-03 21:52:27" "" "" "SEQ" "DNA" "" "" "0000046393" "00046288" "1" "01339" "00008" "2015-07-03 21:52:27" "" "" "SEQ" "DNA" "" "" "0000046394" "00046289" "1" "01339" "00008" "2015-07-03 21:52:27" "" "" "SEQ" "DNA" "" "" "0000046395" "00046290" "1" "01339" "00008" "2015-07-03 21:52:27" "" "" "SEQ" "DNA" "" "" "0000046396" "00046291" "1" "01339" "00008" "2015-07-03 21:52:27" "" "" "SEQ" "DNA" "" "" "0000046397" "00046292" "1" "01339" "00008" "2015-07-03 21:52:27" "" "" "SEQ" "DNA" "" "" "0000046398" "00046293" "1" "01339" "00008" "2015-07-03 21:52:27" "" "" "SEQ" "DNA" "" "" "0000046399" "00046294" "1" "01339" "00008" "2015-07-03 21:52:27" "" "" "SEQ" "DNA" "" "" "0000046400" "00046295" "1" "01339" "00008" "2015-07-03 21:52:27" "" "" "SEQ" "DNA" "" "" "0000046401" "00046296" "1" "01339" "00008" "2015-07-03 21:52:27" "" "" "SEQ" "DNA" "" "" "0000046425" "00046320" "1" "01339" "00008" "2015-07-03 21:52:27" "" "" "SEQ" "DNA" "" "" "0000047421" "00047321" "1" "00727" "00727" "2015-08-20 17:24:55" "" "" "SEQ" "DNA" "" "" "0000047423" "00047322" "1" "00727" "00727" "2015-08-20 17:30:27" "00727" "2015-09-01 19:39:00" "DHPLC;SEQ" "DNA" "" "" "0000047502" "00047328" "1" "00727" "00727" "2015-08-21 19:33:35" "" "" "SEQ" "DNA" "" "" "0000048186" "00048061" "1" "00727" "00727" "2015-09-03 12:41:42" "" "" "SEQ" "DNA" "" "" "0000074819" "00074654" "1" "01694" "01694" "2016-07-12 16:02:55" "00006" "2016-07-14 12:47:50" "RT-PCR;SEQ" "DNA;RNA" "blood" "" "0000079956" "00079875" "1" "01738" "01738" "2016-08-22 13:15:25" "" "" "SEQ-NG" "DNA" "" "" "0000091014" "00090869" "1" "01816" "00006" "2016-11-21 16:06:29" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000091015" "00090870" "1" "01816" "00006" "2016-11-21 16:06:29" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000091016" "00090871" "1" "01816" "00006" "2016-11-21 16:06:29" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000091017" "00090872" "1" "01816" "00006" "2016-11-21 16:06:29" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000091018" "00090873" "1" "01816" "00006" "2016-11-21 16:06:29" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000091019" "00090874" "1" "01816" "00006" "2016-11-21 16:06:29" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000091020" "00090875" "1" "01816" "00006" "2016-11-21 16:06:29" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000091021" "00090876" "1" "01816" "00006" "2016-11-21 16:06:29" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000091022" "00090877" "1" "01816" "00006" "2016-11-21 16:06:29" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000091023" "00090878" "1" "01816" "00006" "2016-11-21 16:06:29" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000091024" "00090879" "1" "01816" "00006" "2016-11-21 16:06:29" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000156489" "00155624" "1" "01873" "00006" "2017-11-15 18:25:58" "" "" "SEQ" "DNA" "" "" "0000179456" "00178553" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179457" "00178554" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179458" "00178555" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179459" "00178556" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179460" "00178557" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179461" "00178558" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179462" "00178559" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179463" "00178560" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179464" "00178561" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179465" "00178562" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179466" "00178563" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179467" "00178564" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179468" "00178565" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179469" "00178566" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179470" "00178567" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179471" "00178568" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179472" "00178569" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179473" "00178570" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179474" "00178571" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179475" "00178572" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179476" "00178573" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179477" "00178574" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179478" "00178575" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179479" "00178576" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179480" "00178577" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179481" "00178578" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179482" "00178579" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179483" "00178580" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179484" "00178581" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179485" "00178582" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179486" "00178583" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179487" "00178584" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179488" "00178585" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179489" "00178586" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179490" "00178587" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179491" "00178588" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179492" "00178589" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179493" "00178590" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179494" "00178591" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179495" "00178592" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179496" "00178593" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179497" "00178594" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179498" "00178595" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179499" "00178596" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179500" "00178597" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179501" "00178598" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179502" "00178599" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179503" "00178600" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179504" "00178601" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179505" "00178602" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179506" "00178603" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179507" "00178604" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179508" "00178605" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179509" "00178606" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179510" "00178607" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179511" "00178608" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179512" "00178609" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179513" "00178610" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179514" "00178611" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179515" "00178612" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179516" "00178613" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179517" "00178614" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179518" "00178615" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179519" "00178616" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179520" "00178617" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179521" "00178618" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179522" "00178619" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179523" "00178620" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179524" "00178621" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179525" "00178622" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179526" "00178623" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179527" "00178624" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179528" "00178625" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179529" "00178626" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179530" "00178627" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179531" "00178628" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000179532" "00178629" "1" "01714" "00006" "2018-08-17 01:16:42" "" "" "SEQ" "DNA" "" "" "0000181775" "00180838" "1" "01714" "00006" "2018-09-07 18:47:50" "" "" "SEQ" "DNA" "" "" "0000181776" "00180839" "1" "01714" "00006" "2018-09-07 18:47:50" "" "" "SEQ" "DNA" "" "" "0000181777" "00180840" "1" "01714" "00006" "2018-09-07 18:47:50" "" "" "SEQ" "DNA" "" "" "0000181778" "00180841" "1" "01714" "00006" "2018-09-07 18:47:50" "" "" "SEQ" "DNA" "" "" "0000181779" "00180842" "1" "01714" "00006" "2018-09-07 18:47:50" "" "" "SEQ" "DNA" "" "" "0000181780" "00180843" "1" "01714" "00006" "2018-09-07 18:47:50" "" "" "SEQ" "DNA" "" "" "0000181781" "00180844" "1" "01714" "00006" "2018-09-07 18:47:50" "" "" "SEQ" "DNA" "" "" "0000181782" "00180845" "1" "01714" "00006" "2018-09-07 18:47:50" "" "" "SEQ" "DNA" "" "" "0000182578" "00181618" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000182579" "00181619" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000182580" "00181620" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000182581" "00181621" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183777" "00182817" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183778" "00182818" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183779" "00182819" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183780" "00182820" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183781" "00182821" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183782" "00182822" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183783" "00182823" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183784" "00182824" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183785" "00182825" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183786" "00182826" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183787" "00182827" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183788" "00182828" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183789" "00182829" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183790" "00182830" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183791" "00182831" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183792" "00182832" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183793" "00182833" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183794" "00182834" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183795" "00182835" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183796" "00182836" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183797" "00182837" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183798" "00182838" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183799" "00182839" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183800" "00182840" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183801" "00182841" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183802" "00182842" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183803" "00182843" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183804" "00182844" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183805" "00182845" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183806" "00182846" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183807" "00182847" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183808" "00182848" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183809" "00182849" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183810" "00182850" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183811" "00182851" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183812" "00182852" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183813" "00182853" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183814" "00182854" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183815" "00182855" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183816" "00182856" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183817" "00182857" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000183818" "00182858" "1" "01714" "00006" "2018-08-25 06:42:38" "00009" "2018-10-11 14:19:58" "SEQ" "DNA" "" "" "0000229367" "00228277" "1" "01807" "01807" "2019-03-22 15:55:33" "" "" "SEQ" "DNA" "" "" "0000232401" "00231303" "1" "03273" "03273" "2019-04-29 21:49:00" "" "" "SEQ-NG-I" "DNA" "Blood" "" "0000241587" "00240477" "1" "03337" "03337" "2019-06-21 12:27:22" "" "" "SEQ" "DNA" "meningioma" "" "0000241588" "00240478" "1" "03337" "03337" "2019-06-21 12:35:07" "" "" "SEQ" "DNA" "meningioma" "" "0000241589" "00240480" "1" "03337" "03337" "2019-06-21 12:42:56" "" "" "SEQ" "DNA" "meningioma" "" "0000241592" "00240482" "1" "03337" "03337" "2019-06-21 12:55:47" "" "" "SEQ" "DNA" "meningioma" "" "0000241593" "00240483" "1" "03337" "03337" "2019-06-21 13:00:49" "" "" "SEQ" "DNA" "meningioma" "" "0000241595" "00240485" "1" "03337" "03337" "2019-06-21 13:05:25" "" "" "SEQ" "DNA" "meningioma" "" "0000241598" "00240488" "1" "03337" "03337" "2019-06-21 13:22:06" "" "" "SEQ" "DNA" "meningioma" "" "0000241602" "00240493" "1" "03337" "03337" "2019-06-21 13:32:33" "" "" "SEQ" "DNA" "meningioma" "" "0000241606" "00240498" "1" "03337" "03337" "2019-06-21 13:53:32" "" "" "SEQ" "DNA" "meningioma" "" "0000241611" "00240502" "1" "03337" "03337" "2019-06-21 14:15:11" "" "" "SEQ" "DNA" "meningioma" "" "0000241613" "00240504" "1" "03337" "03337" "2019-06-21 14:24:25" "" "" "SEQ" "DNA" "meningioma" "" "0000241616" "00240476" "1" "03337" "03337" "2019-06-21 14:40:32" "" "" "SEQ" "DNA" "meningioma" "" "0000242341" "00240485" "1" "03337" "03337" "2019-06-21 14:52:28" "" "" "SEQ" "DNA" "meningioma" "" "0000242343" "00240480" "1" "03337" "03337" "2019-06-21 14:56:58" "" "" "SEQ" "DNA" "meningioma" "" "0000242347" "00241235" "1" "03337" "03337" "2019-06-21 15:08:39" "" "" "SEQ" "DNA" "meningioma" "" "0000242351" "00241239" "1" "03337" "03337" "2019-06-21 15:20:43" "" "" "SEQ" "DNA" "meningioma" "" "0000242353" "00241241" "1" "03337" "03337" "2019-06-21 15:25:09" "" "" "SEQ" "DNA" "meningioma" "" "0000242354" "00241242" "1" "03337" "03337" "2019-06-21 15:32:32" "" "" "SEQ" "DNA" "meningioma" "" "0000242356" "00241244" "1" "03337" "03337" "2019-06-21 15:39:22" "" "" "SEQ" "DNA" "meningioma" "" "0000242358" "00241246" "1" "03337" "03337" "2019-06-21 15:43:20" "" "" "SEQ" "DNA" "meningioma" "" "0000242360" "00241248" "1" "03337" "03337" "2019-06-21 15:47:03" "" "" "SEQ" "DNA" "meningioma" "" "0000242361" "00241251" "1" "03337" "03337" "2019-06-21 15:52:13" "" "" "SEQ" "DNA" "meningioma" "" "0000242364" "00241253" "1" "03337" "03337" "2019-06-21 15:58:20" "" "" "SEQ" "DNA" "meningioma" "" "0000242365" "00241255" "1" "03337" "03337" "2019-06-21 16:03:59" "" "" "SEQ" "DNA" "" "" "0000242368" "00241257" "1" "03337" "03337" "2019-06-21 16:12:22" "" "" "SEQ" "DNA" "meningioma" "" "0000242369" "00241259" "1" "03337" "03337" "2019-06-21 16:16:14" "" "" "SEQ" "DNA" "meningioma" "" "0000242371" "00241260" "1" "03337" "03337" "2019-06-21 16:21:38" "" "" "SEQ" "DNA" "meningioma" "" "0000242372" "00241261" "1" "03337" "03337" "2019-06-21 16:25:31" "" "" "SEQ" "DNA" "meningioma" "" "0000247663" "00246551" "1" "00643" "00006" "2019-07-12 12:55:51" "" "" "SEQ" "DNA" "" "gene panel" "0000247664" "00246552" "1" "00643" "00006" "2019-07-12 12:55:51" "" "" "SEQ" "DNA" "" "gene panel" "0000247665" "00246553" "1" "00643" "00006" "2019-07-12 12:55:51" "" "" "SEQ" "DNA" "" "gene panel" "0000247666" "00246554" "1" "00643" "00006" "2019-07-12 12:55:51" "" "" "SEQ" "DNA" "" "gene panel" "0000247667" "00246555" "1" "00643" "00006" "2019-07-12 12:55:51" "" "" "SEQ" "DNA" "" "gene panel" "0000247668" "00246556" "1" "00643" "00006" "2019-07-12 12:55:51" "" "" "SEQ" "DNA" "" "gene panel" "0000247669" "00246557" "1" "00643" "00006" "2019-07-12 12:55:51" "" "" "SEQ" "DNA" "" "gene panel" "0000247670" "00246558" "1" "00643" "00006" "2019-07-12 12:55:51" "" "" "SEQ" "DNA" "" "gene panel" "0000267537" "00266410" "1" "03452" "03452" "2019-09-18 18:58:36" "" "" "SEQ-NG" "DNA" "" "" "0000267600" "00266474" "1" "02337" "01873" "2019-08-07 20:11:25" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000267601" "00266475" "1" "02337" "01873" "2019-08-07 20:11:25" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000267605" "00266479" "1" "02337" "01873" "2019-08-07 20:11:25" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000267607" "00266481" "1" "02337" "01873" "2019-08-07 20:11:25" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000267611" "00266485" "1" "02337" "01873" "2019-08-07 20:11:25" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000293025" "00291857" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000293026" "00291858" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000293027" "00291859" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000293028" "00291860" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000293029" "00291861" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000296332" "00295164" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000296454" "00295286" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000296455" "00295287" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000296456" "00295288" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000296457" "00295289" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000296734" "00295564" "1" "01164" "01164" "2020-03-18 10:48:19" "" "" "SEQ-NG-S" "DNA" "" "" "0000296917" "00295744" "1" "01164" "01164" "2020-03-26 12:29:54" "" "" "SEQ-NG-S" "DNA" "" "" "0000296921" "00295748" "1" "01164" "01164" "2020-03-26 12:30:03" "" "" "SEQ-NG-S" "DNA" "" "" "0000297062" "00295890" "1" "03629" "03629" "2020-03-30 03:53:21" "" "" "SEQ-NG-I" "DNA" "" "gene panel ATM, AXIN2, BARD1, BRCA1, BRCA2, BRIP1, CDH1, CHEK2, MLH1, MRE11A, MSH2, MSH6, MUTYH, NF1, PALB2, PMS2, PTEN, RAD51, RAD51C, RAD51D, STK11, TP53" "0000337455" "00336225" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000337558" "00336328" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000337559" "00336329" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342979" "00341749" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342980" "00341750" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342981" "00341751" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342982" "00341752" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342983" "00341753" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342984" "00341754" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342985" "00341755" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342986" "00341756" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342987" "00341757" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342988" "00341758" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342989" "00341759" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342990" "00341760" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342991" "00341761" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342992" "00341762" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342993" "00341763" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342994" "00341764" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342995" "00341765" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342996" "00341766" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342997" "00341767" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342998" "00341768" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000342999" "00341769" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000343000" "00341770" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000343001" "00341771" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000343002" "00341772" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000343003" "00341773" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000343004" "00341774" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000343005" "00341775" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000343006" "00341776" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000343007" "00341777" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000343008" "00341778" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000343009" "00341779" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000343010" "00341780" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000343011" "00341781" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000343012" "00341782" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000343013" "00341783" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000343014" "00341784" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000343015" "00341785" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000343016" "00341786" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000343017" "00341787" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000343018" "00341788" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000343019" "00341789" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000343020" "00341790" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000343021" "00341791" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000343022" "00341792" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000343023" "00341793" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000343024" "00341794" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000343025" "00341795" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000343026" "00341796" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000343580" "00342350" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000343581" "00342351" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000343582" "00342352" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000343583" "00342353" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000343584" "00342354" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000343585" "00342355" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000343586" "00342356" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000343805" "00342575" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000343812" "00342582" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000343813" "00342583" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000343814" "00342584" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350218" "00348988" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350219" "00348989" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350220" "00348990" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350221" "00348991" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350222" "00348992" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350223" "00348993" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350224" "00348994" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350225" "00348995" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350226" "00348996" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350227" "00348997" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350228" "00348998" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350229" "00348999" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350230" "00349000" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350231" "00349001" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350232" "00349002" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350233" "00349003" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350234" "00349004" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350235" "00349005" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350236" "00349006" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350237" "00349007" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350238" "00349008" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350239" "00349009" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350240" "00349010" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350241" "00349011" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350242" "00349012" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350243" "00349013" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350244" "00349014" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350245" "00349015" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350246" "00349016" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350247" "00349017" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350248" "00349018" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350249" "00349019" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350250" "00349020" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350251" "00349021" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350252" "00349022" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350253" "00349023" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350254" "00349024" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350255" "00349025" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350256" "00349026" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350257" "00349027" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350258" "00349028" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350259" "00349029" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350260" "00349030" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350261" "00349031" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350262" "00349032" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350263" "00349033" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350264" "00349034" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350265" "00349035" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350266" "00349036" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350267" "00349037" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350268" "00349038" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350269" "00349039" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350270" "00349040" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350271" "00349041" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350272" "00349042" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350273" "00349043" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350274" "00349044" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350275" "00349045" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350276" "00349046" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350277" "00349047" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350278" "00349048" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350279" "00349049" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350280" "00349050" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350281" "00349051" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350282" "00349052" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350283" "00349053" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350284" "00349054" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350285" "00349055" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350286" "00349056" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350287" "00349057" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350288" "00349058" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350289" "00349059" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350290" "00349060" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350291" "00349061" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350292" "00349062" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350293" "00349063" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350294" "00349064" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350295" "00349065" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350296" "00349066" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350297" "00349067" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350298" "00349068" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350299" "00349069" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350300" "00349070" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350301" "00349071" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350302" "00349072" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350303" "00349073" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350304" "00349074" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350305" "00349075" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350306" "00349076" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350307" "00349077" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350308" "00349078" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350309" "00349079" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350310" "00349080" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350311" "00349081" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350312" "00349082" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350313" "00349083" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350314" "00349084" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350315" "00349085" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350316" "00349086" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350317" "00349087" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350318" "00349088" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350319" "00349089" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350320" "00349090" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350321" "00349091" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350322" "00349092" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350323" "00349093" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350324" "00349094" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000350325" "00349095" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355088" "00353858" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355089" "00353859" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355090" "00353860" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355091" "00353861" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355092" "00353862" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355093" "00353863" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355094" "00353864" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355095" "00353865" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355096" "00353866" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355097" "00353867" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355098" "00353868" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355099" "00353869" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355100" "00353870" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355101" "00353871" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355102" "00353872" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355103" "00353873" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355104" "00353874" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355105" "00353875" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355106" "00353876" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355107" "00353877" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355108" "00353878" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355109" "00353879" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355110" "00353880" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355111" "00353881" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355112" "00353882" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355113" "00353883" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355114" "00353884" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355115" "00353885" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355116" "00353886" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355117" "00353887" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355118" "00353888" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355119" "00353889" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355120" "00353890" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355121" "00353891" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355122" "00353892" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355123" "00353893" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355124" "00353894" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355125" "00353895" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355126" "00353896" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355127" "00353897" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355128" "00353898" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355129" "00353899" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355130" "00353900" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355131" "00353901" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355132" "00353902" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355133" "00353903" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355134" "00353904" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355135" "00353905" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355136" "00353906" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355137" "00353907" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355138" "00353908" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000355139" "00353909" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359864" "00358634" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359865" "00358635" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359866" "00358636" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359867" "00358637" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359868" "00358638" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359869" "00358639" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359870" "00358640" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359871" "00358641" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359872" "00358642" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359873" "00358643" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359874" "00358644" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359875" "00358645" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359876" "00358646" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359877" "00358647" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359878" "00358648" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359879" "00358649" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359880" "00358650" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359881" "00358651" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359882" "00358652" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359883" "00358653" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359884" "00358654" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359885" "00358655" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359886" "00358656" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359887" "00358657" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359888" "00358658" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359889" "00358659" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359890" "00358660" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359891" "00358661" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359892" "00358662" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359893" "00358663" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359894" "00358664" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359895" "00358665" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359896" "00358666" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359897" "00358667" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359898" "00358668" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359899" "00358669" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359900" "00358670" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359901" "00358671" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359902" "00358672" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359903" "00358673" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359904" "00358674" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359905" "00358675" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359906" "00358676" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359907" "00358677" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359908" "00358678" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359909" "00358679" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359910" "00358680" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359911" "00358681" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359912" "00358682" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359913" "00358683" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359914" "00358684" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000359915" "00358685" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel" "0000377355" "00376159" "1" "00585" "00585" "2021-06-17 14:26:27" "" "" "SEQ-NG" "DNA" "blood" "" "0000400835" "00399592" "1" "00006" "00006" "2022-01-22 16:55:15" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000400836" "00399593" "1" "00006" "00006" "2022-01-22 16:55:15" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000400837" "00399594" "1" "00006" "00006" "2022-01-22 16:55:15" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000400838" "00399595" "1" "00006" "00006" "2022-01-22 16:55:15" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000400839" "00399596" "1" "00006" "00006" "2022-01-22 16:55:15" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000400840" "00399597" "1" "00006" "00006" "2022-01-22 16:55:15" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000400841" "00399598" "1" "00006" "00006" "2022-01-22 16:55:15" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000400950" "00399707" "1" "00006" "00006" "2022-01-22 16:55:15" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000400951" "00399708" "1" "00006" "00006" "2022-01-22 16:55:15" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000400952" "00399709" "1" "00006" "00006" "2022-01-22 16:55:15" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000400953" "00399710" "1" "00006" "00006" "2022-01-22 16:55:15" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000400954" "00399711" "1" "00006" "00006" "2022-01-22 16:55:15" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000400955" "00399712" "1" "00006" "00006" "2022-01-22 16:55:15" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000400956" "00399713" "1" "00006" "00006" "2022-01-22 16:55:15" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000400957" "00399714" "1" "00006" "00006" "2022-01-22 16:55:15" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000400958" "00399715" "1" "00006" "00006" "2022-01-22 16:55:15" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000400959" "00399716" "1" "00006" "00006" "2022-01-22 16:55:15" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000400960" "00399717" "1" "00006" "00006" "2022-01-22 16:55:15" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000400961" "00399718" "1" "00006" "00006" "2022-01-22 16:55:15" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000400962" "00399719" "1" "00006" "00006" "2022-01-22 16:55:15" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000400963" "00399720" "1" "00006" "00006" "2022-01-22 16:55:15" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000400964" "00399721" "1" "00006" "00006" "2022-01-22 16:55:15" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000408243" "00406997" "1" "00006" "00006" "2022-04-05 15:38:44" "" "" "SEQ-NG" "DNA" "" "81-gene panel" "0000411822" "00410557" "1" "00006" "00006" "2022-05-29 10:39:10" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000432611" "00430358" "1" "01082" "01082" "2023-02-01 19:12:01" "" "" "SEQ-NG" "DNA" "" "" "0000432986" "00430362" "1" "01082" "01082" "2023-02-15 00:30:48" "" "" "SEQ-NG" "DNA" "" "" "0000432989" "00431557" "1" "04467" "04467" "2023-02-15 04:57:05" "" "" "SEQ-NG-I" "DNA" "" "" "0000434580" "00432987" "1" "01082" "01082" "2023-02-28 15:58:57" "" "" "SEQ-NG" "DNA" "" "" "0000434594" "00432996" "1" "01082" "01082" "2023-03-01 12:32:56" "" "" "SEQ-NG" "DNA" "" "" "0000434602" "00433152" "1" "03628" "03628" "2023-03-01 16:32:36" "" "" "PCRm;RT-PCR;SEQ;SEQ-NG-I" "DNA;RNA" "PBMC" "" "0000434604" "00433153" "1" "03628" "03628" "2023-03-01 16:57:13" "" "" "PCR;RT-PCR;SEQ;SEQ-NG;SEQ-NG-I" "DNA;RNA" "PBMC" "" "0000434611" "00433157" "1" "03628" "03628" "2023-03-02 12:22:04" "" "" "PCR;SEQ;SEQ-NG-I" "DNA" "PBMC" "" "0000434612" "00433158" "1" "03628" "03628" "2023-03-02 12:52:08" "" "" "PCR;SEQ;SEQ-NG" "DNA" "PBMC" "" "0000434613" "00433159" "1" "03628" "03628" "2023-03-02 13:15:26" "" "" "PCR;SEQ;SEQ-NG-I" "DNA" "PBMC" "" "0000434614" "00433160" "1" "03628" "03628" "2023-03-02 15:23:49" "" "" "PCR;SEQ;SEQ-NG-I" "DNA" "PBMC" "" "0000434615" "00433161" "1" "03628" "03628" "2023-03-02 15:42:43" "" "" "SEQ-NG-I" "DNA" "PBMC" "" "0000434632" "00433178" "1" "03628" "03628" "2023-03-02 18:56:03" "" "" "PCR;SEQ;SEQ-NG-I" "DNA" "PBMC" "" "0000434633" "00433179" "1" "03628" "03628" "2023-03-02 19:08:16" "" "" "PCR;SEQ;SEQ-NG-I" "DNA" "PBMC" "" "0000434634" "00433180" "1" "03628" "03628" "2023-03-02 19:21:48" "" "" "PCR;SEQ;SEQ-NG-I" "DNA" "PBMC" "" "0000434635" "00433181" "1" "03628" "03628" "2023-03-02 19:33:44" "" "" "PCR;SEQ;SEQ-NG-I" "DNA" "PBMC" "" "0000434636" "00433182" "1" "03628" "03628" "2023-03-02 19:54:32" "" "" "PCR;SEQb;SEQ-NG-I" "DNA" "PBMC" "" "0000434637" "00433183" "1" "03628" "03628" "2023-03-02 20:07:42" "" "" "PCR;SEQ;SEQ-NG-I" "DNA" "PBMC" "" "0000434641" "00433187" "1" "03628" "03628" "2023-03-03 08:17:34" "" "" "PCR;SEQ;SEQ-NG-I" "DNA" "PBMC" "" "0000434644" "00433189" "1" "03628" "03628" "2023-03-03 08:52:07" "" "" "PCR;SEQ;SEQ-NG-I" "DNA" "PBMC" "" "0000445223" "00443728" "1" "04599" "04599" "2023-12-01 07:51:45" "" "" "SEQ-NG-I" "DNA" "Blood" "TruSight Cancer Sequencing Panel" "0000445224" "00443729" "1" "04599" "04599" "2023-12-01 07:59:09" "" "" "SEQ-NG-I" "DNA" "Blood" "TruSight Cancer Sequencing Panel" "0000449621" "00448048" "1" "03628" "03628" "2023-03-02 20:07:42" "" "" "PCR;SEQ;SEQ-NG-I" "DNA" "PBMC" "" "0000451317" "00449725" "1" "04685" "04685" "2024-05-07 10:43:58" "" "" "SEQ-NG-IT" "DNA" "FFPE" "" "0000451331" "00449739" "1" "04685" "04685" "2024-05-08 12:49:50" "" "" "SEQ-NG-IT" "DNA" "FFPE" "" "0000458980" "00457360" "1" "04749" "00006" "2024-10-10 14:37:00" "" "" "SEQ-NG" "DNA" "" "" "0000466044" "00464409" "1" "00006" "00006" "2025-03-10 13:41:04" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000466045" "00464410" "1" "00006" "00006" "2025-03-10 13:47:11" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000469709" "00468043" "1" "04265" "04265" "2025-11-07 13:45:57" "" "" "SEQ" "DNA" "Blood" "" "0000472290" "00470623" "1" "00006" "00006" "2025-12-04 10:36:21" "" "" "RT-PCR;SEQ" "DNA;RNA" "blood" "" "0000472291" "00470624" "1" "00006" "00006" "2025-12-04 10:36:21" "" "" "RT-PCR;SEQ" "DNA;RNA" "blood" "" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 508 "{{screeningid}}" "{{geneid}}" "0000003211" "TP53" "0000046392" "TP53" "0000046393" "TP53" "0000046394" "TP53" "0000046395" "TP53" "0000046396" "TP53" "0000046397" "TP53" "0000046398" "TP53" "0000046399" "TP53" "0000046400" "TP53" "0000046401" "TP53" "0000046425" "TP53" "0000047421" "TP53" "0000047423" "BRCA2" "0000047423" "TP53" "0000047502" "TP53" "0000048186" "FLCN" "0000048186" "TP53" "0000074819" "BRCA1" "0000074819" "BRCA2" "0000074819" "TP53" "0000079956" "FH" "0000091014" "TP53" "0000091015" "TP53" "0000091016" "TP53" "0000091017" "TP53" "0000091018" "TP53" "0000091019" "TP53" "0000091020" "TP53" "0000091021" "TP53" "0000091022" "TP53" "0000091023" "TP53" "0000091024" "TP53" "0000179456" "TP53" "0000179457" "TP53" "0000179458" "TP53" "0000179459" "TP53" "0000179460" "TP53" "0000179461" "TP53" "0000179462" "TP53" "0000179463" "TP53" "0000179464" "TP53" "0000179465" "TP53" "0000179466" "TP53" "0000179467" "TP53" "0000179468" "TP53" "0000179469" "TP53" "0000179470" "TP53" "0000179471" "TP53" "0000179472" "TP53" "0000179473" "TP53" "0000179474" "TP53" "0000179475" "TP53" "0000179476" "TP53" "0000179477" "TP53" "0000179478" "TP53" "0000179479" "TP53" "0000179480" "TP53" "0000179481" "TP53" "0000179482" "TP53" "0000179483" "TP53" "0000179484" "TP53" "0000179485" "TP53" "0000179486" "TP53" "0000179487" "TP53" "0000179488" "TP53" "0000179489" "TP53" "0000179490" "TP53" "0000179491" "TP53" "0000179492" "TP53" "0000179493" "TP53" "0000179494" "TP53" "0000179495" "TP53" "0000179496" "TP53" "0000179497" "TP53" "0000179498" "TP53" "0000179499" "TP53" "0000179500" "TP53" "0000179501" "TP53" "0000179502" "TP53" "0000179503" "TP53" "0000179504" "TP53" "0000179505" "TP53" "0000179506" "TP53" "0000179507" "TP53" "0000179508" "TP53" "0000179509" "TP53" "0000179510" "TP53" "0000179511" "TP53" "0000179512" "TP53" "0000179513" "TP53" "0000179514" "TP53" "0000179515" "TP53" "0000179516" "TP53" "0000179517" "TP53" "0000179518" "TP53" "0000179519" "TP53" "0000179520" "TP53" "0000179521" "TP53" "0000179522" "TP53" "0000179523" "TP53" "0000179524" "TP53" "0000179525" "TP53" "0000179526" "TP53" "0000179527" "TP53" "0000179528" "TP53" "0000179529" "TP53" "0000179530" "TP53" "0000179531" "TP53" "0000179532" "TP53" "0000181775" "TP53" "0000181776" "TP53" "0000181777" "TP53" "0000181778" "TP53" "0000181779" "TP53" "0000181780" "TP53" "0000181781" "TP53" "0000181782" "TP53" "0000182578" "TP53" "0000182579" "TP53" "0000182580" "TP53" "0000182581" "TP53" "0000183777" "TP53" "0000183778" "TP53" "0000183779" "TP53" "0000183780" "TP53" "0000183781" "TP53" "0000183782" "TP53" "0000183783" "TP53" "0000183784" "TP53" "0000183785" "TP53" "0000183786" "TP53" "0000183787" "TP53" "0000183788" "TP53" "0000183789" "TP53" "0000183790" "TP53" "0000183791" "TP53" "0000183792" "TP53" "0000183793" "TP53" "0000183794" "TP53" "0000183795" "TP53" "0000183796" "TP53" "0000183797" "TP53" "0000183798" "TP53" "0000183799" "TP53" "0000183800" "TP53" "0000183801" "TP53" "0000183802" "TP53" "0000183803" "TP53" "0000183804" "TP53" "0000183805" "TP53" "0000183806" "TP53" "0000183807" "TP53" "0000183808" "TP53" "0000183809" "TP53" "0000183810" "TP53" "0000183811" "TP53" "0000183812" "TP53" "0000183813" "TP53" "0000183814" "TP53" "0000183815" "TP53" "0000183816" "TP53" "0000183817" "TP53" "0000183818" "TP53" "0000232401" "TP53" "0000241587" "TP53" "0000241588" "TP53" "0000241589" "TP53" "0000241592" "TP53" "0000241593" "TP53" "0000241595" "TP53" "0000241598" "TP53" "0000241602" "TP53" "0000241606" "TP53" "0000241611" "TP53" "0000241613" "TP53" "0000241616" "TP53" "0000242341" "TP53" "0000242343" "TP53" "0000242347" "TP53" "0000242351" "TP53" "0000242353" "TP53" "0000242354" "TP53" "0000242356" "TP53" "0000242358" "TP53" "0000242360" "TP53" "0000242361" "TP53" "0000242364" "TP53" "0000242365" "TP53" "0000242368" "TP53" "0000242369" "TP53" "0000242371" "TP53" "0000242372" "TP53" "0000247663" "TP53" "0000247664" "TP53" "0000247665" "TP53" "0000247666" "TP53" "0000247667" "TP53" "0000247668" "TP53" "0000247669" "TP53" "0000247670" "TP53" "0000267537" "ATM" "0000267537" "BRCA1" "0000267537" "BRCA2" "0000267537" "CDH1" "0000267537" "CHEK2" "0000267537" "PALB2" "0000267537" "TP53" "0000297062" "TP53" "0000337455" "TP53" "0000337558" "TP53" "0000337559" "TP53" "0000342979" "TP53" "0000342980" "TP53" "0000342981" "TP53" "0000342982" "TP53" "0000342983" "TP53" "0000342984" "TP53" "0000342985" "TP53" "0000342986" "TP53" "0000342987" "TP53" "0000342988" "TP53" "0000342989" "TP53" "0000342990" "TP53" "0000342991" "TP53" "0000342992" "TP53" "0000342993" "TP53" "0000342994" "TP53" "0000342995" "TP53" "0000342996" "TP53" "0000342997" "TP53" "0000342998" "TP53" "0000342999" "TP53" "0000343000" "TP53" "0000343001" "TP53" "0000343002" "TP53" "0000343003" "TP53" "0000343004" "TP53" "0000343005" "TP53" "0000343006" "TP53" "0000343007" "TP53" "0000343008" "TP53" "0000343009" "TP53" "0000343010" "TP53" "0000343011" "TP53" "0000343012" "TP53" "0000343013" "TP53" "0000343014" "TP53" "0000343015" "TP53" "0000343016" "TP53" "0000343017" "TP53" "0000343018" "TP53" "0000343019" "TP53" "0000343020" "TP53" "0000343021" "TP53" "0000343022" "TP53" "0000343023" "TP53" "0000343024" "TP53" "0000343025" "TP53" "0000343026" "TP53" "0000343580" "TP53" "0000343581" "TP53" "0000343582" "TP53" "0000343583" "TP53" "0000343584" "TP53" "0000343585" "TP53" "0000343586" "TP53" "0000343805" "TP53" "0000343812" "TP53" "0000343813" "TP53" "0000343814" "TP53" "0000350218" "TP53" "0000350219" "TP53" "0000350220" "TP53" "0000350221" "TP53" "0000350222" "TP53" "0000350223" "TP53" "0000350224" "TP53" "0000350225" "TP53" "0000350226" "TP53" "0000350227" "TP53" "0000350228" "TP53" "0000350229" "TP53" "0000350230" "TP53" "0000350231" "TP53" "0000350232" "TP53" "0000350233" "TP53" "0000350234" "TP53" "0000350235" "TP53" "0000350236" "TP53" "0000350237" "TP53" "0000350238" "TP53" "0000350239" "TP53" "0000350240" "TP53" "0000350241" "TP53" "0000350242" "TP53" "0000350243" "TP53" "0000350244" "TP53" "0000350245" "TP53" "0000350246" "TP53" "0000350247" "TP53" "0000350248" "TP53" "0000350249" "TP53" "0000350250" "TP53" "0000350251" "TP53" "0000350252" "TP53" "0000350253" "TP53" "0000350254" "TP53" "0000350255" "TP53" "0000350256" "TP53" "0000350257" "TP53" "0000350258" "TP53" "0000350259" "TP53" "0000350260" "TP53" "0000350261" "TP53" "0000350262" "TP53" "0000350263" "TP53" "0000350264" "TP53" "0000350265" "TP53" "0000350266" "TP53" "0000350267" "TP53" "0000350268" "TP53" "0000350269" "TP53" "0000350270" "TP53" "0000350271" "TP53" "0000350272" "TP53" "0000350273" "TP53" "0000350274" "TP53" "0000350275" "TP53" "0000350276" "TP53" "0000350277" "TP53" "0000350278" "TP53" "0000350279" "TP53" "0000350280" "TP53" "0000350281" "TP53" "0000350282" "TP53" "0000350283" "TP53" "0000350284" "TP53" "0000350285" "TP53" "0000350286" "TP53" "0000350287" "TP53" "0000350288" "TP53" "0000350289" "TP53" "0000350290" "TP53" "0000350291" "TP53" "0000350292" "TP53" "0000350293" "TP53" "0000350294" "TP53" "0000350295" "TP53" "0000350296" "TP53" "0000350297" "TP53" "0000350298" "TP53" "0000350299" "TP53" "0000350300" "TP53" "0000350301" "TP53" "0000350302" "TP53" "0000350303" "TP53" "0000350304" "TP53" "0000350305" "TP53" "0000350306" "TP53" "0000350307" "TP53" "0000350308" "TP53" "0000350309" "TP53" "0000350310" "TP53" "0000350311" "TP53" "0000350312" "TP53" "0000350313" "TP53" "0000350314" "TP53" "0000350315" "TP53" "0000350316" "TP53" "0000350317" "TP53" "0000350318" "TP53" "0000350319" "TP53" "0000350320" "TP53" "0000350321" "TP53" "0000350322" "TP53" "0000350323" "TP53" "0000350324" "TP53" "0000350325" "TP53" "0000355088" "TP53" "0000355089" "TP53" "0000355090" "TP53" "0000355091" "TP53" "0000355092" "TP53" "0000355093" "TP53" "0000355094" "TP53" "0000355095" "TP53" "0000355096" "TP53" "0000355097" "TP53" "0000355098" "TP53" "0000355099" "TP53" "0000355100" "TP53" "0000355101" "TP53" "0000355102" "TP53" "0000355103" "TP53" "0000355104" "TP53" "0000355105" "TP53" "0000355106" "TP53" "0000355107" "TP53" "0000355108" "TP53" "0000355109" "TP53" "0000355110" "TP53" "0000355111" "TP53" "0000355112" "TP53" "0000355113" "TP53" "0000355114" "TP53" "0000355115" "TP53" "0000355116" "TP53" "0000355117" "TP53" "0000355118" "TP53" "0000355119" "TP53" "0000355120" "TP53" "0000355121" "TP53" "0000355122" "TP53" "0000355123" "TP53" "0000355124" "TP53" "0000355125" "TP53" "0000355126" "TP53" "0000355127" "TP53" "0000355128" "TP53" "0000355129" "TP53" "0000355130" "TP53" "0000355131" "TP53" "0000355132" "TP53" "0000355133" "TP53" "0000355134" "TP53" "0000355135" "TP53" "0000355136" "TP53" "0000355137" "TP53" "0000355138" "TP53" "0000355139" "TP53" "0000359864" "TP53" "0000359865" "TP53" "0000359866" "TP53" "0000359867" "TP53" "0000359868" "TP53" "0000359869" "TP53" "0000359870" "TP53" "0000359871" "TP53" "0000359872" "TP53" "0000359873" "TP53" "0000359874" "TP53" "0000359875" "TP53" "0000359876" "TP53" "0000359877" "TP53" "0000359878" "TP53" "0000359879" "TP53" "0000359880" "TP53" "0000359881" "TP53" "0000359882" "TP53" "0000359883" "TP53" "0000359884" "TP53" "0000359885" "TP53" "0000359886" "TP53" "0000359887" "TP53" "0000359888" "TP53" "0000359889" "TP53" "0000359890" "TP53" "0000359891" "TP53" "0000359892" "TP53" "0000359893" "TP53" "0000359894" "TP53" "0000359895" "TP53" "0000359896" "TP53" "0000359897" "TP53" "0000359898" "TP53" "0000359899" "TP53" "0000359900" "TP53" "0000359901" "TP53" "0000359902" "TP53" "0000359903" "TP53" "0000359904" "TP53" "0000359905" "TP53" "0000359906" "TP53" "0000359907" "TP53" "0000359908" "TP53" "0000359909" "TP53" "0000359910" "TP53" "0000359911" "TP53" "0000359912" "TP53" "0000359913" "TP53" "0000359914" "TP53" "0000359915" "TP53" "0000432989" "TP53" "0000434602" "TP53" "0000434604" "TP53" "0000434611" "TP53" "0000434612" "TP53" "0000434613" "TP53" "0000434614" "TP53" "0000434615" "TP53" "0000434632" "TP53" "0000434633" "TP53" "0000434634" "TP53" "0000434635" "TP53" "0000434636" "TP53" "0000434637" "TP53" "0000434641" "TP53" "0000434644" "TP53" "0000445223" "TP53" "0000445224" "TP53" "0000451317" "TP53" "0000451331" "TP53" "0000466044" "TP53" "0000466045" "TP53" "0000469709" "TP53" "0000472290" "TP53" "0000472291" "TP53" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 876 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000021759" "0" "55" "17" "7577551" "7577551" "subst" "0" "00552" "TP53_010001" "g.7577551C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.7674233C>T" "" "VUS" "" "0000073916" "0" "99" "17" "7578552" "7578552" "subst" "0" "01339" "TP53_010007" "g.7578552G>T" "1/1658" "{kConFab:P}" "" "P53 378 C>A (Y126X)" "" "Unknown" "" "" "0" "" "" "g.7675234G>T" "" "pathogenic" "kConFab" "0000073917" "0" "55" "17" "7578456" "7578456" "subst" "4.06329E-5" "01339" "TP53_010006" "g.7578456G>A" "1/1658" "{kConFab:SV}" "" "P53 g.13147 C>T (R158R)" "" "Unknown" "" "" "0" "" "" "g.7675138G>A" "" "likely pathogenic" "kConFab" "0000073918" "0" "99" "17" "7578406" "7578406" "subst" "4.06392E-6" "01339" "TP53_010013" "g.7578406C>T" "1/1658" "{kConFab:P}" "" "P53 524 G>A (R175H)" "" "Unknown" "" "" "0" "" "" "g.7675088C>T" "" "pathogenic" "kConFab" "0000073919" "0" "99" "17" "7578263" "7578263" "subst" "4.06085E-6" "01339" "TP53_010012" "g.7578263G>A" "2/1658" "{kConFab:P}" "" "P53 586 C>T (R196X)" "" "Unknown" "" "" "0" "" "" "g.7674945G>A" "" "pathogenic" "kConFab" "0000073920" "0" "11" "17" "7578210" "7578210" "subst" "0.012609" "01339" "TP53_010011" "g.7578210T>C" "2/1658" "{kConFab:PM}" "" "P53 g.13399 A>G (R213R)" "" "Unknown" "" "" "0" "" "" "g.7674892T>C" "" "benign" "kConFab" "0000073921" "0" "55" "17" "7578202" "7578202" "subst" "0" "01339" "TP53_010010" "g.7578202A>C" "1/1658" "{kConFab:UV}" "" "P53 647 T>G (V216G)" "" "Unknown" "" "" "0" "" "" "g.7674884A>C" "" "VUS" "kConFab" "0000073922" "0" "99" "17" "7577539" "7577539" "subst" "4.06085E-6" "01339" "TP53_010008" "g.7577539G>A" "1/1658" "{kConFab:P}" "" "P53 g.14069 C>T (R248W)" "" "Unknown" "" "" "0" "" "" "g.7674221G>A" "" "pathogenic" "kConFab" "0000073923" "0" "99" "17" "7577538" "7577538" "subst" "2.03047E-5" "01339" "TP53_010015" "g.7577538C>T" "1/1658" "{kConFab:P}" "" "P53 g.14070 G>A (R248Q)" "" "Unknown" "" "" "0" "" "" "g.7674220C>T" "" "pathogenic" "kConFab" "0000073924" "0" "11" "17" "7577427" "7577427" "subst" "0" "01339" "TP53_010014" "g.7577427G>A" "1/1658" "{kConFab:PM}" "" "P53 IVS7+72 C>T" "" "Unknown" "" "" "0" "" "" "g.7674109G>A" "" "benign" "kConFab" "0000073925" "0" "11" "17" "7577407" "7577407" "subst" "0" "01339" "TP53_010016" "g.7577407A>C" "1/1658" "{kConFab:PM}" "" "P53 IVS7+92 T>G" "" "Unknown" "" "" "0" "" "" "g.7674089A>C" "" "benign" "kConFab" "0000073949" "0" "99" "17" "7578176" "7579941" "dup" "0" "01339" "TP53_010009" "g.(7577609_7578176)_(7579941_7590694)dup" "1/1658" "{kConFab:LGR}" "" "P53 dup exons 2_6" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "kConFab" "0000076112" "0" "90" "17" "7577091" "7577091" "subst" "8.12255E-5" "00727" "TP53_010002" "g.7577091G>A" "" "{PMID:Manoukian 2007:17224268}" "" "" "" "Germline" "" "" "0" "" "" "g.7673773G>A" "" "pathogenic" "" "0000076115" "0" "90" "17" "7579358" "7579358" "subst" "0" "00727" "TP53_010003" "g.7579358C>A" "" "{PMID:Monnerat 2007:17624602}" "" "" "" "Germline" "" "" "0" "" "" "g.7676040C>A" "" "pathogenic" "" "0000076255" "0" "90" "17" "7577094" "7577094" "subst" "4.06177E-6" "00727" "TP53_010005" "g.7577094G>A" "" "{PMID:Plon 2008:18669439}" "" "" "" "Germline" "" "" "0" "" "" "g.7673776G>A" "" "pathogenic" "" "0000077008" "0" "90" "17" "7578404" "7578404" "subst" "0" "00727" "TP53_010004" "g.7578404A>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.7675086A>G" "" "pathogenic" "" "0000119918" "21" "70" "17" "7675297" "7675305" "del" "0" "01694" "TP53_010017" "g.7675297_7675305del" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.7771979_7771987del" "" "likely pathogenic" "" "0000128832" "20" "50" "17" "7577138" "7577138" "subst" "1.22859E-5" "01738" "TP53_010018" "g.7577138C>T" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.7673820C>T" "" "VUS" "" "0000149143" "1" "50" "17" "7572980" "7572980" "subst" "0.000289196" "01816" "TP53_010028" "g.7572980T>G" "" "Thibodeau lab (Mayo Clinic)" "" "" "" "Germline" "" "" "0" "" "" "g.7669662T>G" "" "VUS" "" "0000149144" "1" "50" "17" "7574012" "7574012" "subst" "6.51111E-5" "01816" "TP53_010025" "g.7574012C>T" "" "Thibodeau lab (Mayo Clinic)" "" "" "" "Germline" "" "" "0" "" "" "g.7670694C>T" "" "VUS" "" "0000149145" "1" "50" "17" "7576541" "7576541" "subst" "5.72643E-5" "01816" "TP53_010026" "g.7576541G>A" "" "Thibodeau lab (Mayo Clinic)" "" "" "" "Germline" "" "" "0" "" "" "g.7673223G>A" "" "VUS" "" "0000149146" "1" "50" "17" "7577088" "7577088" "subst" "0" "01816" "TP53_010027" "g.7577088T>A" "" "Thibodeau lab (Mayo Clinic)" "" "" "" "Germline" "" "" "0" "" "" "g.7673770T>A" "" "VUS" "" "0000149147" "1" "50" "17" "7577091" "7577091" "subst" "8.12255E-5" "01816" "TP53_010002" "g.7577091G>A" "" "Thibodeau lab (Mayo Clinic)" "" "" "" "Germline" "" "" "0" "" "" "g.7673773G>A" "" "VUS" "" "0000149148" "1" "50" "17" "7577577" "7577577" "subst" "0.000190854" "01816" "TP53_010019" "g.7577577T>C" "" "Thibodeau lab (Mayo Clinic)" "" "" "" "Germline" "" "" "0" "" "" "g.7674259T>C" "" "VUS" "" "0000149149" "1" "50" "17" "7578262" "7578262" "subst" "4.06068E-6" "01816" "TP53_010020" "g.7578262C>T" "" "Thibodeau lab (Mayo Clinic)" "" "" "" "Germline" "" "" "0" "" "" "g.7674944C>T" "" "VUS" "" "0000149150" "1" "70" "17" "7578450" "7578450" "subst" "8.12572E-6" "01816" "TP53_010021" "g.7578450C>T" "" "Thibodeau lab (Mayo Clinic)" "" "" "" "Germline" "" "" "0" "" "" "g.7675132C>T" "" "likely pathogenic" "" "0000149151" "1" "50" "17" "7579442" "7579442" "subst" "2.03108E-5" "01816" "TP53_010022" "g.7579442G>A" "" "Thibodeau lab (Mayo Clinic)" "" "" "" "Germline" "" "" "0" "" "" "g.7676124G>A" "" "VUS" "" "0000149152" "1" "50" "17" "7579514" "7579514" "subst" "8.12229E-5" "01816" "TP53_010023" "g.7579514G>C" "" "Thibodeau lab (Mayo Clinic)" "" "" "" "Germline" "" "" "0" "" "" "g.7676196G>C" "" "VUS" "" "0000149153" "1" "50" "17" "7579548" "7579548" "subst" "0.00119016" "01816" "TP53_010024" "g.7579548G>A" "" "Thibodeau lab (Mayo Clinic)" "" "" "" "Germline" "" "" "0" "" "" "g.7676230G>A" "" "VUS" "" "0000250322" "0" "30" "17" "7579432" "7579432" "subst" "3.65643E-5" "02329" "TP53_010047" "g.7579432A>G" "" "" "" "TP53(NM_000546.5):c.255T>C (p.(Pro85=)), TP53(NM_000546.6):c.255T>C (p.P85=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7676114A>G" "" "likely benign" "" "0000254999" "0" "30" "17" "7573931" "7573931" "subst" "5.7301E-5" "01943" "TP53_010030" "g.7573931A>C" "" "" "" "TP53(NM_001126118.1):c.979T>G (p.S327A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7670613A>C" "" "likely benign" "" "0000311978" "0" "10" "17" "7579579" "7579579" "subst" "0.0132391" "02325" "TP53_010050" "g.7579579C>T" "" "" "" "TP53(NM_000546.5):c.108G>A (p.P36=, p.(Pro36=), p.Pro36=), TP53(NM_000546.6):c.108G>A (p.P36=), TP53(NM_001126114.3):c.108G>A (p.P36=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7676261C>T" "" "benign" "" "0000311979" "0" "10" "17" "7579472" "7579472" "subst" "0.668584" "02325" "TP53_010049" "g.7579472G>C" "" "" "" "TP53(NM_000546.5):c.215C>G (p.P72R, p.Pro72Arg), TP53(NM_000546.6):c.215C>G (p.(Pro72Arg), p.P72R), TP53(NM_001126114.3):c.215C>G (p.P72R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7676154G>C" "" "benign" "" "0000311980" "0" "10" "17" "7578210" "7578210" "subst" "0.012609" "02325" "TP53_010011" "g.7578210T>C" "" "" "" "TP53(NM_000546.5):c.639A>G (p.R213=, p.(Arg213=), p.Arg213=), TP53(NM_000546.6):c.639A>G (p.R213=), TP53(NM_001126114.2):c.639A>G (p.R213=), TP53...)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7674892T>C" "" "benign" "" "0000311981" "0" "90" "17" "7577022" "7577022" "subst" "0" "02325" "TP53_010034" "g.7577022G>A" "" "" "" "TP53(NM_000546.6):c.916C>T (p.R306*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7673704G>A" "" "pathogenic" "" "0000311982" "0" "10" "17" "7579669" "7579684" "del" "0" "02325" "TP53_010054" "g.7579669_7579684del" "" "" "" "TP53(NM_000546.5):c.96+41_97-54delACCTGGAGGGCTGGGG, TP53(NM_001126114.3):c.96+41_97-54delACCTGGAGGGCTGGGG" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7676351_7676366del" "" "benign" "" "0000313102" "0" "10" "17" "7606722" "7606722" "subst" "0.297995" "02325" "WRAP53_000015" "g.7606722C>G" "" "" "" "WRAP53(NM_018081.2):c.1565C>G (p.A522G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7703404C>G" "" "benign" "" "0000313480" "0" "10" "17" "7579579" "7579579" "subst" "0.0132391" "02329" "TP53_010050" "g.7579579C>T" "" "" "" "TP53(NM_000546.5):c.108G>A (p.P36=, p.(Pro36=), p.Pro36=), TP53(NM_000546.6):c.108G>A (p.P36=), TP53(NM_001126114.3):c.108G>A (p.P36=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7676261C>T" "" "benign" "" "0000313481" "0" "90" "17" "7579476" "7579476" "dup" "0" "02329" "TP53_010048" "g.7579476dup" "" "" "" "TP53(NM_000546.6):c.216dup (p.Val73ArgfsTer76), TP53(NM_000546.6):c.216dupC (p.V73Rfs*76)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7676158dup" "" "pathogenic" "" "0000313482" "0" "30" "17" "7579358" "7579358" "subst" "4.8765E-5" "02329" "TP53_010045" "g.7579358C>T" "" "" "" "TP53(NM_000546.6):c.329G>A (p.R110H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7676040C>T" "" "likely benign" "" "0000313483" "0" "90" "17" "7578406" "7578406" "subst" "4.06392E-6" "02329" "TP53_010013" "g.7578406C>T" "" "" "" "TP53(NM_000546.5):c.524G>A (p.Arg175His, p.R175H), TP53(NM_000546.6):c.524G>A (p.R175H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7675088C>T" "" "pathogenic" "" "0000313484" "0" "10" "17" "7578210" "7578210" "subst" "0.012609" "02329" "TP53_010011" "g.7578210T>C" "" "" "" "TP53(NM_000546.5):c.639A>G (p.R213=, p.(Arg213=), p.Arg213=), TP53(NM_000546.6):c.639A>G (p.R213=), TP53(NM_001126114.2):c.639A>G (p.R213=), TP53...)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7674892T>C" "" "benign" "" "0000314776" "0" "10" "17" "7578210" "7578210" "subst" "0.012609" "02326" "TP53_010011" "g.7578210T>C" "" "" "" "TP53(NM_000546.5):c.639A>G (p.R213=, p.(Arg213=), p.Arg213=), TP53(NM_000546.6):c.639A>G (p.R213=), TP53(NM_001126114.2):c.639A>G (p.R213=), TP53...)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7674892T>C" "" "benign" "" "0000315552" "0" "10" "17" "7579472" "7579472" "subst" "0.668584" "02369" "TP53_010049" "g.7579472G>C" "" "" "" "TP53(NM_000546.5):c.215C>G (p.P72R, p.Pro72Arg), TP53(NM_000546.6):c.215C>G (p.(Pro72Arg), p.P72R), TP53(NM_001126114.3):c.215C>G (p.P72R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7676154G>C" "" "benign" "" "0000315553" "0" "90" "17" "7579413" "7579413" "del" "0" "02369" "TP53_010046" "g.7579413del" "" "" "" "TP53(NM_000546.5):c.277delC (p.Leu93Cysfs*30)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7676095del" "" "pathogenic" "" "0000315554" "0" "90" "17" "7579342" "7579357" "del" "0" "02369" "TP53_010044" "g.7579342_7579357del" "" "" "" "TP53(NM_000546.5):c.336_351delCTTCTTGCATTCTGGG (p.Phe113Glnfs*5)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7676024_7676039del" "" "pathogenic" "" "0000315555" "0" "50" "17" "7578498" "7578521" "del" "0" "02369" "TP53_010041" "g.7578498_7578521del" "" "" "" "TP53(NM_000546.5):c.412_435delGCCAAGACCTGCCCTGTGCAGCTG (p.Ala138_Leu145del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7675180_7675203del" "" "VUS" "" "0000315556" "0" "30" "17" "7578420" "7578420" "subst" "0.000109699" "02369" "TP53_010039" "g.7578420C>T" "" "" "" "TP53(NM_000546.5):c.510G>A (p.Thr170=), TP53(NM_000546.6):c.510G>A (p.T170=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7675102C>T" "" "likely benign" "" "0000315557" "0" "90" "17" "7578406" "7578406" "subst" "4.06392E-6" "02369" "TP53_010013" "g.7578406C>T" "" "" "" "TP53(NM_000546.5):c.524G>A (p.Arg175His, p.R175H), TP53(NM_000546.6):c.524G>A (p.R175H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7675088C>T" "" "pathogenic" "" "0000315558" "0" "90" "17" "7578290" "7578290" "subst" "0" "02369" "TP53_010038" "g.7578290C>T" "" "" "" "TP53(NM_000546.5):c.560-1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7674972C>T" "" "pathogenic" "" "0000315559" "0" "90" "17" "7578263" "7578263" "subst" "4.06085E-6" "02369" "TP53_010012" "g.7578263G>A" "" "" "" "TP53(NM_000546.5):c.586C>T (p.Arg196*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7674945G>A" "" "pathogenic" "" "0000315560" "0" "90" "17" "7578211" "7578211" "subst" "0" "02369" "TP53_010037" "g.7578211C>T" "" "" "" "TP53(NM_000546.5):c.638G>A (p.Arg213Gln), TP53(NM_000546.6):c.638G>A (p.R213Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7674893C>T" "" "pathogenic" "" "0000315561" "0" "10" "17" "7578210" "7578210" "subst" "0.012609" "02369" "TP53_010011" "g.7578210T>C" "" "" "" "TP53(NM_000546.5):c.639A>G (p.R213=, p.(Arg213=), p.Arg213=), TP53(NM_000546.6):c.639A>G (p.R213=), TP53(NM_001126114.2):c.639A>G (p.R213=), TP53...)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7674892T>C" "" "benign" "" "0000315562" "0" "90" "17" "7579840" "7579846" "del" "0" "02369" "TP53_010055" "g.7579840_7579846del" "" "" "" "TP53(NM_000546.5):c.69_74+1delGAAACTG" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7676522_7676528del" "" "pathogenic" "" "0000315563" "0" "90" "17" "7577559" "7577559" "del" "0" "02369" "TP53_010036" "g.7577559del" "" "" "" "TP53(NM_000546.5):c.723delC (p.Cys242Alafs*5)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7674241del" "" "pathogenic" "" "0000315564" "0" "90" "17" "7577139" "7577139" "subst" "0" "02369" "TP53_010035" "g.7577139G>A" "" "" "" "TP53(NM_000546.5):c.799C>T (p.Arg267Trp)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7673821G>A" "" "pathogenic" "" "0000315565" "0" "30" "17" "7576911" "7576911" "subst" "6.49693E-5" "02369" "TP53_010033" "g.7576911G>C" "" "" "" "TP53(NM_000546.5):c.935C>G (p.Thr312Ser), TP53(NM_000546.6):c.935C>G (p.T312S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7673593G>C" "" "likely benign" "" "0000315566" "0" "10" "17" "7579669" "7579684" "del" "0" "02369" "TP53_010053" "g.7579669_7579684del" "" "" "" "TP53(NM_000546.5):c.96+41_97-54delACCTGGAGGGCTGGGG, TP53(NM_001126114.3):c.96+41_97-54delACCTGGAGGGCTGGGG" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7676351_7676366del" "" "benign" "" "0000315567" "0" "10" "17" "7576501" "7576501" "subst" "0.0322707" "02369" "TP53_010032" "g.7576501G>A" "" "" "" "TP53(NM_000546.5):c.993+352C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7673183G>A" "" "benign" "" "0000315568" "0" "90" "17" "7574034" "7574034" "subst" "0" "02369" "TP53_010031" "g.7574034C>T" "" "" "" "TP53(NM_000546.5):c.994-1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7670716C>T" "" "pathogenic" "" "0000316929" "0" "10" "17" "7579579" "7579579" "subst" "0.0132391" "01943" "TP53_010050" "g.7579579C>T" "" "" "" "TP53(NM_000546.5):c.108G>A (p.P36=, p.(Pro36=), p.Pro36=), TP53(NM_000546.6):c.108G>A (p.P36=), TP53(NM_001126114.3):c.108G>A (p.P36=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7676261C>T" "" "benign" "" "0000316930" "0" "10" "17" "7573897" "7573897" "subst" "0.00935205" "01943" "TP53_010029" "g.7573897T>A" "" "" "" "TP53(NM_000546.5):c.1100+30A>T, TP53(NM_000546.6):c.1100+30A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7670579T>A" "" "benign" "" "0000316931" "0" "10" "17" "7579472" "7579472" "subst" "0.668584" "01943" "TP53_010049" "g.7579472G>C" "" "" "" "TP53(NM_000546.5):c.215C>G (p.P72R, p.Pro72Arg), TP53(NM_000546.6):c.215C>G (p.(Pro72Arg), p.P72R), TP53(NM_001126114.3):c.215C>G (p.P72R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7676154G>C" "" "benign" "" "0000316933" "0" "30" "17" "7578534" "7578534" "subst" "0" "01943" "TP53_010042" "g.7578534C>T" "" "" "" "TP53(NM_000546.5):c.396G>A (p.K132=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7675216C>T" "" "likely benign" "" "0000316934" "0" "30" "17" "7578480" "7578480" "subst" "8.1279E-6" "01943" "TP53_010040" "g.7578480T>C" "" "" "" "TP53(NM_000546.5):c.450A>G (p.T150=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7675162T>C" "" "likely benign" "" "0000316935" "0" "30" "17" "7578210" "7578210" "subst" "0.012609" "01943" "TP53_010011" "g.7578210T>C" "" "" "" "TP53(NM_000546.5):c.639A>G (p.R213=, p.(Arg213=), p.Arg213=), TP53(NM_000546.6):c.639A>G (p.R213=), TP53(NM_001126114.2):c.639A>G (p.R213=), TP53...)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7674892T>C" "" "likely benign" "" "0000316936" "0" "90" "17" "7577538" "7577538" "subst" "2.03047E-5" "01943" "TP53_010015" "g.7577538C>T" "" "" "" "TP53(NM_000546.5):c.743G>A (p.R248Q), TP53(NM_000546.6):c.743G>A (p.R248Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7674220C>T" "" "pathogenic" "" "0000316937" "0" "30" "17" "7579588" "7579588" "subst" "0" "01943" "TP53_010051" "g.7579588G>A" "" "" "" "TP53(NM_001126114.2):c.99C>T (p.S33=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7676270G>A" "" "likely benign" "" "0000320002" "0" "50" "17" "7606357" "7606357" "subst" "8.12401E-6" "01943" "WRAP53_000012" "g.7606357G>A" "" "" "" "WRAP53(NM_018081.2):c.1315G>A (p.V439M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7703039G>A" "" "VUS" "" "0000320003" "0" "30" "17" "7606650" "7606650" "subst" "4.06289E-6" "01943" "WRAP53_000013" "g.7606650T>C" "" "" "" "WRAP53(NM_018081.2):c.1493T>C (p.L498P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7703332T>C" "" "likely benign" "" "0000320004" "0" "30" "17" "7606694" "7606694" "subst" "0.000519949" "01943" "WRAP53_000014" "g.7606694C>G" "" "" "" "WRAP53(NM_018081.2):c.1537C>G (p.R513G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7703376C>G" "" "likely benign" "" "0000320005" "0" "30" "17" "7606723" "7606723" "subst" "0.00179117" "01943" "WRAP53_000016" "g.7606723G>A" "" "" "" "WRAP53(NM_001143990.1):c.1566G>A (p.(Ala522=)), WRAP53(NM_018081.2):c.1566G>A (p.A522=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7703405G>A" "" "likely benign" "" "0000320006" "0" "30" "17" "7592153" "7592153" "subst" "0.000353811" "01943" "WRAP53_000007" "g.7592153G>A" "" "" "" "WRAP53(NM_018081.2):c.187G>A (p.V63M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7688835G>A" "" "likely benign" "" "0000320007" "0" "30" "17" "7604965" "7604965" "subst" "0.00330537" "01943" "WRAP53_000009" "g.7604965C>T" "" "" "" "WRAP53(NM_001143990.1):c.823-10C>T (p.(=)), WRAP53(NM_018081.2):c.823-10C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7701647C>T" "" "likely benign" "" "0000320008" "0" "10" "17" "7605088" "7605088" "subst" "0.00203245" "01943" "WRAP53_000011" "g.7605088C>T" "" "" "" "WRAP53(NM_018081.2):c.936C>T (p.C312=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7701770C>T" "" "benign" "" "0000325163" "0" "10" "17" "7579596" "7579596" "subst" "0.00195481" "01804" "TP53_010052" "g.7579596G>A" "" "" "" "TP53(NM_000546.5):c.97-6C>T (p.(=)), TP53(NM_001126114.2):c.97-6C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7676278G>A" "" "benign" "" "0000338711" "0" "10" "17" "7576841" "7576841" "subst" "0.0110245" "02327" "TP53_010057" "g.7576841A>G" "" "" "" "TP53(NM_000546.5):c.993+12T>C (p.(=)), TP53(NM_000546.6):c.993+12T>C, TP53(NM_001126114.2):c.993+12T>C, TP53(NM_001126114.3):c.993+12T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7673523A>G" "" "benign" "" "0000338712" "0" "10" "17" "7579619" "7579619" "subst" "0.0649701" "02327" "TP53_010061" "g.7579619G>T" "" "" "" "TP53(NM_000546.5):c.97-29C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7676301G>T" "" "benign" "" "0000338713" "0" "30" "17" "7579642" "7579642" "subst" "0" "02327" "TP53_010062" "g.7579642C>T" "" "" "" "TP53(NM_000546.5):c.97-52G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7676324C>T" "" "likely benign" "" "0000338715" "0" "10" "17" "7579801" "7579801" "subst" "0.673823" "02327" "TP53_010063" "g.7579801G>C" "" "" "" "TP53(NM_000546.5):c.74+38C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7676483G>C" "" "benign" "" "0000339185" "0" "50" "17" "7576626" "7576626" "subst" "2.32582E-5" "02327" "TP53_010056" "g.7576626T>G" "" "" "" "TP53(NM_001126113.2):c.994-42A>C (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7673308T>G" "" "VUS" "" "0000340439" "0" "10" "17" "7592560" "7592560" "subst" "0.129505" "02327" "WRAP53_000019" "g.7592560C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7689242C>T" "" "benign" "" "0000340614" "0" "30" "17" "7606350" "7606350" "subst" "0.0144527" "02327" "WRAP53_000021" "g.7606350T>C" "" "" "" "WRAP53(NM_001143990.1):c.1308T>C (p.(Ala436=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7703032T>C" "" "likely benign" "" "0000340910" "0" "10" "17" "7579579" "7579579" "subst" "0.0132391" "02327" "TP53_010050" "g.7579579C>T" "" "" "" "TP53(NM_000546.5):c.108G>A (p.P36=, p.(Pro36=), p.Pro36=), TP53(NM_000546.6):c.108G>A (p.P36=), TP53(NM_001126114.3):c.108G>A (p.P36=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7676261C>T" "" "benign" "" "0000341486" "0" "10" "17" "7606722" "7606722" "subst" "0.297995" "02327" "WRAP53_000015" "g.7606722C>G" "" "" "" "WRAP53(NM_018081.2):c.1565C>G (p.A522G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7703404C>G" "" "benign" "" "0000342087" "0" "90" "17" "7578406" "7578406" "subst" "4.06392E-6" "02327" "TP53_010013" "g.7578406C>T" "" "" "" "TP53(NM_000546.5):c.524G>A (p.Arg175His, p.R175H), TP53(NM_000546.6):c.524G>A (p.R175H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7675088C>T" "" "pathogenic" "" "0000342088" "0" "90" "17" "7578406" "7578406" "subst" "0" "02327" "TP53_010059" "g.7578406C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7675088C>A" "" "pathogenic" "" "0000342787" "0" "70" "17" "7605865" "7605865" "subst" "7.53832E-5" "02327" "WRAP53_000020" "g.7605865C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7702547C>T" "" "likely pathogenic" "" "0000343270" "0" "10" "17" "7592168" "7592168" "subst" "0.197393" "02327" "WRAP53_000018" "g.7592168C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7688850C>G" "" "benign" "" "0000344325" "0" "90" "17" "7577568" "7577568" "subst" "0" "02327" "TP53_010058" "g.7577568C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7674250C>T" "" "pathogenic" "" "0000348156" "0" "30" "17" "7591997" "7591997" "subst" "0.00603041" "02327" "WRAP53_000017" "g.7591997C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7688679C>T" "" "likely benign" "" "0000348566" "0" "10" "17" "7579472" "7579472" "subst" "0.668584" "02327" "TP53_010049" "g.7579472G>C" "" "" "" "TP53(NM_000546.5):c.215C>G (p.P72R, p.Pro72Arg), TP53(NM_000546.6):c.215C>G (p.(Pro72Arg), p.P72R), TP53(NM_001126114.3):c.215C>G (p.P72R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7676154G>C" "" "benign" "" "0000350647" "0" "30" "17" "7579470" "7579470" "subst" "6.49862E-5" "02327" "TP53_010060" "g.7579470C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.7676152C>T" "" "likely benign" "" "0000359603" "1" "90" "17" "7577138" "7577138" "subst" "1.22859E-5" "01873" "TP53_010018" "g.7577138C>T" "" "contributed by Dept. of Dr Vaccaro" "" "" "" "Germline" "" "" "0" "" "" "g.7673820C>T" "" "pathogenic" "" "0000402917" "1" "50" "17" "7572934" "7572934" "subst" "0" "01714" "TP53_010064" "g.7572934G>A" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.7669616G>A" "" "VUS" "" "0000402918" "1" "50" "17" "7572934" "7572934" "subst" "0" "01714" "TP53_010064" "g.7572934G>A" "4/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.7669616G>A" "" "VUS" "" "0000402919" "1" "50" "17" "7572973" "7572973" "subst" "0" "01714" "TP53_010065" "g.7572973C>T" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer" "Germline" "" "" "0" "" "" "g.7669655C>T" "" "VUS" "" "0000402920" "1" "50" "17" "7572997" "7572997" "subst" "0" "01714" "TP53_010066" "g.7572997G>A" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.7669679G>A" "" "VUS" "" "0000402921" "1" "50" "17" "7572997" "7572997" "subst" "0" "01714" "TP53_010066" "g.7572997G>A" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.7669679G>A" "" "VUS" "" "0000402922" "1" "50" "17" "7574012" "7574012" "subst" "6.51111E-5" "01714" "TP53_010025" "g.7574012C>T" "2/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs17882252" "0" "" "" "g.7670694C>T" "" "VUS" "" "0000402923" "1" "50" "17" "7574012" "7574012" "subst" "6.51111E-5" "01714" "TP53_010025" "g.7574012C>T" "2/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs17882252" "0" "" "" "g.7670694C>T" "" "VUS" "" "0000402924" "1" "90" "17" "7574029" "7574029" "subst" "3.66757E-5" "01714" "TP53_010069" "g.7574029C>T" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 11241 controls\r\nVariant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message." "Germline" "" "rs121912664" "0" "" "" "" "" "pathogenic" "" "0000402925" "1" "50" "17" "7576541" "7576541" "subst" "5.72643E-5" "01714" "TP53_010070" "g.7576541G>A" "2/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer\r\nVariant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message." "Germline" "" "rs573154688" "0" "" "" "" "" "VUS" "" "0000402926" "1" "50" "17" "7576541" "7576541" "subst" "5.72643E-5" "01714" "TP53_010026" "g.7576541G>A" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs756952434" "0" "" "" "g.7673223G>A" "" "VUS" "" "0000402927" "1" "50" "17" "7576541" "7576541" "subst" "5.72643E-5" "01714" "TP53_010026" "g.7576541G>A" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs756952434" "0" "" "" "g.7673223G>A" "" "VUS" "" "0000402928" "1" "50" "17" "7576654" "7576654" "subst" "3.29794E-5" "01714" "TP53_010071" "g.7576654G>C" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer\r\nVariant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message." "Germline" "" "rs201293647" "0" "" "" "" "" "VUS" "" "0000402929" "1" "50" "17" "7576655" "7576655" "subst" "1.41568E-5" "01714" "TP53_010075" "g.7576655G>A" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 11241 controls\r\nVariant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message." "Germline" "" "rs764851816" "0" "" "" "" "" "VUS" "" "0000402930" "1" "50" "17" "7576655" "7576655" "subst" "1.41568E-5" "01714" "TP53_010076" "g.7576655G>A" "2/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs750031971" "0" "" "" "g.7673337G>A" "" "VUS" "" "0000402931" "1" "50" "17" "7576655" "7576655" "subst" "1.41568E-5" "01714" "TP53_010076" "g.7576655G>A" "4/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs750031971" "0" "" "" "g.7673337G>A" "" "VUS" "" "0000402932" "1" "50" "17" "7577090" "7577092" "subst" "0" "01714" "TP53_010078" "g.7577090_7577092dup" "2/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 11241 controls\r\nVariant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000402933" "1" "90" "17" "7577091" "7577091" "dup" "8.12255E-5" "01714" "TP53_010079" "g.7577091G>A" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 11241 controls\r\nVariant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000402934" "1" "90" "17" "7577091" "7577091" "subst" "8.12255E-5" "01714" "TP53_010002" "g.7577091G>A" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 11241 controls" "Germline" "" "rs149633775" "0" "" "" "g.7673773G>A" "" "pathogenic" "" "0000402935" "1" "50" "17" "7577108" "7577108" "subst" "0" "01714" "TP53_010080" "g.7577108C>T" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer\r\nVariant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000402936" "1" "90" "17" "7577120" "7577120" "subst" "1.62689E-5" "01714" "TP53_010081" "g.7577120C>T" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer\r\nVariant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message." "Germline" "" "rs763098116" "0" "" "" "" "" "pathogenic" "" "0000402937" "1" "90" "17" "7577120" "7577120" "subst" "1.62689E-5" "01714" "TP53_010082" "g.7577120C>T" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer" "Germline" "" "rs28934576" "0" "" "" "g.7673802C>T" "" "pathogenic" "" "0000402938" "1" "90" "17" "7577139" "7577139" "subst" "0" "01714" "TP53_010083" "g.7577139G>A" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 11241 controls\r\nVariant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message." "Germline" "" "rs121913343" "0" "" "" "" "" "pathogenic" "" "0000402939" "1" "90" "17" "7577139" "7577139" "subst" "0" "01714" "TP53_010035" "g.7577139G>A" "2/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 11241 controls" "Germline" "" "rs55832599" "0" "" "" "g.7673821G>A" "" "pathogenic" "" "0000402940" "1" "90" "17" "7577538" "7577538" "subst" "2.03047E-5" "01714" "TP53_010015" "g.7577538C>T" "5/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 11241 controls" "Germline" "" "rs11540652" "0" "" "" "g.7674220C>T" "" "pathogenic" "" "0000402941" "1" "90" "17" "7577552" "7577552" "subst" "0" "01714" "TP53_010084" "g.7577552C>T" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer\r\nVariant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message." "Germline" "" "rs28934575" "0" "" "" "" "" "pathogenic" "" "0000402942" "1" "50" "17" "7577588" "7577588" "subst" "0" "01714" "TP53_010086" "g.7577588G>A" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer\r\nVariant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000402943" "1" "50" "17" "7577597" "7577597" "subst" "0" "01714" "TP53_010088" "g.7577597G>T" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer\r\nVariant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000402944" "1" "50" "17" "7578183" "7578183" "subst" "4.87654E-5" "01714" "TP53_010089" "g.7578183C>T" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer\r\nVariant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000402945" "1" "10" "17" "7578183" "7578183" "subst" "4.87654E-5" "01714" "TP53_010090" "g.7578183C>T" "6/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer" "Germline" "" "rs72661118" "0" "" "" "g.7674865C>T" "" "benign" "" "0000402946" "1" "50" "17" "7578204" "7578204" "subst" "0" "01714" "TP53_010091" "g.7578204A>C" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer" "Germline" "" "" "0" "" "" "g.7674886A>C" "" "VUS" "" "0000402947" "1" "10" "17" "7578210" "7578210" "subst" "0.012609" "01714" "TP53_010011" "g.7578210T>C" "4/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer" "Germline" "" "rs1800372" "0" "" "" "g.7674892T>C" "" "benign" "" "0000402948" "1" "50" "17" "7578244" "7578244" "subst" "0" "01714" "TP53_010092" "g.7578244C>T" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs587778719" "0" "" "" "g.7674926C>T" "" "VUS" "" "0000402949" "1" "50" "17" "7578244" "7578244" "subst" "0" "01714" "TP53_010092" "g.7578244C>T" "3/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs587778719" "0" "" "" "g.7674926C>T" "" "VUS" "" "0000402950" "1" "90" "17" "7578262" "7578262" "subst" "4.06068E-6" "01714" "TP53_010020" "g.7578262C>T" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 11241 controls" "Germline" "" "rs483352697" "0" "" "" "g.7674944C>T" "" "pathogenic" "" "0000402951" "1" "50" "17" "7578283" "7578283" "subst" "2.43665E-5" "01714" "TP53_010093" "g.7578283G>A" "19/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs121912665" "0" "" "" "g.7674965G>A" "" "VUS" "" "0000402952" "1" "50" "17" "7578283" "7578283" "subst" "2.43665E-5" "01714" "TP53_010093" "g.7578283G>A" "17/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs121912665" "0" "" "" "g.7674965G>A" "" "VUS" "" "0000402953" "1" "50" "17" "7578372" "7578372" "subst" "4.06263E-6" "01714" "TP53_010094" "g.7578372A>T" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 11241 controls" "Germline" "" "rs375275361" "0" "" "" "g.7675054A>T" "" "VUS" "" "0000402954" "1" "50" "17" "7578406" "7578406" "subst" "4.06392E-6" "01714" "TP53_010096" "g.7578406C>T" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 11241 controls\r\nVariant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000402955" "1" "90" "17" "7578406" "7578406" "subst" "4.06392E-6" "01714" "TP53_010013" "g.7578406C>T" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 11241 controls" "Germline" "" "rs28934578" "0" "" "" "g.7675088C>T" "" "pathogenic" "" "0000402956" "1" "50" "17" "7578414" "7578414" "subst" "1.21886E-5" "01714" "TP53_010097" "g.7578414A>C" "2/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs749309577" "0" "" "" "g.7675096A>C" "" "VUS" "" "0000402957" "1" "50" "17" "7578414" "7578414" "subst" "1.21886E-5" "01714" "TP53_010097" "g.7578414A>C" "2/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs749309577" "0" "" "" "g.7675096A>C" "" "VUS" "" "0000402958" "1" "90" "17" "7578446" "7578446" "subst" "0" "01714" "TP53_010098" "g.7578446T>C" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 11241 controls\r\nVariant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message." "Germline" "" "rs730882001" "0" "" "" "" "" "pathogenic" "" "0000402959" "1" "50" "17" "7578451" "7578451" "subst" "0" "01714" "TP53_010099" "g.7578451A>G" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer\r\nVariant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000402960" "1" "50" "17" "7578451" "7578451" "subst" "0" "01714" "TP53_010100" "g.7578451A>G" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer" "Germline" "" "" "0" "" "" "g.7675133A>G" "" "VUS" "" "0000402961" "1" "90" "17" "7578465" "7578465" "subst" "0" "01714" "TP53_010101" "g.7578465G>A" "2/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 11241 controls\r\nVariant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message." "Germline" "" "rs371524413" "0" "" "" "" "" "pathogenic" "" "0000402962" "1" "50" "17" "7578470" "7578470" "subst" "0" "01714" "TP53_010102" "g.7578470C>T" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer\r\nVariant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000402963" "1" "50" "17" "7578474" "7578474" "subst" "4.06359E-6" "01714" "TP53_010103" "g.7578474C>T" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 11241 controls\r\nVariant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message." "Germline" "" "rs137852789" "0" "" "" "" "" "VUS" "" "0000402964" "1" "10" "17" "7578474" "7578474" "subst" "4.06359E-6" "01714" "TP53_010104" "g.7578474C>T" "4/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.7675156C>T" "" "benign" "" "0000402965" "1" "10" "17" "7578474" "7578474" "subst" "4.06359E-6" "01714" "TP53_010104" "g.7578474C>T" "7/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.7675156C>T" "" "benign" "" "0000402966" "1" "10" "17" "7579358" "7579358" "subst" "4.8765E-5" "01714" "TP53_010105" "g.7579358C>T" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 11241 controls\r\nVariant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message." "Germline" "" "rs758781593" "0" "" "" "" "" "benign" "" "0000402967" "1" "50" "17" "7579358" "7579358" "subst" "4.8765E-5" "01714" "TP53_010045" "g.7579358C>T" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer" "Germline" "" "rs11540654" "0" "" "" "g.7676040C>T" "" "VUS" "" "0000402968" "1" "10" "17" "7579382" "7579382" "subst" "0" "01714" "TP53_010107" "g.7579382G>T" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer\r\nVariant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message." "Germline" "" "rs770776262" "0" "" "" "" "" "benign" "" "0000402969" "1" "50" "17" "7579438" "7579438" "subst" "2.43726E-5" "01714" "TP53_010108" "g.7579438C>T" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 11241 controls\r\nVariant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000402970" "1" "50" "17" "7579438" "7579438" "subst" "2.43726E-5" "01714" "TP53_010110" "g.7579438C>T" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs55754907" "0" "" "" "g.7676120C>T" "" "VUS" "" "0000402971" "1" "50" "17" "7579438" "7579438" "subst" "2.43726E-5" "01714" "TP53_010110" "g.7579438C>T" "2/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs55754907" "0" "" "" "g.7676120C>T" "" "VUS" "" "0000402972" "1" "10" "17" "7579472" "7579472" "subst" "0.668584" "01714" "TP53_010049" "g.7579472G>C" "1210/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs1042522" "0" "" "" "g.7676154G>C" "" "benign" "" "0000402973" "1" "10" "17" "7579472" "7579472" "subst" "0.668584" "01714" "TP53_010049" "g.7579472G>C" "2070/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs1042522" "0" "" "" "g.7676154G>C" "" "benign" "" "0000402974" "1" "50" "17" "7579473" "7579473" "subst" "1.21841E-5" "01714" "TP53_010112" "g.7579473G>C" "2/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 11241 controls" "Germline" "" "rs587782769" "0" "" "" "g.7676155G>C" "" "VUS" "" "0000402975" "1" "50" "17" "7579497" "7579497" "subst" "0" "01714" "TP53_010113" "g.7579497G>T" "2/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer" "Germline" "" "" "0" "" "" "g.7676179G>T" "" "VUS" "" "0000402976" "1" "50" "17" "7579542" "7579542" "subst" "8.12367E-6" "01714" "TP53_010115" "g.7579542C>G" "36/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs587780728" "0" "" "" "g.7676224C>G" "" "VUS" "" "0000402977" "1" "50" "17" "7579542" "7579542" "subst" "8.12367E-6" "01714" "TP53_010115" "g.7579542C>G" "49/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs587780728" "0" "" "" "g.7676224C>G" "" "VUS" "" "0000402978" "1" "10" "17" "7579546" "7579546" "subst" "6.90524E-5" "01714" "TP53_010116" "g.7579546C>T" "3/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs201741778" "0" "" "" "g.7676228C>T" "" "benign" "" "0000402979" "1" "10" "17" "7579546" "7579546" "subst" "6.90524E-5" "01714" "TP53_010116" "g.7579546C>T" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs201741778" "0" "" "" "g.7676228C>T" "" "benign" "" "0000402980" "1" "50" "17" "7579558" "7579558" "subst" "4.0623E-6" "01714" "TP53_010117" "g.7579558C>G" "4/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs754332870" "0" "" "" "g.7676240C>G" "" "VUS" "" "0000402981" "1" "50" "17" "7579558" "7579558" "subst" "4.0623E-6" "01714" "TP53_010117" "g.7579558C>G" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs754332870" "0" "" "" "g.7676240C>G" "" "VUS" "" "0000402982" "1" "10" "17" "7579579" "7579579" "subst" "0.0132391" "01714" "TP53_010050" "g.7579579C>T" "36/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs1800370" "0" "" "" "g.7676261C>T" "" "benign" "" "0000402983" "1" "10" "17" "7579579" "7579579" "subst" "0.0132391" "01714" "TP53_010050" "g.7579579C>T" "85/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs1800370" "0" "" "" "g.7676261C>T" "" "benign" "" "0000402984" "1" "10" "17" "7579705" "7579705" "subst" "0.000224827" "01714" "TP53_010118" "g.7579705C>T" "91/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs201753350" "0" "" "" "g.7676387C>T" "" "benign" "" "0000402985" "1" "10" "17" "7579705" "7579705" "subst" "0.000224827" "01714" "TP53_010118" "g.7579705C>T" "138/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs201753350" "0" "" "" "g.7676387C>T" "" "benign" "" "0000402986" "1" "10" "17" "7579882" "7579882" "subst" "4.88715E-5" "01714" "TP53_010119" "g.7579882C>G" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer\r\nVariant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message." "Germline" "" "rs370992294" "0" "" "" "" "" "benign" "" "0000402987" "1" "10" "17" "7579882" "7579882" "subst" "4.88715E-5" "01714" "TP53_010120" "g.7579882C>G" "95/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs201382018" "0" "" "" "g.7676564C>G" "" "benign" "" "0000402988" "1" "10" "17" "7579882" "7579882" "subst" "4.88715E-5" "01714" "TP53_010120" "g.7579882C>G" "172/11214 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs201382018" "0" "" "" "g.7676564C>G" "" "benign" "" "0000402989" "1" "50" "17" "7579885" "7579885" "subst" "3.2577E-5" "01714" "TP53_010121" "g.7579885C>T" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "not in 7051 cases breast cancer" "Germline" "" "rs535274413" "0" "" "" "g.7676567C>T" "" "VUS" "" "0000402990" "1" "10" "17" "7579886" "7579886" "subst" "8.14478E-6" "01714" "TP53_010122" "g.7579886G>A" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs757282628" "0" "" "" "g.7676568G>A" "" "benign" "" "0000402991" "1" "10" "17" "7579886" "7579886" "subst" "8.14478E-6" "01714" "TP53_010122" "g.7579886G>A" "3/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs757282628" "0" "" "" "g.7676568G>A" "" "benign" "" "0000402992" "1" "50" "17" "7579904" "7579904" "subst" "0" "01714" "TP53_010123" "g.7579904C>A" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.7676586C>A" "" "VUS" "" "0000402993" "3" "50" "17" "7579904" "7579904" "subst" "0" "01714" "TP53_010123" "g.7579904C>A" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.7676586C>A" "" "VUS" "" "0000405471" "3" "10" "17" "7579472" "7579472" "subst" "0.668584" "01714" "TP53_010049" "g.7579472G>C" "2920/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs1042522" "0" "" "" "g.7676154G>C" "" "benign" "" "0000405472" "3" "10" "17" "7579472" "7579472" "subst" "0.668584" "01714" "TP53_010049" "g.7579472G>C" "4585/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs1042522" "0" "" "" "g.7676154G>C" "" "benign" "" "0000405473" "3" "50" "17" "7579542" "7579542" "subst" "8.12367E-6" "01714" "TP53_010115" "g.7579542C>G" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs587780728" "0" "" "" "g.7676224C>G" "" "VUS" "" "0000405474" "3" "10" "17" "7579579" "7579579" "subst" "0.0132391" "01714" "TP53_010050" "g.7579579C>T" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs1800370" "0" "" "" "g.7676261C>T" "" "benign" "" "0000405475" "3" "10" "17" "7579705" "7579705" "subst" "0.000224827" "01714" "TP53_010118" "g.7579705C>T" "3/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs201753350" "0" "" "" "g.7676387C>T" "" "benign" "" "0000405476" "3" "10" "17" "7579705" "7579705" "subst" "0.000224827" "01714" "TP53_010118" "g.7579705C>T" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs201753350" "0" "" "" "g.7676387C>T" "" "benign" "" "0000405477" "3" "10" "17" "7579882" "7579882" "subst" "4.88715E-5" "01714" "TP53_010120" "g.7579882C>G" "1/7051 cases breast cancer" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs201382018" "0" "" "" "g.7676564C>G" "" "benign" "" "0000405478" "3" "50" "17" "7579904" "7579904" "subst" "0" "01714" "TP53_010123" "g.7579904C>A" "1/11241 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.7676586C>A" "" "VUS" "" "0000406468" "3" "10" "17" "7579472" "7579472" "subst" "0.668584" "01714" "TP53_010049" "g.7579472G>C" "27/53 cases" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs1042522" "0" "" "" "g.7676154G>C" "" "benign" "" "0000406469" "1" "10" "17" "7579472" "7579472" "subst" "0.668584" "01714" "TP53_010049" "g.7579472G>C" "23/53 cases" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs1042522" "0" "" "" "g.7676154G>C" "" "benign" "" "0000406470" "1" "50" "17" "7579542" "7579542" "subst" "8.12367E-6" "01714" "TP53_010115" "g.7579542C>G" "1/53 cases" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs587780728" "0" "" "" "g.7676224C>G" "" "VUS" "" "0000406471" "1" "10" "17" "7579882" "7579882" "subst" "4.88715E-5" "01714" "TP53_010120" "g.7579882C>G" "1/53 cases" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs201382018" "0" "" "" "g.7676564C>G" "" "benign" "" "0000407667" "1" "50" "17" "7572934" "7572934" "subst" "0" "01714" "TP53_010064" "g.7572934G>A" "1/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.7669616G>A" "" "VUS" "" "0000407668" "1" "50" "17" "7572997" "7572997" "subst" "0" "01714" "TP53_010066" "g.7572997G>A" "1/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.7669679G>A" "" "VUS" "" "0000407669" "1" "50" "17" "7573948" "7573948" "subst" "6.11556E-5" "01714" "TP53_010067" "g.7573948C>A" "2/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs35993958" "0" "" "" "g.7670630C>A" "" "VUS" "" "0000407670" "1" "50" "17" "7573991" "7573991" "subst" "0" "01714" "TP53_010068" "g.7573991C>T" "1/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.7670673C>T" "" "VUS" "" "0000407671" "1" "50" "17" "7574012" "7574012" "subst" "6.51111E-5" "01714" "TP53_010025" "g.7574012C>T" "3/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs17882252" "0" "" "" "g.7670694C>T" "" "VUS" "" "0000407672" "1" "50" "17" "7576568" "7576568" "subst" "2.78316E-5" "01714" "TP53_010072" "g.7576568C>T" "1/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs771319678" "0" "" "" "g.7673250C>T" "" "VUS" "" "0000407673" "1" "50" "17" "7576579" "7576579" "subst" "0" "01714" "TP53_010073" "g.7576579T>C" "1/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.7673261T>C" "" "VUS" "" "0000407674" "1" "50" "17" "7576645" "7576645" "subst" "0" "01714" "TP53_010074" "g.7576645A>T" "1/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.7673327A>T" "" "VUS" "" "0000407675" "1" "50" "17" "7576655" "7576655" "subst" "1.41568E-5" "01714" "TP53_010076" "g.7576655G>A" "4/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs750031971" "0" "" "" "g.7673337G>A" "" "VUS" "" "0000407676" "1" "50" "17" "7576916" "7576916" "subst" "0" "01714" "TP53_010077" "g.7576916G>A" "1/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.7673598G>A" "" "VUS" "" "0000407677" "1" "90" "17" "7577120" "7577120" "subst" "1.62689E-5" "01714" "TP53_010082" "g.7577120C>T" "1/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs28934576" "0" "" "" "g.7673802C>T" "" "pathogenic" "" "0000407678" "1" "90" "17" "7577550" "7577550" "subst" "0" "01714" "TP53_010085" "g.7577550C>T" "1/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.7674232C>T" "" "pathogenic" "" "0000407679" "1" "50" "17" "7577551" "7577551" "subst" "0" "01714" "TP53_010001" "g.7577551C>T" "1/12489 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.7674233C>T" "" "VUS" "" "0000407680" "1" "50" "17" "7577555" "7577555" "subst" "0" "01714" "TP53_010087" "g.7577555G>A" "1/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs375874539" "0" "" "" "g.7674237G>A" "" "VUS" "" "0000407681" "1" "10" "17" "7578183" "7578183" "subst" "4.87654E-5" "01714" "TP53_010090" "g.7578183C>T" "4/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs72661118" "0" "" "" "g.7674865C>T" "" "benign" "" "0000407682" "1" "50" "17" "7578204" "7578204" "subst" "0" "01714" "TP53_010091" "g.7578204A>C" "1/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.7674886A>C" "" "VUS" "" "0000407683" "1" "10" "17" "7578210" "7578210" "subst" "0.012609" "01714" "TP53_010011" "g.7578210T>C" "1/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs1800372" "0" "" "" "g.7674892T>C" "" "benign" "" "0000407684" "1" "50" "17" "7578244" "7578244" "subst" "0" "01714" "TP53_010092" "g.7578244C>T" "4/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs587778719" "0" "" "" "g.7674926C>T" "" "VUS" "" "0000407685" "1" "90" "17" "7578283" "7578283" "subst" "2.43665E-5" "01714" "TP53_010093" "g.7578283G>A" "22/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs121912665" "0" "" "" "g.7674965G>A" "" "pathogenic" "" "0000407686" "1" "50" "17" "7578374" "7578374" "subst" "8.12592E-6" "01714" "TP53_010095" "g.7578374C>T" "1/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.7675056C>T" "" "VUS" "" "0000407687" "1" "50" "17" "7578414" "7578414" "subst" "1.21886E-5" "01714" "TP53_010097" "g.7578414A>C" "3/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs749309577" "0" "" "" "g.7675096A>C" "" "VUS" "" "0000407688" "1" "50" "17" "7578451" "7578451" "subst" "0" "01714" "TP53_010100" "g.7578451A>G" "1/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.7675133A>G" "" "VUS" "" "0000407689" "1" "10" "17" "7578474" "7578474" "subst" "4.06359E-6" "01714" "TP53_010104" "g.7578474C>T" "4/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.7675156C>T" "" "benign" "" "0000407690" "1" "90" "17" "7578552" "7578552" "subst" "0" "01714" "TP53_010106" "g.7578552G>C" "1/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.7675234G>C" "" "pathogenic" "" "0000407691" "1" "50" "17" "7579424" "7579424" "subst" "0" "01714" "TP53_010109" "g.7579424G>T" "1/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.7676106G>T" "" "VUS" "" "0000407692" "1" "10" "17" "7579441" "7579441" "subst" "1.21866E-5" "01714" "TP53_010111" "g.7579441C>T" "1/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs372397095" "0" "" "" "g.7676123C>T" "" "benign" "" "0000407693" "1" "50" "17" "7579470" "7579470" "subst" "6.49862E-5" "01714" "TP53_010060" "g.7579470C>T" "2/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs587782423" "0" "" "" "g.7676152C>T" "" "VUS" "" "0000407694" "3" "10" "17" "7579472" "7579472" "subst" "0.668584" "01714" "TP53_010049" "g.7579472G>C" "5013/12488 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs1042522" "0" "" "" "g.7676154G>C" "" "benign" "" "0000407695" "1" "10" "17" "7579472" "7579472" "subst" "0.668584" "01714" "TP53_010049" "g.7579472G>C" "5837/12488 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs1042522" "0" "" "" "g.7676154G>C" "" "benign" "" "0000407696" "1" "50" "17" "7579473" "7579473" "subst" "1.21841E-5" "01714" "TP53_010112" "g.7579473G>C" "3/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs587782769" "0" "" "" "g.7676155G>C" "" "VUS" "" "0000407697" "1" "50" "17" "7579497" "7579497" "subst" "0" "01714" "TP53_010113" "g.7579497G>T" "2/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.7676179G>T" "" "VUS" "" "0000407698" "1" "50" "17" "7579505" "7579505" "subst" "0" "01714" "TP53_010114" "g.7579505T>G" "1/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.7676187T>G" "" "VUS" "" "0000407699" "1" "50" "17" "7579542" "7579542" "subst" "8.12367E-6" "01714" "TP53_010115" "g.7579542C>G" "68/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs587780728" "0" "" "" "g.7676224C>G" "" "VUS" "" "0000407700" "1" "10" "17" "7579546" "7579546" "subst" "6.90524E-5" "01714" "TP53_010116" "g.7579546C>T" "1/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs201741778" "0" "" "" "g.7676228C>T" "" "benign" "" "0000407701" "3" "10" "17" "7579579" "7579579" "subst" "0.0132391" "01714" "TP53_010050" "g.7579579C>T" "2/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs1800370" "0" "" "" "g.7676261C>T" "" "benign" "" "0000407702" "1" "10" "17" "7579579" "7579579" "subst" "0.0132391" "01714" "TP53_010050" "g.7579579C>T" "88/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs1800370" "0" "" "" "g.7676261C>T" "" "benign" "" "0000407703" "3" "10" "17" "7579705" "7579705" "subst" "0.000224827" "01714" "TP53_010118" "g.7579705C>T" "1/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs201753350" "0" "" "" "g.7676387C>T" "" "benign" "" "0000407704" "1" "10" "17" "7579705" "7579705" "subst" "0.000224827" "01714" "TP53_010118" "g.7579705C>T" "146/12490 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs201753350" "0" "" "" "g.7676387C>T" "" "benign" "" "0000407705" "1" "10" "17" "7579882" "7579882" "subst" "4.88715E-5" "01714" "TP53_010120" "g.7579882C>G" "184/12451 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs201382018" "0" "" "" "g.7676564C>G" "" "benign" "" "0000407706" "1" "50" "17" "7579885" "7579885" "subst" "3.2577E-5" "01714" "TP53_010121" "g.7579885C>T" "2/12454 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs535274413" "0" "" "" "g.7676567C>T" "" "VUS" "" "0000407707" "1" "10" "17" "7579886" "7579886" "subst" "8.14478E-6" "01714" "TP53_010122" "g.7579886G>A" "3/12454 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "rs757282628" "0" "" "" "g.7676568G>A" "" "benign" "" "0000407708" "1" "50" "17" "7579904" "7579904" "subst" "0" "01714" "TP53_010123" "g.7579904C>A" "1/12479 controls" "{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}" "" "" "" "Germline" "" "" "0" "" "" "g.7676586C>A" "" "VUS" "" "0000470553" "0" "70" "17" "7579699" "7579699" "subst" "0" "01807" "TP53_010124" "g.7579699C>T" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.7676381C>T" "" "likely pathogenic" "" "0000474804" "0" "70" "17" "7577094" "7577094" "subst" "4.06177E-6" "03273" "TP53_010005" "g.7577094G>A" "" "{PMID:Gallardo-Alvarado 2019:30709381}" "" "" "" "Germline" "" "rs28934574" "0" "" "" "g.7673776G>A" "" "likely pathogenic" "" "0000487612" "0" "70" "17" "7579502" "7579502" "del" "0" "03337" "TP53_010141" "g.7579502del" "" "" "" "186delA (E62del)" "" "Somatic" "" "" "0" "" "" "g.7676184del" "" "pathogenic" "" "0000487613" "0" "50" "17" "7579478" "7579478" "dup" "0" "03337" "TP53_010143" "g.7579478dup" "" "" "" "7676159_7676160insG" "" "Somatic" "" "" "0" "" "" "g.7676160dup" "" "pathogenic" "" "0000487614" "0" "50" "17" "7579497" "7579497" "subst" "0" "03337" "TP53_010140" "g.7579497G>C" "" "" "" "" "" "Somatic" "" "" "" "" "" "g.7676179G>C" "" "VUS" "" "0000487618" "0" "70" "17" "7579502" "7579502" "del" "0" "03337" "TP53_010141" "g.7579502del" "" "" "" "186delA" "" "Somatic" "" "" "0" "" "" "g.7676184del" "" "pathogenic" "" "0000487619" "0" "30" "17" "7579474" "7579474" "subst" "0" "03337" "TP53_010136" "g.7579474G>T" "" "" "Anja Bukovac" "" "" "Somatic" "" "" "0" "" "" "g.7676156G>T" "" "VUS" "" "0000487622" "0" "50" "17" "7579411" "7579411" "subst" "0" "03337" "TP53_010129" "g.7579411G>T" "" "" "" "" "" "Somatic" "" "" "" "" "" "g.7676093G>T" "" "VUS" "" "0000487624" "0" "70" "17" "7579470" "7579470" "subst" "6.49862E-5" "03337" "TP53_010060" "g.7579470C>T" "" "" "" "" "" "Somatic" "" "" "" "" "" "g.7676152C>T" "" "pathogenic" "" "0000487629" "0" "70" "17" "7579470" "7579470" "subst" "6.49862E-5" "03337" "TP53_010060" "g.7579470C>T" "" "" "" "" "" "Somatic" "" "" "" "" "" "g.7676152C>T" "" "pathogenic" "" "0000487631" "0" "70" "17" "7579387" "7579387" "subst" "0" "03337" "TP53_010128" "g.7579387C>A" "" "" "" "" "" "Somatic" "" "" "" "" "" "g.7676069C>A" "" "pathogenic" "" "0000487633" "0" "50" "17" "7579375" "7579375" "subst" "4.06256E-6" "03337" "TP53_010127" "g.7579375C>T" "" "" "" "" "" "Somatic" "" "" "" "" "" "g.7676057C>T" "" "VUS" "" "0000487634" "0" "50" "17" "7579372" "7579372" "subst" "0" "03337" "TP53_010126" "g.7579372G>A" "" "" "" "" "" "Somatic" "" "" "" "" "" "g.7676054G>A" "" "VUS" "" "0000487638" "0" "70" "17" "7579472" "7579472" "subst" "0.668584" "03337" "TP53_010135" "g.7579472G>C" "" "" "" "" "Variant Error [EMISMATCH/EREF]: This transcript variant does not match the reference sequence. Please fix this entry and then remove this message." "Somatic" "" "" "" "" "" "g.7676154G>C" "" "pathogenic" "" "0000487639" "0" "70" "17" "7579458" "7579458" "subst" "0" "03337" "TP53_010134" "g.7579458G>A" "" "" "" "" "" "Somatic" "" "" "" "" "" "g.7676140G>A" "" "pathogenic" "" "0000487640" "0" "70" "17" "7579442" "7579442" "subst" "2.03108E-5" "03337" "TP53_010022" "g.7579442G>A" "" "" "" "" "" "Somatic" "" "" "" "" "" "g.7676124G>A" "" "pathogenic" "" "0000487644" "0" "70" "17" "7579424" "7579424" "subst" "0" "03337" "TP53_010131" "g.7579424G>C" "" "" "" "" "" "Somatic" "" "" "" "" "" "g.7676106G>C" "" "pathogenic" "" "0000487646" "0" "70" "17" "7579416" "7579416" "subst" "0" "03337" "TP53_010130" "g.7579416A>G" "" "" "" "" "" "Somatic" "" "" "" "" "" "g.7676098A>G" "" "pathogenic" "" "0000487649" "0" "70" "17" "7579502" "7579502" "del" "0" "03337" "TP53_010141" "g.7579502del" "" "" "" "186delA" "" "Somatic" "" "" "" "" "" "g.7676184del" "" "pathogenic" "" "0000487651" "0" "70" "17" "7579472" "7579472" "subst" "0.668584" "03337" "TP53_010135" "g.7579472G>C" "" "" "" "" "Variant Error [EMISMATCH/EREF]: This transcript variant does not match the reference sequence. Please fix this entry and then remove this message." "Somatic" "" "" "" "" "" "g.7676154G>C" "" "pathogenic" "" "0000487652" "0" "70" "17" "7579416" "7579416" "subst" "0" "03337" "TP53_010130" "g.7579416A>G" "" "" "" "" "" "Somatic" "" "" "" "" "" "g.7676098A>G" "" "pathogenic" "" "0000487654" "0" "50" "17" "7579375" "7579375" "subst" "4.06256E-6" "03337" "TP53_010127" "g.7579375C>T" "" "" "" "" "" "Somatic" "" "" "" "" "" "g.7676057C>T" "" "VUS" "" "0000487661" "0" "70" "17" "7579472" "7579472" "subst" "0.668584" "03337" "TP53_010135" "g.7579472G>C" "" "" "" "" "Variant Error [EMISMATCH/EREF]: This transcript variant does not match the reference sequence. Please fix this entry and then remove this message." "Somatic" "" "" "" "" "" "g.7676154G>C" "" "pathogenic" "" "0000487662" "0" "70" "17" "7579365" "7579365" "subst" "0" "03337" "TP53_010125" "g.7579365C>G" "" "" "" "" "" "Somatic" "" "" "" "" "" "g.7676047C>G" "" "pathogenic" "" "0000487665" "0" "70" "17" "7579502" "7579502" "del" "0" "03337" "TP53_010141" "g.7579502del" "" "" "" "186delA" "" "Somatic" "" "" "" "" "" "g.7676184del" "" "pathogenic" "" "0000487668" "0" "70" "17" "7579479" "7579479" "dup" "0" "03337" "TP53_010144" "g.7579479dup" "" "" "" "209insG" "" "Somatic" "" "" "0" "" "" "g.7676161dup" "" "pathogenic" "" "0000487672" "0" "70" "17" "7579472" "7579472" "subst" "0.668584" "03337" "TP53_010049" "g.7579472G>C" "" "" "" "" "" "Somatic" "" "" "0" "" "" "g.7676154G>C" "" "pathogenic" "" "0000489019" "0" "70" "17" "7579472" "7579472" "subst" "0.668584" "03337" "TP53_010135" "g.7579472G>C" "" "" "" "" "Variant Error [EMISMATCH/EREF]: This transcript variant does not match the reference sequence. Please fix this entry and then remove this message." "Somatic" "" "" "" "" "" "g.7676154G>C" "" "pathogenic" "" "0000489021" "0" "70" "17" "7579472" "7579472" "subst" "0.668584" "03337" "TP53_010049" "g.7579472G>C" "" "" "" "" "" "Somatic" "" "" "0" "" "" "g.7676154G>C" "" "pathogenic" "" "0000489030" "0" "70" "17" "7579502" "7579502" "del" "0" "03337" "TP53_010141" "g.7579502del" "" "" "" "186delA" "" "Somatic" "" "" "" "" "" "g.7676184del" "" "pathogenic" "" "0000489032" "0" "50" "17" "7579497" "7579497" "subst" "0" "03337" "TP53_010140" "g.7579497G>C" "" "" "" "" "" "Somatic" "" "" "" "" "" "g.7676179G>C" "" "VUS" "" "0000489035" "0" "70" "17" "7579479" "7579479" "dup" "0" "03337" "TP53_010144" "g.7579479dup" "" "" "" "209insG" "" "Somatic" "" "" "0" "" "" "g.7676161dup" "" "pathogenic" "" "0000489039" "0" "70" "17" "7579472" "7579472" "subst" "0.668584" "03337" "TP53_010135" "g.7579472G>C" "" "" "" "" "Variant Error [EMISMATCH/EREF]: This transcript variant does not match the reference sequence. Please fix this entry and then remove this message." "Somatic" "" "" "" "" "" "g.7676154G>C" "" "pathogenic" "" "0000489041" "0" "70" "17" "7579444" "7579444" "dup" "0" "03337" "TP53_010133" "g.7579444dup" "" "" "" "243_244insA" "" "Somatic" "" "" "0" "" "" "g.7676126dup" "" "pathogenic" "" "0000489043" "0" "70" "17" "7579387" "7579387" "subst" "0" "03337" "TP53_010128" "g.7579387C>A" "" "" "" "" "" "Somatic" "" "" "" "" "" "g.7676069C>A" "" "pathogenic" "" "0000489044" "0" "70" "17" "7579502" "7579502" "del" "0" "03337" "TP53_010141" "g.7579502del" "" "" "" "186delA" "" "Somatic" "" "" "" "" "" "g.7676184del" "" "pathogenic" "" "0000489045" "0" "50" "17" "7579372" "7579372" "subst" "0" "03337" "TP53_010126" "g.7579372G>A" "" "" "" "" "" "Somatic" "" "" "" "" "" "g.7676054G>A" "" "VUS" "" "0000489048" "0" "70" "17" "7579472" "7579472" "subst" "0.668584" "03337" "TP53_010135" "g.7579472G>C" "" "" "" "" "Variant Error [EMISMATCH/EREF]: This transcript variant does not match the reference sequence. Please fix this entry and then remove this message." "Somatic" "" "" "" "" "" "g.7676154G>C" "" "pathogenic" "" "0000489051" "0" "70" "17" "7579472" "7579472" "subst" "0.668584" "03337" "TP53_010135" "g.7579472G>C" "" "" "" "" "Variant Error [EMISMATCH/EREF]: This transcript variant does not match the reference sequence. Please fix this entry and then remove this message." "Somatic" "" "" "" "" "" "g.7676154G>C" "" "pathogenic" "" "0000489055" "0" "70" "17" "7579484" "7579485" "subst" "0" "03337" "TP53_010139" "g.7579484_7579485insA" "" "" "" "" "" "Somatic" "" "" "0" "" "" "g.7676166_7676167insA" "" "pathogenic" "" "0000489057" "0" "70" "17" "7579502" "7579502" "del" "0" "03337" "TP53_010141" "g.7579502del" "" "" "" "186delA" "" "Somatic" "" "" "" "" "" "g.7676184del" "" "pathogenic" "" "0000489059" "0" "70" "17" "7579502" "7579502" "del" "0" "03337" "TP53_010141" "g.7579502del" "" "" "" "186delA" "" "Somatic" "" "" "" "" "" "g.7676184del" "" "pathogenic" "" "0000489060" "0" "50" "17" "7579372" "7579372" "subst" "0" "03337" "TP53_010126" "g.7579372G>A" "" "" "" "" "" "Somatic" "" "" "" "" "" "g.7676054G>A" "" "VUS" "" "0000489061" "0" "70" "17" "7579472" "7579472" "subst" "0.668584" "03337" "TP53_010135" "g.7579472G>C" "" "" "" "" "Variant Error [EMISMATCH/EREF]: This transcript variant does not match the reference sequence. Please fix this entry and then remove this message." "Somatic" "" "" "" "" "" "g.7676154G>C" "" "pathogenic" "" "0000489063" "0" "70" "17" "7579470" "7579470" "subst" "6.49862E-5" "03337" "TP53_010060" "g.7579470C>T" "" "" "" "" "" "Somatic" "" "" "" "" "" "g.7676152C>T" "" "pathogenic" "" "0000489067" "0" "50" "17" "7579375" "7579375" "subst" "4.06256E-6" "03337" "TP53_010127" "g.7579375C>T" "" "" "" "" "" "Somatic" "" "" "" "" "" "g.7676057C>T" "" "VUS" "" "0000489069" "0" "50" "17" "7579372" "7579372" "subst" "0" "03337" "TP53_010126" "g.7579372G>A" "" "" "" "" "" "Somatic" "" "" "" "" "" "g.7676054G>A" "" "VUS" "" "0000489070" "0" "70" "17" "7579502" "7579502" "del" "0" "03337" "TP53_010141" "g.7579502del" "" "" "" "186delA" "" "Somatic" "" "" "" "" "" "g.7676184del" "" "pathogenic" "" "0000489071" "0" "70" "17" "7579502" "7579502" "del" "0" "03337" "TP53_010141" "g.7579502del" "" "" "" "186delA" "" "Somatic" "" "" "" "" "" "g.7676184del" "" "pathogenic" "" "0000489073" "0" "70" "17" "7579472" "7579472" "subst" "0.668584" "03337" "TP53_010135" "g.7579472G>C" "" "" "" "" "Variant Error [EMISMATCH/EREF]: This transcript variant does not match the reference sequence. Please fix this entry and then remove this message." "Somatic" "" "" "" "" "" "g.7676154G>C" "" "pathogenic" "" "0000489074" "0" "70" "17" "7579502" "7579502" "del" "0" "03337" "TP53_010141" "g.7579502del" "" "" "" "186delA" "" "Somatic" "" "" "" "" "" "g.7676184del" "" "pathogenic" "" "0000489075" "0" "50" "17" "7579372" "7579372" "subst" "0" "03337" "TP53_010126" "g.7579372G>A" "" "" "" "" "" "Somatic" "" "" "" "" "" "g.7676054G>A" "" "VUS" "" "0000489076" "0" "70" "17" "7579365" "7579365" "subst" "0" "03337" "TP53_010125" "g.7579365C>G" "" "" "" "" "" "Somatic" "" "" "0" "" "" "g.7676047C>G" "" "pathogenic" "" "0000500509" "0" "90" "17" "7590694" "7590868" "del" "0" "00643" "TP53_010145" "g.(7579941_7590694)_(7590868_?)del" "" "{PMID:Fostira 2020:31300551}" "" "c.(?_-17900)_(?_1-1)del" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000500510" "0" "90" "17" "7579360" "7579363" "dup" "0" "00643" "TP53_010150" "g.7579360_7579363dup" "" "{PMID:Fostira 2020:31300551}" "" "324_327dupTTTC" "" "Germline" "" "" "0" "" "" "g.7676042_7676045dup" "" "pathogenic" "" "0000500511" "0" "90" "17" "7579312" "7579312" "subst" "0" "00643" "TP53_010149" "g.7579312C>T" "" "{PMID:Fostira 2020:31300551}" "" "" "" "Germline" "" "" "0" "" "" "g.7675994C>T" "" "pathogenic" "" "0000500512" "0" "90" "17" "7578369" "7578369" "subst" "0" "00643" "TP53_010148" "g.7578369A>G" "" "{PMID:Fostira 2020:31300551}" "" "" "" "Germline" "" "" "0" "" "" "g.7675051A>G" "" "pathogenic" "" "0000500513" "0" "90" "17" "7578271" "7578271" "subst" "0" "00643" "TP53_010147" "g.7578271T>A" "" "{PMID:Fostira 2020:31300551}" "" "" "" "Germline" "" "" "0" "" "" "g.7674953T>A" "" "pathogenic" "" "0000500514" "0" "90" "17" "7577091" "7577091" "subst" "8.12255E-5" "00643" "TP53_010002" "g.7577091G>A" "" "{PMID:Fostira 2020:31300551}" "" "" "" "Germline" "" "" "0" "" "" "g.7673773G>A" "" "pathogenic" "" "0000500515" "0" "90" "17" "7577091" "7577091" "subst" "8.12255E-5" "00643" "TP53_010002" "g.7577091G>A" "" "{PMID:Fostira 2020:31300551}" "" "" "" "Germline" "" "" "0" "" "" "g.7673773G>A" "" "pathogenic" "" "0000500516" "0" "90" "17" "7574006" "7574006" "subst" "0" "00643" "TP53_010146" "g.7574006A>C" "" "{PMID:Fostira 2020:31300551}" "" "" "" "Germline" "" "" "0" "" "" "g.7670688A>C" "" "pathogenic" "" "0000563208" "0" "90" "17" "7574003" "7574003" "subst" "0" "02325" "TP53_010151" "g.7574003G>A" "" "" "" "TP53(NM_000546.5):c.1024C>T (p.Arg342*), TP53(NM_001126118.2):c.907C>T (p.R303*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7670685G>A" "" "pathogenic" "" "0000563209" "0" "30" "17" "7574013" "7574013" "subst" "0.000256369" "02327" "TP53_010152" "g.7574013G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7670695G>A" "" "likely benign" "" "0000563210" "0" "90" "17" "7574035" "7574035" "subst" "0" "02327" "TP53_010153" "g.7574035T>C" "" "" "" "TP53(NM_000546.6):c.994-2A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7670717T>C" "" "pathogenic" "" "0000563211" "0" "10" "17" "7576841" "7576841" "subst" "0.0110245" "01943" "TP53_010057" "g.7576841A>G" "" "" "" "TP53(NM_000546.5):c.993+12T>C (p.(=)), TP53(NM_000546.6):c.993+12T>C, TP53(NM_001126114.2):c.993+12T>C, TP53(NM_001126114.3):c.993+12T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7673523A>G" "" "benign" "" "0000563212" "0" "10" "17" "7576841" "7576841" "subst" "0.0110245" "02369" "TP53_010057" "g.7576841A>G" "" "" "" "TP53(NM_000546.5):c.993+12T>C (p.(=)), TP53(NM_000546.6):c.993+12T>C, TP53(NM_001126114.2):c.993+12T>C, TP53(NM_001126114.3):c.993+12T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7673523A>G" "" "benign" "" "0000563213" "0" "10" "17" "7576841" "7576841" "subst" "0.0110245" "02325" "TP53_010057" "g.7576841A>G" "" "" "" "TP53(NM_000546.5):c.993+12T>C (p.(=)), TP53(NM_000546.6):c.993+12T>C, TP53(NM_001126114.2):c.993+12T>C, TP53(NM_001126114.3):c.993+12T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7673523A>G" "" "benign" "" "0000563214" "0" "30" "17" "7576841" "7576841" "subst" "0.0110245" "02326" "TP53_010057" "g.7576841A>G" "" "" "" "TP53(NM_000546.5):c.993+12T>C (p.(=)), TP53(NM_000546.6):c.993+12T>C, TP53(NM_001126114.2):c.993+12T>C, TP53(NM_001126114.3):c.993+12T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7673523A>G" "" "likely benign" "" "0000563215" "0" "10" "17" "7576841" "7576841" "subst" "0.0110245" "02329" "TP53_010057" "g.7576841A>G" "" "" "" "TP53(NM_000546.5):c.993+12T>C (p.(=)), TP53(NM_000546.6):c.993+12T>C, TP53(NM_001126114.2):c.993+12T>C, TP53(NM_001126114.3):c.993+12T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7673523A>G" "" "benign" "" "0000563216" "0" "30" "17" "7576969" "7576969" "subst" "0" "02327" "TP53_010154" "g.7576969C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7673651C>T" "" "likely benign" "" "0000563217" "0" "30" "17" "7577091" "7577091" "subst" "8.12255E-5" "02327" "TP53_010002" "g.7577091G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7673773G>A" "" "likely benign" "" "0000563218" "0" "70" "17" "7577093" "7577093" "subst" "4.06124E-6" "02327" "TP53_010155" "g.7577093C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7673775C>T" "" "likely pathogenic" "" "0000563219" "0" "90" "17" "7577121" "7577121" "subst" "1.22115E-5" "02327" "TP53_010083" "g.7577121G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7673803G>A" "" "pathogenic" "" "0000563220" "0" "70" "17" "7577153" "7577153" "subst" "0" "02327" "TP53_010156" "g.7577153C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7673835C>A" "" "likely pathogenic" "" "0000563221" "0" "90" "17" "7577539" "7577539" "subst" "4.06085E-6" "02327" "TP53_010008" "g.7577539G>A" "" "" "" "TP53(NM_000546.5):c.742C>T (p.Arg248Trp), TP53(NM_000546.6):c.742C>T (p.R248W), TP53(NM_001126114.3):c.742C>T (p.R248W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7674221G>A" "" "pathogenic" "" "0000563222" "0" "30" "17" "7577577" "7577577" "subst" "0.000190854" "02327" "TP53_010019" "g.7577577T>C" "" "" "" "TP53(NM_000546.6):c.704A>G (p.N235S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7674259T>C" "" "likely benign" "" "0000563223" "0" "10" "17" "7577644" "7577644" "subst" "0.012238" "02327" "TP53_010157" "g.7577644C>G" "" "" "" "TP53(NM_000546.6):c.673-36G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7674326C>G" "" "benign" "" "0000563224" "0" "30" "17" "7578210" "7578210" "subst" "0.012609" "01804" "TP53_010011" "g.7578210T>C" "" "" "" "TP53(NM_000546.5):c.639A>G (p.R213=, p.(Arg213=), p.Arg213=), TP53(NM_000546.6):c.639A>G (p.R213=), TP53(NM_001126114.2):c.639A>G (p.R213=), TP53...)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7674892T>C" "" "likely benign" "" "0000563225" "0" "70" "17" "7578226" "7578226" "subst" "0" "02327" "TP53_010158" "g.7578226T>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7674908T>A" "" "likely pathogenic" "" "0000563226" "0" "90" "17" "7578263" "7578263" "subst" "4.06085E-6" "02327" "TP53_010012" "g.7578263G>A" "" "" "" "TP53(NM_000546.5):c.586C>T (p.Arg196*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7674945G>A" "" "pathogenic" "" "0000563227" "0" "70" "17" "7578395" "7578395" "subst" "0" "02369" "TP53_010159" "g.7578395G>A" "" "" "" "TP53(NM_000546.5):c.535C>T (p.His179Tyr)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7675077G>A" "" "likely pathogenic" "" "0000563228" "0" "70" "17" "7578404" "7578404" "subst" "0" "02327" "TP53_010160" "g.7578404A>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7675086A>T" "" "likely pathogenic" "" "0000563229" "0" "30" "17" "7578422" "7578422" "subst" "0" "01943" "TP53_010161" "g.7578422T>C" "" "" "" "TP53(NM_001126114.2):c.508A>G (p.T170A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7675104T>C" "" "likely benign" "" "0000563230" "0" "90" "17" "7578457" "7578457" "subst" "4.06322E-6" "02369" "TP53_010162" "g.7578457C>T" "" "" "" "TP53(NM_000546.5):c.473G>A (p.Arg158His), TP53(NM_000546.6):c.473G>A (p.(Arg158His), p.R158H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7675139C>T" "" "pathogenic" "" "0000563231" "0" "90" "17" "7578457" "7578457" "subst" "4.06322E-6" "02325" "TP53_010162" "g.7578457C>T" "" "" "" "TP53(NM_000546.5):c.473G>A (p.Arg158His), TP53(NM_000546.6):c.473G>A (p.(Arg158His), p.R158H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7675139C>T" "" "pathogenic" "" "0000563232" "0" "70" "17" "7578463" "7578463" "subst" "0" "02327" "TP53_010163" "g.7578463C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7675145C>G" "" "likely pathogenic" "" "0000563233" "0" "50" "17" "7578463" "7578463" "subst" "2.03161E-5" "02327" "TP53_010101" "g.7578463C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7675145C>T" "" "VUS" "" "0000563234" "0" "70" "17" "7578556" "7578556" "dup" "0" "01943" "TP53_010164" "g.7578556dup" "" "" "" "TP53(NM_000546.5):c.376-2dupA" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7675238dup" "" "likely pathogenic" "" "0000563235" "0" "30" "17" "7579296" "7579296" "subst" "4.48734E-5" "02327" "TP53_010165" "g.7579296C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7675978C>T" "" "likely benign" "" "0000563236" "0" "90" "17" "7579360" "7579360" "del" "0" "02325" "TP53_010166" "g.7579360del" "" "" "" "TP53(NM_000546.6):c.328delC (p.R110Vfs*13)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7676042del" "" "pathogenic" "" "0000563237" "0" "30" "17" "7579579" "7579579" "subst" "0.0132391" "01804" "TP53_010050" "g.7579579C>T" "" "" "" "TP53(NM_000546.5):c.108G>A (p.P36=, p.(Pro36=), p.Pro36=), TP53(NM_000546.6):c.108G>A (p.P36=), TP53(NM_001126114.3):c.108G>A (p.P36=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7676261C>T" "" "likely benign" "" "0000563238" "0" "10" "17" "7579596" "7579596" "subst" "0.00195481" "01943" "TP53_010052" "g.7579596G>A" "" "" "" "TP53(NM_000546.5):c.97-6C>T (p.(=)), TP53(NM_001126114.2):c.97-6C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7676278G>A" "" "benign" "" "0000563239" "0" "10" "17" "7579619" "7579619" "subst" "0.0649701" "01943" "TP53_010061" "g.7579619G>T" "" "" "" "TP53(NM_000546.5):c.97-29C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7676301G>T" "" "benign" "" "0000563240" "0" "10" "17" "7579619" "7579619" "subst" "0.0649701" "02369" "TP53_010061" "g.7579619G>T" "" "" "" "TP53(NM_000546.5):c.97-29C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7676301G>T" "" "benign" "" "0000563241" "0" "30" "17" "7579642" "7579642" "subst" "0" "02369" "TP53_010062" "g.7579642C>T" "" "" "" "TP53(NM_000546.5):c.97-52G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7676324C>T" "" "likely benign" "" "0000563242" "0" "30" "17" "7579907" "7579907" "subst" "8.96686E-5" "02369" "TP53_010167" "g.7579907C>T" "" "" "" "TP53(NM_000546.5):c.6G>A (p.(Glu2=), p.Glu2=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7676589C>T" "" "likely benign" "" "0000563243" "0" "30" "17" "7592361" "7592361" "subst" "9.34709E-5" "01943" "TP53_010168" "g.7592361C>A" "" "" "" "WRAP53(NM_018081.2):c.395C>A (p.T132N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7689043C>A" "" "likely benign" "" "0000563244" "0" "30" "17" "7592412" "7592412" "subst" "0.00111805" "02326" "TP53_010169" "g.7592412C>T" "" "" "" "WRAP53(NM_018081.2):c.431+15C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7689094C>T" "" "likely benign" "" "0000563245" "0" "50" "17" "7592597" "7592597" "subst" "4.06062E-6" "01943" "TP53_010170" "g.7592597G>C" "" "" "" "WRAP53(NM_018081.2):c.487G>C (p.E163Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7689279G>C" "" "VUS" "" "0000563246" "0" "50" "17" "7604140" "7604140" "subst" "4.06055E-6" "01943" "EFNB3_000001" "g.7604140A>G" "" "" "" "WRAP53(NM_018081.2):c.724A>G (p.T242A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7700822A>G" "" "VUS" "" "0000563247" "0" "50" "17" "7604141" "7604141" "subst" "4.06055E-6" "02325" "EFNB3_000002" "g.7604141C>T" "" "" "" "WRAP53(NM_018081.2):c.725C>T (p.T242I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7700823C>T" "" "VUS" "" "0000563248" "0" "30" "17" "7604873" "7604873" "subst" "2.84289E-5" "02326" "EFNB3_000003" "g.7604873G>A" "" "" "" "WRAP53(NM_018081.2):c.822+6G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7701555G>A" "" "likely benign" "" "0000563249" "0" "50" "17" "7605081" "7605081" "subst" "4.07687E-6" "02325" "EFNB3_000004" "g.7605081G>A" "" "" "" "WRAP53(NM_018081.2):c.929G>A (p.R310Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7701763G>A" "" "VUS" "" "0000563250" "0" "10" "17" "7606119" "7606119" "subst" "0.00138576" "01943" "EFNB3_000005" "g.7606119G>A" "" "" "" "WRAP53(NM_018081.2):c.1223G>A (p.G408D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7702801G>A" "" "benign" "" "0000563251" "0" "50" "17" "7606604" "7606604" "subst" "0" "01943" "EFNB3_000006" "g.7606604C>T" "" "" "" "WRAP53(NM_018081.2):c.1447C>T (p.R483C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7703286C>T" "" "VUS" "" "0000563252" "0" "10" "17" "7606639" "7606639" "subst" "0.00138143" "01943" "EFNB3_000007" "g.7606639A>G" "" "" "" "WRAP53(NM_018081.2):c.1482A>G (p.E494=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7703321A>G" "" "benign" "" "0000563253" "0" "50" "17" "7606694" "7606694" "subst" "0.000519949" "02325" "WRAP53_000014" "g.7606694C>G" "" "" "" "WRAP53(NM_018081.2):c.1537C>G (p.R513G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7703376C>G" "" "VUS" "" "0000563254" "0" "10" "17" "7606798" "7606798" "subst" "0.00137544" "01943" "EFNB3_000008" "g.7606798G>T" "" "" "" "WRAP53(NM_018081.2):c.1641G>T (p.L547=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7703480G>T" "" "benign" "" "0000598754" "3" "10" "17" "7579472" "7579472" "subst" "0.668584" "03452" "TP53_010049" "g.7579472G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.7676154G>C" "" "benign" "" "0000599121" "0" "10" "17" "7579472" "7579472" "subst" "0.668584" "02337" "TP53_010049" "g.7579472G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.7676154G>C" "" "benign" "" "0000599122" "0" "10" "17" "7579472" "7579472" "subst" "0.668584" "02337" "TP53_010049" "g.7579472G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.7676154G>C" "" "benign" "" "0000599123" "0" "10" "17" "7579472" "7579472" "subst" "0.668584" "02337" "TP53_010049" "g.7579472G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.7676154G>C" "" "benign" "" "0000599124" "0" "10" "17" "7579472" "7579472" "subst" "0.668584" "02337" "TP53_010049" "g.7579472G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.7676154G>C" "" "benign" "" "0000599125" "0" "10" "17" "7579472" "7579472" "subst" "0.668584" "02337" "TP53_010049" "g.7579472G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.7676154G>C" "" "benign" "" "0000616835" "0" "10" "17" "7573057" "7573057" "subst" "0.0110587" "02327" "TP53_010171" "g.7573057G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7669739G>A" "" "benign" "" "0000616836" "0" "50" "17" "7576931" "7576931" "subst" "5.27919E-5" "01804" "TP53_010172" "g.7576931G>A" "" "" "" "TP53(NM_000546.5):c.920-5C>T (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7673613G>A" "" "VUS" "" "0000616837" "0" "30" "17" "7576961" "7576961" "subst" "4.06065E-6" "02369" "TP53_010173" "g.7576961A>C" "" "" "" "TP53(NM_000546.5):c.920-35T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7673643A>C" "" "likely benign" "" "0000616838" "0" "30" "17" "7576997" "7576997" "subst" "8.12123E-6" "02327" "TP53_010174" "g.7576997G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7673679G>A" "" "likely benign" "" "0000616839" "0" "90" "17" "7577030" "7577034" "dup" "0" "02369" "TP53_010175" "g.7577030_7577034dup" "" "" "" "TP53(NM_000546.5):c.904_908dupGGGAG (p.Ser303Argfs*44)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7673712_7673716dup" "" "pathogenic" "" "0000616840" "0" "30" "17" "7577487" "7577487" "subst" "9.75182E-5" "02369" "TP53_010177" "g.7577487G>A" "" "" "" "TP53(NM_000546.5):c.782+12C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7674169G>A" "" "likely benign" "" "0000616841" "0" "90" "17" "7577548" "7577548" "subst" "0" "02327" "TP53_010084" "g.7577548C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7674230C>T" "" "pathogenic" "" "0000616842" "0" "30" "17" "7578159" "7578159" "subst" "0.000330709" "01804" "TP53_010178" "g.7578159C>G" "" "" "" "TP53(NM_000546.5):c.672+18G>C (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7674841C>G" "" "likely benign" "" "0000616843" "0" "90" "17" "7578265" "7578265" "subst" "0" "02327" "TP53_010179" "g.7578265A>G" "" "" "" "TP53(NM_000546.5):c.584T>C (p.Ile195Thr)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7674947A>G" "" "pathogenic" "" "0000616844" "0" "90" "17" "7578457" "7578457" "subst" "4.06322E-6" "02327" "TP53_010162" "g.7578457C>T" "" "" "" "TP53(NM_000546.5):c.473G>A (p.Arg158His), TP53(NM_000546.6):c.473G>A (p.(Arg158His), p.R158H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7675139C>T" "" "pathogenic" "" "0000616845" "0" "10" "17" "7579579" "7579579" "subst" "0.0132391" "02369" "TP53_010050" "g.7579579C>T" "" "" "" "TP53(NM_000546.5):c.108G>A (p.P36=, p.(Pro36=), p.Pro36=), TP53(NM_000546.6):c.108G>A (p.P36=), TP53(NM_001126114.3):c.108G>A (p.P36=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7676261C>T" "" "benign" "" "0000616848" "0" "30" "17" "7604792" "7604792" "subst" "0" "01943" "EFNB3_000010" "g.7604792C>T" "" "" "" "WRAP53(NM_018081.2):c.747C>T (p.S249=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7701474C>T" "" "likely benign" "" "0000616849" "0" "30" "17" "7606722" "7606722" "subst" "1.22079E-5" "01943" "EFNB3_000012" "g.7606722C>T" "" "" "" "WRAP53(NM_018081.2):c.1565C>T (p.A522V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7703404C>T" "" "likely benign" "" "0000623770" "0" "50" "17" "7605071" "7605071" "subst" "0.000394575" "01943" "EFNB3_000011" "g.7605071C>T" "" "" "" "WRAP53(NM_018081.2):c.919C>T (p.R307W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7701753C>T" "" "VUS" "" "0000649714" "1" "30" "17" "7576841" "7576841" "subst" "0.0110245" "03575" "TP53_010057" "g.7576841A>G" "51/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "51 heterozygous, no homozygous; {DB:CLININrs1800899}" "Germline" "" "rs1800899" "0" "" "" "g.7673523A>G" "" "likely benign" "" "0000649715" "1" "50" "17" "7577090" "7577090" "subst" "4.06101E-5" "03575" "TP53_010180" "g.7577090C>T" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 1 heterozygous, no homozygous; {DB:CLININrs587781564}" "Germline" "" "rs587781564" "0" "" "" "g.7673772C>T" "" "VUS" "" "0000649716" "1" "50" "17" "7577091" "7577091" "subst" "8.12255E-5" "03575" "TP53_010002" "g.7577091G>A" "1/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 1 heterozygous, no homozygous; {DB:CLININrs149633775}" "Germline" "" "rs149633775" "0" "" "" "g.7673773G>A" "" "VUS" "" "0000649717" "1" "50" "17" "7577570" "7577570" "subst" "4.06075E-6" "03575" "TP53_010183" "g.7577570C>T" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 1 heterozygous, no homozygous; {DB:CLININrs587782664}" "Germline" "" "rs587782664" "0" "" "" "g.7674252C>T" "" "VUS" "" "0000649718" "1" "30" "17" "7578210" "7578210" "subst" "0.012609" "03575" "TP53_010011" "g.7578210T>C" "3/2791 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "3 heterozygous, no homozygous; {DB:CLININrs1800372}" "Germline" "" "rs1800372" "0" "" "" "g.7674892T>C" "" "likely benign" "" "0000653021" "1" "90" "17" "7577022" "7577022" "subst" "0" "03575" "TP53_010034" "g.7577022G>A" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs121913344}" "Germline" "" "rs121913344" "0" "" "" "g.7673704G>A" "" "pathogenic" "" "0000653143" "1" "50" "17" "7577108" "7577108" "subst" "0" "03575" "TP53_010080" "g.7577108C>T" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 1 heterozygous, no homozygous; {DB:CLININrs763098116.1}" "Germline" "" "rs763098116" "0" "" "" "g.7673790C>T" "" "VUS" "" "0000653144" "1" "70" "17" "7577114" "7577114" "subst" "0" "03575" "TP53_010181" "g.7577114C>T" "1/2793 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs863224451}" "Germline" "" "rs863224451" "0" "" "" "g.7673796C>T" "" "likely pathogenic" "" "0000653145" "1" "70" "17" "7577509" "7577509" "subst" "4.06128E-6" "03575" "TP53_010182" "g.7577509C>T" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs121912652}" "Germline" "" "rs121912652" "0" "" "" "g.7674191C>T" "" "likely pathogenic" "" "0000653146" "1" "70" "17" "7577538" "7577538" "subst" "2.03047E-5" "03575" "TP53_010015" "g.7577538C>T" "3/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "3 heterozygous, no homozygous; {DB:CLININrs11540652}" "Germline" "" "rs11540652" "0" "" "" "g.7674220C>T" "" "likely pathogenic" "" "0000653432" "0" "50" "17" "7579445" "7579445" "subst" "0" "01164" "TP53_010184" "g.7579445G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.7676127G>A" "" "VUS" "ACMG" "0000658256" "0" "10" "17" "7573897" "7573897" "subst" "0.00935205" "02369" "TP53_010029" "g.7573897T>A" "" "" "" "TP53(NM_000546.5):c.1100+30A>T, TP53(NM_000546.6):c.1100+30A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7670579T>A" "" "benign" "" "0000658257" "0" "90" "17" "7577094" "7577094" "subst" "4.06177E-6" "02327" "TP53_010005" "g.7577094G>A" "" "" "" "TP53(NM_000546.6):c.844C>T (p.R282W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7673776G>A" "" "pathogenic" "" "0000658258" "0" "90" "17" "7577099" "7577099" "subst" "0" "02327" "TP53_010187" "g.7577099C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7673781C>T" "" "pathogenic" "" "0000658259" "0" "70" "17" "7577112" "7577112" "subst" "0" "02327" "TP53_010188" "g.7577112C>G" "" "" "" "TP53(NM_000546.4):c.826G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7673794C>G" "" "likely pathogenic" "" "0000658260" "0" "90" "17" "7577120" "7577120" "subst" "1.62689E-5" "02327" "TP53_010081" "g.7577120C>T" "" "" "" "TP53(NM_000546.5):c.818G>A (p.(Arg273His), p.Arg273His)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7673802C>T" "" "pathogenic" "" "0000658261" "0" "30" "17" "7577199" "7577199" "subst" "0" "02369" "TP53_010189" "g.7577199C>T" "" "" "" "TP53(NM_000546.5):c.783-44G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7673881C>T" "" "likely benign" "" "0000658262" "0" "90" "17" "7578211" "7578211" "subst" "0" "02327" "TP53_010037" "g.7578211C>T" "" "" "" "TP53(NM_000546.5):c.638G>A (p.Arg213Gln), TP53(NM_000546.6):c.638G>A (p.R213Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7674893C>T" "" "pathogenic" "" "0000658263" "0" "70" "17" "7578454" "7578454" "subst" "0" "02327" "TP53_010190" "g.7578454G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7675136G>A" "" "likely pathogenic" "" "0000658264" "0" "10" "17" "7579801" "7579801" "subst" "0.673823" "02369" "TP53_010063" "g.7579801G>C" "" "" "" "TP53(NM_000546.5):c.74+38C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7676483G>C" "" "benign" "" "0000658265" "0" "30" "17" "7579828" "7579828" "subst" "0" "02327" "TP53_010191" "g.7579828G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7676510G>T" "" "likely benign" "" "0000658266" "0" "30" "17" "7579886" "7579886" "subst" "8.14478E-6" "02369" "TP53_010122" "g.7579886G>A" "" "" "" "TP53(NM_000546.5):c.27C>T (p.Ser9=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7676568G>A" "" "likely benign" "" "0000658267" "0" "50" "17" "7592174" "7592174" "subst" "2.03138E-5" "02325" "TP53_010192" "g.7592174G>T" "" "" "" "WRAP53(NM_018081.2):c.208G>T (p.G70W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7688856G>T" "" "VUS" "" "0000659568" "0" "50" "17" "7578392" "7578392" "subst" "0" "01164" "TP53_010185" "g.7578392C>T" "" "" "" "" "ACMG: PM2,PP3,PP5; Monti et al. 2011. Mol Cancer Res 9: 271; Birch et al. 1994. Cancer 54: 1298; Kato et al. 2003. PNAS 100: 8424; Follis et al. 2014. Nat Struct Mol Biol 21: 535" "Germline" "" "rs879253911" "0" "" "" "g.7675074C>T" "" "VUS" "ACMG" "0000659573" "0" "50" "17" "7572957" "7572957" "subst" "0" "01164" "TP53_010186" "g.7572957C>T" "" "" "" "" "ACMG: PM2; 2x DCIS at age 46y, mother BC at age 55y, grandmother (ms) BC at age 48y" "Germline" "" "" "0" "" "" "g.7669639C>T" "" "VUS" "ACMG" "0000659672" "1" "90" "17" "7574017" "7574017" "subst" "8.1408E-6" "03629" "TP53_010069" "g.7574017C>T" "1/22 cases" "" "" "" "" "Germline" "" "rs121912664" "0" "" "" "g.7670699C>T" "" "pathogenic (dominant)" "" "0000681034" "0" "90" "17" "7577025" "7577025" "subst" "0" "02369" "TP53_010193" "g.7577025T>A" "" "" "" "TP53(NM_000546.5):c.913A>T (p.Lys305*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000681035" "0" "70" "17" "7577106" "7577106" "subst" "0" "02325" "TP53_010194" "g.7577106G>C" "" "" "" "TP53(NM_001126114.3):c.832C>G (p.P278A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000681036" "0" "90" "17" "7577539" "7577539" "subst" "4.06085E-6" "02325" "TP53_010008" "g.7577539G>A" "" "" "" "TP53(NM_000546.5):c.742C>T (p.Arg248Trp), TP53(NM_000546.6):c.742C>T (p.R248W), TP53(NM_001126114.3):c.742C>T (p.R248W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000681037" "0" "90" "17" "7578265" "7578265" "subst" "0" "02369" "TP53_010179" "g.7578265A>G" "" "" "" "TP53(NM_000546.5):c.584T>C (p.Ile195Thr)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000681038" "0" "70" "17" "7578392" "7578392" "subst" "0" "02327" "TP53_010185" "g.7578392C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000681039" "0" "90" "17" "7578413" "7578413" "subst" "0" "02369" "TP53_010195" "g.7578413C>A" "" "" "" "TP53(NM_000546.5):c.517G>T (p.Val173Leu)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000681040" "0" "30" "17" "7604965" "7604965" "subst" "0.00330537" "01804" "WRAP53_000009" "g.7604965C>T" "" "" "" "WRAP53(NM_001143990.1):c.823-10C>T (p.(=)), WRAP53(NM_018081.2):c.823-10C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000692477" "0" "50" "17" "7574012" "7574012" "subst" "6.51111E-5" "01943" "TP53_010025" "g.7574012C>T" "" "" "" "TP53(NM_001126118.1):c.898G>A (p.E300K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000692478" "0" "70" "17" "7578388" "7578388" "subst" "1.21893E-5" "02327" "TP53_010196" "g.7578388C>T" "" "" "" "TP53(NM_000546.5):c.542G>A (p.Arg181His)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000692479" "0" "90" "17" "7578460" "7578497" "del" "0" "02327" "TP53_010197" "g.7578460_7578497del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000726694" "0" "30" "17" "7576712" "7576712" "subst" "0" "02369" "TP53_010199" "g.7576712C>T" "" "" "" "TP53(NM_000546.5):c.993+141G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000726695" "0" "90" "17" "7577539" "7577539" "subst" "4.06085E-6" "02369" "TP53_010008" "g.7577539G>A" "" "" "" "TP53(NM_000546.5):c.742C>T (p.Arg248Trp), TP53(NM_000546.6):c.742C>T (p.R248W), TP53(NM_001126114.3):c.742C>T (p.R248W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000726696" "0" "10" "17" "7578146" "7578146" "subst" "0.0072708" "02369" "TP53_010200" "g.7578146T>C" "" "" "" "TP53(NM_000546.5):c.672+31A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000726697" "0" "50" "17" "7578277" "7578277" "subst" "4.06081E-6" "01804" "TP53_010201" "g.7578277G>A" "" "" "" "TP53(NM_000546.5):c.572C>T (p.(Pro191Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000726698" "0" "30" "17" "7579907" "7579907" "subst" "8.96686E-5" "01804" "TP53_010167" "g.7579907C>T" "" "" "" "TP53(NM_000546.5):c.6G>A (p.(Glu2=), p.Glu2=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000726699" "0" "50" "17" "7604072" "7604072" "subst" "8.12117E-6" "02325" "EFNB3_000013" "g.7604072G>A" "" "" "" "WRAP53(NM_018081.2):c.656G>A (p.R219Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000726700" "0" "30" "17" "7604136" "7604136" "subst" "0.000178664" "01943" "EFNB3_000014" "g.7604136A>G" "" "" "" "WRAP53(NM_018081.2):c.720A>G (p.P240=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000726701" "0" "50" "17" "7605071" "7605071" "subst" "0.000394575" "02325" "EFNB3_000011" "g.7605071C>T" "" "" "" "WRAP53(NM_018081.2):c.919C>T (p.R307W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000726702" "0" "10" "17" "7605088" "7605088" "subst" "0.00203245" "02326" "WRAP53_000011" "g.7605088C>T" "" "" "" "WRAP53(NM_018081.2):c.936C>T (p.C312=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000726703" "0" "90" "17" "7606721" "7606721" "del" "0" "01943" "EFNB3_000015" "g.7606721del" "" "" "" "WRAP53(NM_018081.2):c.1564delG (p.A522Rfs*26)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000726704" "0" "30" "17" "7606747" "7606747" "subst" "0" "01943" "EFNB3_000016" "g.7606747T>A" "" "" "" "WRAP53(NM_018081.2):c.1590T>A (p.D530E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000737086" "1" "50" "17" "7578556" "7578556" "dup" "0" "04020" "TP53_010164" "g.7578556dup" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578555_C_CT" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000737189" "1" "50" "17" "7574002" "7574003" "delins" "0" "04020" "TP53_010227" "g.7574002_7574003delinsAA" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7574002_CG_AA" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000737190" "1" "50" "17" "7578230" "7578231" "delins" "0" "04020" "TP53_010294" "g.7578230_7578231delinsGA" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578230_CC_GA" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742610" "1" "50" "17" "7572944" "7572944" "subst" "0" "04020" "TP53_010202" "g.7572944C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7572944_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742611" "1" "50" "17" "7572958" "7572958" "subst" "4.06062E-6" "04020" "TP53_010205" "g.7572958A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7572958_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742612" "1" "50" "17" "7572961" "7572961" "subst" "0" "04020" "TP53_010207" "g.7572961A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7572961_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742613" "1" "50" "17" "7572983" "7572983" "subst" "0" "04020" "TP53_010210" "g.7572983A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7572983_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742614" "1" "50" "17" "7572989" "7572989" "subst" "4.06329E-6" "04020" "TP53_010211" "g.7572989C>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7572989_C_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742615" "1" "50" "17" "7572989" "7572989" "subst" "0" "04020" "TP53_010212" "g.7572989C>T" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7572989_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742616" "1" "50" "17" "7573934" "7573934" "subst" "4.09041E-6" "04020" "TP53_010214" "g.7573934G>A" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7573934_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742617" "1" "50" "17" "7573936" "7573936" "subst" "0" "04020" "TP53_010215" "g.7573936G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7573936_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742618" "1" "50" "17" "7573961" "7573961" "subst" "4.0713E-6" "04020" "TP53_010221" "g.7573961C>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7573961_C_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742619" "1" "50" "17" "7573973" "7573973" "subst" "0" "04020" "TP53_010223" "g.7573973C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7573973_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742620" "1" "50" "17" "7574024" "7574024" "subst" "0" "04020" "TP53_010233" "g.7574024G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7574024_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742621" "1" "50" "17" "7576896" "7576896" "subst" "4.06058E-6" "04020" "TP53_010239" "g.7576896T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7576896_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742622" "1" "50" "17" "7576908" "7576908" "subst" "0" "04020" "TP53_010243" "g.7576908C>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7576908_C_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742623" "1" "50" "17" "7577021" "7577021" "subst" "4.06072E-6" "04020" "TP53_010246" "g.7577021C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577021_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742624" "1" "50" "17" "7577029" "7577029" "subst" "0" "04020" "TP53_010247" "g.7577029G>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577029_G_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742625" "1" "50" "17" "7577061" "7577061" "subst" "8.12137E-6" "04020" "TP53_010254" "g.7577061C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577061_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742626" "1" "50" "17" "7577063" "7577063" "subst" "0" "04020" "TP53_010256" "g.7577063T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577063_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742627" "1" "50" "17" "7577072" "7577072" "subst" "0" "04020" "TP53_010258" "g.7577072A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577072_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742628" "1" "50" "17" "7577076" "7577076" "subst" "0" "04020" "TP53_010259" "g.7577076T>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577076_T_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742629" "1" "50" "17" "7577090" "7577090" "subst" "4.06101E-5" "04020" "TP53_010180" "g.7577090C>T" "5/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577090_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742630" "1" "50" "17" "7577138" "7577138" "subst" "1.22859E-5" "04020" "TP53_010018" "g.7577138C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577138_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742631" "1" "50" "17" "7577593" "7577593" "subst" "0" "04020" "TP53_010278" "g.7577593T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577593_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742632" "1" "50" "17" "7577596" "7577596" "subst" "0" "04020" "TP53_010280" "g.7577596A>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577596_A_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742633" "1" "50" "17" "7577609" "7577609" "subst" "0" "04020" "TP53_010281" "g.7577609C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577609_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742634" "1" "50" "17" "7578228" "7578228" "subst" "0" "04020" "TP53_010292" "g.7578228A>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578228_A_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742635" "1" "50" "17" "7578244" "7578244" "subst" "0" "04020" "TP53_010296" "g.7578244C>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578244_C_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742636" "1" "50" "17" "7578244" "7578244" "subst" "0" "04020" "TP53_010092" "g.7578244C>T" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578244_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742637" "1" "50" "17" "7578273" "7578273" "subst" "0" "04020" "TP53_010300" "g.7578273C>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578273_C_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742638" "1" "50" "17" "7578277" "7578277" "subst" "1.21824E-5" "04020" "TP53_010302" "g.7578277G>C" "5/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578277_G_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742639" "1" "50" "17" "7578416" "7578416" "subst" "0" "04020" "TP53_010309" "g.7578416C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578416_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742640" "1" "50" "17" "7578451" "7578451" "subst" "0" "04020" "TP53_010099" "g.7578451A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578451_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742641" "1" "50" "17" "7578469" "7578469" "subst" "8.12638E-6" "04020" "TP53_010320" "g.7578469C>T" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578469_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742642" "1" "50" "17" "7578484" "7578484" "subst" "0" "04020" "TP53_010323" "g.7578484G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578484_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742643" "1" "50" "17" "7578503" "7578503" "subst" "0" "04020" "TP53_010324" "g.7578503C>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578503_C_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742644" "1" "50" "17" "7578545" "7578545" "subst" "0" "04020" "TP53_010335" "g.7578545C>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578545_C_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742645" "1" "50" "17" "7579323" "7579323" "subst" "0" "04020" "TP53_010339" "g.7579323C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579323_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742646" "1" "50" "17" "7579424" "7579424" "subst" "0" "04020" "TP53_010350" "g.7579424G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579424_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742647" "1" "50" "17" "7579428" "7579428" "subst" "0" "04020" "TP53_010352" "g.7579428G>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579428_G_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742648" "1" "50" "17" "7579439" "7579439" "subst" "0.000142182" "04020" "TP53_010354" "g.7579439G>A" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579439_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742649" "1" "50" "17" "7579469" "7579469" "subst" "0" "04020" "TP53_010358" "g.7579469A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579469_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742650" "1" "50" "17" "7579470" "7579470" "subst" "6.49862E-5" "04020" "TP53_010060" "g.7579470C>T" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579470_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742651" "1" "50" "17" "7579472" "7579472" "subst" "0" "04020" "TP53_010360" "g.7579472G>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579472_G_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742652" "1" "50" "17" "7579504" "7579504" "subst" "0" "04020" "TP53_010363" "g.7579504A>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579504_A_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742653" "1" "50" "17" "7579509" "7579509" "subst" "0" "04020" "TP53_010365" "g.7579509G>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579509_G_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742654" "1" "50" "17" "7579535" "7579535" "subst" "0" "04020" "TP53_010366" "g.7579535T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579535_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742655" "1" "50" "17" "7579543" "7579543" "subst" "0" "04020" "TP53_010369" "g.7579543G>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579543_G_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742656" "1" "50" "17" "7579890" "7579890" "subst" "0" "04020" "TP53_010374" "g.7579890G>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579890_G_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000742657" "1" "50" "17" "7579905" "7579905" "subst" "0" "04020" "TP53_010376" "g.7579905T>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579905_T_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000743211" "1" "50" "17" "7577040" "7577043" "dup" "0" "04020" "TP53_010248" "g.7577040_7577043dup" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577038_G_GGGCA" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000743212" "1" "50" "17" "7577050" "7577050" "del" "0" "04020" "TP53_010251" "g.7577050del" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577048_TG_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000743213" "1" "50" "17" "7577577" "7577587" "dup" "0" "04020" "TP53_010277" "g.7577577_7577587dup" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577576_G_GTTGTAGTGGAT" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000743214" "1" "50" "17" "7578273" "7578276" "dup" "0" "04020" "TP53_010301" "g.7578273_7578276dup" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578272_G_GCTGA" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000743215" "1" "50" "17" "7578478" "7578479" "del" "0" "04020" "TP53_010322" "g.7578478_7578479del" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578474_CGG_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000743216" "1" "50" "17" "7579363" "7579411" "dup" "0" "04020" "TP53_010344" "g.7579363_7579411dup" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579362_A_AACCGTAGCTGCCCTGGTAGGTTTTCTGGGAAGGGACAGAAGATGACAGG" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000743217" "1" "50" "17" "7579719" "7579719" "del" "0" "04020" "TP53_010373" "g.7579719del" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579717_GA_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000743436" "1" "50" "17" "7578424" "7578425" "del" "0" "04020" "TP53_010311" "g.7578424_7578425del" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578423_CAT_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000743443" "1" "50" "17" "7577046" "7577047" "delins" "0" "04020" "TP53_010250" "g.7577046_7577047delinsAA" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577046_CG_AA" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000743444" "1" "50" "17" "7579471" "7579472" "delins" "0" "04020" "TP53_010359" "g.7579471_7579472delinsAC" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579471_GG_AC" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000743445" "1" "50" "17" "7579472" "7579473" "delins" "0" "04020" "TP53_010361" "g.7579472_7579473delinsCC" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579472_GG_CC" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749849" "1" "50" "17" "7572959" "7572959" "subst" "0" "04020" "TP53_010206" "g.7572959T>C" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7572959_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749850" "1" "50" "17" "7573943" "7573943" "subst" "4.08333E-6" "04020" "TP53_010216" "g.7573943T>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7573943_T_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749851" "1" "50" "17" "7573943" "7573943" "subst" "0" "04020" "TP53_010217" "g.7573943T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7573943_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749852" "1" "50" "17" "7573982" "7573982" "subst" "0" "04020" "TP53_010224" "g.7573982C>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7573982_C_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749853" "1" "50" "17" "7573987" "7573987" "subst" "0" "04020" "TP53_010225" "g.7573987G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7573987_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749854" "1" "50" "17" "7573988" "7573988" "subst" "0" "04020" "TP53_010226" "g.7573988C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7573988_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749855" "1" "50" "17" "7574007" "7574007" "subst" "0" "04020" "TP53_010229" "g.7574007C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7574007_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749856" "1" "50" "17" "7574012" "7574012" "subst" "8.13888E-6" "04020" "TP53_010230" "g.7574012C>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7574012_C_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749857" "1" "50" "17" "7574015" "7574015" "subst" "0" "04020" "TP53_010231" "g.7574015A>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7574015_A_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749858" "1" "50" "17" "7574018" "7574018" "subst" "0" "04020" "TP53_010232" "g.7574018G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7574018_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749859" "1" "50" "17" "7574026" "7574026" "subst" "0" "04020" "TP53_010234" "g.7574026C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7574026_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749860" "1" "50" "17" "7576875" "7576875" "subst" "4.06062E-6" "04020" "TP53_010236" "g.7576875T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7576875_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749861" "1" "50" "17" "7576876" "7576876" "subst" "1.21819E-5" "04020" "TP53_010237" "g.7576876C>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7576876_C_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749862" "1" "50" "17" "7576893" "7576893" "subst" "0" "04020" "TP53_010238" "g.7576893G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7576893_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749863" "1" "50" "17" "7576902" "7576902" "subst" "0" "04020" "TP53_010242" "g.7576902G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7576902_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749864" "1" "50" "17" "7576921" "7576921" "subst" "0" "04020" "TP53_010244" "g.7576921G>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7576921_G_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749865" "1" "50" "17" "7576924" "7576924" "subst" "0" "04020" "TP53_010245" "g.7576924G>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7576924_G_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749866" "1" "50" "17" "7577022" "7577022" "subst" "0" "04020" "TP53_010034" "g.7577022G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577022_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749867" "1" "50" "17" "7577052" "7577052" "subst" "0" "04020" "TP53_010252" "g.7577052G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577052_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749868" "1" "50" "17" "7577061" "7577061" "subst" "8.12137E-6" "04020" "TP53_010255" "g.7577061C>A" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577061_C_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749869" "1" "50" "17" "7577063" "7577063" "subst" "0" "04020" "TP53_010257" "g.7577063T>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577063_T_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749870" "1" "50" "17" "7577088" "7577088" "subst" "0" "04020" "TP53_010260" "g.7577088T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577088_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749871" "1" "50" "17" "7577091" "7577091" "subst" "4.06128E-6" "04020" "TP53_010261" "g.7577091G>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577091_G_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749872" "1" "50" "17" "7577093" "7577093" "subst" "4.06124E-6" "04020" "TP53_010155" "g.7577093C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577093_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749873" "1" "50" "17" "7577094" "7577094" "subst" "4.06177E-6" "04020" "TP53_010005" "g.7577094G>A" "5/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577094_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749874" "1" "50" "17" "7577094" "7577094" "subst" "0" "04020" "TP53_010263" "g.7577094G>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577094_G_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749875" "1" "50" "17" "7577095" "7577095" "subst" "0" "04020" "TP53_010264" "g.7577095G>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577095_G_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749876" "1" "50" "17" "7577099" "7577099" "subst" "0" "04020" "TP53_010187" "g.7577099C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577099_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749877" "1" "50" "17" "7577103" "7577103" "subst" "0" "04020" "TP53_010265" "g.7577103C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577103_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749878" "1" "50" "17" "7577115" "7577115" "subst" "0" "04020" "TP53_010266" "g.7577115A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577115_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749879" "1" "50" "17" "7577121" "7577121" "subst" "1.22115E-5" "04020" "TP53_010083" "g.7577121G>A" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577121_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749880" "1" "50" "17" "7577139" "7577139" "subst" "0" "04020" "TP53_010035" "g.7577139G>A" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577139_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749881" "1" "50" "17" "7577153" "7577153" "subst" "0" "04020" "TP53_010268" "g.7577153C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577153_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749882" "1" "50" "17" "7577155" "7577155" "subst" "0" "04020" "TP53_010269" "g.7577155A>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577155_A_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749883" "1" "50" "17" "7577509" "7577509" "subst" "0" "04020" "TP53_010270" "g.7577509C>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577509_C_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749884" "1" "50" "17" "7577538" "7577538" "subst" "2.03047E-5" "04020" "TP53_010015" "g.7577538C>T" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577538_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749885" "1" "50" "17" "7577539" "7577539" "subst" "4.06085E-6" "04020" "TP53_010008" "g.7577539G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577539_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749886" "1" "50" "17" "7577543" "7577543" "subst" "0" "04020" "TP53_010272" "g.7577543C>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577543_C_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749887" "1" "50" "17" "7577545" "7577545" "subst" "0" "04020" "TP53_010273" "g.7577545T>C" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577545_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749888" "1" "50" "17" "7577548" "7577548" "subst" "0" "04020" "TP53_010274" "g.7577548C>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577548_C_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749889" "1" "50" "17" "7577548" "7577548" "subst" "0" "04020" "TP53_010084" "g.7577548C>T" "6/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577548_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749890" "1" "50" "17" "7577551" "7577551" "subst" "0" "04020" "TP53_010001" "g.7577551C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577551_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749891" "1" "50" "17" "7577556" "7577556" "subst" "0" "04020" "TP53_010275" "g.7577556C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577556_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749892" "1" "50" "17" "7577568" "7577568" "subst" "0" "04020" "TP53_010058" "g.7577568C>T" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577568_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749893" "1" "50" "17" "7577571" "7577571" "subst" "0" "04020" "TP53_010276" "g.7577571A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577571_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749894" "1" "50" "17" "7577595" "7577595" "subst" "0" "04020" "TP53_010279" "g.7577595C>T" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577595_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749895" "1" "50" "17" "7578178" "7578178" "subst" "0" "04020" "TP53_010282" "g.7578178T>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578178_T_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749896" "1" "50" "17" "7578181" "7578181" "subst" "0" "04020" "TP53_010283" "g.7578181G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578181_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749897" "1" "50" "17" "7578184" "7578184" "subst" "1.21886E-5" "04020" "TP53_010284" "g.7578184G>A" "4/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578184_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749898" "1" "50" "17" "7578185" "7578185" "subst" "0" "04020" "TP53_010285" "g.7578185G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578185_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749899" "1" "50" "17" "7578202" "7578202" "subst" "0" "04020" "TP53_010010" "g.7578202A>C" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578202_A_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749900" "1" "50" "17" "7578205" "7578205" "subst" "0" "04020" "TP53_010289" "g.7578205C>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578205_C_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749901" "1" "50" "17" "7578211" "7578211" "subst" "0" "04020" "TP53_010037" "g.7578211C>T" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578211_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749902" "1" "50" "17" "7578220" "7578220" "subst" "0" "04020" "TP53_010291" "g.7578220T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578220_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749903" "1" "50" "17" "7578230" "7578230" "subst" "0" "04020" "TP53_010293" "g.7578230C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578230_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749904" "1" "50" "17" "7578242" "7578242" "subst" "0" "04020" "TP53_010295" "g.7578242C>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578242_C_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749905" "1" "50" "17" "7578260" "7578260" "subst" "0" "04020" "TP53_010298" "g.7578260C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578260_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749906" "1" "50" "17" "7578262" "7578262" "subst" "4.06068E-6" "04020" "TP53_010020" "g.7578262C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578262_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749907" "1" "50" "17" "7578263" "7578263" "subst" "4.06085E-6" "04020" "TP53_010012" "g.7578263G>A" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578263_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749908" "1" "50" "17" "7578265" "7578265" "subst" "0" "04020" "TP53_010179" "g.7578265A>G" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578265_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749909" "1" "50" "17" "7578271" "7578271" "subst" "0" "04020" "TP53_010299" "g.7578271T>C" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578271_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749910" "1" "50" "17" "7578283" "7578283" "subst" "0" "04020" "TP53_010303" "g.7578283G>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578283_G_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749911" "1" "50" "17" "7578374" "7578374" "subst" "8.12592E-6" "04020" "TP53_010095" "g.7578374C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578374_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749912" "1" "50" "17" "7578389" "7578389" "subst" "0" "04020" "TP53_010305" "g.7578389G>A" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578389_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749913" "1" "50" "17" "7578392" "7578392" "subst" "0" "04020" "TP53_010185" "g.7578392C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578392_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749914" "1" "50" "17" "7578393" "7578393" "subst" "0" "04020" "TP53_010306" "g.7578393A>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578393_A_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749915" "1" "50" "17" "7578400" "7578400" "subst" "4.06352E-6" "04020" "TP53_010096" "g.7578400G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578400_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749916" "1" "50" "17" "7578412" "7578412" "subst" "0" "04020" "TP53_010308" "g.7578412A>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578412_A_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749917" "1" "50" "17" "7578428" "7578428" "subst" "0" "04020" "TP53_010312" "g.7578428G>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578428_G_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749918" "1" "50" "17" "7578437" "7578437" "subst" "0" "04020" "TP53_010313" "g.7578437G>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578437_G_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749919" "1" "50" "17" "7578442" "7578442" "subst" "0" "04020" "TP53_010314" "g.7578442T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578442_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749920" "1" "50" "17" "7578448" "7578448" "subst" "0" "04020" "TP53_010315" "g.7578448G>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578448_G_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749921" "1" "50" "17" "7578455" "7578455" "subst" "0" "04020" "TP53_010316" "g.7578455C>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578455_C_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749922" "1" "50" "17" "7578457" "7578457" "subst" "0" "04020" "TP53_010317" "g.7578457C>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578457_C_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749923" "1" "50" "17" "7578458" "7578458" "subst" "8.12638E-6" "04020" "TP53_010318" "g.7578458G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578458_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749924" "1" "50" "17" "7578475" "7578475" "subst" "0" "04020" "TP53_010321" "g.7578475G>A" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578475_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749925" "1" "50" "17" "7578503" "7578503" "subst" "0" "04020" "TP53_010325" "g.7578503C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578503_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749926" "1" "50" "17" "7578506" "7578506" "subst" "0" "04020" "TP53_010326" "g.7578506G>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578506_G_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749927" "1" "50" "17" "7578508" "7578508" "subst" "0" "04020" "TP53_010327" "g.7578508C>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578508_C_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749928" "1" "50" "17" "7578509" "7578509" "subst" "0" "04020" "TP53_010328" "g.7578509A>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578509_A_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749929" "1" "50" "17" "7578517" "7578517" "subst" "0" "04020" "TP53_010329" "g.7578517G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578517_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749930" "1" "50" "17" "7578522" "7578522" "subst" "0" "04020" "TP53_010330" "g.7578522T>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578522_T_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749931" "1" "50" "17" "7578523" "7578523" "subst" "0" "04020" "TP53_010331" "g.7578523T>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578523_T_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749932" "1" "50" "17" "7578528" "7578528" "subst" "0" "04020" "TP53_010332" "g.7578528A>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578528_A_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749933" "1" "50" "17" "7578541" "7578541" "subst" "0" "04020" "TP53_010333" "g.7578541A>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578541_A_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749934" "1" "50" "17" "7578542" "7578542" "subst" "0" "04020" "TP53_010334" "g.7578542G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578542_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749935" "1" "50" "17" "7578555" "7578555" "subst" "0" "04020" "TP53_010337" "g.7578555C>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578555_C_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749936" "1" "50" "17" "7579313" "7579313" "subst" "0" "04020" "TP53_010338" "g.7579313G>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579313_G_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749937" "1" "50" "17" "7579334" "7579334" "subst" "0" "04020" "TP53_010340" "g.7579334G>A" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579334_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749938" "1" "50" "17" "7579343" "7579343" "subst" "0" "04020" "TP53_010341" "g.7579343T>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579343_T_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749939" "1" "50" "17" "7579359" "7579359" "subst" "0" "04020" "TP53_010342" "g.7579359G>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579359_G_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749940" "1" "50" "17" "7579365" "7579365" "subst" "1.21884E-5" "04020" "TP53_010345" "g.7579365C>T" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579365_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749941" "1" "50" "17" "7579373" "7579373" "subst" "0" "04020" "TP53_010346" "g.7579373C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579373_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749942" "1" "50" "17" "7579374" "7579374" "subst" "0" "04020" "TP53_010347" "g.7579374C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579374_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749943" "1" "50" "17" "7579378" "7579378" "subst" "0" "04020" "TP53_010348" "g.7579378G>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579378_G_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749944" "1" "50" "17" "7579395" "7579395" "subst" "0" "04020" "TP53_010349" "g.7579395G>A" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579395_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749945" "1" "50" "17" "7579427" "7579427" "subst" "0" "04020" "TP53_010351" "g.7579427G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579427_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749946" "1" "50" "17" "7579431" "7579431" "subst" "0" "04020" "TP53_010353" "g.7579431C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579431_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749947" "1" "50" "17" "7579443" "7579443" "subst" "0" "04020" "TP53_010355" "g.7579443G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579443_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749948" "1" "50" "17" "7579463" "7579463" "subst" "0" "04020" "TP53_010356" "g.7579463G>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579463_G_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749949" "1" "50" "17" "7579466" "7579466" "subst" "8.12275E-6" "04020" "TP53_010357" "g.7579466G>A" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579466_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749950" "1" "50" "17" "7579499" "7579499" "subst" "1.21839E-5" "04020" "TP53_010362" "g.7579499G>A" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579499_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749951" "1" "50" "17" "7579506" "7579506" "subst" "0" "04020" "TP53_010364" "g.7579506C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579506_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749952" "1" "50" "17" "7579538" "7579538" "subst" "0" "04020" "TP53_010367" "g.7579538A>G" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579538_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749953" "1" "50" "17" "7579541" "7579541" "subst" "8.12334E-6" "04020" "TP53_010368" "g.7579541T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579541_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749954" "1" "50" "17" "7579555" "7579555" "subst" "0" "04020" "TP53_010370" "g.7579555C>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579555_C_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749955" "1" "50" "17" "7579710" "7579710" "subst" "0" "04020" "TP53_010371" "g.7579710T>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579710_T_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000749956" "1" "50" "17" "7579717" "7579717" "subst" "0" "04020" "TP53_010372" "g.7579717G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579717_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754721" "1" "50" "17" "7572946" "7572946" "subst" "0" "04020" "TP53_010203" "g.7572946T>G" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7572946_T_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754722" "1" "50" "17" "7572949" "7572949" "subst" "4.06058E-6" "04020" "TP53_010204" "g.7572949G>C" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7572949_G_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754723" "1" "50" "17" "7572974" "7572974" "subst" "4.0618E-6" "04020" "TP53_010208" "g.7572974G>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7572974_G_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754724" "1" "50" "17" "7572979" "7572979" "subst" "0" "04020" "TP53_010209" "g.7572979G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7572979_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754725" "1" "50" "17" "7573007" "7573007" "subst" "0" "04020" "TP53_010213" "g.7573007G>A" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7573007_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754726" "1" "50" "17" "7573931" "7573931" "subst" "5.7301E-5" "04020" "TP53_010030" "g.7573931A>C" "14/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7573931_A_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754727" "1" "50" "17" "7573948" "7573948" "subst" "6.11556E-5" "04020" "TP53_010067" "g.7573948C>A" "9/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7573948_C_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754728" "1" "50" "17" "7573948" "7573948" "subst" "0.000183467" "04020" "TP53_010218" "g.7573948C>G" "10/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7573948_C_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754729" "1" "50" "17" "7573949" "7573949" "subst" "4.07667E-6" "04020" "TP53_010219" "g.7573949C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7573949_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754730" "1" "50" "17" "7573954" "7573954" "subst" "2.03651E-5" "04020" "TP53_010220" "g.7573954T>A" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7573954_T_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754731" "1" "50" "17" "7573967" "7573967" "subst" "1.22112E-5" "04020" "TP53_010222" "g.7573967G>T" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7573967_G_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754732" "1" "50" "17" "7574003" "7574003" "subst" "0" "04020" "TP53_010228" "g.7574003G>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7574003_G_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754733" "1" "50" "17" "7574012" "7574012" "subst" "6.51111E-5" "04020" "TP53_010025" "g.7574012C>T" "5/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7574012_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754734" "1" "50" "17" "7574017" "7574017" "subst" "8.1408E-6" "04020" "TP53_010069" "g.7574017C>T" "4/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7574017_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754735" "1" "50" "17" "7574029" "7574029" "subst" "3.66757E-5" "04020" "TP53_010069" "g.7574029C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7574029_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754736" "1" "50" "17" "7574030" "7574030" "subst" "2.44565E-5" "04020" "TP53_010235" "g.7574030G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7574030_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754737" "1" "50" "17" "7576897" "7576897" "subst" "8.12117E-6" "04020" "TP53_010240" "g.7576897G>T" "5/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7576897_G_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754738" "1" "50" "17" "7576900" "7576900" "subst" "4.06062E-6" "04020" "TP53_010241" "g.7576900G>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7576900_G_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754739" "1" "50" "17" "7576911" "7576911" "subst" "6.49693E-5" "04020" "TP53_010033" "g.7576911G>C" "6/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7576911_G_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754740" "1" "50" "17" "7577046" "7577046" "subst" "1.21819E-5" "04020" "TP53_010249" "g.7577046C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577046_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754741" "1" "50" "17" "7577054" "7577054" "subst" "1.62423E-5" "04020" "TP53_010253" "g.7577054G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577054_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754742" "1" "50" "17" "7577091" "7577091" "subst" "8.12255E-5" "04020" "TP53_010002" "g.7577091G>A" "10/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577091_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754743" "1" "50" "17" "7577093" "7577093" "subst" "0" "04020" "TP53_010262" "g.7577093C>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577093_C_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754744" "1" "50" "17" "7577120" "7577120" "subst" "1.62689E-5" "04020" "TP53_010081" "g.7577120C>T" "7/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577120_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754745" "1" "50" "17" "7577151" "7577151" "subst" "0.000116063" "04020" "TP53_010267" "g.7577151T>C" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577151_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754746" "1" "50" "17" "7577521" "7577521" "subst" "1.21825E-5" "04020" "TP53_010271" "g.7577521T>C" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577521_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754747" "1" "50" "17" "7577577" "7577577" "subst" "0.000190854" "04020" "TP53_010019" "g.7577577T>C" "45/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577577_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754748" "1" "50" "17" "7578188" "7578188" "subst" "4.06213E-6" "04020" "TP53_010286" "g.7578188C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578188_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754749" "1" "50" "17" "7578190" "7578190" "subst" "8.12354E-6" "04020" "TP53_010287" "g.7578190T>C" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578190_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754750" "1" "50" "17" "7578203" "7578203" "subst" "0" "04020" "TP53_010288" "g.7578203C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578203_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754751" "1" "50" "17" "7578207" "7578207" "subst" "3.2487E-5" "04020" "TP53_010290" "g.7578207A>C" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578207_A_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754752" "1" "50" "17" "7578245" "7578245" "subst" "2.43645E-5" "04020" "TP53_010297" "g.7578245G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578245_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754753" "1" "50" "17" "7578283" "7578283" "subst" "2.43665E-5" "04020" "TP53_010093" "g.7578283G>A" "5/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578283_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754754" "1" "50" "17" "7578372" "7578372" "subst" "4.06263E-6" "04020" "TP53_010094" "g.7578372A>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578372_A_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754755" "1" "50" "17" "7578376" "7578376" "subst" "4.06283E-6" "04020" "TP53_010304" "g.7578376C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578376_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754756" "1" "50" "17" "7578388" "7578388" "subst" "1.21893E-5" "04020" "TP53_010196" "g.7578388C>T" "5/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578388_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754757" "1" "50" "17" "7578406" "7578406" "subst" "4.06392E-6" "04020" "TP53_010013" "g.7578406C>T" "4/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578406_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754758" "1" "50" "17" "7578407" "7578407" "subst" "2.03191E-5" "04020" "TP53_010307" "g.7578407G>A" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578407_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754759" "1" "50" "17" "7578421" "7578421" "subst" "4.46936E-5" "04020" "TP53_010310" "g.7578421G>A" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578421_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754760" "1" "50" "17" "7578463" "7578463" "subst" "2.03161E-5" "04020" "TP53_010101" "g.7578463C>T" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578463_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754761" "1" "50" "17" "7578464" "7578464" "subst" "4.06303E-6" "04020" "TP53_010319" "g.7578464G>A" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578464_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754762" "1" "50" "17" "7578470" "7578470" "subst" "0" "04020" "TP53_010102" "g.7578470C>T" "4/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578470_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754763" "1" "50" "17" "7578548" "7578548" "subst" "0" "04020" "TP53_010336" "g.7578548G>T" "9/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578548_G_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754764" "1" "50" "17" "7579358" "7579358" "subst" "4.8765E-5" "04020" "TP53_010045" "g.7579358C>T" "7/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579358_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754765" "1" "50" "17" "7579359" "7579359" "subst" "2.03173E-5" "04020" "TP53_010343" "g.7579359G>A" "5/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579359_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754766" "1" "50" "17" "7579442" "7579442" "subst" "2.03108E-5" "04020" "TP53_010022" "g.7579442G>A" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579442_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754767" "1" "50" "17" "7579473" "7579473" "subst" "1.21841E-5" "04020" "TP53_010112" "g.7579473G>C" "6/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579473_G_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754768" "1" "50" "17" "7579548" "7579548" "subst" "0.00119016" "04020" "TP53_010024" "g.7579548G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579548_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754769" "1" "50" "17" "7579705" "7579705" "subst" "0.000224827" "04020" "TP53_010118" "g.7579705C>T" "55/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579705_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754770" "1" "50" "17" "7579882" "7579882" "subst" "4.88715E-5" "04020" "TP53_010119" "g.7579882C>G" "16/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579882_C_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754771" "1" "50" "17" "7579885" "7579885" "subst" "3.2577E-5" "04020" "TP53_010121" "g.7579885C>T" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579885_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000754772" "1" "50" "17" "7579899" "7579899" "subst" "1.22214E-5" "04020" "TP53_010375" "g.7579899T>C" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579899_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759495" "1" "50" "17" "7572946" "7572946" "subst" "0" "04020" "TP53_010203" "g.7572946T>G" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7572946_T_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759496" "1" "50" "17" "7572949" "7572949" "subst" "4.06058E-6" "04020" "TP53_010204" "g.7572949G>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7572949_G_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759497" "1" "50" "17" "7572974" "7572974" "subst" "4.0618E-6" "04020" "TP53_010208" "g.7572974G>T" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7572974_G_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759498" "1" "50" "17" "7572979" "7572979" "subst" "0" "04020" "TP53_010209" "g.7572979G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7572979_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759499" "1" "50" "17" "7573007" "7573007" "subst" "0" "04020" "TP53_010213" "g.7573007G>A" "6/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7573007_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759500" "1" "50" "17" "7573931" "7573931" "subst" "5.7301E-5" "04020" "TP53_010030" "g.7573931A>C" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7573931_A_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759501" "1" "50" "17" "7573948" "7573948" "subst" "6.11556E-5" "04020" "TP53_010067" "g.7573948C>A" "6/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7573948_C_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759502" "1" "50" "17" "7573948" "7573948" "subst" "0.000183467" "04020" "TP53_010218" "g.7573948C>G" "14/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7573948_C_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759503" "1" "50" "17" "7573949" "7573949" "subst" "4.07667E-6" "04020" "TP53_010219" "g.7573949C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7573949_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759504" "1" "50" "17" "7573954" "7573954" "subst" "2.03651E-5" "04020" "TP53_010220" "g.7573954T>A" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7573954_T_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759505" "1" "50" "17" "7573967" "7573967" "subst" "1.22112E-5" "04020" "TP53_010222" "g.7573967G>T" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7573967_G_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759506" "1" "50" "17" "7574003" "7574003" "subst" "0" "04020" "TP53_010228" "g.7574003G>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7574003_G_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759507" "1" "50" "17" "7574012" "7574012" "subst" "6.51111E-5" "04020" "TP53_010025" "g.7574012C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7574012_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759508" "1" "50" "17" "7574017" "7574017" "subst" "8.1408E-6" "04020" "TP53_010069" "g.7574017C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7574017_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759509" "1" "50" "17" "7574029" "7574029" "subst" "3.66757E-5" "04020" "TP53_010069" "g.7574029C>T" "4/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7574029_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759510" "1" "50" "17" "7574030" "7574030" "subst" "2.44565E-5" "04020" "TP53_010235" "g.7574030G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7574030_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759511" "1" "50" "17" "7576897" "7576897" "subst" "8.12117E-6" "04020" "TP53_010240" "g.7576897G>T" "4/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7576897_G_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759512" "1" "50" "17" "7576900" "7576900" "subst" "4.06062E-6" "04020" "TP53_010241" "g.7576900G>T" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7576900_G_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759513" "1" "50" "17" "7576911" "7576911" "subst" "6.49693E-5" "04020" "TP53_010033" "g.7576911G>C" "7/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7576911_G_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759514" "1" "50" "17" "7577046" "7577046" "subst" "1.21819E-5" "04020" "TP53_010249" "g.7577046C>T" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577046_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759515" "1" "50" "17" "7577054" "7577054" "subst" "1.62423E-5" "04020" "TP53_010253" "g.7577054G>A" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577054_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759516" "1" "50" "17" "7577091" "7577091" "subst" "8.12255E-5" "04020" "TP53_010002" "g.7577091G>A" "15/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577091_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759517" "1" "50" "17" "7577093" "7577093" "subst" "0" "04020" "TP53_010262" "g.7577093C>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577093_C_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759518" "1" "50" "17" "7577120" "7577120" "subst" "1.62689E-5" "04020" "TP53_010081" "g.7577120C>T" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577120_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759519" "1" "50" "17" "7577151" "7577151" "subst" "0.000116063" "04020" "TP53_010267" "g.7577151T>C" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577151_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759520" "1" "50" "17" "7577521" "7577521" "subst" "1.21825E-5" "04020" "TP53_010271" "g.7577521T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577521_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759521" "1" "50" "17" "7577577" "7577577" "subst" "0.000190854" "04020" "TP53_010019" "g.7577577T>C" "36/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7577577_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759522" "1" "50" "17" "7578188" "7578188" "subst" "4.06213E-6" "04020" "TP53_010286" "g.7578188C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578188_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759523" "1" "50" "17" "7578190" "7578190" "subst" "8.12354E-6" "04020" "TP53_010287" "g.7578190T>C" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578190_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759524" "1" "50" "17" "7578203" "7578203" "subst" "0" "04020" "TP53_010288" "g.7578203C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578203_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759525" "1" "50" "17" "7578207" "7578207" "subst" "3.2487E-5" "04020" "TP53_010290" "g.7578207A>C" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578207_A_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759526" "1" "50" "17" "7578245" "7578245" "subst" "2.43645E-5" "04020" "TP53_010297" "g.7578245G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578245_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759527" "1" "50" "17" "7578283" "7578283" "subst" "2.43665E-5" "04020" "TP53_010093" "g.7578283G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578283_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759528" "1" "50" "17" "7578372" "7578372" "subst" "4.06263E-6" "04020" "TP53_010094" "g.7578372A>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578372_A_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759529" "1" "50" "17" "7578376" "7578376" "subst" "4.06283E-6" "04020" "TP53_010304" "g.7578376C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578376_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759530" "1" "50" "17" "7578388" "7578388" "subst" "1.21893E-5" "04020" "TP53_010196" "g.7578388C>T" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578388_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759531" "1" "50" "17" "7578406" "7578406" "subst" "4.06392E-6" "04020" "TP53_010013" "g.7578406C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578406_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759532" "1" "50" "17" "7578407" "7578407" "subst" "2.03191E-5" "04020" "TP53_010307" "g.7578407G>A" "4/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578407_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759533" "1" "50" "17" "7578421" "7578421" "subst" "4.46936E-5" "04020" "TP53_010310" "g.7578421G>A" "4/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578421_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759534" "1" "50" "17" "7578463" "7578463" "subst" "2.03161E-5" "04020" "TP53_010101" "g.7578463C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578463_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759535" "1" "50" "17" "7578464" "7578464" "subst" "4.06303E-6" "04020" "TP53_010319" "g.7578464G>A" "4/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578464_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759536" "1" "50" "17" "7578470" "7578470" "subst" "0" "04020" "TP53_010102" "g.7578470C>T" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578470_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759537" "1" "50" "17" "7578548" "7578548" "subst" "0" "04020" "TP53_010336" "g.7578548G>T" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7578548_G_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759538" "1" "50" "17" "7579358" "7579358" "subst" "4.8765E-5" "04020" "TP53_010045" "g.7579358C>T" "5/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579358_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759539" "1" "50" "17" "7579359" "7579359" "subst" "2.03173E-5" "04020" "TP53_010343" "g.7579359G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579359_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759540" "1" "50" "17" "7579442" "7579442" "subst" "2.03108E-5" "04020" "TP53_010022" "g.7579442G>A" "4/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579442_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759541" "1" "50" "17" "7579473" "7579473" "subst" "1.21841E-5" "04020" "TP53_010112" "g.7579473G>C" "4/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579473_G_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759542" "1" "50" "17" "7579548" "7579548" "subst" "0.00119016" "04020" "TP53_010024" "g.7579548G>A" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579548_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759543" "1" "50" "17" "7579705" "7579705" "subst" "0.000224827" "04020" "TP53_010118" "g.7579705C>T" "41/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579705_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759544" "1" "50" "17" "7579882" "7579882" "subst" "4.88715E-5" "04020" "TP53_010119" "g.7579882C>G" "9/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579882_C_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759545" "1" "50" "17" "7579885" "7579885" "subst" "3.2577E-5" "04020" "TP53_010121" "g.7579885C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579885_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000759546" "1" "50" "17" "7579899" "7579899" "subst" "1.22214E-5" "04020" "TP53_010375" "g.7579899T>C" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr17_7579899_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" "" "0000789671" "0" "70" "17" "7578402" "7578402" "subst" "0" "00585" "TP53_010377" "g.7578402G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.7675084G>T" "" "likely pathogenic" "ACMG" "0000808268" "0" "50" "17" "7574029" "7574029" "subst" "3.66757E-5" "01804" "TP53_010069" "g.7574029C>T" "" "" "" "TP53(NM_000546.5):c.998G>A (p.(Arg333His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000808269" "0" "30" "17" "7577070" "7577070" "subst" "1.2182E-5" "02369" "TP53_010378" "g.7577070G>A" "" "" "" "TP53(NM_000546.5):c.868C>T (p.Arg290Cys)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000808270" "0" "10" "17" "7577407" "7577407" "subst" "0" "02369" "TP53_010016" "g.7577407A>C" "" "" "" "TP53(NM_000546.5):c.782+92T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000808271" "0" "10" "17" "7577427" "7577427" "subst" "0" "02369" "TP53_010014" "g.7577427G>A" "" "" "" "TP53(NM_000546.5):c.782+72C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000808272" "0" "10" "17" "7577577" "7577577" "subst" "0.000190854" "02329" "TP53_010019" "g.7577577T>C" "" "" "" "TP53(NM_000546.6):c.704A>G (p.N235S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000808273" "0" "10" "17" "7578115" "7578115" "subst" "0" "02369" "TP53_010379" "g.7578115T>C" "" "" "" "TP53(NM_000546.5):c.672+62A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000808274" "0" "90" "17" "7578212" "7578212" "subst" "0" "02327" "TP53_010380" "g.7578212G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000808275" "0" "30" "17" "7579256" "7579256" "subst" "0" "02369" "TP53_010381" "g.7579256G>A" "" "" "" "TP53(NM_000546.5):c.375+56C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000808276" "0" "70" "17" "7579313" "7579313" "subst" "0" "02327" "TP53_010382" "g.7579313G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000808277" "0" "10" "17" "7579472" "7579472" "subst" "0.668584" "02326" "TP53_010049" "g.7579472G>C" "" "" "" "TP53(NM_000546.5):c.215C>G (p.P72R, p.Pro72Arg), TP53(NM_000546.6):c.215C>G (p.(Pro72Arg), p.P72R), TP53(NM_001126114.3):c.215C>G (p.P72R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000808278" "0" "90" "17" "7579717" "7579717" "del" "0" "02369" "TP53_010383" "g.7579717del" "" "" "" "TP53(NM_000546.5):c.80delC (p.Pro27Leufs*17)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000808279" "0" "30" "17" "7592929" "7592929" "subst" "0" "01943" "TP53_010384" "g.7592929C>T" "" "" "" "WRAP53(NM_018081.2):c.552C>T (p.I184=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000808280" "0" "30" "17" "7606723" "7606723" "subst" "0.00179117" "02326" "WRAP53_000016" "g.7606723G>A" "" "" "" "WRAP53(NM_001143990.1):c.1566G>A (p.(Ala522=)), WRAP53(NM_018081.2):c.1566G>A (p.A522=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000833858" "1" "90" "17" "7578277" "7578278" "del" "0" "00006" "TP53_010391" "g.7578277_7578278del" "" "{PMID:Evans 2022:33758026}" "" "" "" "Germline" "" "" "0" "" "" "g.7674959_7674960del" "" "pathogenic (dominant)" "ACMG" "0000833859" "1" "90" "17" "7576852" "7576852" "subst" "0" "00006" "TP53_010385" "g.7576852C>T" "" "{PMID:Evans 2022:33758026}" "" "" "" "Germline" "" "" "0" "" "" "g.7673534C>T" "" "pathogenic (dominant)" "ACMG" "0000833860" "1" "90" "17" "7578406" "7578406" "subst" "4.06392E-6" "00006" "TP53_010013" "g.7578406C>T" "" "{PMID:Evans 2022:33758026}" "" "" "" "Germline" "" "" "0" "" "" "g.7675088C>T" "" "pathogenic (dominant)" "ACMG" "0000833861" "1" "90" "17" "7576897" "7576897" "subst" "0" "00006" "TP53_010386" "g.7576897G>A" "" "{PMID:Evans 2022:33758026}" "" "" "" "Germline" "" "" "0" "" "" "g.7673579G>A" "" "pathogenic (dominant)" "ACMG" "0000833862" "1" "90" "17" "7577539" "7577539" "subst" "4.06085E-6" "00006" "TP53_010008" "g.7577539G>A" "" "{PMID:Evans 2022:33758026}" "" "" "" "Germline" "" "" "0" "" "" "g.7674221G>A" "" "pathogenic (dominant)" "ACMG" "0000833863" "1" "90" "17" "7577551" "7577551" "subst" "0" "00006" "TP53_010001" "g.7577551C>T" "" "{PMID:Evans 2022:33758026}" "" "" "" "Germline" "" "" "0" "" "" "g.7674233C>T" "" "pathogenic (dominant)" "ACMG" "0000833864" "1" "90" "17" "7578211" "7578211" "subst" "0" "00006" "TP53_010037" "g.7578211C>T" "" "{PMID:Evans 2022:33758026}" "" "" "" "Germline" "" "" "0" "" "" "g.7674893C>T" "" "pathogenic (dominant)" "ACMG" "0000833973" "1" "90" "17" "7577120" "7577120" "subst" "1.62689E-5" "00006" "TP53_010081" "g.7577120C>T" "" "{PMID:Evans 2022:33758026}" "" "" "" "Germline" "" "" "0" "" "" "g.7673802C>T" "" "pathogenic (dominant)" "ACMG" "0000833974" "1" "90" "17" "7578190" "7578190" "subst" "8.12354E-6" "00006" "TP53_010287" "g.7578190T>C" "" "{PMID:Evans 2022:33758026}" "" "" "" "Germline" "" "" "0" "" "" "g.7674872T>C" "" "pathogenic (dominant)" "ACMG" "0000833975" "1" "90" "17" "7577120" "7577120" "subst" "1.62689E-5" "00006" "TP53_010081" "g.7577120C>T" "" "{PMID:Evans 2022:33758026}" "" "" "" "Germline" "" "" "0" "" "" "g.7673802C>T" "" "pathogenic (dominant)" "ACMG" "0000833976" "1" "90" "17" "7578275" "7578275" "subst" "0" "00006" "TP53_010390" "g.7578275G>A" "" "{PMID:Evans 2022:33758026}" "" "" "" "Germline" "" "" "0" "" "" "g.7674957G>A" "" "pathogenic (dominant)" "ACMG" "0000833977" "1" "90" "17" "7578190" "7578190" "subst" "8.12354E-6" "00006" "TP53_010287" "g.7578190T>C" "" "{PMID:Evans 2022:33758026}" "" "" "" "Germline" "" "" "0" "" "" "g.7674872T>C" "" "pathogenic (dominant)" "ACMG" "0000833978" "1" "90" "17" "7579312" "7579312" "subst" "0" "00006" "TP53_010392" "g.7579312C>A" "" "{PMID:Evans 2022:33758026}" "" "" "" "Germline" "" "" "0" "" "" "g.7675994C>A" "" "pathogenic (dominant)" "ACMG" "0000833979" "1" "90" "17" "7574018" "7574018" "subst" "0" "00006" "TP53_010232" "g.7574018G>A" "" "{PMID:Evans 2022:33758026}" "" "" "" "Germline" "" "" "0" "" "" "g.7670700G>A" "" "pathogenic (dominant)" "ACMG" "0000833980" "1" "90" "17" "7577538" "7577538" "subst" "2.03047E-5" "00006" "TP53_010015" "g.7577538C>T" "" "{PMID:Evans 2022:33758026}" "" "" "" "Germline" "" "" "0" "" "" "g.7674220C>T" "" "pathogenic (dominant)" "ACMG" "0000833981" "1" "90" "17" "7578406" "7578406" "subst" "4.06392E-6" "00006" "TP53_010013" "g.7578406C>T" "" "{PMID:Evans 2022:33758026}" "" "" "" "Germline" "" "" "0" "" "" "g.7675088C>T" "" "pathogenic (dominant)" "ACMG" "0000833982" "1" "90" "17" "7577018" "7577018" "subst" "0" "00006" "TP53_010387" "g.7577018C>T" "" "{PMID:Evans 2022:33758026}" "" "" "" "Germline" "" "" "0" "" "" "g.7673700C>T" "" "pathogenic (dominant)" "ACMG" "0000833983" "1" "70" "17" "7577106" "7577106" "subst" "0" "00006" "TP53_010389" "g.7577106G>A" "" "{PMID:Evans 2022:33758026}" "" "" "" "Germline" "" "" "0" "" "" "g.7673788G>A" "" "likely pathogenic (dominant)" "ACMG" "0000833984" "1" "90" "17" "7577022" "7577022" "subst" "0" "00006" "TP53_010034" "g.7577022G>A" "" "{PMID:Evans 2022:33758026}" "" "" "" "Germline" "" "" "0" "" "" "g.7673704G>A" "" "pathogenic (dominant)" "ACMG" "0000833985" "1" "90" "17" "7577022" "7577022" "subst" "0" "00006" "TP53_010034" "g.7577022G>A" "" "{PMID:Evans 2022:33758026}" "" "" "" "Germline" "" "" "0" "" "" "g.7673704G>A" "" "pathogenic (dominant)" "ACMG" "0000833986" "1" "90" "17" "7577548" "7577548" "subst" "0" "00006" "TP53_010084" "g.7577548C>T" "" "{PMID:Evans 2022:33758026}" "" "" "" "Germline" "" "" "0" "" "" "g.7674230C>T" "" "pathogenic (dominant)" "ACMG" "0000833987" "1" "90" "17" "7577033" "7577046" "del" "0" "00006" "TP53_010388" "g.7577033_7577046del" "" "{PMID:Evans 2022:33758026}" "" "" "" "Germline" "" "" "0" "" "" "g.7673715_7673728del" "" "pathogenic (dominant)" "ACMG" "0000845120" "0" "50" "17" "7579705" "7579705" "subst" "0.000224827" "00006" "TP53_010118" "g.7579705C>T" ">1/309 cases" "{PMID:Jiang 2022:33563768}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.7676387C>T" "" "VUS" "" "0000855119" "0" "70" "17" "7578203" "7578203" "subst" "0" "02327" "TP53_010288" "g.7578203C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000855120" "0" "50" "17" "7579792" "7579792" "subst" "0" "02369" "TP53_010394" "g.7579792G>A" "" "" "" "TP53(NM_000546.5):c.74+47C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000865513" "0" "50" "17" "7576626" "7576626" "subst" "2.32582E-5" "01804" "TP53_010056" "g.7576626T>G" "" "" "" "TP53(NM_001126113.2):c.994-42A>C (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000865514" "0" "30" "17" "7576841" "7576841" "subst" "0.0110245" "01804" "TP53_010057" "g.7576841A>G" "" "" "" "TP53(NM_000546.5):c.993+12T>C (p.(=)), TP53(NM_000546.6):c.993+12T>C, TP53(NM_001126114.2):c.993+12T>C, TP53(NM_001126114.3):c.993+12T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000865515" "0" "50" "17" "7578407" "7578407" "subst" "2.03191E-5" "01804" "TP53_010307" "g.7578407G>A" "" "" "" "TP53(NM_000546.5):c.523C>T (p.(Arg175Cys)), TP53(NM_000546.6):c.523C>T (p.R175C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000865516" "0" "70" "17" "7578461" "7578461" "subst" "0" "02327" "TP53_010393" "g.7578461C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000865517" "0" "30" "17" "7606350" "7606350" "subst" "0.0144527" "01804" "WRAP53_000021" "g.7606350T>C" "" "" "" "WRAP53(NM_001143990.1):c.1308T>C (p.(Ala436=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000865518" "0" "30" "17" "7606723" "7606723" "subst" "0.00179117" "01804" "WRAP53_000016" "g.7606723G>A" "" "" "" "WRAP53(NM_001143990.1):c.1566G>A (p.(Ala522=)), WRAP53(NM_018081.2):c.1566G>A (p.A522=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000869100" "2" "70" "17" "7577093" "7577093" "subst" "4.06124E-6" "00006" "TP53_010155" "g.7577093C>T" "" "{PMID:Schuermans 2022:35606766}" "" "" "ACMG PM1, PM2, PM5, PP2, PP3" "Germline" "" "" "0" "" "" "g.7673775C>T" "" "likely pathogenic (recessive)" "" "0000877182" "0" "50" "17" "7576540" "7576540" "subst" "0.000108928" "03779" "TP53_010395" "g.7576540C>T" "" "" "" "" "" "CLASSIFICATION record" "" "rs372821099" "0" "" "" "" "" "VUS" "" "0000894301" "0" "90" "17" "7574035" "7574035" "subst" "0" "02329" "TP53_010153" "g.7574035T>C" "" "" "" "TP53(NM_000546.6):c.994-2A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000894302" "0" "90" "17" "7577094" "7577094" "subst" "4.06177E-6" "02329" "TP53_010005" "g.7577094G>A" "" "" "" "TP53(NM_000546.6):c.844C>T (p.R282W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000894303" "0" "70" "17" "7577139" "7577139" "subst" "0" "02327" "TP53_010035" "g.7577139G>A" "" "" "" "TP53(NM_000546.5):c.799C>T (p.Arg267Trp)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000894304" "0" "90" "17" "7577538" "7577538" "subst" "2.03047E-5" "02327" "TP53_010015" "g.7577538C>T" "" "" "" "TP53(NM_000546.5):c.743G>A (p.R248Q), TP53(NM_000546.6):c.743G>A (p.R248Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000894305" "0" "10" "17" "7578159" "7578159" "subst" "0.000330709" "02369" "TP53_010178" "g.7578159C>G" "" "" "" "TP53(NM_000546.5):c.672+18G>C (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000894306" "0" "70" "17" "7578262" "7578262" "subst" "0" "02327" "TP53_010396" "g.7578262C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000894307" "0" "90" "17" "7578406" "7578406" "subst" "4.06392E-6" "02326" "TP53_010013" "g.7578406C>T" "" "" "" "TP53(NM_000546.5):c.524G>A (p.Arg175His, p.R175H), TP53(NM_000546.6):c.524G>A (p.R175H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000894308" "0" "90" "17" "7579312" "7579312" "subst" "0" "02327" "TP53_010149" "g.7579312C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000894309" "0" "90" "17" "7579365" "7579366" "ins" "0" "02327" "TP53_010397" "g.7579365_7579366insTTTCC" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000894310" "0" "30" "17" "7592929" "7592929" "subst" "0" "02326" "TP53_010384" "g.7592929C>T" "" "" "" "WRAP53(NM_018081.2):c.552C>T (p.I184=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000894311" "0" "50" "17" "7606721" "7606721" "dup" "0" "02326" "EFNB3_000017" "g.7606721dup" "" "" "" "WRAP53(NM_001143992.2):c.1564dup (p.(Ala522GlyfsTer8)), WRAP53(NM_018081.2):c.1564dupG (p.A522Gfs*8)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000914978" "0" "30" "17" "7574050" "7574050" "subst" "0.000160016" "02369" "TP53_010398" "g.7574050G>A" "" "" "" "TP53(NM_000546.5):c.994-17C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000914979" "0" "90" "17" "7577141" "7577141" "subst" "0" "02327" "TP53_010399" "g.7577141C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000914980" "0" "50" "17" "7579349" "7579349" "subst" "0" "02327" "TP53_010400" "g.7579349A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000914981" "0" "70" "17" "7579355" "7579355" "subst" "0" "02327" "TP53_010401" "g.7579355A>G" "" "" "" "TP53(NM_000546.6):c.332T>C (p.L111P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000914982" "0" "70" "17" "7579355" "7579355" "subst" "0" "02329" "TP53_010401" "g.7579355A>G" "" "" "" "TP53(NM_000546.6):c.332T>C (p.L111P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000914983" "0" "30" "17" "7592373" "7592373" "subst" "0.00340617" "02326" "TP53_010402" "g.7592373C>G" "" "" "" "WRAP53(NM_018081.2):c.407C>G (p.P136R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000918151" "0" "90" "17" "7574017" "7574017" "subst" "8.1408E-6" "01082" "TP53_010069" "g.7574017C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.7670699C>T" "12379" "pathogenic (dominant)" "ACMG" "0000918610" "0" "90" "17" "7574017" "7574017" "subst" "8.1408E-6" "01082" "TP53_010069" "g.7574017C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.7670699C>T" "12379" "pathogenic (dominant)" "ACMG" "0000918613" "0" "70" "17" "7577120" "7577120" "subst" "1.62689E-5" "04467" "TP53_010081" "g.7577120C>T" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000918614" "0" "50" "17" "7579472" "7579472" "subst" "0.668584" "04467" "TP53_010049" "g.7579472G>C" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000920375" "0" "90" "17" "7574017" "7574017" "subst" "8.1408E-6" "01082" "TP53_010069" "g.7574017C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.7670699C>T" "12379" "pathogenic (dominant)" "ACMG" "0000920392" "0" "90" "17" "7574017" "7574017" "subst" "8.1408E-6" "01082" "TP53_010069" "g.7574017C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.7670699C>T" "12379" "pathogenic (dominant)" "ACMG" "0000920405" "0" "70" "17" "7579306" "7579306" "subst" "0" "03628" "TP53_010403" "g.7579306A>G" "" "{PMID:Butz 2023:37653074}" "" "" "" "Germline" "?" "" "0" "" "" "g.7675988A>G" "" "VUS" "other" "0000920407" "0" "70" "17" "7578556" "7578556" "dup" "0" "03628" "TP53_010164" "g.7578556dup" "" "{PMID:Butz 2023:37653074}" "" "376-2dupA" "" "Germline" "" "" "0" "" "" "g.7675238dup" "" "VUS" "other" "0000920417" "0" "50" "17" "7579717" "7579717" "subst" "0" "03628" "TP53_010404" "g.7579717G>T" "" "{PMID:Butz 2023:37653074}" "" "" "" "Germline" "" "" "0" "" "" "g.7676399G>T" "" "VUS" "other" "0000920418" "0" "90" "17" "7579592" "7579592" "subst" "0" "03628" "TP53_010405" "g.7579592T>G" "" "{PMID:Butz 2023:37653074}" "" "" "" "Germline" "" "" "0" "" "" "g.7676274T>G" "" "pathogenic" "ACMG" "0000920419" "0" "90" "17" "7579360" "7579366" "dup" "0" "03628" "TP53_010406" "g.7579360_7579366dup" "" "{PMID:Butz 2023:37653074}" "" "" "" "Germline" "" "" "0" "" "" "g.7676042_7676048dup" "" "likely pathogenic" "other" "0000920435" "0" "90" "17" "7578470" "7578470" "subst" "0" "03628" "TP53_010102" "g.7578470C>T" "" "{PMID:Butz 2023:37653074}" "" "" "" "Germline" "" "" "0" "" "" "g.7675152C>T" "" "pathogenic" "ACMG" "0000920436" "0" "90" "17" "7578464" "7578464" "subst" "4.06303E-6" "03628" "TP53_010319" "g.7578464G>A" "" "{PMID:Butz 2023:37653074}" "" "" "" "Germline" "" "" "0" "" "" "g.7675146G>A" "" "VUS" "other" "0000920483" "0" "90" "17" "7578457" "7578457" "subst" "4.06322E-6" "03628" "TP53_010162" "g.7578457C>T" "" "{PMID:Butz 2023:37653074}" "" "" "" "Germline" "" "" "0" "" "" "g.7675139C>T" "" "pathogenic" "other" "0000920484" "0" "90" "17" "7578437" "7578437" "subst" "0" "03628" "TP53_010098" "g.7578437G>A" "" "{PMID:Butz 2023:37653074}" "" "" "" "Germline" "" "" "0" "" "" "g.7675119G>A" "" "likely pathogenic" "other" "0000920485" "0" "90" "17" "7578394" "7578394" "subst" "0" "03628" "TP53_010407" "g.7578394T>A" "" "{PMID:Butz 2023:37653074}" "" "" "" "Germline" "" "" "0" "" "" "g.7675076T>A" "" "pathogenic" "other" "0000920486" "0" "70" "17" "7578260" "7578260" "subst" "0" "03628" "TP53_010408" "g.7578260C>G" "" "{PMID:Butz 2023:37653074}" "" "" "" "Germline" "" "" "0" "" "" "g.7674942C>G" "" "likely pathogenic" "other" "0000920487" "0" "90" "17" "7578235" "7578235" "subst" "0" "03628" "TP53_010409" "g.7578235T>C" "" "{PMID:Butz 2023:37653074}" "" "" "" "Germline" "" "" "0" "" "" "g.7674917T>C" "" "likely pathogenic" "other" "0000920488" "0" "90" "17" "7577538" "7577538" "subst" "2.03047E-5" "03628" "TP53_010015" "g.7577538C>T" "" "{PMID:Butz 2023:37653074}" "" "" "" "Germline" "" "" "0" "" "" "g.7674220C>T" "" "pathogenic" "other" "0000920495" "0" "90" "17" "7577520" "7577522" "del" "0" "03628" "TP53_010410" "g.7577520_7577522del" "" "{PMID:Butz 2023:37653074}" "" "" "" "Germline" "" "" "0" "" "" "g.7674202_7674204del" "" "likely pathogenic" "other" "0000920497" "0" "90" "17" "7577040" "7577040" "del" "0" "03628" "TP53_010411" "g.7577040del" "" "{PMID:Butz 2023:37653074}" "" "902delC" "" "Germline" "" "" "0" "" "" "g.7673722del" "" "likely pathogenic" "other" "0000926644" "0" "30" "17" "7577188" "7577188" "subst" "0.000158701" "02327" "TP53_010412" "g.7577188A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000926645" "0" "90" "17" "7577552" "7577552" "del" "0" "02327" "TP53_010413" "g.7577552del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000926646" "0" "30" "17" "7579728" "7579728" "subst" "0" "02369" "TP53_010414" "g.7579728G>A" "" "" "" "TP53(NM_000546.5):c.75-7C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000930890" "0" "90" "17" "7577142" "7577142" "subst" "0" "02327" "TP53_010415" "g.7577142C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000930891" "0" "30" "17" "7578420" "7578420" "subst" "0.000109699" "02329" "TP53_010039" "g.7578420C>T" "" "" "" "TP53(NM_000546.5):c.510G>A (p.Thr170=), TP53(NM_000546.6):c.510G>A (p.T170=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000930892" "0" "30" "17" "7579674" "7579674" "subst" "5.17652E-5" "02369" "TP53_010416" "g.7579674G>A" "" "" "" "TP53(NM_000546.5):c.96+26C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000951043" "0" "90" "17" "7574018" "7574018" "subst" "0" "02327" "TP53_010232" "g.7574018G>A" "" "" "" "TP53(NM_000546.5):c.1009C>T (p.(Arg337Cys)), TP53(NM_000546.6):c.1009C>T (p.R337C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000951044" "0" "90" "17" "7577120" "7577120" "subst" "1.62689E-5" "02369" "TP53_010081" "g.7577120C>T" "" "" "" "TP53(NM_000546.5):c.818G>A (p.(Arg273His), p.Arg273His)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000951045" "0" "90" "17" "7577538" "7577538" "subst" "2.03047E-5" "02329" "TP53_010015" "g.7577538C>T" "" "" "" "TP53(NM_000546.5):c.743G>A (p.R248Q), TP53(NM_000546.6):c.743G>A (p.R248Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000951046" "0" "90" "17" "7577539" "7577539" "subst" "4.06085E-6" "02329" "TP53_010008" "g.7577539G>A" "" "" "" "TP53(NM_000546.5):c.742C>T (p.Arg248Trp), TP53(NM_000546.6):c.742C>T (p.R248W), TP53(NM_001126114.3):c.742C>T (p.R248W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000951047" "0" "10" "17" "7579472" "7579472" "subst" "0.668584" "02329" "TP53_010049" "g.7579472G>C" "" "" "" "TP53(NM_000546.5):c.215C>G (p.P72R, p.Pro72Arg), TP53(NM_000546.6):c.215C>G (p.(Pro72Arg), p.P72R), TP53(NM_001126114.3):c.215C>G (p.P72R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000951048" "0" "30" "17" "7606650" "7606650" "subst" "4.06289E-6" "02326" "WRAP53_000013" "g.7606650T>C" "" "" "" "WRAP53(NM_018081.2):c.1493T>C (p.L498P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000951049" "0" "30" "17" "7606671" "7606671" "subst" "0.000300591" "02326" "EFNB3_000018" "g.7606671C>T" "" "" "" "WRAP53(NM_018081.2):c.1514C>T (p.T505M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000952123" "0" "90" "17" "7577100" "7577100" "subst" "0" "04599" "TP53_010417" "g.7577100T>C" "" "" "" "" "" "Germline" "" "rs753660142" "0" "" "" "g.7673782T>C" "376658" "pathogenic" "ACMG" "0000952124" "0" "90" "17" "7579373" "7579373" "subst" "0" "04599" "TP53_010418" "g.7579373C>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.7676055C>A" "634708" "pathogenic" "ACMG" "0000960047" "0" "90" "17" "7577538" "7577538" "subst" "2.03047E-5" "03628" "TP53_010015" "g.7577538C>T" "" "{PMID:Butz 2023:37653074}" "" "" "" "Germline" "" "" "0" "" "" "g.7674220C>T" "" "pathogenic" "other" "0000969238" "0" "30" "17" "7573897" "7573897" "subst" "0.00935205" "02329" "TP53_010029" "g.7573897T>A" "" "" "" "TP53(NM_000546.5):c.1100+30A>T, TP53(NM_000546.6):c.1100+30A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000969239" "0" "50" "17" "7574012" "7574012" "subst" "6.51111E-5" "02327" "TP53_010025" "g.7574012C>T" "" "" "" "TP53(NM_001126118.1):c.898G>A (p.E300K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000969240" "0" "50" "17" "7577138" "7577138" "subst" "1.22859E-5" "01804" "TP53_010018" "g.7577138C>T" "" "" "" "TP53(NM_000546.5):c.800G>A (p.(Arg267Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000969241" "0" "90" "17" "7578406" "7578406" "subst" "4.06392E-6" "02325" "TP53_010013" "g.7578406C>T" "" "" "" "TP53(NM_000546.5):c.524G>A (p.Arg175His, p.R175H), TP53(NM_000546.6):c.524G>A (p.R175H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000969242" "0" "30" "17" "7579432" "7579432" "subst" "3.65643E-5" "01804" "TP53_010047" "g.7579432A>G" "" "" "" "TP53(NM_000546.5):c.255T>C (p.(Pro85=)), TP53(NM_000546.6):c.255T>C (p.P85=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000982817" "0" "30" "17" "7572877" "7572877" "subst" "0" "02369" "TP53_010419" "g.7572877G>C" "" "" "" "TP53(NM_000546.5):c.*50C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000982818" "0" "90" "17" "7574003" "7574003" "subst" "0" "02369" "TP53_010151" "g.7574003G>A" "" "" "" "TP53(NM_000546.5):c.1024C>T (p.Arg342*), TP53(NM_001126118.2):c.907C>T (p.R303*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000982819" "0" "30" "17" "7576525" "7576540" "del" "0" "02369" "TP53_010420" "g.7576525_7576540del" "" "" "" "TP53(NM_000546.5):c.993+326_993+341delATTGTAAGTTGAAAAT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000982820" "0" "50" "17" "7577090" "7577090" "subst" "4.06101E-5" "01804" "TP53_010180" "g.7577090C>T" "" "" "" "TP53(NM_000546.6):c.848G>A (p.(Arg283His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000982821" "0" "70" "17" "7578395" "7578396" "delins" "0" "02369" "TP53_010421" "g.7578395_7578396delinsAA" "" "" "" "TP53(NM_000546.5):c.534_535delCCinsTT (p.His179Tyr)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000982822" "0" "50" "17" "7605066" "7605066" "subst" "4.87638E-5" "01804" "EFNB3_000019" "g.7605066C>T" "" "" "" "WRAP53(NM_001143992.2):c.914C>T (p.(Thr305Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000982823" "0" "50" "17" "7605838" "7605838" "subst" "2.87224E-5" "01804" "EFNB3_000020" "g.7605838G>A" "" "" "" "WRAP53(NM_001143992.2):c.1132G>A (p.(Asp378Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000982824" "0" "50" "17" "7606721" "7606721" "dup" "0" "01804" "EFNB3_000017" "g.7606721dup" "" "" "" "WRAP53(NM_001143992.2):c.1564dup (p.(Ala522GlyfsTer8)), WRAP53(NM_018081.2):c.1564dupG (p.A522Gfs*8)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000985169" "3" "90" "17" "7578210" "7578212" "delins" "0" "04685" "TP53_010422" "g.7578210_7578212delinsCCA" "" "" "" "" "" "Somatic" "" "" "0" "" "" "g.7674892_7674894delinsCCA" "" "pathogenic" "" "0000985182" "3" "90" "17" "7577485" "7577506" "delins" "0" "04685" "TP53_010423" "g.7577485_7577506delinsCACT" "" "" "" "" "" "Somatic" "" "" "0" "" "" "g.7674167_7674188delinsCACT" "" "likely pathogenic" "" "0001003714" "0" "10" "17" "7571752" "7571752" "subst" "0" "02327" "TP53_010424" "g.7571752T>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001003715" "0" "30" "17" "7577063" "7577063" "subst" "0" "02327" "TP53_010256" "g.7577063T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001003716" "0" "90" "17" "7577120" "7577120" "subst" "1.62689E-5" "01804" "TP53_010081" "g.7577120C>T" "" "" "" "TP53(NM_000546.5):c.818G>A (p.(Arg273His), p.Arg273His)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001003717" "0" "70" "17" "7577570" "7577570" "subst" "0" "02327" "TP53_010425" "g.7577570C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001003718" "0" "30" "17" "7578162" "7578162" "subst" "1.63047E-5" "02329" "TP53_010426" "g.7578162A>G" "" "" "" "TP53(NM_000546.6):c.672+15T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001003719" "0" "50" "17" "7578262" "7578262" "subst" "4.06068E-6" "01804" "TP53_010020" "g.7578262C>T" "" "" "" "TP53(NM_000546.5):c.587G>A (p.(Arg196Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001003720" "0" "50" "17" "7592072" "7592072" "subst" "4.06095E-6" "01804" "TP53_010427" "g.7592072G>A" "" "" "" "WRAP53(NM_001143992.1):c.106G>A (p.(Ala36Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001015619" "0" "90" "17" "7574018" "7574018" "subst" "0" "01804" "TP53_010232" "g.7574018G>A" "" "" "" "TP53(NM_000546.5):c.1009C>T (p.(Arg337Cys)), TP53(NM_000546.6):c.1009C>T (p.R337C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001015620" "0" "90" "17" "7574018" "7574018" "subst" "0" "02325" "TP53_010232" "g.7574018G>A" "" "" "" "TP53(NM_000546.5):c.1009C>T (p.(Arg337Cys)), TP53(NM_000546.6):c.1009C>T (p.R337C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001015621" "0" "90" "17" "7576879" "7576879" "del" "0" "02327" "TP53_010428" "g.7576879del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001015622" "0" "10" "17" "7576911" "7576911" "subst" "6.49693E-5" "02329" "TP53_010033" "g.7576911G>C" "" "" "" "TP53(NM_000546.5):c.935C>G (p.Thr312Ser), TP53(NM_000546.6):c.935C>G (p.T312S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001015623" "0" "90" "17" "7578190" "7578190" "subst" "8.12354E-6" "02327" "TP53_010287" "g.7578190T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001015624" "0" "90" "17" "7578235" "7578235" "subst" "0" "02369" "TP53_010409" "g.7578235T>C" "" "" "" "TP53(NM_000546.5):c.614A>G (p.Tyr205Cys)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001015625" "0" "50" "17" "7578407" "7578407" "subst" "2.03191E-5" "02329" "TP53_010307" "g.7578407G>A" "" "" "" "TP53(NM_000546.5):c.523C>T (p.(Arg175Cys)), TP53(NM_000546.6):c.523C>T (p.R175C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001015626" "0" "70" "17" "7578413" "7578413" "subst" "0" "02327" "TP53_010429" "g.7578413C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001015627" "0" "10" "17" "7579548" "7579548" "subst" "0.00119016" "02327" "TP53_010024" "g.7579548G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001016677" "0" "90" "17" "7579913" "4294967295" "del" "" "04749" "TP53_010430" "g.(7579913_?)del" "" "Yuen (unpublished)" "" "c.-?_-1del" "" "Germline" "" "" "0" "" "" "g.(7676595_?)del" "" "pathogenic" "" "0001027057" "0" "90" "17" "7577575" "7577575" "subst" "0" "02369" "TP53_010431" "g.7577575A>C" "" "" "" "TP53(NM_000546.5):c.706T>G (p.Tyr236Asp)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001027058" "0" "10" "17" "7578146" "7578146" "subst" "0.0072708" "02327" "TP53_010200" "g.7578146T>C" "" "" "" "TP53(NM_000546.5):c.672+31A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001027059" "0" "70" "17" "7578388" "7578388" "subst" "1.21893E-5" "02369" "TP53_010196" "g.7578388C>T" "" "" "" "TP53(NM_000546.5):c.542G>A (p.Arg181His)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001027060" "0" "90" "17" "7578479" "7578479" "subst" "0" "02369" "TP53_010432" "g.7578479G>A" "" "" "" "TP53(NM_000546.5):c.451C>T (p.Pro151Ser)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001027061" "0" "50" "17" "7578500" "7578502" "del" "0" "02369" "TP53_010433" "g.7578500_7578502del" "" "" "" "TP53(NM_000546.5):c.428_430delTGC (p.Val143_Gln144delinsGlu)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001027062" "0" "30" "17" "7579471" "7579471" "subst" "5.2797E-5" "02329" "TP53_010434" "g.7579471G>A" "" "" "" "TP53(NM_000546.6):c.216C>T (p.P72=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001027063" "0" "30" "17" "7579471" "7579472" "delins" "0" "02329" "TP53_010359" "g.7579471_7579472delinsAC" "" "" "" "TP53(NM_000546.6):c.215_216delCCinsGT (p.P72R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001027064" "0" "90" "17" "7579554" "7579557" "del" "0" "02369" "TP53_010435" "g.7579554_7579557del" "" "" "" "TP53(NM_000546.5):c.130_133delATGC (p.Met44Cysfs*78)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001029684" "0" "90" "17" "7578534" "7578534" "subst" "0" "03779" "TP53_010436" "g.7578534C>G" "" "" "" "" "" "CLASSIFICATION record" "" "rs866775781" "0" "" "" "" "" "pathogenic" "" "0001029752" "0" "90" "17" "7577114" "7577114" "subst" "0" "03779" "TP53_010181" "g.7577114C>T" "" "" "" "" "" "CLASSIFICATION record" "" "rs863224451" "0" "" "" "" "" "pathogenic" "" "0001029753" "0" "70" "17" "7578537" "7578538" "ins" "0" "03779" "TP53_010441" "g.7578537_7578538insC" "" "" "" "" "" "CLASSIFICATION record" "" "" "0" "" "" "" "" "likely pathogenic" "" "0001029757" "0" "90" "17" "7577610" "7577610" "subst" "0" "03779" "TP53_010440" "g.7577610T>A" "" "" "" "" "" "CLASSIFICATION record" "" "rs1555525585" "0" "" "" "" "" "pathogenic" "" "0001029761" "0" "90" "17" "7577534" "7577534" "subst" "0" "03779" "TP53_010439" "g.7577534C>A" "" "" "" "" "" "CLASSIFICATION record" "" "rs28934571" "0" "" "" "" "" "pathogenic" "" "0001029762" "0" "90" "17" "7579358" "7579358" "subst" "0" "03779" "TP53_010003" "g.7579358C>A" "" "" "" "" "" "CLASSIFICATION record" "" "rs11540654" "0" "" "" "" "" "pathogenic" "" "0001029763" "0" "90" "17" "7577532" "7577532" "subst" "0" "03779" "TP53_010438" "g.7577532G>A" "" "" "" "" "" "CLASSIFICATION record" "" "rs1064794311" "0" "" "" "" "" "pathogenic" "" "0001029764" "0" "70" "17" "7579460" "7579460" "del" "0" "03779" "TP53_010442" "g.7579460del" "" "" "" "" "" "CLASSIFICATION record" "" "" "0" "" "" "" "" "likely pathogenic" "" "0001029809" "0" "90" "17" "7577143" "7577143" "dup" "0" "03779" "TP53_010437" "g.7577143dup" "" "" "" "" "" "CLASSIFICATION record" "" "" "0" "" "" "" "" "pathogenic" "" "0001029859" "0" "70" "17" "7579312" "7579312" "subst" "0" "00006" "TP53_010392" "g.7579312C>A" "" "{PMID:Williams 1998:9510848}" "" "" "" "Germline" "" "" "0" "" "" "g.7675994C>A" "" "likely pathogenic (!)" "" "0001029860" "0" "70" "17" "7578556" "7578556" "subst" "0" "00006" "TP53_010443" "g.7578556T>C" "" "{PMID:Williams 1998:9510848}" "" "" "" "Germline" "" "" "0" "" "" "g.7675238T>C" "" "likely pathogenic (!)" "" "0001029896" "0" "90" "17" "7577094" "7577094" "subst" "4.06177E-6" "03779" "TP53_010005" "g.7577094G>A" "" "" "" "" "" "CLASSIFICATION record" "" "rs28934574" "0" "" "" "" "" "pathogenic" "" "0001030037" "0" "70" "17" "7578555" "7578555" "subst" "0" "03779" "TP53_010337" "g.7578555C>G" "" "" "" "" "" "Unknown" "" "rs868137297" "0" "" "" "" "" "likely pathogenic" "" "0001042203" "0" "10" "17" "7576630" "7576630" "subst" "0.000301004" "01804" "TP53_010444" "g.7576630A>C" "" "" "" "TP53(NM_001126114.3):c.1021T>G (p.(Cys341Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001042204" "0" "50" "17" "7579317" "7579317" "subst" "0" "02327" "TP53_010445" "g.7579317A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001042205" "0" "10" "17" "7579472" "7579472" "subst" "0.668584" "01804" "TP53_010049" "g.7579472G>C" "" "" "" "TP53(NM_000546.5):c.215C>G (p.P72R, p.Pro72Arg), TP53(NM_000546.6):c.215C>G (p.(Pro72Arg), p.P72R), TP53(NM_001126114.3):c.215C>G (p.P72R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001042206" "0" "30" "17" "7579706" "7579706" "subst" "8.17728E-6" "01804" "TP53_010119" "g.7579706G>A" "" "" "" "TP53(NM_001126118.2):c.-28C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001042207" "0" "50" "17" "7606071" "7606071" "subst" "0" "01804" "EFNB3_000021" "g.7606071T>A" "" "" "" "WRAP53(NM_001143992.2):c.1175T>A (p.(Leu392His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001045034" "0" "50" "17" "7574036" "7574036" "subst" "0" "03779" "TP53_010446" "g.7574036G>C" "" "" "" "" "" "Unknown" "" "rs2150995454" "0" "" "" "" "" "VUS" "" "0001045035" "0" "90" "17" "7577106" "7577106" "subst" "0" "03779" "TP53_010389" "g.7577106G>A" "" "" "" "" "" "Unknown" "" "rs17849781" "0" "" "" "" "" "pathogenic" "" "0001045036" "0" "90" "17" "7577550" "7577550" "subst" "0" "03779" "TP53_010085" "g.7577550C>T" "" "" "" "" "" "Unknown" "" "rs985033810" "0" "" "" "" "" "pathogenic" "" "0001045358" "0" "90" "17" "7577539" "7577539" "subst" "4.06085E-6" "03779" "TP53_010008" "g.7577539G>A" "" "" "" "" "" "Unknown" "" "rs121912651" "0" "" "" "" "" "pathogenic" "" "0001045473" "0" "90" "17" "7579413" "7579413" "del" "0" "03779" "TP53_010046" "g.7579413del" "" "" "" "" "" "Unknown" "" "rs1567556123" "0" "" "" "" "" "pathogenic" "" "0001046672" "0" "30" "17" "7574074" "7574074" "subst" "2.17033E-5" "02327" "TP53_010447" "g.7574074G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001046673" "0" "90" "17" "7577084" "7577084" "del" "0" "02327" "TP53_010448" "g.7577084del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001046674" "0" "90" "17" "7578211" "7578211" "subst" "0" "02325" "TP53_010037" "g.7578211C>T" "" "" "" "TP53(NM_000546.5):c.638G>A (p.Arg213Gln), TP53(NM_000546.6):c.638G>A (p.R213Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001047553" "0" "90" "17" "7577121" "7577121" "subst" "1.22115E-5" "03779" "TP53_010083" "g.7577121G>A" "" "" "" "" "" "Unknown" "" "rs121913343" "0" "" "" "" "" "pathogenic" "" "0001047982" "0" "50" "17" "7574003" "7574003" "subst" "0" "03779" "TP53_010228" "g.7574003G>C" "" "" "" "" "" "Unknown" "" "rs730882029" "0" "" "" "" "" "VUS" "" "0001048012" "0" "10" "17" "7577644" "7577644" "subst" "0.012238" "03779" "TP53_010157" "g.7577644C>G" "" "" "" "" "" "Unknown" "" "rs17880604" "0" "" "" "" "" "benign" "" "0001048016" "0" "90" "17" "7577570" "7577570" "subst" "4.06075E-6" "03779" "TP53_010183" "g.7577570C>T" "" "" "" "" "" "Unknown" "" "rs587782664" "0" "" "" "" "" "pathogenic" "" "0001048024" "0" "30" "17" "7574013" "7574013" "subst" "0.000256369" "03779" "TP53_010152" "g.7574013G>A" "" "" "" "" "" "Unknown" "" "rs150293825" "0" "" "" "" "" "likely benign" "" "0001048130" "0" "70" "17" "7579312" "7579312" "subst" "0" "03779" "TP53_010149" "g.7579312C>T" "" "" "" "" "" "Unknown" "" "rs55863639" "0" "" "" "" "" "likely pathogenic" "" "0001048150" "0" "90" "17" "7577105" "7577105" "subst" "0" "03779" "TP53_010449" "g.7577105G>A" "" "" "" "" "" "Unknown" "" "rs876659802" "0" "" "" "" "" "pathogenic" "" "0001048162" "0" "90" "17" "7578532" "7578532" "subst" "0" "03779" "TP53_010452" "g.7578532A>G" "" "" "" "" "" "Unknown" "" "rs28934873" "0" "" "" "" "" "pathogenic" "" "0001048163" "0" "70" "17" "7577524" "7577532" "del" "0" "03779" "TP53_010450" "g.7577524_7577532del" "" "" "" "" "" "Unknown" "" "rs2073243450" "0" "" "" "" "" "likely pathogenic" "" "0001048164" "0" "90" "17" "7579310" "7579310" "subst" "0" "03779" "TP53_010453" "g.7579310A>G" "" "" "" "" "" "Unknown" "" "rs1555526469" "0" "" "" "" "" "pathogenic" "" "0001048165" "0" "90" "17" "7578382" "7578382" "subst" "0" "03779" "TP53_010451" "g.7578382G>C" "" "" "" "" "" "Unknown" "" "rs1555525970" "0" "" "" "" "" "pathogenic" "" "0001049495" "0" "10" "17" "7573081" "7573081" "subst" "0" "03779" "TP53_010454" "g.7573081C>G" "" "" "" "" "" "Unknown" "" "rs17883043" "0" "" "" "" "" "benign" "" "0001055810" "0" "70" "17" "7573996" "7573996" "subst" "0" "02369" "TP53_010455" "g.7573996A>G" "" "" "" "TP53(NM_000546.6):c.1031T>C (p.Leu344Pro)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001055811" "0" "90" "17" "7577117" "7577117" "subst" "0" "02369" "TP53_010456" "g.7577117A>C" "" "" "" "TP53(NM_000546.6):c.821T>G (p.Val274Gly)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001055812" "0" "10" "17" "7577644" "7577644" "subst" "0.012238" "02369" "TP53_010157" "g.7577644C>G" "" "" "" "TP53(NM_000546.6):c.673-36G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001055813" "0" "90" "17" "7578431" "7578431" "subst" "0" "02369" "TP53_010457" "g.7578431G>A" "" "" "" "TP53(NM_000546.6):c.499C>T (p.Gln167Ter)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001055814" "0" "90" "17" "7578457" "7578457" "subst" "4.06322E-6" "01804" "TP53_010162" "g.7578457C>T" "" "" "" "TP53(NM_000546.5):c.473G>A (p.Arg158His), TP53(NM_000546.6):c.473G>A (p.(Arg158His), p.R158H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001055815" "0" "70" "17" "7578535" "7578535" "subst" "0" "02327" "TP53_010458" "g.7578535T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001055816" "0" "30" "17" "7579472" "7579472" "subst" "0" "02369" "TP53_010360" "g.7579472G>T" "" "" "" "TP53(NM_000546.6):c.215C>A (p.Pro72His)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001057754" "21" "90" "17" "7579373" "7579373" "subst" "0" "04265" "TP53_010418" "g.7579373C>A" "" "{PMID:Cherbal 2025:41232303}, {DOI:Cherbal 2025:10.1016/j.cancergen.2025.11.00}" "" "" "" "Germline" "yes" "rs587781504" "0" "" "" "g.7676055C>A" "" "likely pathogenic" "ACMG" "0001059744" "0" "30" "17" "7573096" "7573096" "subst" "0" "03779" "TP53_010459" "g.7573096C>T" "" "" "" "" "" "Unknown" "" "rs145723145" "0" "" "" "" "" "likely benign" "" "0001059751" "0" "10" "17" "7573384" "7573384" "subst" "0" "03779" "TP53_010460" "g.7573384G>A" "" "" "" "" "" "Unknown" "" "rs112847074" "0" "" "" "" "" "benign" "" "0001059756" "0" "70" "17" "7578271" "7578271" "subst" "0" "03779" "TP53_010147" "g.7578271T>A" "" "" "" "" "" "Unknown" "" "rs786201838" "0" "" "" "" "" "likely pathogenic" "" "0001060702" "0" "50" "17" "7578226" "7578226" "subst" "0" "00006" "TP53_010462" "g.7578226T>C" "" "{PMID:Wai 2020:32123317}" "" "" "no effect on splicing observed" "Germline" "" "rs1464727668" "0" "" "" "g.7674908T>C" "" "VUS" "" "0001060703" "0" "30" "17" "7577215" "7577215" "subst" "0" "00006" "TP53_010461" "g.7577215C>T" "" "{PMID:Wai 2020:32123317}" "" "" "no effect on splicing observed" "Germline" "" "" "0" "" "" "g.7673897C>T" "" "likely benign" "" "0001061009" "0" "10" "17" "7576348" "7576348" "subst" "0" "03779" "TP53_010463" "g.7576348C>T" "" "" "" "" "" "Unknown" "" "rs75732100" "0" "" "" "" "" "benign" "" "0001061952" "0" "90" "17" "7579719" "7579719" "del" "0" "03779" "TP53_010373" "g.7579719del" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0001062821" "0" "90" "17" "7577548" "7577548" "subst" "0" "03779" "TP53_010084" "g.7577548C>T" "" "" "" "" "" "Unknown" "" "rs28934575" "0" "" "" "" "" "pathogenic" "" "0001066616" "0" "50" "17" "7570318" "7570318" "subst" "0" "01804" "chr17_010898" "g.7570318G>T" "" "" "" "TP53(NM_000546.6):c.*2609C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001066617" "0" "90" "17" "7574034" "7574034" "subst" "0" "02327" "chr17_010899" "g.7574034C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001066618" "0" "50" "17" "7576626" "7576626" "subst" "2.32582E-5" "02325" "TP53_010056" "g.7576626T>G" "" "" "" "TP53(NM_001126113.2):c.994-42A>C (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001066619" "0" "90" "17" "7578275" "7578275" "subst" "0" "02325" "TP53_010390" "g.7578275G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001066620" "0" "70" "17" "7578388" "7578388" "subst" "1.21893E-5" "02325" "TP53_010196" "g.7578388C>T" "" "" "" "TP53(NM_000546.5):c.542G>A (p.Arg181His)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001066621" "0" "70" "17" "7578404" "7578404" "subst" "0" "02327" "chr17_010900" "g.7578404A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001066622" "0" "90" "17" "7579476" "7579476" "dup" "0" "02369" "TP53_010048" "g.7579476dup" "" "" "" "TP53(NM_000546.6):c.216dup (p.Val73ArgfsTer76), TP53(NM_000546.6):c.216dupC (p.V73Rfs*76)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes TP53 ## Count = 876 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000021759" "00021656" "55" "730" "0" "730" "0" "c.730G>A" "r.(?)" "p.(Gly244Ser)" "7" "0000073916" "00021656" "99" "378" "0" "378" "0" "c.378C>A" "r.(?)" "p.(Tyr126*)" "5" "0000073917" "00021656" "55" "474" "0" "474" "0" "c.474C>T" "r.(=)" "p.(=)" "5" "0000073918" "00021656" "99" "524" "0" "524" "0" "c.524G>A" "r.(?)" "p.(Arg175His)" "5" "0000073919" "00021656" "99" "586" "0" "586" "0" "c.586C>T" "r.(?)" "p.(Arg196*)" "6" "0000073920" "00021656" "11" "639" "0" "639" "0" "c.639A>G" "r.(=)" "p.(=)" "6" "0000073921" "00021656" "55" "647" "0" "647" "0" "c.647T>G" "r.(?)" "p.(Val216Gly)" "6" "0000073922" "00021656" "99" "742" "0" "742" "0" "c.742C>T" "r.(?)" "p.(Arg248Trp)" "7" "0000073923" "00021656" "99" "743" "0" "743" "0" "c.743G>A" "r.(?)" "p.(Arg248Gln)" "7" "0000073924" "00021656" "11" "782" "72" "782" "72" "c.782+72C>T" "r.(=)" "p.(=)" "7i" "0000073925" "00021656" "11" "782" "92" "782" "92" "c.782+92T>G" "r.(=)" "p.(=)" "7i" "0000073949" "00021656" "99" "-28" "-1" "672" "1" "c.(-29+1_-28-1)_(672+1_673-1)dup" "r.spl?" "p.?" "1i_6i" "0000076112" "00021656" "90" "847" "0" "847" "0" "c.847C>T" "r.(?)" "p.(Arg283Cys)" "8" "0000076115" "00021656" "90" "329" "0" "329" "0" "c.329G>T" "r.(?)" "p.(Arg110Leu)" "4" "0000076255" "00021656" "90" "844" "0" "844" "0" "c.844C>T" "r.(?)" "p.(Arg282Trp)" "8" "0000077008" "00021656" "90" "526" "0" "526" "0" "c.526T>C" "r.(?)" "p.(Cys176Arg)" "5" "0000119918" "00021656" "70" "437" "0" "445" "0" "c.437_445del" "r.[=,627_635del]" "p.[=,Trp146_Asp148del)" "5" "0000128832" "00021656" "50" "800" "0" "800" "0" "c.800G>A" "r.(?)" "p.(Arg267Gln)" "8" "0000149143" "00021656" "00" "1129" "0" "1129" "0" "c.1129A>C" "r.(?)" "p.(Thr377Pro)" "" "0000149144" "00021656" "00" "1015" "0" "1015" "0" "c.1015G>A" "r.(?)" "p.(Glu339Lys)" "" "0000149145" "00021656" "00" "993" "312" "993" "312" "c.993+312C>T" "r.(=)" "p.(=)" "" "0000149146" "00021656" "00" "850" "0" "850" "0" "c.850A>T" "r.(?)" "p.(Thr284Ser)" "" "0000149147" "00021656" "00" "847" "0" "847" "0" "c.847C>T" "r.(?)" "p.(Arg283Cys)" "" "0000149148" "00021656" "00" "704" "0" "704" "0" "c.704A>G" "r.(?)" "p.(Asn235Ser)" "" "0000149149" "00021656" "00" "587" "0" "587" "0" "c.587G>A" "r.(?)" "p.(Arg196Gln)" "" "0000149150" "00021656" "00" "480" "0" "480" "0" "c.480G>A" "r.(?)" "p.(Met160Ile)" "" "0000149151" "00021656" "00" "245" "0" "245" "0" "c.245C>T" "r.(?)" "p.(Pro82Leu)" "" "0000149152" "00021656" "00" "173" "0" "173" "0" "c.173C>G" "r.(?)" "p.(Pro58Arg)" "" "0000149153" "00021656" "00" "139" "0" "139" "0" "c.139C>T" "r.(?)" "p.(Pro47Ser)" "" "0000250322" "00021656" "30" "255" "0" "255" "0" "c.255T>C" "r.(?)" "p.(Pro85=)" "" "0000254999" "00021656" "30" "1096" "0" "1096" "0" "c.1096T>G" "r.(?)" "p.(Ser366Ala)" "" "0000311978" "00021656" "10" "108" "0" "108" "0" "c.108G>A" "r.(?)" "p.(Pro36=)" "" "0000311979" "00021656" "10" "215" "0" "215" "0" "c.215C>G" "r.(?)" "p.(Pro72Arg)" "" "0000311980" "00021656" "10" "639" "0" "639" "0" "c.639A>G" "r.(?)" "p.(Arg213=)" "" "0000311981" "00021656" "90" "916" "0" "916" "0" "c.916C>T" "r.(?)" "p.(Arg306Ter)" "" "0000311982" "00021656" "10" "96" "41" "97" "-54" "c.96+41_97-54del" "r.?" "p.?" "" "0000313102" "00021656" "10" "-16056" "0" "-16056" "0" "c.-16056G>C" "r.(?)" "p.(=)" "" "0000313480" "00021656" "10" "108" "0" "108" "0" "c.108G>A" "r.(?)" "p.(Pro36=)" "" "0000313481" "00021656" "90" "216" "0" "216" "0" "c.216dup" "r.(?)" "p.(Val73ArgfsTer76)" "" "0000313482" "00021656" "30" "329" "0" "329" "0" "c.329G>A" "r.(?)" "p.(Arg110His)" "" "0000313483" "00021656" "90" "524" "0" "524" "0" "c.524G>A" "r.(?)" "p.(Arg175His)" "" "0000313484" "00021656" "10" "639" "0" "639" "0" "c.639A>G" "r.(?)" "p.(Arg213=)" "" "0000314776" "00021656" "10" "639" "0" "639" "0" "c.639A>G" "r.(?)" "p.(Arg213=)" "" "0000315552" "00021656" "10" "215" "0" "215" "0" "c.215C>G" "r.(?)" "p.(Pro72Arg)" "" "0000315553" "00021656" "90" "277" "0" "277" "0" "c.277del" "r.(?)" "p.(Leu93CysfsTer30)" "" "0000315554" "00021656" "90" "336" "0" "351" "0" "c.336_351del" "r.(?)" "p.(Phe113GlnfsTer5)" "" "0000315555" "00021656" "50" "412" "0" "435" "0" "c.412_435del" "r.(?)" "p.(Ala138_Leu145del)" "" "0000315556" "00021656" "30" "510" "0" "510" "0" "c.510G>A" "r.(?)" "p.(Thr170=)" "" "0000315557" "00021656" "90" "524" "0" "524" "0" "c.524G>A" "r.(?)" "p.(Arg175His)" "" "0000315558" "00021656" "90" "560" "-1" "560" "-1" "c.560-1G>A" "r.spl?" "p.?" "" "0000315559" "00021656" "90" "586" "0" "586" "0" "c.586C>T" "r.(?)" "p.(Arg196Ter)" "" "0000315560" "00021656" "90" "638" "0" "638" "0" "c.638G>A" "r.(?)" "p.(Arg213Gln)" "" "0000315561" "00021656" "10" "639" "0" "639" "0" "c.639A>G" "r.(?)" "p.(Arg213=)" "" "0000315562" "00021656" "90" "69" "0" "74" "1" "c.69_74+1del" "r.spl?" "p.?" "" "0000315563" "00021656" "90" "723" "0" "723" "0" "c.723del" "r.(?)" "p.(Cys242AlafsTer5)" "" "0000315564" "00021656" "90" "799" "0" "799" "0" "c.799C>T" "r.(?)" "p.(Arg267Trp)" "" "0000315565" "00021656" "30" "935" "0" "935" "0" "c.935C>G" "r.(?)" "p.(Thr312Ser)" "" "0000315566" "00021656" "10" "96" "41" "97" "-54" "c.96+41_97-54del" "r.?" "p.?" "" "0000315567" "00021656" "10" "993" "352" "993" "352" "c.993+352C>T" "r.(=)" "p.(=)" "" "0000315568" "00021656" "90" "994" "-1" "994" "-1" "c.994-1G>A" "r.spl?" "p.?" "" "0000316929" "00021656" "10" "108" "0" "108" "0" "c.108G>A" "r.(?)" "p.(Pro36=)" "" "0000316930" "00021656" "10" "1100" "30" "1100" "30" "c.1100+30A>T" "r.(=)" "p.(=)" "" "0000316931" "00021656" "10" "215" "0" "215" "0" "c.215C>G" "r.(?)" "p.(Pro72Arg)" "" "0000316933" "00021656" "30" "396" "0" "396" "0" "c.396G>A" "r.(?)" "p.(Lys132=)" "" "0000316934" "00021656" "30" "450" "0" "450" "0" "c.450A>G" "r.(?)" "p.(Thr150=)" "" "0000316935" "00021656" "30" "639" "0" "639" "0" "c.639A>G" "r.(?)" "p.(Arg213=)" "" "0000316936" "00021656" "90" "743" "0" "743" "0" "c.743G>A" "r.(?)" "p.(Arg248Gln)" "" "0000316937" "00021656" "30" "99" "0" "99" "0" "c.99C>T" "r.(?)" "p.(Ser33=)" "" "0000320002" "00021656" "50" "-15691" "0" "-15691" "0" "c.-15691C>T" "r.(?)" "p.(=)" "" "0000320003" "00021656" "30" "-15984" "0" "-15984" "0" "c.-15984A>G" "r.(?)" "p.(=)" "" "0000320004" "00021656" "30" "-16028" "0" "-16028" "0" "c.-16028G>C" "r.(?)" "p.(=)" "" "0000320005" "00021656" "30" "-16057" "0" "-16057" "0" "c.-16057C>T" "r.(?)" "p.(=)" "" "0000320006" "00021656" "30" "-1487" "0" "-1487" "0" "c.-1487C>T" "r.(?)" "p.(=)" "" "0000320007" "00021656" "30" "-14299" "0" "-14299" "0" "c.-14299G>A" "r.(?)" "p.(=)" "" "0000320008" "00021656" "10" "-14422" "0" "-14422" "0" "c.-14422G>A" "r.(?)" "p.(=)" "" "0000325163" "00021656" "10" "97" "-6" "97" "-6" "c.97-6C>T" "r.(=)" "p.(=)" "" "0000338711" "00021656" "10" "993" "12" "993" "12" "c.993+12T>C" "r.(=)" "p.(=)" "" "0000338712" "00021656" "10" "97" "-29" "97" "-29" "c.97-29C>A" "r.(=)" "p.(=)" "" "0000338713" "00021656" "30" "97" "-52" "97" "-52" "c.97-52G>A" "r.(=)" "p.(=)" "" "0000338715" "00021656" "10" "74" "38" "74" "38" "c.74+38C>G" "r.(=)" "p.(=)" "" "0000339185" "00021656" "50" "993" "227" "993" "227" "c.993+227A>C" "r.(=)" "p.(=)" "" "0000340439" "00021656" "10" "-1894" "0" "-1894" "0" "c.-1894G>A" "r.(?)" "p.(=)" "" "0000340614" "00021656" "30" "-15684" "0" "-15684" "0" "c.-15684A>G" "r.(?)" "p.(=)" "" "0000340910" "00021656" "10" "108" "0" "108" "0" "c.108G>A" "r.(?)" "p.(Pro36=)" "" "0000341486" "00021656" "10" "-16056" "0" "-16056" "0" "c.-16056G>C" "r.(?)" "p.(=)" "" "0000342087" "00021656" "90" "524" "0" "524" "0" "c.524G>A" "r.(?)" "p.(Arg175His)" "" "0000342088" "00021656" "90" "524" "0" "524" "0" "c.524G>T" "r.(?)" "p.(Arg175Leu)" "" "0000342787" "00021656" "70" "-15199" "0" "-15199" "0" "c.-15199G>A" "r.(?)" "p.(=)" "" "0000343270" "00021656" "10" "-1502" "0" "-1502" "0" "c.-1502G>C" "r.(?)" "p.(=)" "" "0000344325" "00021656" "90" "713" "0" "713" "0" "c.713G>A" "r.(?)" "p.(Cys238Tyr)" "" "0000348156" "00021656" "30" "-1331" "0" "-1331" "0" "c.-1331G>A" "r.(?)" "p.(=)" "" "0000348566" "00021656" "10" "215" "0" "215" "0" "c.215C>G" "r.(?)" "p.(Pro72Arg)" "" "0000350647" "00021656" "30" "217" "0" "217" "0" "c.217G>A" "r.(?)" "p.(Val73Met)" "" "0000359603" "00021656" "90" "800" "0" "800" "0" "c.800G>A" "r.(?)" "p.(Arg267Gln)" "8" "0000402917" "00021656" "50" "1175" "0" "1175" "0" "c.1175C>T" "r.(?)" "p.(Ser392Leu)" "11" "0000402918" "00021656" "50" "1175" "0" "1175" "0" "c.1175C>T" "r.(?)" "p.(Ser392Leu)" "11" "0000402919" "00021656" "50" "1136" "0" "1136" "0" "c.1136G>A" "r.(?)" "p.(Arg379His)" "11" "0000402920" "00021656" "50" "1112" "0" "1112" "0" "c.1112C>T" "r.(?)" "p.(Ser371Phe)" "11" "0000402921" "00021656" "50" "1112" "0" "1112" "0" "c.1112C>T" "r.(?)" "p.(Ser371Phe)" "11" "0000402922" "00021656" "50" "1015" "0" "1015" "0" "c.1015G>A" "r.(?)" "p.(Glu339Lys)" "10" "0000402923" "00021656" "50" "1015" "0" "1015" "0" "c.1015G>A" "r.(?)" "p.(Glu339Lys)" "10" "0000402924" "00021656" "90" "1010" "0" "1010" "0" "c.1010G>A" "r.(?)" "p.(Arg337His)" "10" "0000402925" "00021656" "50" "998" "0" "998" "0" "c.998G>A" "r.(?)" "p.(Arg333His)" "10" "0000402926" "00021656" "50" "993" "312" "993" "312" "c.993+312C>T" "r.(?)" "p.(=)" "9i" "0000402927" "00021656" "50" "993" "312" "993" "312" "c.993+312C>T" "r.(?)" "p.(=)" "9i" "0000402928" "00021656" "50" "993" "310" "993" "310" "c.993+310G>A" "r.(?)" "p.(=)" "9i" "0000402929" "00021656" "50" "993" "199" "993" "199" "c.993+199C>G" "r.(?)" "p.(=)" "9i" "0000402930" "00021656" "50" "993" "198" "993" "198" "c.993+198C>T" "r.(?)" "p.(=)" "9i" "0000402931" "00021656" "50" "993" "198" "993" "198" "c.993+198C>T" "r.(?)" "p.(=)" "9i" "0000402932" "00021656" "50" "861" "0" "861" "0" "c.861G>T" "r.(?)" "p.(Glu287Asp)" "8" "0000402933" "00021656" "90" "846" "0" "848" "0" "c.846_848dup" "r.(?)" "p.(Arg283dup)" "8" "0000402934" "00021656" "90" "847" "0" "847" "0" "c.847C>T" "r.(?)" "p.(Arg283Cys)" "8" "0000402935" "00021656" "50" "843" "0" "843" "0" "c.843C>T" "r.(?)" "p.(=)" "8" "0000402936" "00021656" "90" "830" "0" "830" "0" "c.830G>A" "r.(?)" "p.(Cys277Tyr)" "8" "0000402937" "00021656" "90" "818" "0" "818" "0" "c.818G>A" "r.(?)" "p.(Arg273His)" "8" "0000402938" "00021656" "90" "817" "0" "817" "0" "c.817C>T" "r.(?)" "p.(Arg273Cys)" "8" "0000402939" "00021656" "90" "799" "0" "799" "0" "c.799C>T" "r.(?)" "p.(Arg267Trp)" "8" "0000402940" "00021656" "90" "743" "0" "743" "0" "c.743G>A" "r.(?)" "p.(Arg248Gln)" "7" "0000402941" "00021656" "90" "733" "0" "733" "0" "c.733G>A" "r.(?)" "p.(Gly245Ser)" "7" "0000402942" "00021656" "50" "729" "0" "729" "0" "c.729G>A" "r.(?)" "p.(Met243Ile)" "7" "0000402943" "00021656" "50" "693" "0" "693" "0" "c.693C>T" "r.(?)" "p.(=)" "7" "0000402944" "00021656" "50" "684" "0" "684" "0" "c.684C>A" "r.(?)" "p.(Asp228Glu)" "7" "0000402945" "00021656" "10" "666" "0" "666" "0" "c.666G>A" "r.(?)" "p.(=)" "6" "0000402946" "00021656" "50" "645" "0" "645" "0" "c.645T>G" "r.(?)" "p.(Ser215Arg)" "6" "0000402947" "00021656" "10" "639" "0" "639" "0" "c.639A>G" "r.(?)" "p.(=)" "6" "0000402948" "00021656" "50" "605" "0" "605" "0" "c.605G>A" "r.(?)" "p.(Arg202His)" "6" "0000402949" "00021656" "50" "605" "0" "605" "0" "c.605G>A" "r.(?)" "p.(Arg202His)" "6" "0000402950" "00021656" "90" "587" "0" "587" "0" "c.587G>A" "r.(?)" "p.(Arg196Gln)" "6" "0000402951" "00021656" "50" "566" "0" "566" "0" "c.566C>T" "r.(?)" "p.(Ala189Val)" "6" "0000402952" "00021656" "50" "566" "0" "566" "0" "c.566C>T" "r.(?)" "p.(Ala189Val)" "6" "0000402953" "00021656" "50" "558" "0" "558" "0" "c.558T>A" "r.(?)" "p.(Asp186Glu)" "5" "0000402954" "00021656" "50" "530" "0" "530" "0" "c.530C>T" "r.(?)" "p.(Pro177Leu)" "5" "0000402955" "00021656" "90" "524" "0" "524" "0" "c.524G>A" "r.(?)" "p.(Arg175His)" "5" "0000402956" "00021656" "50" "516" "0" "516" "0" "c.516T>G" "r.(?)" "p.(=)" "5" "0000402957" "00021656" "50" "516" "0" "516" "0" "c.516T>G" "r.(?)" "p.(=)" "5" "0000402958" "00021656" "90" "493" "0" "493" "0" "c.493C>T" "r.(?)" "p.(Gln165*)" "5" "0000402959" "00021656" "50" "484" "0" "484" "0" "c.484A>G" "r.(?)" "p.(Ile162Val)" "5" "0000402960" "00021656" "50" "479" "0" "479" "0" "c.479T>C" "r.(?)" "p.(Met160Thr)" "5" "0000402961" "00021656" "90" "467" "0" "467" "0" "c.467G>A" "r.(?)" "p.(Arg156His)" "5" "0000402962" "00021656" "50" "465" "0" "465" "0" "c.465C>T" "r.(?)" "p.(=)" "5" "0000402963" "00021656" "50" "460" "0" "460" "0" "c.460G>A" "r.(?)" "p.(Gly154Ser)" "5" "0000402964" "00021656" "10" "456" "0" "456" "0" "c.456G>A" "r.(?)" "p.(=)" "5" "0000402965" "00021656" "10" "456" "0" "456" "0" "c.456G>A" "r.(?)" "p.(=)" "5" "0000402966" "00021656" "10" "408" "0" "408" "0" "c.408A>G" "r.(?)" "p.(=)" "5" "0000402967" "00021656" "50" "329" "0" "329" "0" "c.329G>A" "r.(?)" "p.(Arg110His)" "4" "0000402968" "00021656" "10" "321" "0" "321" "0" "c.321C>T" "r.(?)" "p.(=)" "4" "0000402969" "00021656" "50" "305" "0" "305" "0" "c.305C>A" "r.(?)" "p.(Thr102Asn)" "4" "0000402970" "00021656" "50" "249" "0" "249" "0" "c.249G>A" "r.(?)" "p.(=)" "4" "0000402971" "00021656" "50" "249" "0" "249" "0" "c.249G>A" "r.(?)" "p.(=)" "4" "0000402972" "00021656" "10" "215" "0" "215" "0" "c.215C>G" "r.(?)" "p.(Pro72Arg)" "4" "0000402973" "00021656" "10" "215" "0" "215" "0" "c.215C>G" "r.(?)" "p.(Pro72Arg)" "4" "0000402974" "00021656" "50" "214" "0" "214" "0" "c.214C>G" "r.(?)" "p.(Pro72Ala)" "4" "0000402975" "00021656" "50" "190" "0" "190" "0" "c.190C>A" "r.(?)" "p.(Pro64Thr)" "4" "0000402976" "00021656" "50" "145" "0" "145" "0" "c.145G>C" "r.(?)" "p.(Asp49His)" "4" "0000402977" "00021656" "50" "145" "0" "145" "0" "c.145G>C" "r.(?)" "p.(Asp49His)" "4" "0000402978" "00021656" "10" "141" "0" "141" "0" "c.141G>A" "r.(?)" "p.(=)" "4" "0000402979" "00021656" "10" "141" "0" "141" "0" "c.141G>A" "r.(?)" "p.(=)" "4" "0000402980" "00021656" "50" "129" "0" "129" "0" "c.129G>C" "r.(?)" "p.(Leu43Phe)" "4" "0000402981" "00021656" "50" "129" "0" "129" "0" "c.129G>C" "r.(?)" "p.(Leu43Phe)" "4" "0000402982" "00021656" "10" "108" "0" "108" "0" "c.108G>A" "r.(?)" "p.(=)" "4" "0000402983" "00021656" "10" "108" "0" "108" "0" "c.108G>A" "r.(?)" "p.(=)" "4" "0000402984" "00021656" "10" "91" "0" "91" "0" "c.91G>A" "r.(?)" "p.(Val31Ile)" "3" "0000402985" "00021656" "10" "91" "0" "91" "0" "c.91G>A" "r.(?)" "p.(Val31Ile)" "3" "0000402986" "00021656" "10" "90" "0" "90" "0" "c.90C>T" "r.(?)" "p.(=)" "3" "0000402987" "00021656" "10" "31" "0" "31" "0" "c.31G>C" "r.(?)" "p.(Glu11Gln)" "2" "0000402988" "00021656" "10" "31" "0" "31" "0" "c.31G>C" "r.(?)" "p.(Glu11Gln)" "2" "0000402989" "00021656" "50" "28" "0" "28" "0" "c.28G>A" "r.(?)" "p.(Val10Ile)" "2" "0000402990" "00021656" "10" "27" "0" "27" "0" "c.27C>T" "r.(?)" "p.(=)" "2" "0000402991" "00021656" "10" "27" "0" "27" "0" "c.27C>T" "r.(?)" "p.(=)" "2" "0000402992" "00021656" "50" "9" "0" "9" "0" "c.9G>T" "r.(?)" "p.(Glu3Asp)" "2" "0000402993" "00021656" "50" "9" "0" "9" "0" "c.9G>T" "r.(?)" "p.(Glu3Asp)" "2" "0000405471" "00021656" "10" "215" "0" "215" "0" "c.215C>G" "r.(?)" "p.(Pro72Arg)" "" "0000405472" "00021656" "10" "215" "0" "215" "0" "c.215C>G" "r.(?)" "p.(Pro72Arg)" "" "0000405473" "00021656" "50" "145" "0" "145" "0" "c.145G>C" "r.(?)" "p.(Asp49His)" "" "0000405474" "00021656" "10" "108" "0" "108" "0" "c.108G>A" "r.(?)" "p.(=)" "" "0000405475" "00021656" "10" "91" "0" "91" "0" "c.91G>A" "r.(?)" "p.(Val31Ile)" "" "0000405476" "00021656" "10" "91" "0" "91" "0" "c.91G>A" "r.(?)" "p.(Val31Ile)" "" "0000405477" "00021656" "10" "31" "0" "31" "0" "c.31G>C" "r.(?)" "p.(Glu11Gln)" "" "0000405478" "00021656" "50" "9" "0" "9" "0" "c.9G>T" "r.(?)" "p.(Glu3Asp)" "" "0000406468" "00021656" "10" "215" "0" "215" "0" "c.215C>G" "r.(?)" "p.(Pro72Arg)" "" "0000406469" "00021656" "10" "215" "0" "215" "0" "c.215C>G" "r.(?)" "p.(Pro72Arg)" "" "0000406470" "00021656" "50" "145" "0" "145" "0" "c.145G>C" "r.(?)" "p.(Asp49His)" "" "0000406471" "00021656" "10" "31" "0" "31" "0" "c.31G>C" "r.(?)" "p.(Glu11Gln)" "" "0000407667" "00021656" "50" "1175" "0" "1175" "0" "c.1175C>T" "r.(?)" "p.(Ser392Leu)" "" "0000407668" "00021656" "50" "1112" "0" "1112" "0" "c.1112C>T" "r.(?)" "p.(Ser371Phe)" "" "0000407669" "00021656" "50" "1079" "0" "1079" "0" "c.1079G>T" "r.(?)" "p.(Gly360Val)" "" "0000407670" "00021656" "50" "1036" "0" "1036" "0" "c.1036G>A" "r.(?)" "p.(Glu346Lys)" "" "0000407671" "00021656" "50" "1015" "0" "1015" "0" "c.1015G>A" "r.(?)" "p.(Glu339Lys)" "" "0000407672" "00021656" "50" "993" "285" "993" "285" "c.993+285G>A" "r.(?)" "p.(=)" "" "0000407673" "00021656" "50" "993" "274" "993" "274" "c.993+274A>G" "r.(?)" "p.(=)" "" "0000407674" "00021656" "50" "993" "208" "993" "208" "c.993+208T>A" "r.(?)" "p.(=)" "" "0000407675" "00021656" "50" "993" "198" "993" "198" "c.993+198C>T" "r.(?)" "p.(=)" "" "0000407676" "00021656" "50" "930" "0" "930" "0" "c.930C>T" "r.(?)" "p.(=)" "" "0000407677" "00021656" "90" "818" "0" "818" "0" "c.818G>A" "r.(?)" "p.(Arg273His)" "" "0000407678" "00021656" "90" "731" "0" "731" "0" "c.731G>A" "r.(?)" "p.(Gly244Asp)" "" "0000407679" "00021656" "50" "730" "0" "730" "0" "c.730G>A" "r.(?)" "p.(Gly244Ser)" "" "0000407680" "00021656" "50" "726" "0" "726" "0" "c.726C>T" "r.(?)" "p.(=)" "" "0000407681" "00021656" "10" "666" "0" "666" "0" "c.666G>A" "r.(?)" "p.(=)" "" "0000407682" "00021656" "50" "645" "0" "645" "0" "c.645T>G" "r.(?)" "p.(Ser215Arg)" "" "0000407683" "00021656" "10" "639" "0" "639" "0" "c.639A>G" "r.(?)" "p.(=)" "" "0000407684" "00021656" "50" "605" "0" "605" "0" "c.605G>A" "r.(?)" "p.(Arg202His)" "" "0000407685" "00021656" "90" "566" "0" "566" "0" "c.566C>T" "r.(?)" "p.(Ala189Val)" "" "0000407686" "00021656" "50" "556" "0" "556" "0" "c.556G>A" "r.(?)" "p.(Asp186Asn)" "" "0000407687" "00021656" "50" "516" "0" "516" "0" "c.516T>G" "r.(?)" "p.(=)" "" "0000407688" "00021656" "50" "479" "0" "479" "0" "c.479T>C" "r.(?)" "p.(Met160Thr)" "" "0000407689" "00021656" "10" "456" "0" "456" "0" "c.456G>A" "r.(?)" "p.(=)" "" "0000407690" "00021656" "90" "378" "0" "378" "0" "c.378C>G" "r.(?)" "p.(Tyr126*)" "" "0000407691" "00021656" "50" "263" "0" "263" "0" "c.263C>A" "r.(?)" "p.(Ala88Asp)" "" "0000407692" "00021656" "10" "246" "0" "246" "0" "c.246G>A" "r.(?)" "p.(=)" "" "0000407693" "00021656" "50" "217" "0" "217" "0" "c.217G>A" "r.(?)" "p.(Val73Met)" "" "0000407694" "00021656" "10" "215" "0" "215" "0" "c.215C>G" "r.(?)" "p.(Pro72Arg)" "" "0000407695" "00021656" "10" "215" "0" "215" "0" "c.215C>G" "r.(?)" "p.(Pro72Arg)" "" "0000407696" "00021656" "50" "214" "0" "214" "0" "c.214C>G" "r.(?)" "p.(Pro72Ala)" "" "0000407697" "00021656" "50" "190" "0" "190" "0" "c.190C>A" "r.(?)" "p.(Pro64Thr)" "" "0000407698" "00021656" "50" "182" "0" "182" "0" "c.182A>C" "r.(?)" "p.(Asp61Ala)" "" "0000407699" "00021656" "50" "145" "0" "145" "0" "c.145G>C" "r.(?)" "p.(Asp49His)" "" "0000407700" "00021656" "10" "141" "0" "141" "0" "c.141G>A" "r.(?)" "p.(=)" "" "0000407701" "00021656" "10" "108" "0" "108" "0" "c.108G>A" "r.(?)" "p.(=)" "" "0000407702" "00021656" "10" "108" "0" "108" "0" "c.108G>A" "r.(?)" "p.(=)" "" "0000407703" "00021656" "10" "91" "0" "91" "0" "c.91G>A" "r.(?)" "p.(Val31Ile)" "" "0000407704" "00021656" "10" "91" "0" "91" "0" "c.91G>A" "r.(?)" "p.(Val31Ile)" "" "0000407705" "00021656" "10" "31" "0" "31" "0" "c.31G>C" "r.(?)" "p.(Glu11Gln)" "" "0000407706" "00021656" "50" "28" "0" "28" "0" "c.28G>A" "r.(?)" "p.(Val10Ile)" "" "0000407707" "00021656" "10" "27" "0" "27" "0" "c.27C>T" "r.(?)" "p.(=)" "" "0000407708" "00021656" "50" "9" "0" "9" "0" "c.9G>T" "r.(?)" "p.(Glu3Asp)" "" "0000470553" "00021656" "70" "96" "1" "96" "1" "c.96+1G>A" "r.spl" "p.?" "" "0000474804" "00021656" "70" "844" "0" "844" "0" "c.844C>T" "r.(?)" "p.(Arg282Trp)" "8" "0000487612" "00021656" "70" "186" "0" "186" "0" "c.186del" "r.(?)" "p.(Ala63Leufs*60)" "4" "0000487613" "00021656" "50" "209" "0" "209" "0" "c.209dup" "r.(?)" "p.(Pro71Serfs*78)" "4" "0000487614" "00021656" "50" "190" "0" "190" "0" "c.190C>G" "r.(?)" "p.(Pro64Ala)" "4" "0000487618" "00021656" "70" "186" "0" "186" "0" "c.186del" "r.(?)" "p.(Ala63Leufs*60)" "4" "0000487619" "00021656" "30" "213" "0" "213" "0" "c.213C>A" "r.(=)" "p.(Pro71=)" "4" "0000487622" "00021656" "50" "276" "0" "276" "0" "c.276C>A" "r.(?)" "p.(Pro92=)" "4" "0000487624" "00021656" "70" "217" "0" "217" "0" "c.217G>A" "r.(?)" "p.(Val73Met)" "4" "0000487629" "00021656" "70" "217" "0" "217" "0" "c.217G>A" "r.(?)" "p.(Val73Met)" "4" "0000487631" "00021656" "70" "300" "0" "300" "0" "c.300G>T" "r.(?)" "p.(Gln100His)" "4" "0000487633" "00021656" "50" "312" "0" "312" "0" "c.312G>A" "r.(?)" "p.(Gln104=)" "4" "0000487634" "00021656" "50" "315" "0" "315" "0" "c.315C>T" "r.(?)" "p.(Gly105=)" "4" "0000487638" "00021656" "70" "215" "0" "215" "0" "c.215G>C" "r.(?)" "p.(Pro72Arg)" "4" "0000487639" "00021656" "70" "229" "0" "229" "0" "c.229C>T" "r.(?)" "p.(Pro77Ser)" "4" "0000487640" "00021656" "70" "245" "0" "245" "0" "c.245C>T" "r.(?)" "p.(Pro82Leu)" "4" "0000487644" "00021656" "70" "263" "0" "263" "0" "c.263C>G" "r.(?)" "p.(Ala88Gly)" "4" "0000487646" "00021656" "70" "271" "0" "271" "0" "c.271T>C" "r.(?)" "p.(Trp91Arg)" "4" "0000487649" "00021656" "70" "186" "0" "186" "0" "c.186del" "r.(?)" "p.(Ala63Leufs*60)" "4" "0000487651" "00021656" "70" "215" "0" "215" "0" "c.215G>C" "r.(?)" "p.(Pro72Arg)" "4" "0000487652" "00021656" "70" "271" "0" "271" "0" "c.271T>C" "r.(?)" "p.(Trp91Arg)" "4" "0000487654" "00021656" "50" "312" "0" "312" "0" "c.312G>A" "r.(?)" "p.(Gln104=)" "4" "0000487661" "00021656" "70" "215" "0" "215" "0" "c.215G>C" "r.(?)" "p.(Pro72Arg)" "4" "0000487662" "00021656" "70" "322" "0" "322" "0" "c.322G>C" "r.(?)" "p.(Gly108Arg)" "4" "0000487665" "00021656" "70" "186" "0" "186" "0" "c.186del" "r.(?)" "p.(Ala63Leufs*60)" "4" "0000487668" "00021656" "70" "208" "0" "208" "0" "c.208dup" "r.(?)" "p.(Ala70Glyfs*79)" "4" "0000487672" "00021656" "70" "215" "0" "215" "0" "c.215C>G" "r.(?)" "p.(Pro72Arg)" "4" "0000489019" "00021656" "70" "215" "0" "215" "0" "c.215G>C" "r.(?)" "p.(Pro72Arg)" "4" "0000489021" "00021656" "70" "215" "0" "215" "0" "c.215C>G" "r.(?)" "p.(Pro72Arg)" "4" "0000489030" "00021656" "70" "186" "0" "186" "0" "c.186del" "r.(?)" "p.(Ala63Leufs*60)" "4" "0000489032" "00021656" "50" "190" "0" "190" "0" "c.190C>G" "r.(?)" "p.(Pro64Ala)" "4" "0000489035" "00021656" "70" "208" "0" "208" "0" "c.208dup" "r.(?)" "p.(Ala70Glyfs*79)" "4" "0000489039" "00021656" "70" "215" "0" "215" "0" "c.215G>C" "r.(?)" "p.(Pro72Arg)" "4" "0000489041" "00021656" "70" "243" "0" "243" "0" "c.243dup" "r.(?)" "p.(Pro82Thrfs*67)" "4" "0000489043" "00021656" "70" "300" "0" "300" "0" "c.300G>T" "r.(?)" "p.(Gln100His)" "4" "0000489044" "00021656" "70" "186" "0" "186" "0" "c.186del" "r.(?)" "p.(Ala63Leufs*60)" "4" "0000489045" "00021656" "50" "315" "0" "315" "0" "c.315C>T" "r.(?)" "p.(Gly105=)" "4" "0000489048" "00021656" "70" "215" "0" "215" "0" "c.215G>C" "r.(?)" "p.(Pro72Arg)" "4" "0000489051" "00021656" "70" "215" "0" "215" "0" "c.215G>C" "r.(?)" "p.(Pro72Arg)" "4" "0000489055" "00021656" "70" "202" "0" "203" "0" "c.202_203insT" "r.(?)" "p.(Glu68Valfs*81)" "4" "0000489057" "00021656" "70" "186" "0" "186" "0" "c.186del" "r.(?)" "p.(Ala63Leufs*60)" "4" "0000489059" "00021656" "70" "186" "0" "186" "0" "c.186del" "r.(?)" "p.(Ala63Leufs*60)" "4" "0000489060" "00021656" "50" "315" "0" "315" "0" "c.315C>T" "r.(?)" "p.(Gly105=)" "4" "0000489061" "00021656" "70" "215" "0" "215" "0" "c.215G>C" "r.(?)" "p.(Pro72Arg)" "4" "0000489063" "00021656" "70" "217" "0" "217" "0" "c.217G>A" "r.(?)" "p.(Val73Met)" "4" "0000489067" "00021656" "50" "312" "0" "312" "0" "c.312G>A" "r.(?)" "p.(Gln104=)" "4" "0000489069" "00021656" "50" "315" "0" "315" "0" "c.315C>T" "r.(?)" "p.(Gly105=)" "4" "0000489070" "00021656" "70" "186" "0" "186" "0" "c.186del" "r.(?)" "p.(Ala63Leufs*60)" "4" "0000489071" "00021656" "70" "186" "0" "186" "0" "c.186del" "r.(?)" "p.(Ala63Leufs*60)" "4" "0000489073" "00021656" "70" "215" "0" "215" "0" "c.215G>C" "r.(?)" "p.(Pro72Arg)" "4" "0000489074" "00021656" "70" "186" "0" "186" "0" "c.186del" "r.(?)" "p.(Ala63Leufs*60)" "4" "0000489075" "00021656" "50" "315" "0" "315" "0" "c.315C>T" "r.(?)" "p.(Gly105=)" "4" "0000489076" "00021656" "70" "322" "0" "322" "0" "c.322G>C" "r.(?)" "p.(Gly108Arg)" "4" "0000500509" "00021656" "90" "-202" "0" "-29" "1" "c.(?_-202)_(-29+1_-28-1)del" "r.0?" "p.0?" "_1_1i" "0000500510" "00021656" "90" "324" "0" "327" "0" "c.324_327dup" "r.(?)" "p.(Arg110Phefs*40)" "" "0000500511" "00021656" "90" "375" "0" "375" "0" "c.375G>A" "r.spl" "p.(Ser33_Thr125del)" "" "0000500512" "00021656" "90" "559" "2" "559" "2" "c.559+2T>C" "r.spl" "p.?" "" "0000500513" "00021656" "90" "578" "0" "578" "0" "c.578A>T" "r.(?)" "p.(His193Leu)" "" "0000500514" "00021656" "90" "847" "0" "847" "0" "c.847C>T" "r.(?)" "p.(Arg283Cys)" "" "0000500515" "00021656" "90" "847" "0" "847" "0" "c.847C>T" "r.(?)" "p.(Arg283Cys)" "" "0000500516" "00021656" "90" "1021" "0" "1021" "0" "c.1021T>G" "r.(?)" "p.(Phe341Val)" "" "0000563208" "00021656" "90" "1024" "0" "1024" "0" "c.1024C>T" "r.(?)" "p.(Arg342Ter)" "" "0000563209" "00021656" "30" "1014" "0" "1014" "0" "c.1014C>T" "r.(?)" "p.(Phe338=)" "" "0000563210" "00021656" "90" "994" "-2" "994" "-2" "c.994-2A>G" "r.spl?" "p.?" "" "0000563211" "00021656" "10" "993" "12" "993" "12" "c.993+12T>C" "r.(=)" "p.(=)" "" "0000563212" "00021656" "10" "993" "12" "993" "12" "c.993+12T>C" "r.(=)" "p.(=)" "" "0000563213" "00021656" "10" "993" "12" "993" "12" "c.993+12T>C" "r.(=)" "p.(=)" "" "0000563214" "00021656" "30" "993" "12" "993" "12" "c.993+12T>C" "r.(=)" "p.(=)" "" "0000563215" "00021656" "10" "993" "12" "993" "12" "c.993+12T>C" "r.(=)" "p.(=)" "" "0000563216" "00021656" "30" "920" "-43" "920" "-43" "c.920-43G>A" "r.(=)" "p.(=)" "" "0000563217" "00021656" "30" "847" "0" "847" "0" "c.847C>T" "r.(?)" "p.(Arg283Cys)" "" "0000563218" "00021656" "70" "845" "0" "845" "0" "c.845G>A" "r.(?)" "p.(Arg282Gln)" "" "0000563219" "00021656" "90" "817" "0" "817" "0" "c.817C>T" "r.(?)" "p.(Arg273Cys)" "" "0000563220" "00021656" "70" "785" "0" "785" "0" "c.785G>T" "r.(?)" "p.(Gly262Val)" "" "0000563221" "00021656" "90" "742" "0" "742" "0" "c.742C>T" "r.(?)" "p.(Arg248Trp)" "" "0000563222" "00021656" "30" "704" "0" "704" "0" "c.704A>G" "r.(?)" "p.(Asn235Ser)" "" "0000563223" "00021656" "10" "673" "-36" "673" "-36" "c.673-36G>C" "r.(=)" "p.(=)" "" "0000563224" "00021656" "30" "639" "0" "639" "0" "c.639A>G" "r.(?)" "p.(Arg213=)" "" "0000563225" "00021656" "70" "623" "0" "623" "0" "c.623A>T" "r.(?)" "p.(Asp208Val)" "" "0000563226" "00021656" "90" "586" "0" "586" "0" "c.586C>T" "r.(?)" "p.(Arg196Ter)" "" "0000563227" "00021656" "70" "535" "0" "535" "0" "c.535C>T" "r.(?)" "p.(His179Tyr)" "" "0000563228" "00021656" "70" "526" "0" "526" "0" "c.526T>A" "r.(?)" "p.(Cys176Ser)" "" "0000563229" "00021656" "30" "508" "0" "508" "0" "c.508A>G" "r.(?)" "p.(Thr170Ala)" "" "0000563230" "00021656" "90" "473" "0" "473" "0" "c.473G>A" "r.(?)" "p.(Arg158His)" "" "0000563231" "00021656" "90" "473" "0" "473" "0" "c.473G>A" "r.(?)" "p.(Arg158His)" "" "0000563232" "00021656" "70" "467" "0" "467" "0" "c.467G>C" "r.(?)" "p.(Arg156Pro)" "" "0000563233" "00021656" "50" "467" "0" "467" "0" "c.467G>A" "r.(?)" "p.(Arg156His)" "" "0000563234" "00021656" "70" "376" "-2" "376" "-2" "c.376-2dup" "r.spl?" "p.?" "" "0000563235" "00021656" "30" "375" "16" "375" "16" "c.375+16G>A" "r.(=)" "p.(=)" "" "0000563236" "00021656" "90" "328" "0" "328" "0" "c.328del" "r.(?)" "p.(Arg110ValfsTer13)" "" "0000563237" "00021656" "30" "108" "0" "108" "0" "c.108G>A" "r.(?)" "p.(Pro36=)" "" "0000563238" "00021656" "10" "97" "-6" "97" "-6" "c.97-6C>T" "r.(=)" "p.(=)" "" "0000563239" "00021656" "10" "97" "-29" "97" "-29" "c.97-29C>A" "r.(=)" "p.(=)" "" "0000563240" "00021656" "10" "97" "-29" "97" "-29" "c.97-29C>A" "r.(=)" "p.(=)" "" "0000563241" "00021656" "30" "97" "-52" "97" "-52" "c.97-52G>A" "r.(=)" "p.(=)" "" "0000563242" "00021656" "30" "6" "0" "6" "0" "c.6G>A" "r.(?)" "p.(Glu2=)" "" "0000563243" "00021656" "30" "-1695" "0" "-1695" "0" "c.-1695G>T" "r.(?)" "p.(=)" "" "0000563244" "00021656" "30" "-1746" "0" "-1746" "0" "c.-1746G>A" "r.(?)" "p.(=)" "" "0000563245" "00021656" "50" "-1931" "0" "-1931" "0" "c.-1931C>G" "r.(?)" "p.(=)" "" "0000563246" "00021656" "50" "-13474" "0" "-13474" "0" "c.-13474T>C" "r.(?)" "p.(=)" "" "0000563247" "00021656" "50" "-13475" "0" "-13475" "0" "c.-13475G>A" "r.(?)" "p.(=)" "" "0000563248" "00021656" "30" "-14207" "0" "-14207" "0" "c.-14207C>T" "r.(?)" "p.(=)" "" "0000563249" "00021656" "50" "-14415" "0" "-14415" "0" "c.-14415C>T" "r.(?)" "p.(=)" "" "0000563250" "00021656" "10" "-15453" "0" "-15453" "0" "c.-15453C>T" "r.(?)" "p.(=)" "" "0000563251" "00021656" "50" "-15938" "0" "-15938" "0" "c.-15938G>A" "r.(?)" "p.(=)" "" "0000563252" "00021656" "10" "-15973" "0" "-15973" "0" "c.-15973T>C" "r.(?)" "p.(=)" "" "0000563253" "00021656" "50" "-16028" "0" "-16028" "0" "c.-16028G>C" "r.(?)" "p.(=)" "" "0000563254" "00021656" "10" "-16132" "0" "-16132" "0" "c.-16132C>A" "r.(?)" "p.(=)" "" "0000598754" "00021656" "10" "215" "0" "215" "0" "c.215C>G" "r.(?)" "p.(Pro72Arg)" "" "0000599121" "00021656" "10" "215" "0" "215" "0" "c.215C>G" "r.(?)" "p.(Pro72Arg)" "4" "0000599122" "00021656" "10" "215" "0" "215" "0" "c.215C>G" "r.(?)" "p.(Pro72Arg)" "4" "0000599123" "00021656" "10" "215" "0" "215" "0" "c.215C>G" "r.(?)" "p.(Pro72Arg)" "4" "0000599124" "00021656" "10" "215" "0" "215" "0" "c.215C>G" "r.(?)" "p.(Pro72Arg)" "4" "0000599125" "00021656" "10" "215" "0" "215" "0" "c.215C>G" "r.(?)" "p.(Pro72Arg)" "4" "0000616835" "00021656" "10" "1101" "-49" "1101" "-49" "c.1101-49C>T" "r.(=)" "p.(=)" "" "0000616836" "00021656" "50" "920" "-5" "920" "-5" "c.920-5C>T" "r.spl?" "p.?" "" "0000616837" "00021656" "30" "920" "-35" "920" "-35" "c.920-35T>G" "r.(=)" "p.(=)" "" "0000616838" "00021656" "30" "919" "22" "919" "22" "c.919+22C>T" "r.(=)" "p.(=)" "" "0000616839" "00021656" "90" "904" "0" "908" "0" "c.904_908dup" "r.(?)" "p.(Ser303ArgfsTer44)" "" "0000616840" "00021656" "30" "782" "12" "782" "12" "c.782+12C>T" "r.(=)" "p.(=)" "" "0000616841" "00021656" "90" "733" "0" "733" "0" "c.733G>A" "r.(?)" "p.(Gly245Ser)" "" "0000616842" "00021656" "30" "672" "18" "672" "18" "c.672+18G>C" "r.(=)" "p.(=)" "" "0000616843" "00021656" "90" "584" "0" "584" "0" "c.584T>C" "r.(?)" "p.(Ile195Thr)" "" "0000616844" "00021656" "90" "473" "0" "473" "0" "c.473G>A" "r.(?)" "p.(Arg158His)" "" "0000616845" "00021656" "10" "108" "0" "108" "0" "c.108G>A" "r.(?)" "p.(Pro36=)" "" "0000616848" "00021656" "30" "-14126" "0" "-14126" "0" "c.-14126G>A" "r.(?)" "p.(=)" "" "0000616849" "00021656" "30" "-16056" "0" "-16056" "0" "c.-16056G>A" "r.(?)" "p.(=)" "" "0000623770" "00021656" "50" "-14405" "0" "-14405" "0" "c.-14405G>A" "r.(?)" "p.(=)" "" "0000649714" "00021656" "30" "993" "12" "993" "12" "c.993+12T>C" "r.(=)" "p.(=)" "" "0000649715" "00021656" "50" "848" "0" "848" "0" "c.848G>A" "r.(?)" "p.(Arg283His)" "" "0000649716" "00021656" "50" "847" "0" "847" "0" "c.847C>T" "r.(?)" "p.(Arg283Cys)" "" "0000649717" "00021656" "50" "711" "0" "711" "0" "c.711G>A" "r.(?)" "p.(Met237Ile)" "" "0000649718" "00021656" "30" "639" "0" "639" "0" "c.639A>G" "r.(=)" "p.(=)" "" "0000653021" "00021656" "90" "916" "0" "916" "0" "c.916C>T" "r.(?)" "p.(Arg306*)" "" "0000653143" "00021656" "50" "830" "0" "830" "0" "c.830G>A" "r.(?)" "p.(Cys277Tyr)" "" "0000653144" "00021656" "70" "824" "0" "824" "0" "c.824G>A" "r.(?)" "p.(Cys275Tyr)" "" "0000653145" "00021656" "70" "772" "0" "772" "0" "c.772G>A" "r.(?)" "p.(Glu258Lys)" "" "0000653146" "00021656" "70" "743" "0" "743" "0" "c.743G>A" "r.(?)" "p.(Arg248Gln)" "" "0000653432" "00021656" "50" "242" "0" "242" "0" "c.242C>T" "r.(?)" "p.(Thr81Ile)" "" "0000658256" "00021656" "10" "1100" "30" "1100" "30" "c.1100+30A>T" "r.(=)" "p.(=)" "" "0000658257" "00021656" "90" "844" "0" "844" "0" "c.844C>T" "r.(?)" "p.(Arg282Trp)" "" "0000658258" "00021656" "90" "839" "0" "839" "0" "c.839G>A" "r.(?)" "p.(Arg280Lys)" "" "0000658259" "00021656" "70" "826" "0" "826" "0" "c.826G>C" "r.(?)" "p.(Ala276Pro)" "" "0000658260" "00021656" "90" "818" "0" "818" "0" "c.818G>A" "r.(?)" "p.(Arg273His)" "" "0000658261" "00021656" "30" "783" "-44" "783" "-44" "c.783-44G>A" "r.(=)" "p.(=)" "" "0000658262" "00021656" "90" "638" "0" "638" "0" "c.638G>A" "r.(?)" "p.(Arg213Gln)" "" "0000658263" "00021656" "70" "476" "0" "476" "0" "c.476C>T" "r.(?)" "p.(Ala159Val)" "" "0000658264" "00021656" "10" "74" "38" "74" "38" "c.74+38C>G" "r.(=)" "p.(=)" "" "0000658265" "00021656" "30" "74" "11" "74" "11" "c.74+11C>A" "r.(=)" "p.(=)" "" "0000658266" "00021656" "30" "27" "0" "27" "0" "c.27C>T" "r.(?)" "p.(Ser9=)" "" "0000658267" "00021656" "50" "-1508" "0" "-1508" "0" "c.-1508C>A" "r.(?)" "p.(=)" "" "0000659568" "00021656" "50" "538" "0" "538" "0" "c.538G>A" "r.(?)" "p.(Glu180Lys)" "" "0000659573" "00021656" "50" "1152" "0" "1152" "0" "c.1152G>A" "r.(?)" "p.(Met384Ile)" "" "0000659672" "00021656" "90" "1010" "0" "1010" "0" "c.1010G>A" "r.(?)" "p.(Arg337His)" "" "0000681034" "00021656" "90" "913" "0" "913" "0" "c.913A>T" "r.(?)" "p.(Lys305Ter)" "" "0000681035" "00021656" "70" "832" "0" "832" "0" "c.832C>G" "r.(?)" "p.(Pro278Ala)" "" "0000681036" "00021656" "90" "742" "0" "742" "0" "c.742C>T" "r.(?)" "p.(Arg248Trp)" "" "0000681037" "00021656" "90" "584" "0" "584" "0" "c.584T>C" "r.(?)" "p.(Ile195Thr)" "" "0000681038" "00021656" "70" "538" "0" "538" "0" "c.538G>A" "r.(?)" "p.(Glu180Lys)" "" "0000681039" "00021656" "90" "517" "0" "517" "0" "c.517G>T" "r.(?)" "p.(Val173Leu)" "" "0000681040" "00021656" "30" "-14299" "0" "-14299" "0" "c.-14299G>A" "r.(?)" "p.(=)" "" "0000692477" "00021656" "50" "1015" "0" "1015" "0" "c.1015G>A" "r.(?)" "p.(Glu339Lys)" "" "0000692478" "00021656" "70" "542" "0" "542" "0" "c.542G>A" "r.(?)" "p.(Arg181His)" "" "0000692479" "00021656" "90" "434" "0" "471" "0" "c.434_471del" "r.(?)" "p.(Leu145ProfsTer23)" "" "0000726694" "00021656" "30" "993" "141" "993" "141" "c.993+141G>A" "r.(=)" "p.(=)" "" "0000726695" "00021656" "90" "742" "0" "742" "0" "c.742C>T" "r.(?)" "p.(Arg248Trp)" "" "0000726696" "00021656" "10" "672" "31" "672" "31" "c.672+31A>G" "r.(=)" "p.(=)" "" "0000726697" "00021656" "50" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Pro191Leu)" "" "0000726698" "00021656" "30" "6" "0" "6" "0" "c.6G>A" "r.(?)" "p.(Glu2=)" "" "0000726699" "00021656" "50" "-13406" "0" "-13406" "0" "c.-13406C>T" "r.(?)" "p.(=)" "" "0000726700" "00021656" "30" "-13470" "0" "-13470" "0" "c.-13470T>C" "r.(?)" "p.(=)" "" "0000726701" "00021656" "50" "-14405" "0" "-14405" "0" "c.-14405G>A" "r.(?)" "p.(=)" "" "0000726702" "00021656" "10" "-14422" "0" "-14422" "0" "c.-14422G>A" "r.(?)" "p.(=)" "" "0000726703" "00021656" "90" "-16049" "0" "-16049" "0" "c.-16049del" "r.(?)" "p.(=)" "" "0000726704" "00021656" "30" "-16081" "0" "-16081" "0" "c.-16081A>T" "r.(?)" "p.(=)" "" "0000737086" "00021656" "50" "376" "-2" "376" "-2" "c.376-2dup" "r.spl?" "p.?" "" "0000737189" "00021656" "50" "1024" "0" "1025" "0" "c.1024_1025delinsTT" "r.(?)" "p.(Arg342Leu)" "" "0000737190" "00021656" "50" "618" "0" "619" "0" "c.618_619delinsTC" "r.(?)" "p.(Leu206_Asp207delinsPheHis)" "" "0000742610" "00021656" "50" "1165" "0" "1165" "0" "c.1165G>A" "r.(?)" "p.(Gly389Arg)" "" "0000742611" "00021656" "50" "1151" "0" "1151" "0" "c.1151T>C" "r.(?)" "p.(Met384Thr)" "" "0000742612" "00021656" "50" "1148" "0" "1148" "0" "c.1148T>C" "r.(?)" "p.(Leu383Pro)" "" "0000742613" "00021656" "50" "1126" "0" "1126" "0" "c.1126T>C" "r.(?)" "p.(Ser376Pro)" "" "0000742614" "00021656" "50" "1120" "0" "1120" "0" "c.1120G>C" "r.(?)" "p.(Gly374Arg)" "" "0000742615" "00021656" "50" "1120" "0" "1120" "0" "c.1120G>A" "r.(?)" "p.(Gly374Ser)" "" "0000742616" "00021656" "50" "1093" "0" "1093" "0" "c.1093C>T" "r.(?)" "p.(His365Tyr)" "" "0000742617" "00021656" "50" "1091" "0" "1091" "0" "c.1091C>T" "r.(?)" "p.(Ala364Val)" "" "0000742618" "00021656" "50" "1066" "0" "1066" "0" "c.1066G>C" "r.(?)" "p.(Gly356Arg)" "" "0000742619" "00021656" "50" "1054" "0" "1054" "0" "c.1054G>A" "r.(?)" "p.(Asp352Asn)" "" "0000742620" "00021656" "50" "1003" "0" "1003" "0" "c.1003C>T" "r.(?)" "p.(Arg335Cys)" "" "0000742621" "00021656" "50" "950" "0" "950" "0" "c.950A>G" "r.(?)" "p.(Gln317Arg)" "" "0000742622" "00021656" "50" "938" "0" "938" "0" "c.938G>T" "r.(?)" "p.(Ser313Ile)" "" "0000742623" "00021656" "50" "917" "0" "917" "0" "c.917G>A" "r.(?)" "p.(Arg306Gln)" "" "0000742624" "00021656" "50" "909" "0" "909" "0" "c.909C>G" "r.(?)" "p.(Ser303Arg)" "" "0000742625" "00021656" "50" "877" "0" "877" "0" "c.877G>A" "r.(?)" "p.(Gly293Arg)" "" "0000742626" "00021656" "50" "875" "0" "875" "0" "c.875A>G" "r.(?)" "p.(Lys292Arg)" "" "0000742627" "00021656" "50" "866" "0" "866" "0" "c.866T>C" "r.(?)" "p.(Leu289Pro)" "" "0000742628" "00021656" "50" "862" "0" "862" "0" "c.862A>C" "r.(?)" "p.(Asn288His)" "" "0000742629" "00021656" "50" "848" "0" "848" "0" "c.848G>A" "r.(?)" "p.(Arg283His)" "" "0000742630" "00021656" "50" "800" "0" "800" "0" "c.800G>A" "r.(?)" "p.(Arg267Gln)" "" "0000742631" "00021656" "50" "688" "0" "688" "0" "c.688A>G" "r.(?)" "p.(Thr230Ala)" "" "0000742632" "00021656" "50" "685" "0" "685" "0" "c.685T>G" "r.(?)" "p.(Cys229Gly)" "" "0000742633" "00021656" "50" "673" "-1" "673" "-1" "c.673-1G>A" "r.spl?" "p.?" "" "0000742634" "00021656" "50" "621" "0" "621" "0" "c.621T>G" "r.(?)" "p.(Asp207Glu)" "" "0000742635" "00021656" "50" "605" "0" "605" "0" "c.605G>C" "r.(?)" "p.(Arg202Pro)" "" "0000742636" "00021656" "50" "605" "0" "605" "0" "c.605G>A" "r.(?)" "p.(Arg202His)" "" "0000742637" "00021656" "50" "576" "0" "576" "0" "c.576G>T" "r.(?)" "p.(Gln192His)" "" "0000742638" "00021656" "50" "572" "0" "572" "0" "c.572C>G" "r.(?)" "p.(Pro191Arg)" "" "0000742639" "00021656" "50" "514" "0" "514" "0" "c.514G>A" "r.(?)" "p.(Val172Ile)" "" "0000742640" "00021656" "50" "479" "0" "479" "0" "c.479T>C" "r.(?)" "p.(Met160Thr)" "" "0000742641" "00021656" "50" "461" "0" "461" "0" "c.461G>A" "r.(?)" "p.(Gly154Asp)" "" "0000742642" "00021656" "50" "446" "0" "446" "0" "c.446C>T" "r.(?)" "p.(Ser149Phe)" "" "0000742643" "00021656" "50" "427" "0" "427" "0" "c.427G>T" "r.(?)" "p.(Val143Leu)" "" "0000742644" "00021656" "50" "385" "0" "385" "0" "c.385G>T" "r.(?)" "p.(Ala129Ser)" "" "0000742645" "00021656" "50" "364" "0" "364" "0" "c.364G>A" "r.(?)" "p.(Val122Met)" "" "0000742646" "00021656" "50" "263" "0" "263" "0" "c.263C>T" "r.(?)" "p.(Ala88Val)" "" "0000742647" "00021656" "50" "259" "0" "259" "0" "c.259C>G" "r.(?)" "p.(Pro87Ala)" "" "0000742648" "00021656" "50" "248" "0" "248" "0" "c.248C>T" "r.(?)" "p.(Ala83Val)" "" "0000742649" "00021656" "50" "218" "0" "218" "0" "c.218T>C" "r.(?)" "p.(Val73Ala)" "" "0000742650" "00021656" "50" "217" "0" "217" "0" "c.217G>A" "r.(?)" "p.(Val73Met)" "" "0000742651" "00021656" "50" "215" "0" "215" "0" "c.215C>A" "r.(?)" "p.(Pro72His)" "" "0000742652" "00021656" "50" "183" "0" "183" "0" "c.183T>G" "r.(?)" "p.(Asp61Glu)" "" "0000742653" "00021656" "50" "178" "0" "178" "0" "c.178C>G" "r.(?)" "p.(Pro60Ala)" "" "0000742654" "00021656" "50" "152" "0" "152" "0" "c.152A>G" "r.(?)" "p.(Glu51Gly)" "" "0000742655" "00021656" "50" "144" "0" "144" "0" "c.144C>A" "r.(?)" "p.(Asp48Glu)" "" "0000742656" "00021656" "50" "23" "0" "23" "0" "c.23C>A" "r.(?)" "p.(Pro8His)" "" "0000742657" "00021656" "50" "8" "0" "8" "0" "c.8A>T" "r.(?)" "p.(Glu3Val)" "" "0000743211" "00021656" "50" "896" "0" "899" "0" "c.896_899dup" "r.(?)" "p.(Pro301Alafs*6)" "" "0000743212" "00021656" "50" "889" "0" "889" "0" "c.889del" "r.(?)" "p.(His297Thrfs*48)" "" "0000743213" "00021656" "50" "694" "0" "704" "0" "c.694_704dup" "r.(?)" "p.(Asn235Lysfs*16)" "" "0000743214" "00021656" "50" "573" "0" "576" "0" "c.573_576dup" "r.(?)" "p.(His193Serfs*17)" "" "0000743215" "00021656" "50" "454" "0" "455" "0" "c.454_455del" "r.(?)" "p.(Pro152Alafs*28)" "" "0000743216" "00021656" "50" "276" "0" "324" "0" "c.276_324dup" "r.(?)" "p.(Phe109Profs*56)" "" "0000743217" "00021656" "50" "78" "0" "78" "0" "c.78del" "r.(?)" "p.(Pro27Leufs*17)" "" "0000743436" "00021656" "50" "505" "0" "506" "0" "c.505_506del" "r.(?)" "p.(Met169Aspfs*11)" "" "0000743443" "00021656" "50" "891" "0" "892" "0" "c.891_892delinsTT" "r.(?)" "p.(Glu298*)" "" "0000743444" "00021656" "50" "215" "0" "216" "0" "c.215_216delinsGT" "r.(?)" "p.(Pro72Arg)" "" "0000743445" "00021656" "50" "214" "0" "215" "0" "c.214_215inv" "r.(?)" "p.(Pro72Gly)" "" "0000749849" "00021656" "50" "1150" "0" "1150" "0" "c.1150A>G" "r.(?)" "p.(Met384Val)" "" "0000749850" "00021656" "50" "1084" "0" "1084" "0" "c.1084A>T" "r.(?)" "p.(Ser362Cys)" "" "0000749851" "00021656" "50" "1084" "0" "1084" "0" "c.1084A>G" "r.(?)" "p.(Ser362Gly)" "" "0000749852" "00021656" "50" "1045" "0" "1045" "0" "c.1045G>C" "r.(?)" "p.(Glu349Gln)" "" "0000749853" "00021656" "50" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Ala347Val)" "" "0000749854" "00021656" "50" "1039" "0" "1039" "0" "c.1039G>A" "r.(?)" "p.(Ala347Thr)" "" "0000749855" "00021656" "50" "1020" "0" "1020" "0" "c.1020G>A" "r.(?)" "p.(Met340Ile)" "" "0000749856" "00021656" "50" "1015" "0" "1015" "0" "c.1015G>C" "r.(?)" "p.(Glu339Gln)" "" "0000749857" "00021656" "50" "1012" "0" "1012" "0" "c.1012T>G" "r.(?)" "p.(Phe338Val)" "" "0000749858" "00021656" "50" "1009" "0" "1009" "0" "c.1009C>T" "r.(?)" "p.(Arg337Cys)" "" "0000749859" "00021656" "50" "1001" "0" "1001" "0" "c.1001G>A" "r.(?)" "p.(Gly334Glu)" "" "0000749860" "00021656" "50" "971" "0" "971" "0" "c.971A>G" "r.(?)" "p.(Asp324Gly)" "" "0000749861" "00021656" "50" "970" "0" "970" "0" "c.970G>C" "r.(?)" "p.(Asp324His)" "" "0000749862" "00021656" "50" "953" "0" "953" "0" "c.953C>T" "r.(?)" "p.(Pro318Leu)" "" "0000749863" "00021656" "50" "944" "0" "944" "0" "c.944C>T" "r.(?)" "p.(Ser315Phe)" "" "0000749864" "00021656" "50" "925" "0" "925" "0" "c.925C>A" "r.(?)" "p.(Pro309Thr)" "" "0000749865" "00021656" "50" "922" "0" "922" "0" "c.922C>A" "r.(?)" "p.(Leu308Met)" "" "0000749866" "00021656" "50" "916" "0" "916" "0" "c.916C>T" "r.(?)" "p.(Arg306*)" "" "0000749867" "00021656" "50" "886" "0" "886" "0" "c.886C>T" "r.(?)" "p.(His296Tyr)" "" "0000749868" "00021656" "50" "877" "0" "877" "0" "c.877G>T" "r.(?)" "p.(Gly293Trp)" "" "0000749869" "00021656" "50" "875" "0" "875" "0" "c.875A>T" "r.(?)" "p.(Lys292Ile)" "" "0000749870" "00021656" "50" "850" "0" "850" "0" "c.850A>G" "r.(?)" "p.(Thr284Ala)" "" "0000749871" "00021656" "50" "847" "0" "847" "0" "c.847C>A" "r.(?)" "p.(Arg283Ser)" "" "0000749872" "00021656" "50" "845" "0" "845" "0" "c.845G>A" "r.(?)" "p.(Arg282Gln)" "" "0000749873" "00021656" "50" "844" "0" "844" "0" "c.844C>T" "r.(?)" "p.(Arg282Trp)" "" "0000749874" "00021656" "50" "844" "0" "844" "0" "c.844C>G" "r.(?)" "p.(Arg282Gly)" "" "0000749875" "00021656" "50" "843" "0" "843" "0" "c.843C>G" "r.(?)" "p.(Asp281Glu)" "" "0000749876" "00021656" "50" "839" "0" "839" "0" "c.839G>A" "r.(?)" "p.(Arg280Lys)" "" "0000749877" "00021656" "50" "835" "0" "835" "0" "c.835G>A" "r.(?)" "p.(Gly279Arg)" "" "0000749878" "00021656" "50" "823" "0" "823" "0" "c.823T>C" "r.(?)" "p.(Cys275Arg)" "" "0000749879" "00021656" "50" "817" "0" "817" "0" "c.817C>T" "r.(?)" "p.(Arg273Cys)" "" "0000749880" "00021656" "50" "799" "0" "799" "0" "c.799C>T" "r.(?)" "p.(Arg267Trp)" "" "0000749881" "00021656" "50" "785" "0" "785" "0" "c.785G>A" "r.(?)" "p.(Gly262Asp)" "" "0000749882" "00021656" "50" "783" "0" "783" "0" "c.783T>A" "r.(?)" "p.(Ser261Arg)" "" "0000749883" "00021656" "50" "772" "0" "772" "0" "c.772G>T" "r.(?)" "p.(Glu258*)" "" "0000749884" "00021656" "50" "743" "0" "743" "0" "c.743G>A" "r.(?)" "p.(Arg248Gln)" "" "0000749885" "00021656" "50" "742" "0" "742" "0" "c.742C>T" "r.(?)" "p.(Arg248Trp)" "" "0000749886" "00021656" "50" "738" "0" "738" "0" "c.738G>T" "r.(?)" "p.(Met246Ile)" "" "0000749887" "00021656" "50" "736" "0" "736" "0" "c.736A>G" "r.(?)" "p.(Met246Val)" "" "0000749888" "00021656" "50" "733" "0" "733" "0" "c.733G>C" "r.(?)" "p.(Gly245Arg)" "" "0000749889" "00021656" "50" "733" "0" "733" "0" "c.733G>A" "r.(?)" "p.(Gly245Ser)" "" "0000749890" "00021656" "50" "730" "0" "730" "0" "c.730G>A" "r.(?)" "p.(Gly244Ser)" "" "0000749891" "00021656" "50" "725" "0" "725" "0" "c.725G>A" "r.(?)" "p.(Cys242Tyr)" "" "0000749892" "00021656" "50" "713" "0" "713" "0" "c.713G>A" "r.(?)" "p.(Cys238Tyr)" "" "0000749893" "00021656" "50" "710" "0" "710" "0" "c.710T>C" "r.(?)" "p.(Met237Thr)" "" "0000749894" "00021656" "50" "686" "0" "686" "0" "c.686G>A" "r.(?)" "p.(Cys229Tyr)" "" "0000749895" "00021656" "50" "671" "0" "671" "0" "c.671A>C" "r.(?)" "p.(Glu224Ala)" "" "0000749896" "00021656" "50" "668" "0" "668" "0" "c.668C>T" "r.(?)" "p.(Pro223Leu)" "" "0000749897" "00021656" "50" "665" "0" "665" "0" "c.665C>T" "r.(?)" "p.(Pro222Leu)" "" "0000749898" "00021656" "50" "664" "0" "664" "0" "c.664C>T" "r.(?)" "p.(Pro222Ser)" "" "0000749899" "00021656" "50" "647" "0" "647" "0" "c.647T>G" "r.(?)" "p.(Val216Gly)" "" "0000749900" "00021656" "50" "644" "0" "644" "0" "c.644G>T" "r.(?)" "p.(Ser215Ile)" "" "0000749901" "00021656" "50" "638" "0" "638" "0" "c.638G>A" "r.(?)" "p.(Arg213Gln)" "" "0000749902" "00021656" "50" "629" "0" "629" "0" "c.629A>G" "r.(?)" "p.(Asn210Ser)" "" "0000749903" "00021656" "50" "619" "0" "619" "0" "c.619G>A" "r.(?)" "p.(Asp207Asn)" "" "0000749904" "00021656" "50" "607" "0" "607" "0" "c.607G>T" "r.(?)" "p.(Val203Leu)" "" "0000749905" "00021656" "50" "589" "0" "589" "0" "c.589G>A" "r.(?)" "p.(Val197Met)" "" "0000749906" "00021656" "50" "587" "0" "587" "0" "c.587G>A" "r.(?)" "p.(Arg196Gln)" "" "0000749907" "00021656" "50" "586" "0" "586" "0" "c.586C>T" "r.(?)" "p.(Arg196*)" "" "0000749908" "00021656" "50" "584" "0" "584" "0" "c.584T>C" "r.(?)" "p.(Ile195Thr)" "" "0000749909" "00021656" "50" "578" "0" "578" "0" "c.578A>G" "r.(?)" "p.(His193Arg)" "" "0000749910" "00021656" "50" "566" "0" "566" "0" "c.566C>G" "r.(?)" "p.(Ala189Gly)" "" "0000749911" "00021656" "50" "556" "0" "556" "0" "c.556G>A" "r.(?)" "p.(Asp186Asn)" "" "0000749912" "00021656" "50" "541" "0" "541" "0" "c.541C>T" "r.(?)" "p.(Arg181Cys)" "" "0000749913" "00021656" "50" "538" "0" "538" "0" "c.538G>A" "r.(?)" "p.(Glu180Lys)" "" "0000749914" "00021656" "50" "537" "0" "537" "0" "c.537T>G" "r.(?)" "p.(His179Gln)" "" "0000749915" "00021656" "50" "530" "0" "530" "0" "c.530C>T" "r.(?)" "p.(Pro177Leu)" "" "0000749916" "00021656" "50" "518" "0" "518" "0" "c.518T>G" "r.(?)" "p.(Val173Gly)" "" "0000749917" "00021656" "50" "502" "0" "502" "0" "c.502C>G" "r.(?)" "p.(His168Asp)" "" "0000749918" "00021656" "50" "493" "0" "493" "0" "c.493C>A" "r.(?)" "p.(Gln165Lys)" "" "0000749919" "00021656" "50" "488" "0" "488" "0" "c.488A>G" "r.(?)" "p.(Tyr163Cys)" "" "0000749920" "00021656" "50" "482" "0" "482" "0" "c.482C>A" "r.(?)" "p.(Ala161Asp)" "" "0000749921" "00021656" "50" "475" "0" "475" "0" "c.475G>C" "r.(?)" "p.(Ala159Pro)" "" "0000749922" "00021656" "50" "473" "0" "473" "0" "c.473G>C" "r.(?)" "p.(Arg158Pro)" "" "0000749923" "00021656" "50" "472" "0" "472" "0" "c.472C>T" "r.(?)" "p.(Arg158Cys)" "" "0000749924" "00021656" "50" "455" "0" "455" "0" "c.455C>T" "r.(?)" "p.(Pro152Leu)" "" "0000749925" "00021656" "50" "427" "0" "427" "0" "c.427G>A" "r.(?)" "p.(Val143Met)" "" "0000749926" "00021656" "50" "424" "0" "424" "0" "c.424C>A" "r.(?)" "p.(Pro142Thr)" "" "0000749927" "00021656" "50" "422" "0" "422" "0" "c.422G>T" "r.(?)" "p.(Cys141Phe)" "" "0000749928" "00021656" "50" "421" "0" "421" "0" "c.421T>G" "r.(?)" "p.(Cys141Gly)" "" "0000749929" "00021656" "50" "413" "0" "413" "0" "c.413C>T" "r.(?)" "p.(Ala138Val)" "" "0000749930" "00021656" "50" "408" "0" "408" "0" "c.408A>C" "r.(?)" "p.(Gln136His)" "" "0000749931" "00021656" "50" "407" "0" "407" "0" "c.407A>T" "r.(?)" "p.(Gln136Leu)" "" "0000749932" "00021656" "50" "402" "0" "402" "0" "c.402T>G" "r.(?)" "p.(Phe134Leu)" "" "0000749933" "00021656" "50" "389" "0" "389" "0" "c.389T>G" "r.(?)" "p.(Leu130Arg)" "" "0000749934" "00021656" "50" "388" "0" "388" "0" "c.388C>T" "r.(?)" "p.(Leu130Phe)" "" "0000749935" "00021656" "50" "376" "-1" "376" "-1" "c.376-1G>C" "r.spl?" "p.?" "" "0000749936" "00021656" "50" "374" "0" "374" "0" "c.374C>A" "r.(?)" "p.(Thr125Lys)" "" "0000749937" "00021656" "50" "353" "0" "353" "0" "c.353C>T" "r.(?)" "p.(Thr118Ile)" "" "0000749938" "00021656" "50" "344" "0" "344" "0" "c.344A>C" "r.(?)" "p.(His115Pro)" "" "0000749939" "00021656" "50" "328" "0" "328" "0" "c.328C>G" "r.(?)" "p.(Arg110Gly)" "" "0000749940" "00021656" "50" "322" "0" "322" "0" "c.322G>A" "r.(?)" "p.(Gly108Ser)" "" "0000749941" "00021656" "50" "314" "0" "314" "0" "c.314G>A" "r.(?)" "p.(Gly105Asp)" "" "0000749942" "00021656" "50" "313" "0" "313" "0" "c.313G>A" "r.(?)" "p.(Gly105Ser)" "" "0000749943" "00021656" "50" "309" "0" "309" "0" "c.309C>G" "r.(?)" "p.(Tyr103*)" "" "0000749944" "00021656" "50" "292" "0" "292" "0" "c.292C>T" "r.(?)" "p.(Pro98Ser)" "" "0000749945" "00021656" "50" "260" "0" "260" "0" "c.260C>T" "r.(?)" "p.(Pro87Leu)" "" "0000749946" "00021656" "50" "256" "0" "256" "0" "c.256G>A" "r.(?)" "p.(Ala86Thr)" "" "0000749947" "00021656" "50" "244" "0" "244" "0" "c.244C>T" "r.(?)" "p.(Pro82Ser)" "" "0000749948" "00021656" "50" "224" "0" "224" "0" "c.224C>A" "r.(?)" "p.(Pro75His)" "" "0000749949" "00021656" "50" "221" "0" "221" "0" "c.221C>T" "r.(?)" "p.(Ala74Val)" "" "0000749950" "00021656" "50" "188" "0" "188" "0" "c.188C>T" "r.(?)" "p.(Ala63Val)" "" "0000749951" "00021656" "50" "181" "0" "181" "0" "c.181G>A" "r.(?)" "p.(Asp61Asn)" "" "0000749952" "00021656" "50" "149" "0" "149" "0" "c.149T>C" "r.(?)" "p.(Ile50Thr)" "" "0000749953" "00021656" "50" "146" "0" "146" "0" "c.146A>G" "r.(?)" "p.(Asp49Gly)" "" "0000749954" "00021656" "50" "132" "0" "132" "0" "c.132G>T" "r.(?)" "p.(Met44Ile)" "" "0000749955" "00021656" "50" "86" "0" "86" "0" "c.86A>C" "r.(?)" "p.(Asn29Thr)" "" "0000749956" "00021656" "50" "79" "0" "79" "0" "c.79C>T" "r.(?)" "p.(Pro27Ser)" "" "0000754721" "00021656" "50" "1163" "0" "1163" "0" "c.1163A>C" "r.(?)" "p.(Glu388Ala)" "" "0000754722" "00021656" "50" "1160" "0" "1160" "0" "c.1160C>G" "r.(?)" "p.(Thr387Arg)" "" "0000754723" "00021656" "50" "1135" "0" "1135" "0" "c.1135C>A" "r.(?)" "p.(Arg379Ser)" "" "0000754724" "00021656" "50" "1130" "0" "1130" "0" "c.1130C>T" "r.(?)" "p.(Thr377Ile)" "" "0000754725" "00021656" "50" "1102" "0" "1102" "0" "c.1102C>T" "r.(?)" "p.(His368Tyr)" "" "0000754726" "00021656" "50" "1096" "0" "1096" "0" "c.1096T>G" "r.(?)" "p.(Ser366Ala)" "" "0000754727" "00021656" "50" "1079" "0" "1079" "0" "c.1079G>T" "r.(?)" "p.(Gly360Val)" "" "0000754728" "00021656" "50" "1079" "0" "1079" "0" "c.1079G>C" "r.(?)" "p.(Gly360Ala)" "" "0000754729" "00021656" "50" "1078" "0" "1078" "0" "c.1078G>A" "r.(?)" "p.(Gly360Arg)" "" "0000754730" "00021656" "50" "1073" "0" "1073" "0" "c.1073A>T" "r.(?)" "p.(Glu358Val)" "" "0000754731" "00021656" "50" "1060" "0" "1060" "0" "c.1060C>A" "r.(?)" "p.(Gln354Lys)" "" "0000754732" "00021656" "50" "1024" "0" "1024" "0" "c.1024C>G" "r.(?)" "p.(Arg342Gly)" "" "0000754733" "00021656" "50" "1015" "0" "1015" "0" "c.1015G>A" "r.(?)" "p.(Glu339Lys)" "" "0000754734" "00021656" "50" "1010" "0" "1010" "0" "c.1010G>A" "r.(?)" "p.(Arg337His)" "" "0000754735" "00021656" "50" "998" "0" "998" "0" "c.998G>A" "r.(?)" "p.(Arg333His)" "" "0000754736" "00021656" "50" "997" "0" "997" "0" "c.997C>T" "r.(?)" "p.(Arg333Cys)" "" "0000754737" "00021656" "50" "949" "0" "949" "0" "c.949C>A" "r.(?)" "p.(Gln317Lys)" "" "0000754738" "00021656" "50" "946" "0" "946" "0" "c.946C>A" "r.(?)" "p.(Pro316Thr)" "" "0000754739" "00021656" "50" "935" "0" "935" "0" "c.935C>G" "r.(?)" "p.(Thr312Ser)" "" "0000754740" "00021656" "50" "892" "0" "892" "0" "c.892G>A" "r.(?)" "p.(Glu298Lys)" "" "0000754741" "00021656" "50" "884" "0" "884" "0" "c.884C>T" "r.(?)" "p.(Pro295Leu)" "" "0000754742" "00021656" "50" "847" "0" "847" "0" "c.847C>T" "r.(?)" "p.(Arg283Cys)" "" "0000754743" "00021656" "50" "845" "0" "845" "0" "c.845G>T" "r.(?)" "p.(Arg282Leu)" "" "0000754744" "00021656" "50" "818" "0" "818" "0" "c.818G>A" "r.(?)" "p.(Arg273His)" "" "0000754745" "00021656" "50" "787" "0" "787" "0" "c.787A>G" "r.(?)" "p.(Asn263Asp)" "" "0000754746" "00021656" "50" "760" "0" "760" "0" "c.760A>G" "r.(?)" "p.(Ile254Val)" "" "0000754747" "00021656" "50" "704" "0" "704" "0" "c.704A>G" "r.(?)" "p.(Asn235Ser)" "" "0000754748" "00021656" "50" "661" "0" "661" "0" "c.661G>A" "r.(?)" "p.(Glu221Lys)" "" "0000754749" "00021656" "50" "659" "0" "659" "0" "c.659A>G" "r.(?)" "p.(Tyr220Cys)" "" "0000754750" "00021656" "50" "646" "0" "646" "0" "c.646G>A" "r.(?)" "p.(Val216Met)" "" "0000754751" "00021656" "50" "642" "0" "642" "0" "c.642T>G" "r.(?)" "p.(His214Gln)" "" "0000754752" "00021656" "50" "604" "0" "604" "0" "c.604C>T" "r.(?)" "p.(Arg202Cys)" "" "0000754753" "00021656" "50" "566" "0" "566" "0" "c.566C>T" "r.(?)" "p.(Ala189Val)" "" "0000754754" "00021656" "50" "558" "0" "558" "0" "c.558T>A" "r.(?)" "p.(Asp186Glu)" "" "0000754755" "00021656" "50" "554" "0" "554" "0" "c.554G>A" "r.(?)" "p.(Ser185Asn)" "" "0000754756" "00021656" "50" "542" "0" "542" "0" "c.542G>A" "r.(?)" "p.(Arg181His)" "" "0000754757" "00021656" "50" "524" "0" "524" "0" "c.524G>A" "r.(?)" "p.(Arg175His)" "" "0000754758" "00021656" "50" "523" "0" "523" "0" "c.523C>T" "r.(?)" "p.(Arg175Cys)" "" "0000754759" "00021656" "50" "509" "0" "509" "0" "c.509C>T" "r.(?)" "p.(Thr170Met)" "" "0000754760" "00021656" "50" "467" "0" "467" "0" "c.467G>A" "r.(?)" "p.(Arg156His)" "" "0000754761" "00021656" "50" "466" "0" "466" "0" "c.466C>T" "r.(?)" "p.(Arg156Cys)" "" "0000754762" "00021656" "50" "460" "0" "460" "0" "c.460G>A" "r.(?)" "p.(Gly154Ser)" "" "0000754763" "00021656" "50" "382" "0" "382" "0" "c.382C>A" "r.(?)" "p.(Pro128Thr)" "" "0000754764" "00021656" "50" "329" "0" "329" "0" "c.329G>A" "r.(?)" "p.(Arg110His)" "" "0000754765" "00021656" "50" "328" "0" "328" "0" "c.328C>T" "r.(?)" "p.(Arg110Cys)" "" "0000754766" "00021656" "50" "245" "0" "245" "0" "c.245C>T" "r.(?)" "p.(Pro82Leu)" "" "0000754767" "00021656" "50" "214" "0" "214" "0" "c.214C>G" "r.(?)" "p.(Pro72Ala)" "" "0000754768" "00021656" "50" "139" "0" "139" "0" "c.139C>T" "r.(?)" "p.(Pro47Ser)" "" "0000754769" "00021656" "50" "91" "0" "91" "0" "c.91G>A" "r.(?)" "p.(Val31Ile)" "" "0000754770" "00021656" "50" "31" "0" "31" "0" "c.31G>C" "r.(?)" "p.(Glu11Gln)" "" "0000754771" "00021656" "50" "28" "0" "28" "0" "c.28G>A" "r.(?)" "p.(Val10Ile)" "" "0000754772" "00021656" "50" "14" "0" "14" "0" "c.14A>G" "r.(?)" "p.(Gln5Arg)" "" "0000759495" "00021656" "50" "1163" "0" "1163" "0" "c.1163A>C" "r.(?)" "p.(Glu388Ala)" "" "0000759496" "00021656" "50" "1160" "0" "1160" "0" "c.1160C>G" "r.(?)" "p.(Thr387Arg)" "" "0000759497" "00021656" "50" "1135" "0" "1135" "0" "c.1135C>A" "r.(?)" "p.(Arg379Ser)" "" "0000759498" "00021656" "50" "1130" "0" "1130" "0" "c.1130C>T" "r.(?)" "p.(Thr377Ile)" "" "0000759499" "00021656" "50" "1102" "0" "1102" "0" "c.1102C>T" "r.(?)" "p.(His368Tyr)" "" "0000759500" "00021656" "50" "1096" "0" "1096" "0" "c.1096T>G" "r.(?)" "p.(Ser366Ala)" "" "0000759501" "00021656" "50" "1079" "0" "1079" "0" "c.1079G>T" "r.(?)" "p.(Gly360Val)" "" "0000759502" "00021656" "50" "1079" "0" "1079" "0" "c.1079G>C" "r.(?)" "p.(Gly360Ala)" "" "0000759503" "00021656" "50" "1078" "0" "1078" "0" "c.1078G>A" "r.(?)" "p.(Gly360Arg)" "" "0000759504" "00021656" "50" "1073" "0" "1073" "0" "c.1073A>T" "r.(?)" "p.(Glu358Val)" "" "0000759505" "00021656" "50" "1060" "0" "1060" "0" "c.1060C>A" "r.(?)" "p.(Gln354Lys)" "" "0000759506" "00021656" "50" "1024" "0" "1024" "0" "c.1024C>G" "r.(?)" "p.(Arg342Gly)" "" "0000759507" "00021656" "50" "1015" "0" "1015" "0" "c.1015G>A" "r.(?)" "p.(Glu339Lys)" "" "0000759508" "00021656" "50" "1010" "0" "1010" "0" "c.1010G>A" "r.(?)" "p.(Arg337His)" "" "0000759509" "00021656" "50" "998" "0" "998" "0" "c.998G>A" "r.(?)" "p.(Arg333His)" "" "0000759510" "00021656" "50" "997" "0" "997" "0" "c.997C>T" "r.(?)" "p.(Arg333Cys)" "" "0000759511" "00021656" "50" "949" "0" "949" "0" "c.949C>A" "r.(?)" "p.(Gln317Lys)" "" "0000759512" "00021656" "50" "946" "0" "946" "0" "c.946C>A" "r.(?)" "p.(Pro316Thr)" "" "0000759513" "00021656" "50" "935" "0" "935" "0" "c.935C>G" "r.(?)" "p.(Thr312Ser)" "" "0000759514" "00021656" "50" "892" "0" "892" "0" "c.892G>A" "r.(?)" "p.(Glu298Lys)" "" "0000759515" "00021656" "50" "884" "0" "884" "0" "c.884C>T" "r.(?)" "p.(Pro295Leu)" "" "0000759516" "00021656" "50" "847" "0" "847" "0" "c.847C>T" "r.(?)" "p.(Arg283Cys)" "" "0000759517" "00021656" "50" "845" "0" "845" "0" "c.845G>T" "r.(?)" "p.(Arg282Leu)" "" "0000759518" "00021656" "50" "818" "0" "818" "0" "c.818G>A" "r.(?)" "p.(Arg273His)" "" "0000759519" "00021656" "50" "787" "0" "787" "0" "c.787A>G" "r.(?)" "p.(Asn263Asp)" "" "0000759520" "00021656" "50" "760" "0" "760" "0" "c.760A>G" "r.(?)" "p.(Ile254Val)" "" "0000759521" "00021656" "50" "704" "0" "704" "0" "c.704A>G" "r.(?)" "p.(Asn235Ser)" "" "0000759522" "00021656" "50" "661" "0" "661" "0" "c.661G>A" "r.(?)" "p.(Glu221Lys)" "" "0000759523" "00021656" "50" "659" "0" "659" "0" "c.659A>G" "r.(?)" "p.(Tyr220Cys)" "" "0000759524" "00021656" "50" "646" "0" "646" "0" "c.646G>A" "r.(?)" "p.(Val216Met)" "" "0000759525" "00021656" "50" "642" "0" "642" "0" "c.642T>G" "r.(?)" "p.(His214Gln)" "" "0000759526" "00021656" "50" "604" "0" "604" "0" "c.604C>T" "r.(?)" "p.(Arg202Cys)" "" "0000759527" "00021656" "50" "566" "0" "566" "0" "c.566C>T" "r.(?)" "p.(Ala189Val)" "" "0000759528" "00021656" "50" "558" "0" "558" "0" "c.558T>A" "r.(?)" "p.(Asp186Glu)" "" "0000759529" "00021656" "50" "554" "0" "554" "0" "c.554G>A" "r.(?)" "p.(Ser185Asn)" "" "0000759530" "00021656" "50" "542" "0" "542" "0" "c.542G>A" "r.(?)" "p.(Arg181His)" "" "0000759531" "00021656" "50" "524" "0" "524" "0" "c.524G>A" "r.(?)" "p.(Arg175His)" "" "0000759532" "00021656" "50" "523" "0" "523" "0" "c.523C>T" "r.(?)" "p.(Arg175Cys)" "" "0000759533" "00021656" "50" "509" "0" "509" "0" "c.509C>T" "r.(?)" "p.(Thr170Met)" "" "0000759534" "00021656" "50" "467" "0" "467" "0" "c.467G>A" "r.(?)" "p.(Arg156His)" "" "0000759535" "00021656" "50" "466" "0" "466" "0" "c.466C>T" "r.(?)" "p.(Arg156Cys)" "" "0000759536" "00021656" "50" "460" "0" "460" "0" "c.460G>A" "r.(?)" "p.(Gly154Ser)" "" "0000759537" "00021656" "50" "382" "0" "382" "0" "c.382C>A" "r.(?)" "p.(Pro128Thr)" "" "0000759538" "00021656" "50" "329" "0" "329" "0" "c.329G>A" "r.(?)" "p.(Arg110His)" "" "0000759539" "00021656" "50" "328" "0" "328" "0" "c.328C>T" "r.(?)" "p.(Arg110Cys)" "" "0000759540" "00021656" "50" "245" "0" "245" "0" "c.245C>T" "r.(?)" "p.(Pro82Leu)" "" "0000759541" "00021656" "50" "214" "0" "214" "0" "c.214C>G" "r.(?)" "p.(Pro72Ala)" "" "0000759542" "00021656" "50" "139" "0" "139" "0" "c.139C>T" "r.(?)" "p.(Pro47Ser)" "" "0000759543" "00021656" "50" "91" "0" "91" "0" "c.91G>A" "r.(?)" "p.(Val31Ile)" "" "0000759544" "00021656" "50" "31" "0" "31" "0" "c.31G>C" "r.(?)" "p.(Glu11Gln)" "" "0000759545" "00021656" "50" "28" "0" "28" "0" "c.28G>A" "r.(?)" "p.(Val10Ile)" "" "0000759546" "00021656" "50" "14" "0" "14" "0" "c.14A>G" "r.(?)" "p.(Gln5Arg)" "" "0000789671" "00021656" "70" "528" "0" "528" "0" "c.528C>A" "r.(?)" "p.(Cys176Ter)" "5" "0000808268" "00021656" "50" "998" "0" "998" "0" "c.998G>A" "r.(?)" "p.(Arg333His)" "" "0000808269" "00021656" "30" "868" "0" "868" "0" "c.868C>T" "r.(?)" "p.(Arg290Cys)" "" "0000808270" "00021656" "10" "782" "92" "782" "92" "c.782+92T>G" "r.(=)" "p.(=)" "" "0000808271" "00021656" "10" "782" "72" "782" "72" "c.782+72C>T" "r.(=)" "p.(=)" "" "0000808272" "00021656" "10" "704" "0" "704" "0" "c.704A>G" "r.(?)" "p.(Asn235Ser)" "" "0000808273" "00021656" "10" "672" "62" "672" "62" "c.672+62A>G" "r.(=)" "p.(=)" "" "0000808274" "00021656" "90" "637" "0" "637" "0" "c.637C>T" "r.(?)" "p.(Arg213*)" "" "0000808275" "00021656" "30" "375" "56" "375" "56" "c.375+56C>T" "r.(=)" "p.(=)" "" "0000808276" "00021656" "70" "374" "0" "374" "0" "c.374C>T" "r.(?)" "p.(Thr125Met)" "" "0000808277" "00021656" "10" "215" "0" "215" "0" "c.215C>G" "r.(?)" "p.(Pro72Arg)" "" "0000808278" "00021656" "90" "80" "0" "80" "0" "c.80del" "r.(?)" "p.(Pro27Leufs*17)" "" "0000808279" "00021656" "30" "-2263" "0" "-2263" "0" "c.-2263G>A" "r.(?)" "p.(=)" "" "0000808280" "00021656" "30" "-16057" "0" "-16057" "0" "c.-16057C>T" "r.(?)" "p.(=)" "" "0000833858" "00021656" "90" "571" "0" "572" "0" "c.571_572del" "r.(?)" "p.(Pro191SerfsTer17)" "" "0000833859" "00021656" "90" "993" "1" "993" "1" "c.993+1G>A" "r.spl" "p.?" "" "0000833860" "00021656" "90" "524" "0" "524" "0" "c.524G>A" "r.(?)" "p.(Arg175His)" "" "0000833861" "00021656" "90" "949" "0" "949" "0" "c.949C>T" "r.(?)" "p.(Gln317Ter)" "" "0000833862" "00021656" "90" "742" "0" "742" "0" "c.742C>T" "r.(?)" "p.(Arg248Trp)" "" "0000833863" "00021656" "90" "730" "0" "730" "0" "c.730G>A" "r.(?)" "p.(Gly244Ser)" "" "0000833864" "00021656" "90" "638" "0" "638" "0" "c.638G>A" "r.(?)" "p.(Arg213Gln)" "" "0000833973" "00021656" "90" "818" "0" "818" "0" "c.818G>A" "r.(?)" "p.(Arg273His)" "" "0000833974" "00021656" "90" "659" "0" "659" "0" "c.659A>G" "r.(?)" "p.(Tyr220Cys)" "" "0000833975" "00021656" "90" "818" "0" "818" "0" "c.818G>A" "r.(?)" "p.(Arg273His)" "" "0000833976" "00021656" "90" "574" "0" "574" "0" "c.574C>T" "r.(?)" "p.(Gln192Ter)" "" "0000833977" "00021656" "90" "659" "0" "659" "0" "c.659A>G" "r.(?)" "p.(Tyr220Cys)" "" "0000833978" "00021656" "90" "375" "0" "375" "0" "c.375G>T" "r.(?)" "p.(Thr125=)" "" "0000833979" "00021656" "90" "1009" "0" "1009" "0" "c.1009C>T" "r.(?)" "p.(Arg337Cys)" "" "0000833980" "00021656" "90" "743" "0" "743" "0" "c.743G>A" "r.(?)" "p.(Arg248Gln)" "" "0000833981" "00021656" "90" "524" "0" "524" "0" "c.524G>A" "r.(?)" "p.(Arg175His)" "" "0000833982" "00021656" "90" "919" "1" "919" "1" "c.919+1G>A" "r.spl" "p.?" "" "0000833983" "00021656" "70" "832" "0" "832" "0" "c.832C>T" "r.(?)" "p.(Pro278Ser)" "" "0000833984" "00021656" "90" "916" "0" "916" "0" "c.916C>T" "r.(?)" "p.(Arg306Ter)" "" "0000833985" "00021656" "90" "916" "0" "916" "0" "c.916C>T" "r.(?)" "p.(Arg306Ter)" "" "0000833986" "00021656" "90" "733" "0" "733" "0" "c.733G>A" "r.(?)" "p.(Gly245Ser)" "" "0000833987" "00021656" "90" "896" "0" "909" "0" "c.896_909del" "r.(?)" "p.(Leu299HisfsTer2)" "" "0000845120" "00021656" "90" "91" "0" "91" "0" "c.91G>A" "r.(?)" "p.(Val31Ile)" "" "0000855119" "00021656" "70" "646" "0" "646" "0" "c.646G>A" "r.(?)" "p.(Val216Met)" "" "0000855120" "00021656" "50" "74" "47" "74" "47" "c.74+47C>T" "r.(=)" "p.(=)" "" "0000865513" "00021656" "50" "993" "227" "993" "227" "c.993+227A>C" "r.(=)" "p.(=)" "" "0000865514" "00021656" "30" "993" "12" "993" "12" "c.993+12T>C" "r.(=)" "p.(=)" "" "0000865515" "00021656" "50" "523" "0" "523" "0" "c.523C>T" "r.(?)" "p.(Arg175Cys)" "" "0000865516" "00021656" "70" "469" "0" "469" "0" "c.469G>T" "r.(?)" "p.(Val157Phe)" "" "0000865517" "00021656" "30" "-15684" "0" "-15684" "0" "c.-15684A>G" "r.(?)" "p.(=)" "" "0000865518" "00021656" "30" "-16057" "0" "-16057" "0" "c.-16057C>T" "r.(?)" "p.(=)" "" "0000869100" "00021656" "70" "845" "0" "845" "0" "c.845G>A" "r.(?)" "p.(Arg282Gln)" "" "0000877182" "00021656" "50" "993" "313" "993" "313" "c.993+313G>A" "r.(?)" "p.(?)" "" "0000894301" "00021656" "90" "994" "-2" "994" "-2" "c.994-2A>G" "r.spl?" "p.?" "" "0000894302" "00021656" "90" "844" "0" "844" "0" "c.844C>T" "r.(?)" "p.(Arg282Trp)" "" "0000894303" "00021656" "70" "799" "0" "799" "0" "c.799C>T" "r.(?)" "p.(Arg267Trp)" "" "0000894304" "00021656" "90" "743" "0" "743" "0" "c.743G>A" "r.(?)" "p.(Arg248Gln)" "" "0000894305" "00021656" "10" "672" "18" "672" "18" "c.672+18G>C" "r.(=)" "p.(=)" "" "0000894306" "00021656" "70" "587" "0" "587" "0" "c.587G>C" "r.(?)" "p.(Arg196Pro)" "" "0000894307" "00021656" "90" "524" "0" "524" "0" "c.524G>A" "r.(?)" "p.(Arg175His)" "" "0000894308" "00021656" "90" "375" "0" "375" "0" "c.375G>A" "r.(?)" "p.(Thr125=)" "" "0000894309" "00021656" "90" "323" "0" "324" "0" "c.323_324insAAAGG" "r.(?)" "p.(Phe109Lysfs*16)" "" "0000894310" "00021656" "30" "-2263" "0" "-2263" "0" "c.-2263G>A" "r.(?)" "p.(=)" "" "0000894311" "00021656" "50" "-16049" "0" "-16049" "0" "c.-16049dup" "r.(?)" "p.(=)" "" "0000914978" "00021656" "30" "994" "-17" "994" "-17" "c.994-17C>T" "r.(=)" "p.(=)" "" "0000914979" "00021656" "90" "797" "0" "797" "0" "c.797G>A" "r.(?)" "p.(Gly266Glu)" "" "0000914980" "00021656" "50" "338" "0" "338" "0" "c.338T>G" "r.(?)" "p.(Phe113Cys)" "" "0000914981" "00021656" "70" "332" "0" "332" "0" "c.332T>C" "r.(?)" "p.(Leu111Pro)" "" "0000914982" "00021656" "70" "332" "0" "332" "0" "c.332T>C" "r.(?)" "p.(Leu111Pro)" "" "0000914983" "00021656" "30" "-1707" "0" "-1707" "0" "c.-1707G>C" "r.(?)" "p.(=)" "" "0000918151" "00021656" "90" "1010" "0" "1010" "0" "c.1010G>A" "r.(?)" "p.(Arg337His)" "" "0000918610" "00021656" "90" "1010" "0" "1010" "0" "c.1010G>A" "r.(?)" "p.(Arg337His)" "" "0000918613" "00021656" "70" "818" "0" "818" "0" "c.818G>A" "r.(?)" "p.(Arg273His)" "" "0000918614" "00021656" "50" "215" "0" "215" "0" "c.215C>G" "r.(?)" "p.(Pro72Arg)" "" "0000920375" "00021656" "90" "1010" "0" "1010" "0" "c.1010G>A" "r.(?)" "p.(Arg337His)" "" "0000920392" "00021656" "90" "1010" "0" "1010" "0" "c.1010G>A" "r.(?)" "p.(Arg337His)" "" "0000920405" "00021656" "70" "375" "6" "375" "6" "c.375+6T>C" "r.?" "p.?" "4i" "0000920407" "00021656" "70" "376" "-2" "376" "-2" "c.376-2dup" "r.spl?" "p.?" "4i" "0000920417" "00021656" "50" "79" "0" "79" "0" "c.79C>A" "r.(?)" "p.(Pro27Thr)" "2" "0000920418" "00021656" "90" "97" "-2" "97" "-2" "c.97-2A>C" "r.spl" "p.?" "2i" "0000920419" "00021656" "90" "323" "0" "329" "0" "c.323_329dup" "r.(?)" "p.(Leu111Phefs*40)" "3" "0000920435" "00021656" "90" "460" "0" "460" "0" "c.460G>A" "r.(?)" "p.(Gly154Ser)" "4" "0000920436" "00021656" "90" "466" "0" "466" "0" "c.466C>T" "r.(?)" "p.(Arg156Cys)" "4" "0000920483" "00021656" "90" "473" "0" "473" "0" "c.473G>A" "r.(?)" "p.(Arg158His)" "4" "0000920484" "00021656" "90" "493" "0" "493" "0" "c.493C>T" "r.(?)" "p.(Gln165*)" "4" "0000920485" "00021656" "90" "536" "0" "536" "0" "c.536A>T" "r.(?)" "p.(His179Leu)" "4" "0000920486" "00021656" "70" "589" "0" "589" "0" "c.589G>C" "r.(?)" "p.(Val197Leu)" "5" "0000920487" "00021656" "90" "614" "0" "614" "0" "c.614A>G" "r.(?)" "p.(Tyr205Cys)" "5" "0000920488" "00021656" "90" "743" "0" "743" "0" "c.743G>A" "r.(?)" "p.(Arg248Gln)" "6" "0000920495" "00021656" "90" "764" "0" "766" "0" "c.764_766del" "r.(?)" "p.(Ile255del)" "" "0000920497" "00021656" "90" "902" "0" "902" "0" "c.902del" "r.(?)" "p.(Pro301Glnfs*44)" "7" "0000926644" "00021656" "30" "783" "-33" "783" "-33" "c.783-33T>C" "r.(=)" "p.(=)" "" "0000926645" "00021656" "90" "731" "0" "731" "0" "c.731del" "r.(?)" "p.(Gly244Alafs*3)" "" "0000926646" "00021656" "30" "75" "-7" "75" "-7" "c.75-7C>T" "r.(=)" "p.(=)" "" "0000930890" "00021656" "90" "796" "0" "796" "0" "c.796G>A" "r.(?)" "p.(Gly266Arg)" "" "0000930891" "00021656" "30" "510" "0" "510" "0" "c.510G>A" "r.(?)" "p.(Thr170=)" "" "0000930892" "00021656" "30" "96" "26" "96" "26" "c.96+26C>T" "r.(=)" "p.(=)" "" "0000951043" "00021656" "90" "1009" "0" "1009" "0" "c.1009C>T" "r.(?)" "p.(Arg337Cys)" "" "0000951044" "00021656" "90" "818" "0" "818" "0" "c.818G>A" "r.(?)" "p.(Arg273His)" "" "0000951045" "00021656" "90" "743" "0" "743" "0" "c.743G>A" "r.(?)" "p.(Arg248Gln)" "" "0000951046" "00021656" "90" "742" "0" "742" "0" "c.742C>T" "r.(?)" "p.(Arg248Trp)" "" "0000951047" "00021656" "10" "215" "0" "215" "0" "c.215C>G" "r.(?)" "p.(Pro72Arg)" "" "0000951048" "00021656" "30" "-15984" "0" "-15984" "0" "c.-15984A>G" "r.(?)" "p.(=)" "" "0000951049" "00021656" "30" "-16005" "0" "-16005" "0" "c.-16005G>A" "r.(?)" "p.(=)" "" "0000952123" "00021656" "90" "838" "0" "838" "0" "c.838A>G" "r.(?)" "p.(Arg280Gly)" "" "0000952124" "00021656" "90" "314" "0" "314" "0" "c.314G>T" "r.(?)" "p.(Gly105Val)" "" "0000960047" "00021656" "90" "743" "0" "743" "0" "c.743G>A" "r.(?)" "p.(Arg248Gln)" "6" "0000969238" "00021656" "30" "1100" "30" "1100" "30" "c.1100+30A>T" "r.(=)" "p.(=)" "" "0000969239" "00021656" "50" "1015" "0" "1015" "0" "c.1015G>A" "r.(?)" "p.(Glu339Lys)" "" "0000969240" "00021656" "50" "800" "0" "800" "0" "c.800G>A" "r.(?)" "p.(Arg267Gln)" "" "0000969241" "00021656" "90" "524" "0" "524" "0" "c.524G>A" "r.(?)" "p.(Arg175His)" "" "0000969242" "00021656" "30" "255" "0" "255" "0" "c.255T>C" "r.(?)" "p.(Pro85=)" "" "0000982817" "00021656" "30" "1232" "0" "1232" "0" "c.*50C>G" "r.(=)" "p.(=)" "" "0000982818" "00021656" "90" "1024" "0" "1024" "0" "c.1024C>T" "r.(?)" "p.(Arg342Ter)" "" "0000982819" "00021656" "30" "993" "326" "993" "341" "c.993+326_993+341del" "r.(=)" "p.(=)" "" "0000982820" "00021656" "50" "848" "0" "848" "0" "c.848G>A" "r.(?)" "p.(Arg283His)" "" "0000982821" "00021656" "70" "534" "0" "535" "0" "c.534_535delinsTT" "r.(?)" "p.(His179Tyr)" "" "0000982822" "00021656" "50" "-14400" "0" "-14400" "0" "c.-14400G>A" "r.(?)" "p.(=)" "" "0000982823" "00021656" "50" "-15172" "0" "-15172" "0" "c.-15172C>T" "r.(?)" "p.(=)" "" "0000982824" "00021656" "50" "-16049" "0" "-16049" "0" "c.-16049dup" "r.(?)" "p.(=)" "" "0000985169" "00021656" "90" "637" "0" "639" "0" "c.637_639delinsTGG" "r.(?)" "p.(Arg213Trp)" "6" "0000985182" "00021656" "90" "775" "0" "782" "14" "c.775_782+14delinsAGTG" "r.?" "p.?" "7" "0001003714" "00021656" "10" "2357" "0" "2357" "0" "c.*1175A>C" "r.(=)" "p.(=)" "" "0001003715" "00021656" "30" "875" "0" "875" "0" "c.875A>G" "r.(?)" "p.(Lys292Arg)" "" "0001003716" "00021656" "90" "818" "0" "818" "0" "c.818G>A" "r.(?)" "p.(Arg273His)" "" "0001003717" "00021656" "70" "711" "0" "711" "0" "c.711G>T" "r.(?)" "p.(Met237Ile)" "" "0001003718" "00021656" "30" "672" "15" "672" "15" "c.672+15T>C" "r.(=)" "p.(=)" "" "0001003719" "00021656" "50" "587" "0" "587" "0" "c.587G>A" "r.(?)" "p.(Arg196Gln)" "" "0001003720" "00021656" "50" "-1406" "0" "-1406" "0" "c.-1406C>T" "r.(?)" "p.(=)" "" "0001015619" "00021656" "90" "1009" "0" "1009" "0" "c.1009C>T" "r.(?)" "p.(Arg337Cys)" "" "0001015620" "00021656" "90" "1009" "0" "1009" "0" "c.1009C>T" "r.(?)" "p.(Arg337Cys)" "" "0001015621" "00021656" "90" "967" "0" "967" "0" "c.967del" "r.(?)" "p.(Leu323Trpfs*22)" "" "0001015622" "00021656" "10" "935" "0" "935" "0" "c.935C>G" "r.(?)" "p.(Thr312Ser)" "" "0001015623" "00021656" "90" "659" "0" "659" "0" "c.659A>G" "r.(?)" "p.(Tyr220Cys)" "" "0001015624" "00021656" "90" "614" "0" "614" "0" "c.614A>G" "r.(?)" "p.(Tyr205Cys)" "" "0001015625" "00021656" "50" "523" "0" "523" "0" "c.523C>T" "r.(?)" "p.(Arg175Cys)" "" "0001015626" "00021656" "70" "517" "0" "517" "0" "c.517G>A" "r.(?)" "p.(Val173Met)" "" "0001015627" "00021656" "10" "139" "0" "139" "0" "c.139C>T" "r.(?)" "p.(Pro47Ser)" "" "0001016677" "00021656" "90" "-8388608" "0" "-1" "0" "c.(?_-1)del" "r.0?" "p.0?" "" "0001027057" "00021656" "90" "706" "0" "706" "0" "c.706T>G" "r.(?)" "p.(Tyr236Asp)" "" "0001027058" "00021656" "10" "672" "31" "672" "31" "c.672+31A>G" "r.(=)" "p.(=)" "" "0001027059" "00021656" "70" "542" "0" "542" "0" "c.542G>A" "r.(?)" "p.(Arg181His)" "" "0001027060" "00021656" "90" "451" "0" "451" "0" "c.451C>T" "r.(?)" "p.(Pro151Ser)" "" "0001027061" "00021656" "50" "428" "0" "430" "0" "c.428_430del" "r.(?)" "p.(Val143_Gln144delinsGlu)" "" "0001027062" "00021656" "30" "216" "0" "216" "0" "c.216C>T" "r.(?)" "p.(=)" "" "0001027063" "00021656" "30" "215" "0" "216" "0" "c.215_216delinsGT" "r.(?)" "p.(Pro72Arg)" "" "0001027064" "00021656" "90" "130" "0" "133" "0" "c.130_133del" "r.(?)" "p.(Met44Cysfs*78)" "" "0001029684" "00021656" "90" "396" "0" "396" "0" "c.396G>C" "r.(?)" "p.(Lys132Asn)" "" "0001029752" "00021656" "90" "824" "0" "824" "0" "c.824G>A" "r.(?)" "p.(Cys275Tyr)" "" "0001029753" "00021656" "70" "392" "0" "393" "0" "c.392_393insG" "r.(?)" "p.(Asn131LysfsTer18)" "" "0001029757" "00021656" "90" "673" "-2" "673" "-2" "c.673-2A>T" "r.(?)" "p.(?)" "" "0001029761" "00021656" "90" "747" "0" "747" "0" "c.747G>T" "r.(?)" "p.(Arg249Ser)" "" "0001029762" "00021656" "90" "329" "0" "329" "0" "c.329G>T" "r.(?)" "p.(Arg110Leu)" "" "0001029763" "00021656" "90" "749" "0" "749" "0" "c.749C>T" "r.(?)" "p.(Pro250Leu)" "" "0001029764" "00021656" "70" "227" "0" "227" "0" "c.227del" "r.(?)" "p.(Ala76AspfsTer47)" "" "0001029809" "00021656" "90" "797" "0" "797" "0" "c.797dup" "r.(?)" "p.(Arg267ThrfsTer5)" "" "0001029859" "00021656" "70" "375" "0" "375" "0" "c.375G>T" "r.176_375del" "p.Gly59ValfsTer23" "4" "0001029860" "00021656" "70" "376" "-2" "376" "-2" "c.376-2A>G" "r.376_396del" "p.Tyr126_Lys132del" "4i" "0001029896" "00021656" "90" "844" "0" "844" "0" "c.844C>T" "r.(?)" "p.(Arg282Trp)" "" "0001030037" "00021656" "70" "376" "-1" "376" "-1" "c.376-1G>C" "r.(?)" "p.(?)" "" "0001042203" "00021656" "10" "993" "223" "993" "223" "c.993+223T>G" "r.(=)" "p.(=)" "" "0001042204" "00021656" "50" "370" "0" "370" "0" "c.370T>G" "r.(?)" "p.(Cys124Gly)" "" "0001042205" "00021656" "10" "215" "0" "215" "0" "c.215C>G" "r.(?)" "p.(Pro72Arg)" "" "0001042206" "00021656" "30" "90" "0" "90" "0" "c.90C>T" "r.(?)" "p.(=)" "" "0001042207" "00021656" "50" "-15405" "0" "-15405" "0" "c.-15405A>T" "r.(?)" "p.(=)" "" "0001045034" "00021656" "50" "994" "-3" "994" "-3" "c.994-3C>G" "r.(?)" "p.(?)" "" "0001045035" "00021656" "90" "832" "0" "832" "0" "c.832C>T" "r.(?)" "p.(Pro278Ser)" "" "0001045036" "00021656" "90" "731" "0" "731" "0" "c.731G>A" "r.(?)" "p.(Gly244Asp)" "" "0001045358" "00021656" "90" "742" "0" "742" "0" "c.742C>T" "r.(?)" "p.(Arg248Trp)" "" "0001045473" "00021656" "90" "277" "0" "277" "0" "c.277del" "r.(?)" "p.(Leu93CysfsTer30)" "" "0001046672" "00021656" "30" "994" "-41" "994" "-41" "c.994-41C>T" "r.(=)" "p.(=)" "" "0001046673" "00021656" "90" "854" "0" "854" "0" "c.854del" "r.(?)" "p.(Glu285Glyfs*60)" "" "0001046674" "00021656" "90" "638" "0" "638" "0" "c.638G>A" "r.(?)" "p.(Arg213Gln)" "" "0001047553" "00021656" "90" "817" "0" "817" "0" "c.817C>T" "r.(?)" "p.(Arg273Cys)" "" "0001047982" "00021656" "50" "1024" "0" "1024" "0" "c.1024C>G" "r.(?)" "p.(Arg342Gly)" "" "0001048012" "00021656" "10" "673" "-36" "673" "-36" "c.673-36G>C" "r.(?)" "p.(?)" "" "0001048016" "00021656" "90" "711" "0" "711" "0" "c.711G>A" "r.(?)" "p.(Met237Ile)" "" "0001048024" "00021656" "30" "1014" "0" "1014" "0" "c.1014C>T" "r.(?)" "p.(Phe338=)" "" "0001048130" "00021656" "70" "375" "0" "375" "0" "c.375G>A" "r.(?)" "p.(Thr125=)" "" "0001048150" "00021656" "90" "833" "0" "833" "0" "c.833C>T" "r.(?)" "p.(Pro278Leu)" "" "0001048162" "00021656" "90" "398" "0" "398" "0" "c.398T>C" "r.(?)" "p.(Met133Thr)" "" "0001048163" "00021656" "70" "754" "0" "762" "0" "c.754_762del" "r.(?)" "p.(Leu252_Ile254del)" "" "0001048164" "00021656" "90" "375" "2" "375" "2" "c.375+2T>C" "r.(?)" "p.(?)" "" "0001048165" "00021656" "90" "548" "0" "548" "0" "c.548C>G" "r.(?)" "p.(Ser183Ter)" "" "0001049495" "00021656" "10" "1101" "-73" "1101" "-73" "c.1101-73G>C" "r.(?)" "p.(?)" "" "0001055810" "00021656" "70" "1031" "0" "1031" "0" "c.1031T>C" "r.(?)" "p.(Leu344Pro)" "" "0001055811" "00021656" "90" "821" "0" "821" "0" "c.821T>G" "r.(?)" "p.(Val274Gly)" "" "0001055812" "00021656" "10" "673" "-36" "673" "-36" "c.673-36G>C" "r.(=)" "p.(=)" "" "0001055813" "00021656" "90" "499" "0" "499" "0" "c.499C>T" "r.(?)" "p.(Gln167*)" "" "0001055814" "00021656" "90" "473" "0" "473" "0" "c.473G>A" "r.(?)" "p.(Arg158His)" "" "0001055815" "00021656" "70" "395" "0" "395" "0" "c.395A>G" "r.(?)" "p.(Lys132Arg)" "" "0001055816" "00021656" "30" "215" "0" "215" "0" "c.215C>A" "r.(?)" "p.(Pro72His)" "" "0001057754" "00021656" "90" "314" "0" "314" "0" "c.314G>T" "r.(?)" "p.(Gly105Val)" "4" "0001059744" "00021656" "30" "1101" "-88" "1101" "-88" "c.1101-88G>A" "r.(?)" "p.(?)" "" "0001059751" "00021656" "10" "1101" "-376" "1101" "-376" "c.1101-376C>T" "r.(?)" "p.(?)" "" "0001059756" "00021656" "70" "578" "0" "578" "0" "c.578A>T" "r.(?)" "p.(His193Leu)" "" "0001060702" "00021656" "50" "623" "0" "623" "0" "c.623A>G" "r.623A>G" "p.Asp208Gly" "" "0001060703" "00021656" "30" "783" "-60" "783" "-60" "c.783-60G>A" "r.782_783=" "p.=" "" "0001061009" "00021656" "10" "993" "505" "993" "505" "c.993+505G>A" "r.(?)" "p.(?)" "" "0001061952" "00021656" "90" "78" "0" "78" "0" "c.78del" "r.(?)" "p.(Pro27LeufsTer17)" "" "0001062821" "00021656" "90" "733" "0" "733" "0" "c.733G>A" "r.(?)" "p.(Gly245Ser)" "" "0001066616" "00021656" "50" "3791" "0" "3791" "0" "c.*2609C>A" "r.(=)" "p.(=)" "" "0001066617" "00021656" "90" "994" "-1" "994" "-1" "c.994-1G>C" "r.spl?" "p.?" "" "0001066618" "00021656" "50" "993" "227" "993" "227" "c.993+227A>C" "r.(=)" "p.(=)" "" "0001066619" "00021656" "90" "574" "0" "574" "0" "c.574C>T" "r.(?)" "p.(Gln192*)" "" "0001066620" "00021656" "70" "542" "0" "542" "0" "c.542G>A" "r.(?)" "p.(Arg181His)" "" "0001066621" "00021656" "70" "526" "0" "526" "0" "c.526T>G" "r.(?)" "p.(Cys176Gly)" "" "0001066622" "00021656" "90" "216" "0" "216" "0" "c.216dup" "r.(?)" "p.(Val73ArgfsTer76)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 573 "{{screeningid}}" "{{variantid}}" "0000003211" "0000021759" "0000046392" "0000073916" "0000046393" "0000073917" "0000046394" "0000073918" "0000046395" "0000073919" "0000046396" "0000073920" "0000046397" "0000073921" "0000046398" "0000073922" "0000046399" "0000073923" "0000046400" "0000073924" "0000046401" "0000073925" "0000046425" "0000073949" "0000047421" "0000076112" "0000047423" "0000076115" "0000047502" "0000076255" "0000048186" "0000077008" "0000074819" "0000119918" "0000079956" "0000128832" "0000091014" "0000149143" "0000091015" "0000149144" "0000091016" "0000149145" "0000091017" "0000149146" "0000091018" "0000149147" "0000091019" "0000149148" "0000091020" "0000149149" "0000091021" "0000149150" "0000091022" "0000149151" "0000091023" "0000149152" "0000091024" "0000149153" "0000156489" "0000359603" "0000179456" "0000402917" "0000179457" "0000402918" "0000179458" "0000402919" "0000179459" "0000402920" "0000179460" "0000402921" "0000179461" "0000402922" "0000179462" "0000402923" "0000179463" "0000402924" "0000179464" "0000402925" "0000179465" "0000402926" "0000179466" "0000402927" "0000179467" "0000402928" "0000179468" "0000402929" "0000179469" "0000402930" "0000179470" "0000402931" "0000179471" "0000402932" "0000179472" "0000402933" "0000179473" "0000402934" "0000179474" "0000402935" "0000179475" "0000402936" "0000179476" "0000402937" "0000179477" "0000402938" "0000179478" "0000402939" "0000179479" "0000402940" "0000179480" "0000402941" "0000179481" "0000402942" "0000179482" "0000402943" "0000179483" "0000402944" "0000179484" "0000402945" "0000179485" "0000402946" "0000179486" "0000402947" "0000179487" "0000402948" "0000179488" "0000402949" "0000179489" "0000402950" "0000179490" "0000402951" "0000179491" "0000402952" "0000179492" "0000402953" "0000179493" "0000402954" "0000179494" "0000402955" "0000179495" "0000402956" "0000179496" "0000402957" "0000179497" "0000402958" "0000179498" "0000402959" "0000179499" "0000402960" "0000179500" "0000402961" "0000179501" "0000402962" "0000179502" "0000402963" "0000179503" "0000402964" "0000179504" "0000402965" "0000179505" "0000402966" "0000179506" "0000402967" "0000179507" "0000402968" "0000179508" "0000402969" "0000179509" "0000402970" "0000179510" "0000402971" "0000179511" "0000402972" "0000179512" "0000402973" "0000179513" "0000402974" "0000179514" "0000402975" "0000179515" "0000402976" "0000179516" "0000402977" "0000179517" "0000402978" "0000179518" "0000402979" "0000179519" "0000402980" "0000179520" "0000402981" "0000179521" "0000402982" "0000179522" "0000402983" "0000179523" "0000402984" "0000179524" "0000402985" "0000179525" "0000402986" "0000179526" "0000402987" "0000179527" "0000402988" "0000179528" "0000402989" "0000179529" "0000402990" "0000179530" "0000402991" "0000179531" "0000402992" "0000179532" "0000402993" "0000181775" "0000405471" "0000181776" "0000405472" "0000181777" "0000405473" "0000181778" "0000405474" "0000181779" "0000405475" "0000181780" "0000405476" "0000181781" "0000405477" "0000181782" "0000405478" "0000182578" "0000406468" "0000182579" "0000406469" "0000182580" "0000406470" "0000182581" "0000406471" "0000183777" "0000407667" "0000183778" "0000407668" "0000183779" "0000407669" "0000183780" "0000407670" "0000183781" "0000407671" "0000183782" "0000407672" "0000183783" "0000407673" "0000183784" "0000407674" "0000183785" "0000407675" "0000183786" "0000407676" "0000183787" "0000407677" "0000183788" "0000407678" "0000183789" "0000407679" "0000183790" "0000407680" "0000183791" "0000407681" "0000183792" "0000407682" "0000183793" "0000407683" "0000183794" "0000407684" "0000183795" "0000407685" "0000183796" "0000407686" "0000183797" "0000407687" "0000183798" "0000407688" "0000183799" "0000407689" "0000183800" "0000407690" "0000183801" "0000407691" "0000183802" "0000407692" "0000183803" "0000407693" "0000183804" "0000407694" "0000183805" "0000407695" "0000183806" "0000407696" "0000183807" "0000407697" "0000183808" "0000407698" "0000183809" "0000407699" "0000183810" "0000407700" "0000183811" "0000407701" "0000183812" "0000407702" "0000183813" "0000407703" "0000183814" "0000407704" "0000183815" "0000407705" "0000183816" "0000407706" "0000183817" "0000407707" "0000183818" "0000407708" "0000229367" "0000470553" "0000232401" "0000474804" "0000241587" "0000487612" "0000241588" "0000487613" "0000241589" "0000487614" "0000241592" "0000487618" "0000241593" "0000487619" "0000241595" "0000487622" "0000241595" "0000487624" "0000241598" "0000487629" "0000241598" "0000487631" "0000241598" "0000487633" "0000241598" "0000487634" "0000241602" "0000487638" "0000241602" "0000487639" "0000241602" "0000487640" "0000241602" "0000487644" "0000241602" "0000487646" "0000241606" "0000487649" "0000241606" "0000487651" "0000241606" "0000487652" "0000241606" "0000487654" "0000241611" "0000487661" "0000241611" "0000487662" "0000241613" "0000487665" "0000241613" "0000487668" "0000241616" "0000487672" "0000242341" "0000489019" "0000242343" "0000489021" "0000242347" "0000489030" "0000242347" "0000489032" "0000242347" "0000489035" "0000242351" "0000489039" "0000242353" "0000489041" "0000242353" "0000489043" "0000242354" "0000489044" "0000242354" "0000489045" "0000242356" "0000489048" "0000242358" "0000489051" "0000242360" "0000489055" "0000242361" "0000489057" "0000242364" "0000489059" "0000242364" "0000489060" "0000242365" "0000489061" "0000242365" "0000489063" "0000242365" "0000489067" "0000242365" "0000489069" "0000242368" "0000489070" "0000242369" "0000489071" "0000242369" "0000489073" "0000242371" "0000489074" "0000242372" "0000489075" "0000242372" "0000489076" "0000247663" "0000500509" "0000247664" "0000500510" "0000247665" "0000500511" "0000247666" "0000500512" "0000247667" "0000500513" "0000247668" "0000500514" "0000247669" "0000500515" "0000247670" "0000500516" "0000267537" "0000598754" "0000267600" "0000599124" "0000267601" "0000599125" "0000267605" "0000599123" "0000267607" "0000599121" "0000267611" "0000599122" "0000293025" "0000649714" "0000293026" "0000649715" "0000293027" "0000649716" "0000293028" "0000649717" "0000293029" "0000649718" "0000296332" "0000653021" "0000296454" "0000653143" "0000296455" "0000653144" "0000296456" "0000653145" "0000296457" "0000653146" "0000296734" "0000653432" "0000296917" "0000659568" "0000296921" "0000659573" "0000297062" "0000659672" "0000337455" "0000737086" "0000337558" "0000737189" "0000337559" "0000737190" "0000342979" "0000742610" "0000342980" "0000742611" "0000342981" "0000742612" "0000342982" "0000742613" "0000342983" "0000742614" "0000342984" "0000742615" "0000342985" "0000742616" "0000342986" "0000742617" "0000342987" "0000742618" "0000342988" "0000742619" "0000342989" "0000742620" "0000342990" "0000742621" "0000342991" "0000742622" "0000342992" "0000742623" "0000342993" "0000742624" "0000342994" "0000742625" "0000342995" "0000742626" "0000342996" "0000742627" "0000342997" "0000742628" "0000342998" "0000742629" "0000342999" "0000742630" "0000343000" "0000742631" "0000343001" "0000742632" "0000343002" "0000742633" "0000343003" "0000742634" "0000343004" "0000742635" "0000343005" "0000742636" "0000343006" "0000742637" "0000343007" "0000742638" "0000343008" "0000742639" "0000343009" "0000742640" "0000343010" "0000742641" "0000343011" "0000742642" "0000343012" "0000742643" "0000343013" "0000742644" "0000343014" "0000742645" "0000343015" "0000742646" "0000343016" "0000742647" "0000343017" "0000742648" "0000343018" "0000742649" "0000343019" "0000742650" "0000343020" "0000742651" "0000343021" "0000742652" "0000343022" "0000742653" "0000343023" "0000742654" "0000343024" "0000742655" "0000343025" "0000742656" "0000343026" "0000742657" "0000343580" "0000743211" "0000343581" "0000743212" "0000343582" "0000743213" "0000343583" "0000743214" "0000343584" "0000743215" "0000343585" "0000743216" "0000343586" "0000743217" "0000343805" "0000743436" "0000343812" "0000743443" "0000343813" "0000743444" "0000343814" "0000743445" "0000350218" "0000749849" "0000350219" "0000749850" "0000350220" "0000749851" "0000350221" "0000749852" "0000350222" "0000749853" "0000350223" "0000749854" "0000350224" "0000749855" "0000350225" "0000749856" "0000350226" "0000749857" "0000350227" "0000749858" "0000350228" "0000749859" "0000350229" "0000749860" "0000350230" "0000749861" "0000350231" "0000749862" "0000350232" "0000749863" "0000350233" "0000749864" "0000350234" "0000749865" "0000350235" "0000749866" "0000350236" "0000749867" "0000350237" "0000749868" "0000350238" "0000749869" "0000350239" "0000749870" "0000350240" "0000749871" "0000350241" "0000749872" "0000350242" "0000749873" "0000350243" "0000749874" "0000350244" "0000749875" "0000350245" "0000749876" "0000350246" "0000749877" "0000350247" "0000749878" "0000350248" "0000749879" "0000350249" "0000749880" "0000350250" "0000749881" "0000350251" "0000749882" "0000350252" "0000749883" "0000350253" "0000749884" "0000350254" "0000749885" "0000350255" "0000749886" "0000350256" "0000749887" "0000350257" "0000749888" "0000350258" "0000749889" "0000350259" "0000749890" "0000350260" "0000749891" "0000350261" "0000749892" "0000350262" "0000749893" "0000350263" "0000749894" "0000350264" "0000749895" "0000350265" "0000749896" "0000350266" "0000749897" "0000350267" "0000749898" "0000350268" "0000749899" "0000350269" "0000749900" "0000350270" "0000749901" "0000350271" "0000749902" "0000350272" "0000749903" "0000350273" "0000749904" "0000350274" "0000749905" "0000350275" "0000749906" "0000350276" "0000749907" "0000350277" "0000749908" "0000350278" "0000749909" "0000350279" "0000749910" "0000350280" "0000749911" "0000350281" "0000749912" "0000350282" "0000749913" "0000350283" "0000749914" "0000350284" "0000749915" "0000350285" "0000749916" "0000350286" "0000749917" "0000350287" "0000749918" "0000350288" "0000749919" "0000350289" "0000749920" "0000350290" "0000749921" "0000350291" "0000749922" "0000350292" "0000749923" "0000350293" "0000749924" "0000350294" "0000749925" "0000350295" "0000749926" "0000350296" "0000749927" "0000350297" "0000749928" "0000350298" "0000749929" "0000350299" "0000749930" "0000350300" "0000749931" "0000350301" "0000749932" "0000350302" "0000749933" "0000350303" "0000749934" "0000350304" "0000749935" "0000350305" "0000749936" "0000350306" "0000749937" "0000350307" "0000749938" "0000350308" "0000749939" "0000350309" "0000749940" "0000350310" "0000749941" "0000350311" "0000749942" "0000350312" "0000749943" "0000350313" "0000749944" "0000350314" "0000749945" "0000350315" "0000749946" "0000350316" "0000749947" "0000350317" "0000749948" "0000350318" "0000749949" "0000350319" "0000749950" "0000350320" "0000749951" "0000350321" "0000749952" "0000350322" "0000749953" "0000350323" "0000749954" "0000350324" "0000749955" "0000350325" "0000749956" "0000355088" "0000754721" "0000355089" "0000754722" "0000355090" "0000754723" "0000355091" "0000754724" "0000355092" "0000754725" "0000355093" "0000754726" "0000355094" "0000754727" "0000355095" "0000754728" "0000355096" "0000754729" "0000355097" "0000754730" "0000355098" "0000754731" "0000355099" "0000754732" "0000355100" "0000754733" "0000355101" "0000754734" "0000355102" "0000754735" "0000355103" "0000754736" "0000355104" "0000754737" "0000355105" "0000754738" "0000355106" "0000754739" "0000355107" "0000754740" "0000355108" "0000754741" "0000355109" "0000754742" "0000355110" "0000754743" "0000355111" "0000754744" "0000355112" "0000754745" "0000355113" "0000754746" "0000355114" "0000754747" "0000355115" "0000754748" "0000355116" "0000754749" "0000355117" "0000754750" "0000355118" "0000754751" "0000355119" "0000754752" "0000355120" "0000754753" "0000355121" "0000754754" "0000355122" "0000754755" "0000355123" "0000754756" "0000355124" "0000754757" "0000355125" "0000754758" "0000355126" "0000754759" "0000355127" "0000754760" "0000355128" "0000754761" "0000355129" "0000754762" "0000355130" "0000754763" "0000355131" "0000754764" "0000355132" "0000754765" "0000355133" "0000754766" "0000355134" "0000754767" "0000355135" "0000754768" "0000355136" "0000754769" "0000355137" "0000754770" "0000355138" "0000754771" "0000355139" "0000754772" "0000359864" "0000759495" "0000359865" "0000759496" "0000359866" "0000759497" "0000359867" "0000759498" "0000359868" "0000759499" "0000359869" "0000759500" "0000359870" "0000759501" "0000359871" "0000759502" "0000359872" "0000759503" "0000359873" "0000759504" "0000359874" "0000759505" "0000359875" "0000759506" "0000359876" "0000759507" "0000359877" "0000759508" "0000359878" "0000759509" "0000359879" "0000759510" "0000359880" "0000759511" "0000359881" "0000759512" "0000359882" "0000759513" "0000359883" "0000759514" "0000359884" "0000759515" "0000359885" "0000759516" "0000359886" "0000759517" "0000359887" "0000759518" "0000359888" "0000759519" "0000359889" "0000759520" "0000359890" "0000759521" "0000359891" "0000759522" "0000359892" "0000759523" "0000359893" "0000759524" "0000359894" "0000759525" "0000359895" "0000759526" "0000359896" "0000759527" "0000359897" "0000759528" "0000359898" "0000759529" "0000359899" "0000759530" "0000359900" "0000759531" "0000359901" "0000759532" "0000359902" "0000759533" "0000359903" "0000759534" "0000359904" "0000759535" "0000359905" "0000759536" "0000359906" "0000759537" "0000359907" "0000759538" "0000359908" "0000759539" "0000359909" "0000759540" "0000359910" "0000759541" "0000359911" "0000759542" "0000359912" "0000759543" "0000359913" "0000759544" "0000359914" "0000759545" "0000359915" "0000759546" "0000377355" "0000789671" "0000400835" "0000833858" "0000400836" "0000833859" "0000400837" "0000833860" "0000400838" "0000833861" "0000400839" "0000833862" "0000400840" "0000833863" "0000400841" "0000833864" "0000400950" "0000833973" "0000400951" "0000833974" "0000400952" "0000833975" "0000400953" "0000833976" "0000400954" "0000833977" "0000400955" "0000833978" "0000400956" "0000833979" "0000400957" "0000833980" "0000400958" "0000833981" "0000400959" "0000833982" "0000400960" "0000833983" "0000400961" "0000833984" "0000400962" "0000833985" "0000400963" "0000833986" "0000400964" "0000833987" "0000408243" "0000845120" "0000411822" "0000869100" "0000432611" "0000918151" "0000432986" "0000918610" "0000432989" "0000918613" "0000432989" "0000918614" "0000434580" "0000920375" "0000434594" "0000920392" "0000434602" "0000920405" "0000434604" "0000920407" "0000434611" "0000920417" "0000434612" "0000920418" "0000434613" "0000920419" "0000434614" "0000920435" "0000434615" "0000920436" "0000434632" "0000920483" "0000434633" "0000920484" "0000434634" "0000920485" "0000434635" "0000920486" "0000434636" "0000920487" "0000434637" "0000920488" "0000434641" "0000920495" "0000434644" "0000920497" "0000445223" "0000952123" "0000445224" "0000952124" "0000449621" "0000960047" "0000451317" "0000985169" "0000451331" "0000985182" "0000458980" "0001016677" "0000466044" "0001029859" "0000466045" "0001029860" "0000469709" "0001057754" "0000472290" "0001060702" "0000472291" "0001060703"