### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ###
## Filter: (gene_public = TRPM4)
# charset = UTF-8

## Genes ## Do not remove or alter this header ##
## Count = 1
"{{id}}"	"{{name}}"	"{{chromosome}}"	"{{chrom_band}}"	"{{imprinting}}"	"{{refseq_genomic}}"	"{{refseq_UD}}"	"{{reference}}"	"{{url_homepage}}"	"{{url_external}}"	"{{allow_download}}"	"{{id_hgnc}}"	"{{id_entrez}}"	"{{id_omim}}"	"{{show_hgmd}}"	"{{show_genecards}}"	"{{show_genetests}}"	"{{show_orphanet}}"	"{{note_index}}"	"{{note_listing}}"	"{{refseq}}"	"{{refseq_url}}"	"{{disclaimer}}"	"{{disclaimer_text}}"	"{{header}}"	"{{header_align}}"	"{{footer}}"	"{{footer_align}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"	"{{updated_by}}"	"{{updated_date}}"
"TRPM4"	"transient receptor potential cation channel, subfamily M, member 4"	"19"	"q13.3"	"unknown"	"NG_027551.1"	"UD_132119165074"	""	"http://www.LOVD.nl/TRPM4"	""	"1"	"17993"	"54795"	"606936"	"1"	"1"	"1"	"1"	""	""	"g"	"http://databases.lovd.nl/shared/refseq/TRPM4_codingDNA.html"	"1"	""	""	"-1"	""	"-1"	"00001"	"2011-05-26 00:00:00"	"00006"	"2015-06-22 23:25:24"	"00000"	"2025-05-05 21:14:00"


## Transcripts ## Do not remove or alter this header ##
## Count = 1
"{{id}}"	"{{geneid}}"	"{{name}}"	"{{id_mutalyzer}}"	"{{id_ncbi}}"	"{{id_ensembl}}"	"{{id_protein_ncbi}}"	"{{id_protein_ensembl}}"	"{{id_protein_uniprot}}"	"{{remarks}}"	"{{position_c_mrna_start}}"	"{{position_c_mrna_end}}"	"{{position_c_cds_end}}"	"{{position_g_mrna_start}}"	"{{position_g_mrna_end}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"
"00021909"	"TRPM4"	"transcript variant 1"	"001"	"NM_017636.3"	""	"NP_060106.2"	""	""	""	"-108"	"3988"	"3645"	"49661016"	"49715098"	""	"0000-00-00 00:00:00"	""	""


## Diseases ## Do not remove or alter this header ##
## Count = 5
"{{id}}"	"{{symbol}}"	"{{name}}"	"{{inheritance}}"	"{{id_omim}}"	"{{tissues}}"	"{{features}}"	"{{remarks}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"
"00198"	"?"	"unclassified / mixed"	""	""	""	""	""	"00006"	"2013-09-13 14:21:47"	"00006"	"2024-11-23 09:38:12"
"00404"	"LQT"	"QT syndrome, long (LQT)"	""	""	""	""	""	"00006"	"2014-06-06 17:35:42"	"00006"	"2015-07-04 16:01:55"
"02087"	"SIDS"	"death, sudden, syndrome, infant (SIDS)"	"AR"	"272120"	""	""	""	"00006"	"2014-09-25 23:29:40"	"00006"	"2021-12-10 21:51:32"
"02517"	"PFHB1B"	"heart block, familial, progressive, type 1B"	"AD"	"604559"	""	""	""	"00006"	"2014-09-25 23:29:40"	"00006"	"2021-12-10 21:51:32"
"06445"	"EKVP6"	"erythrokeratodermia veriabilis et progressiva, type 6"	"AD"	"618531"	""	""	""	"00006"	"2021-12-10 23:20:41"	"00006"	"2023-12-07 08:45:53"


## Genes_To_Diseases ## Do not remove or alter this header ##
## Count = 2
"{{geneid}}"	"{{diseaseid}}"
"TRPM4"	"02517"
"TRPM4"	"06445"


## Individuals ## Do not remove or alter this header ##
## Count = 34
"{{id}}"	"{{fatherid}}"	"{{motherid}}"	"{{panelid}}"	"{{panel_size}}"	"{{license}}"	"{{owned_by}}"	"{{Individual/Reference}}"	"{{Individual/Remarks}}"	"{{Individual/Gender}}"	"{{Individual/Consanguinity}}"	"{{Individual/Origin/Geographic}}"	"{{Individual/Age_of_death}}"	"{{Individual/VIP}}"	"{{Individual/Data_av}}"	"{{Individual/Treatment}}"	"{{Individual/Origin/Population}}"	"{{Individual/Individual_ID}}"
"00043775"	""	""	"00043766"	"1"	""	"01337"	"{PMID:Hertz 2015:26350513}, {DOI:Hertz 2015:10.1038/ejhg.2015.198}"	""	"M"	"?"	"Denmark"	"00y02m"	"0"	""	""	"Denmark"	""
"00043784"	""	""	"00043766"	"1"	""	"01337"	"{PMID:Hertz 2015:26350513}, {DOI:Hertz 2015:10.1038/ejhg.2015.198}"	""	"F"	"?"	"Denmark"	"00y00m"	"0"	""	""	"Denmark"	""
"00064062"	""	""	""	"178"	""	"01195"	"{PMID:Hof 2017:28315637}"	""	"M"	"no"	"France"	">64y"	"0"	""	""	"white"	"Pat1"
"00064063"	""	""	""	"178"	""	"01195"	"{PMID:Hof 2017:28315637}"	""	"M"	"no"	"(France)"	">12y"	"0"	""	""	"white"	"Pat2"
"00064064"	""	""	""	"178"	""	"01195"	"{PMID:Hof 2017:28315637}"	""	"F"	"?"	"France"	">69y"	"0"	""	""	"white"	"Pat3"
"00064065"	""	""	""	"178"	""	"01195"	"{PMID:Hof 2017:28315637}"	""	"M"	"?"	"France"	">15y"	"0"	""	""	"white"	"Pat4"
"00064764"	""	""	""	"1"	""	"01602"	"{PMID:Neubauer 2017:28074886} {DOI:Neubauer 2017:10.1038/ejhg.2016.199}"	""	"M"	"?"	"Switzerland"	"00y02m"	"0"	""	""	"Europe"	"SIDS011"
"00065142"	""	""	""	"1"	""	"01602"	"{PMID:Neubauer 2017:28074886} {DOI:Neubauer 2017:10.1038/ejhg.2016.199}"	""	"F"	"?"	"Switzerland"	"00y02m"	"0"	""	""	"Europe"	"SIDS096"
"00065145"	""	""	""	"1"	""	"01602"	"{PMID:Neubauer 2017:28074886} {DOI:Neubauer 2017:10.1038/ejhg.2016.199}"	""	"F"	"?"	"Switzerland"	"00y01m"	"0"	""	""	"Europe"	"SIDS119"
"00128356"	""	""	""	"1"	""	"02244"	"{PMID:Sahlin 2019:30615648}, {DOI:Sahlin 2019:10.1371/journal.pone.0210017}"	"stillbirth cohort (290 cases from Sweden)"	"M"	""	"Sweden"	"0"	""	""	""	""	"11"
"00128358"	""	""	""	"1"	""	"02244"	"{PMID:Sahlin 2019:30615648}, {DOI:Sahlin 2019:10.1371/journal.pone.0210017}"	"stillbirth cohort (290 cases from Sweden)"	"M"	""	"Sweden"	"0"	""	""	""	""	"17"
"00128365"	""	""	""	"1"	""	"02244"	"{PMID:Sahlin 2019:30615648}, {DOI:Sahlin 2019:10.1371/journal.pone.0210017}"	"stillbirth cohort (290 cases from Sweden)"	"M"	""	"Sweden"	"0"	""	""	""	""	"26"
"00128366"	""	""	""	"1"	""	"02244"	"{PMID:Sahlin 2019:30615648}, {DOI:Sahlin 2019:10.1371/journal.pone.0210017}"	"stillbirth cohort (290 cases from Sweden)"	"F"	""	"Sweden"	"0"	""	""	""	""	"34"
"00128393"	""	""	""	"1"	""	"02244"	"{PMID:Sahlin 2019:30615648}, {DOI:Sahlin 2019:10.1371/journal.pone.0210017}"	"stillbirth cohort (290 cases from Sweden)"	"F"	""	"Sweden"	"0"	""	""	""	""	"90"
"00128401"	""	""	""	"1"	""	"02244"	"{PMID:Sahlin 2019:30615648}, {DOI:Sahlin 2019:10.1371/journal.pone.0210017}"	"stillbirth cohort (290 cases from Sweden)"	"M"	""	"Sweden"	"0"	""	""	""	""	"104"
"00128476"	""	""	""	"1"	""	"02244"	"{PMID:Sahlin 2019:30615648}, {DOI:Sahlin 2019:10.1371/journal.pone.0210017}"	"stillbirth cohort (290 cases from Sweden)"	"M"	""	"Sweden"	"0"	""	""	""	""	"261"
"00128479"	""	""	""	"1"	""	"02244"	"{PMID:Sahlin 2019:30615648}, {DOI:Sahlin 2019:10.1371/journal.pone.0210017}"	"stillbirth cohort (290 cases from Sweden)"	"M"	""	"Sweden"	"0"	""	""	""	""	"269"
"00204304"	""	""	""	"23"	""	"00000"	"{PMID:Brink et al 1977:897853}"	"extensive family, 23 affeteds/35 unaffecteds analysed"	""	""	"South Africa"	""	"0"	""	""	"Afrikaner"	""
"00204305"	""	""	""	"12"	""	"00000"	"{PMID:Liu et al 2010:20562447}"	"4-generation family (12 carriers, 7 non-carriers)"	""	""	"France"	""	"0"	""	""	""	""
"00204306"	""	""	""	"35"	""	"00000"	"{PMID:Liu et al 2010:20562447}"	"5-generation family (35 carriers, 46 non-carriers)"	""	""	"Lebanon"	""	"0"	""	""	""	""
"00204307"	""	""	""	"10"	""	"00000"	"{PMID:Liu et al 2010:20562447}"	"4-generation family (10 carriers, 4 non-carriers)"	""	""	"France"	""	"0"	""	""	""	""
"00204308"	""	""	""	"1"	""	"02971"	""	""	"M"	""	"Turkey"	""	"0"	""	""	""	""
"00204309"	""	""	""	"1"	""	"02971"	""	""	"M"	""	"Germany"	""	"0"	""	""	""	""
"00204310"	""	""	""	"1"	""	"02971"	""	""	"M"	""	"Germany"	""	"0"	""	""	""	""
"00204311"	""	""	""	"1"	""	"02971"	""	""	"M"	""	"France"	""	"0"	""	""	""	""
"00204312"	""	""	""	"1"	""	"02971"	""	""	"M"	""	"Cambodia"	""	"0"	""	""	""	""
"00204313"	""	""	""	"1"	""	"02971"	""	""	"M"	""	"Viet Nam"	""	"0"	""	""	""	""
"00204314"	""	""	""	"1"	""	"02971"	""	""	"M"	""	"Turkey"	""	"0"	""	""	""	""
"00204315"	""	""	""	"1"	""	"02971"	""	""	"M"	""	"Germany"	""	"0"	""	""	""	""
"00292175"	""	""	""	"235"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00292176"	""	""	""	"215"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00292177"	""	""	""	"1"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00304675"	""	""	""	"2"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00460999"	""	""	""	"1"	""	"04796"	""	""	""	""	"Netherlands"	""	"0"	""	""	""	""


## Individuals_To_Diseases ## Do not remove or alter this header ##
## Count = 34
"{{individualid}}"	"{{diseaseid}}"
"00043775"	"02087"
"00043784"	"02087"
"00064062"	"00404"
"00064063"	"00404"
"00064064"	"00404"
"00064065"	"00404"
"00064764"	"02087"
"00065142"	"02087"
"00065145"	"02087"
"00128356"	"00198"
"00128358"	"00198"
"00128365"	"00198"
"00128366"	"00198"
"00128393"	"00198"
"00128401"	"00198"
"00128476"	"00198"
"00128479"	"00198"
"00204304"	"02517"
"00204305"	"00198"
"00204306"	"00198"
"00204307"	"00198"
"00204308"	"00198"
"00204309"	"00198"
"00204310"	"00198"
"00204311"	"00198"
"00204312"	"00198"
"00204313"	"00198"
"00204314"	"00198"
"00204315"	"00198"
"00292175"	"00198"
"00292176"	"00198"
"00292177"	"00198"
"00304675"	"00198"
"00460999"	"00198"


## Phenotypes ## Do not remove or alter this header ##
## Note: Only showing Phenotype columns active for Diseases 00198, 00404, 02087, 02517, 06445
## Count = 30
"{{id}}"	"{{diseaseid}}"	"{{individualid}}"	"{{owned_by}}"	"{{Phenotype/Inheritance}}"	"{{Phenotype/Age}}"	"{{Phenotype/Additional}}"	"{{Phenotype/Age/Onset}}"	"{{Phenotype/Age/Diagnosis}}"	"{{Phenotype/Onset}}"	"{{Phenotype/Protein}}"	"{{Phenotype/Tumor/MSI}}"	"{{Phenotype/Enzyme/CPK}}"	"{{Phenotype/Heart/Myocardium}}"	"{{Phenotype/Lung}}"	"{{Phenotype/Diagnosis/Definite}}"	"{{Phenotype/Diagnosis/Initial}}"	"{{Phenotype/Diagnosis/Criteria}}"
"0000034035"	"02087"	"00043784"	"01337"	"Unknown"	""	"Did not fulfil SIDS criteria due to missing information"	""	""	""	""	""	""	""	""	""	""	""
"0000034050"	"02087"	"00043775"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000050578"	"00404"	"00064062"	"01195"	"Unknown"	"68y"	"QT=560 ms; QTc=539 ms, left-anterior hemiblock, notched T waves, syncope and exercise dyspnea"	""	"64y"	""	""	""	""	""	""	""	""	""
"0000050579"	"00404"	"00064063"	"01195"	"Unknown"	"00y03m"	"Heart rate=86/min; PR interval=120 ms; QTc=471 ms\r\n4 fainting episodes"	"00y03m"	"00y03m"	""	""	""	""	""	""	""	""	""
"0000050580"	"00404"	"00064064"	"01195"	"Unknown"	"69y"	"Heart rate=68/min; QTc=469 ms; ventricular arrhythmia, episodes of fainting"	"69y"	"69y"	""	""	""	""	""	""	""	""	""
"0000050581"	"00404"	"00064065"	"01195"	"Familial"	"15y"	"Heart rate=58/min; QTc=490 ms; resuscitated sudden cardiac death"	"15y"	"15y"	""	""	""	""	""	""	""	""	""
"0000050923"	"02087"	"00064764"	"01602"	"Unknown"	""	"SIDS"	""	""	""	""	""	""	""	""	""	""	""
"0000051247"	"02087"	"00065142"	"01602"	"Unknown"	""	"SIDS"	""	""	""	""	""	""	""	""	""	""	""
"0000051250"	"02087"	"00065145"	"01602"	"Unknown"	""	"SIDS"	""	""	""	""	""	""	""	""	""	""	""
"0000100574"	"00198"	"00128356"	"02244"	"Unknown"	"0d"	""	""	""	""	""	""	""	""	""	""	"stillbirth (HP:0003826)"	""
"0000100576"	"00198"	"00128358"	"02244"	"Unknown"	"0d"	""	""	""	""	""	""	""	""	""	""	"stillbirth (HP:0003826)"	""
"0000100581"	"00198"	"00128365"	"02244"	"Unknown"	"0d"	""	""	""	""	""	""	""	""	""	""	"stillbirth (HP:0003826)"	""
"0000100582"	"00198"	"00128365"	"02244"	"Unknown"	"0d"	""	""	""	""	""	""	""	""	""	""	"stillbirth (HP:0003826)"	""
"0000100583"	"00198"	"00128366"	"02244"	"Unknown"	"0d"	""	""	""	""	""	""	""	""	""	""	"stillbirth (HP:0003826)"	""
"0000100609"	"00198"	"00128393"	"02244"	"Unknown"	"0d"	""	""	""	""	""	""	""	""	""	""	"stillbirth (HP:0003826)"	""
"0000100617"	"00198"	"00128401"	"02244"	"Unknown"	"0d"	""	""	""	""	""	""	""	""	""	""	"stillbirth (HP:0003826)"	""
"0000100698"	"00198"	"00128476"	"02244"	"Unknown"	"0d"	""	""	""	""	""	""	""	""	""	""	"stillbirth (HP:0003826)"	""
"0000100701"	"00198"	"00128479"	"02244"	"Unknown"	"0d"	""	""	""	""	""	""	""	""	""	""	"stillbirth (HP:0003826)"	""
"0000152794"	"02517"	"00204304"	"02971"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000152795"	"00198"	"00204305"	"02971"	"Familial, autosomal dominant"	""	"cardiac conduction block, isolated"	""	""	""	""	""	""	""	""	""	""	""
"0000152796"	"00198"	"00204306"	"02971"	"Familial, autosomal dominant"	""	"cardiac conduction block, isolated"	""	""	""	""	""	""	""	""	""	""	""
"0000152797"	"00198"	"00204307"	"02971"	"Familial, autosomal dominant"	""	"cardiac conduction block, isolated"	""	""	""	""	""	""	""	""	""	""	""
"0000152798"	"00198"	"00204308"	"02971"	"Familial"	""	"Atrio ventricular block (AVB)"	""	"12y"	""	""	""	""	""	""	""	""	""
"0000152799"	"00198"	"00204309"	"02971"	"Familial"	""	"incomplete right bundle branch block (iRBBB)"	""	"44y"	""	""	""	""	""	""	""	""	""
"0000152800"	"00198"	"00204310"	"02971"	"Familial"	""	"right bundle branch block (RBBB); left anterior hemiblock (LAHB)"	""	"11y"	""	""	""	""	""	""	""	""	""
"0000152801"	"00198"	"00204311"	"02971"	"Familial, autosomal dominant"	""	"atrio ventricular block (AVB)"	""	"1y"	""	""	""	""	""	""	""	""	""
"0000152802"	"00198"	"00204312"	"02971"	"Isolated (sporadic)"	""	"right bundle branch block (RBBB)"	""	"49y"	""	""	""	""	""	""	""	""	""
"0000152803"	"00198"	"00204313"	"02971"	"Isolated (sporadic)"	""	"atrio ventricular block (AVB)"	""	"30y"	""	""	""	""	""	""	""	""	""
"0000152804"	"00198"	"00204314"	"02971"	"Unknown"	""	"right bundle branch block (RBBB)"	""	"38y"	""	""	""	""	""	""	""	""	""
"0000152805"	"00198"	"00204315"	"02971"	"Familial"	""	"right bundle branch block (RBBB); left anterior hemiblock (LAHB)"	""	"17y"	""	""	""	""	""	""	""	""	""


## Screenings ## Do not remove or alter this header ##
## Count = 34
"{{id}}"	"{{individualid}}"	"{{variants_found}}"	"{{owned_by}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"	"{{Screening/Technique}}"	"{{Screening/Template}}"	"{{Screening/Tissue}}"	"{{Screening/Remarks}}"
"0000044019"	"00043775"	"1"	"01337"	"01337"	"2015-06-19 13:54:53"	""	""	"SEQ-NG-I"	"DNA"	"Blood"	""
"0000044027"	"00043784"	"1"	"01337"	"01337"	"2015-06-19 14:31:24"	""	""	"SEQ-NG-I"	"DNA"	"Blood"	""
"0000064195"	"00064062"	"1"	"01195"	"01195"	"2016-04-25 09:11:21"	""	""	"SEQ"	"DNA"	"Blood"	""
"0000064196"	"00064063"	"1"	"01195"	"01195"	"2016-04-25 09:37:39"	""	""	"SEQ"	"DNA"	"Blood"	""
"0000064197"	"00064064"	"1"	"01195"	"01195"	"2016-04-25 09:46:38"	""	""	"SEQ"	"DNA"	"Blood"	""
"0000064198"	"00064065"	"1"	"01195"	"01195"	"2016-04-25 09:54:34"	""	""	"SEQ"	"DNA"	"Blood"	""
"0000064905"	"00064764"	"1"	"01602"	"01602"	"2016-05-11 15:09:26"	"01602"	"2016-05-19 13:27:39"	"SEQ-NG-I"	"DNA"	""	""
"0000065293"	"00065142"	"1"	"01602"	"01602"	"2016-05-19 14:20:56"	""	""	"SEQ-NG-I"	"DNA"	""	""
"0000065296"	"00065145"	"1"	"01602"	"01602"	"2016-05-19 14:26:47"	""	""	"SEQ-NG-I"	"DNA"	""	""
"0000128825"	"00128356"	"1"	"02244"	"02244"	"2017-09-15 13:40:50"	""	""	"SEQ-NG"	"DNA"	""	"HaloPlex gene panel (70 heart genes)"
"0000128827"	"00128358"	"1"	"02244"	"02244"	"2017-09-15 13:47:28"	""	""	"SEQ-NG"	"DNA"	""	"HaloPlex gene panel (70 heart genes)"
"0000128832"	"00128365"	"1"	"02244"	"02244"	"2017-09-15 14:21:34"	""	""	"SEQ-NG"	"DNA"	""	"HaloPlex gene panel (70 heart genes)"
"0000128833"	"00128366"	"1"	"02244"	"02244"	"2017-09-15 14:24:24"	""	""	"SEQ-NG"	"DNA"	""	"HaloPlex gene panel (70 heart genes)"
"0000129231"	"00128393"	"1"	"02244"	"02244"	"2017-09-15 15:27:40"	""	""	"SEQ-NG"	"DNA"	""	"HaloPlex gene panel (70 heart genes)"
"0000129239"	"00128401"	"1"	"02244"	"02244"	"2017-09-15 15:43:27"	""	""	"SEQ-NG"	"DNA"	""	"HaloPlex gene panel (70 heart genes)"
"0000129314"	"00128476"	"1"	"02244"	"02244"	"2017-09-15 18:40:44"	""	""	"SEQ-NG"	"DNA"	""	"HaloPlex gene panel (70 heart genes)"
"0000129317"	"00128479"	"1"	"02244"	"02244"	"2017-09-15 18:46:58"	""	""	"SEQ-NG"	"DNA"	""	"HaloPlex gene panel (70 heart genes)"
"0000205332"	"00204304"	"1"	"00000"	"00002"	"2011-05-26 23:08:43"	""	""	"SEQ"	"DNA"	""	""
"0000205333"	"00204305"	"1"	"00000"	"00002"	"2011-05-29 10:01:37"	""	""	"SEQ"	"DNA"	""	""
"0000205334"	"00204306"	"1"	"00000"	"00002"	"2011-05-29 10:01:37"	""	""	"SEQ"	"DNA"	""	""
"0000205335"	"00204307"	"1"	"00000"	"00002"	"2011-05-29 10:01:37"	"00002"	"2011-05-29 10:05:11"	"SEQ"	"DNA"	""	""
"0000205336"	"00204308"	"1"	"02971"	"02971"	"2011-08-19 22:03:17"	"00006"	"2011-08-22 08:29:57"	"SEQ"	"DNA"	""	""
"0000205337"	"00204309"	"1"	"02971"	"02971"	"2011-08-19 22:10:40"	"00006"	"2011-08-22 08:28:59"	"SEQ"	"DNA"	""	""
"0000205338"	"00204310"	"1"	"02971"	"02971"	"2011-08-19 22:17:49"	"00006"	"2011-08-22 08:34:17"	"SEQ"	"DNA"	""	""
"0000205339"	"00204311"	"1"	"02971"	"02971"	"2011-08-19 22:25:31"	"00006"	"2011-08-22 08:30:54"	"SEQ"	"DNA"	""	""
"0000205340"	"00204312"	"1"	"02971"	"02971"	"2011-08-19 22:30:40"	"00006"	"2011-08-22 08:31:50"	"SEQ"	"DNA"	""	""
"0000205341"	"00204313"	"1"	"02971"	"02971"	"2011-08-19 22:35:47"	"00006"	"2011-08-22 08:32:44"	"SEQ"	"DNA"	""	""
"0000205342"	"00204314"	"1"	"02971"	"02971"	"2011-08-19 22:45:10"	"00006"	"2011-08-22 08:21:23"	"SEQ"	"DNA"	""	""
"0000205343"	"00204315"	"1"	"02971"	"02971"	"2011-08-19 21:53:41"	"00006"	"2011-08-22 08:16:13"	"SEQ"	"DNA"	""	""
"0000293343"	"00292175"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000293344"	"00292176"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000293345"	"00292177"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000305804"	"00304675"	"1"	"03575"	"00006"	"2020-06-24 11:55:42"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000462631"	"00460999"	"1"	"04796"	"00006"	"2024-11-05 16:15:00"	""	""	"RT-PCR;SEQ;SEQ-NG"	"DNA;RNA"	"fibroblasts"	"mRNA splicing analysis on tissue"


## Screenings_To_Genes ## Do not remove or alter this header ##
## Count = 17
"{{screeningid}}"	"{{geneid}}"
"0000064195"	"TRPM4"
"0000064196"	"TRPM4"
"0000064197"	"TRPM4"
"0000064198"	"TRPM4"
"0000205332"	"TRPM4"
"0000205333"	"TRPM4"
"0000205334"	"TRPM4"
"0000205335"	"TRPM4"
"0000205336"	"TRPM4"
"0000205337"	"TRPM4"
"0000205338"	"TRPM4"
"0000205339"	"TRPM4"
"0000205340"	"TRPM4"
"0000205341"	"TRPM4"
"0000205342"	"TRPM4"
"0000205343"	"TRPM4"
"0000462631"	"TRPM4"


## Variants_On_Genome ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Count = 247
"{{id}}"	"{{allele}}"	"{{effectid}}"	"{{chromosome}}"	"{{position_g_start}}"	"{{position_g_end}}"	"{{type}}"	"{{average_frequency}}"	"{{owned_by}}"	"{{VariantOnGenome/DBID}}"	"{{VariantOnGenome/DNA}}"	"{{VariantOnGenome/Frequency}}"	"{{VariantOnGenome/Reference}}"	"{{VariantOnGenome/Restriction_site}}"	"{{VariantOnGenome/Published_as}}"	"{{VariantOnGenome/Remarks}}"	"{{VariantOnGenome/Genetic_origin}}"	"{{VariantOnGenome/Segregation}}"	"{{VariantOnGenome/dbSNP}}"	"{{VariantOnGenome/VIP}}"	"{{VariantOnGenome/Methylation}}"	"{{VariantOnGenome/ISCN}}"	"{{VariantOnGenome/DNA/hg38}}"	"{{VariantOnGenome/ClinVar}}"	"{{VariantOnGenome/ClinicalClassification}}"	"{{VariantOnGenome/ClinicalClassification/Method}}"
"0000071823"	"0"	"70"	"19"	"49686146"	"49686146"	"subst"	"0.00151969"	"01337"	"TRPM4_000012"	"g.49686146G>A"	""	"{PMID:Hertz 2015:26350513}, {DOI:Hertz 2015:10.1038/ejhg.2015.198}"	""	""	""	"Germline"	"?"	""	"0"	""	""	"g.49182889G>A"	""	"likely pathogenic"	""
"0000071832"	"0"	"70"	"19"	"49685865"	"49685865"	"subst"	"0.000476827"	"01337"	"TRPM4_000003"	"g.49685865G>A"	""	"{PMID:Hertz 2015:26350513}, {DOI:Hertz 2015:10.1038/ejhg.2015.198}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.49182608G>A"	""	"likely pathogenic"	""
"0000071833"	"0"	"70"	"19"	"49691898"	"49691898"	"subst"	"0.000511667"	"01337"	"TRPM4_000011"	"g.49691898G>A"	""	"{PMID:Hertz 2015:26350513}, {DOI:Hertz 2015:10.1038/ejhg.2015.198}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.49188641G>A"	""	"likely pathogenic"	""
"0000095177"	"0"	"90"	"19"	"49685892"	"49685892"	"subst"	"3.65889E-5"	"01195"	"TRPM4_000015"	"g.49685892G>A"	""	"{PMID:Hof 2017:28315637}"	""	""	"6/75617 (6/66466 ExAC European, non-Finnish), 0/8600 ESP (European American), 0/551 our controls)"	"Germline"	"?"	""	"0"	""	""	"g.49182635G>A"	""	"pathogenic"	""
"0000095178"	"0"	"90"	"19"	"49686066"	"49686066"	"subst"	"6.65109E-5"	"01195"	"TRPM4_000017"	"g.49686066C>T"	""	"{PMID:Hof 2017:28315637}"	""	""	"15/71146 (ExAC 12/62148, ESP 2/8588, our controls 1/410)"	"Germline"	"?"	""	"0"	""	""	"g.49182809C>T"	""	"pathogenic"	""
"0000095179"	"0"	"70"	"19"	"49686067"	"49686067"	"subst"	"0"	"01195"	"TRPM4_000016"	"g.49686067G>C"	""	"{PMID:Hof 2017:28315637}"	""	""	"not in 71146 controls (ExAC 0/62148, ESP 0/8588, our controls 0/410)"	"Germline"	"?"	""	"0"	""	""	"g.49182810G>C"	""	"likely pathogenic"	""
"0000095180"	"0"	"90"	"19"	"49700017"	"49700017"	"subst"	"0.00102493"	"01195"	"TRPM4_000004"	"g.49700017G>A"	""	"{PMID:Hof 2017:28315637}"	""	""	"55/17683 (ExAC 37/8324, ESP 13/8359, our controls 4/1000)"	"Germline"	"?"	"rs200038418"	"0"	""	""	"g.49196760G>A"	""	"pathogenic"	""
"0000096560"	"0"	"50"	"19"	"49686146"	"49686146"	"subst"	"0.00151969"	"01602"	"TRPM4_000012"	"g.49686146G>A"	""	"{PMID:Neubauer 2017:28074886}, {DOI:Neubauer 2017:10.1038/ejhg.2016.199}"	""	""	""	"Germline"	"?"	"rs71352737"	"0"	""	""	"g.49182889G>A"	""	"VUS"	""
"0000096968"	"0"	"50"	"19"	"49686146"	"49686146"	"subst"	"0.00151969"	"01602"	"TRPM4_000012"	"g.49686146G>A"	""	"{PMID:Neubauer 2017:28074886}, {DOI:Neubauer 2017:10.1038/ejhg.2016.199}"	""	""	""	"Germline"	"?"	"rs71352737"	"0"	""	""	"g.49182889G>A"	""	"VUS"	""
"0000096971"	"0"	"50"	"19"	"49669452"	"49669452"	"dup"	"0"	"01602"	"TRPM4_000018"	"g.49669452dup"	""	"{PMID:Neubauer 2017:28074886}, {DOI:Neubauer 2017:10.1038/ejhg.2016.199}"	""	""	""	"Germline"	"?"	""	"0"	""	""	"g.49166195dup"	""	"VUS"	""
"0000217955"	"0"	"50"	"19"	"49691898"	"49691898"	"subst"	"0.000511667"	"02244"	"TRPM4_000011"	"g.49691898G>A"	""	"{PMID:Sahlin 2019:30615648}, {DOI:Sahlin 2019:10.1371/journal.pone.0210017}"	""	""	""	"Germline"	"?"	""	""	""	""	"g.49188641G>A"	""	"VUS"	""
"0000217957"	"0"	"50"	"19"	"49703585"	"49703585"	"subst"	"0.000577039"	"02244"	"TRPM4_000023"	"g.49703585C>T"	""	"{PMID:Sahlin 2019:30615648}, {DOI:Sahlin 2019:10.1371/journal.pone.0210017}"	""	""	""	"Germline"	"?"	""	""	""	""	"g.49200328C>T"	""	"VUS"	""
"0000217963"	"0"	"50"	"19"	"49684686"	"49684686"	"subst"	"0"	"02244"	"TRPM4_000021"	"g.49684686A>G"	""	"{PMID:Sahlin 2019:30615648}, {DOI:Sahlin 2019:10.1371/journal.pone.0210017}"	""	""	""	"Germline"	""	""	""	""	""	"g.49181429A>G"	""	"VUS"	""
"0000217965"	"0"	"50"	"19"	"49703651"	"49703651"	"subst"	"0.00122695"	"02244"	"TRPM4_000024"	"g.49703651A>T"	""	"{PMID:Sahlin 2019:30615648}, {DOI:Sahlin 2019:10.1371/journal.pone.0210017}"	""	""	""	"Germline"	"?"	""	""	""	""	"g.49200394A>T"	""	"VUS"	""
"0000218371"	"0"	"50"	"19"	"49671946"	"49671946"	"subst"	"5.5145E-5"	"02244"	"TRPM4_000019"	"g.49671946G>A"	""	"{PMID:Sahlin 2019:30615648}, {DOI:Sahlin 2019:10.1371/journal.pone.0210017}"	""	""	""	"Germline"	"?"	""	""	""	""	"g.49168689G>A"	""	"VUS"	""
"0000218381"	"0"	"90"	"19"	"49684650"	"49684657"	"del"	"0"	"02244"	"TRPM4_000020"	"g.49684650_49684657del"	""	"{PMID:Sahlin 2019:30615648}, {DOI:Sahlin 2019:10.1371/journal.pone.0210017}"	""	""	""	"Germline"	"?"	""	""	""	""	"g.49181393_49181400del"	""	"pathogenic"	""
"0000218481"	"0"	"90"	"19"	"49703651"	"49703651"	"subst"	"0.00122695"	"02244"	"TRPM4_000024"	"g.49703651A>T"	""	"{PMID:Sahlin 2019:30615648}, {DOI:Sahlin 2019:10.1371/journal.pone.0210017}"	""	""	""	"Germline"	"?"	""	""	""	""	"g.49200394A>T"	""	"pathogenic"	""
"0000218487"	"0"	"50"	"19"	"49691971"	"49691971"	"subst"	"0"	"02244"	"TRPM4_000022"	"g.49691971C>T"	""	"{PMID:Sahlin 2019:30615648}, {DOI:Sahlin 2019:10.1371/journal.pone.0210017}"	""	""	""	"Germline"	"?"	""	""	""	""	"g.49188714C>T"	""	"VUS"	""
"0000247582"	"0"	"10"	"19"	"49685957"	"49685957"	"subst"	"4.06769E-6"	"02330"	"TRPM4_000050"	"g.49685957A>G"	""	""	""	"TRPM4(NM_017636.4):c.1386A>G (p.Q462=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49182700A>G"	""	"benign"	""
"0000247583"	"0"	"10"	"19"	"49714043"	"49714043"	"subst"	"0.00104179"	"02330"	"TRPM4_000074"	"g.49714043A>C"	""	""	""	"TRPM4(NM_017636.4):c.3405A>C (p.A1135=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49210786A>C"	""	"benign"	""
"0000247585"	"0"	"10"	"19"	"49686408"	"49686408"	"subst"	"0.00357134"	"02330"	"TRPM4_000077"	"g.49686408A>C"	""	""	""	"TRPM4(NM_017636.4):c.1682A>C (p.D561A)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49183151A>C"	""	"benign"	""
"0000247605"	"0"	"10"	"19"	"49693461"	"49693461"	"subst"	"0.00012594"	"02330"	"TRPM4_000054"	"g.49693461A>C"	""	""	""	"TRPM4(NM_017636.4):c.2020-4A>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49190204A>C"	""	"benign"	""
"0000247606"	"0"	"10"	"19"	"49703540"	"49703540"	"subst"	"0.00102563"	"02330"	"TRPM4_000064"	"g.49703540A>T"	""	""	""	"TRPM4(NM_017636.4):c.2646-17A>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49200283A>T"	""	"benign"	""
"0000247617"	"0"	"30"	"19"	"49700047"	"49700047"	"subst"	"0.00080115"	"02330"	"TRPM4_000062"	"g.49700047A>G"	""	""	""	"TRPM4(NM_017636.4):c.2561A>G (p.Q854R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49196790A>G"	""	"likely benign"	""
"0000256203"	"0"	"50"	"19"	"49703651"	"49703651"	"subst"	"0.00122695"	"01943"	"TRPM4_000024"	"g.49703651A>T"	""	""	""	"TRPM4(NM_017636.3):c.2740A>T (p.K914*), TRPM4(NM_017636.4):c.2740A>T (p.K914*, p.(Lys914Ter))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49200394A>T"	""	"VUS"	""
"0000309539"	"0"	"10"	"19"	"49661112"	"49661112"	"subst"	"0.23711"	"02330"	"TRPM4_000025"	"g.49661112G>A"	""	""	""	"TRPM4(NM_017636.4):c.-12G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49157855G>A"	""	"benign"	""
"0000309540"	"0"	"10"	"19"	"49675017"	"49675017"	"subst"	"0.04813"	"02330"	"TRPM4_000041"	"g.49675017G>T"	""	""	""	"TRPM4(NM_017636.4):c.1041G>T (p.L347=, p.(Leu347=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49171760G>T"	""	"benign"	""
"0000309542"	"0"	"10"	"19"	"49684586"	"49684586"	"subst"	"0.0395804"	"02330"	"TRPM4_000044"	"g.49684586T>A"	""	""	""	"TRPM4(NM_017636.4):c.1151-20T>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49181329T>A"	""	"benign"	""
"0000309543"	"0"	"10"	"19"	"49684697"	"49684697"	"subst"	"0.000126019"	"02330"	"TRPM4_000045"	"g.49684697T>C"	""	""	""	"TRPM4(NM_017636.3):c.1242T>C (p.F414=), TRPM4(NM_017636.4):c.1242T>C (p.F414=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49181440T>C"	""	"benign"	""
"0000309544"	"0"	"10"	"19"	"49684727"	"49684727"	"subst"	"0"	"02330"	"TRPM4_000046"	"g.49684727T>C"	""	""	""	"TRPM4(NM_017636.4):c.1263+9T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49181470T>C"	""	"benign"	""
"0000309545"	"0"	"50"	"19"	"49685865"	"49685865"	"subst"	"0.000476827"	"02330"	"TRPM4_000003"	"g.49685865G>A"	""	""	""	"TRPM4(NM_001195227.1):c.1294G>A (p.(Ala432Thr)), TRPM4(NM_017636.3):c.1294G>A (p.A432T), TRPM4(NM_017636.4):c.1294G>A (p.A432T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49182608G>A"	""	"VUS"	""
"0000309546"	"0"	"10"	"19"	"49685894"	"49685894"	"subst"	"2.84523E-5"	"02330"	"TRPM4_000047"	"g.49685894G>T"	""	""	""	"TRPM4(NM_017636.4):c.1323G>T (p.V441=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49182637G>T"	""	"benign"	""
"0000309547"	"0"	"50"	"19"	"49685933"	"49685933"	"subst"	"0"	"02330"	"TRPM4_000048"	"g.49685933C>G"	""	""	""	"TRPM4(NM_017636.4):c.1362C>G (p.F454L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49182676C>G"	""	"VUS"	""
"0000309548"	"0"	"10"	"19"	"49685939"	"49685939"	"subst"	"0.00253318"	"02330"	"TRPM4_000049"	"g.49685939C>G"	""	""	""	"TRPM4(NM_017636.3):c.1368C>G (p.T456=), TRPM4(NM_017636.4):c.1368C>G (p.T456=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49182682C>G"	""	"benign"	""
"0000309549"	"0"	"10"	"19"	"49686030"	"49686065"	"del"	"0"	"02330"	"TRPM4_000051"	"g.49686030_49686065del"	""	""	""	"TRPM4(NM_017636.3):c.1459_1494delAAAGCCCCAGCCCTAAAAGGGGGAGCTGCGGAGCTC (p.(Lys487_Leu498del)), TRPM4(NM_017636.4):c.1459_1494del (p.K487_L498del)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49182773_49182808del"	""	"benign"	""
"0000309550"	"0"	"30"	"19"	"49686146"	"49686146"	"subst"	"0.00151969"	"02330"	"TRPM4_000012"	"g.49686146G>A"	""	""	""	"TRPM4(NM_017636.3):c.1575G>A (p.W525*), TRPM4(NM_017636.4):c.1575G>A (p.W525*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49182889G>A"	""	"likely benign"	""
"0000309551"	"0"	"50"	"19"	"49691898"	"49691898"	"subst"	"0.000511667"	"02330"	"TRPM4_000011"	"g.49691898G>A"	""	""	""	"TRPM4(NM_001195227.1):c.1744G>A (p.?), TRPM4(NM_017636.3):c.1744G>A (p.G582S), TRPM4(NM_017636.4):c.1744G>A (p.G582S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49188641G>A"	""	"VUS"	""
"0000309552"	"0"	"10"	"19"	"49692194"	"49692194"	"subst"	"0.000151506"	"02330"	"TRPM4_000052"	"g.49692194C>T"	""	""	""	"TRPM4(NM_017636.4):c.1874-9C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49188937C>T"	""	"benign"	""
"0000309553"	"0"	"10"	"19"	"49692210"	"49692210"	"subst"	"2.04792E-5"	"02330"	"TRPM4_000053"	"g.49692210T>C"	""	""	""	"TRPM4(NM_017636.4):c.1881T>C (p.F627=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49188953T>C"	""	"benign"	""
"0000309554"	"0"	"30"	"19"	"49693944"	"49693944"	"subst"	"1.2192E-5"	"02330"	"TRPM4_000056"	"g.49693944C>A"	""	""	""	"TRPM4(NM_017636.4):c.2133-9C>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49190687C>A"	""	"likely benign"	""
"0000309555"	"0"	"10"	"19"	"49694029"	"49694029"	"subst"	"0.00205937"	"02330"	"TRPM4_000057"	"g.49694029G>A"	""	""	""	"TRPM4(NM_017636.4):c.2209G>A (p.G737R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49190772G>A"	""	"benign"	""
"0000309556"	"0"	"10"	"19"	"49694041"	"49694041"	"subst"	"0.0129374"	"02330"	"TRPM4_000058"	"g.49694041C>G"	""	""	""	"TRPM4(NM_017636.4):c.2210+11C>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49190784C>G"	""	"benign"	""
"0000309557"	"0"	"10"	"19"	"49699769"	"49699780"	"del"	"0"	"02330"	"TRPM4_000059"	"g.49699769_49699780del"	""	""	""	"TRPM4(NM_017636.4):c.2283_2294delCCGCTGCGGGGG (p.C763_R766del)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49196512_49196523del"	""	"benign"	""
"0000309558"	"0"	"10"	"19"	"49699866"	"49699866"	"subst"	"0.0692714"	"02330"	"TRPM4_000060"	"g.49699866C>T"	""	""	""	"TRPM4(NM_017636.4):c.2380C>T (p.L794=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49196609C>T"	""	"benign"	""
"0000309559"	"0"	"30"	"19"	"49661153"	"49661153"	"subst"	"8.34991E-5"	"02330"	"TRPM4_000026"	"g.49661153C>G"	""	""	""	"TRPM4(NM_017636.4):c.24+6C>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49157896C>G"	""	"likely benign"	""
"0000309560"	"0"	"30"	"19"	"49699886"	"49699886"	"subst"	"0"	"02330"	"TRPM4_000061"	"g.49699886G>T"	""	""	""	"TRPM4(NM_017636.4):c.2400G>T (p.V800=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49196629G>T"	""	"likely benign"	""
"0000309561"	"0"	"10"	"19"	"49669448"	"49669448"	"subst"	"3.04305E-5"	"02330"	"TRPM4_000028"	"g.49669448G>C"	""	""	""	"TRPM4(NM_017636.4):c.243G>C (p.T81=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49166191G>C"	""	"benign"	""
"0000309562"	"0"	"50"	"19"	"49700059"	"49700059"	"subst"	"4.87163E-6"	"02330"	"TRPM4_000063"	"g.49700059T>G"	""	""	""	"TRPM4(NM_017636.4):c.2573T>G (p.L858R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49196802T>G"	""	"VUS"	""
"0000309563"	"0"	"50"	"19"	"49703576"	"49703576"	"del"	"0"	"02330"	"TRPM4_000065"	"g.49703576del"	""	""	""	"TRPM4(NM_017636.4):c.2665del (p.(His889Thrfs*35)), TRPM4(NM_017636.4):c.2665delC (p.H889Tfs*35)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49200319del"	""	"VUS"	""
"0000309564"	"0"	"10"	"19"	"49669486"	"49669486"	"subst"	"0.011248"	"02330"	"TRPM4_000029"	"g.49669486C>G"	""	""	""	"TRPM4(NM_017636.4):c.267+14C>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49166229C>G"	""	"benign"	""
"0000309565"	"0"	"10"	"19"	"49704023"	"49704023"	"subst"	"0.00621519"	"02330"	"TRPM4_000066"	"g.49704023T>C"	""	""	""	"TRPM4(NM_017636.4):c.2934T>C (p.I978=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49200766T>C"	""	"benign"	""
"0000309566"	"0"	"10"	"19"	"49705249"	"49705249"	"subst"	"0.00731528"	"02330"	"TRPM4_000067"	"g.49705249G>A"	""	""	""	"TRPM4(NM_017636.4):c.2982G>A (p.S994=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49201992G>A"	""	"benign"	""
"0000309567"	"0"	"50"	"19"	"49705266"	"49705266"	"subst"	"0"	"02330"	"TRPM4_000068"	"g.49705266G>A"	""	""	""	"TRPM4(NM_017636.4):c.2999G>A (p.W1000*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49202009G>A"	""	"VUS"	""
"0000309568"	"0"	"10"	"19"	"49671207"	"49671207"	"subst"	"7.6137E-5"	"02330"	"TRPM4_000030"	"g.49671207G>A"	""	""	""	"TRPM4(NM_017636.3):c.301G>A (p.(Ala101Thr)), TRPM4(NM_017636.4):c.301G>A (p.A101T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49167950G>A"	""	"benign"	""
"0000309569"	"0"	"10"	"19"	"49705291"	"49705291"	"subst"	"0.00654903"	"02330"	"TRPM4_000069"	"g.49705291G>A"	""	""	""	"TRPM4(NM_017636.4):c.3024G>A (p.A1008=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49202034G>A"	""	"benign"	""
"0000309570"	"0"	"10"	"19"	"49705415"	"49705415"	"subst"	"0.00371762"	"02330"	"TRPM4_000070"	"g.49705415C>T"	""	""	""	"TRPM4(NM_017636.4):c.3131+17C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49202158C>T"	""	"benign"	""
"0000309571"	"0"	"10"	"19"	"49671228"	"49671228"	"subst"	"0.00211575"	"02330"	"TRPM4_000031"	"g.49671228C>T"	""	""	""	"TRPM4(NM_017636.4):c.322C>T (p.R108C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49167971C>T"	""	"benign"	""
"0000309572"	"0"	"10"	"19"	"49713959"	"49713959"	"subst"	"8.15069E-6"	"02330"	"TRPM4_000071"	"g.49713959C>G"	""	""	""	"TRPM4(NM_017636.4):c.3329-8C>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49210702C>G"	""	"benign"	""
"0000309573"	"0"	"50"	"19"	"49713990"	"49713990"	"subst"	"0"	"02330"	"TRPM4_000072"	"g.49713990G>A"	""	""	""	"TRPM4(NM_017636.4):c.3352G>A (p.E1118K)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49210733G>A"	""	"VUS"	""
"0000309574"	"0"	"50"	"19"	"49714025"	"49714025"	"subst"	"4.88838E-5"	"02330"	"TRPM4_000073"	"g.49714025G>C"	""	""	""	"TRPM4(NM_017636.4):c.3387G>C (p.K1129N)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49210768G>C"	""	"VUS"	""
"0000309575"	"0"	"10"	"19"	"49671260"	"49671260"	"subst"	"0.00055321"	"02330"	"TRPM4_000032"	"g.49671260G>C"	""	""	""	"TRPM4(NM_017636.4):c.354G>C (p.V118=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49168003G>C"	""	"benign"	""
"0000309576"	"0"	"10"	"19"	"49714497"	"49714497"	"subst"	"0.00346899"	"02330"	"TRPM4_000075"	"g.49714497C>T"	""	""	""	"TRPM4(NM_017636.4):c.3611C>T (p.P1204L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49211240C>T"	""	"benign"	""
"0000309577"	"0"	"10"	"19"	"49714732"	"49714732"	"subst"	"0.00764169"	"02330"	"TRPM4_000076"	"g.49714732C>G"	""	""	""	"TRPM4(NM_017636.4):c.3641-19C>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49211475C>G"	""	"benign"	""
"0000309578"	"0"	"50"	"19"	"49671322"	"49671322"	"subst"	"4.15707E-5"	"02330"	"TRPM4_000033"	"g.49671322G>A"	""	""	""	"TRPM4(NM_017636.4):c.416G>A (p.R139H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49168065G>A"	""	"VUS"	""
"0000309579"	"0"	"10"	"19"	"49671507"	"49671507"	"subst"	"0.0202864"	"02330"	"TRPM4_000034"	"g.49671507G>A"	""	""	""	"TRPM4(NM_017636.4):c.449-10G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49168250G>A"	""	"benign"	""
"0000309580"	"0"	"50"	"19"	"49671832"	"49671832"	"subst"	"3.25148E-5"	"02330"	"TRPM4_000035"	"g.49671832G>A"	""	""	""	"TRPM4(NM_017636.4):c.635G>A (p.R212Q)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49168575G>A"	""	"VUS"	""
"0000309581"	"0"	"10"	"19"	"49671908"	"49671908"	"subst"	"2.45413E-5"	"02330"	"TRPM4_000036"	"g.49671908C>T"	""	""	""	"TRPM4(NM_017636.4):c.711C>T (p.D237=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49168651C>T"	""	"benign"	""
"0000309582"	"0"	"10"	"19"	"49671952"	"49671952"	"subst"	"0.00427948"	"02330"	"TRPM4_000037"	"g.49671952G>A"	""	""	""	"TRPM4(NM_017636.4):c.755G>A (p.R252H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49168695G>A"	""	"benign"	""
"0000309583"	"0"	"10"	"19"	"49671980"	"49671980"	"subst"	"0.0219535"	"02330"	"TRPM4_000038"	"g.49671980G>A"	""	""	""	"TRPM4(NM_017636.4):c.783G>A (p.K261=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49168723G>A"	""	"benign"	""
"0000309584"	"0"	"10"	"19"	"49674601"	"49674601"	"subst"	"0"	"02330"	"TRPM4_000039"	"g.49674601C>A"	""	""	""	"TRPM4(NM_017636.4):c.797-13C>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49171344C>A"	""	"benign"	""
"0000309585"	"0"	"10"	"19"	"49674846"	"49674846"	"subst"	"0.00315855"	"02330"	"TRPM4_000040"	"g.49674846C>T"	""	""	""	"TRPM4(NM_017636.4):c.870C>T (p.N290=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49171589C>T"	""	"benign"	""
"0000309586"	"0"	"10"	"19"	"49661528"	"49661528"	"subst"	"0.000248105"	"02330"	"TRPM4_000027"	"g.49661528G>A"	""	""	""	"TRPM4(NM_017636.4):c.92+12G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49158271G>A"	""	"benign"	""
"0000314842"	"0"	"30"	"19"	"49714497"	"49714497"	"subst"	"0.00346899"	"02326"	"TRPM4_000075"	"g.49714497C>T"	""	""	""	"TRPM4(NM_017636.4):c.3611C>T (p.P1204L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49211240C>T"	""	"likely benign"	""
"0000317146"	"0"	"50"	"19"	"49685865"	"49685865"	"subst"	"0.000476827"	"01943"	"TRPM4_000003"	"g.49685865G>A"	""	""	""	"TRPM4(NM_001195227.1):c.1294G>A (p.(Ala432Thr)), TRPM4(NM_017636.3):c.1294G>A (p.A432T), TRPM4(NM_017636.4):c.1294G>A (p.A432T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49182608G>A"	""	"VUS"	""
"0000317147"	"0"	"50"	"19"	"49691898"	"49691898"	"subst"	"0.000511667"	"01943"	"TRPM4_000011"	"g.49691898G>A"	""	""	""	"TRPM4(NM_001195227.1):c.1744G>A (p.?), TRPM4(NM_017636.3):c.1744G>A (p.G582S), TRPM4(NM_017636.4):c.1744G>A (p.G582S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49188641G>A"	""	"VUS"	""
"0000326692"	"0"	"50"	"19"	"49657619"	"49657619"	"subst"	"0"	"01804"	"HRC_000002"	"g.49657619G>T"	""	""	""	"HRC(NM_002152.2):c.876C>A (p.(Asp292Glu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49154362G>T"	""	"VUS"	""
"0000326693"	"0"	"50"	"19"	"49657751"	"49657753"	"dup"	"0"	"01804"	"HRC_000003"	"g.49657751_49657753dup"	""	""	""	"HRC(NM_002152.2):c.782_784dup (p.(Asp261dup))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49154494_49154496dup"	""	"VUS"	""
"0000326695"	"0"	"50"	"19"	"49657742"	"49657753"	"del"	"0"	"01804"	"HRC_000004"	"g.49657742_49657753del"	""	""	""	"HRC(NM_002152.2):c.773_784del (p.(Asp258_Asp261del))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49154485_49154496del"	""	"VUS"	""
"0000326696"	"0"	"50"	"19"	"49657739"	"49657753"	"del"	"0"	"01804"	"HRC_000005"	"g.49657739_49657753del"	""	""	""	"HRC(NM_002152.2):c.770_784del (p.(Asp257_Asp261del))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49154482_49154496del"	""	"VUS"	""
"0000326697"	"0"	"50"	"19"	"49657751"	"49657753"	"del"	"0"	"01804"	"HRC_000007"	"g.49657751_49657753del"	""	""	""	"HRC(NM_002152.2):c.779_781del (p.(Asp261del)), HRC(NM_002152.3):c.782_784delATG (p.D261del)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49154494_49154496del"	""	"VUS"	""
"0000326699"	"0"	"50"	"19"	"49657754"	"49657754"	"subst"	"0"	"01804"	"HRC_000010"	"g.49657754G>T"	""	""	""	"HRC(NM_002152.2):c.741C>A (p.(Asp247Glu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49154497G>T"	""	"VUS"	""
"0000326700"	"0"	"50"	"19"	"49657757"	"49657757"	"subst"	"0"	"01804"	"HRC_000011"	"g.49657757A>T"	""	""	""	"HRC(NM_002152.2):c.738T>A (p.(Asp246Glu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49154500A>T"	""	"VUS"	""
"0000326702"	"0"	"50"	"19"	"49657765"	"49657765"	"subst"	"0"	"01804"	"HRC_000012"	"g.49657765C>T"	""	""	""	"HRC(NM_002152.2):c.730G>A (p.(Glu244Lys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49154508C>T"	""	"VUS"	""
"0000326703"	"0"	"50"	"19"	"49657773"	"49657773"	"subst"	"0"	"01804"	"HRC_000013"	"g.49657773T>C"	""	""	""	"HRC(NM_002152.2):c.722A>G (p.(Gln241Arg))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49154516T>C"	""	"VUS"	""
"0000326704"	"0"	"50"	"19"	"49657792"	"49657792"	"subst"	"0"	"01804"	"HRC_000014"	"g.49657792C>T"	""	""	""	"HRC(NM_002152.2):c.703G>A (p.(Gly235Ser))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49154535C>T"	""	"VUS"	""
"0000326705"	"0"	"50"	"19"	"49657806"	"49657806"	"subst"	"8.41673E-6"	"01804"	"HRC_000015"	"g.49657806C>T"	""	""	""	"HRC(NM_002152.2):c.689G>A (p.(Gly230Glu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49154549C>T"	""	"VUS"	""
"0000326706"	"0"	"50"	"19"	"49675366"	"49675366"	"subst"	"3.24884E-5"	"01804"	"TRPM4_000043"	"g.49675366G>A"	""	""	""	"TRPM4(NM_001195227.1):c.1150+1G>A (p.?)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49172109G>A"	""	"VUS"	""
"0000326707"	"0"	"50"	"19"	"49685865"	"49685865"	"subst"	"0.000476827"	"01804"	"TRPM4_000003"	"g.49685865G>A"	""	""	""	"TRPM4(NM_001195227.1):c.1294G>A (p.(Ala432Thr)), TRPM4(NM_017636.3):c.1294G>A (p.A432T), TRPM4(NM_017636.4):c.1294G>A (p.A432T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49182608G>A"	""	"VUS"	""
"0000326709"	"0"	"50"	"19"	"49691898"	"49691898"	"subst"	"0.000511667"	"01804"	"TRPM4_000011"	"g.49691898G>A"	""	""	""	"TRPM4(NM_001195227.1):c.1744G>A (p.?), TRPM4(NM_017636.3):c.1744G>A (p.G582S), TRPM4(NM_017636.4):c.1744G>A (p.G582S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49188641G>A"	""	"VUS"	""
"0000326711"	"0"	"50"	"19"	"49693488"	"49693488"	"subst"	"0"	"01804"	"TRPM4_000055"	"g.49693488G>A"	""	""	""	"TRPM4(NM_001195227.1):c.2043G>A (p.(Trp681Ter))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.49190231G>A"	""	"VUS"	""
"0000434696"	"1"	"95"	"19"	"49661142"	"49661142"	"subst"	"0"	"00000"	"TRPM4_000001"	"g.49661142G>A"	""	"{PMID:Kruse et al 2009:19726882}, {OMIM606936:0001}"	"MboII+"	""	"not in 460 Afrikaner control chromosomes, not in 778 European control chromosomes; variant from founder Portugal"	"Germline"	""	""	"0"	""	""	"g.49157885G>A"	""	"pathogenic"	""
"0000434697"	"0"	"95"	"19"	"49661142"	"49661142"	"subst"	"0"	"00000"	"TRPM4_000001"	"g.49661142G>A"	""	"{PMID:Kruse et al 2009:19726882}, {OMIM606936:0001}"	""	""	"expression cloning HEK293/CHO cells; increased current density, elevated steady state TRPM4 protein level"	"In vitro (cloned)"	""	""	"0"	""	""	"g.49157885G>A"	""	"NA"	""
"0000434698"	"1"	"75"	"19"	"49671299"	"49671299"	"subst"	"4.50956E-5"	"02971"	"TRPM4_000009"	"g.49671299G>C"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.49168042G>C"	""	"likely pathogenic"	""
"0000434699"	"1"	"95"	"19"	"49671558"	"49671558"	"subst"	"1.62454E-5"	"00000"	"TRPM4_000002"	"g.49671558C>T"	""	"{PMID:Liu et al 2010:20562447}"	""	""	"mapped by linkage"	"Germline"	""	""	"0"	""	""	"g.49168301C>T"	""	"pathogenic"	""
"0000434700"	"1"	"75"	"19"	"49674854"	"49674854"	"subst"	"0.000187521"	"02971"	"TRPM4_000010"	"g.49674854A>G"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.49171597A>G"	""	"likely pathogenic"	""
"0000434701"	"1"	"95"	"19"	"49685865"	"49685865"	"subst"	"0.000476827"	"00000"	"TRPM4_000003"	"g.49685865G>A"	""	"{PMID:Liu et al 2010:20562447}"	""	""	"mapped by linkage"	"Germline"	""	""	"0"	""	""	"g.49182608G>A"	""	"pathogenic"	""
"0000434702"	"0"	"95"	"19"	"49685865"	"49685865"	"subst"	"0.000476827"	"02971"	"TRPM4_000003"	"g.49685865G>A"	""	""	""	""	"mapped by linkage"	"Germline"	""	""	"0"	""	""	"g.49182608G>A"	""	"pathogenic"	""
"0000434703"	"0"	"75"	"19"	"49691898"	"49691898"	"subst"	"0.000511667"	"02971"	"TRPM4_000011"	"g.49691898G>A"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.49188641G>A"	""	"likely pathogenic"	""
"0000434704"	"21"	"35"	"19"	"49699769"	"49699780"	"del"	"0"	"02971"	"TRPM4_000005"	"g.49699769_49699780del"	""	""	""	"Arg762-Gly765del"	""	"Germline"	""	""	"0"	""	""	"g.49196512_49196523del"	""	"likely benign"	""
"0000434705"	"0"	"35"	"19"	"49699769"	"49699780"	"del"	"0"	"02971"	"TRPM4_000005"	"g.49699769_49699780del"	""	""	""	"Arg762-Gly765del"	""	"Unknown"	""	""	"0"	""	""	"g.49196512_49196523del"	""	"likely benign"	""
"0000434706"	"11"	"75"	"19"	"49699854"	"49699854"	"subst"	"0"	"02971"	"TRPM4_000008"	"g.49699854T>C"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.49196597T>C"	""	"likely pathogenic"	""
"0000434707"	"1"	"95"	"19"	"49700017"	"49700017"	"subst"	"0.00102493"	"00000"	"TRPM4_000004"	"g.49700017G>A"	""	"{PMID:Liu et al 2010:20562447}"	""	""	"mapped by linkage"	"Germline"	""	""	"0"	""	""	"g.49196760G>A"	""	"pathogenic"	""
"0000434708"	"11"	"95"	"19"	"49700017"	"49700017"	"subst"	"0.00102493"	"02971"	"TRPM4_000004"	"g.49700017G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.49196760G>A"	""	"pathogenic"	""
"0000434709"	"21"	"75"	"19"	"49700017"	"49700017"	"subst"	"0.00102493"	"02971"	"TRPM4_000004"	"g.49700017G>A"	""	""	""	""	"mapped by linkage"	"Germline"	""	""	"0"	""	""	"g.49196760G>A"	""	"likely pathogenic"	""
"0000434710"	"11"	"75"	"19"	"49703652"	"49703652"	"subst"	"0"	"02971"	"TRPM4_000006"	"g.49703652A>G"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.49200395A>G"	""	"likely pathogenic"	""
"0000434711"	"1"	"75"	"19"	"49703997"	"49703997"	"subst"	"4.06293E-6"	"02971"	"TRPM4_000007"	"g.49703997C>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.49200740C>T"	""	"likely pathogenic"	""
"0000567958"	"0"	"50"	"19"	"49657603"	"49657603"	"subst"	"4.50214E-5"	"01804"	"HRC_000017"	"g.49657603G>A"	""	""	""	"HRC(NM_002152.2):c.892C>T (p.(Arg298Ter))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49154346G>A"	""	"VUS"	""
"0000567963"	"0"	"10"	"19"	"49671212"	"49671212"	"subst"	"8.87949E-5"	"02330"	"TRPM4_000078"	"g.49671212T>G"	""	""	""	"TRPM4(NM_017636.4):c.306T>G (p.V102=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49167955T>G"	""	"benign"	""
"0000567964"	"0"	"10"	"19"	"49671281"	"49671281"	"subst"	"0.0606057"	"02330"	"TRPM4_000079"	"g.49671281G>A"	""	""	""	"TRPM4(NM_017636.4):c.375G>A (p.S125=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49168024G>A"	""	"benign"	""
"0000567965"	"0"	"10"	"19"	"49671360"	"49671360"	"subst"	"0.00227362"	"02330"	"TRPM4_000080"	"g.49671360C>T"	""	""	""	"TRPM4(NM_017636.4):c.448+6C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49168103C>T"	""	"benign"	""
"0000567966"	"0"	"10"	"19"	"49671503"	"49671503"	"subst"	"0.00480257"	"02330"	"TRPM4_000081"	"g.49671503C>T"	""	""	""	"TRPM4(NM_017636.4):c.449-14C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49168246C>T"	""	"benign"	""
"0000567967"	"0"	"50"	"19"	"49671580"	"49671580"	"subst"	"0"	"02330"	"TRPM4_000082"	"g.49671580G>A"	""	""	""	"TRPM4(NM_017636.4):c.512G>A (p.R171Q)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49168323G>A"	""	"VUS"	""
"0000567968"	"0"	"10"	"19"	"49671815"	"49671815"	"subst"	"0.0042594"	"02330"	"TRPM4_000083"	"g.49671815G>A"	""	""	""	"TRPM4(NM_017636.4):c.618G>A (p.S206=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49168558G>A"	""	"benign"	""
"0000567969"	"0"	"30"	"19"	"49671945"	"49671945"	"subst"	"0.000472231"	"02330"	"TRPM4_000084"	"g.49671945C>T"	""	""	""	"TRPM4(NM_017636.4):c.748C>T (p.R250C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49168688C>T"	""	"likely benign"	""
"0000567970"	"0"	"50"	"19"	"49674932"	"49674934"	"del"	"0.000244206"	"02330"	"TRPM4_000085"	"g.49674932_49674934del"	""	""	""	"TRPM4(NM_017636.4):c.956_958delTGG (p.L319_A320del)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49171675_49171677del"	""	"VUS"	""
"0000567971"	"0"	"10"	"19"	"49675039"	"49675042"	"dup"	"0"	"02330"	"TRPM4_000086"	"g.49675039_49675042dup"	""	""	""	"TRPM4(NM_017636.4):c.1050+13_1050+16dupGGGC"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49171782_49171785dup"	""	"benign"	""
"0000567973"	"0"	"10"	"19"	"49684619"	"49684619"	"subst"	"0.000276214"	"02330"	"TRPM4_000088"	"g.49684619G>A"	""	""	""	"TRPM4(NM_017636.4):c.1164G>A (p.S388=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49181362G>A"	""	"benign"	""
"0000567974"	"0"	"10"	"19"	"49684670"	"49684670"	"subst"	"4.06283E-5"	"02330"	"TRPM4_000089"	"g.49684670C>T"	""	""	""	"TRPM4(NM_017636.4):c.1215C>T (p.R405=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49181413C>T"	""	"benign"	""
"0000567975"	"0"	"50"	"19"	"49686122"	"49686122"	"subst"	"0"	"02330"	"TRPM4_000090"	"g.49686122G>A"	""	""	""	"TRPM4(NM_017636.4):c.1551G>A (p.P517=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49182865G>A"	""	"VUS"	""
"0000567976"	"0"	"30"	"19"	"49686146"	"49686146"	"subst"	"0.00151969"	"02325"	"TRPM4_000012"	"g.49686146G>A"	""	""	""	"TRPM4(NM_017636.3):c.1575G>A (p.W525*), TRPM4(NM_017636.4):c.1575G>A (p.W525*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49182889G>A"	""	"likely benign"	""
"0000567977"	"0"	"30"	"19"	"49686363"	"49686363"	"subst"	"0"	"01943"	"TRPM4_000091"	"g.49686363C>T"	""	""	""	"TRPM4(NM_017636.3):c.1637C>T (p.S546L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49183106C>T"	""	"likely benign"	""
"0000567978"	"0"	"10"	"19"	"49692183"	"49692183"	"subst"	"8.18625E-6"	"02330"	"TRPM4_000092"	"g.49692183A>G"	""	""	""	"TRPM4(NM_017636.4):c.1874-20A>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49188926A>G"	""	"benign"	""
"0000567979"	"0"	"50"	"19"	"49692315"	"49692315"	"subst"	"0"	"02330"	"TRPM4_000093"	"g.49692315C>G"	""	""	""	"TRPM4(NM_017636.4):c.1986C>G (p.D662E)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49189058C>G"	""	"VUS"	""
"0000567980"	"0"	"10"	"19"	"49699847"	"49699847"	"subst"	"4.36992E-5"	"02330"	"TRPM4_000094"	"g.49699847G>A"	""	""	""	"TRPM4(NM_017636.4):c.2361G>A (p.V787=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49196590G>A"	""	"benign"	""
"0000567981"	"0"	"50"	"19"	"49699994"	"49699994"	"subst"	"0.00010595"	"02330"	"TRPM4_000095"	"g.49699994C>T"	""	""	""	"TRPM4(NM_017636.4):c.2508C>T (p.G836=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49196737C>T"	""	"VUS"	""
"0000567982"	"0"	"50"	"19"	"49700017"	"49700017"	"subst"	"0.00102493"	"02330"	"TRPM4_000004"	"g.49700017G>A"	""	""	""	"TRPM4(NM_017636.3):c.2531G>A (p.G844D, p.(Gly844Asp)), TRPM4(NM_017636.4):c.2531G>A (p.G844D)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49196760G>A"	""	"VUS"	""
"0000567983"	"0"	"30"	"19"	"49703585"	"49703585"	"subst"	"0.000577039"	"01804"	"TRPM4_000023"	"g.49703585C>T"	""	""	""	"TRPM4(NM_001195227.1):c.2239C>T (p.(Arg747Cys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49200328C>T"	""	"likely benign"	""
"0000567984"	"0"	"30"	"19"	"49703651"	"49703651"	"subst"	"0.00122695"	"02330"	"TRPM4_000024"	"g.49703651A>T"	""	""	""	"TRPM4(NM_017636.3):c.2740A>T (p.K914*), TRPM4(NM_017636.4):c.2740A>T (p.K914*, p.(Lys914Ter))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49200394A>T"	""	"likely benign"	""
"0000567985"	"0"	"30"	"19"	"49703886"	"49703888"	"del"	"0"	"02330"	"TRPM4_000096"	"g.49703886_49703888del"	""	""	""	"TRPM4(NM_017636.4):c.2797_2799delTTC (p.F933del)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49200629_49200631del"	""	"likely benign"	""
"0000567986"	"0"	"50"	"19"	"49705259"	"49705259"	"subst"	"2.03684E-5"	"02330"	"TRPM4_000097"	"g.49705259G>A"	""	""	""	"TRPM4(NM_017636.3):c.2992G>A (p.G998S), TRPM4(NM_017636.4):c.2992G>A (p.G998S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49202002G>A"	""	"VUS"	""
"0000567987"	"0"	"50"	"19"	"49705266"	"49705266"	"subst"	"0"	"02325"	"TRPM4_000068"	"g.49705266G>A"	""	""	""	"TRPM4(NM_017636.4):c.2999G>A (p.W1000*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49202009G>A"	""	"VUS"	""
"0000567988"	"0"	"30"	"19"	"49714471"	"49714471"	"subst"	"4.68345E-6"	"01943"	"TRPM4_000098"	"g.49714471C>G"	""	""	""	"TRPM4(NM_017636.3):c.3585C>G (p.R1195=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49211214C>G"	""	"likely benign"	""
"0000567989"	"0"	"10"	"19"	"49714734"	"49714734"	"subst"	"0.000538696"	"02330"	"TRPM4_000099"	"g.49714734T>G"	""	""	""	"TRPM4(NM_017636.4):c.3641-17T>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49211477T>G"	""	"benign"	""
"0000617745"	"0"	"10"	"19"	"49661112"	"49661112"	"subst"	"0.23711"	"02327"	"TRPM4_000025"	"g.49661112G>A"	""	""	""	"TRPM4(NM_017636.4):c.-12G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49157855G>A"	""	"benign"	""
"0000617746"	"0"	"30"	"19"	"49661153"	"49661153"	"subst"	"8.34991E-5"	"02326"	"TRPM4_000026"	"g.49661153C>G"	""	""	""	"TRPM4(NM_017636.4):c.24+6C>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49157896C>G"	""	"likely benign"	""
"0000617747"	"0"	"10"	"19"	"49669486"	"49669486"	"subst"	"0.011248"	"02327"	"TRPM4_000029"	"g.49669486C>G"	""	""	""	"TRPM4(NM_017636.4):c.267+14C>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49166229C>G"	""	"benign"	""
"0000617748"	"0"	"10"	"19"	"49671207"	"49671207"	"subst"	"7.6137E-5"	"02327"	"TRPM4_000030"	"g.49671207G>A"	""	""	""	"TRPM4(NM_017636.3):c.301G>A (p.(Ala101Thr)), TRPM4(NM_017636.4):c.301G>A (p.A101T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49167950G>A"	""	"benign"	""
"0000617749"	"0"	"10"	"19"	"49671212"	"49671212"	"subst"	"8.87949E-5"	"02327"	"TRPM4_000078"	"g.49671212T>G"	""	""	""	"TRPM4(NM_017636.4):c.306T>G (p.V102=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49167955T>G"	""	"benign"	""
"0000617750"	"0"	"10"	"19"	"49671281"	"49671281"	"subst"	"0.0606057"	"02327"	"TRPM4_000079"	"g.49671281G>A"	""	""	""	"TRPM4(NM_017636.4):c.375G>A (p.S125=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49168024G>A"	""	"benign"	""
"0000617751"	"0"	"10"	"19"	"49671507"	"49671507"	"subst"	"0.0202864"	"02327"	"TRPM4_000034"	"g.49671507G>A"	""	""	""	"TRPM4(NM_017636.4):c.449-10G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49168250G>A"	""	"benign"	""
"0000617752"	"0"	"30"	"19"	"49671584"	"49671584"	"subst"	"0"	"01943"	"TRPM4_000100"	"g.49671584C>T"	""	""	""	"TRPM4(NM_017636.3):c.516C>T (p.D172=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49168327C>T"	""	"likely benign"	""
"0000617753"	"0"	"10"	"19"	"49671771"	"49671771"	"subst"	"0.0201572"	"02327"	"TRPM4_000101"	"g.49671771C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49168514C>T"	""	"benign"	""
"0000617754"	"0"	"10"	"19"	"49674846"	"49674846"	"subst"	"0.00315855"	"02327"	"TRPM4_000040"	"g.49674846C>T"	""	""	""	"TRPM4(NM_017636.4):c.870C>T (p.N290=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49171589C>T"	""	"benign"	""
"0000617755"	"0"	"30"	"19"	"49674900"	"49674900"	"subst"	"1.22538E-5"	"02327"	"TRPM4_000102"	"g.49674900G>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49171643G>A"	""	"likely benign"	""
"0000617756"	"0"	"10"	"19"	"49675017"	"49675017"	"subst"	"0.04813"	"02327"	"TRPM4_000041"	"g.49675017G>T"	""	""	""	"TRPM4(NM_017636.4):c.1041G>T (p.L347=, p.(Leu347=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49171760G>T"	""	"benign"	""
"0000617757"	"0"	"10"	"19"	"49675039"	"49675042"	"dup"	"0"	"02327"	"TRPM4_000086"	"g.49675039_49675042dup"	""	""	""	"TRPM4(NM_017636.4):c.1050+13_1050+16dupGGGC"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49171782_49171785dup"	""	"benign"	""
"0000617758"	"0"	"10"	"19"	"49675233"	"49675233"	"subst"	"0.0596851"	"02327"	"TRPM4_000103"	"g.49675233C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49171976C>T"	""	"benign"	""
"0000617759"	"0"	"50"	"19"	"49675266"	"49675266"	"subst"	"8.1213E-6"	"02327"	"TRPM4_000104"	"g.49675266G>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49172009G>A"	""	"VUS"	""
"0000617760"	"0"	"10"	"19"	"49684583"	"49684583"	"subst"	"0.000906239"	"02327"	"TRPM4_000105"	"g.49684583C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49181326C>T"	""	"benign"	""
"0000617761"	"0"	"10"	"19"	"49684586"	"49684586"	"subst"	"0.0395804"	"02327"	"TRPM4_000044"	"g.49684586T>A"	""	""	""	"TRPM4(NM_017636.4):c.1151-20T>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49181329T>A"	""	"benign"	""
"0000617762"	"0"	"30"	"19"	"49684615"	"49684615"	"subst"	"8.1242E-6"	"02327"	"TRPM4_000106"	"g.49684615G>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49181358G>A"	""	"likely benign"	""
"0000617763"	"0"	"10"	"19"	"49685939"	"49685939"	"subst"	"0.00253318"	"02327"	"TRPM4_000049"	"g.49685939C>G"	""	""	""	"TRPM4(NM_017636.3):c.1368C>G (p.T456=), TRPM4(NM_017636.4):c.1368C>G (p.T456=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49182682C>G"	""	"benign"	""
"0000617764"	"0"	"10"	"19"	"49686030"	"49686065"	"del"	"0"	"02327"	"TRPM4_000051"	"g.49686030_49686065del"	""	""	""	"TRPM4(NM_017636.3):c.1459_1494delAAAGCCCCAGCCCTAAAAGGGGGAGCTGCGGAGCTC (p.(Lys487_Leu498del)), TRPM4(NM_017636.4):c.1459_1494del (p.K487_L498del)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49182773_49182808del"	""	"benign"	""
"0000617765"	"0"	"30"	"19"	"49686174"	"49686174"	"subst"	"9.36996E-6"	"02327"	"TRPM4_000107"	"g.49686174G>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49182917G>A"	""	"likely benign"	""
"0000617766"	"0"	"10"	"19"	"49691870"	"49691870"	"subst"	"0.00844016"	"02327"	"TRPM4_000108"	"g.49691870C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49188613C>T"	""	"benign"	""
"0000617767"	"0"	"30"	"19"	"49691898"	"49691898"	"subst"	"0.000511667"	"02327"	"TRPM4_000011"	"g.49691898G>A"	""	""	""	"TRPM4(NM_001195227.1):c.1744G>A (p.?), TRPM4(NM_017636.3):c.1744G>A (p.G582S), TRPM4(NM_017636.4):c.1744G>A (p.G582S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49188641G>A"	""	"likely benign"	""
"0000617768"	"0"	"30"	"19"	"49692031"	"49692031"	"subst"	"0.000158477"	"02330"	"TRPM4_000109"	"g.49692031C>T"	""	""	""	"TRPM4(NM_017636.4):c.1873+4C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49188774C>T"	""	"likely benign"	""
"0000617769"	"0"	"10"	"19"	"49692373"	"49692373"	"subst"	"0.31333"	"02327"	"TRPM4_000110"	"g.49692373C>G"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49189116C>G"	""	"benign"	""
"0000617770"	"0"	"30"	"19"	"49693461"	"49693461"	"subst"	"0.00012594"	"02327"	"TRPM4_000054"	"g.49693461A>C"	""	""	""	"TRPM4(NM_017636.4):c.2020-4A>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49190204A>C"	""	"likely benign"	""
"0000617771"	"0"	"50"	"19"	"49693477"	"49693477"	"subst"	"0"	"02327"	"TRPM4_000111"	"g.49693477C>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49190220C>A"	""	"VUS"	""
"0000617772"	"0"	"30"	"19"	"49693571"	"49693571"	"subst"	"4.06256E-6"	"02327"	"TRPM4_000112"	"g.49693571C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49190314C>T"	""	"likely benign"	""
"0000617773"	"0"	"30"	"19"	"49699760"	"49699760"	"subst"	"1.31287E-5"	"02327"	"TRPM4_000113"	"g.49699760C>G"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49196503C>G"	""	"likely benign"	""
"0000617774"	"0"	"30"	"19"	"49699760"	"49699761"	"delins"	"0"	"02327"	"TRPM4_000114"	"g.49699760_49699761delinsGG"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49196503_49196504delinsGG"	""	"likely benign"	""
"0000617775"	"0"	"30"	"19"	"49699761"	"49699761"	"subst"	"1.30995E-5"	"02327"	"TRPM4_000115"	"g.49699761T>G"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49196504T>G"	""	"likely benign"	""
"0000617776"	"0"	"50"	"19"	"49699821"	"49699821"	"subst"	"0.000198273"	"02330"	"TRPM4_000116"	"g.49699821C>A"	""	""	""	"TRPM4(NM_017636.4):c.2335C>A (p.P779T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49196564C>A"	""	"VUS"	""
"0000617777"	"0"	"10"	"19"	"49699866"	"49699866"	"subst"	"0.0692714"	"02327"	"TRPM4_000060"	"g.49699866C>T"	""	""	""	"TRPM4(NM_017636.4):c.2380C>T (p.L794=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49196609C>T"	""	"benign"	""
"0000617778"	"0"	"50"	"19"	"49699890"	"49699890"	"subst"	"6.56978E-6"	"02325"	"TRPM4_000117"	"g.49699890C>T"	""	""	""	"TRPM4(NM_017636.4):c.2404C>T (p.L802F)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49196633C>T"	""	"VUS"	""
"0000617779"	"0"	"10"	"19"	"49700105"	"49700105"	"subst"	"0.00177104"	"02330"	"TRPM4_000118"	"g.49700105C>T"	""	""	""	"TRPM4(NM_017636.4):c.2619C>T (p.T873=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49196848C>T"	""	"benign"	""
"0000617780"	"0"	"50"	"19"	"49703615"	"49703615"	"subst"	"2.03075E-5"	"02327"	"TRPM4_000119"	"g.49703615T>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49200358T>C"	""	"VUS"	""
"0000617781"	"0"	"10"	"19"	"49704023"	"49704023"	"subst"	"0.00621519"	"02327"	"TRPM4_000066"	"g.49704023T>C"	""	""	""	"TRPM4(NM_017636.4):c.2934T>C (p.I978=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49200766T>C"	""	"benign"	""
"0000617782"	"0"	"10"	"19"	"49704057"	"49704057"	"subst"	"0.00200462"	"02330"	"TRPM4_000121"	"g.49704057G>A"	""	""	""	"TRPM4(NM_017636.4):c.2953+15G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49200800G>A"	""	"benign"	""
"0000617783"	"0"	"10"	"19"	"49705291"	"49705291"	"subst"	"0.00654903"	"02327"	"TRPM4_000069"	"g.49705291G>A"	""	""	""	"TRPM4(NM_017636.4):c.3024G>A (p.A1008=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49202034G>A"	""	"benign"	""
"0000617784"	"0"	"50"	"19"	"49705335"	"49705335"	"subst"	"0"	"02327"	"TRPM4_000122"	"g.49705335T>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49202078T>A"	""	"VUS"	""
"0000617785"	"0"	"10"	"19"	"49705349"	"49705349"	"subst"	"0.00261604"	"02330"	"TRPM4_000123"	"g.49705349C>T"	""	""	""	"TRPM4(NM_017636.4):c.3082C>T (p.L1028=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49202092C>T"	""	"benign"	""
"0000617786"	"0"	"30"	"19"	"49705349"	"49705349"	"subst"	"0.00261604"	"02327"	"TRPM4_000123"	"g.49705349C>T"	""	""	""	"TRPM4(NM_017636.4):c.3082C>T (p.L1028=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49202092C>T"	""	"likely benign"	""
"0000617787"	"0"	"50"	"19"	"49713513"	"49713513"	"subst"	"0"	"02327"	"TRPM4_000124"	"g.49713513C>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49210256C>A"	""	"VUS"	""
"0000617788"	"0"	"50"	"19"	"49713558"	"49713558"	"subst"	"8.93423E-5"	"02327"	"TRPM4_000125"	"g.49713558T>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49210301T>C"	""	"VUS"	""
"0000617789"	"0"	"30"	"19"	"49714732"	"49714732"	"subst"	"0.00764169"	"02327"	"TRPM4_000076"	"g.49714732C>G"	""	""	""	"TRPM4(NM_017636.4):c.3641-19C>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49211475C>G"	""	"likely benign"	""
"0000624051"	"0"	"50"	"19"	"49703663"	"49703663"	"subst"	"0"	"02330"	"TRPM4_000120"	"g.49703663C>T"	""	""	""	"TRPM4(NM_017636.4):c.2752C>T (p.P918S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49200406C>T"	""	"VUS"	""
"0000650032"	"1"	"10"	"19"	"49671207"	"49671207"	"subst"	"7.6137E-5"	"03575"	"TRPM4_000030"	"g.49671207G>A"	"235/2794 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"235 heterozygous; {DB:CLININrs113984787}"	"Germline"	""	"rs113984787"	"0"	""	""	"g.49167950G>A"	""	"benign"	""
"0000650033"	"1"	"30"	"19"	"49671507"	"49671507"	"subst"	"0.0202864"	"03575"	"TRPM4_000034"	"g.49671507G>A"	"215/2794 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"215 heterozygous; {DB:CLININrs78444754}"	"Germline"	""	"rs78444754"	"0"	""	""	"g.49168250G>A"	""	"likely benign"	""
"0000650034"	"1"	"50"	"19"	"49685865"	"49685865"	"subst"	"0.000476827"	"03575"	"TRPM4_000003"	"g.49685865G>A"	"1/2795 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"conflicting interpretations of pathogenicity; 1 heterozygous, no homozygous; {DB:CLININrs201907325}"	"Germline"	""	"rs201907325"	"0"	""	""	"g.49182608G>A"	""	"VUS"	""
"0000658629"	"0"	"10"	"19"	"49675035"	"49675035"	"dup"	"0"	"02330"	"TRPM4_000126"	"g.49675035dup"	""	""	""	"TRPM4(NM_017636.4):c.1050+9dupC"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49171778dup"	""	"benign"	""
"0000658630"	"0"	"10"	"19"	"49675036"	"49675036"	"subst"	"4.26018E-6"	"02330"	"TRPM4_000127"	"g.49675036T>G"	""	""	""	"TRPM4(NM_017636.4):c.1050+10T>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49171779T>G"	""	"benign"	""
"0000658631"	"0"	"50"	"19"	"49686171"	"49686171"	"subst"	"0"	"02325"	"TRPM4_000128"	"g.49686171G>T"	""	""	""	"TRPM4(NM_017636.4):c.1600G>T (p.G534W)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.49182914G>T"	""	"VUS"	""
"0000669492"	"3"	"30"	"19"	"49671507"	"49671507"	"subst"	"0.0202864"	"03575"	"TRPM4_000034"	"g.49671507G>A"	"2/2794 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"2 homozygous; {DB:CLININrs78444754}"	"Germline"	""	"rs78444754"	"0"	""	""	"g.49168250G>A"	""	"likely benign"	""
"0000681476"	"0"	"50"	"19"	"49700017"	"49700017"	"subst"	"0.00102493"	"01943"	"TRPM4_000004"	"g.49700017G>A"	""	""	""	"TRPM4(NM_017636.3):c.2531G>A (p.G844D, p.(Gly844Asp)), TRPM4(NM_017636.4):c.2531G>A (p.G844D)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000692857"	"0"	"30"	"19"	"49684697"	"49684697"	"subst"	"0.000126019"	"01943"	"TRPM4_000045"	"g.49684697T>C"	""	""	""	"TRPM4(NM_017636.3):c.1242T>C (p.F414=), TRPM4(NM_017636.4):c.1242T>C (p.F414=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000692858"	"0"	"30"	"19"	"49685939"	"49685939"	"subst"	"0.00253318"	"01943"	"TRPM4_000049"	"g.49685939C>G"	""	""	""	"TRPM4(NM_017636.3):c.1368C>G (p.T456=), TRPM4(NM_017636.4):c.1368C>G (p.T456=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000692859"	"0"	"30"	"19"	"49686146"	"49686146"	"subst"	"0.00151969"	"01943"	"TRPM4_000012"	"g.49686146G>A"	""	""	""	"TRPM4(NM_017636.3):c.1575G>A (p.W525*), TRPM4(NM_017636.4):c.1575G>A (p.W525*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000692860"	"0"	"10"	"19"	"49699691"	"49699691"	"subst"	"0"	"02330"	"TRPM4_000129"	"g.49699691C>T"	""	""	""	"TRPM4(NM_017636.4):c.2211-6C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000727476"	"0"	"10"	"19"	"49693569"	"49693569"	"subst"	"0"	"02330"	"TRPM4_000130"	"g.49693569C>T"	""	""	""	"TRPM4(NM_017636.4):c.2124C>T (p.I708=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000808978"	"0"	"10"	"19"	"49705258"	"49705258"	"subst"	"1.62961E-5"	"02330"	"TRPM4_000131"	"g.49705258C>T"	""	""	""	"TRPM4(NM_017636.4):c.2991C>T (p.P997=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000855659"	"0"	"50"	"19"	"49661125"	"49661125"	"subst"	"0"	"01943"	"HRC_000022"	"g.49661125T>C"	""	""	""	"TRPM4(NM_017636.3):c.2T>C (p.M1?)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000866217"	"0"	"50"	"19"	"49657984"	"49657984"	"subst"	"0.000117778"	"01943"	"HRC_000021"	"g.49657984T>C"	""	""	""	"HRC(NM_002152.3):c.511A>G (p.S171G)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000866218"	"0"	"50"	"19"	"49671214"	"49671214"	"subst"	"0.00033727"	"01943"	"TRPM4_000132"	"g.49671214A>G"	""	""	""	"TRPM4(NM_017636.3):c.308A>G (p.Y103C), TRPM4(NM_017636.4):c.308A>G (p.Y103C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000866219"	"0"	"50"	"19"	"49675285"	"49675285"	"subst"	"2.43637E-5"	"02330"	"TRPM4_000133"	"g.49675285G>A"	""	""	""	"TRPM4(NM_017636.4):c.1070G>A (p.R357Q)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000866220"	"0"	"50"	"19"	"49686003"	"49686003"	"subst"	"0"	"02330"	"TRPM4_000134"	"g.49686003G>C"	""	""	""	"TRPM4(NM_017636.4):c.1432G>C (p.D478H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000866221"	"0"	"50"	"19"	"49686409"	"49686409"	"subst"	"1.21881E-5"	"02330"	"TRPM4_000135"	"g.49686409C>G"	""	""	""	"TRPM4(NM_017636.4):c.1683C>G (p.D561E)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000866222"	"0"	"50"	"19"	"49691910"	"49691910"	"subst"	"0.000113704"	"02330"	"TRPM4_000136"	"g.49691910G>C"	""	""	""	"TRPM4(NM_017636.4):c.1756G>C (p.V586L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000866223"	"0"	"50"	"19"	"49705259"	"49705259"	"subst"	"2.03684E-5"	"01943"	"TRPM4_000097"	"g.49705259G>A"	""	""	""	"TRPM4(NM_017636.3):c.2992G>A (p.G998S), TRPM4(NM_017636.4):c.2992G>A (p.G998S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000866224"	"0"	"30"	"19"	"49714351"	"49714351"	"subst"	"0"	"02330"	"TRPM4_000137"	"g.49714351C>T"	""	""	""	"TRPM4(NM_017636.4):c.3534+7C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000866225"	"0"	"50"	"19"	"49714449"	"49714449"	"subst"	"0"	"02330"	"TRPM4_000138"	"g.49714449G>T"	""	""	""	"TRPM4(NM_017636.4):c.3563G>T (p.W1188L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000895079"	"0"	"30"	"19"	"49671214"	"49671214"	"subst"	"0.00033727"	"02330"	"TRPM4_000132"	"g.49671214A>G"	""	""	""	"TRPM4(NM_017636.3):c.308A>G (p.Y103C), TRPM4(NM_017636.4):c.308A>G (p.Y103C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000895080"	"0"	"50"	"19"	"49671528"	"49671528"	"subst"	"0"	"02326"	"TRPM4_000139"	"g.49671528G>T"	""	""	""	"TRPM4(NM_017636.4):c.460G>T (p.V154F)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000895081"	"0"	"30"	"19"	"49671545"	"49671545"	"subst"	"0"	"02327"	"TRPM4_000140"	"g.49671545C>G"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000895082"	"0"	"10"	"19"	"49686030"	"49686065"	"del"	"0"	"02326"	"TRPM4_000051"	"g.49686030_49686065del"	""	""	""	"TRPM4(NM_017636.3):c.1459_1494delAAAGCCCCAGCCCTAAAAGGGGGAGCTGCGGAGCTC (p.(Lys487_Leu498del)), TRPM4(NM_017636.4):c.1459_1494del (p.K487_L498del)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000895083"	"0"	"30"	"19"	"49692210"	"49692210"	"subst"	"2.04792E-5"	"02326"	"TRPM4_000053"	"g.49692210T>C"	""	""	""	"TRPM4(NM_017636.4):c.1881T>C (p.F627=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000895084"	"0"	"50"	"19"	"49714502"	"49714502"	"subst"	"0"	"02326"	"TRPM4_000141"	"g.49714502C>G"	""	""	""	"TRPM4(NM_017636.4):c.3616C>G (p.P1206A)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000915272"	"0"	"10"	"19"	"49657751"	"49657753"	"del"	"0"	"02326"	"HRC_000006"	"g.49657751_49657753del"	""	""	""	"HRC(NM_002152.2):c.779_781del (p.(Asp261del)), HRC(NM_002152.3):c.782_784delATG (p.D261del)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000915273"	"0"	"10"	"19"	"49671815"	"49671815"	"subst"	"0.0042594"	"02326"	"TRPM4_000083"	"g.49671815G>A"	""	""	""	"TRPM4(NM_017636.4):c.618G>A (p.S206=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000915274"	"0"	"50"	"19"	"49674971"	"49674971"	"subst"	"1.63044E-5"	"02330"	"TRPM4_000142"	"g.49674971G>A"	""	""	""	"TRPM4(NM_017636.4):c.995G>A (p.R332Q)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000915275"	"0"	"10"	"19"	"49685951"	"49685951"	"subst"	"0.000268435"	"02330"	"TRPM4_000143"	"g.49685951G>C"	""	""	""	"TRPM4(NM_017636.4):c.1380G>C (p.L460=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000915276"	"0"	"50"	"19"	"49705335"	"49705335"	"subst"	"0"	"02325"	"TRPM4_000144"	"g.49705335T>C"	""	""	""	"TRPM4(NM_017636.4):c.3068T>C (p.L1023P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000926927"	"0"	"50"	"19"	"49700017"	"49700017"	"subst"	"0.00102493"	"02325"	"TRPM4_000004"	"g.49700017G>A"	""	""	""	"TRPM4(NM_017636.3):c.2531G>A (p.G844D, p.(Gly844Asp)), TRPM4(NM_017636.4):c.2531G>A (p.G844D)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000926928"	"0"	"10"	"19"	"49703623"	"49703623"	"subst"	"0.000162475"	"02330"	"TRPM4_000145"	"g.49703623G>T"	""	""	""	"TRPM4(NM_017636.4):c.2712G>T (p.V904=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000931084"	"0"	"30"	"19"	"49671214"	"49671214"	"subst"	"0.00033727"	"02326"	"TRPM4_000132"	"g.49671214A>G"	""	""	""	"TRPM4(NM_017636.3):c.308A>G (p.Y103C), TRPM4(NM_017636.4):c.308A>G (p.Y103C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000931085"	"0"	"50"	"19"	"49705310"	"49705310"	"subst"	"4.06266E-5"	"02330"	"TRPM4_000146"	"g.49705310T>G"	""	""	""	"TRPM4(NM_017636.4):c.3043T>G (p.Y1015D)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000951324"	"0"	"10"	"19"	"49686408"	"49686408"	"subst"	"0.00357134"	"02326"	"TRPM4_000077"	"g.49686408A>C"	""	""	""	"TRPM4(NM_017636.4):c.1682A>C (p.D561A)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000951325"	"0"	"30"	"19"	"49700017"	"49700017"	"subst"	"0.00102493"	"02326"	"TRPM4_000004"	"g.49700017G>A"	""	""	""	"TRPM4(NM_017636.3):c.2531G>A (p.G844D, p.(Gly844Asp)), TRPM4(NM_017636.4):c.2531G>A (p.G844D)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000951326"	"0"	"50"	"19"	"49713977"	"49713980"	"del"	"0"	"02326"	"TRPM4_000147"	"g.49713977_49713980del"	""	""	""	"TRPM4(NM_017636.4):c.3339_3342delTTCT (p.S1114Rfs*8)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000951327"	"0"	"30"	"19"	"49714734"	"49714734"	"subst"	"0.000538696"	"02326"	"TRPM4_000099"	"g.49714734T>G"	""	""	""	"TRPM4(NM_017636.4):c.3641-17T>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000969841"	"0"	"50"	"19"	"49671250"	"49671250"	"subst"	"2.03282E-5"	"02330"	"TRPM4_000148"	"g.49671250C>T"	""	""	""	"TRPM4(NM_017636.4):c.344C>T (p.P115L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000969842"	"0"	"30"	"19"	"49675334"	"49675334"	"subst"	"5.27897E-5"	"02330"	"TRPM4_000149"	"g.49675334C>A"	""	""	""	"TRPM4(NM_017636.4):c.1119C>A (p.F373L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000969843"	"0"	"30"	"19"	"49686058"	"49686058"	"subst"	"0"	"02330"	"TRPM4_000150"	"g.49686058C>T"	""	""	""	"TRPM4(NM_017636.4):c.1487C>T (p.A496V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000983582"	"0"	"30"	"19"	"49671207"	"49671207"	"subst"	"7.6137E-5"	"01804"	"TRPM4_000030"	"g.49671207G>A"	""	""	""	"TRPM4(NM_017636.3):c.301G>A (p.(Ala101Thr)), TRPM4(NM_017636.4):c.301G>A (p.A101T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000983583"	"0"	"30"	"19"	"49671507"	"49671507"	"subst"	"0.0202864"	"01804"	"TRPM4_000034"	"g.49671507G>A"	""	""	""	"TRPM4(NM_017636.4):c.449-10G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000983584"	"0"	"30"	"19"	"49675017"	"49675017"	"subst"	"0.04813"	"01804"	"TRPM4_000041"	"g.49675017G>T"	""	""	""	"TRPM4(NM_017636.4):c.1041G>T (p.L347=, p.(Leu347=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000983585"	"0"	"30"	"19"	"49700017"	"49700017"	"subst"	"0.00102493"	"02327"	"TRPM4_000004"	"g.49700017G>A"	""	""	""	"TRPM4(NM_017636.3):c.2531G>A (p.G844D, p.(Gly844Asp)), TRPM4(NM_017636.4):c.2531G>A (p.G844D)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000983586"	"0"	"30"	"19"	"49703651"	"49703651"	"subst"	"0.00122695"	"01804"	"TRPM4_000024"	"g.49703651A>T"	""	""	""	"TRPM4(NM_017636.3):c.2740A>T (p.K914*), TRPM4(NM_017636.4):c.2740A>T (p.K914*, p.(Lys914Ter))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000988474"	"0"	"30"	"19"	"49693566"	"49693566"	"subst"	"4.06187E-6"	"03779"	"TRPM4_000151"	"g.49693566C>T"	""	""	""	""	""	"CLASSIFICATION record"	""	"rs761675175"	"0"	""	""	""	""	"likely benign"	""
"0001004981"	"0"	"10"	"19"	"49671260"	"49671260"	"subst"	"0.00055321"	"02326"	"TRPM4_000032"	"g.49671260G>C"	""	""	""	"TRPM4(NM_017636.4):c.354G>C (p.V118=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0001004982"	"0"	"30"	"19"	"49685865"	"49685865"	"subst"	"0.000476827"	"02327"	"TRPM4_000003"	"g.49685865G>A"	""	""	""	"TRPM4(NM_001195227.1):c.1294G>A (p.(Ala432Thr)), TRPM4(NM_017636.3):c.1294G>A (p.A432T), TRPM4(NM_017636.4):c.1294G>A (p.A432T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001004983"	"0"	"30"	"19"	"49686030"	"49686065"	"del"	"0"	"01804"	"TRPM4_000051"	"g.49686030_49686065del"	""	""	""	"TRPM4(NM_017636.3):c.1459_1494delAAAGCCCCAGCCCTAAAAGGGGGAGCTGCGGAGCTC (p.(Lys487_Leu498del)), TRPM4(NM_017636.4):c.1459_1494del (p.K487_L498del)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001004984"	"0"	"50"	"19"	"49686416"	"49686418"	"dup"	"0"	"02329"	"TRPM4_000152"	"g.49686416_49686418dup"	""	""	""	"TRPM4(NM_017636.4):c.1690_1692dup (p.(Leu564dup)), TRPM4(NM_017636.4):c.1690_1692dupCTT (p.L564dup)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001004985"	"0"	"50"	"19"	"49700017"	"49700017"	"subst"	"0.00102493"	"01804"	"TRPM4_000004"	"g.49700017G>A"	""	""	""	"TRPM4(NM_017636.3):c.2531G>A (p.G844D, p.(Gly844Asp)), TRPM4(NM_017636.4):c.2531G>A (p.G844D)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001015820"	"0"	"30"	"19"	"49692237"	"49692237"	"subst"	"4.09608E-6"	"02330"	"TRPM4_000153"	"g.49692237G>C"	""	""	""	"TRPM4(NM_017636.4):c.1908G>C (p.V636=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001015821"	"0"	"50"	"19"	"49693531"	"49693531"	"subst"	"3.24915E-5"	"02330"	"TRPM4_000154"	"g.49693531G>A"	""	""	""	"TRPM4(NM_017636.4):c.2086G>A (p.A696T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001015822"	"0"	"50"	"19"	"49705301"	"49705301"	"subst"	"0.00017883"	"02330"	"TRPM4_000155"	"g.49705301G>A"	""	""	""	"TRPM4(NM_017636.4):c.3034G>A (p.V1012I)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001022158"	"0"	"30"	"19"	"49699994"	"49699994"	"subst"	"0.00010595"	"04796"	"TRPM4_000095"	"g.49699994C>T"	""	""	""	""	"no effect on RNA"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.49196737C>T"	""	"likely benign"	""
"0001027241"	"0"	"30"	"19"	"49692194"	"49692194"	"subst"	"0.000151506"	"02326"	"TRPM4_000052"	"g.49692194C>T"	""	""	""	"TRPM4(NM_017636.4):c.1874-9C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001043090"	"0"	"30"	"19"	"49661155"	"49661155"	"subst"	"0"	"01804"	"HRC_000023"	"g.49661155C>A"	""	""	""	"TRPM4(NM_017636.4):c.24+8C>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001043091"	"0"	"30"	"19"	"49671946"	"49671946"	"subst"	"5.5145E-5"	"01804"	"TRPM4_000019"	"g.49671946G>A"	""	""	""	"TRPM4(NM_017636.4):c.749G>A (p.(Arg250His))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001043092"	"0"	"50"	"19"	"49674985"	"49674985"	"subst"	"0.000135113"	"01804"	"TRPM4_000156"	"g.49674985C>T"	""	""	""	"TRPM4(NM_017636.4):c.1009C>T (p.(Arg337Cys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001043093"	"0"	"30"	"19"	"49686416"	"49686418"	"dup"	"0"	"01804"	"TRPM4_000152"	"g.49686416_49686418dup"	""	""	""	"TRPM4(NM_017636.4):c.1690_1692dup (p.(Leu564dup)), TRPM4(NM_017636.4):c.1690_1692dupCTT (p.L564dup)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001043094"	"0"	"50"	"19"	"49703576"	"49703576"	"del"	"0"	"01804"	"TRPM4_000065"	"g.49703576del"	""	""	""	"TRPM4(NM_017636.4):c.2665del (p.(His889Thrfs*35)), TRPM4(NM_017636.4):c.2665delC (p.H889Tfs*35)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001043095"	"0"	"50"	"19"	"49703904"	"49703904"	"subst"	"1.63007E-5"	"01804"	"TRPM4_000157"	"g.49703904G>T"	""	""	""	"TRPM4(NM_017636.4):c.2815G>T (p.(Val939Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""


## Variants_On_Transcripts ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Note: Only showing Variants_On_Transcript columns active for Genes TRPM4
## Count = 247
"{{id}}"	"{{transcriptid}}"	"{{effectid}}"	"{{position_c_start}}"	"{{position_c_start_intron}}"	"{{position_c_end}}"	"{{position_c_end_intron}}"	"{{VariantOnTranscript/DNA}}"	"{{VariantOnTranscript/RNA}}"	"{{VariantOnTranscript/Protein}}"	"{{VariantOnTranscript/Exon}}"
"0000071823"	"00021909"	"70"	"1575"	"0"	"1575"	"0"	"c.1575G>A"	"r.(?)"	"p.(Trp525*)"	"11"
"0000071832"	"00021909"	"70"	"1294"	"0"	"1294"	"0"	"c.1294G>A"	"r.(?)"	"p.(Ala432Thr)"	"11"
"0000071833"	"00021909"	"70"	"1744"	"0"	"1744"	"0"	"c.1744G>A"	"r.(?)"	"p.(Gly582Ser)"	"13"
"0000095177"	"00021909"	"90"	"1321"	"0"	"1321"	"0"	"c.1321G>A"	"r.(?)"	"p.(Val441Met)"	"11"
"0000095178"	"00021909"	"90"	"1495"	"0"	"1495"	"0"	"c.1495C>T"	"r.(?)"	"p.(Arg499Trp)"	"11"
"0000095179"	"00021909"	"70"	"1496"	"0"	"1496"	"0"	"c.1496G>C"	"r.(?)"	"p.(Arg499Pro)"	"11"
"0000095180"	"00021909"	"90"	"2531"	"0"	"2531"	"0"	"c.2531G>A"	"r.(?)"	"p.(Gly844Asp)"	"17"
"0000096560"	"00021909"	"50"	"1575"	"0"	"1575"	"0"	"c.1575G>A"	"r.(?)"	"p.(Trp525*)"	"11"
"0000096968"	"00021909"	"50"	"1575"	"0"	"1575"	"0"	"c.1575G>A"	"r.(?)"	"p.(Trp525*)"	"11"
"0000096971"	"00021909"	"50"	"247"	"0"	"247"	"0"	"c.247dup"	"r.(?)"	"p.(Ala83Glyfs*13)"	"3"
"0000217955"	"00021909"	"50"	"1744"	"0"	"1744"	"0"	"c.1744G>A"	"r.(?)"	"p.(Gly582Ser)"	""
"0000217957"	"00021909"	"50"	"2674"	"0"	"2674"	"0"	"c.2674C>T"	"r.(?)"	"p.(Arg892Cys)"	""
"0000217963"	"00021909"	"50"	"1231"	"0"	"1231"	"0"	"c.1231A>G"	"r.(?)"	"p.(Ser411Gly)"	""
"0000217965"	"00021909"	"90"	"2740"	"0"	"2740"	"0"	"c.2740A>T"	"r.(?)"	"p.(Lys914*)"	""
"0000218371"	"00021909"	"50"	"749"	"0"	"749"	"0"	"c.749G>A"	"r.(?)"	"p.(Arg250His)"	""
"0000218381"	"00021909"	"90"	"1195"	"0"	"1202"	"0"	"c.1195_1202del"	"r.(?)"	"p.(Leu399Glyfs*11)"	""
"0000218481"	"00021909"	"90"	"2740"	"0"	"2740"	"0"	"c.2740A>T"	"r.(?)"	"p.(Lys914*)"	""
"0000218487"	"00021909"	"50"	"1817"	"0"	"1817"	"0"	"c.1817C>T"	"r.(?)"	"p.(Ala606Val)"	""
"0000247582"	"00021909"	"10"	"1386"	"0"	"1386"	"0"	"c.1386A>G"	"r.(?)"	"p.(Gln462=)"	""
"0000247583"	"00021909"	"10"	"3405"	"0"	"3405"	"0"	"c.3405A>C"	"r.(?)"	"p.(Ala1135=)"	""
"0000247585"	"00021909"	"10"	"1682"	"0"	"1682"	"0"	"c.1682A>C"	"r.(?)"	"p.(Asp561Ala)"	""
"0000247605"	"00021909"	"10"	"2020"	"-4"	"2020"	"-4"	"c.2020-4A>C"	"r.spl?"	"p.?"	""
"0000247606"	"00021909"	"10"	"2646"	"-17"	"2646"	"-17"	"c.2646-17A>T"	"r.(=)"	"p.(=)"	""
"0000247617"	"00021909"	"30"	"2561"	"0"	"2561"	"0"	"c.2561A>G"	"r.(?)"	"p.(Gln854Arg)"	""
"0000256203"	"00021909"	"50"	"2740"	"0"	"2740"	"0"	"c.2740A>T"	"r.(?)"	"p.(Lys914Ter)"	""
"0000309539"	"00021909"	"10"	"-12"	"0"	"-12"	"0"	"c.-12G>A"	"r.(?)"	"p.(=)"	""
"0000309540"	"00021909"	"10"	"1041"	"0"	"1041"	"0"	"c.1041G>T"	"r.(?)"	"p.(Leu347=)"	""
"0000309542"	"00021909"	"10"	"1151"	"-20"	"1151"	"-20"	"c.1151-20T>A"	"r.(=)"	"p.(=)"	""
"0000309543"	"00021909"	"10"	"1242"	"0"	"1242"	"0"	"c.1242T>C"	"r.(?)"	"p.(Phe414=)"	""
"0000309544"	"00021909"	"10"	"1263"	"9"	"1263"	"9"	"c.1263+9T>C"	"r.(=)"	"p.(=)"	""
"0000309545"	"00021909"	"50"	"1294"	"0"	"1294"	"0"	"c.1294G>A"	"r.(?)"	"p.(Ala432Thr)"	""
"0000309546"	"00021909"	"10"	"1323"	"0"	"1323"	"0"	"c.1323G>T"	"r.(?)"	"p.(Val441=)"	""
"0000309547"	"00021909"	"50"	"1362"	"0"	"1362"	"0"	"c.1362C>G"	"r.(?)"	"p.(Phe454Leu)"	""
"0000309548"	"00021909"	"10"	"1368"	"0"	"1368"	"0"	"c.1368C>G"	"r.(?)"	"p.(Thr456=)"	""
"0000309549"	"00021909"	"10"	"1459"	"0"	"1494"	"0"	"c.1459_1494del"	"r.(?)"	"p.(Lys487_Leu498del)"	""
"0000309550"	"00021909"	"30"	"1575"	"0"	"1575"	"0"	"c.1575G>A"	"r.(?)"	"p.(Trp525Ter)"	""
"0000309551"	"00021909"	"50"	"1744"	"0"	"1744"	"0"	"c.1744G>A"	"r.(?)"	"p.(Gly582Ser)"	""
"0000309552"	"00021909"	"10"	"1874"	"-9"	"1874"	"-9"	"c.1874-9C>T"	"r.(=)"	"p.(=)"	""
"0000309553"	"00021909"	"10"	"1881"	"0"	"1881"	"0"	"c.1881T>C"	"r.(?)"	"p.(Phe627=)"	""
"0000309554"	"00021909"	"30"	"2133"	"-9"	"2133"	"-9"	"c.2133-9C>A"	"r.(=)"	"p.(=)"	""
"0000309555"	"00021909"	"10"	"2209"	"0"	"2209"	"0"	"c.2209G>A"	"r.(?)"	"p.(Gly737Arg)"	""
"0000309556"	"00021909"	"10"	"2210"	"11"	"2210"	"11"	"c.2210+11C>G"	"r.(=)"	"p.(=)"	""
"0000309557"	"00021909"	"10"	"2283"	"0"	"2294"	"0"	"c.2283_2294del"	"r.(?)"	"p.(Cys763_Arg766del)"	""
"0000309558"	"00021909"	"10"	"2380"	"0"	"2380"	"0"	"c.2380C>T"	"r.(?)"	"p.(Leu794=)"	""
"0000309559"	"00021909"	"30"	"24"	"6"	"24"	"6"	"c.24+6C>G"	"r.(=)"	"p.(=)"	""
"0000309560"	"00021909"	"30"	"2400"	"0"	"2400"	"0"	"c.2400G>T"	"r.(?)"	"p.(Val800=)"	""
"0000309561"	"00021909"	"10"	"243"	"0"	"243"	"0"	"c.243G>C"	"r.(?)"	"p.(Thr81=)"	""
"0000309562"	"00021909"	"50"	"2573"	"0"	"2573"	"0"	"c.2573T>G"	"r.(?)"	"p.(Leu858Arg)"	""
"0000309563"	"00021909"	"50"	"2665"	"0"	"2665"	"0"	"c.2665del"	"r.(?)"	"p.(His889ThrfsTer35)"	""
"0000309564"	"00021909"	"10"	"267"	"14"	"267"	"14"	"c.267+14C>G"	"r.(=)"	"p.(=)"	""
"0000309565"	"00021909"	"10"	"2934"	"0"	"2934"	"0"	"c.2934T>C"	"r.(?)"	"p.(Ile978=)"	""
"0000309566"	"00021909"	"10"	"2982"	"0"	"2982"	"0"	"c.2982G>A"	"r.(?)"	"p.(Ser994=)"	""
"0000309567"	"00021909"	"50"	"2999"	"0"	"2999"	"0"	"c.2999G>A"	"r.(?)"	"p.(Trp1000Ter)"	""
"0000309568"	"00021909"	"10"	"301"	"0"	"301"	"0"	"c.301G>A"	"r.(?)"	"p.(Ala101Thr)"	""
"0000309569"	"00021909"	"10"	"3024"	"0"	"3024"	"0"	"c.3024G>A"	"r.(?)"	"p.(Ala1008=)"	""
"0000309570"	"00021909"	"10"	"3131"	"17"	"3131"	"17"	"c.3131+17C>T"	"r.(=)"	"p.(=)"	""
"0000309571"	"00021909"	"10"	"322"	"0"	"322"	"0"	"c.322C>T"	"r.(?)"	"p.(Arg108Cys)"	""
"0000309572"	"00021909"	"10"	"3329"	"-8"	"3329"	"-8"	"c.3329-8C>G"	"r.(=)"	"p.(=)"	""
"0000309573"	"00021909"	"50"	"3352"	"0"	"3352"	"0"	"c.3352G>A"	"r.(?)"	"p.(Glu1118Lys)"	""
"0000309574"	"00021909"	"50"	"3387"	"0"	"3387"	"0"	"c.3387G>C"	"r.(?)"	"p.(Lys1129Asn)"	""
"0000309575"	"00021909"	"10"	"354"	"0"	"354"	"0"	"c.354G>C"	"r.(?)"	"p.(Val118=)"	""
"0000309576"	"00021909"	"10"	"3611"	"0"	"3611"	"0"	"c.3611C>T"	"r.(?)"	"p.(Pro1204Leu)"	""
"0000309577"	"00021909"	"10"	"3641"	"-19"	"3641"	"-19"	"c.3641-19C>G"	"r.(=)"	"p.(=)"	""
"0000309578"	"00021909"	"50"	"416"	"0"	"416"	"0"	"c.416G>A"	"r.(?)"	"p.(Arg139His)"	""
"0000309579"	"00021909"	"10"	"449"	"-10"	"449"	"-10"	"c.449-10G>A"	"r.(=)"	"p.(=)"	""
"0000309580"	"00021909"	"50"	"635"	"0"	"635"	"0"	"c.635G>A"	"r.(?)"	"p.(Arg212Gln)"	""
"0000309581"	"00021909"	"10"	"711"	"0"	"711"	"0"	"c.711C>T"	"r.(?)"	"p.(Asp237=)"	""
"0000309582"	"00021909"	"10"	"755"	"0"	"755"	"0"	"c.755G>A"	"r.(?)"	"p.(Arg252His)"	""
"0000309583"	"00021909"	"10"	"783"	"0"	"783"	"0"	"c.783G>A"	"r.(?)"	"p.(Lys261=)"	""
"0000309584"	"00021909"	"10"	"797"	"-13"	"797"	"-13"	"c.797-13C>A"	"r.(=)"	"p.(=)"	""
"0000309585"	"00021909"	"10"	"870"	"0"	"870"	"0"	"c.870C>T"	"r.(?)"	"p.(Asn290=)"	""
"0000309586"	"00021909"	"10"	"92"	"12"	"92"	"12"	"c.92+12G>A"	"r.(=)"	"p.(=)"	""
"0000314842"	"00021909"	"30"	"3611"	"0"	"3611"	"0"	"c.3611C>T"	"r.(?)"	"p.(Pro1204Leu)"	""
"0000317146"	"00021909"	"50"	"1294"	"0"	"1294"	"0"	"c.1294G>A"	"r.(?)"	"p.(Ala432Thr)"	""
"0000317147"	"00021909"	"50"	"1744"	"0"	"1744"	"0"	"c.1744G>A"	"r.(?)"	"p.(Gly582Ser)"	""
"0000326692"	"00021909"	"50"	"-3505"	"0"	"-3505"	"0"	"c.-3505G>T"	"r.(?)"	"p.(=)"	""
"0000326693"	"00021909"	"50"	"-3373"	"0"	"-3371"	"0"	"c.-3373_-3371dup"	"r.(?)"	"p.(=)"	""
"0000326695"	"00021909"	"50"	"-3382"	"0"	"-3371"	"0"	"c.-3382_-3371del"	"r.(?)"	"p.(=)"	""
"0000326696"	"00021909"	"50"	"-3385"	"0"	"-3371"	"0"	"c.-3385_-3371del"	"r.(?)"	"p.(=)"	""
"0000326697"	"00021909"	"50"	"-3373"	"0"	"-3371"	"0"	"c.-3373_-3371del"	"r.(?)"	"p.(=)"	""
"0000326699"	"00021909"	"50"	"-3370"	"0"	"-3370"	"0"	"c.-3370G>T"	"r.(?)"	"p.(=)"	""
"0000326700"	"00021909"	"50"	"-3367"	"0"	"-3367"	"0"	"c.-3367A>T"	"r.(?)"	"p.(=)"	""
"0000326702"	"00021909"	"50"	"-3359"	"0"	"-3359"	"0"	"c.-3359C>T"	"r.(?)"	"p.(=)"	""
"0000326703"	"00021909"	"50"	"-3351"	"0"	"-3351"	"0"	"c.-3351T>C"	"r.(?)"	"p.(=)"	""
"0000326704"	"00021909"	"50"	"-3332"	"0"	"-3332"	"0"	"c.-3332C>T"	"r.(?)"	"p.(=)"	""
"0000326705"	"00021909"	"50"	"-3318"	"0"	"-3318"	"0"	"c.-3318C>T"	"r.(?)"	"p.(=)"	""
"0000326706"	"00021909"	"50"	"1150"	"1"	"1150"	"1"	"c.1150+1G>A"	"r.spl?"	"p.?"	""
"0000326707"	"00021909"	"50"	"1294"	"0"	"1294"	"0"	"c.1294G>A"	"r.(?)"	"p.(Ala432Thr)"	""
"0000326709"	"00021909"	"50"	"1744"	"0"	"1744"	"0"	"c.1744G>A"	"r.(?)"	"p.(Gly582Ser)"	""
"0000326711"	"00021909"	"50"	"2043"	"0"	"2043"	"0"	"c.2043G>A"	"r.(?)"	"p.(Trp681Ter)"	""
"0000434696"	"00021909"	"95"	"19"	"0"	"19"	"0"	"c.19G>A"	"r.(?)"	"p.(Glu7Lys)"	"1"
"0000434697"	"00021909"	"95"	"19"	"0"	"19"	"0"	"c.19G>A"	"r.(?)"	"p.(Glu7Lys)"	"1"
"0000434698"	"00021909"	"75"	"393"	"0"	"393"	"0"	"c.393G>C"	"r.(?)"	"p.(Gln131His)"	"4"
"0000434699"	"00021909"	"95"	"490"	"0"	"490"	"0"	"c.490C>T"	"r.(?)"	"p.(Arg164Trp)"	"5"
"0000434700"	"00021909"	"75"	"878"	"0"	"878"	"0"	"c.878A>G"	"r.(?)"	"p.(Gln293Arg)"	"8"
"0000434701"	"00021909"	"95"	"1294"	"0"	"1294"	"0"	"c.1294G>A"	"r.(?)"	"p.(Ala432Thr)"	"11"
"0000434702"	"00021909"	"95"	"1294"	"0"	"1294"	"0"	"c.1294G>A"	"r.(?)"	"p.(Ala432Thr)"	"11"
"0000434703"	"00021909"	"75"	"1744"	"0"	"1744"	"0"	"c.1744G>A"	"r.(spl?)"	"p.(Gly582Ser)"	"13"
"0000434704"	"00021909"	"35"	"2283"	"0"	"2294"	"0"	"c.2283_2294del"	"r.(?)"	"p.(Cys763_Arg766del)"	"17"
"0000434705"	"00021909"	"35"	"2283"	"0"	"2294"	"0"	"c.2283_2294del"	"r.(?)"	"p.(Cys763_Arg766del)"	"17"
"0000434706"	"00021909"	"75"	"2368"	"0"	"2368"	"0"	"c.2368T>C"	"r.(?)"	"p.(Tyr790His)"	"17"
"0000434707"	"00021909"	"95"	"2531"	"0"	"2531"	"0"	"c.2531G>A"	"r.(?)"	"p.(Gly844Asp)"	"17"
"0000434708"	"00021909"	"95"	"2531"	"0"	"2531"	"0"	"c.2531G>A"	"r.(?)"	"p.(Gly844Asp)"	"17"
"0000434709"	"00021909"	"75"	"2531"	"0"	"2531"	"0"	"c.2531G>A"	"r.(?)"	"p.(Gly844Asp)"	"17"
"0000434710"	"00021909"	"75"	"2741"	"0"	"2741"	"0"	"c.2741A>G"	"r.(?)"	"p.(Lys914Arg)"	"18"
"0000434711"	"00021909"	"75"	"2908"	"0"	"2908"	"0"	"c.2908C>T"	"r.(?)"	"p.(Pro970Ser)"	"19"
"0000567958"	"00021909"	"50"	"-3521"	"0"	"-3521"	"0"	"c.-3521G>A"	"r.(?)"	"p.(=)"	""
"0000567963"	"00021909"	"10"	"306"	"0"	"306"	"0"	"c.306T>G"	"r.(?)"	"p.(Val102=)"	""
"0000567964"	"00021909"	"10"	"375"	"0"	"375"	"0"	"c.375G>A"	"r.(?)"	"p.(Ser125=)"	""
"0000567965"	"00021909"	"10"	"448"	"6"	"448"	"6"	"c.448+6C>T"	"r.(=)"	"p.(=)"	""
"0000567966"	"00021909"	"10"	"449"	"-14"	"449"	"-14"	"c.449-14C>T"	"r.(=)"	"p.(=)"	""
"0000567967"	"00021909"	"50"	"512"	"0"	"512"	"0"	"c.512G>A"	"r.(?)"	"p.(Arg171Gln)"	""
"0000567968"	"00021909"	"10"	"618"	"0"	"618"	"0"	"c.618G>A"	"r.(?)"	"p.(Ser206=)"	""
"0000567969"	"00021909"	"30"	"748"	"0"	"748"	"0"	"c.748C>T"	"r.(?)"	"p.(Arg250Cys)"	""
"0000567970"	"00021909"	"50"	"956"	"0"	"958"	"0"	"c.956_958del"	"r.(?)"	"p.(Leu319_Ala320delinsPro)"	""
"0000567971"	"00021909"	"10"	"1050"	"13"	"1050"	"16"	"c.1050+13_1050+16dup"	"r.(=)"	"p.(=)"	""
"0000567973"	"00021909"	"10"	"1164"	"0"	"1164"	"0"	"c.1164G>A"	"r.(?)"	"p.(Ser388=)"	""
"0000567974"	"00021909"	"10"	"1215"	"0"	"1215"	"0"	"c.1215C>T"	"r.(?)"	"p.(Arg405=)"	""
"0000567975"	"00021909"	"50"	"1551"	"0"	"1551"	"0"	"c.1551G>A"	"r.(?)"	"p.(Pro517=)"	""
"0000567976"	"00021909"	"30"	"1575"	"0"	"1575"	"0"	"c.1575G>A"	"r.(?)"	"p.(Trp525Ter)"	""
"0000567977"	"00021909"	"30"	"1637"	"0"	"1637"	"0"	"c.1637C>T"	"r.(?)"	"p.(Ser546Leu)"	""
"0000567978"	"00021909"	"10"	"1874"	"-20"	"1874"	"-20"	"c.1874-20A>G"	"r.(=)"	"p.(=)"	""
"0000567979"	"00021909"	"50"	"1986"	"0"	"1986"	"0"	"c.1986C>G"	"r.(?)"	"p.(Asp662Glu)"	""
"0000567980"	"00021909"	"10"	"2361"	"0"	"2361"	"0"	"c.2361G>A"	"r.(?)"	"p.(Val787=)"	""
"0000567981"	"00021909"	"50"	"2508"	"0"	"2508"	"0"	"c.2508C>T"	"r.(?)"	"p.(Gly836=)"	""
"0000567982"	"00021909"	"50"	"2531"	"0"	"2531"	"0"	"c.2531G>A"	"r.(?)"	"p.(Gly844Asp)"	""
"0000567983"	"00021909"	"30"	"2674"	"0"	"2674"	"0"	"c.2674C>T"	"r.(?)"	"p.(Arg892Cys)"	""
"0000567984"	"00021909"	"30"	"2740"	"0"	"2740"	"0"	"c.2740A>T"	"r.(?)"	"p.(Lys914Ter)"	""
"0000567985"	"00021909"	"30"	"2797"	"0"	"2799"	"0"	"c.2797_2799del"	"r.(?)"	"p.(Phe933del)"	""
"0000567986"	"00021909"	"50"	"2992"	"0"	"2992"	"0"	"c.2992G>A"	"r.(?)"	"p.(Gly998Ser)"	""
"0000567987"	"00021909"	"50"	"2999"	"0"	"2999"	"0"	"c.2999G>A"	"r.(?)"	"p.(Trp1000Ter)"	""
"0000567988"	"00021909"	"30"	"3585"	"0"	"3585"	"0"	"c.3585C>G"	"r.(?)"	"p.(Arg1195=)"	""
"0000567989"	"00021909"	"10"	"3641"	"-17"	"3641"	"-17"	"c.3641-17T>G"	"r.(=)"	"p.(=)"	""
"0000617745"	"00021909"	"10"	"-12"	"0"	"-12"	"0"	"c.-12G>A"	"r.(?)"	"p.(=)"	""
"0000617746"	"00021909"	"30"	"24"	"6"	"24"	"6"	"c.24+6C>G"	"r.(=)"	"p.(=)"	""
"0000617747"	"00021909"	"10"	"267"	"14"	"267"	"14"	"c.267+14C>G"	"r.(=)"	"p.(=)"	""
"0000617748"	"00021909"	"10"	"301"	"0"	"301"	"0"	"c.301G>A"	"r.(?)"	"p.(Ala101Thr)"	""
"0000617749"	"00021909"	"10"	"306"	"0"	"306"	"0"	"c.306T>G"	"r.(?)"	"p.(Val102=)"	""
"0000617750"	"00021909"	"10"	"375"	"0"	"375"	"0"	"c.375G>A"	"r.(?)"	"p.(Ser125=)"	""
"0000617751"	"00021909"	"10"	"449"	"-10"	"449"	"-10"	"c.449-10G>A"	"r.(=)"	"p.(=)"	""
"0000617752"	"00021909"	"30"	"516"	"0"	"516"	"0"	"c.516C>T"	"r.(?)"	"p.(Asp172=)"	""
"0000617753"	"00021909"	"10"	"613"	"-39"	"613"	"-39"	"c.613-39C>T"	"r.(=)"	"p.(=)"	""
"0000617754"	"00021909"	"10"	"870"	"0"	"870"	"0"	"c.870C>T"	"r.(?)"	"p.(Asn290=)"	""
"0000617755"	"00021909"	"30"	"924"	"0"	"924"	"0"	"c.924G>A"	"r.(?)"	"p.(Ala308=)"	""
"0000617756"	"00021909"	"10"	"1041"	"0"	"1041"	"0"	"c.1041G>T"	"r.(?)"	"p.(Leu347=)"	""
"0000617757"	"00021909"	"10"	"1050"	"13"	"1050"	"16"	"c.1050+13_1050+16dup"	"r.(=)"	"p.(=)"	""
"0000617758"	"00021909"	"10"	"1051"	"-33"	"1051"	"-33"	"c.1051-33C>T"	"r.(=)"	"p.(=)"	""
"0000617759"	"00021909"	"50"	"1051"	"0"	"1051"	"0"	"c.1051G>A"	"r.(?)"	"p.(Val351Met)"	""
"0000617760"	"00021909"	"10"	"1151"	"-23"	"1151"	"-23"	"c.1151-23C>T"	"r.(=)"	"p.(=)"	""
"0000617761"	"00021909"	"10"	"1151"	"-20"	"1151"	"-20"	"c.1151-20T>A"	"r.(=)"	"p.(=)"	""
"0000617762"	"00021909"	"30"	"1160"	"0"	"1160"	"0"	"c.1160G>A"	"r.(?)"	"p.(Ser387Asn)"	""
"0000617763"	"00021909"	"10"	"1368"	"0"	"1368"	"0"	"c.1368C>G"	"r.(?)"	"p.(Thr456=)"	""
"0000617764"	"00021909"	"10"	"1459"	"0"	"1494"	"0"	"c.1459_1494del"	"r.(?)"	"p.(Lys487_Leu498del)"	""
"0000617765"	"00021909"	"30"	"1603"	"0"	"1603"	"0"	"c.1603G>A"	"r.(?)"	"p.(Glu535Lys)"	""
"0000617766"	"00021909"	"10"	"1744"	"-28"	"1744"	"-28"	"c.1744-28C>T"	"r.(=)"	"p.(=)"	""
"0000617767"	"00021909"	"30"	"1744"	"0"	"1744"	"0"	"c.1744G>A"	"r.(?)"	"p.(Gly582Ser)"	""
"0000617768"	"00021909"	"30"	"1873"	"4"	"1873"	"4"	"c.1873+4C>T"	"r.spl?"	"p.?"	""
"0000617769"	"00021909"	"10"	"2019"	"25"	"2019"	"25"	"c.2019+25C>G"	"r.(=)"	"p.(=)"	""
"0000617770"	"00021909"	"30"	"2020"	"-4"	"2020"	"-4"	"c.2020-4A>C"	"r.spl?"	"p.?"	""
"0000617771"	"00021909"	"50"	"2032"	"0"	"2032"	"0"	"c.2032C>A"	"r.(?)"	"p.(Gln678Lys)"	""
"0000617772"	"00021909"	"30"	"2126"	"0"	"2126"	"0"	"c.2126C>T"	"r.(?)"	"p.(Thr709Ile)"	""
"0000617773"	"00021909"	"30"	"2274"	"0"	"2274"	"0"	"c.2274C>G"	"r.(?)"	"p.(Cys758Trp)"	""
"0000617774"	"00021909"	"30"	"2274"	"0"	"2275"	"0"	"c.2274_2275delinsGG"	"r.(?)"	"p.(Cys758_Cys759delinsTrpGly)"	""
"0000617775"	"00021909"	"30"	"2275"	"0"	"2275"	"0"	"c.2275T>G"	"r.(?)"	"p.(Cys759Gly)"	""
"0000617776"	"00021909"	"50"	"2335"	"0"	"2335"	"0"	"c.2335C>A"	"r.(?)"	"p.(Pro779Thr)"	""
"0000617777"	"00021909"	"10"	"2380"	"0"	"2380"	"0"	"c.2380C>T"	"r.(?)"	"p.(Leu794=)"	""
"0000617778"	"00021909"	"50"	"2404"	"0"	"2404"	"0"	"c.2404C>T"	"r.(?)"	"p.(Leu802Phe)"	""
"0000617779"	"00021909"	"10"	"2619"	"0"	"2619"	"0"	"c.2619C>T"	"r.(?)"	"p.(Thr873=)"	""
"0000617780"	"00021909"	"50"	"2704"	"0"	"2704"	"0"	"c.2704T>C"	"r.(?)"	"p.(Phe902Leu)"	""
"0000617781"	"00021909"	"10"	"2934"	"0"	"2934"	"0"	"c.2934T>C"	"r.(?)"	"p.(Ile978=)"	""
"0000617782"	"00021909"	"10"	"2953"	"15"	"2953"	"15"	"c.2953+15G>A"	"r.(=)"	"p.(=)"	""
"0000617783"	"00021909"	"10"	"3024"	"0"	"3024"	"0"	"c.3024G>A"	"r.(?)"	"p.(Ala1008=)"	""
"0000617784"	"00021909"	"50"	"3068"	"0"	"3068"	"0"	"c.3068T>A"	"r.(?)"	"p.(Leu1023His)"	""
"0000617785"	"00021909"	"10"	"3082"	"0"	"3082"	"0"	"c.3082C>T"	"r.(?)"	"p.(Leu1028=)"	""
"0000617786"	"00021909"	"30"	"3082"	"0"	"3082"	"0"	"c.3082C>T"	"r.(?)"	"p.(Leu1028=)"	""
"0000617787"	"00021909"	"50"	"3179"	"0"	"3179"	"0"	"c.3179C>A"	"r.(?)"	"p.(Ala1060Glu)"	""
"0000617788"	"00021909"	"50"	"3224"	"0"	"3224"	"0"	"c.3224T>C"	"r.(?)"	"p.(Leu1075Pro)"	""
"0000617789"	"00021909"	"30"	"3641"	"-19"	"3641"	"-19"	"c.3641-19C>G"	"r.(=)"	"p.(=)"	""
"0000624051"	"00021909"	"50"	"2752"	"0"	"2752"	"0"	"c.2752C>T"	"r.(?)"	"p.(Pro918Ser)"	""
"0000650032"	"00021909"	"10"	"301"	"0"	"301"	"0"	"c.301G>A"	"r.(?)"	"p.(Ala101Thr)"	""
"0000650033"	"00021909"	"30"	"449"	"-10"	"449"	"-10"	"c.449-10G>A"	"r.(=)"	"p.(=)"	""
"0000650034"	"00021909"	"50"	"1294"	"0"	"1294"	"0"	"c.1294G>A"	"r.(?)"	"p.(Ala432Thr)"	""
"0000658629"	"00021909"	"10"	"1050"	"9"	"1050"	"9"	"c.1050+9dup"	"r.(=)"	"p.(=)"	""
"0000658630"	"00021909"	"10"	"1050"	"10"	"1050"	"10"	"c.1050+10T>G"	"r.(=)"	"p.(=)"	""
"0000658631"	"00021909"	"50"	"1600"	"0"	"1600"	"0"	"c.1600G>T"	"r.(?)"	"p.(Gly534Trp)"	""
"0000669492"	"00021909"	"30"	"449"	"-10"	"449"	"-10"	"c.449-10G>A"	"r.(=)"	"p.(=)"	""
"0000681476"	"00021909"	"50"	"2531"	"0"	"2531"	"0"	"c.2531G>A"	"r.(?)"	"p.(Gly844Asp)"	""
"0000692857"	"00021909"	"30"	"1242"	"0"	"1242"	"0"	"c.1242T>C"	"r.(?)"	"p.(Phe414=)"	""
"0000692858"	"00021909"	"30"	"1368"	"0"	"1368"	"0"	"c.1368C>G"	"r.(?)"	"p.(Thr456=)"	""
"0000692859"	"00021909"	"30"	"1575"	"0"	"1575"	"0"	"c.1575G>A"	"r.(?)"	"p.(Trp525Ter)"	""
"0000692860"	"00021909"	"10"	"2211"	"-6"	"2211"	"-6"	"c.2211-6C>T"	"r.(=)"	"p.(=)"	""
"0000727476"	"00021909"	"10"	"2124"	"0"	"2124"	"0"	"c.2124C>T"	"r.(?)"	"p.(Ile708=)"	""
"0000808978"	"00021909"	"10"	"2991"	"0"	"2991"	"0"	"c.2991C>T"	"r.(?)"	"p.(Pro997=)"	""
"0000855659"	"00021909"	"50"	"2"	"0"	"2"	"0"	"c.2T>C"	"r.(?)"	"p.(Met1?)"	""
"0000866217"	"00021909"	"50"	"-3140"	"0"	"-3140"	"0"	"c.-3140T>C"	"r.(?)"	"p.(=)"	""
"0000866218"	"00021909"	"50"	"308"	"0"	"308"	"0"	"c.308A>G"	"r.(?)"	"p.(Tyr103Cys)"	""
"0000866219"	"00021909"	"50"	"1070"	"0"	"1070"	"0"	"c.1070G>A"	"r.(?)"	"p.(Arg357Gln)"	""
"0000866220"	"00021909"	"50"	"1432"	"0"	"1432"	"0"	"c.1432G>C"	"r.(?)"	"p.(Asp478His)"	""
"0000866221"	"00021909"	"50"	"1683"	"0"	"1683"	"0"	"c.1683C>G"	"r.(?)"	"p.(Asp561Glu)"	""
"0000866222"	"00021909"	"50"	"1756"	"0"	"1756"	"0"	"c.1756G>C"	"r.(?)"	"p.(Val586Leu)"	""
"0000866223"	"00021909"	"50"	"2992"	"0"	"2992"	"0"	"c.2992G>A"	"r.(?)"	"p.(Gly998Ser)"	""
"0000866224"	"00021909"	"30"	"3534"	"7"	"3534"	"7"	"c.3534+7C>T"	"r.(=)"	"p.(=)"	""
"0000866225"	"00021909"	"50"	"3563"	"0"	"3563"	"0"	"c.3563G>T"	"r.(?)"	"p.(Trp1188Leu)"	""
"0000895079"	"00021909"	"30"	"308"	"0"	"308"	"0"	"c.308A>G"	"r.(?)"	"p.(Tyr103Cys)"	""
"0000895080"	"00021909"	"50"	"460"	"0"	"460"	"0"	"c.460G>T"	"r.(?)"	"p.(Val154Phe)"	""
"0000895081"	"00021909"	"30"	"477"	"0"	"477"	"0"	"c.477C>G"	"r.(?)"	"p.(His159Gln)"	""
"0000895082"	"00021909"	"10"	"1459"	"0"	"1494"	"0"	"c.1459_1494del"	"r.(?)"	"p.(Lys487_Leu498del)"	""
"0000895083"	"00021909"	"30"	"1881"	"0"	"1881"	"0"	"c.1881T>C"	"r.(?)"	"p.(Phe627=)"	""
"0000895084"	"00021909"	"50"	"3616"	"0"	"3616"	"0"	"c.3616C>G"	"r.(?)"	"p.(Pro1206Ala)"	""
"0000915272"	"00021909"	"10"	"-3373"	"0"	"-3371"	"0"	"c.-3373_-3371del"	"r.(?)"	"p.(=)"	""
"0000915273"	"00021909"	"10"	"618"	"0"	"618"	"0"	"c.618G>A"	"r.(?)"	"p.(Ser206=)"	""
"0000915274"	"00021909"	"50"	"995"	"0"	"995"	"0"	"c.995G>A"	"r.(?)"	"p.(Arg332Gln)"	""
"0000915275"	"00021909"	"10"	"1380"	"0"	"1380"	"0"	"c.1380G>C"	"r.(?)"	"p.(Leu460=)"	""
"0000915276"	"00021909"	"50"	"3068"	"0"	"3068"	"0"	"c.3068T>C"	"r.(?)"	"p.(Leu1023Pro)"	""
"0000926927"	"00021909"	"50"	"2531"	"0"	"2531"	"0"	"c.2531G>A"	"r.(?)"	"p.(Gly844Asp)"	""
"0000926928"	"00021909"	"10"	"2712"	"0"	"2712"	"0"	"c.2712G>T"	"r.(?)"	"p.(Val904=)"	""
"0000931084"	"00021909"	"30"	"308"	"0"	"308"	"0"	"c.308A>G"	"r.(?)"	"p.(Tyr103Cys)"	""
"0000931085"	"00021909"	"50"	"3043"	"0"	"3043"	"0"	"c.3043T>G"	"r.(?)"	"p.(Tyr1015Asp)"	""
"0000951324"	"00021909"	"10"	"1682"	"0"	"1682"	"0"	"c.1682A>C"	"r.(?)"	"p.(Asp561Ala)"	""
"0000951325"	"00021909"	"30"	"2531"	"0"	"2531"	"0"	"c.2531G>A"	"r.(?)"	"p.(Gly844Asp)"	""
"0000951326"	"00021909"	"50"	"3339"	"0"	"3342"	"0"	"c.3339_3342del"	"r.(?)"	"p.(Ser1114Argfs*8)"	""
"0000951327"	"00021909"	"30"	"3641"	"-17"	"3641"	"-17"	"c.3641-17T>G"	"r.(=)"	"p.(=)"	""
"0000969841"	"00021909"	"50"	"344"	"0"	"344"	"0"	"c.344C>T"	"r.(?)"	"p.(Pro115Leu)"	""
"0000969842"	"00021909"	"30"	"1119"	"0"	"1119"	"0"	"c.1119C>A"	"r.(?)"	"p.(Phe373Leu)"	""
"0000969843"	"00021909"	"30"	"1487"	"0"	"1487"	"0"	"c.1487C>T"	"r.(?)"	"p.(Ala496Val)"	""
"0000983582"	"00021909"	"30"	"301"	"0"	"301"	"0"	"c.301G>A"	"r.(?)"	"p.(Ala101Thr)"	""
"0000983583"	"00021909"	"30"	"449"	"-10"	"449"	"-10"	"c.449-10G>A"	"r.(=)"	"p.(=)"	""
"0000983584"	"00021909"	"30"	"1041"	"0"	"1041"	"0"	"c.1041G>T"	"r.(?)"	"p.(Leu347=)"	""
"0000983585"	"00021909"	"30"	"2531"	"0"	"2531"	"0"	"c.2531G>A"	"r.(?)"	"p.(Gly844Asp)"	""
"0000983586"	"00021909"	"30"	"2740"	"0"	"2740"	"0"	"c.2740A>T"	"r.(?)"	"p.(Lys914Ter)"	""
"0000988474"	"00021909"	"30"	"2121"	"0"	"2121"	"0"	"c.2121C>T"	"r.(?)"	"p.(Leu707=)"	""
"0001004981"	"00021909"	"10"	"354"	"0"	"354"	"0"	"c.354G>C"	"r.(?)"	"p.(Val118=)"	""
"0001004982"	"00021909"	"30"	"1294"	"0"	"1294"	"0"	"c.1294G>A"	"r.(?)"	"p.(Ala432Thr)"	""
"0001004983"	"00021909"	"30"	"1459"	"0"	"1494"	"0"	"c.1459_1494del"	"r.(?)"	"p.(Lys487_Leu498del)"	""
"0001004984"	"00021909"	"50"	"1690"	"0"	"1692"	"0"	"c.1690_1692dup"	"r.(?)"	"p.(Leu564dup)"	""
"0001004985"	"00021909"	"50"	"2531"	"0"	"2531"	"0"	"c.2531G>A"	"r.(?)"	"p.(Gly844Asp)"	""
"0001015820"	"00021909"	"30"	"1908"	"0"	"1908"	"0"	"c.1908G>C"	"r.(?)"	"p.(=)"	""
"0001015821"	"00021909"	"50"	"2086"	"0"	"2086"	"0"	"c.2086G>A"	"r.(?)"	"p.(Ala696Thr)"	""
"0001015822"	"00021909"	"50"	"3034"	"0"	"3034"	"0"	"c.3034G>A"	"r.(?)"	"p.(Val1012Ile)"	""
"0001022158"	"00021909"	"30"	"2508"	"0"	"2508"	"0"	"c.2508C>T"	"r.2508C>T"	"p.Gly836="	"17"
"0001027241"	"00021909"	"30"	"1874"	"-9"	"1874"	"-9"	"c.1874-9C>T"	"r.(=)"	"p.(=)"	""
"0001043090"	"00021909"	"30"	"24"	"8"	"24"	"8"	"c.24+8C>A"	"r.(=)"	"p.(=)"	""
"0001043091"	"00021909"	"30"	"749"	"0"	"749"	"0"	"c.749G>A"	"r.(?)"	"p.(Arg250His)"	""
"0001043092"	"00021909"	"50"	"1009"	"0"	"1009"	"0"	"c.1009C>T"	"r.(?)"	"p.(Arg337Cys)"	""
"0001043093"	"00021909"	"30"	"1690"	"0"	"1692"	"0"	"c.1690_1692dup"	"r.(?)"	"p.(Leu564dup)"	""
"0001043094"	"00021909"	"50"	"2665"	"0"	"2665"	"0"	"c.2665del"	"r.(?)"	"p.(His889ThrfsTer35)"	""
"0001043095"	"00021909"	"50"	"2815"	"0"	"2815"	"0"	"c.2815G>T"	"r.(?)"	"p.(Val939Leu)"	""


## Screenings_To_Variants ## Do not remove or alter this header ##
## Count = 38
"{{screeningid}}"	"{{variantid}}"
"0000044019"	"0000071823"
"0000044027"	"0000071832"
"0000044027"	"0000071833"
"0000064195"	"0000095177"
"0000064196"	"0000095178"
"0000064197"	"0000095179"
"0000064198"	"0000095180"
"0000064905"	"0000096560"
"0000065293"	"0000096968"
"0000065296"	"0000096971"
"0000128825"	"0000217955"
"0000128827"	"0000217957"
"0000128832"	"0000217963"
"0000128833"	"0000217965"
"0000129231"	"0000218371"
"0000129239"	"0000218381"
"0000129314"	"0000218481"
"0000129317"	"0000218487"
"0000205332"	"0000434696"
"0000205333"	"0000434699"
"0000205334"	"0000434701"
"0000205335"	"0000434707"
"0000205336"	"0000434710"
"0000205337"	"0000434711"
"0000205338"	"0000434709"
"0000205339"	"0000434706"
"0000205340"	"0000434698"
"0000205341"	"0000434700"
"0000205342"	"0000434702"
"0000205342"	"0000434703"
"0000205342"	"0000434705"
"0000205343"	"0000434704"
"0000205343"	"0000434708"
"0000293343"	"0000650032"
"0000293344"	"0000650033"
"0000293345"	"0000650034"
"0000305804"	"0000669492"
"0000462631"	"0001022158"