### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = TULP1) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "TULP1" "tubby like protein 1" "6" "p21.3" "unknown" "NG_009077.1" "UD_132119037550" "" "https://www.LOVD.nl/TULP1" "" "1" "12423" "7287" "602280" "1" "1" "1" "1" "This database is one of the \"Eye disease\" gene variant databases.\r\nEstablishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "" "g" "http://databases.lovd.nl/shared/refseq/TULP1_codingDNA.html" "1" "" "This database is one of the \"Eye disease\" gene variant databases." "-1" "" "-1" "00001" "2012-07-04 00:00:00" "00006" "2017-01-31 22:59:29" "00006" "2025-04-07 13:47:05" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00022150" "TULP1" "tubby like protein 1" "001" "NM_003322.3" "" "NP_003313.3" "" "" "" "-12" "2082" "1629" "35480647" "35465651" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 11 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00112" "RP" "retinitis pigmentosa (RP)" "" "268000" "" "" "" "00001" "2013-02-21 17:12:36" "00006" "2021-01-18 09:53:26" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00312" "FAP1" "adenomatous polyposis, familial, type 1 (FAP-1, Gardner syndrome)" "AD" "175100" "" "" "" "00006" "2014-01-27 14:53:36" "00006" "2021-12-10 21:51:32" "00381" "RD" "dystrophy, retinal (RD)" "" "" "" "" "" "00006" "2014-05-09 11:59:52" "00006" "2015-12-07 07:11:25" "02289" "RP14" "retinitis pigmentosa, type 14 (RP14)" "AR" "600132" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "03460" "LCA15" "Leber congenital amaurosis, type 15 (LCA-15)" "AR" "613843" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "04210" "LCA" "Leber congenital amaurosis (LCA)" "" "" "" "" "" "00006" "2015-02-27 18:57:11" "" "" "04211" "RPar" "retinitis pigmentosa, autosomal recessive (RPar)" "" "" "" "" "" "00006" "2015-02-27 18:58:57" "" "" "04214" "-" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00001" "2023-03-09 14:26:26" "04249" "macular dystrophy" "dystrophy, macular" "" "" "" "" "" "00006" "2015-05-04 22:10:58" "00006" "2024-02-15 21:18:39" "05086" "HL" "hearing loss (HL)" "" "" "" "" "" "00006" "2015-10-23 11:41:05" "00006" "2015-10-23 11:43:00" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 2 "{{geneid}}" "{{diseaseid}}" "TULP1" "02289" "TULP1" "03460" ## Individuals ## Do not remove or alter this header ## ## Count = 406 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00001812" "" "" "" "1" "" "00102" "" "" "" "" "(United States)" "" "0" "" "" "" "" "00014444" "" "" "" "1" "" "00640" "" "" "" "" "Netherlands" "" "" "?" "" "" "" "00014468" "" "" "" "1" "" "00100" "Finland, Helsinki, Department of Medical Genetics, University of Helsinki" "" "" "" "Finland" "" "" "no (pedigree)" "" "" "" "00087824" "" "" "" "1" "" "00234" "{PMID:Hagstrom 1998:9462750}" "2 generation family 1 affected, 5 carrier" "F" "no" "United States" "" "0" "" "" "" "" "00087825" "" "" "" "1" "" "00234" "{PMID:Banerjee 1998:9462751}" "" "M" "no" "United States" "" "0" "" "" "" "" "00087826" "" "" "" "1" "" "00234" "{PMID:Hanein 2004:15024725}" "" "" "" "Italy" "" "0" "" "" "" "" "00087827" "" "" "" "1" "" "00234" "{PMID:Banerjee 1998:9462751}" "?" "?" "?" "Dominican Republic" "" "0" "" "" "" "" "00087828" "" "" "" "1" "" "00234" "{PMID:Gu 1998:9660588}" "" "?" "" "Germany" "" "0" "" "" "" "" "00087829" "" "" "" "1" "" "00234" "{PMID:Hagstrom 1998:9462750}" "2 generation family 1 affected, 5 carrier" "M" "no" "" "" "0" "" "" "" "" "00087830" "" "" "" "1" "" "00234" "{PMID:Paloma 2000:10711677}" "" "F" "?" "Spain" "" "0" "" "" "Spainish" "" "00087831" "" "" "" "1" "" "00234" "{PMID:Gu 1998:9660588}" "" "?" "" "Germany" "" "0" "" "" "" "" "00087832" "" "" "" "1" "" "00234" "{PMID:Paloma 2000:10711677}" "" "?" "?" "" "" "0" "" "" "" "" "00087833" "" "" "" "1" "" "00234" "{PMID:den Hollander 2007:18055821}" "?" "F" "yes" "Afghanistan" "" "0" "" "" "" "" "00087834" "" "" "" "1" "" "00234" "{PMID:den Hollander 2007:18055821}" "" "M" "yes" "Afghanistan" "" "0" "" "" "" "" "00087835" "" "" "" "1" "" "00234" "{PMID:Hagstrom 1998:9462750}" "?" "?" "?" "United States" "" "0" "" "" "" "" "00087836" "" "" "" "1" "" "00234" "{PMID:Hagstrom 1998:9462750}" "2 generation family 1 affected, 2 carrier" "M" "no" "United States" "" "0" "" "" "" "" "00087837" "" "" "" "1" "" "00234" "{PMID:Banerjee 1998:9462751}" "?" "?" "?" "" "" "0" "" "" "" "" "00087838" "" "" "" "1" "" "00234" "{PMID:Hagstrom 1998:9462750}" "2 generation family 1 affected, 4 carrier" "M" "no" "United States" "" "0" "" "" "" "" "00087839" "" "" "" "1" "" "00234" "{PMID:Hagstrom 1998:9462750}" "2 generation family 1 affected 6 carrier" "F" "no" "United States" "" "0" "" "" "" "" "00087840" "" "" "" "1" "" "00234" "{PMID:Hagstrom 1998:9462750}" "2 generation family 1 affected 5 carrier" "M" "no" "United States" "" "0" "" "" "" "" "00087841" "" "" "" "1" "" "00234" "{PMID:Banerjee 1998:9462751}" "?" "?" "?" "Dominican Republic" "" "0" "" "" "" "" "00087842" "" "" "" "1" "" "00234" "{PMID:Banerjee 1998, :9462751}" "?" "" "" "Dominican Republic" "" "0" "" "" "" "" "00087843" "" "" "" "1" "" "00234" "{PMID:Mataftsi  2007:17962469}" "7 generation family.this SNP identified in only one person" "F" "yes" "Algeria" "" "0" "" "" "" "" "00087844" "" "" "" "1" "" "00234" "{PMID:Li 2009:18936139}" "5 Generation family, 3 affected" "?" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00087845" "" "" "" "1" "" "00234" "{PMID:Li 2009:18936139}" "5 Generation family, 3 affected" "?" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00087846" "" "" "" "1" "" "00234" "{PMID:Li 2009:18936139}" "5 Generation family, 3 affected" "?" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00087847" "" "" "" "1" "" "00234" "{PMID:Li 2009:18936139}" "6 Generation family, 16 affected" "?" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00087848" "" "" "" "1" "" "00234" "{PMID:Li 2009:18936139}" "6 Generation family, 16 affected" "?" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00087849" "" "" "" "1" "" "00234" "{PMID:Li 2009:18936139}" "6 Generation family, 16 affected" "?" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00087850" "" "" "" "1" "" "00234" "{PMID:Li 2009:18936139}" "6 Generation family, 16 affected" "?" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00087851" "" "" "" "1" "" "00234" "{PMID:Li 2009:18936139}" "6 Generation family, 16 affected" "?" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00087852" "" "" "" "1" "" "00234" "{PMID:Li 2009:18936139}" "6 Generation family, 16 affected" "?" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00087853" "" "" "" "1" "" "00234" "{PMID:Li 2009:18936139}" "6 Generation family, 16 affected" "?" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00087854" "" "" "" "1" "" "00234" "{PMID:Li 2009:18936139}" "6 Generation family, 16 affected" "?" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00087855" "" "" "" "1" "" "00234" "{PMID:Li 2009:18936139}" "6 Generation family, 16 affected" "?" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00087856" "" "" "" "1" "" "00234" "{PMID:Li 2009:18936139}" "6 Generation family, 16 affected" "?" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00087857" "" "" "" "1" "" "00234" "{PMID:Li 2009:18936139}" "6 Generation family, 16 affected" "?" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00087858" "" "" "" "1" "" "00234" "{PMID:Li 2009:18936139}" "6 Generation family, 16 affected" "?" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00087859" "" "" "" "1" "" "00234" "{PMID:Li 2009:18936139}" "6 Generation family, 2 affected" "?" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00087860" "" "" "" "1" "" "00234" "{PMID:Li 2009:18936139}" "6 Generation family, 2 affected" "?" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00087861" "" "" "" "1" "" "00234" "{PMID:Li 2009:18936139}" "6 Generation family, 14 affected" "?" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00087862" "" "" "" "1" "" "00234" "{PMID:Li 2009:18936139}" "6 Generation family, 14 affected" "?" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00087863" "" "" "" "1" "" "00234" "{PMID:Li 2009:18936139}" "6 Generation family, 14 affected" "?" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00087864" "" "" "" "1" "" "00234" "{PMID:Li 2009:18936139}" "6 Generation family, 14 affected" "?" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00087865" "" "" "" "1" "" "00234" "{PMID:Li 2009:18936139}" "6 Generation family, 14 affected" "?" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00087866" "" "" "" "1" "" "00234" "{PMID:Li 2009:18936139}" "6 Generation family, 14 affected" "?" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00087867" "" "" "" "1" "" "00234" "{PMID:Li 2009:18936139}" "6 Generation family, 14 affected" "?" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00087868" "" "" "" "1" "" "00234" "{PMID:Li 2009:18936139}" "6 Generation family, 14 affected" "?" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00087869" "" "" "" "1" "" "00234" "{PMID:Li 2009:18936139}" "6 Generation family, 14 affected" "?" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00087870" "" "" "" "1" "" "00234" "{PMID:Li 2009:18936139}" "6 Generation family, 14 affected" "?" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00087871" "" "" "" "1" "" "00234" "{PMID:Li 2009:18936139}" "6 Generation family, 14 affected" "?" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00087872" "" "" "" "1" "" "00234" "{PMID:Li 2009:18936139}" "6 Generation family, 14 affected" "?" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00087873" "" "" "" "1" "" "00234" "{PMID:Li 2009:18936139}" "6 Generation family, 14 affected" "?" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00087874" "" "" "" "1" "" "00234" "{PMID:Li 2009:18936139}" "4 Generation family, 2 affected" "?" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00087875" "" "" "" "1" "" "00234" "{PMID:Li 2009:18936139}" "4 Generation family, 2 affected" "?" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00087876" "" "" "" "1" "" "00234" "{PMID:Hebrard 2011:21792230}" "3 generation family, 2 affected, 8 carriers, 1 normal" "M" "no" "France" "" "0" "" "" "" "" "00087877" "" "" "" "1" "" "00234" "{PMID:Hebrard 2011:21792230}" "3 generation family, 2 affected, 8 carriers, 1 normal" "F" "no" "France" "" "0" "" "" "" "" "00087878" "" "" "" "1" "" "00234" "{PMID:den Hollander 2007:18055821}" "?" "M" "yes" "Turkey" "" "0" "" "" "" "" "00087879" "" "" "" "1" "" "00234" "{PMID:Kannabiran 2012:22605927}" "4 generation family 2 affected, 3 carrier" "M" "yes" "India" "" "0" "" "" "South india" "" "00087880" "" "" "" "1" "" "00234" "{PMID:Kannabiran 2012:22605927}" "4 generation family 3 affected, 2 carrier" "M" "yes" "India" "" "0" "" "" "South india" "" "00087881" "" "" "" "1" "" "00234" "{PMID:Hanein 2004:15024725}" "" "" "?" "" "" "0" "" "" "" "" "00087882" "" "" "" "1" "" "00234" "{PMID:Iqbal 2011:21987678}" "4 generation family, 4 affected, 4 carriers" "F" "yes" "Pakistan" "" "0" "" "" "Southern Punjab" "" "00087883" "" "" "" "1" "" "00234" "{PMID:Iqbal 2011:21987678}" "4 generation family, 4 affected, 4 carriers" "F" "yes" "Pakistan" "" "0" "" "" "Southern Punjab" "" "00087884" "" "" "" "1" "" "00234" "{PMID:Iqbal 2011:21987678}" "4 generation family, 4 affected, 4 carriers" "F" "yes" "Pakistan" "" "0" "" "" "Southern Punjab" "" "00087885" "" "" "" "1" "" "00234" "{PMID:Iqbal 2011:21987678}" "4 generation family, 4 affected, 4 carriers" "F" "yes" "Pakistan" "" "0" "" "" "Southern Punjab" "" "00087886" "" "" "" "1" "" "00234" "{PMID:McKibbin 2010:20065226}" "?" "?" "?" "Pakistan" "" "0" "" "" "Northern Punjab" "" "00087887" "" "" "" "1" "" "00234" "{PMID:Ajmal 2012:22665969}" "6 generation family, 16 carriers, 27 affected" "M" "" "Pakistan" "" "0" "" "" "NothernPunjab,Nothern Pakistan" "" "00087888" "" "" "" "1" "" "00234" "{PMID:Iqbal  2011:21987678}" " 4 generation family, 4 affected, 3 carriers" "F" "yes" "Pakistan" "" "0" "" "" "Southern Punjab" "" "00087889" "" "" "" "1" "" "00234" "{PMID:Iqbal 2011:21987678}" " 4 generation family, 4 affected, 3 carriers" "F" "yes" "Pakistan" "" "0" "" "" "Southern Punjab" "" "00087890" "" "" "" "1" "" "00234" "{PMID:Iqbal  2011:21987678}" " 4 generation family, 4 affected, 3 carriers" "F" "yes" "Pakistan" "" "0" "" "" "Southern Punjab" "" "00087891" "" "" "" "1" "" "00234" "{PMID:Iqbal  2011:21987678}" " 4 generation family, 4 affected, 3 carriers" "F" "yes" "Pakistan" "" "0" "" "" "Southern Punjab" "" "00087892" "" "" "" "1" "" "00234" "{PMID:Kondo  2004:157452}" "2 generation family 2 affected, 3 carrier" "F" "no" "Japan" "" "0" "" "" "" "" "00087893" "" "" "" "1" "" "00234" "{PMID:Kondo  2004:157452}" "2 generation family 2 affected, 3 carrier" "M" "no" "Japan" "" "0" "" "" "" "" "00087894" "" "" "" "1" "" "00234" "{PMID:Gu 1998:9660588}" "" "?" "" "Germany" "" "0" "" "" "" "" "00087895" "" "" "" "1" "" "00234" "{PMID:Hanein 2004:15024725}" "" "" "?" "" "" "0" "" "" "" "" "00087896" "" "" "" "2" "" "00234" "{PMID:Singh 2009:19339744}" "2 Families" "M" "yes" "India" "" "0" "" "" "" "" "00087897" "" "" "" "1" "" "00234" "{PMID:Gu 1998:9660588}" "" "" "?" "" "" "0" "" "" "" "" "00087898" "" "" "" "1" "" "00234" "{PMID:Gu 1998:9660588}" "" "" "?" "" "" "0" "" "" "" "" "00087899" "" "" "" "1" "" "00234" "{PMID:Hagstrom 1998:9462750}" "2 generation family 2 affected" "M" "no" "" "" "0" "" "" "" "" "00087900" "" "" "" "1" "" "00234" "{PMID:Hagstrom 1998:9462750}" "2 generation family 2 affected" "M" "no" "" "" "0" "" "" "" "" "00087901" "" "" "" "1" "" "00234" "{PMID:Hagstrom 1998:9462750}" "?" "?" "?" "United States" "" "0" "" "" "" "" "00087902" "" "" "" "1" "" "00234" "{PMID:Hagstrom 1998:9462750}" "?" "?" "?" "United States" "" "0" "" "" "" "" "00087903" "" "" "" "1" "" "00234" "{PMID:Gu 1998:9660588}" "" "?" "" "Germany" "" "0" "" "" "" "" "00087904" "" "" "" "1" "" "00234" "{PMID:den Hollander 2007:18055821}" "?" "M" "yes" "Mexico" "" "0" "" "" "" "" "00087905" "" "" "" "1" "" "00234" "{PMID:den Hollander 2007:17620573}" "2 generation family, 5 affected indiviuals" "F" "no" "Suriname" "" "0" "" "" "" "" "00087906" "" "" "" "1" "" "00234" "{PMID:den Hollander 2007:17620573}" "2 generation family, 5 affected indiviuals" "F" "no" "Suriname" "" "0" "" "" "" "" "00087907" "" "" "" "1" "" "00234" "{PMID:den Hollander 2007:17620573}" "2 generation family, 5 affected indiviuals" "F" "no" "Suriname" "" "0" "" "" "" "" "00087908" "" "" "" "1" "" "00234" "{PMID:den Hollander 2007:17620573}" "2 generation family, 5 affected indiviuals" "F" "no" "Suriname" "" "0" "" "" "" "" "00087909" "" "" "" "1" "" "00234" "{PMID:den Hollander 2007:17620573}" "2 generation family, 5 affected indiviuals" "M" "no" "Suriname" "" "0" "" "" "" "" "00087910" "" "" "" "1" "" "00234" "{PMID:Ajmal 2012:22665969}" "6 generation family, 5 carriers, 6 affected" "M" "yes" "Pakistan" "" "0" "" "" "Nothern Punjab" "" "00087911" "" "" "" "1" "" "00234" "{PMID:Iqbal 2011:21987678}" "4 generation family, 5 affected, 3 carriers" "M" "yes" "Pakistan" "" "0" "" "" "Punjab" "" "00087912" "" "" "" "1" "" "00234" "{PMID:Iqbal 2011:21987678}" "4 generation family, 5 affected, 3 carriers" "M" "yes" "Pakistan" "" "0" "" "" "Punjab" "" "00087913" "" "" "" "1" "" "00234" "{PMID:Iqbal 2011:21987678}" "4 generation family, 5 affected, 3 carriers" "F" "yes" "Pakistan" "" "0" "" "" "Punjab" "" "00087914" "" "" "" "1" "" "00234" "{PMID:Iqbal 2011:21987678}" "4 generation family, 5 affected, 3 carriers" "F" "yes" "Pakistan" "" "0" "" "" "Punjab" "" "00087915" "" "" "" "1" "" "00234" "{PMID:Iqbal 2011:21987678}" "4 generation family, 5 affected, 3 carriers" "F" "yes" "Pakistan" "" "0" "" "" "Punjab" "" "00087916" "" "" "" "1" "" "00234" "{PMID:Iqbal 2011:21987678}" "5 generation family, 5 affected, 5 carriers;" "M" "yes" "Pakistan" "" "0" "" "" "Punjab" "" "00087917" "" "" "" "1" "" "00234" "{PMID:Iqbal 2011:21987678}" "5 generation family, 5 affected, 5 carriers" "M" "yes" "Pakistan" "" "0" "" "" "Punjab" "" "00087918" "" "" "" "1" "" "00234" "{PMID:Iqbal 2011:21987678}" "5 generation family, 5 affected, 5 carriers" "F" "yes" "Pakistan" "" "0" "" "" "Punjab" "" "00087919" "" "" "" "1" "" "00234" "{PMID:Iqbal 2011:21987678}" "5 generation family, 5 affected, 5 carriers" "F" "yes" "Pakistan" "" "0" "" "" "Punjab" "" "00087920" "" "" "" "1" "" "00234" "{PMID:Iqbal 2011:21987678}" "5 generation family, 5 affected, 5 carriers" "F" "yes" "Pakistan" "" "0" "" "" "Punjab" "" "00087921" "" "" "" "1" "" "00234" "{PMID:Iqbal 2011:21987678}" " 4 generation family, 4 affected, 4 carriers" "F" "yes" "Pakistan" "" "0" "" "" "Punjab" "" "00087922" "" "" "" "1" "" "00234" "{PMID:Iqbal 2011:21987678}" " 4 generation family, 4 affected, 4 carriers" "M" "yes" "Pakistan" "" "0" "" "" "Punjab" "" "00087923" "" "" "" "1" "" "00234" "{PMID:Iqbal 2011:21987678}" " 4 generation family, 4 affected, 4 carriers" "M" "yes" "Pakistan" "" "0" "" "" "Punjab" "" "00087924" "" "" "" "1" "" "00234" "{PMID:Iqbal 2011:21987678}" " 4 generation family, 4 affected, 4 carriers" "M" "yes" "Pakistan" "" "0" "" "" "Punjab" "" "00087925" "" "" "" "1" "" "00234" "{PMID:Iqbal 2011:21987678}" "PKRP171: 4 generation family, 5 affected, 3 carriers" "M" "yes" "Pakistan" "" "0" "" "" "Punjab" "" "00087926" "" "" "" "1" "" "00234" "{PMID:Iqbal 2011:21987678}" "4 generation family, 5 affected, 3 carriers" "M" "yes" "Pakistan" "" "0" "" "" "Punjab" "" "00087927" "" "" "" "1" "" "00234" "{PMID:Iqbal 2011:21987678}" "4 generation family, 5 affected, 3 carriers" "F" "yes" "Pakistan" "" "0" "" "" "Punjab" "" "00087928" "" "" "" "1" "" "00234" "{PMID:Iqbal 2011:21987678}" "4 generation family, 5 affected, 3 carriers" "F" "yes" "Pakistan" "" "0" "" "" "Punjab" "" "00087929" "" "" "" "1" "" "00234" "{PMID:Iqbal 2011:21987678}" "4 generation family, 5 affected, 3 carriers" "F" "yes" "Pakistan" "" "0" "" "" "Punjab" "" "00087930" "" "" "" "1" "" "00234" "{PMID:Gu 1998:9660588}" "-0" "M" "?" "Germany" "" "0" "" "" "" "" "00087931" "" "" "" "1" "" "00234" "{PMID:Hagstrom 1998:9462750}" "?" "?" "?" "United States" "" "0" "" "" "" "" "00087932" "" "" "" "1" "" "00234" "{PMID:Hagstrom 1998:9462750}" "?" "?" "?" "United States" "" "0" "" "" "" "" "00087933" "" "" "" "1" "" "00234" "{PMID:Banerjee 1998:9462751}" "2 generation family 2 affected, 1 carrier" "M" "no" "Dominican Republic" "" "0" "" "" "" "" "00087934" "" "" "" "1" "" "00234" "{PMID:Banerjee 1998:9462751}" "2 generation family 2 affected, 1 carrier" "F" "no" "Dominican Republic" "" "0" "" "" "" "" "00087935" "" "" "" "1" "" "00234" "{PMID:Banerjee 1998:9462751}" "2 generation family 2 affected, 1 carrier" "M" "no" "United States" "" "0" "" "" "" "" "00087936" "" "" "" "1" "" "00234" "{PMID:Banerjee 1998:9462751}" "2 generation family 2 affected, 1 carrier" "M" "no" "United States" "" "0" "" "" "" "" "00087937" "" "" "" "1" "" "00234" "{PMID:Abbasi 2008:18432314}" "4 generation family 5 affected indiviuals" "M" "yes" "Israel" "" "0" "" "" "" "" "00087938" "" "" "" "1" "" "00234" "{PMID:Abbasi 2008:18432314}" "4 generation family 5 affected indiviuals" "F" "yes" "Israel" "" "0" "" "" "" "" "00087939" "" "" "" "1" "" "00234" "{PMID:Abbasi 2008:18432314}" "4 generation family 5 affected indiviuals" "F" "yes" "Israel" "" "0" "" "" "" "" "00087940" "" "" "" "1" "" "00234" "{PMID:Abbasi 2008:18432314}" "4 generation family 5 affected indiviuals" "F" "yes" "Israel" "" "0" "" "" "" "" "00087941" "" "" "" "1" "" "00234" "{PMID:Abbasi 2008:18432314}" "4 generation family 5 affected indiviuals" "F" "yes" "Israel" "" "0" "" "" "" "" "00087942" "" "" "" "1" "" "00234" "{PMID:Gu 1998:9660588}" "-0" "M" "?" "Germany" "" "0" "" "" "" "" "00087943" "" "" "" "1" "" "00234" "{PMID:Hagstrom 1998:9462750}" "?" "?" "?" "United States" "" "0" "" "" "" "" "00087944" "" "" "" "1" "" "00234" "{PMID:Gu 1998:9660588}" "-0" "M" "?" "Germany" "" "0" "" "" "" "" "00087945" "" "" "" "1" "" "00234" "{PMID:Mataftsi 2007:17962469}" "7 generation family, 7 affected, 17 carriers; VII-3 &VII-4 are brother and sister" "M" "yes" "Algeria" "" "0" "" "" "" "" "00087946" "" "" "" "1" "" "00234" "{PMID:Mataftsi 2007:17962469}" "7 generation family, 7 affected, 17 carriers. VII-3 &VII-4 are brother and sister" "F" "yes" "Algeria" "" "0" "" "" "" "" "00087947" "" "" "" "1" "" "00234" "{PMID:Mataftsi 2007:17962469}" "7 generation family, 7 affected, 17 carriers; VI-9 & VI-10 are brothers" "M" "yes" "Algeria" "" "0" "" "" "" "" "00087948" "" "" "" "1" "" "00234" "{PMID:Mataftsi 2007:17962469}" "7 generation family, 7 affected, 17 carriers. VI-9 & VI-10 are brothers." "M" "yes" "Algeria" "" "0" "" "" "" "" "00087949" "" "" "" "1" "" "00234" "{PMID:Mataftsi 2007:17962469}" "7 generation family, 7 affected, 17 carriers; VI-24, VI-25, VI-26 are brother and sisters" "M" "yes" "Algeria" "" "0" "" "" "" "" "00087950" "" "" "" "1" "" "00234" "{PMID:Mataftsi 2007:17962469}" "7 generation family, 7 affected, 17 carriers. VI-24, VI-25, VI-26 are brother and sisters." "F" "yes" "Algeria" "" "0" "" "" "" "" "00087951" "" "" "" "1" "" "00234" "{PMID:Mataftsi 2007:17962469}" "7 generation family, 7 affected, 17 carriers. VI-24, VI-25, VI-26 are brother and sisters." "F" "yes" "Algeria" "" "0" "" "" "" "" "00088083" "" "" "" "1" "" "00243" "" "One 2-generation family, 2 affecteds, unaffected heterozygous carrier parents" "M" "no" "India" "" "0" "" "" "South India" "" "00095953" "" "" "" "1" "" "01769" "{PMID:Li 2017:28418496}" "" "M" "yes" "Pakistan" "" "0" "" "" "Pakistani" "61206" "00100071" "" "" "" "1" "" "01769" "{PMID:Li 2017:28418496}" "" "M" "yes" "Pakistan" "" "0" "" "" "Pakistani" "61084" "00100075" "" "" "" "1" "" "01769" "{PMID:Li 2017:28418496}" "" "F" "no" "Pakistan" "" "0" "" "" "Pakistani" "61111" "00100081" "" "" "" "1" "" "01769" "{PMID:Li 2017:28418496}" "" "F" "yes" "Pakistan" "" "0" "" "" "Pakistani" "61122" "00100113" "" "" "" "1" "" "01769" "{PMID:Li 2017:28418496}" "" "M" "yes" "Pakistan" "" "0" "" "" "Pakistani" "61259" "00100115" "" "" "" "1" "" "01769" "{PMID:Li 2017:28418496}" "" "M" "yes" "Pakistan" "" "0" "" "" "Pakistani" "61268" "00155558" "" "" "" "1" "" "01243" "Sharon, submitted" "" "F" "yes" "Israel" "" "0" "" "" "Arab-Muslim" "" "00155559" "" "" "" "1" "" "01243" "Sharon, submitted" "" "F" "yes" "Israel" "" "0" "" "" "Druze" "" "00155560" "" "" "" "2" "" "01243" "{PMID:Beryozkin 2015:26306921}, {PMID:Sharon 2019:31456290}" "family" "M" "no" "Israel" "" "0" "" "" "Jewish;Ethiopia" "MOL1125" "00207679" "" "" "" "1" "" "01244" "" "" "F" "" "" "" "0" "" "" "" "" "00207695" "" "" "" "2" "" "01244" "" "" "F" "" "" "" "0" "" "" "" "" "00232668" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232669" "" "" "" "2" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232670" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232671" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232672" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232673" "" "" "" "2" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232674" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232675" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232676" "" "" "" "290" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232677" "" "" "" "591" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232678" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232679" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232680" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232681" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232682" "" "" "" "287" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233684" "" "" "" "887" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233685" "" "" "" "189" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233686" "" "" "" "891" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00240463" "" "" "" "1" "" "03335" "" "" "M" "" "Mexico" "" "0" "" "" "" "" "00244507" "" "" "" "1" "" "01807" "" "" "F" "" "" "" "0" "" "" "" "" "00245770" "" "" "" "5" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00265883" "" "" "" "1" "" "01807" "" "" "F" "" "" "" "0" "" "" "" "" "00294093" "" "" "" "30" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294094" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00308415" "" "" "" "1" "" "00004" "{PMID:Boulanger-Scemama 2015:26103963}, {PMID:Boulanger-Scemama 2019:31574917}" "" "" "" "France" "" "0" "" "" "" "CIC00963" "00308570" "" "" "" "1" "" "00004" "{PMID:Holtan 2020:31429209}" "1 patient with variant in heterozygous or compound heterozygous form" "" "" "Norway" "" "0" "" "" "" "" "00308625" "" "" "" "1" "" "00004" "{PMID:Holtan 2020:31429209}" "1 homozygous patient" "" "" "Norway" "" "0" "" "" "" "" "00309442" "" "" "" "4" "" "00004" "{PMID:Sharon 2019:31456290}" "4 IRD families" "" "" "Israel" "" "0" "" "" "" "" "00309443" "" "" "" "2" "" "00004" "{PMID:Sharon 2019:31456290}" "2 IRD families" "" "" "Israel" "" "0" "" "" "" "" "00309444" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309445" "" "" "" "4" "" "00004" "{PMID:Sharon 2019:31456290}" "4 IRD families" "" "" "Israel" "" "0" "" "" "" "" "00309446" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309447" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309448" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309450" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309451" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309630" "" "" "" "2" "" "00006" "{PMID:Chen 2018:29843741}" "5-generation family, 6 affected, affected brother/sister" "F;M" "" "China" "" "0" "" "" "" "FamBPatIV1/2" "00309670" "" "" "" "1" "" "00006" "{PMID:Jinda 2014:24618324}" "" "M" "" "Thailand" "" "0" "" "" "" "RP038" "00325439" "" "" "" "1" "" "00006" "{PMID:Zenteno 2020:31736247}" "" "" "" "Mexico" "" "0" "" "" "" "2669" "00326694" "" "" "" "1" "" "00008" "{PMID:Mandal 2005:16123440}" "" "" "" "" "" "0" "" "" "" "" "00331619" "" "" "" "1" "" "00000" "{PMID:Sun 2018:29625443}" "sporadic case" "" "no" "China" "" "0" "" "" "" "19791" "00332356" "" "" "" "1" "" "00000" "{PMID:Thompson 2017:29178642}" "" "" "" "Australia" "" "0" "" "" "" "Fam1620" "00332357" "" "" "" "2" "" "00000" "{PMID:Thompson 2017:29178642}" "family, 2 affected" "" "" "Australia" "" "0" "" "" "" "Fam2175" "00332467" "" "" "" "1" "" "00000" "{PMID:Di Iorio 2017:29053603}" "" "" "" "Italy" "" "0" "" "" "" "Pat36" "00332505" "" "" "" "1" "" "00000" "{PMID:Avela 2018:29068140}" "" "" "" "Finland" "" "0" "" "" "" "Pat30" "00332545" "" "" "" "1" "" "00006" "{PMID:Comander 2017:28981474}" "proband" "F" "" "United States" "" "0" "" "" "" "Pat33" "00333861" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "M" "" "(United States)" "" "0" "" "" "" "81" "00334564" "" "" "" "1" "" "00000" "{PMID:Jinda 2017:28453600}" "patient" "" "" "Thailand" "" "0" "" "" "" "RP038" "00334883" "" "" "" "1" "" "00000" "{PMID:Li 2017:28418496}" "" "" "" "Pakistan" "" "0" "" "" "" "61063" "00334885" "" "" "" "1" "" "00000" "{PMID:Li 2017:28418496}" "" "" "" "Pakistan" "" "0" "" "" "" "61171" "00334893" "" "" "" "1" "" "00000" "{PMID:Li 2017:28418496}" "" "" "" "Pakistan" "" "0" "" "" "" "61301" "00334894" "" "" "" "1" "" "00000" "{PMID:Li 2017:28418496}" "" "" "" "Pakistan" "" "0" "" "" "" "61309" "00335419" "" "" "" "1" "" "00000" "{PMID:Huang 2018:29641573}" "" "" "" "" "" "0" "" "" "" "RP025" "00335440" "" "" "" "1" "" "00000" "{PMID:Huang 2018:29641573}" "" "" "" "" "" "0" "" "" "" "RP086" "00335503" "" "" "" "1" "" "00000" "{PMID:Bernardis 2016:28127548}" "familial case" "" "" "Italy" "" "0" "" "" "" "IRD059" "00335504" "" "" "" "1" "" "00000" "{PMID:Bernardis 2016:28127548}" "" "" "" "Italy" "" "0" "" "" "" "IRD060" "00335505" "" "" "" "1" "" "00000" "{PMID:Bernardis 2016:28127548}" " " "" "" "Italy" "" "0" "" "" "" "IRD041" "00335996" "" "" "" "2" "" "00000" "{PMID:Sergouniotis 2016:27628848}" "analysis 486 cases" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00359324" "" "" "" "1" "" "00000" "{PMID:Khan 2017:27160483}" "see paper" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "5041" "00362910" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2016:26766544}" "family" "" "" "Germany" "" "0" "" "" "" "ARRP83" "00362932" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2016:26766544}" "family" "" "" "Germany" "" "0" "" "" "" "RCD281" "00363474" "" "" "" "1" "" "00000" "{PMID:Ge 2015:26667666}" "simplex case" "" "" "United States" "" "0" "" "" "" "5FP+L.15" "00363586" "" "" "" "1" "" "00000" "{PMID:Patel 2016:26355662}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "09DG00491" "00363587" "" "" "" "1" "" "00000" "{PMID:Patel 2016:26355662}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "09DG00492" "00363601" "" "" "" "1" "" "00000" "{PMID:Patel 2016:26355662}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "09DG01106" "00363642" "" "" "" "1" "" "00000" "{PMID:Patel 2016:26355662}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "11DG0480" "00363663" "" "" "" "1" "" "00000" "{PMID:Patel 2016:26355662}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "11DG1963" "00363691" "" "" "" "1" "" "00000" "{PMID:Patel 2016:26355662}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "12DG0751" "00363708" "" "" "" "1" "" "00000" "{PMID:Patel 2016:26355662}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "12DG1758" "00363717" "" "" "" "1" "" "00000" "{PMID:Patel 2016:26355662}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "12DG2327" "00363743" "" "" "" "1" "" "00000" "{PMID:Patel 2016:26355662}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "13DG2124" "00363746" "" "" "" "1" "" "00000" "{PMID:Patel 2016:26355662}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "14DG0103" "00372456" "" "" "" "1" "" "00000" "{PMID:Wang 2015:26047050}" "index case" "" "" "China" "" "0" "" "" "" "121" "00372457" "" "" "" "1" "" "00000" "{PMID:Wang 2015:26047050}" "index case" "" "" "China" "" "0" "" "" "" "74" "00372493" "" "" "" "1" "" "00000" "{PMID:Wang 2015:26047050}" "index case" "" "" "China" "" "0" "" "" "" "98" "00372496" "" "" "" "1" "" "00000" "{PMID:Wang 2015:26047050}" "index case" "" "" "China" "" "0" "" "" "" "139" "00372666" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "family" "F" "" "China" "" "0" "" "" "" "RP016" "00372707" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "" "" "" "China" "" "0" "" "" "" "RP160" "00373415" "" "" "" "4" "" "00000" "{PMID:Maria 2015:25775262}" "family" "" "yes" "Pakistan" "" "0" "" "" "" "Fam11" "00373924" "" "" "" "1" "" "00000" "{PMID:Consugar 2015:25412400}" "" "" "" "United States" "" "0" "" "" "" "OGI-031-075" "00374974" "" "" "00374972" "1" "" "00000" "{PMID:Sanchez-Alcudia 2014:25342620}" "" "M" "" "Spain" "" "0" "" "" "" "RP-0184PatVI16" "00374975" "" "" "00374972" "1" "" "00000" "{PMID:Sanchez-Alcudia 2014:25342620}" "" "M" "" "Spain" "" "0" "" "" "" "RP-0184PatVI17" "00375318" "" "" "" "1" "" "00000" "{PMID:Oishi 2014:25324289}" "family" "" "" "Japan" "" "0" "" "" "" "K6292" "00375319" "" "" "" "1" "" "00000" "{PMID:Oishi 2014:25324289}" "family" "" "" "Japan" "" "0" "" "" "" "K6131" "00375320" "" "" "" "1" "" "00000" "{PMID:Oishi 2014:25324289}" "family" "" "" "Japan" "" "0" "" "" "" "K6326" "00375423" "" "" "" "1" "" "00000" "{PMID:Katagiri 2014:25268133}" "family" "" "" "Japan" "" "0" "" "" "" "RP#016" "00376297" "" "" "" "1" "" "00000" "{PMID:Avela 2019:18487375}" "" "" "" "Finland" "" "0" "" "" "Finnish" "" "00376298" "" "" "" "1" "" "00000" "{PMID:Avela 2019:18487375}" "" "" "" "Finland" "" "0" "" "" "Finnish" "" "00376481" "" "" "" "1" "" "00000" "{PMID:Seong-2008:18682808}" "" "" "" "Korea" "" "0" "" "" "Koreans" "" "00377262" "" "" "" "1" "" "00000" "Tracewska 2021, MolVis in press" "proband" "F" "no" "Poland" "" "0" "yes" "" "Slavic" "392" "00377513" "" "" "" "1" "" "04521" "{PMID:Hosono 2018:29844330}" "proband, family EYE16" "M" "no" "Japan" "" "0" "" "" "Asian" "EYE16" "00379576" "" "" "" "1" "" "00000" "{PMID:kannabiran-2012:22605927}" "" "M" "" "India" "" "0" "" "" "Indian" "" "00379577" "" "" "" "1" "" "00000" "{PMID:kannabiran-2012:22605927}" "" "M" "" "India" "" "0" "" "" "Indian" "" "00379898" "" "" "" "1" "" "00000" "{PMID:Wang 2018:30029497}" "" "M" "?" "China" "" "0" "" "" "Han Chinese" "2016082413" "00380206" "" "" "" "1" "" "00000" "{PMID:Ezquerra-Inchausti 2018:30337596}" "Family RP57, II:5" "?" "yes" "Spain" "" "0" "" "" "" "II:5" "00380327" "" "" "" "2" "" "00000" "{PMID:Abu-Safieh-2013:23105016}" "# affected:2 (1)" "" "" "Saudi Arabia" "" "0" "" "" "" "" "00380328" "" "" "" "3" "" "00000" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "" "00380329" "" "" "" "3" "" "00000" "{PMID:Abu-Safieh-2013:23105016}" "Failed segregation test" "" "" "Saudi Arabia" "" "0" "" "" "" "" "00380330" "" "" "" "3" "" "00000" "{PMID:Abu-Safieh-2013:23105016}" "olfactory receptor family of proteins are not uncommonly truncated in healthy people" "" "" "Saudi Arabia" "" "0" "" "" "" "" "00380331" "" "" "" "3" "" "00000" "{PMID:Abu-Safieh-2013:23105016}" "Found in Saudi controls  " "" "" "Saudi Arabia" "" "0" "" "" "" "" "00380332" "" "" "" "3" "" "00000" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "" "00380333" "" "" "" "6" "" "00000" "{PMID:Abu-Safieh-2013:23105016}" "# affected:6 (3); No eye phenotype in KO mouse" "" "" "Saudi Arabia" "" "0" "" "" "" "" "00380334" "" "" "" "6" "" "00000" "{PMID:Abu-Safieh-2013:23105016}" "# affected:6 (3); Mutated in Huntington disease" "" "" "Saudi Arabia" "" "0" "" "" "" "" "00380335" "" "" "" "1" "" "00000" "{PMID:Abu-Safieh-2013:23105016}" "Absent in Saudi controls" "" "" "Saudi Arabia" "" "0" "" "" "" "" "00380336" "" "" "" "4" "" "00000" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "" "00380998" "" "" "" "1" "" "00000" "{PMID:Schorderet-2013:23484092}" "" "" "" "Switzerland" "" "0" "" "" "Swiss, Algerian or Tunisian" "" "00381038" "" "" "" "1" "" "00000" "{PMID:Chen-2013:23661368}" "" "M" "" "China" "" "0" "" "" "Chinese" "" "00381048" "" "" "" "1" "" "00000" "{PMID:Chen-2013:23661368}" "" "" "" "China" "" "0" "" "" "Chinese" "" "00381198" "" "" "" "1" "" "00008" "{PMID:Wang-2013:23847139}" "" "" "no" "" "" "0" "" "" "" "" "00381199" "" "" "" "1" "" "00008" "{PMID:Wang-2013:23847139}" "" "" "no" "" "" "0" "" "" "" "" "00381200" "" "" "" "1" "" "00008" "{PMID:Wang-2013:23847139}" "" "" "no" "" "" "0" "" "" "" "" "00381219" "" "" "" "1" "" "00008" "{PMID:Wang-2013:23847139}" "novel LOF mutations" "" "no" "" "" "0" "" "" "" "" "00381220" "" "" "" "1" "" "00008" "{PMID:Wang-2013:23847139}" "novel LOF mutations" "" "no" "" "" "0" "" "" "" "" "00381227" "" "" "" "1" "" "00008" "{PMID:Wang-2013:23847139}" "novel missense mutations" "" "no" "" "" "0" "" "" "" "" "00381228" "" "" "" "1" "" "00008" "{PMID:Wang-2013:23847139}" "novel missense mutations" "" "no" "" "" "0" "" "" "" "" "00381229" "" "" "" "1" "" "00008" "{PMID:Wang-2013:23847139}" "novel missense mutations" "" "no" "" "" "0" "" "" "" "" "00381614" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "M" "no" "Germany" "" "0" "" "" "" "" "00381617" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "F" "yes" "Iran" "" "0" "" "" "" "" "00381618" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "F" "yes" "Iran" "" "0" "" "" "" "" "00381641" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "F" "no" "Germany" "" "0" "" "" "" "" "00381650" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "M" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00381659" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "M" "no" "Saudi Arabia" "" "0" "" "" "" "" "00381661" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "F" "?" "United States" "" "0" "" "" "" "" "00381664" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "F" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00381669" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "F" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00381671" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "M" "?" "Saudi Arabia" "" "0" "" "" "" "" "00381719" "" "" "" "1" "" "00000" "{PMID:Wang-2014:24154662}" "" "" "no" "" "" "0" "" "" "" "" "00382609" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "472" "00382610" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "473" "00382847" "" "" "" "1" "" "00000" "{PMID:Beryozkin-2014:24474277}" "" "" "yes" "" "" "0" "" "" "Druze" "" "00382851" "" "" "" "1" "" "00000" "{PMID:Beryozkin-2014:24474277}" "" "" "yes" "" "" "0" "" "" "Arab-Muslim" "" "00384032" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-1782" "00384110" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-2367" "00384111" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-2380" "00384750" "" "" "" "1" "" "00000" "{PMID:González-del Pozo-2011:22164218}" "" "" "" "" "" "0" "" "" "Spanish" "" "00384779" "" "" "" "1" "" "00000" "{PMID:González-del Pozo-2011:22164218}" "" "" "" "" "" "0" "" "" "Spanish" "" "00384997" "" "" "" "1" "" "00000" "{PMID:Xu 2020:31630094}" "" "?" "yes" "China" "" "0" "" "" "" "19032" "00385033" "" "" "" "1" "" "00000" "{PMID:Xu 2020:31630094}" "" "?" "no" "China" "" "0" "" "" "" "19502" "00386197" "" "" "" "1" "" "00000" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "?" "" "Spain" "" "0" "" "" "" "RPN-315" "00386271" "" "" "" "1" "" "00000" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "?" "" "Spain" "" "0" "" "" "" "RP-1943" "00386281" "" "" "" "1" "" "00000" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "?" "" "Spain" "" "0" "" "" "" "RPN-191" "00386617" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "121-055" "00386662" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "121-260" "00386730" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "OGI2868_004453" "00386858" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "OGI766_001500" "00387078" "" "" "" "1" "" "00000" "{PMID:Jauregui 2020:32098976}" "" "M" "" "(United States)" "" "0" "" "" "Asian" "104" "00387950" "" "" "" "1" "" "00006" "{PMID:Kondo 2004:15557452}" "family, 2 affected" "" "" "Japan" "" "0" "" "" "" "Pat04601" "00388506" "" "" "" "1" "" "00000" "{PMID:Ellingsford 2018:29074561}" "2-generation family, 1 affected, unaffected heterozygous carrier father" "M" "yes" "United Kingdom (Great Britain)" "" "0" "" "" "" "14017670" "00388937" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 77, Leber congenital amaurosis, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "221" "00389102" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 127, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "386" "00389103" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 127, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "387" "00389164" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 145, Leber congenital amaurosis, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "448" "00389165" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 145, Leber congenital amaurosis, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "449" "00389451" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 281, cone-rod dystrophy, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "735" "00389452" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 281, cone-rod dystrophy, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "736" "00389591" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 363, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "875" "00389593" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 365, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "877" "00389748" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 586, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "1032" "00389767" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 640, cone-rod dystrophy, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "1051" "00389938" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 963, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "1222" "00390411" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "G005259" "00391589" "" "" "" "1" "" "00000" "{PMID:Hull 2020:32856788}" "" "?" "" "New Zealand" "" "0" "" "" "white" "88" "00392577" "" "" "" "1" "" "00000" "{PMID:Ma 2021:33691693}" "" "?" "" "Korea" "" "0" "" "" "" "26" "00392593" "" "" "" "1" "" "00000" "{PMID:Ma 2021:33691693}" "" "?" "" "Korea" "" "0" "" "" "" "50" "00393520" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" "" "00393769" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" "" "00393912" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" "" "00394008" "" "" "" "1" "" "00000" "{PMID:Salmaninejad-202:33173045}" "" "" "yes" "" "" "0" "" "" "Iranian" "" "00394370" "" "" "" "1" "" "00000" "{PMID:Thorsteinsson 2021:33851411}" "" "?" "" "Iceland" "" "0" "" "" "" "LCA2" "00394636" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "M" "no" "" "" "0" "" "" "" "" "00394637" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "F" "no" "" "" "0" "" "" "" "" "00395808" "" "" "" "1" "" "00000" "{PMID:Chen 2021:43360855}" "" "?" "" "Taiwan" "" "0" "" "" "" "F039" "00396650" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "M" "" "Japan" "" "0" "" "" "Japanese" "" "00404108" "" "" "" "1" "" "00006" "{PMID:Aldahmesh 2009:19956407}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "DGU-F3" "00404114" "" "" "" "1" "" "00006" "{PMID:Aldahmesh 2009:19956407}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "DGU-F10" "00408301" "" "" "" "1" "" "00000" "{PMID:Lewis 1999:10440267}" "pedigree A, individual VII-16" "M" "yes" "Dominican Republic" "" "0" "" "" "" "A_VII-16" "00408302" "" "" "" "1" "" "00000" "{PMID:Lewis 1999:10440267}" "pedigree A, individual VII-14" "F" "yes" "Dominican Republic" "" "0" "" "" "" "A_VII-14" "00408303" "" "" "" "1" "" "00000" "{PMID:Lewis 1999:10440267}" "pedigree A, individual VII-15" "F" "yes" "Dominican Republic" "" "0" "" "" "" "A_VII-15" "00408304" "" "" "" "1" "" "00000" "{PMID:Lewis 1999:10440267}" "pedigree B, individual VII-1" "F" "yes" "Dominican Republic" "" "0" "" "" "" "B_VII-1" "00408305" "" "" "" "1" "" "00000" "{PMID:Lewis 1999:10440267}" "pedigree A, individual VII-13" "F" "yes" "Dominican Republic" "" "0" "" "" "" "A_VII-13" "00408306" "" "" "" "1" "" "00000" "{PMID:Lewis 1999:10440267}" "pedigree A, individual VII-10" "M" "yes" "Dominican Republic" "" "0" "" "" "" "A_VII-10" "00408307" "" "" "" "1" "" "00000" "{PMID:Lewis 1999:10440267}" "pedigree A, individual VII-12" "F" "yes" "Dominican Republic" "" "0" "" "" "" "A_VII-12" "00408308" "" "" "" "1" "" "00000" "{PMID:Lewis 1999:10440267}" "pedigree A, individual VII-1" "F" "yes" "Dominican Republic" "" "0" "" "" "" "A_VII-1" "00408309" "" "" "" "1" "" "00000" "{PMID:Lewis 1999:10440267}" "pedigree A, individual VII-9" "M" "yes" "Dominican Republic" "" "0" "" "" "" "A_VII-9" "00408310" "" "" "" "1" "" "00000" "{PMID:Lewis 1999:10440267}" "pedigree A, individual VI-2" "F" "yes" "Dominican Republic" "" "0" "" "" "" "A_VI-2" "00408311" "" "" "" "1" "" "00000" "{PMID:Lewis 1999:10440267}" "pedigree B, individual VI-4" "F" "yes" "Dominican Republic" "" "0" "" "" "" "B_VI-4" "00408312" "" "" "" "1" "" "00000" "{PMID:Lewis 1999:10440267}" "pedigree B, individual VI-3" "M" "yes" "Dominican Republic" "" "0" "" "" "" "B_VI-3" "00408313" "" "" "" "1" "" "00000" "{PMID:Lewis 1999:10440267}" "pedigree A, individual VII-6" "M" "yes" "Dominican Republic" "" "0" "" "" "" "A_VII-6" "00408314" "" "" "" "1" "" "00000" "{PMID:Lewis 1999:10440267}" "pedigree A, individual V-6" "F" "yes" "Dominican Republic" "" "0" "" "" "" "A_V-6" "00408315" "" "" "" "1" "" "00000" "{PMID:Lewis 1999:10440267}" "pedigree A, individual V-5" "M" "yes" "Dominican Republic" "" "0" "" "" "" "A_V-5" "00408316" "" "" "" "1" "" "00000" "{PMID:Lewis 1999:10440267}" "pedigree A, individual VI-5" "M" "yes" "Dominican Republic" "" "0" "" "" "" "A_VI-5" "00408323" "" "" "" "1" "" "00000" "{PMID:Roosing 2013:23499059}" "" "M" "no" "Netherlands" "" "0" "" "" "" "Patient 1" "00408324" "" "" "" "1" "" "00000" "{PMID:Roosing 2013:23499059}" "" "M" "yes" "Netherlands" "" "0" "" "" "" "Patient 2" "00408326" "" "" "" "1" "" "00000" "{PMID:Jacobson 2014:25074776}" "sibling of P2" "F" "" "United States" "" "0" "" "" "" "P1" "00408327" "" "" "" "1" "" "00000" "{PMID:Jacobson 2014:25074776}" "sibling of P1" "M" "" "United States" "" "0" "" "" "" "P2" "00408328" "" "" "" "1" "" "00000" "{PMID:Jacobson 2014:25074776}" "" "F" "" "United States" "" "0" "" "" "" "P3" "00408329" "" "" "" "1" "" "00000" "{PMID:Jacobson 2014:25074776}" "" "M" "" "United States" "" "0" "" "" "" "P4" "00408330" "" "" "" "1" "" "00000" "{PMID:Jacobson 2014:25074776}" "" "F" "" "United States" "" "0" "" "" "" "P5" "00408331" "" "" "" "1" "" "00000" "{PMID:Jacobson 2014:25074776}" "" "M" "" "United States" "" "0" "" "" "" "P6" "00408362" "" "" "" "1" "" "00000" "{PMID:Guo 2015:24547928}" "parents first cousins" "F" "yes" "Australia" "" "0" "" "" "Italian" "II-3" "00408364" "" "" "" "1" "" "00000" "{PMID:Khan 2015:25342276}" "sibling of 2; retrospective consecutive case series" "M" "" "Saudi Arabia" "" "0" "" "" "" "1" "00408365" "" "" "" "1" "" "00000" "{PMID:Khan 2015:25342276}" "sibling of 1; retrospective consecutive case series" "F" "" "Saudi Arabia" "" "0" "" "" "" "2" "00408366" "" "" "" "1" "" "00000" "{PMID:Khan 2015:25342276}" "retrospective consecutive case series" "F" "" "Saudi Arabia" "" "0" "" "" "" "3" "00408367" "" "" "" "1" "" "00000" "{PMID:Khan 2015:25342276}" "retrospective consecutive case series" "F" "" "Saudi Arabia" "" "0" "" "" "" "4" "00408368" "" "" "" "1" "" "00000" "{PMID:Khan 2015:25342276}" "retrospective consecutive case series" "F" "" "Saudi Arabia" "" "0" "" "" "" "5" "00408369" "" "" "" "1" "" "00000" "{PMID:Khan 2015:25342276}" "retrospective consecutive case series" "F" "" "Saudi Arabia" "" "0" "" "" "" "6" "00408370" "" "" "" "1" "" "00000" "{PMID:Khan 2015:25342276}" "sibling of 8; retrospective consecutive case series" "M" "" "Saudi Arabia" "" "0" "" "" "" "7" "00408371" "" "" "" "1" "" "00000" "{PMID:Khan 2015:25342276}" "sibling of 7; retrospective consecutive case series" "M" "" "Saudi Arabia" "" "0" "" "" "" "8" "00408372" "" "" "" "1" "" "00000" "{PMID:Khan 2015:25342276}" "retrospective consecutive case series" "F" "" "Saudi Arabia" "" "0" "" "" "" "9" "00408373" "" "" "" "1" "" "00000" "{PMID:Khan 2015:25342276}" "retrospective consecutive case series" "F" "" "Saudi Arabia" "" "0" "" "" "" "10" "00408374" "" "" "" "1" "" "00000" "{PMID:Ullah 2016:27440997}" "family PKRP259 , individual 10" "M" "" "Pakistan" "" "0" "" "" "" "PKRP259 _10" "00408375" "" "" "" "1" "" "00000" "{PMID:Ullah 2016:27440997}" "family PKRP259 , individual 15" "M" "" "Pakistan" "" "0" "" "" "" "PKRP259 _15" "00408376" "" "" "" "1" "" "00000" "{PMID:Ullah 2016:27440997}" "family PKRP268 , individual 12" "M" "" "Pakistan" "" "0" "" "" "" "PKRP268 _12" "00408377" "" "" "" "1" "" "00000" "{PMID:Ullah 2016:27440997}" "family PKRP268 , individual 13" "F" "" "Pakistan" "" "0" "" "" "" "PKRP268 _13" "00408378" "" "" "" "1" "" "00000" "{PMID:Ullah 2016:27440997}" "family PKRP301 , individual 14" "M" "" "Pakistan" "" "0" "" "" "" "PKRP301 _14" "00408379" "" "" "" "1" "" "00000" "{PMID:Ullah 2016:27440997}" "family PKRP301 , individual 17" "F" "" "Pakistan" "" "0" "" "" "" "PKRP301 _17" "00408380" "" "" "" "1" "" "00000" "{PMID:Ullah 2016:27440997}" "family PKRP309 , individual 11" "F" "" "Pakistan" "" "0" "" "" "" "PKRP309 _11" "00408381" "" "" "" "1" "" "00000" "{PMID:Ullah 2016:27440997}" "family PKRP309 , individual 15" "F" "" "Pakistan" "" "0" "" "" "" "PKRP309 _15" "00408382" "" "" "" "1" "" "00000" "{PMID:Ullah 2016:27440997}" "family PKRP356 , individual 10" "F" "" "Pakistan" "" "0" "" "" "" "PKRP356 _10" "00408383" "" "" "" "1" "" "00000" "{PMID:Ullah 2016:27440997}" "family PKRP356 , individual 12" "F" "" "Pakistan" "" "0" "" "" "" "PKRP356 _12" "00408384" "" "" "" "1" "" "00000" "{PMID:Ullah 2016:27440997}" "family PKRP364 , individual 10" "M" "" "Pakistan" "" "0" "" "" "" "PKRP364 _10" "00408385" "" "" "" "1" "" "00000" "{PMID:Ullah 2016:27440997}" "family PKRP364 , individual 20" "M" "" "Pakistan" "" "0" "" "" "" "PKRP364 _20" "00408386" "" "" "" "1" "" "00000" "{PMID:Ullah 2016:27440997}" "family PKRP367 , individual 11" "M" "" "Pakistan" "" "0" "" "" "" "PKRP367 _11" "00408387" "" "" "" "1" "" "00000" "{PMID:Ullah 2016:27440997}" "family PKRP367 , individual 12" "M" "" "Pakistan" "" "0" "" "" "" "PKRP367 _12" "00408388" "" "" "" "1" "" "00000" "{PMID:Souzeau 2018:30090012}" "" "F" "no" "" "" "0" "" "" "Italian" "?" "00408397" "" "" "" "1" "" "00000" "{PMID:Verbakel 2019:30950243}" "" "M" "" "Netherlands" "" "0" "" "" "" "?" "00408398" "" "" "" "1" "" "00000" "{PMID:Verbakel 2019:30950243}" "" "F" "" "Netherlands" "" "0" "" "" "" "?" "00408424" "" "" "" "1" "" "00000" "{PMID:Avela 2019:31087526}" "Family 16, invidivual a" "?" "" "Finland" "" "0" "" "" "" "16a" "00408425" "" "" "" "1" "" "00000" "{PMID:Avela 2019:31087526}" "Family 16, invidivual b" "?" "" "Finland" "" "0" "" "" "" "16b" "00411338" "" "" "" "2" "" "04333" "{PMID:Sharon 2020:31456290}, {PMID:Ben Yosef 2023:37287645}" "family, 2 affected" "M" "no" "Israel" "" "0" "" "" "Ethiopia;Jew" "Fam13Pat1" "00411339" "" "" "00411338" "1" "" "04333" "{PMID:Sharon 2020:31456290}, {PMID:Ben Yosef 2023:37287645}" "sib" "M" "no" "Israel" "" "0" "" "" "Ethiopia;Jew" "Fam13Pat2" "00411340" "" "" "" "2" "" "04333" "{PMID:Sharon 2020:31456290}, {PMID:Ben Yosef 2023:37287645}" "family, 2 affected" "F" "no" "Israel" "" "0" "" "" "Ethiopia;Jew" "Fam14Pat1" "00411341" "" "" "00411340" "1" "" "04333" "{PMID:Sharon 2020:31456290}, {PMID:Ben Yosef 2023:37287645}" "sib" "M" "no" "Israel" "" "0" "" "" "Ethiopia;Jew" "Fam14Pat2" "00420419" "" "" "" "1" "" "00000" "{PMID:Chen 2021:33608557}" "" "" "" "Taiwan" "" "0" "" "" "" "F039" "00427828" "" "" "" "1" "" "01164" "" "" "F" "no" "Germany" "" "0" "" "" "" "188460" "00429556" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00429560" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00429664" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00429707" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00429738" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00429756" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00429817" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00429819" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00429896" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00429985" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00430143" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00446973" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "F" "" "Germany" "" "0" "" "" "" "ARRP-380" "00447005" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "F" "" "Germany" "" "0" "" "" "" "ARRP-464" "00447276" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "F" "" "Germany" "" "0" "" "" "" "SRP-1146" "00447298" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "M" "" "Germany" "" "0" "" "" "" "SRP-1199" "00447500" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "F" "" "Germany" "" "0" "" "" "" "ARRP-417" "00447534" "" "" "" "2" "" "00006" "{PMID:Weisschuh 2024:37734845}" "family, 2 affected" "M" "" "Germany" "" "0" "" "" "" "CRD-781" "00447696" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "M" "" "Germany" "" "0" "" "" "" "SRP-368" "00447725" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "F" "" "Germany" "" "0" "" "" "" "UD-105" "00451026" "" "" "" "1" "" "04405" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "" "" "0" "" "" "" "071992" "00451027" "" "" "" "1" "" "04405" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "M" "" "" "" "0" "" "" "" "072817" "00451028" "" "" "" "1" "" "04405" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "M" "" "" "" "0" "" "" "" "073081" "00451029" "" "" "" "1" "" "04405" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "M" "" "" "" "0" "" "" "" "DNA12-12851" "00451068" "" "" "" "1" "" "00006" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "" "" "0" "" "" "" "066836" "00451251" "" "" "" "1" "" "00006" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "" "" "0" "" "" "" "072852" "00451544" "" "" "" "2" "" "04543" "{PMID:Basharat 2024:38815792}" "5-generation family, 2 affected (F, M)" "M" "yes" "Pakistan" "" "0" "" "" "" "FamEPatIV1" "00451545" "" "" "00451544" "1" "" "04543" "{PMID:Basharat 2024:38815792}" "daughter" "F" "yes" "Pakistan" "" "0" "" "" "" "FamEPatV1" "00451553" "" "" "00451549" "1" "" "04543" "{PMID:Basharat 2024:38815792}" "relative" "F" "yes" "Pakistan" "" "0" "" "" "" "FamGPatV1" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 396 "{{individualid}}" "{{diseaseid}}" "00001812" "00112" "00014444" "00312" "00014468" "00312" "00087824" "04211" "00087825" "04211" "00087826" "03460" "00087828" "04211" "00087829" "04214" "00087830" "04211" "00087831" "04214" "00087832" "04214" "00087833" "03460" "00087834" "03460" "00087836" "04214" "00087838" "04214" "00087839" "04214" "00087840" "04214" "00087842" "03460" "00087844" "04210" "00087845" "04210" "00087846" "04210" "00087847" "04210" "00087848" "04210" "00087849" "04210" "00087850" "04210" "00087851" "04210" "00087852" "04210" "00087853" "04210" "00087854" "04210" "00087855" "04210" "00087856" "04210" "00087857" "04210" "00087858" "04210" "00087859" "04210" "00087860" "04210" "00087861" "04210" "00087862" "04210" "00087863" "04210" "00087864" "04210" "00087865" "04210" "00087866" "04210" "00087867" "04210" "00087868" "04210" "00087869" "04210" "00087870" "04210" "00087871" "04210" "00087872" "04210" "00087873" "04210" "00087874" "04210" "00087875" "04210" "00087876" "04211" "00087877" "04211" "00087878" "03460" "00087879" "04211" "00087880" "04211" "00087881" "03460" "00087882" "04211" "00087883" "04211" "00087884" "04211" "00087885" "04211" "00087886" "04210" "00087887" "04211" "00087888" "04211" "00087889" "04211" "00087890" "04211" "00087891" "04211" "00087892" "04211" "00087893" "04211" "00087894" "04214" "00087895" "03460" "00087896" "04211" "00087897" "00198" "00087898" "00198" "00087899" "04211" "00087900" "04211" "00087903" "04214" "00087904" "03460" "00087905" "04211" "00087906" "04211" "00087907" "04211" "00087908" "04211" "00087909" "04211" "00087910" "04211" "00087911" "04211" "00087912" "04211" "00087913" "04211" "00087914" "04211" "00087915" "04211" "00087916" "04211" "00087917" "04211" "00087918" "04211" "00087919" "04211" "00087920" "04211" "00087921" "04211" "00087922" "04211" "00087923" "04211" "00087924" "04211" "00087925" "04211" "00087926" "04211" "00087927" "04211" "00087928" "04211" "00087929" "04211" "00087930" "04211" "00087933" "04211" "00087934" "04211" "00087935" "04211" "00087936" "04211" "00087937" "04211" "00087938" "04211" "00087939" "04211" "00087940" "04211" "00087941" "04211" "00087942" "04211" "00087944" "04211" "00087945" "04210" "00087946" "04210" "00087947" "04210" "00087948" "04210" "00087949" "04210" "00087950" "04210" "00087951" "04210" "00088083" "04211" "00095953" "04214" "00100071" "04214" "00100075" "04214" "00100081" "04214" "00100113" "04214" "00100115" "04214" "00155558" "04210" "00155559" "04210" "00155560" "04210" "00207679" "04210" "00207695" "04210" "00232668" "04214" "00232669" "04214" "00232670" "04214" "00232671" "04214" "00232672" "04214" "00232673" "04214" "00232674" "04214" "00232675" "04214" "00232676" "04214" "00232677" "04214" "00232678" "04214" "00232679" "04214" "00232680" "04214" "00232681" "04214" "00232682" "04214" "00233684" "04214" "00233685" "04214" "00233686" "04214" "00240463" "00381" "00244507" "00198" "00245770" "04214" "00265883" "00198" "00294093" "00198" "00294094" "00198" "00308415" "04214" "00308570" "04214" "00308625" "04214" "00309442" "04214" "00309443" "04214" "00309444" "04214" "00309445" "04214" "00309446" "04214" "00309447" "04214" "00309448" "04214" "00309450" "04214" "00309451" "04214" "00309630" "04214" "00309670" "04214" "00325439" "04214" "00326694" "04214" "00331619" "05086" "00332356" "04214" "00332357" "04214" "00332467" "04214" "00332505" "04214" "00332545" "04214" "00333861" "04214" "00334564" "04214" "00334883" "04214" "00334885" "04214" "00334893" "04214" "00334894" "04214" "00335419" "04214" "00335440" "04214" "00335503" "04214" "00335504" "04214" "00335505" "04214" "00335996" "04214" "00359324" "04214" "00362910" "04214" "00362932" "04214" "00363474" "04214" "00363586" "04214" "00363587" "04214" "00363601" "04214" "00363642" "04214" "00363663" "04214" "00363691" "04214" "00363708" "04214" "00363717" "04214" "00363743" "04214" "00363746" "04214" "00372456" "04214" "00372457" "04214" "00372493" "04214" "00372496" "04214" "00372666" "04214" "00372707" "04214" "00373415" "04214" "00373924" "04214" "00374974" "04214" "00374975" "04214" "00375318" "04214" "00375319" "04214" "00375320" "04214" "00375423" "04214" "00376297" "04214" "00376298" "04214" "00376481" "04214" "00377262" "04214" "00377513" "04214" "00379576" "04214" "00379577" "04214" "00379898" "04214" "00380206" "04214" "00380327" "04214" "00380328" "04214" "00380329" "04214" "00380330" "04214" "00380331" "04214" "00380332" "04214" "00380333" "04214" "00380334" "04214" "00380335" "04214" "00380336" "04214" "00380998" "04214" "00381038" "04214" "00381048" "04214" "00381198" "04214" "00381199" "04214" "00381200" "04214" "00381219" "04214" "00381220" "04214" "00381227" "04214" "00381228" "04214" "00381229" "04214" "00381614" "04214" "00381617" "04214" "00381618" "04214" "00381641" "04214" "00381650" "04214" "00381659" "04214" "00381661" "04214" "00381664" "04214" "00381669" "04214" "00381671" "04214" "00381719" "04214" "00382609" "04214" "00382610" "04214" "00382847" "04214" "00382851" "04214" "00384032" "04214" "00384110" "04214" "00384111" "04214" "00384750" "04214" "00384779" "04214" "00384997" "04214" "00385033" "04214" "00386197" "04214" "00386271" "04214" "00386281" "04214" "00386617" "04214" "00386662" "04214" "00386730" "04214" "00386858" "04214" "00387078" "04214" "00387950" "04214" "00388506" "04214" "00388937" "04214" "00389102" "04214" "00389103" "04214" "00389164" "04214" "00389165" "04214" "00389451" "04214" "00389452" "04214" "00389591" "04214" "00389593" "04214" "00389748" "04214" "00389767" "04214" "00389938" "04214" "00390411" "04214" "00391589" "04214" "00392577" "04214" "00392593" "04214" "00393520" "04214" "00393769" "04214" "00393912" "04214" "00394008" "04214" "00394370" "04214" "00394636" "04214" "00394637" "04214" "00395808" "04214" "00396650" "04214" "00404108" "04214" "00404114" "04214" "00408301" "04214" "00408302" "04214" "00408303" "04214" "00408304" "04214" "00408305" "04214" "00408306" "04214" "00408307" "04214" "00408308" "04214" "00408309" "04214" "00408310" "04214" "00408311" "04214" "00408312" "04214" "00408313" "04214" "00408314" "04214" "00408315" "04214" "00408316" "04214" "00408323" "04214" "00408324" "04214" "00408326" "04214" "00408327" "04214" "00408328" "04214" "00408329" "04214" "00408330" "04214" "00408331" "04214" "00408362" "04214" "00408364" "04214" "00408365" "04214" "00408366" "04214" "00408367" "04214" "00408368" "04214" "00408369" "04214" "00408370" "04214" "00408371" "04214" "00408372" "04214" "00408373" "04214" "00408374" "04214" "00408375" "04214" "00408376" "04214" "00408377" "04214" "00408378" "04214" "00408379" "04214" "00408380" "04214" "00408381" "04214" "00408382" "04214" "00408383" "04214" "00408384" "04214" "00408385" "04214" "00408386" "04214" "00408387" "04214" "00408388" "04214" "00408397" "04214" "00408398" "04214" "00408424" "04214" "00408425" "04214" "00411338" "03460" "00411339" "03460" "00411340" "03460" "00411341" "03460" "00420419" "04214" "00427828" "02289" "00429556" "00112" "00429560" "00112" "00429664" "04214" "00429707" "00112" "00429738" "00112" "00429756" "00112" "00429817" "00112" "00429819" "00112" "00429896" "04210" "00429985" "04210" "00430143" "04210" "00446973" "00198" "00447005" "00198" "00447276" "00198" "00447298" "00198" "00447500" "00198" "00447534" "00198" "00447696" "00198" "00447725" "00198" "00451026" "04249" "00451027" "04249" "00451028" "04249" "00451029" "04249" "00451068" "04249" "00451251" "04249" "00451544" "00198" "00451545" "00198" "00451553" "00198" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00112, 00198, 00312, 00381, 02289, 03460, 04210, 04211, 04214, 04249, 05086 ## Count = 366 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Cysts}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Eye/Retina}}" "{{Phenotype/Neoplasm}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000013131" "00312" "00014444" "00640" "Unknown" "" "?" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000013155" "00312" "00014468" "00100" "Unknown" "" "no additional phenotype data available" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067355" "04211" "00087824" "00234" "Familial, autosomal recessive" "" "" "31y" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067356" "04211" "00087825" "00234" "Familial, autosomal recessive" "" "" "?" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067357" "03460" "00087826" "00234" "Unknown" "" "Congenital nystagmus,no or verypoor ocular pursuit,digito-ocular signs of franceschetti attesting of profoundly impaired vision,no recordable erg since birth or the first months of life" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067358" "04211" "00087828" "00234" "Familial, autosomal recessive" "" "" "?" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067359" "04214" "00087829" "00234" "Unknown" "" "" "?" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067360" "04211" "00087830" "00234" "Familial, autosomal recessive" "" "" "3y" "" "Poor dark adaptation, Visual field defects and Color vision alterations,Visual field constriction and visual acuity impairment" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067361" "04214" "00087831" "00234" "Familial, autosomal recessive" "" "" "?" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067362" "04214" "00087832" "00234" "Familial, autosomal recessive" "" "" "?" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067363" "03460" "00087833" "00234" "Familial, autosomal recessive" "" "Mild temporal pallor annular ring : yellow perifoveal," "7y" "" "Night Blindness, Nystagmus, small headturn, Visual impairment" "" "" "" "" "" "" "" "" "" "" "" "0000067364" "03460" "00087834" "00234" "Familial, autosomal recessive" "" "Mild temporal pallor annular ring : yellow perifoveal," "1y6m" "" "Night Blindness, Nystagmus, small headturn, Visual impairment" "" "" "" "" "" "" "" "" "" "" "" "0000067365" "04214" "00087836" "00234" "Unknown" "" "" "?" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067366" "04214" "00087838" "00234" "Unknown" "" "" "?" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067367" "04214" "00087839" "00234" "Unknown" "" "" "?" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067368" "04214" "00087840" "00234" "Unknown" "" "" "?" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067369" "03460" "00087842" "00234" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067370" "04210" "00087844" "00234" "Familial, autosomal recessive" "" "Poor vision, nystagmus, hyperopic, vessel attenuation; diminished foveal and ilm macularreflexivities" "?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067371" "04210" "00087845" "00234" "Familial, autosomal recessive" "" "Atrophic macula with fovea spared; bone spicules in the mid periphery; unstablenystagmus; peripheral cortical cuneiform spokes." "?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067372" "04210" "00087846" "00234" "Familial, autosomal recessive" "" "Irregular coarse nystagmus; hyperopic astigmatism; nystagmus; vertically oval discs" "?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067373" "04210" "00087847" "00234" "Familial, autosomal recessive" "" "“rp” with macula spared" "?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067374" "04210" "00087848" "00234" "Familial, autosomal recessive" "" "Disc elevation,macula spared,minimal vascular attenuation,sandy peripheral depigmentation,vision cf,horizontal nystagmus,small posterior subcapsular cataracts,vitreous syneresis and cells,midperipheral bone spicules" "?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067375" "04210" "00087849" "00234" "Familial, autosomal recessive" "" "Disc elevation,macula spared,minimal vascular attenuation,sandy peripheral depigmentation,vision cf,horizontal nystagmus,small posterior subcapsular cataracts,vitreous syneresis and cells,midperipheral bone spicules" "?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067376" "04210" "00087850" "00234" "Familial, autosomal recessive" "" "Nystagmus,minimal disc pallor,full discs,sandy granular rpe periphery" "?" "" "Nystagmus" "" "" "" "" "" "" "" "" "" "" "" "0000067377" "04210" "00087851" "00234" "Familial, autosomal recessive" "" "Pale discs,3/4 vessel attenuation,full “pseudo-papilledema” discs,fine bone spicules" "?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067378" "04210" "00087852" "00234" "Familial, autosomal recessive" "" "Small round pale discs; bone spicules in mid-periphery; vessel attenuation." "?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067379" "04210" "00087853" "00234" "Familial, autosomal recessive" "" "2 pallor of discs; 2 vessel attenuation; fine bone spicule in mid periphery; pvd ou;erg nonrecordable." "?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067380" "04210" "00087854" "00234" "Familial, autosomal recessive" "" "5 d hyperopic; vertically oval discs; 2 pink pallor; slight elevation; 2 vesselattenuation; fine mid-peripheral bone spicules beyond the arcade" "?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067381" "04210" "00087855" "00234" "Familial, autosomal recessive" "" "Nystagmus; poor vision to cf ou; disc hyperemia and temporal pallor; vessels mildlyattenuated; bone spicules in midperiphery; ct normal; ekg normal; erg nonrecordable" "?" "" "Nystagmus" "" "" "" "" "" "" "" "" "" "" "" "0000067382" "04210" "00087856" "00234" "Familial, autosomal recessive" "" "Jerk nystagmus; vision “follows objects poorly”; pseudopapilledema; ct normal; ekgnormal; erg nonrecordable; attenuated vessels; slightly pale discs" "?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067383" "04210" "00087857" "00234" "Familial, autosomal recessive" "" "Fundus shows “rp“" "?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067384" "04210" "00087858" "00234" "Familial, autosomal recessive" "" "No features of deafness, neurologic impairment or mental deficiency; normal ekg; ct scannormal; erg nonrecordable; fundus shows pigmentary retinopathy with attenuated vessels" "?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067385" "04210" "00087859" "00234" "Familial, autosomal recessive" "" "Erg nonrecordable; compound hyperopic astigmatism; diffuse optic nerve pallorattenuated vessels and rpe granularity; pendular nystagmus" "?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067386" "04210" "00087860" "00234" "Familial, autosomal recessive" "" "Irregular horizontal nystagmus; mild horizontal head titubation; onset at age 6 months;hyperopia 4.00d; erg nonrecordable; 2 disc pallor; mild vascular attenuation;atrophic foveal light reflexes; minimal rpe degeneration" "?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067387" "04210" "00087861" "00234" "Familial, autosomal recessive" "" "High hyperopia ou: 7.00 2.25 90;fundus periphery shows confluent outer retinal peripheral whitening and patchy dots at the posterior edge distantly similar to fundus albipunctatus" "?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067388" "04210" "00087862" "00234" "Familial, autosomal recessive" "" "Rotatory nystagmus; vertically oval discs; rosy pale discs; vascular attenuation; diffusepigmentary degeneration" "?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067389" "04210" "00087863" "00234" "Familial, autosomal recessive" "" "Microrotatory nystagmus; discs, vessels, and pigment same as sister" "?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067390" "04210" "00087864" "00234" "Familial, autosomal recessive" "" "Microrotatory nystagmus; rosy orange discs; 2–3 vessel attenuation; diffuse pigmentarychanges without bone spicules" "?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067391" "04210" "00087865" "00234" "Familial, autosomal recessive" "" "Rotatory nystagmus; high hyperopia 5.50 1.50 90 ou; full elevated discs; 1–2vessel attenuation; periphery brown grainy rpe; erg nonrecordable" "?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067392" "04210" "00087866" "00234" "Familial, autosomal recessive" "" "8.25 hyperopic; minimal end-gaze nystagmus; macula normal; anterior to equatorconfluent outer retinal whitening" "?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067393" "04210" "00087867" "00234" "Familial, autosomal recessive" "" "Rotatory nystagmus; rosy flat vertically oval discs; 1 vessel attenuation; fine midperipheralbone spicules" "?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067394" "04210" "00087868" "00234" "Familial, autosomal recessive" "" "Rotatory nystagmus; flat rosy discs; 1 vessel attenuation; absent fovea and umbo; greybrownperipheral rpe." "?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067395" "04210" "00087869" "00234" "Familial, autosomal recessive" "" "Rotatory nystagmus; 1 elevated discs; 1 vessel attenuation; dirty brown peripheralgranular rpe." "?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067396" "04210" "00087870" "00234" "Familial, autosomal recessive" "" "Rotatory nystagmus; minimal hyperopia; rosy pale discs; typical rp in periphery." "?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067397" "04210" "00087871" "00234" "Familial, autosomal recessive" "" "30 diopter xt; rotatory nystagmus; 4.00 d hyperopia; vascular attenuation, modest bonespicule midperiphery ou; 6.00 0,74 180 ou" "?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067398" "04210" "00087872" "00234" "Familial, autosomal recessive" "" "Rotatory nystagmus; flat discs; vascular attenuation; midperipheral bone spicules." "?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067399" "04210" "00087873" "00234" "Familial, autosomal recessive" "" "Rotatory nystagmus; 4-prism diopter xt; sluggish pupils; 2/4 vascular attenuation; ratebone spicules in periphery; 3.50 sphere hyperopia" "?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067400" "04210" "00087874" "00234" "Familial, autosomal recessive" "" "Microrotatory nystagmus; 3.50 sph hyperopia; pvd and vitreous condensation ou;vascular attenuation; equatorial and peripheral dense pigmentary rp-like degeneration ou." "?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067401" "04210" "00087875" "00234" "Familial, autosomal recessive" "" "Microrotatory nystagmus; full elevated discs with grey corona; far peripheral retina shows confluent grey-white belt" "?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067402" "04211" "00087876" "00234" "Familial, autosomal recessive" "" "Bilateral macular atrophy,pigment deposits in retinal periphery,attenuated retinal vessels and pale optic disks" "54y" "" "night blindness and visual field defects" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067403" "04211" "00087877" "00234" "Familial, autosomal recessive" "" "Disorganized aspect, many bone spicule-shaped yellowish pigment deposits in mid periphery , visible retinal vessels and waxy optic disks" "42y" "" "night blindness and visual field defects" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067404" "03460" "00087878" "00234" "Familial, autosomal recessive" "" "Mild attenuation, rpe mottling, withround, atrophiclesions of the rpe with bone spicules" "3y" "" "Night Blindness, Nystagmus, exotropia" "" "" "" "" "" "" "" "" "" "" "" "0000067405" "04211" "00087879" "00234" "Familial, autosomal recessive" "" "Rpe degeneration, arterial narrowing, pigmentary deposits and disc pallor, cellophane reflexes" "1y" "" "Decreased day and night vision, decreased night mobility" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067406" "04211" "00087880" "00234" "Familial, autosomal recessive" "" "Rpe degeneration, arterial narrowing, pigmentary deposits and disc pallor, cellophane reflexes" "8y" "" "Decreased day and night vision, decreased night mobility" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067407" "03460" "00087881" "00234" "Isolated (sporadic)" "" "Congenital nystagmus, no or verypoor ocular pursuit, digito-ocular signs of franceschetti attesting of profoundly impaired vision, and no recordableerg since birth or the first months of life." "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067408" "04211" "00087882" "00234" "Familial, autosomal recessive" "" "Attenuated retinal vessels, pigment deposit" "?" "" "Night Blindness,Progressive loss of Peripheral Vision,Decrease Visual Acuity" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067409" "04211" "00087883" "00234" "Familial, autosomal recessive" "" "Attenuated retinal vessels, pigment deposit" "?" "" "Night Blindness,Progressive loss of Peripheral Vision,Decrease Visual Acuity" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067410" "04211" "00087884" "00234" "Familial, autosomal recessive" "" "Attenuated retinal vessels, pigment deposit" "?" "" "Night Blindness,Progressive loss of Peripheral Vision,Decrease Visual Acuity" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067411" "04211" "00087885" "00234" "Familial, autosomal recessive" "" "Attenuated retinal vessels, pigment deposit" "?" "" "Night Blindness,Progressive loss of Peripheral Vision,Decrease Visual Acuity" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067412" "04210" "00087886" "00234" "Familial, autosomal recessive" "" "Bone spicules absent" "?" "" "?" "" "" "" "" "" "" "" "" "" "" "" "0000067413" "04211" "00087887" "00234" "Familial, autosomal recessive" "" "Attenuated retinal vessels, pigment deposit,waxy pale appearnace of optic disc,yellow perifoveal annnular ring" "" "" "Loss of Night and Daytime Vision" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067414" "04211" "00087888" "00234" "Familial, autosomal recessive" "" "Attenuated retinal vessels, pigment deposit,waxy pale appearnace of optic disc,yellow perifoveal annnular ring,bone spicules absent" "?" "" "Night Blindness,Progressive loss of Peripheral Vision,Decrease Visual Acuity" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067415" "04211" "00087889" "00234" "Familial, autosomal recessive" "" "Attenuated retinal vessels, pigment deposit,waxy pale appearnace of optic disc,yellow perifoveal annnular ring,bone spicules absent" "?" "" "Night Blindness,Progressive loss of Peripheral Vision,Decrease Visual Acuity" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067416" "04211" "00087890" "00234" "Familial, autosomal recessive" "" "Attenuated retinal vessels, pigment deposit,waxy pale appearnace of optic disc,yellow perifoveal annnular ring,bone spicules absent" "?" "" "Night Blindness,Progressive loss of Peripheral Vision,Decrease Visual Acuity" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067417" "04211" "00087891" "00234" "Familial, autosomal recessive" "" "Attenuated retinal vessels, pigment deposit,waxy pale appearnace of optic disc,yellow perifoveal annnular ring,bone spicules absent" "?" "" "Night Blindness,Progressive loss of Peripheral Vision,Decrease Visual Acuity" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067418" "04211" "00087892" "00234" "Familial, autosomal recessive" "" "Attenuated retinal vessels, minimal pigmented retinopathy with temporal disc pallor and annuli of yellow deposits on the macula, bulles eye appearance of macula, myopia" "20y" "" "Show myopic refractive errors,Poor dark adaptation, Visual field defect." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067419" "04211" "00087893" "00234" "Familial, autosomal recessive" "" "Attenuated retinal vessels, minimal pigmented retinopathy with temporal disc pallor and annuli of yellow deposits on the macula, bulles eye appearance of macula, myopia" "?" "" "Show myopic refractive errors,Poor dark adaptation, Visual field defect." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067420" "04214" "00087894" "00234" "Familial, autosomal recessive" "" "" "?" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067421" "03460" "00087895" "00234" "Isolated (sporadic)" "" "Congenital nystagmus, no or verypoor ocular pursuit, digito-ocular signs of franceschetti attesting of profoundly impaired vision, and no recordableerg since birth or the first months of life." "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067422" "04211" "00087896" "00234" "Familial, autosomal recessive" "" "Macular degeneration,pigment migration, bone–corpuscular pigmentation, vitreous opacities and vitreous pigments,diffuse disc pallor" "22y" "" "Night Blindness, Progressive reduce Vision" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067423" "00198" "00087897" "00234" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067424" "00198" "00087898" "00234" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067425" "04211" "00087899" "00234" "Familial, autosomal recessive" "" "" "31y" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067426" "04211" "00087900" "00234" "Familial, autosomal recessive" "" "" "?" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067427" "04214" "00087903" "00234" "Familial, autosomal recessive" "" "" "?" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067428" "03460" "00087904" "00234" "Familial, autosomal recessive" "" "Arteriolar attenuation, nyctalopia, photoaversion,head bobbing, and side and central visual difficulties" "2y" "" "Night Blindness, Nystagmus, nyctalopia, photoaversion,head bobbing, and side and central visual difficulties" "" "" "" "" "" "" "" "" "" "" "" "0000067429" "04211" "00087905" "00234" "Familial, autosomal recessive" "" "Nustagmus,low visual acuity,nyclatopia, retinal dystrophy" "?" "" "Nystagmus, low visual acquity,nyclatopic since infancy" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067430" "04211" "00087906" "00234" "Familial, autosomal recessive" "" "Nustagmus,low visual acuity,nyclatopia, retinal dystrophy" "?" "" "Nystagmus, low visual acquity,nyclatopic since infancy" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067431" "04211" "00087907" "00234" "Familial, autosomal recessive" "" "Nustagmus,low visual acuity,nyclatopia, retinal dystrophy" "?" "" "Nystagmus, low visual acquity,nyclatopic since infancy" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067432" "04211" "00087908" "00234" "Familial, autosomal recessive" "" "Nustagmus,low visual acuity,nyclatopia, retinal dystrophy" "?" "" "Nystagmus, low visual acquity,nyclatopic since infancy" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067433" "04211" "00087909" "00234" "Familial, autosomal recessive" "" "Nustagmus,low visual acuity,nyclatopia, retinal dystrophy" "?" "" "Nystagmus, low visual acquity,nyclatopic since infancy" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067434" "04211" "00087910" "00234" "Familial, autosomal recessive" "" "Incomplete ring formation, bone spicules absent" "19y" "" "Loss of Night and Daytime Vision" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067435" "04211" "00087911" "00234" "Familial, autosomal recessive" "" "Artery attenuation, pigment deposit, and pale optic disc" "?" "" "Night Blindness,Progressive loss of Peripheral Vision,Decrease Visual Acuity" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067436" "04211" "00087912" "00234" "Familial, autosomal recessive" "" "Artery attenuation, pigment deposit, and pale optic disc" "?" "" "Night Blindness,Progressive loss of Peripheral Vision,Decrease Visual Acuity" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067437" "04211" "00087913" "00234" "Familial, autosomal recessive" "" "Artery attenuation, pigment deposit, and pale optic disc" "?" "" "Night Blindness,Progressive loss of Peripheral Vision,Decrease Visual Acuity" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067438" "04211" "00087914" "00234" "Familial, autosomal recessive" "" "Artery attenuation, pigment deposit, and pale optic disc" "?" "" "Night Blindness,Progressive loss of Peripheral Vision,Decrease Visual Acuity" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067439" "04211" "00087915" "00234" "Familial, autosomal recessive" "" "Artery attenuation, pigment deposit, and pale optic disc" "?" "" "Night Blindness,Progressive loss of Peripheral Vision,Decrease Visual Acuity" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067440" "04211" "00087916" "00234" "Familial, autosomal recessive" "" "Artery attenuation, pigment deposit, and pale optic disc" "?" "" "Night Blindness,Progressive loss of Peripheral Vision,Decrease Visual Acuity" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067441" "04211" "00087917" "00234" "Familial, autosomal recessive" "" "Artery attenuation, pigment deposit, and pale optic disc" "?" "" "Night Blindness,Progressive loss of Peripheral Vision,Decrease Visual Acuity" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067442" "04211" "00087918" "00234" "Familial, autosomal recessive" "" "Artery attenuation, pigment deposit, and pale optic disc" "?" "" "Night Blindness,Progressive loss of Peripheral Vision,Decrease Visual Acuity" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067443" "04211" "00087919" "00234" "Familial, autosomal recessive" "" "Artery attenuation, pigment deposit, and pale optic disc" "?" "" "Night Blindness,Progressive loss of Peripheral Vision,Decrease Visual Acuity" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067444" "04211" "00087920" "00234" "Familial, autosomal recessive" "" "Artery attenuation, pigment deposit, and pale optic disc" "?" "" "Night Blindness,Progressive loss of Peripheral Vision,Decrease Visual Acuity" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067445" "04211" "00087921" "00234" "Familial, autosomal recessive" "" "Artery attenuation, pigment deposit, and pale optic disc" "?" "" "Night Blindness,Progressive loss of Peripheral Vision,Decrease Visual Acuity" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067446" "04211" "00087922" "00234" "Familial, autosomal recessive" "" "Artery attenuation, pigment deposit, and pale optic disc" "?" "" "Night Blindness,Progressive loss of Peripheral Vision,Decrease Visual Acuity" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067447" "04211" "00087923" "00234" "Familial, autosomal recessive" "" "Artery attenuation, pigment deposit, and pale optic disc" "?" "" "Night Blindness,Progressive loss of Peripheral Vision,Decrease Visual Acuity" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067448" "04211" "00087924" "00234" "Familial, autosomal recessive" "" "Artery attenuation, pigment deposit, and pale optic disc" "?" "" "Night Blindness,Progressive loss of Peripheral Vision,Decrease Visual Acuity" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067449" "04211" "00087925" "00234" "Familial, autosomal recessive" "" "Artery attenuation, pigment deposit, and pale optic disc" "?" "" "Night Blindness,Progressive loss of Peripheral Vision,Decrease Visual Acuity" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067450" "04211" "00087926" "00234" "Familial, autosomal recessive" "" "Artery attenuation, pigment deposit, and pale optic disc" "?" "" "Night Blindness,Progressive loss of Peripheral Vision,Decrease Visual Acuity" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067451" "04211" "00087927" "00234" "Familial, autosomal recessive" "" "Artery attenuation, pigment deposit, and pale optic disc" "?" "" "Night Blindness,Progressive loss of Peripheral Vision,Decrease Visual Acuity" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067452" "04211" "00087928" "00234" "Familial, autosomal recessive" "" "Artery attenuation, pigment deposit, and pale optic disc" "?" "" "Night Blindness,Progressive loss of Peripheral Vision,Decrease Visual Acuity" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067453" "04211" "00087929" "00234" "Familial, autosomal recessive" "" "Artery attenuation, pigment deposit, and pale optic disc" "?" "" "Night Blindness,Progressive loss of Peripheral Vision,Decrease Visual Acuity" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067454" "04211" "00087930" "00234" "Familial, autosomal recessive" "" "" "?" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067455" "04211" "00087933" "00234" "Familial, autosomal recessive" "" "No hairing impairment, overt obesity" "?" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067456" "04211" "00087934" "00234" "Familial, autosomal recessive" "" "No hairing impairment, overt obesity" "?" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067457" "04211" "00087935" "00234" "Familial, autosomal recessive" "" "No hairing impairment, overt obesity" "?" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067458" "04211" "00087936" "00234" "Familial, autosomal recessive" "" "No hairing impairment, overt obesity" "?" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067459" "04211" "00087937" "00234" "Familial, autosomal recessive" "" "Early onset rp,retinal dystrophy,vascular attenuation,peripheral bone spicule pigmentation," "31y" "" "Low visual acuity, nightblindness, and congenital nystagmus" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067460" "04211" "00087938" "00234" "Familial, autosomal recessive" "" "Early onset rp,retinal dystrophy,vascular attenuation,peripheral bone spicule pigmentation," "?" "" "Low visual acuity, nightblindness, and congenital nystagmus" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067461" "04211" "00087939" "00234" "Familial, autosomal recessive" "" "Early onset rp,retinal dystrophy,vascular attenuation,peripheral bone spicule pigmentation," "41y" "" "Low visual acuity, nightblindness, and congenital nystagmus" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067462" "04211" "00087940" "00234" "Familial, autosomal recessive" "" "Early onset rp,retinal dystrophy,vascular attenuation,peripheral bone spicule pigmentation," "38y" "" "Low visual acuity, nightblindness, and congenital nystagmus" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067463" "04211" "00087941" "00234" "Familial, autosomal recessive" "" "Early onset rp,retinal dystrophy,vascular attenuation,peripheral bone spicule pigmentation," "?" "" "Low visual acuity, nightblindness, and congenital nystagmus" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067464" "04211" "00087942" "00234" "Familial, autosomal recessive" "" "" "20y" "" "Night Blindness ,Constriction of Visual Field" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067465" "04211" "00087944" "00234" "Familial, autosomal recessive" "" "" "20y" "" "Night Blindness ,Constriction of Visual Field" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000067466" "04210" "00087945" "00234" "Familial, autosomal recessive" "" "Lca/eord; few pigment clumps,shiny white spots atmid periphery;discrete diffuse rpemottling, salt-and-pepper appearance" "8y" "" "Symptoms started at birth. Night blindness and nystagmus,myopic refractive error" "" "" "" "" "" "" "" "" "" "" "" "0000067467" "04210" "00087946" "00234" "Familial, autosomal recessive" "" "No lesion detected" "3y" "" "Symptoms started at birth. Night blindness and nystagmus,myopic refractive error" "" "" "" "" "" "" "" "" "" "" "" "0000067468" "04210" "00087947" "00234" "Familial, autosomal recessive" "" "Multiple pigmentclumps, shiny white spots at mid periphery; pronounced pigment migration around vessels" "26y" "" "Symptoms started during infancy. Night blindness and nystagmus,myopic refractive error" "" "" "" "" "" "" "" "" "" "" "" "0000067469" "04210" "00087948" "00234" "Familial, autosomal recessive" "" "Multiple pigmentclumps, shiny white spots at mid periphery; pronounced pigment migration around vessels" "20y" "" "Symptoms started during infancy. Night blindness and nystagmus, mild hyperopia" "" "" "" "" "" "" "" "" "" "" "" "0000067470" "04210" "00087949" "00234" "Familial, autosomal recessive" "" "Areas of accentuated retinal mottling;pronounced chorioretinal atrophy along the temporal arcades, geographic atrophy,waxy disc pallor" "44y" "" "Symptoms started during infancy. Night blindness and nystagmus, myopic refractive error" "" "" "" "" "" "" "" "" "" "" "" "0000067471" "04210" "00087950" "00234" "Familial, autosomal recessive" "" "Few pigment clumps, shiny white spots at mid periphery" "37y" "" "Symptoms started during infancy. Night blindness and nystagmus,myopic refractive error" "" "" "" "" "" "" "" "" "" "" "" "0000067472" "04210" "00087951" "00234" "Familial, autosomal recessive" "" "Discrete diffuse rpe mottling" "33y" "" "Symptoms started during infancy. Night blindness and nystagmus,myopic refractive error" "" "" "" "" "" "" "" "" "" "" "" "0000067589" "04211" "00088083" "00243" "Familial, autosomal recessive" "" "" "0d" "0d" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000074231" "04214" "00095953" "01769" "Familial, autosomal recessive" "" "Progressive RP" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000078312" "04214" "00100071" "01769" "Familial, autosomal recessive" "" "progressive RP" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000078316" "04214" "00100075" "01769" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000078321" "04214" "00100081" "01769" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000078350" "04214" "00100113" "01769" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000078352" "04214" "00100115" "01769" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000128058" "04210" "00155558" "01243" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "LCA" "" "0000128059" "04210" "00155559" "01243" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "LCA" "" "0000128060" "04210" "00155560" "01243" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "LCA" "" "0000155468" "04210" "00207679" "01244" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000155486" "04210" "00207695" "01244" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000184472" "00198" "00244507" "01807" "Unknown" "" "HP:0000510 (Rod-cone dystrophy)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000203663" "00198" "00265883" "01807" "Unknown" "" "Rod-cone dystrophy (HP:0000510)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000233842" "04214" "00308415" "00004" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000233998" "04214" "00308570" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000234053" "04214" "00308625" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000234762" "04214" "00309442" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000234763" "04214" "00309443" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234764" "04214" "00309444" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "cone–rod dystrophy" "" "0000234765" "04214" "00309445" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000234766" "04214" "00309446" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "cone–rod dystrophy" "" "0000234767" "04214" "00309447" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234768" "04214" "00309448" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234770" "04214" "00309450" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000234771" "04214" "00309451" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000234950" "04214" "00309630" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000234989" "04214" "00309670" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000243926" "04214" "00325439" "00006" "Familial, autosomal recessive" "" "Leber congenital amaurosis" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000245160" "04214" "00326694" "00008" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa (arRP)" "" "0000249811" "05086" "00331619" "00000" "Familial, autosomal recessive" "7y" "profound hearing loss (acouophone or cochlear implant)" "1y" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome, type I" "" "0000250542" "04214" "00332356" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000250543" "04214" "00332357" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000250651" "04214" "00332467" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "EORP" "" "0000250689" "04214" "00332505" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy, Bull\'s eye sign in macula" "" "0000250733" "04214" "00332545" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "pericentral retinitis pigmentosa" "" "0000252046" "04214" "00333861" "00000" "Familial, autosomal recessive" "71y" "clinical category IA1a" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000252604" "04214" "00334564" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000252669" "04214" "00334883" "00000" "Familial, autosomal recessive" "" "progressive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000252671" "04214" "00334885" "00000" "Familial, autosomal recessive" "" "progressive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000252679" "04214" "00334893" "00000" "Familial, autosomal recessive" "" "progressive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, early onset" "" "0000252680" "04214" "00334894" "00000" "Familial, autosomal recessive" "" "progressive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, early onset" "" "0000253365" "04214" "00335419" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253386" "04214" "00335440" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253448" "04214" "00335503" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253449" "04214" "00335504" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253450" "04214" "00335505" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253911" "04214" "00335996" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000254620" "04214" "00359324" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000258276" "04214" "00362910" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000258298" "04214" "00362932" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" "0000258835" "04214" "00363474" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000258936" "04214" "00363586" "00000" "Familial" "" "non-syndromic" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, cone-rod dystrophy (early onset)" "" "0000258937" "04214" "00363587" "00000" "Familial" "" "non-syndromic" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, cone-rod dystrophy (early onset)" "" "0000258951" "04214" "00363601" "00000" "Familial" "" "non-syndromic" "" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000258992" "04214" "00363642" "00000" "Familial" "" "non-syndromic" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, cone-rod dystrophy (early onset)" "" "0000259013" "04214" "00363663" "00000" "Familial" "" "non-syndromic" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, cone-rod dystrophy" "" "0000259041" "04214" "00363691" "00000" "Isolated (sporadic)" "" "non-syndromic" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, cone-rod dystrophy (early onset)" "" "0000259058" "04214" "00363708" "00000" "Isolated (sporadic)" "" "non-syndromic" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, cone-rod dystrophy" "" "0000259067" "04214" "00363717" "00000" "Familial" "" "non-syndromic" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, cone-rod dystrophy" "" "0000259093" "04214" "00363743" "00000" "Familial" "" "non-syndromic" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, cone-rod dystrophy" "" "0000259096" "04214" "00363746" "00000" "Familial" "" "non-syndromic" "" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000267771" "04214" "00372456" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000267772" "04214" "00372457" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000267808" "04214" "00372493" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000267811" "04214" "00372496" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000267945" "04214" "00372666" "00000" "Familial, autosomal recessive" "28y" "see paper; ..." "<10y" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000267986" "04214" "00372707" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000268691" "04214" "00373415" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269133" "04214" "00373924" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000270184" "04214" "00374974" "00000" "Familial, autosomal recessive" "36y" "4y-night blindenss, diminished visual acuity (4y), diminished visual field (4y); best corrected visual acuity light perception/light perception; macular unstructured and atrophy in left macula; cataract (30y), nystagmus" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000270185" "04214" "00374975" "00000" "Familial, autosomal recessive" "44y" "4y-night blindenss, diminished visual acuity (4y), diminished visual field (4y); best corrected visual acuity light perception/light perception; slightly bone spicule pigmentation; cataract (20y), nystagmus" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000270532" "04214" "00375318" "00000" "Familial, X-linked" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000270533" "04214" "00375319" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000270534" "04214" "00375320" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000270637" "04214" "00375423" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000271505" "04214" "00376297" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "Cone-rod dystrophy (CRD)" "" "0000271506" "04214" "00376298" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "Cone-rod dystrophy (CRD)" "" "0000271688" "04214" "00376481" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000272420" "04214" "00377262" "00000" "Familial, autosomal recessive" "51y" "see paper" "8y" "9y" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, type 14 (RP14)" "retinal disease" "" "0000272663" "04214" "00377513" "04521" "Isolated (sporadic)" "" "see paper; ..., Leber congenital amaurosis" "" "" "" "" "" "" "" "" "" "" "" "LCA" "retinal disease" "" "0000273430" "04214" "00379576" "00008" "Familial, autosomal recessive" "14y" "Decreased vision day) & decreased night mobility; Arterial narrowing; discpallor, RPE degeneration;cellophane reflexes" "8y" "" "" "" "" "" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" "0000273431" "04214" "00379577" "00008" "Familial, autosomal recessive" "9y" "" "1y" "" "" "" "" "" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" "0000273752" "04214" "00379898" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "Cone-rod dystrophy" "" "0000274061" "04214" "00380206" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000274178" "04214" "00380327" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "non-syndromic retinitis pigmentosa (RP)" "" "0000274179" "04214" "00380328" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "non-syndromic retinitis pigmentosa (RP)" "" "0000274180" "04214" "00380329" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "non-syndromic retinitis pigmentosa (RP)" "" "0000274181" "04214" "00380330" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "non-syndromic retinitis pigmentosa (RP)" "" "0000274182" "04214" "00380331" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "non-syndromic retinitis pigmentosa (RP)" "" "0000274183" "04214" "00380332" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "non-syndromic retinitis pigmentosa (RP)" "" "0000274184" "04214" "00380333" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000274185" "04214" "00380334" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000274186" "04214" "00380335" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy (CRD)" "" "0000274187" "04214" "00380336" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "leber congenital amaurosis (LCA)" "" "0000274849" "04214" "00380998" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000274889" "04214" "00381038" "00000" "Isolated (sporadic)" "<1y" "poor vision, nystagmus" "11y" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000274899" "04214" "00381048" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000275049" "04214" "00381198" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000275050" "04214" "00381199" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000275051" "04214" "00381200" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000275070" "04214" "00381219" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000275071" "04214" "00381220" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000275078" "04214" "00381227" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000275079" "04214" "00381228" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000275080" "04214" "00381229" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000275456" "04214" "00381614" "00000" "Isolated (sporadic)" "" "" "52y" "" "" "" "" "" "" "" "" "" "" "" "Autosomal recessive retinitis pigmentosa, arRP" "" "0000275459" "04214" "00381617" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "Autosomal recessive retinitis pigmentosa, arRP" "" "0000275460" "04214" "00381618" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "Autosomal recessive retinitis pigmentosa, arRP" "" "0000275483" "04214" "00381641" "00000" "Isolated (sporadic)" "" "" "35y" "" "" "" "" "" "" "" "" "" "" "" "Autosomal recessive retinitis pigmentosa, arRP" "" "0000275492" "04214" "00381650" "00000" "Familial, autosomal recessive" "" "" "7y" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000275501" "04214" "00381659" "00000" "Familial, autosomal recessive" "" "" "19y" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000275503" "04214" "00381661" "00000" "Familial, autosomal recessive" "" "" "7y" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000275506" "04214" "00381664" "00000" "Familial, autosomal recessive" "" "" "8y" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000275511" "04214" "00381669" "00000" "Familial, autosomal recessive" "" "" "3y" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000275513" "04214" "00381671" "00000" "Familial, autosomal recessive" "" "" "6y" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000275561" "04214" "00381719" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276458" "04214" "00382609" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276459" "04214" "00382610" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276703" "04214" "00382847" "00000" "Familial, autosomal recessive" "15y" "" "" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000276707" "04214" "00382851" "00000" "Familial, autosomal recessive" "6y" "" "" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000277817" "04214" "00384032" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277895" "04214" "00384110" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277896" "04214" "00384111" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000278533" "04214" "00384750" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa (RP)" "" "0000278562" "04214" "00384779" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa (RP)" "" "0000278781" "04214" "00384997" "00000" "Familial, autosomal recessive" "8y" "nyctalopia, nystagmus, no oculodigital sign, ERG extinguished, best corrected visual acuity right/left eye: 0.1/0.1" "1y" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "Leber congenital amaurosis" "" "0000278817" "04214" "00385033" "00000" "Isolated (sporadic)" "5y" "nyctalopia, no nystagmus, best corrected visual acuity right/left eye: 0.2/0.3" "2y" "" "" "" "" "" "" "" "" "" "" "early onset severe retinal dystrophy" "early onset severe retinal dystrophy" "" "0000280000" "04214" "00386197" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000280074" "04214" "00386271" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000280084" "04214" "00386281" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000280417" "04214" "00386617" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280462" "04214" "00386662" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280530" "04214" "00386730" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280658" "04214" "00386858" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280856" "04214" "00387078" "00000" "Familial, autosomal recessive" "26y" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal recessive" "" "" "0000282058" "04214" "00388506" "00000" "Unknown" "15y" "" "" "" "" "" "" "" "" "" "" "" "" "" "rod-cone dystrophy" "" "0000282478" "04214" "00388937" "00000" "Familial, autosomal recessive" "13y" "age at genetic diagnosis mentioned" "" "6y" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000282643" "04214" "00389102" "00000" "Familial, autosomal recessive" "24y" "age at genetic diagnosis mentioned" "" "17y" "" "" "" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" "" "0000282644" "04214" "00389103" "00000" "Familial, autosomal recessive" "21y" "age at genetic diagnosis mentioned" "" "14y" "" "" "" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" "" "0000282705" "04214" "00389164" "00000" "Familial, autosomal recessive" "38y" "age at genetic diagnosis mentioned" "" "37y" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000282706" "04214" "00389165" "00000" "Familial, autosomal recessive" "38y" "age at genetic diagnosis mentioned" "" "37y" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000282992" "04214" "00389451" "00000" "Familial, autosomal recessive" "26y" "age at genetic diagnosis mentioned" "" "22y" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" "" "0000282993" "04214" "00389452" "00000" "Familial, autosomal recessive" "33y" "age at genetic diagnosis mentioned" "" "29y" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" "" "0000283132" "04214" "00389591" "00000" "Isolated (sporadic)" "54y" "age at genetic diagnosis mentioned" "" "47y" "" "" "" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" "" "0000283134" "04214" "00389593" "00000" "Isolated (sporadic)" "36y" "age at genetic diagnosis mentioned" "" "35y" "" "" "" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" "" "0000283289" "04214" "00389748" "00000" "Isolated (sporadic)" "66y" "age at genetic diagnosis mentioned" "" "62y" "" "" "" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" "" "0000283308" "04214" "00389767" "00000" "Familial, autosomal recessive" "39y" "age at genetic diagnosis mentioned" "" "38y" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" "" "0000283479" "04214" "00389938" "00000" "Isolated (sporadic)" "78y" "age at genetic diagnosis mentioned" "" "77y" "" "" "" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" "" "0000283949" "04214" "00390411" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "retinal disease" "" "0000284925" "04214" "00391589" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "early onset severe retinal dystrophy" "" "0000285824" "04214" "00392577" "00000" "Familial, autosomal recessive" "" "initial diagnosis of autosomal recessive cone-rod dystrophy redifined to retinitis pigmentosa" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "cone-rod dystrophy" "" "0000285840" "04214" "00392593" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "retinitis pigmentosa" "" "0000286726" "04214" "00393520" "00000" "Isolated (sporadic)" "26y" "" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000286975" "04214" "00393769" "00000" "Isolated (sporadic)" "13y" "" "" "" "" "" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis (LCA)" "" "0000287118" "04214" "00393912" "00000" "Isolated (sporadic)" "16y" "" "" "" "" "" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis (LCA)" "" "0000287214" "04214" "00394008" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "Inherited Retinal Dystrophies" "" "0000287574" "04214" "00394370" "00000" "Familial, autosomal recessive" "" "Congenital nystagmus, fundus changes detected about 1 y, consistent with RP and related diseases" "1y" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000287839" "04214" "00394636" "00000" "Familial, autosomal recessive" "44y" "" "6y" "" "" "" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287840" "04214" "00394637" "00000" "Familial, autosomal recessive" "80y" "" "20y" "" "" "" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000288970" "04214" "00395808" "00000" "Unknown" "30y5m" "" "15y" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000289811" "04214" "00396650" "00000" "Familial, autosomal recessive" "58y" "constriction of visual field" "52y" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000296697" "04214" "00404108" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000296703" "04214" "00404114" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000300426" "04214" "00408301" "00000" "Familial, autosomal recessive" "9y" "best corrected visual acuity right, left eye: 20/400; refraction: -4.00 -2.50 x 180; no measurable rod function detected; markedly reduced cone function detectable across the visual field or in the remaining peripheral island; rod and cone electroretinograms not detectable" "" "" "" "" "" "" "" "" "" "" "" "early-onset severe retinal degeneration" "" "" "0000300427" "04214" "00408302" "00000" "Familial, autosomal recessive" "10y" "best corrected visual acuity right, left eye: counting fingers; refraction: plano -1.00 x 180; no measurable rod function detected; markedly reduced cone function detectable across the visual field or in the remaining peripheral island; rod and cone electroretinograms not detectable" "" "" "" "" "" "" "" "" "" "" "" "early-onset severe retinal degeneration" "" "" "0000300428" "04214" "00408303" "00000" "Familial, autosomal recessive" "15y" "best corrected visual acuity right, left eye: 20/200; refraction: -4.00 -3.00 x 180; no measurable rod function detected; markedly reduced cone function detectable across the visual field or in the remaining peripheral island; rod and cone electroretinograms not detectable" "" "" "" "" "" "" "" "" "" "" "" "early-onset severe retinal degeneration" "" "" "0000300429" "04214" "00408304" "00000" "Familial, autosomal recessive" "16y" "best corrected visual acuity right, left eye: 20/200; refraction: -8.75; no measurable rod function detected; markedly reduced cone function detectable across the visual field or in the remaining peripheral island; rod and cone electroretinograms not detectable" "" "" "" "" "" "" "" "" "" "" "" "early-onset severe retinal degeneration" "" "" "0000300430" "04214" "00408305" "00000" "Familial, autosomal recessive" "16y" "best corrected visual acuity right, left eye: counting fingers; refraction: -4.25; no measurable rod function detected; markedly reduced cone function detectable across the visual field or in the remaining peripheral island; rod and cone electroretinograms not detectable" "" "" "" "" "" "" "" "" "" "" "" "early-onset severe retinal degeneration" "" "" "0000300431" "04214" "00408306" "00000" "Familial, autosomal recessive" "17y" "best corrected visual acuity right, left eye: 20/200; refraction: -1; no measurable rod function detected; markedly reduced cone function detectable across the visual field or in the remaining peripheral island; rod and cone electroretinograms not detectable" "" "" "" "" "" "" "" "" "" "" "" "early-onset severe retinal degeneration" "" "" "0000300432" "04214" "00408307" "00000" "Familial, autosomal recessive" "18y" "best corrected visual acuity right, left eye: 20/400; refraction: -2.00 -0.50 x 180; no measurable rod function detected; markedly reduced cone function detectable across the visual field or in the remaining peripheral island; rod and cone electroretinograms not detectable" "" "" "" "" "" "" "" "" "" "" "" "early-onset severe retinal degeneration" "" "" "0000300433" "04214" "00408308" "00000" "Familial, autosomal recessive" "22y" "best corrected visual acuity right, left eye: 20/200; refraction: -3.5; no measurable rod function detected; markedly reduced cone function detectable across the visual field or in the remaining peripheral island; rod and cone electroretinograms not detectable" "" "" "" "" "" "" "" "" "" "" "" "early-onset severe retinal degeneration" "" "" "0000300434" "04214" "00408309" "00000" "Familial, autosomal recessive" "25y" "best corrected visual acuity right, left eye: counting fingers; refraction: -7.25; no measurable rod function detected; markedly reduced cone function detectable across the visual field or in the remaining peripheral island; rod and cone electroretinograms not detectable" "" "" "" "" "" "" "" "" "" "" "" "early-onset severe retinal degeneration" "" "" "0000300435" "04214" "00408310" "00000" "Familial, autosomal recessive" "26y" "best corrected visual acuity right, left eye: counting fingers; refraction: -6.5; no measurable rod function detected; markedly reduced cone function detectable across the visual field or in the remaining peripheral island; rod and cone electroretinograms not detectable" "" "" "" "" "" "" "" "" "" "" "" "early-onset severe retinal degeneration" "" "" "0000300436" "04214" "00408311" "00000" "Familial, autosomal recessive" "27y" "best corrected visual acuity right, left eye: counting fingers; refraction: -2.75; no measurable rod function detected; markedly reduced cone function detectable across the visual field or in the remaining peripheral island; rod and cone electroretinograms not detectable" "" "" "" "" "" "" "" "" "" "" "" "early-onset severe retinal degeneration" "" "" "0000300437" "04214" "00408312" "00000" "Familial, autosomal recessive" "30y" "best corrected visual acuity right, left eye: hand motion; refraction: -10.5; no measurable rod function detected; markedly reduced cone function detectable across the visual field or in the remaining peripheral island; rod and cone electroretinograms not detectable" "" "" "" "" "" "" "" "" "" "" "" "early-onset severe retinal degeneration" "" "" "0000300438" "04214" "00408313" "00000" "Familial, autosomal recessive" "31y" "best corrected visual acuity right, left eye: hand motion; refraction: -9.5; no measurable rod function detected; markedly reduced cone function detectable across the visual field or in the remaining peripheral island; rod and cone electroretinograms not detectable" "" "" "" "" "" "" "" "" "" "" "" "early-onset severe retinal degeneration" "" "" "0000300439" "04214" "00408314" "00000" "Familial, autosomal recessive" "35y" "best corrected visual acuity right, left eye: 20/400; refraction: -0.25 -0.50 x 180; no measurable rod function detected; markedly reduced cone function detectable across the visual field or in the remaining peripheral island; rod and cone electroretinograms not detectable" "" "" "" "" "" "" "" "" "" "" "" "early-onset severe retinal degeneration" "" "" "0000300440" "04214" "00408315" "00000" "Familial, autosomal recessive" "42y" "best corrected visual acuity right, left eye: light perception; refraction: -2.25; no measurable rod function detected; markedly reduced cone function detectable across the visual field or in the remaining peripheral island; rod and cone electroretinograms not detectable" "" "" "" "" "" "" "" "" "" "" "" "early-onset severe retinal degeneration" "" "" "0000300441" "04214" "00408316" "00000" "Familial, autosomal recessive" "42y" "best corrected visual acuity right, left eye: 20/400; refraction: -11; no measurable rod function detected; markedly reduced cone function detectable across the visual field or in the remaining peripheral island; rod and cone electroretinograms not detectable" "" "" "" "" "" "" "" "" "" "" "" "early-onset severe retinal degeneration" "" "" "0000300448" "04214" "00408323" "00000" "Familial, autosomal recessive" "52y" "at onset:, best corrected visual acuity right, left eye: 80/200, 120/200, current age: counting fingers, 10/200, mild myopia (se -3 d), macular bull\'s eye, peripheral mottling, vessels slightly attenuated, optic disc: mild pallor" "43y" "43y" "" "" "" "" "" "" "" "" "" "early-onset severe retinal degeneration" "" "" "0000300449" "04214" "00408324" "00000" "Familial, autosomal recessive" "36y" "at onset:, best corrected visual acuity right, left eye: 50/200, 32/200, current age: 10/200, 10/200, high myopia (se -12.5 d), macular bull\'s eye, midperiphery subtle retinal pigment epithelium changes and, far periphery bone spicules, vessels severely attenuated, optic disc: moderate pallor" "24y" "24y" "" "" "" "" "" "" "" "" "" "early-onset severe retinal degeneration" "" "" "0000300452" "04214" "00408326" "00000" "Familial, autosomal recessive" "15y" "best corrected visual acuity right, left eye: 20/160, 20/125; refraction right/left eye: -1.25 / -1.25" "" "" "" "" "" "" "" "" "" "" "" "Retinal degeneration" "" "" "0000300453" "04214" "00408327" "00000" "Familial, autosomal recessive" "19y" "best corrected visual acuity right, left eye: 20/200, 20/200; refraction right/left eye: +6.00 / +6.00" "" "" "" "" "" "" "" "" "" "" "" "Retinal degeneration" "" "" "0000300454" "04214" "00408328" "00000" "Familial, autosomal recessive" "25y" "best corrected visual acuity right, left eye: 20/80, 20/80; refraction right/left eye: plano / +0.50" "" "" "" "" "" "" "" "" "" "" "" "Retinal degeneration" "" "" "0000300455" "04214" "00408329" "00000" "Familial, autosomal recessive" "36y" "best corrected visual acuity right, left eye: hand movement, hand movement; refraction right/left eye: -1.25 / -1.50" "" "" "" "" "" "" "" "" "" "" "" "Retinal degeneration" "" "" "0000300456" "04214" "00408330" "00000" "Familial, autosomal recessive" "33y" "best corrected visual acuity right, left eye: 20/100, 20/100; refraction right/left eye: +5.75 / +6.75" "" "" "" "" "" "" "" "" "" "" "" "Retinal degeneration" "" "" "0000300457" "04214" "00408331" "00000" "Familial, autosomal recessive" "55y" "best corrected visual acuity right, left eye: 20/20, 20/25; refraction right/left eye: -1.50 / -2.50" "" "" "" "" "" "" "" "" "" "" "" "Retinal degeneration" "" "" "0000300488" "04214" "00408362" "00000" "Familial, autosomal recessive" "8y" "18m: only seemed able to see large objects and had particular problems with her vision at night; 3y8m: electroretinogram: flat photopic and scotopic responses (same at ages 5y and 7y); 8y best corrected visual acuity right, left eye: 6/60, 6/60 + 1; fine, high frequency, low amplitude vertical nystagmus in the primary position, which converted to a more exaggerated horizontal nystagmus in side gaze; cycloplegic refraction: a low and normal degree of hypermetropia with some moderate astigmatism (+0.5/ +1.75 x 120 right eye and +1.25/+1.75 x 60 left eye); fundus: slight attenuation of the retinal arterioles, loss of both foveal and ring reflexes of the maculae and a diffuse abnormal retinal sheen with some pigment stippling inferiorly in the left eye; otherwise well, with normal hearing and intellectual development" "6m" "" "nystagmus and head shaking" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000300490" "04214" "00408364" "00000" "Familial, autosomal recessive" "6y" "best corrected visual acuity: 2/30; primary: orthotropia (accommodative esotropia); fundus: grossly normal except vessel attenuation; cycloplegic retinoscopy: +7.50 -1.50×180, +9.25 -1.75×180; electroretinography scotopic: non-recordable, photopic: depressed and delay" "" "" "" "" "" "" "" "" "" "" "" "rod-cone dystrophy" "" "" "0000300491" "04214" "00408365" "00000" "Familial, autosomal recessive" "3y" "best corrected visual acuity: (1/3)/30; primary: orthotropia (accommodative esotropia); fundus: grossly normal except vessel attenuation; cycloplegic retinoscopy: +8.75 / +8.75; electroretinography scotopic: not done, photopic: not done" "" "" "" "" "" "" "" "" "" "" "" "rod-cone dystrophy" "" "" "0000300492" "04214" "00408366" "00000" "Familial, autosomal recessive" "7y" "best corrected visual acuity right, left eye: 20/200, 20/400; primary: orthotropia; fundus: pale optic discs (peripheral changes); cycloplegic retinoscopy: +4.00 -1.75×180, +5.00 -2.75×180; electroretinography scotopic: non-recordable, photopic: depressed and delay" "" "" "" "" "" "" "" "" "" "" "" "rod-cone dystrophy" "" "" "0000300493" "04214" "00408367" "00000" "Familial, autosomal recessive" "4y" "best corrected visual acuity: central, steady, maintained vision; primary: orthotropia; fundus: grossly normal except vessel attenuation; cycloplegic retinoscopy: +2.50 -1.00×180, +2.50 -1.00×180 ; electroretinography scotopic: non-recordable, photopic: depressed and delay" "" "" "" "" "" "" "" "" "" "" "" "rod-cone dystrophy" "" "" "0000300494" "04214" "00408368" "00000" "Familial, autosomal recessive" "7y" "best corrected visual acuity: 20/300; primary: orthotropia; fundus: grossly normal except vessel attenuation (peripheral changes); cycloplegic retinoscopy: +2.50, +2.50; electroretinography scotopic: non-recordable, photopic: depressed and delayed" "" "" "" "" "" "" "" "" "" "" "" "rod-cone dystrophy" "" "" "0000300495" "04214" "00408369" "00000" "Familial, autosomal recessive" "3y" "best corrected visual acuity: central, steady, maintained vision; primary: orthotropia; fundus: grossly normal except vessel attenuation (peripheral changes); cycloplegic retinoscopy: +4.50, +4.50; electroretinography scotopic: non-recordable, photopic: depressed and delayed" "" "" "" "" "" "" "" "" "" "" "" "rod-cone dystrophy" "" "" "0000300496" "04214" "00408370" "00000" "Familial, autosomal recessive" "8y" "best corrected visual acuity: 20/400; primary: orthotropia; fundus: dull fovea (peripheral changes); cycloplegic retinoscopy: +1.50 -1.00×180, +2.75 -1.00×180; electroretinography scotopic: not done, photopic: not do" "" "" "" "" "" "" "" "" "" "" "" "rod-cone dystrophy" "" "" "0000300497" "04214" "00408371" "00000" "Familial, autosomal recessive" "6y" "best corrected visual acuity: 20/200; primary: orthotropia; fundus: grossly normal except vessel attenuation (peripheral changes); cycloplegic retinoscopy: +5.50 -1.25×180, +5.50 -1.25×180; electroretinography scotopic: non-recordable, photopic: depressed and delayed (flat age 1" "" "" "" "" "" "" "" "" "" "" "" "rod-cone dystrophy" "" "" "0000300498" "04214" "00408372" "00000" "Familial, autosomal recessive" "2y" "best corrected visual acuity: central, steady, maintained vision; primary: orthotropia; fundus: grossly normal except vessel attenuation (peripheral changes); cycloplegic retinoscopy: −3.00 -1.00×180, −3.00 -1.00×180; electroretinography scotopic: non-recordable, photopic: depressed and d" "" "" "" "" "" "" "" "" "" "" "" "rod-cone dystrophy" "" "" "0000300499" "04214" "00408373" "00000" "Familial, autosomal recessive" "6y" "best corrected visual acuity: 20/400; primary: 35 exotropia in prism dioptres; fundus: grossly normal except vessel attenuation; cycloplegic retinoscopy: +5.0 /+ 5.0; electroretinography scotopic: non-recordable, photopic: depressed and delayed (flat age 10)" "" "" "" "" "" "" "" "" "" "" "" "rod-cone dystrophy" "" "" "0000300500" "04214" "00408374" "00000" "Familial, autosomal recessive" "28y" "progressive night blindness; fundus: macular degeneration, artery attenuation, pigment deposit, pale optic disc; electroretinography: no a or b wave response; no flicker response; best corrected visual acuity right, left eye: 6/3" "6y" "" "night blindness" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300501" "04214" "00408375" "00000" "Familial, autosomal recessive" "22y" "progressive night blindness; fundus: macular degeneration, artery attenuation, pigment deposit, pale optic disc; electroretinography: no a or b wave response; no flicker response; best corrected visual acuity right, left eye: 6/2" "7y" "" "night blindness" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300502" "04214" "00408376" "00000" "Familial, autosomal recessive" "17y" "progressive night blindness; fundus: macular degeneration, artery attenuation, pigment deposit, pale optic disc; electroretinography: no a or b wave response; no flicker response; best corrected visual acuity right, left eye: 6/2" "7y" "" "night blindness" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300503" "04214" "00408377" "00000" "Familial, autosomal recessive" "14y" "progressive night blindness; fundus: macular degeneration, artery attenuation, pigment deposit, pale optic disc; electroretinography: no a or b wave response; no flicker response; best corrected visual acuity right, left eye: 6/2" "6y" "" "night blindness" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300504" "04214" "00408378" "00000" "Familial, autosomal recessive" "20y" "progressive night blindness; fundus: macular degeneration, artery attenuation, pigment deposit, pale optic disc; electroretinography: no a or b wave response; no flicker response; best corrected visual acuity right, left eye: 6/1" "5y" "" "night blindness" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300505" "04214" "00408379" "00000" "Familial, autosomal recessive" "14y" "progressive night blindness; fundus: macular degeneration, artery attenuation, pigment deposit, pale optic disc; electroretinography: no a or b wave response; no flicker response; best corrected visual acuity right, left eye: 6/2" "5y" "" "night blindness" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300506" "04214" "00408380" "00000" "Familial, autosomal recessive" "34y" "progressive night blindness; fundus: macular degeneration, artery attenuation, pigment deposit, pale optic disc; electroretinography: no a or b wave response; no flicker response; best corrected visual acuity right, left eye: 6/3" "6y" "" "night blindness" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300507" "04214" "00408381" "00000" "Familial, autosomal recessive" "25y" "progressive night blindness; fundus: macular degeneration, artery attenuation, pigment deposit, pale optic disc; electroretinography: no a or b wave response; no flicker response; best corrected visual acuity right, left eye: 6/2" "7y" "" "night blindness" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300508" "04214" "00408382" "00000" "Familial, autosomal recessive" "10y" "progressive night blindness; fundus: macular degeneration, artery attenuation, pigment deposit, pale optic disc; electroretinography: no a or b wave response; no flicker response; best corrected visual acuity right, left eye: 6/1" "5y" "" "night blindness" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300509" "04214" "00408383" "00000" "Familial, autosomal recessive" "8y" "progressive night blindness; fundus: macular degeneration, artery attenuation, pigment deposit, pale optic disc; electroretinography: no a or b wave response; no flicker response; best corrected visual acuity right, left eye: 6/2" "5y" "" "night blindness" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300510" "04214" "00408384" "00000" "Familial, autosomal recessive" "58y" "progressive night blindness; fundus: macular degeneration, artery attenuation, pigment deposit, pale optic disc; electroretinography: no a or b wave response; no flicker response; best corrected visual acuity right, left eye: 6/5" "7y" "" "night blindness" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300511" "04214" "00408385" "00000" "Familial, autosomal recessive" "21y" "progressive night blindness; fundus: macular degeneration, artery attenuation, pigment deposit, pale optic disc; electroretinography: no a or b wave response; no flicker response; best corrected visual acuity right, left eye: 6/2" "8y" "" "night blindness" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300512" "04214" "00408386" "00000" "Familial, autosomal recessive" "31y" "progressive night blindness; fundus: macular degeneration, artery attenuation, pigment deposit, pale optic disc; electroretinography: no a or b wave response; no flicker response; best corrected visual acuity right, left eye: 6/2" "6y" "" "night blindness" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300513" "04214" "00408387" "00000" "Familial, autosomal recessive" "20y" "progressive night blindness; fundus: macular degeneration, artery attenuation, pigment deposit, pale optic disc; electroretinography: no a or b wave response; no flicker response; best corrected visual acuity right, left eye: 6/2" "7y" "" "night blindness" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300514" "04214" "00408388" "00000" "Familial, autosomal recessive" "22y" "17m: normal fundi; electroretinogram: reduced responses under light-adapted conditions and no response under dark-adapted conditions; poor night vision; 2y6m: mild myopia (-3.0 D in both eyes) 22y: poor night vision and peripheral vision; bilateral visual acuity of 6/76, mild to moderate attenuation of arterioles, mild peripheral bone spicule-like pigmentation in the fundus, no optic disc atrophy; optical coherence tomography: severe thinning at the macula; no cataracts, keratoconus, or macular edema" "3m" "" "nystagmus, poor pupillary constriction to strong light, retinal pallor" "" "" "" "" "" "" "" "" "rod-cone dystrophy" "" "" "0000300516" "04214" "00408397" "00000" "Familial, autosomal recessive" "15y" "best corrected visual acuity right, left eye: 20/100, 20/200; spherical equivalent refraction: 6,13 / 7,25; lens: clear; ophthalmoscopy: sparse bone spicule pigmentation in the periphery, small hyperemic optic discs, and attenuated retinal vessels; Goldmann perimetry: severely constricted visual field to <10deg; 5y electroretinogram: scotopic: severely reduced, photopic: reduced" "3y" "" "nystagmus" "midigene splice assay" "" "" "" "" "" "" "" "early-onset retinal dystrophy" "" "" "0000300517" "04214" "00408398" "00000" "Familial, autosomal recessive" "13y" "best corrected visual acuity right, left eye: 20/130, 20/60; spherical equivalent refraction: 7,00 / 6,50; lens: clear; ophthalmoscopy: bone spicule pigmentation in the periphery, small hyperemic optic discs, pigment alterations in the macula, and attenuated retinal vessels; Goldmann perimetry: constricted visual field to 30deg (right eye) and 20deg (left eye); 6y electroretinogram: scoptopic: non-recordable, photopic: severely reduced" "1y" "" "nystagmus" "midigene splice assay" "" "" "" "" "" "" "" "early-onset retinal dystrophy" "" "" "0000300540" "04214" "00408424" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" "" "0000300541" "04214" "00408425" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" "" "0000311667" "04214" "00420419" "00000" "Familial, autosomal recessive" "30y5m" "" "15y" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000318800" "02289" "00427828" "01164" "Familial" "32y" "Myopia; Two uncles (maternal side) retinitis pigmentosa, one with variant TULP1 NM_003322.6 c.1082G>A p.(Arg361Gln) in homozygous state" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320428" "00112" "00429556" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320432" "00112" "00429560" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320536" "04214" "00429664" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320579" "00112" "00429707" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320610" "00112" "00429738" "04436" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320628" "00112" "00429756" "04436" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320689" "00112" "00429817" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320691" "00112" "00429819" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320768" "04210" "00429896" "04436" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320857" "04210" "00429985" "04436" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000321015" "04210" "00430143" "04436" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000336172" "00198" "00446973" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, autosomal recessive" "" "0000336204" "00198" "00447005" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, autosomal recessive" "" "0000336475" "00198" "00447276" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, simplex" "" "0000336497" "00198" "00447298" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, simplex" "" "0000336699" "00198" "00447500" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, autosomal recessive" "" "0000336733" "00198" "00447534" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" "0000336895" "00198" "00447696" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, simplex" "" "0000336924" "00198" "00447725" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "unclear diagnosis" "" "0000340081" "04249" "00451026" "04405" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "Stargardt disease" "" "0000340082" "04249" "00451027" "04405" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "cone dystrophy" "" "0000340083" "04249" "00451028" "04405" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "Stargardt disease" "" "0000340084" "04249" "00451029" "04405" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy (AD)" "" "0000340219" "00198" "00451544" "04543" "Familial, autosomal recessive" "31y" "no night vision; no perception light; no nystagmus; no corneal haze; no photophobia" "2y" "" "" "" "" "" "" "" "" "" "" "RP14" "retinitis pigmentosa" "" "0000340220" "00198" "00451545" "04543" "Familial, autosomal recessive" "11y" "no night vision; day vision 20/80; normal color vision; no nystagmus; no corneal haze; no photophobia" "<2y" "" "" "" "" "" "" "" "" "" "" "RP14" "retinitis pigmentosa" "" "0000340228" "00198" "00451553" "04543" "Familial, autosomal recessive" "8y" "no night vision; day vision 20/100; normal color vision; no nystagmus; no corneal haze; no photophobia" "2y" "" "" "" "" "" "" "" "" "" "" "RP14" "retinitis pigmentosa" "" ## Screenings ## Do not remove or alter this header ## ## Count = 406 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000001615" "00001812" "1" "00102" "00102" "2013-08-08 22:45:27" "" "" "SEQ-NG-I" "DNA" "" "" "0000014360" "00014444" "1" "00640" "00100" "2011-11-30 15:31:40" "00006" "2019-08-02 20:11:40" "SEQ" "DNA" "leukocytes" "screen APC gene (index patient)" "0000014384" "00014468" "1" "00100" "00034" "2011-11-30 15:31:41" "00006" "2019-08-02 20:11:40" "SEQ" "DNA" "?" "screen APC gene (index patient)" "0000087964" "00087824" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "SSCA;PCRdig;SEQ;PAGE" "DNA" "" "" "0000087965" "00087825" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "PCR;SEQ;SSCA;PAGE" "DNA" "" "" "0000087966" "00087826" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "SEQ;PCR;DHPLC" "DNA" "" "" "0000087967" "00087827" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "PCR;SEQ;SSCA;PAGE" "DNA" "" "" "0000087968" "00087828" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "RT-PCR;SEQ;SSCA" "DNA" "" "" "0000087969" "00087829" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "SSCA;PCRdig;SEQ;PAGE" "DNA" "" "" "0000087970" "00087830" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "PCRdig;SEQ;SSCA;PAGE" "DNA" "" "" "0000087971" "00087831" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "RT-PCR;SEQ;SSCA" "DNA" "" "" "0000087972" "00087832" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "RT-PCR;SEQ;SSCA" "DNA" "" "" "0000087973" "00087833" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "arraySNP; PCR;SEQ" "DNA" "" "" "0000087974" "00087834" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "arraySNP; PCR;SEQ" "DNA" "" "" "0000087975" "00087835" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "SSCA;PCRdig;SEQ;PAGE" "DNA" "" "" "0000087976" "00087836" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "SSCA;PCRdig;SEQ;PAGE" "DNA" "" "" "0000087977" "00087837" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "PCR;SEQ;SSCA;PAGE" "DNA" "" "" "0000087978" "00087839" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "SSCA;PCRdig;SEQ;PAGE" "DNA" "" "" "0000087979" "00087840" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "SSCA;PCRdig;SEQ;PAGE" "DNA" "" "" "0000087980" "00087841" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "SSCA;PCRdig;SEQ;PAGE" "DNA" "" "" "0000087981" "00087842" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "PCR;SEQ;SSCA;PAGE" "DNA" "" "" "0000087982" "00087843" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "PCR; SEQ" "DNA" "" "" "0000087983" "00087838" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "PCR; SEQ" "DNA" "" "" "0000087984" "00087844" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "PCR; SEQ" "DNA" "" "" "0000087985" "00087845" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "PCR; SEQ" "DNA" "" "" "0000087986" "00087846" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "PCR; SEQ" "DNA" "" "" "0000087987" "00087847" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "PCR; SEQ" "DNA" "" "" "0000087988" "00087848" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "PCR; SEQ" "DNA" "" "" "0000087989" "00087849" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "PCR; SEQ" "DNA" "" "" "0000087990" "00087850" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "PCR; SEQ" "DNA" "" "" "0000087991" "00087851" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "PCR; SEQ" "DNA" "" "" "0000087992" "00087852" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "PCR; SEQ" "DNA" "" "" "0000087993" "00087853" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "PCR; SEQ" "DNA" "" "" "0000087994" "00087854" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "PCR; SEQ" "DNA" "" "" "0000087995" "00087855" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "PCR; SEQ" "DNA" "" "" "0000087996" "00087856" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "PCR; SEQ" "DNA" "" "" "0000087997" "00087857" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "PCR; SEQ" "DNA" "" "" "0000087998" "00087858" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "PCR; SEQ" "DNA" "" "" "0000087999" "00087859" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "PCR; SEQ" "DNA" "" "" "0000088000" "00087860" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "PCR; SEQ" "DNA" "" "" "0000088001" "00087861" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "PCR; SEQ" "DNA" "" "" "0000088002" "00087862" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "PCR; SEQ" "DNA" "" "" "0000088003" "00087863" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "PCR; SEQ" "DNA" "" "" "0000088004" "00087864" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "PCR; SEQ" "DNA" "" "" "0000088005" "00087865" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "PCR; SEQ" "DNA" "" "" "0000088006" "00087866" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "PCR; SEQ" "DNA" "" "" "0000088007" "00087867" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "PCR; SEQ" "DNA" "" "" "0000088008" "00087868" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "PCR; SEQ" "DNA" "" "" "0000088009" "00087869" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "PCR; SEQ" "DNA" "" "" "0000088010" "00087870" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "PCR; SEQ" "DNA" "" "" "0000088011" "00087871" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "PCR; SEQ" "DNA" "" "" "0000088012" "00087872" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "PCR; SEQ" "DNA" "" "" "0000088013" "00087873" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "PCR; SEQ" "DNA" "" "" "0000088014" "00087874" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "PCR; SEQ" "DNA" "" "" "0000088015" "00087875" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "PCR; SEQ" "DNA" "" "" "0000088016" "00087876" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "PCR;SEQ; arraySNP" "DNA" "" "" "0000088017" "00087877" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "PCR;SEQ; arraySNP" "DNA" "" "" "0000088018" "00087878" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "arraySNP; PCR;SEQ" "DNA" "" "" "0000088019" "00087879" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "PCR;SEQ;arraySNP;SBE" "DNA" "" "" "0000088020" "00087880" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "PCR;SEQ;arraySNP;SBE" "DNA" "" "" "0000088021" "00087881" "1" "00234" "00234" "2012-09-06 09:49:01" "" "" "PCR;SEQ;DHPLC" "DNA" "" "" "0000088022" "00087882" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCR; SEQ; microsat" "DNA" "" "" "0000088023" "00087883" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCR; SEQ; microsat" "DNA" "" "" "0000088024" "00087884" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCR; SEQ; microsat" "DNA" "" "" "0000088025" "00087885" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCR; SEQ; microsat" "DNA" "" "" "0000088026" "00087886" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCR;arraySNP;SEQ;microsat" "DNA" "" "" "0000088027" "00087887" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCR;arraySNP;SEQ;RFLP;microsat" "DNA" "" "" "0000088028" "00087888" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCRm;arraySNP;SEQ;RFLP;microsat" "DNA" "" "" "0000088029" "00087889" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCRm;arraySNP;SEQ;RFLP;microsat" "DNA" "" "" "0000088030" "00087890" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCRm;arraySNP;SEQ;RFLP;microsat" "DNA" "" "" "0000088031" "00087891" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCRm;arraySNP;SEQ;RFLP;microsat" "DNA" "" "" "0000088032" "00087892" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "SEQ;PCRm" "DNA" "" "" "0000088033" "00087893" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "SEQ;PCRm" "DNA" "" "" "0000088034" "00087894" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "RT-PCR;SEQ;SSCA" "DNA" "" "" "0000088035" "00087895" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCR; SEQ; DHPLC" "DNA" "" "" "0000088036" "00087896" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "SEQ;PCRm;PAGE;RFLP" "DNA" "" "" "0000088037" "00087897" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "SEQ" "DNA" "" "" "0000088038" "00087898" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "SEQ" "DNA" "" "" "0000088039" "00087899" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "SSCA;PCRdig;SEQ;PAGE" "DNA" "" "" "0000088040" "00087900" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "SSCA;PCRdig;SEQ;PAGE" "DNA" "" "" "0000088041" "00087901" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "SSCA;PCRdig;SEQ;PAGE" "DNA" "" "" "0000088042" "00087902" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "SSCA;PCRdig;SEQ;PAGE" "DNA" "" "" "0000088043" "00087903" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "RT-PCR;SEQ;SSCA" "DNA" "" "" "0000088044" "00087904" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "arraySNP; PCR;SEQ" "DNA" "" "" "0000088045" "00087905" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCR; arraySNP;SEQ" "DNA" "" "" "0000088046" "00087906" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCR; arraySNP;SEQ" "DNA" "" "" "0000088047" "00087907" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCR; arraySNP;SEQ" "DNA" "" "" "0000088048" "00087908" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCR; arraySNP;SEQ" "DNA" "" "" "0000088049" "00087909" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCR; arraySNP;SEQ" "DNA" "" "" "0000088050" "00087910" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCR; arraySNP;SEQ;RFLP" "DNA" "" "" "0000088051" "00087911" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCRm;SEQ;SSCA;arraySNP" "DNA" "" "" "0000088052" "00087912" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCRm;SEQ;SSCA;arraySNP" "DNA" "" "" "0000088053" "00087913" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCRm;SEQ;SSCA;arraySNP" "DNA" "" "" "0000088054" "00087914" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCRm;SEQ;SSCA;arraySNP" "DNA" "" "" "0000088055" "00087915" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCRm;SEQ;SSCA;arraySNP" "DNA" "" "" "0000088056" "00087916" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCRm;SEQ;SSCA;arraySNP" "DNA" "" "" "0000088057" "00087917" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCRm;SEQ;SSCA;arraySNP" "DNA" "" "" "0000088058" "00087918" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCRm;SEQ;SSCA;arraySNP" "DNA" "" "" "0000088059" "00087919" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCRm;SEQ;SSCA;arraySNP" "DNA" "" "" "0000088060" "00087920" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCRm;SEQ;SSCA;arraySNP" "DNA" "" "" "0000088061" "00087921" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCRm;SEQ;SSCA;arraySNP" "DNA" "" "" "0000088062" "00087922" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCRm;SEQ;SSCA;arraySNP" "DNA" "" "" "0000088063" "00087923" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCRm;SEQ;SSCA;arraySNP" "DNA" "" "" "0000088064" "00087924" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCRm;SEQ;SSCA;arraySNP" "DNA" "" "" "0000088065" "00087925" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCRm;SEQ;SSCA;arraySNP" "DNA" "" "" "0000088066" "00087926" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCRm;SEQ;SSCA;arraySNP" "DNA" "" "" "0000088067" "00087927" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCRm;SEQ;SSCA;arraySNP" "DNA" "" "" "0000088068" "00087928" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCRm;SEQ;SSCA;arraySNP" "DNA" "" "" "0000088069" "00087929" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCRm;SEQ;SSCA;arraySNP" "DNA" "" "" "0000088070" "00087930" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "RT-PCR;SEQ;SSCA" "DNA" "" "" "0000088071" "00087931" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "SSCA;PCRdig;SEQ;PAGE" "DNA" "" "" "0000088072" "00087932" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "SSCA;PCRdig;SEQ;PAGE" "DNA" "" "" "0000088073" "00087933" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCR; SEQ; PCRdig" "DNA" "" "" "0000088074" "00087934" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCR; SEQ; PCRdig" "DNA" "" "" "0000088075" "00087935" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCR; SEQ; PCRdig" "DNA" "" "" "0000088076" "00087936" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCR; SEQ; PCRdig" "DNA" "" "" "0000088077" "00087937" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCR; SEQ; RT-PCR;EMC" "DNA;RNA" "" "" "0000088078" "00087938" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCR; SEQ; RT-PCR;EMC" "DNA;RNA" "" "" "0000088079" "00087939" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCR; SEQ; RT-PCR;EMC" "DNA;RNA" "" "" "0000088080" "00087940" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCR; SEQ; RT-PCR;EMC" "DNA;RNA" "" "" "0000088081" "00087941" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCR; SEQ; RT-PCR;EMC" "DNA;RNA" "" "" "0000088082" "00087942" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "RT-PCR;SEQ;SSCA" "DNA" "" "" "0000088083" "00087943" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "SSCA;PCRdig;SEQ;PAGE" "DNA" "" "" "0000088084" "00087944" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "RT-PCR;SEQ;SSCA" "DNA" "" "" "0000088085" "00087945" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCR; SEQ" "DNA" "" "" "0000088086" "00087946" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCR; SEQ" "DNA" "" "" "0000088087" "00087947" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCR; SEQ" "DNA" "" "" "0000088088" "00087948" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCR; SEQ" "DNA" "" "" "0000088089" "00087949" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCR; SEQ" "DNA" "" "" "0000088090" "00087950" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCR; SEQ" "DNA" "" "" "0000088091" "00087951" "1" "00234" "00234" "2012-09-06 09:49:02" "" "" "PCR; SEQ" "DNA" "" "" "0000088223" "00088083" "1" "00243" "00243" "2015-02-24 10:55:14" "01813" "2015-02-26 07:52:32" "SEQ-NG-I" "DNA" "" "" "0000096356" "00095953" "1" "01769" "01769" "2017-01-26 22:32:17" "" "" "SEQ" "DNA" "WBC" "" "0000100474" "00100071" "1" "01769" "01769" "2017-01-30 15:35:02" "" "" "SEQ" "DNA" "WBC" "" "0000100478" "00100075" "1" "01769" "01769" "2017-01-30 15:52:21" "" "" "SEQ" "DNA" "WBC" "" "0000100485" "00100081" "1" "01769" "01769" "2017-01-30 16:29:05" "" "" "SEQ" "DNA" "WBC" "" "0000100517" "00100113" "1" "01769" "01769" "2017-01-30 20:52:37" "01769" "2017-01-30 20:55:46" "SEQ" "DNA" "WBC" "" "0000100519" "00100115" "1" "01769" "01769" "2017-01-30 21:05:13" "" "" "SEQ" "DNA" "WBC" "" "0000156423" "00155558" "1" "01243" "01243" "2018-03-18 14:37:15" "" "" "SEQ" "DNA" "" "" "0000156424" "00155559" "1" "01243" "01243" "2018-03-18 14:37:15" "" "" "SEQ" "DNA" "" "" "0000156425" "00155560" "1" "01243" "01243" "2018-03-18 14:37:15" "" "" "SEQ" "DNA" "" "" "0000208720" "00207679" "1" "01244" "01244" "2018-11-27 16:17:22" "" "" "SEQ-NG-I" "DNA" "Peripheral blood" "" "0000208736" "00207695" "1" "01244" "01244" "2018-11-28 15:51:32" "" "" "SEQ-NG-I" "DNA" "Peripheral blood" "" "0000233767" "00232668" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233768" "00232669" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233769" "00232670" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233770" "00232671" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233771" "00232672" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233772" "00232673" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233773" "00232674" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233774" "00232675" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233775" "00232676" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233776" "00232677" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233777" "00232678" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233778" "00232679" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233779" "00232680" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233780" "00232681" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233781" "00232682" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234783" "00233684" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234784" "00233685" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234785" "00233686" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000241573" "00240463" "1" "03335" "00008" "2019-06-20 17:48:49" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000245618" "00244507" "1" "01807" "01807" "2019-06-28 09:55:41" "" "" "SEQ" "DNA" "" "" "0000246882" "00245770" "1" "02591" "02591" "2019-07-08 14:44:25" "" "" "SEQ-NG" "DNA" "" "" "0000267003" "00265883" "1" "01807" "01807" "2019-10-10 10:24:43" "" "" "SEQ" "DNA" "" "" "0000295261" "00294093" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295262" "00294094" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000309559" "00308415" "1" "00004" "00006" "2020-08-26 16:56:47" "" "" "SEQ;SEQ-NG" "DNA" "" "123 gene panel" "0000309715" "00308570" "1" "00004" "00006" "2020-08-27 13:01:07" "" "" "SEQ" "DNA" "" "" "0000309770" "00308625" "1" "00004" "00006" "2020-08-27 13:01:07" "" "" "SEQ" "DNA" "" "" "0000310587" "00309442" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310588" "00309443" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310589" "00309444" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310590" "00309445" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310591" "00309446" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310592" "00309447" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310593" "00309448" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310595" "00309450" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310596" "00309451" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310775" "00309630" "1" "00006" "00006" "2020-08-30 12:08:46" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000310815" "00309670" "1" "00006" "00006" "2020-08-31 18:12:02" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000326650" "00325439" "1" "00006" "00006" "2021-01-03 11:36:11" "" "" "SEQ;SEQ-NG" "DNA" "" "199 gene panel" "0000327907" "00326694" "1" "00008" "00008" "2021-01-14 12:28:06" "" "" "arraySEQ" "DNA" "blood" "" "0000332838" "00331619" "1" "00000" "00006" "2021-02-12 13:51:13" "" "" "SEQ-NG" "DNA" "" "" "0000333579" "00332356" "1" "00000" "00006" "2021-02-17 18:00:14" "" "" "SEQ" "DNA" "" "" "0000333580" "00332357" "1" "00000" "00006" "2021-02-17 18:00:14" "" "" "SEQ" "DNA" "" "" "0000333691" "00332467" "1" "00000" "00006" "2021-02-19 15:15:03" "" "" "SEQ-NG" "DNA" "" "150-gene panel" "0000333729" "00332505" "1" "00000" "00006" "2021-02-19 16:33:37" "" "" "SEQ-NG" "DNA" "" "" "0000333769" "00332545" "1" "00000" "00006" "2021-02-20 09:48:27" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000335087" "00333861" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335793" "00334564" "1" "00000" "00006" "2021-03-01 15:50:09" "" "" "SEQ-NG" "DNA" "" "WES" "0000336112" "00334883" "1" "00000" "00006" "2021-03-02 11:57:03" "" "" "SEQ-NG" "DNA" "" "WES" "0000336114" "00334885" "1" "00000" "00006" "2021-03-02 11:57:03" "" "" "SEQ-NG" "DNA" "" "WES" "0000336122" "00334893" "1" "00000" "00006" "2021-03-02 11:57:03" "" "" "SEQ-NG" "DNA" "" "WES" "0000336123" "00334894" "1" "00000" "00006" "2021-03-02 11:57:03" "" "" "SEQ-NG" "DNA" "" "WES" "0000336648" "00335419" "1" "00000" "00006" "2021-03-05 16:19:42" "" "" "SEQ-NG" "DNA" "" "283-gene panel" "0000336669" "00335440" "1" "00000" "00006" "2021-03-05 16:19:42" "" "" "SEQ-NG" "DNA" "" "283-gene panel" "0000336732" "00335503" "1" "00000" "00006" "2021-03-05 19:30:17" "" "" "SEQ-NG" "DNA" "" "72-gene panel" "0000336733" "00335504" "1" "00000" "00006" "2021-03-05 19:30:17" "" "" "SEQ-NG" "DNA" "" "72-gene panel" "0000336734" "00335505" "1" "00000" "00006" "2021-03-05 19:30:17" "" "" "SEQ-NG" "DNA" "" "72-gene panel" "0000337226" "00335996" "1" "00000" "00006" "2021-03-10 17:05:56" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000360565" "00359324" "1" "00000" "00006" "2021-03-19 13:20:32" "" "" "SEQ-NG" "DNA" "" "105-gene panel" "0000364138" "00362910" "1" "00000" "00006" "2021-04-23 19:25:57" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000364160" "00362932" "1" "00000" "00006" "2021-04-23 19:25:57" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000364702" "00363474" "1" "00000" "00006" "2021-04-27 10:42:53" "" "" "SEQ-NG" "DNA" "" "195-gene panel" "0000364814" "00363586" "1" "00000" "00006" "2021-04-29 16:11:05" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000364815" "00363587" "1" "00000" "00006" "2021-04-29 16:11:05" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000364829" "00363601" "1" "00000" "00006" "2021-04-29 16:11:05" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000364870" "00363642" "1" "00000" "00006" "2021-04-29 16:11:05" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000364891" "00363663" "1" "00000" "00006" "2021-04-29 16:11:05" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000364919" "00363691" "1" "00000" "00006" "2021-04-29 16:11:05" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000364936" "00363708" "1" "00000" "00006" "2021-04-29 16:11:05" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000364945" "00363717" "1" "00000" "00006" "2021-04-29 16:11:05" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000364971" "00363743" "1" "00000" "00006" "2021-04-29 16:11:05" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000364974" "00363746" "1" "00000" "00006" "2021-04-29 16:11:05" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373689" "00372456" "1" "00000" "00006" "2021-05-08 09:43:10" "" "" "SEQ-NG" "DNA" "" "163-gene panel" "0000373690" "00372457" "1" "00000" "00006" "2021-05-08 09:43:10" "" "" "SEQ-NG" "DNA" "" "163-gene panel" "0000373726" "00372493" "1" "00000" "00006" "2021-05-08 09:43:10" "" "" "SEQ-NG" "DNA" "" "163-gene panel" "0000373729" "00372496" "1" "00000" "00006" "2021-05-08 09:43:10" "" "" "SEQ-NG" "DNA" "" "163-gene panel" "0000373898" "00372666" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373939" "00372707" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000374650" "00373415" "1" "00000" "00006" "2021-05-14 15:17:31" "" "" "arraySNP;SEQ" "DNA" "" "" "0000375156" "00373924" "1" "00000" "00006" "2021-05-21 15:01:30" "" "" "SEQ-NG" "DNA" "" "238-gene panel" "0000376168" "00374974" "1" "00000" "00006" "2021-05-27 16:02:07" "" "" "SEQ" "DNA" "" "" "0000376169" "00374975" "1" "00000" "00006" "2021-05-27 16:02:07" "" "" "SEQ" "DNA" "" "" "0000376515" "00375318" "1" "00000" "00006" "2021-06-03 08:39:58" "" "" "SEQ-NG" "DNA" "" "193-gene panel" "0000376516" "00375319" "1" "00000" "00006" "2021-06-03 08:39:58" "" "" "SEQ-NG" "DNA" "" "193-gene panel" "0000376517" "00375320" "1" "00000" "00006" "2021-06-03 08:39:58" "" "" "SEQ-NG" "DNA" "" "193-gene panel" "0000376620" "00375423" "1" "00000" "00006" "2021-06-04 09:36:04" "" "" "SEQ-NG" "DNA" "" "WES" "0000377493" "00376297" "1" "00000" "00008" "2021-06-19 02:19:40" "" "" "SEQ-NG" "DNA" "blood" "" "0000377494" "00376298" "1" "00000" "00008" "2021-06-19 02:19:40" "" "" "SEQ-NG" "DNA" "blood" "" "0000377686" "00376481" "1" "00000" "00008" "2021-06-25 02:22:54" "" "" "SEQ;PCR;DHPLC" "DNA" "blood" "" "0000378467" "00377262" "1" "00000" "03840" "2021-07-16 14:18:12" "00006" "2021-08-06 16:49:30" "SEQ-NG-I;SEQ" "DNA" "blood" "targeted resequencing using MIPs library prep; 108-gene panel" "0000378716" "00377513" "1" "04521" "03840" "2021-07-22 15:35:32" "00006" "2023-06-13 22:59:17" "MLPA;SEQ;SEQ-NG" "DNA" "blood" "Targeted next-generation sequencing, CEP290 intronic variant c.2991 +1655A> G, PCR for RPGRIP1 exon 17 deletion, CCT2, CLUAP1, DTHD1, GDF6, and IFT140 seuqencing, The RPGR exon ORF15 analysis, multiplex ligation-dependent probe amplification analysis" "0000380775" "00379576" "1" "00000" "00008" "2021-08-06 03:44:17" "" "" "PCR;SEQ; arraySNP" "DNA" "blood" "" "0000380776" "00379577" "1" "00000" "00008" "2021-08-06 03:44:17" "" "" "PCR;SEQ; arraySNP" "DNA" "blood" "" "0000381100" "00379898" "1" "00000" "03840" "2021-08-10 08:08:19" "" "" "SEQ-NG" "DNA" "" "panel of 441 hereditary eye disease genes including 291 genes related to IRD" "0000381408" "00380206" "1" "00000" "03840" "2021-08-11 10:47:34" "" "" "SEQ-NG" "DNA" "blood" "" "0000381541" "00380327" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "SEQ-NG" "DNA" "blood" "" "0000381542" "00380328" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "SEQ-NG" "DNA" "blood" "" "0000381543" "00380329" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "SEQ-NG" "DNA" "blood" "" "0000381544" "00380330" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "SEQ-NG" "DNA" "blood" "" "0000381545" "00380331" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "SEQ-NG" "DNA" "blood" "" "0000381546" "00380332" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "SEQ-NG" "DNA" "blood" "" "0000381547" "00380333" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "SEQ-NG" "DNA" "blood" "" "0000381548" "00380334" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "SEQ-NG" "DNA" "blood" "" "0000381549" "00380335" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "SEQ-NG" "DNA" "blood" "" "0000381550" "00380336" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "SEQ-NG" "DNA" "blood" "" "0000382212" "00380998" "1" "00000" "00008" "2021-08-25 12:56:54" "" "" "SEQ-NG;SEQp" "DNA" "blood" "targeted exon capture/IROme assay" "0000382252" "00381038" "1" "00000" "00008" "2021-08-25 12:56:54" "" "" "SEQ" "DNA" "blood" "" "0000382262" "00381048" "1" "00000" "00008" "2021-08-25 12:56:54" "" "" "SEQ" "DNA" "blood" "" "0000382413" "00381198" "1" "00009" "00008" "2021-08-27 03:00:16" "" "" "SEQ-NG" "DNA" "blood" "" "0000382414" "00381199" "1" "00009" "00008" "2021-08-27 03:00:16" "" "" "SEQ-NG" "DNA" "blood" "" "0000382415" "00381200" "1" "00009" "00008" "2021-08-27 03:00:16" "" "" "SEQ-NG" "DNA" "blood" "" "0000382434" "00381219" "1" "00009" "00008" "2021-08-27 03:00:16" "" "" "SEQ-NG" "DNA" "blood" "" "0000382435" "00381220" "1" "00009" "00008" "2021-08-27 03:00:16" "" "" "SEQ-NG" "DNA" "blood" "" "0000382442" "00381227" "1" "00009" "00008" "2021-08-27 03:00:16" "" "" "SEQ-NG" "DNA" "blood" "" "0000382443" "00381228" "1" "00009" "00008" "2021-08-27 03:00:16" "" "" "SEQ-NG" "DNA" "blood" "" "0000382444" "00381229" "1" "00009" "00008" "2021-08-27 03:00:16" "" "" "SEQ-NG" "DNA" "blood" "" "0000382830" "00381614" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" "" "0000382833" "00381617" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" "" "0000382834" "00381618" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" "" "0000382857" "00381641" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" "" "0000382866" "00381650" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" "" "0000382875" "00381659" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" "" "0000382877" "00381661" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" "" "0000382880" "00381664" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" "" "0000382885" "00381669" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" "" "0000382887" "00381671" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" "" "0000382935" "00381719" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "PCR;SEQ-NG" "DNA" "blood or a saliva sample" "" "0000383823" "00382609" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383824" "00382610" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000384063" "00382847" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "SEQ" "DNA" "" "" "0000384067" "00382851" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "SEQ" "DNA" "" "" "0000385257" "00384032" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "SEQ-NG-I" "DNA" "" "" "0000385335" "00384110" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "SEQ-NG-I" "DNA" "" "" "0000385336" "00384111" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "SEQ-NG-I" "DNA" "" "" "0000385976" "00384750" "1" "00000" "00008" "2021-10-05 15:28:49" "" "" "arraySEQ;MLPA" "DNA" "" "" "0000386005" "00384779" "1" "00000" "00008" "2021-10-05 15:28:49" "" "" "arraySEQ;MLPA" "DNA" "" "" "0000386226" "00384997" "1" "00000" "03840" "2021-10-06 17:52:46" "" "" "SEQ-NG" "DNA" "" "targeted next-generation sequencing" "0000386262" "00385033" "1" "00000" "03840" "2021-10-06 17:52:46" "" "" "SEQ-NG" "DNA" "" "targeted next-generation sequencing" "0000387426" "00386197" "1" "00000" "03840" "2021-10-20 11:58:39" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000387500" "00386271" "1" "00000" "03840" "2021-10-20 11:58:39" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000387510" "00386281" "1" "00000" "03840" "2021-10-20 11:58:39" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000387845" "00386617" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000387890" "00386662" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000387958" "00386730" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;PCRq" "DNA" "blood" "" "0000388086" "00386858" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000388304" "00387078" "1" "00000" "03840" "2021-10-28 13:59:26" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000389186" "00387950" "1" "00006" "00006" "2021-10-31 21:48:50" "" "" "SEQ" "DNA" "" "" "0000389747" "00388506" "1" "00000" "00008" "2021-11-04 08:27:28" "" "" "SEQ-NG" "DNA" "" "CNV gene panel next-generation sequencing" "0000390180" "00388937" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET2 targeted sequencing panel - see paper" "0000390345" "00389102" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET2 targeted sequencing panel - see paper" "0000390346" "00389103" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000390407" "00389164" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000390408" "00389165" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET9 targeted sequencing panel - see paper" "0000390694" "00389451" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000390695" "00389452" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET7 targeted sequencing panel - see paper" "0000390834" "00389591" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET3 targeted sequencing panel - see paper" "0000390836" "00389593" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper" "0000390991" "00389748" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET7 targeted sequencing panel - see paper" "0000391010" "00389767" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper" "0000391181" "00389938" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET9 targeted sequencing panel - see paper" "0000391652" "00390411" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing" "0000392831" "00391589" "1" "00000" "03840" "2021-11-17 14:55:16" "" "" "?" "DNA" "blood" "NGS gene panel investigation in 60 families, Sanger sequencing in 27 families, and Asper microarray in 25 families" "0000393824" "00392577" "1" "00000" "03840" "2021-11-23 15:06:01" "" "" "SEQ-NG-I;SEQ" "DNA" "" "whole exome sequencing" "0000393840" "00392593" "1" "00000" "03840" "2021-11-23 15:06:01" "" "" "SEQ-NG-I;SEQ" "DNA" "" "whole exome sequencing" "0000394768" "00393520" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000395017" "00393769" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000395160" "00393912" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000395256" "00394008" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG;arraySNP;PCR;SEQ" "DNA" "blood" "WES" "0000395617" "00394370" "1" "00000" "03840" "2021-12-01 10:17:04" "" "" "SEQ-NG" "DNA" "" "retrospective analysis" "0000395883" "00394636" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395884" "00394637" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000397047" "00395808" "1" "00000" "03840" "2021-12-09 13:32:39" "" "" "SEQ-NG" "DNA" "blood" "212 inherited retinal disease-related genes" "0000397893" "00396650" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000405346" "00404108" "1" "00006" "00006" "2022-02-27 18:38:43" "" "" "SEQ" "DNA" "" "" "0000405352" "00404114" "1" "00006" "00006" "2022-02-27 19:55:45" "" "" "SEQ" "DNA" "" "" "0000409557" "00408301" "1" "00000" "03840" "2022-04-20 11:03:55" "" "" "SEQ" "DNA" "" "" "0000409558" "00408302" "1" "00000" "03840" "2022-04-20 11:03:55" "" "" "SEQ" "DNA" "" "" "0000409559" "00408303" "1" "00000" "03840" "2022-04-20 11:03:55" "" "" "SEQ" "DNA" "" "" "0000409560" "00408304" "1" "00000" "03840" "2022-04-20 11:03:55" "" "" "SEQ" "DNA" "" "" "0000409561" "00408305" "1" "00000" "03840" "2022-04-20 11:03:55" "" "" "SEQ" "DNA" "" "" "0000409562" "00408306" "1" "00000" "03840" "2022-04-20 11:03:55" "" "" "SEQ" "DNA" "" "" "0000409563" "00408307" "1" "00000" "03840" "2022-04-20 11:03:55" "" "" "SEQ" "DNA" "" "" "0000409564" "00408308" "1" "00000" "03840" "2022-04-20 11:03:55" "" "" "SEQ" "DNA" "" "" "0000409565" "00408309" "1" "00000" "03840" "2022-04-20 11:03:55" "" "" "SEQ" "DNA" "" "" "0000409566" "00408310" "1" "00000" "03840" "2022-04-20 11:03:55" "" "" "SEQ" "DNA" "" "" "0000409567" "00408311" "1" "00000" "03840" "2022-04-20 11:03:55" "" "" "SEQ" "DNA" "" "" "0000409568" "00408312" "1" "00000" "03840" "2022-04-20 11:03:55" "" "" "SEQ" "DNA" "" "" "0000409569" "00408313" "1" "00000" "03840" "2022-04-20 11:03:55" "" "" "SEQ" "DNA" "" "" "0000409570" "00408314" "1" "00000" "03840" "2022-04-20 11:03:55" "" "" "SEQ" "DNA" "" "" "0000409571" "00408315" "1" "00000" "03840" "2022-04-20 11:03:55" "" "" "SEQ" "DNA" "" "" "0000409572" "00408316" "1" "00000" "03840" "2022-04-20 11:03:55" "" "" "SEQ" "DNA" "" "" "0000409579" "00408323" "1" "00000" "03840" "2022-04-20 13:16:02" "" "" "STR;arraySNP;SEQ" "DNA" "" "" "0000409580" "00408324" "1" "00000" "03840" "2022-04-20 13:16:02" "" "" "STR;arraySNP;SEQ" "DNA" "" "" "0000409583" "00408326" "1" "00000" "03840" "2022-04-20 15:25:39" "" "" "?" "DNA" "" "" "0000409584" "00408327" "1" "00000" "03840" "2022-04-20 15:25:39" "" "" "?" "DNA" "" "" "0000409585" "00408328" "1" "00000" "03840" "2022-04-20 15:25:39" "" "" "?" "DNA" "" "" "0000409586" "00408329" "1" "00000" "03840" "2022-04-20 15:25:39" "" "" "?" "DNA" "" "" "0000409587" "00408330" "1" "00000" "03840" "2022-04-20 15:25:39" "" "" "?" "DNA" "" "" "0000409588" "00408331" "1" "00000" "03840" "2022-04-20 15:25:39" "" "" "?" "DNA" "" "" "0000409619" "00408362" "1" "00000" "03840" "2022-04-20 16:36:56" "" "" "SEQ;SEQ-NG" "DNA" "" "135 of the most common LCA-causing variations, followed by sequencing of 61 regions in 14 causative genes in LCA; whole exome sequencing" "0000409621" "00408364" "1" "00000" "03840" "2022-04-20 18:49:08" "" "" "SEQ;SEQ-NG" "DNA" "" "retrospective study" "0000409622" "00408365" "1" "00000" "03840" "2022-04-20 18:49:08" "" "" "SEQ;SEQ-NG" "DNA" "" "retrospective study" "0000409623" "00408366" "1" "00000" "03840" "2022-04-20 18:49:08" "" "" "SEQ;SEQ-NG" "DNA" "" "retrospective study" "0000409624" "00408367" "1" "00000" "03840" "2022-04-20 18:49:08" "" "" "SEQ;SEQ-NG" "DNA" "" "retrospective study" "0000409625" "00408368" "1" "00000" "03840" "2022-04-20 18:49:08" "" "" "SEQ;SEQ-NG" "DNA" "" "retrospective study" "0000409626" "00408369" "1" "00000" "03840" "2022-04-20 18:49:08" "" "" "SEQ;SEQ-NG" "DNA" "" "retrospective study" "0000409627" "00408370" "1" "00000" "03840" "2022-04-20 18:49:08" "" "" "SEQ;SEQ-NG" "DNA" "" "retrospective study" "0000409628" "00408371" "1" "00000" "03840" "2022-04-20 18:49:08" "" "" "SEQ;SEQ-NG" "DNA" "" "retrospective study" "0000409629" "00408372" "1" "00000" "03840" "2022-04-20 18:49:08" "" "" "SEQ;SEQ-NG" "DNA" "" "retrospective study" "0000409630" "00408373" "1" "00000" "03840" "2022-04-20 18:49:08" "" "" "SEQ;SEQ-NG" "DNA" "" "retrospective study" "0000409631" "00408374" "1" "00000" "03840" "2022-04-20 20:24:55" "" "" "SEQ;STR" "DNA" "" "" "0000409632" "00408375" "1" "00000" "03840" "2022-04-20 20:24:55" "" "" "SEQ;STR" "DNA" "" "" "0000409633" "00408376" "1" "00000" "03840" "2022-04-20 20:24:55" "" "" "SEQ;STR" "DNA" "" "" "0000409634" "00408377" "1" "00000" "03840" "2022-04-20 20:24:55" "" "" "SEQ;STR" "DNA" "" "" "0000409635" "00408378" "1" "00000" "03840" "2022-04-20 20:24:55" "" "" "SEQ;STR" "DNA" "" "" "0000409636" "00408379" "1" "00000" "03840" "2022-04-20 20:24:55" "" "" "SEQ;STR" "DNA" "" "" "0000409637" "00408380" "1" "00000" "03840" "2022-04-20 20:24:55" "" "" "SEQ;STR" "DNA" "" "" "0000409638" "00408381" "1" "00000" "03840" "2022-04-20 20:24:55" "" "" "SEQ;STR" "DNA" "" "" "0000409639" "00408382" "1" "00000" "03840" "2022-04-20 20:24:55" "" "" "SEQ;STR" "DNA" "" "" "0000409640" "00408383" "1" "00000" "03840" "2022-04-20 20:24:55" "" "" "SEQ;STR" "DNA" "" "" "0000409641" "00408384" "1" "00000" "03840" "2022-04-20 20:24:55" "" "" "SEQ;STR" "DNA" "" "" "0000409642" "00408385" "1" "00000" "03840" "2022-04-20 20:24:55" "" "" "SEQ;STR" "DNA" "" "" "0000409643" "00408386" "1" "00000" "03840" "2022-04-20 20:24:55" "" "" "SEQ;STR" "DNA" "" "" "0000409644" "00408387" "1" "00000" "03840" "2022-04-20 20:24:55" "" "" "SEQ;STR" "DNA" "" "" "0000409645" "00408388" "1" "00000" "03840" "2022-04-20 20:45:47" "" "" "SEQ-NG;SEQ" "DNA" "" "disease-specific IRD next-generation sequencing SmartPanel (250 genes) v9" "0000409654" "00408397" "1" "00000" "03840" "2022-04-20 22:53:40" "" "" "SEQ-NG;SEQ" "DNA" "" "whole exome sequencing in two siblings in whom a single pathogenic variant in TULP1 was found previously" "0000409655" "00408398" "1" "00000" "03840" "2022-04-20 22:53:40" "" "" "SEQ-NG;SEQ" "DNA" "" "whole exome sequencing in two siblings in whom a single pathogenic variant in TULP1 was found previously" "0000409681" "00408424" "1" "00000" "03840" "2022-04-21 15:58:46" "" "" "SEQ-NG;SEQ" "DNA" "" "targeted gene analysis or a next-generation sequencing-based gene panel" "0000409682" "00408425" "1" "00000" "03840" "2022-04-21 15:58:46" "" "" "SEQ-NG;SEQ" "DNA" "" "targeted gene analysis or a next-generation sequencing-based gene panel" "0000412608" "00411338" "1" "04333" "04333" "2022-06-12 10:19:39" "" "" "SEQ-NG" "DNA" "" "MIPs" "0000412609" "00411339" "1" "04333" "04333" "2022-06-12 10:22:42" "" "" "SEQ-NG" "DNA" "" "MIPs" "0000412610" "00411340" "1" "04333" "04333" "2022-06-12 10:25:23" "" "" "SEQ-NG" "DNA" "" "WES" "0000412611" "00411341" "1" "04333" "04333" "2022-06-12 10:27:23" "" "" "SEQ-NG" "DNA" "" "WES" "0000421728" "00420419" "1" "00000" "03840" "2022-11-02 10:32:06" "" "" "SEQ-NG" "DNA" "" "targeted 212 IRD-related genes" "0000429152" "00427828" "1" "01164" "01164" "2022-12-15 12:30:24" "" "" "SEQ-NG-I" "DNA" "" "" "0000430969" "00429556" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000430973" "00429560" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431077" "00429664" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431120" "00429707" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431151" "00429738" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431169" "00429756" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431230" "00429817" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431232" "00429819" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431309" "00429896" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431398" "00429985" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431556" "00430143" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000448550" "00446973" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS" "0000448582" "00447005" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS" "0000448853" "00447276" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS" "0000448875" "00447298" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS" "0000449077" "00447500" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000449111" "00447534" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000449273" "00447696" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000449302" "00447725" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000452624" "00451026" "1" "04405" "00006" "2024-03-27 11:47:00" "" "" "SEQ;SEQ-NG" "DNA" "" "smMIP-based 105 iMD/AMD genes" "0000452625" "00451027" "1" "04405" "00006" "2024-03-27 11:47:00" "" "" "SEQ;SEQ-NG" "DNA" "" "smMIP-based 105 iMD/AMD genes" "0000452626" "00451028" "1" "04405" "00006" "2024-03-27 11:47:00" "" "" "SEQ;SEQ-NG" "DNA" "" "smMIP-based 105 iMD/AMD genes" "0000452627" "00451029" "1" "04405" "00006" "2024-03-27 11:47:00" "" "" "SEQ;SEQ-NG" "DNA" "" "smMIP-based 105 iMD/AMD genes" "0000452667" "00451068" "1" "00006" "00006" "2024-05-31 11:39:36" "" "" "SEQ" "DNA" "" "smMIP-based 105 iMD/AMD genes" "0000452850" "00451251" "1" "00006" "00006" "2024-05-31 11:39:36" "" "" "SEQ" "DNA" "" "smMIP-based 105 iMD/AMD genes" "0000453145" "00451544" "1" "04543" "00006" "2024-06-10 15:00:36" "" "" "SEQ;SEQ-NG" "DNA" "" "smMIPs" "0000453146" "00451545" "1" "04543" "00006" "2024-06-10 15:00:36" "" "" "SEQ;SEQ-NG" "DNA" "" "smMIPs" "0000453154" "00451553" "1" "04543" "00006" "2024-06-10 15:00:36" "" "" "SEQ;SEQ-NG" "DNA" "" "smMIPs" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 376 "{{screeningid}}" "{{geneid}}" "0000014360" "APC" "0000014384" "APC" "0000087964" "TULP1" "0000087965" "TULP1" "0000087966" "TULP1" "0000087967" "TULP1" "0000087968" "TULP1" "0000087969" "TULP1" "0000087970" "TULP1" "0000087971" "TULP1" "0000087972" "TULP1" "0000087973" "TULP1" "0000087974" "TULP1" "0000087975" "TULP1" "0000087976" "TULP1" "0000087977" "TULP1" "0000087978" "TULP1" "0000087979" "TULP1" "0000087980" "TULP1" "0000087981" "TULP1" "0000087982" "TULP1" "0000087983" "TULP1" "0000087984" "TULP1" "0000087985" "TULP1" "0000087986" "TULP1" "0000087987" "TULP1" "0000087988" "TULP1" "0000087989" "TULP1" "0000087990" "TULP1" "0000087991" "TULP1" "0000087992" "TULP1" "0000087993" "TULP1" "0000087994" "TULP1" "0000087995" "TULP1" "0000087996" "TULP1" "0000087997" "TULP1" "0000087998" "TULP1" "0000087999" "TULP1" "0000088000" "TULP1" "0000088001" "TULP1" "0000088002" "TULP1" "0000088003" "TULP1" "0000088004" "TULP1" "0000088005" "TULP1" "0000088006" "TULP1" "0000088007" "TULP1" "0000088008" "TULP1" "0000088009" "TULP1" "0000088010" "TULP1" "0000088011" "TULP1" "0000088012" "TULP1" "0000088013" "TULP1" "0000088014" "TULP1" "0000088015" "TULP1" "0000088016" "TULP1" "0000088017" "TULP1" "0000088018" "TULP1" "0000088019" "TULP1" "0000088020" "TULP1" "0000088021" "TULP1" "0000088022" "TULP1" "0000088023" "TULP1" "0000088024" "TULP1" "0000088025" "TULP1" "0000088026" "TULP1" "0000088027" "TULP1" "0000088028" "TULP1" "0000088029" "TULP1" "0000088030" "TULP1" "0000088031" "TULP1" "0000088032" "TULP1" "0000088033" "TULP1" "0000088034" "TULP1" "0000088035" "TULP1" "0000088036" "TULP1" "0000088037" "TULP1" "0000088038" "TULP1" "0000088039" "TULP1" "0000088040" "TULP1" "0000088041" "TULP1" "0000088042" "TULP1" "0000088043" "TULP1" "0000088044" "TULP1" "0000088045" "TULP1" "0000088046" "TULP1" "0000088047" "TULP1" "0000088048" "TULP1" "0000088049" "TULP1" "0000088050" "TULP1" "0000088051" "TULP1" "0000088052" "TULP1" "0000088053" "TULP1" "0000088054" "TULP1" "0000088055" "TULP1" "0000088056" "TULP1" "0000088057" "TULP1" "0000088058" "TULP1" "0000088059" "TULP1" "0000088060" "TULP1" "0000088061" "TULP1" "0000088062" "TULP1" "0000088063" "TULP1" "0000088064" "TULP1" "0000088065" "TULP1" "0000088066" "TULP1" "0000088067" "TULP1" "0000088068" "TULP1" "0000088069" "TULP1" "0000088070" "TULP1" "0000088071" "TULP1" "0000088072" "TULP1" "0000088073" "TULP1" "0000088074" "TULP1" "0000088075" "TULP1" "0000088076" "TULP1" "0000088077" "TULP1" "0000088078" "TULP1" "0000088079" "TULP1" "0000088080" "TULP1" "0000088081" "TULP1" "0000088082" "TULP1" "0000088083" "TULP1" "0000088084" "TULP1" "0000088085" "TULP1" "0000088086" "TULP1" "0000088087" "TULP1" "0000088088" "TULP1" "0000088089" "TULP1" "0000088090" "TULP1" "0000088091" "TULP1" "0000088223" "TULP1" "0000096356" "TULP1" "0000100474" "TULP1" "0000100478" "TULP1" "0000100485" "TULP1" "0000100517" "TULP1" "0000100519" "TULP1" "0000156423" "TULP1" "0000156424" "TULP1" "0000156425" "TULP1" "0000233767" "TULP1" "0000233768" "TULP1" "0000233769" "TULP1" "0000233770" "TULP1" "0000233771" "TULP1" "0000233772" "TULP1" "0000233773" "TULP1" "0000233774" "TULP1" "0000233775" "TULP1" "0000233776" "TULP1" "0000233777" "TULP1" "0000233778" "TULP1" "0000233779" "TULP1" "0000233780" "TULP1" "0000233781" "TULP1" "0000234783" "TULP1" "0000234784" "TULP1" "0000234785" "TULP1" "0000241573" "TULP1" "0000246882" "TULP1" "0000309559" "TULP1" "0000309715" "TULP1" "0000309770" "TULP1" "0000310587" "TULP1" "0000310588" "TULP1" "0000310589" "TULP1" "0000310590" "TULP1" "0000310591" "TULP1" "0000310592" "TULP1" "0000310593" "TULP1" "0000310595" "TULP1" "0000310596" "TULP1" "0000310815" "ROM1" "0000326650" "TULP1" "0000327907" "TULP1" "0000332838" "PCDH15" "0000332838" "TULP1" "0000333579" "TULP1" "0000333580" "TULP1" "0000333691" "TULP1" "0000333729" "TULP1" "0000333769" "TULP1" "0000335087" "TULP1" "0000335793" "C8orf37" "0000335793" "ROM1" "0000335793" "TULP1" "0000336112" "TULP1" "0000336114" "TULP1" "0000336122" "TULP1" "0000336123" "TULP1" "0000336648" "TULP1" "0000336669" "TULP1" "0000336732" "TULP1" "0000336733" "TULP1" "0000336734" "TULP1" "0000337226" "TULP1" "0000360565" "TULP1" "0000364138" "TULP1" "0000364160" "TULP1" "0000364702" "TULP1" "0000364814" "TULP1" "0000364815" "TULP1" "0000364829" "TULP1" "0000364870" "TULP1" "0000364891" "TULP1" "0000364919" "TULP1" "0000364936" "TULP1" "0000364945" "TULP1" "0000364971" "TULP1" "0000364974" "TULP1" "0000373689" "TULP1" "0000373690" "TULP1" "0000373726" "TULP1" "0000373729" "TULP1" "0000374650" "TULP1" "0000375156" "TULP1" "0000376168" "TULP1" "0000376169" "TULP1" "0000376515" "RPGR" "0000376516" "TULP1" "0000376517" "TULP1" "0000377493" "TULP1" "0000377494" "TULP1" "0000377686" "TULP1" "0000378467" "TULP1" "0000380775" "TULP1" "0000380776" "TULP1" "0000381100" "TULP1" "0000381408" "TULP1" "0000381541" "TULP1" "0000381542" "TULP1" "0000381543" "TULP1" "0000381544" "TULP1" "0000381545" "TULP1" "0000381546" "TULP1" "0000381547" "TULP1" "0000381548" "TULP1" "0000381549" "TULP1" "0000381550" "TULP1" "0000382212" "TULP1" "0000382252" "TULP1" "0000382262" "TULP1" "0000382413" "TULP1" "0000382414" "TULP1" "0000382415" "TULP1" "0000382434" "TULP1" "0000382435" "TULP1" "0000382442" "TULP1" "0000382443" "TULP1" "0000382444" "TULP1" "0000382830" "CRX" "0000382833" "TULP1" "0000382834" "TULP1" "0000382857" "TULP1" "0000382866" "TULP1" "0000382875" "TULP1" "0000382877" "TULP1" "0000382880" "TULP1" "0000382885" "TULP1" "0000382887" "TULP1" "0000382935" "TULP1" "0000383823" "TULP1" "0000383824" "TULP1" "0000384063" "TULP1" "0000384067" "TULP1" "0000385257" "TULP1" "0000385335" "TULP1" "0000385336" "TULP1" "0000385976" "TULP1" "0000386005" "TULP1" "0000386226" "TULP1" "0000386262" "TULP1" "0000387426" "GNAT2" "0000387500" "FAM161A" "0000387510" "ABCA4" "0000387845" "TULP1" "0000387890" "TULP1" "0000387958" "TULP1" "0000388086" "TULP1" "0000388304" "TULP1" "0000389186" "TULP1" "0000389747" "PRPF31" "0000390180" "TULP1" "0000390345" "TULP1" "0000390346" "TULP1" "0000390407" "TULP1" "0000390408" "TULP1" "0000390694" "TULP1" "0000390695" "TULP1" "0000390834" "TULP1" "0000390836" "TULP1" "0000390991" "TULP1" "0000391010" "TULP1" "0000391181" "TULP1" "0000391652" "TULP1" "0000392831" "TULP1" "0000393824" "TULP1" "0000393840" "TULP1" "0000394768" "TULP1" "0000395017" "TULP1" "0000395160" "TULP1" "0000395256" "TULP1" "0000395617" "TULP1" "0000395883" "TULP1" "0000395884" "TULP1" "0000397047" "TULP1" "0000397893" "PRPF8" "0000405346" "TULP1" "0000405352" "TULP1" "0000409557" "TULP1" "0000409558" "TULP1" "0000409559" "TULP1" "0000409560" "TULP1" "0000409561" "TULP1" "0000409562" "TULP1" "0000409563" "TULP1" "0000409564" "TULP1" "0000409565" "TULP1" "0000409566" "TULP1" "0000409567" "TULP1" "0000409568" "TULP1" "0000409569" "TULP1" "0000409570" "TULP1" "0000409571" "TULP1" "0000409572" "TULP1" "0000409579" "TULP1" "0000409580" "TULP1" "0000409583" "TULP1" "0000409584" "TULP1" "0000409585" "TULP1" "0000409586" "TULP1" "0000409587" "TULP1" "0000409588" "MAK" "0000409619" "TULP1" "0000409621" "TULP1" "0000409622" "TULP1" "0000409623" "TULP1" "0000409624" "TULP1" "0000409625" "TULP1" "0000409626" "TULP1" "0000409627" "TULP1" "0000409628" "TULP1" "0000409629" "TULP1" "0000409630" "TULP1" "0000409631" "TULP1" "0000409632" "TULP1" "0000409633" "TULP1" "0000409634" "TULP1" "0000409635" "TULP1" "0000409636" "TULP1" "0000409637" "TULP1" "0000409638" "TULP1" "0000409639" "TULP1" "0000409640" "TULP1" "0000409641" "TULP1" "0000409642" "TULP1" "0000409643" "TULP1" "0000409644" "TULP1" "0000409645" "TULP1" "0000409654" "TULP1" "0000409655" "TULP1" "0000409681" "TULP1" "0000409682" "TULP1" "0000421728" "TULP1" "0000429152" "TULP1" "0000430969" "TULP1" "0000430973" "TULP1" "0000431077" "TULP1" "0000431120" "TULP1" "0000431151" "TULP1" "0000431169" "TULP1" "0000431230" "TULP1" "0000431232" "TULP1" "0000431309" "TULP1" "0000431398" "TULP1" "0000431556" "TULP1" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 555 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000019523" "0" "55" "6" "35473516" "35473516" "subst" "0" "00102" "TULP1_000044" "g.35473516A>G" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.35505739A>G" "" "VUS" "" "0000019524" "0" "55" "6" "35467877" "35467877" "subst" "0.000418274" "00102" "TULP1_000045" "g.35467877A>G" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.35500100A>G" "" "VUS" "" "0000141408" "21" "75" "6" "35480415" "35480415" "subst" "4.06273E-6" "00234" "TULP1_000001" "g.35480415C>T" "" "{PMID:Hagstrom 1998:09462750}" "" "IVS2+1, G->A" "" "Germline" "" "" "0" "" "" "g.35512638C>T" "" "likely pathogenic" "" "0000141409" "11" "95" "6" "35480415" "35480415" "subst" "4.06273E-6" "00234" "TULP1_000001" "g.35480415C>T" "" "{PMID:Banerjee 1998:09462751}" "" "IVS2+1G>A" "" "Germline" "" "" "0" "" "" "g.35512638C>T" "" "pathogenic" "" "0000141410" "1" "95" "6" "35480415" "35480415" "subst" "4.06273E-6" "00234" "TULP1_000001" "g.35480415C>T" "" "{PMID:Hanein 2004:15024725}" "" "c.99+1G>A" "" "Germline" "" "" "0" "" "" "g.35512638C>T" "" "pathogenic" "" "0000141411" "3" "15" "6" "35479574" "35479574" "subst" "0" "00234" "TULP1_000005" "g.35479574G" "2/26 chromosomes (0.08)" "{PMID:Banerjee 1998:09462751}" "" "AGG->ACG / p.(Arg67Thr)" "Variant Error [ESYNTAX]: This genomic variant has an error (char 25: end of input). Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "benign" "" "0000141412" "3" "35" "6" "35479574" "35479574" "subst" "0" "00234" "TULP1_000005" "g.35479574G" "" "{PMID:Gu 1998:09660588}" "" "Arg67Thr" "Linkage Analysis\r\nVariant Error [ESYNTAX]: This genomic variant has an error (char 25: end of input). Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "likely benign" "" "0000141413" "3" "35" "6" "35479574" "35479574" "subst" "0" "00234" "TULP1_000005" "g.35479574G" "" "{PMID:Hagstrom 1998:09462750}" "" "AGG->ACG / p.(Arg67Thr)" "Variant Error [ESYNTAX]: This genomic variant has an error (char 25: end of input). Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "likely benign" "" "0000141414" "21" "95" "6" "35478787" "35478789" "del" "4.2002E-6" "00234" "TULP1_000006" "g.35478787_35478789del" "" "{PMID:Paloma 2000:10711677}" "MspI+" "IVS4-2delAGA" "" "Germline" "" "" "0" "" "" "g.35511010_35511012del" "" "pathogenic" "" "0000141415" "1" "95" "6" "35478720" "35478743" "del" "0" "00234" "TULP1_000008" "g.35478720_35478743del" "" "{PMID:Gu 1998:09660588}" "" "394del24 E120-D127del" "" "Germline" "" "" "0" "" "" "g.35510943_35510966del" "" "pathogenic" "" "0000141416" "1" "95" "6" "35478720" "35478743" "del" "0" "00234" "TULP1_000008" "g.35478720_35478743del" "2/50 controls" "{PMID:Paloma 2000:10711677}" "" "394del24 E120-D127del" "" "Germline" "" "" "0" "" "" "g.35510943_35510966del" "" "pathogenic" "" "0000141417" "3" "75" "6" "35477409" "35477409" "subst" "0" "00234" "TULP1_000009" "g.35477409A>G" "" "{PMID:den Hollander 2007:18055821}" "" "c.718+2T>C" "" "Germline" "" "" "0" "" "" "g.35509632A>G" "" "likely pathogenic" "" "0000141418" "3" "75" "6" "35477409" "35477409" "subst" "0" "00234" "TULP1_000009" "g.35477409A>G" "" "{PMID:den Hollander 2007:18055821}" "" "c.718+2T>C" "" "Germline" "" "" "0" "" "" "g.35509632A>G" "" "likely pathogenic" "" "0000141419" "3" "35" "6" "35477108" "35477108" "subst" "4.06138E-6" "00234" "TULP1_000010" "g.35477108A>T" "" "{PMID:Hagstrom 1998:09462750}" "" "IVS7-19T/TTGTTTC->TTGATTC" "" "Germline" "" "" "0" "" "" "g.35509331A>T" "" "likely benign" "" "0000141420" "11" "35" "6" "35477071" "35477071" "subst" "0" "00234" "TULP1_000011" "g.35477071G>A" "" "{PMID:Hagstrom 1998:09462750}" "" "GCG->GTG" "Variant Error [EREF/EREF]: This genomic variant does not match the reference sequence; the transcript variant does not match the reference sequence either. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "likely benign" "" "0000141421" "3" "15" "6" "35477032" "35477032" "subst" "0.380733" "00234" "TULP1_000012" "g.35477032A>G" "0.23" "{PMID:Banerjee 1998:09462751}" "" "ATA->ACA" "" "Germline" "" "" "0" "" "" "g.35509255A>G" "" "benign" "" "0000141422" "1" "35" "6" "35477032" "35477032" "subst" "0.380733" "00234" "TULP1_000012" "g.35477032A>G" "" "{PMID:Mataftsi 2007:17962469}" "" "I259T (ATA-to-ACA)" "" "Germline" "" "" "0" "" "" "g.35509255A>G" "" "likely benign" "" "0000141423" "3" "75" "6" "35477032" "35477032" "subst" "0.380733" "00234" "TULP1_000012" "g.35477032A>G" "" "{PMID:Hagstrom 1998:09462750}" "" "ATA->ACA" "" "Germline" "" "" "0" "" "" "g.35509255A>G" "" "likely pathogenic" "" "0000141424" "21" "75" "6" "35477032" "35477032" "subst" "0.380733" "00234" "TULP1_000012" "g.35477032A>G" "" "{PMID:Hagstrom 1998:09462750}" "" "ATA->ACA" "" "Germline" "" "" "0" "" "" "g.35509255A>G" "" "likely pathogenic" "" "0000141425" "21" "75" "6" "35477032" "35477032" "subst" "0.380733" "00234" "TULP1_000012" "g.35477032A>G" "" "{PMID:Hagstrom 1998:09462750}" "" "ATA->ACA" "" "Germline" "" "" "0" "" "" "g.35509255A>G" "" "likely pathogenic" "" "0000141426" "11" "75" "6" "35477025" "35477025" "subst" "0" "00234" "TULP1_000013" "g.35477025C" "" "{PMID:Hagstrom 1998:09462750}" "" "AAC->AAG / 783C>G / p.(Asn261Lys)" "Variant Error [ESYNTAX]: This genomic variant has an error (char 25: end of input). Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000141427" "11" "75" "6" "35477025" "35477025" "subst" "0" "00234" "TULP1_000013" "g.35477025C" "" "{PMID:Hagstrom 1998:09462750}" "" "AAC->AAG / 783C>G / p.(Asn261Lys)" "Variant Error [ESYNTAX]: This genomic variant has an error (char 25: end of input). Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000141428" "3" "15" "6" "35477025" "35477025" "subst" "0" "00234" "TULP1_000013" "g.35477025C" "3/28 chromosomes (0.11)" "{PMID:Banerjee 1998:09462751}" "" "AAC->AAG / 783C>G / p.(Asn261Lys)" "Variant Error [ESYNTAX]: This genomic variant has an error (char 25: end of input). Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "benign" "" "0000141429" "3" "15" "6" "35477025" "35477025" "subst" "0" "00234" "TULP1_000013" "g.35477025C" "3/28 chromosomes (0.11)" "{PMID:Banerjee 1998:09462751}" "" "AAC->AAG / 783C>G / p.(Asn261Lys)" "Technique: also used electrophoresis\r\nVariant Error [ESYNTAX]: This genomic variant has an error (char 25: end of input). Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "benign" "" "0000141430" "3" "35" "6" "35477025" "35477025" "subst" "0.822024" "00234" "TULP1_000014" "g.35477025C>G" "" "{PMID:Mataftsi  2007:17962469}" "" "K261N (AAG-to-AAC)" "" "De novo" "" "" "0" "" "" "g.35509248C>G" "" "likely benign" "" "0000141431" "3" "95" "6" "35473878" "35473878" "subst" "0" "00234" "TULP1_000004" "g.35473878G>A" "" "{PMID:Li 2009:18936139}" "" "codon position 301(Q301X)" "" "Germline" "" "" "0" "" "" "g.35506101G>A" "" "pathogenic" "" "0000141432" "3" "95" "6" "35473878" "35473878" "subst" "0" "00234" "TULP1_000004" "g.35473878G>A" "" "{PMID:Li 2009:18936139}" "" "codon position 301(Q301X)" "" "Germline" "" "" "0" "" "" "g.35506101G>A" "" "pathogenic" "" "0000141433" "3" "95" "6" "35473878" "35473878" "subst" "0" "00234" "TULP1_000004" "g.35473878G>A" "" "{PMID:Li 2009:18936139}" "" "codon position 301(Q301X)" "" "Germline" "" "" "0" "" "" "g.35506101G>A" "" "pathogenic" "" "0000141434" "3" "95" "6" "35473878" "35473878" "subst" "0" "00234" "TULP1_000004" "g.35473878G>A" "" "{PMID:Li 2009:18936139}" "" "codon position 301(Q301X)" "" "Germline" "" "" "0" "" "" "g.35506101G>A" "" "pathogenic" "" "0000141435" "3" "95" "6" "35473878" "35473878" "subst" "0" "00234" "TULP1_000004" "g.35473878G>A" "" "{PMID:Li 2009:18936139}" "" "codon position 301(Q301X)" "" "Germline" "" "" "0" "" "" "g.35506101G>A" "" "pathogenic" "" "0000141436" "3" "95" "6" "35473878" "35473878" "subst" "0" "00234" "TULP1_000004" "g.35473878G>A" "" "{PMID:Li 2009:18936139}" "" "codon position 301(Q301X)" "" "Germline" "" "" "0" "" "" "g.35506101G>A" "" "pathogenic" "" "0000141437" "3" "95" "6" "35473878" "35473878" "subst" "0" "00234" "TULP1_000004" "g.35473878G>A" "" "{PMID:Li 2009:18936139}" "" "codon position 301(Q301X)" "" "Germline" "" "" "0" "" "" "g.35506101G>A" "" "pathogenic" "" "0000141438" "3" "95" "6" "35473878" "35473878" "subst" "0" "00234" "TULP1_000004" "g.35473878G>A" "" "{PMID:Li 2009:18936139}" "" "codon position 301(Q301X)" "" "Germline" "" "" "0" "" "" "g.35506101G>A" "" "pathogenic" "" "0000141439" "3" "95" "6" "35473878" "35473878" "subst" "0" "00234" "TULP1_000004" "g.35473878G>A" "" "{PMID:Li 2009:18936139}" "" "codon position 301(Q301X)" "" "Germline" "" "" "0" "" "" "g.35506101G>A" "" "pathogenic" "" "0000141440" "3" "95" "6" "35473878" "35473878" "subst" "0" "00234" "TULP1_000004" "g.35473878G>A" "" "{PMID:Li 2009:18936139}" "" "codon position 301(Q301X)" "" "Germline" "" "" "0" "" "" "g.35506101G>A" "" "pathogenic" "" "0000141441" "3" "95" "6" "35473878" "35473878" "subst" "0" "00234" "TULP1_000004" "g.35473878G>A" "" "{PMID:Li 2009:18936139}" "" "codon position 301(Q301X)" "" "Germline" "" "" "0" "" "" "g.35506101G>A" "" "pathogenic" "" "0000141442" "3" "95" "6" "35473878" "35473878" "subst" "0" "00234" "TULP1_000004" "g.35473878G>A" "" "{PMID:Li 2009:18936139}" "" "codon position 301(Q301X)" "" "Germline" "" "" "0" "" "" "g.35506101G>A" "" "pathogenic" "" "0000141443" "3" "95" "6" "35473878" "35473878" "subst" "0" "00234" "TULP1_000004" "g.35473878G>A" "" "{PMID:Li 2009:18936139}" "" "codon position 301(Q301X)" "" "Germline" "" "" "0" "" "" "g.35506101G>A" "" "pathogenic" "" "0000141444" "3" "95" "6" "35473878" "35473878" "subst" "0" "00234" "TULP1_000004" "g.35473878G>A" "" "{PMID:Li 2009:18936139}" "" "codon position 301(Q301X)" "" "Germline" "" "" "0" "" "" "g.35506101G>A" "" "pathogenic" "" "0000141445" "3" "95" "6" "35473878" "35473878" "subst" "0" "00234" "TULP1_000004" "g.35473878G>A" "" "{PMID:Li 2009:18936139}" "" "codon position 301(Q301X)" "" "Germline" "" "" "0" "" "" "g.35506101G>A" "" "pathogenic" "" "0000141446" "3" "95" "6" "35473878" "35473878" "subst" "0" "00234" "TULP1_000004" "g.35473878G>A" "" "{PMID:Li 2009:18936139}" "" "codon position 301(Q301X)" "" "Germline" "" "" "0" "" "" "g.35506101G>A" "" "pathogenic" "" "0000141447" "3" "95" "6" "35473878" "35473878" "subst" "0" "00234" "TULP1_000004" "g.35473878G>A" "" "{PMID:Li 2009:18936139}" "" "codon position 301(Q301X)" "" "Germline" "" "" "0" "" "" "g.35506101G>A" "" "pathogenic" "" "0000141448" "3" "95" "6" "35473878" "35473878" "subst" "0" "00234" "TULP1_000004" "g.35473878G>A" "" "{PMID:Li 2009:18936139}" "" "codon position 301(Q301X)" "" "Germline" "" "" "0" "" "" "g.35506101G>A" "" "pathogenic" "" "0000141449" "3" "95" "6" "35473878" "35473878" "subst" "0" "00234" "TULP1_000004" "g.35473878G>A" "" "{PMID:Li 2009:18936139}" "" "codon position 301(Q301X)" "" "Germline" "" "" "0" "" "" "g.35506101G>A" "" "pathogenic" "" "0000141450" "3" "95" "6" "35473878" "35473878" "subst" "0" "00234" "TULP1_000004" "g.35473878G>A" "" "{PMID:Li 2009:18936139}" "" "codon position 301(Q301X)" "" "Germline" "" "" "0" "" "" "g.35506101G>A" "" "pathogenic" "" "0000141451" "3" "95" "6" "35473878" "35473878" "subst" "0" "00234" "TULP1_000004" "g.35473878G>A" "" "{PMID:Li 2009:18936139}" "" "codon position 301(Q301X)" "" "Germline" "" "" "0" "" "" "g.35506101G>A" "" "pathogenic" "" "0000141452" "3" "95" "6" "35473878" "35473878" "subst" "0" "00234" "TULP1_000004" "g.35473878G>A" "" "{PMID:Li 2009:18936139}" "" "codon position 301(Q301X)" "" "Germline" "" "" "0" "" "" "g.35506101G>A" "" "pathogenic" "" "0000141453" "3" "95" "6" "35473878" "35473878" "subst" "0" "00234" "TULP1_000004" "g.35473878G>A" "" "{PMID:Li 2009:18936139}" "" "codon position 301(Q301X)" "" "Germline" "" "" "0" "" "" "g.35506101G>A" "" "pathogenic" "" "0000141454" "3" "95" "6" "35473878" "35473878" "subst" "0" "00234" "TULP1_000004" "g.35473878G>A" "" "{PMID:Li 2009:18936139}" "" "codon position 301(Q301X)" "" "Germline" "" "" "0" "" "" "g.35506101G>A" "" "pathogenic" "" "0000141455" "3" "95" "6" "35473878" "35473878" "subst" "0" "00234" "TULP1_000004" "g.35473878G>A" "" "{PMID:Li 2009:18936139}" "" "codon position 301(Q301X)" "" "Germline" "" "" "0" "" "" "g.35506101G>A" "" "pathogenic" "" "0000141456" "3" "95" "6" "35473878" "35473878" "subst" "0" "00234" "TULP1_000004" "g.35473878G>A" "" "{PMID:Li 2009:18936139}" "" "codon position 301(Q301X)" "" "Germline" "" "" "0" "" "" "g.35506101G>A" "" "pathogenic" "" "0000141457" "3" "95" "6" "35473878" "35473878" "subst" "0" "00234" "TULP1_000004" "g.35473878G>A" "" "{PMID:Li 2009:18936139}" "" "codon position 301(Q301X)" "" "Germline" "" "" "0" "" "" "g.35506101G>A" "" "pathogenic" "" "0000141458" "3" "95" "6" "35473878" "35473878" "subst" "0" "00234" "TULP1_000004" "g.35473878G>A" "" "{PMID:Li 2009:18936139}" "" "codon position 301(Q301X)" "" "Germline" "" "" "0" "" "" "g.35506101G>A" "" "pathogenic" "" "0000141459" "3" "95" "6" "35473878" "35473878" "subst" "0" "00234" "TULP1_000004" "g.35473878G>A" "" "{PMID:Li 2009:18936139}" "" "codon position 301(Q301X)" "" "Germline" "" "" "0" "" "" "g.35506101G>A" "" "pathogenic" "" "0000141460" "3" "95" "6" "35473878" "35473878" "subst" "0" "00234" "TULP1_000004" "g.35473878G>A" "" "{PMID:Li 2009:18936139}" "" "codon position 301(Q301X)" "" "Germline" "" "" "0" "" "" "g.35506101G>A" "" "pathogenic" "" "0000141461" "3" "95" "6" "35473878" "35473878" "subst" "0" "00234" "TULP1_000004" "g.35473878G>A" "" "{PMID:Li 2009:18936139}" "" "codon position 301(Q301X)" "" "Germline" "" "" "0" "" "" "g.35506101G>A" "" "pathogenic" "" "0000141462" "3" "95" "6" "35473878" "35473878" "subst" "0" "00234" "TULP1_000004" "g.35473878G>A" "" "{PMID:Li 2009:18936139}" "" "codon position 301(Q301X)" "" "Germline" "" "" "0" "" "" "g.35506101G>A" "" "pathogenic" "" "0000141463" "10" "75" "6" "35473847" "35473847" "subst" "2.0351E-5" "00234" "TULP1_000015" "g.35473847C>T" "" "{PMID:Hebrard 2011:21792230}" "" "c.932G>A" "" "Germline" "" "" "0" "" "" "g.35506070C>T" "" "likely pathogenic" "" "0000141464" "10" "75" "6" "35473847" "35473847" "subst" "2.0351E-5" "00234" "TULP1_000015" "g.35473847C>T" "" "{PMID:Hebrard 2011:21792230}" "" "c.932G>A" "" "Germline" "" "" "0" "" "" "g.35506070C>T" "" "likely pathogenic" "" "0000141465" "11" "95" "6" "35473883" "35473883" "del" "0" "00234" "TULP1_000007" "g.35473883del" "" "{PMID:Paloma 2000:10711677}" "" "c.937delC" "" "Germline" "" "" "0" "" "" "g.35506106del" "" "pathogenic" "" "0000141466" "3" "75" "6" "35473775" "35473775" "subst" "0" "00234" "TULP1_000017" "g.35473775C>G" "" "{PMID:den Hollander 2007:18055821}" "" "c.999+5G>C" "" "Germline" "" "" "0" "" "" "g.35505998C>G" "" "likely pathogenic" "" "0000141467" "21" "75" "6" "35473605" "35473605" "subst" "2.03051E-5" "00234" "TULP1_000016" "g.35473605C>T" "" "{PMID:Hebrard 2011:21792230}" "" "c.1025G>A" "" "Germline" "" "" "0" "" "" "g.35505828C>T" "" "likely pathogenic" "" "0000141468" "21" "75" "6" "35473605" "35473605" "subst" "2.03051E-5" "00234" "TULP1_000016" "g.35473605C>T" "" "{PMID:Hebrard 2011:21792230}" "" "c.1025G>A" "" "Germline" "" "" "0" "" "" "g.35505828C>T" "" "likely pathogenic" "" "0000141469" "3" "95" "6" "35473583" "35473583" "subst" "8.12176E-6" "00234" "TULP1_000018" "g.35473583A>C" "" "{PMID:Kannabiran 2012:22605927}" "" "c.1047T>G" "" "Germline" "" "" "0" "" "" "g.35505806A>C" "" "pathogenic" "" "0000141470" "3" "95" "6" "35473583" "35473583" "subst" "8.12176E-6" "00234" "TULP1_000018" "g.35473583A>C" "" "{PMID:Kannabiran 2012:22605927}" "" "c.1047T>G" "" "Germline" "" "" "0" "" "" "g.35505806A>C" "" "pathogenic" "" "0000141471" "3" "75" "6" "35473583" "35473583" "subst" "8.12176E-6" "00243" "TULP1_000043" "g.35473583A>C" "" "" "" "" "not in 314 control chromosomes" "Germline" "yes" "" "0" "" "" "g.35505806A>C" "" "likely pathogenic" "" "0000141472" "3" "55" "6" "35473528" "35473528" "subst" "4.06312E-6" "00234" "TULP1_000019" "g.35473528C>A" "" "{PMID:Hanein 2004:15024725}" "" "c.1102G>T" "" "Germline" "" "" "0" "" "" "g.35505751C>A" "" "VUS" "" "0000141473" "1" "35" "6" "35471605" "35471605" "subst" "7.03695E-5" "00234" "TULP1_000020" "g.35471605C>T" "" "{PMID:Hagstrom 1998:09462750}" "" "CGC->CAC" "" "Germline" "" "" "0" "" "" "g.35503828C>T" "" "likely benign" "" "0000141474" "3" "95" "6" "35471600" "35471600" "subst" "8.23418E-6" "00234" "TULP1_000021" "g.35471600T>C" "" "{PMID:Iqbal 2011:21987678}" "" "c.1138A>G" "" "Germline" "" "" "0" "" "" "g.35503823T>C" "" "pathogenic" "" "0000141475" "3" "95" "6" "35471600" "35471600" "subst" "8.23418E-6" "00234" "TULP1_000021" "g.35471600T>C" "" "{PMID:Iqbal 2011:21987678}" "" "c.1138A>G" "" "Germline" "" "" "0" "" "" "g.35503823T>C" "" "pathogenic" "" "0000141476" "3" "95" "6" "35471600" "35471600" "subst" "8.23418E-6" "00234" "TULP1_000021" "g.35471600T>C" "" "{PMID:Iqbal 2011:21987678}" "" "c.1138A>G" "" "Germline" "" "" "0" "" "" "g.35503823T>C" "" "pathogenic" "" "0000141477" "3" "95" "6" "35471600" "35471600" "subst" "8.23418E-6" "00234" "TULP1_000021" "g.35471600T>C" "" "{PMID:Iqbal 2011:21987678}" "" "c.1138A>G" "" "Germline" "" "" "0" "" "" "g.35503823T>C" "" "pathogenic" "" "0000141478" "3" "95" "6" "35471600" "35471600" "subst" "8.23418E-6" "00234" "TULP1_000021" "g.35471600T>C" "" "{PMID:McKibbin 2010:20065226}" "" "c.1138A>G" "" "Germline" "" "" "0" "" "" "g.35503823T>C" "" "pathogenic" "" "0000141479" "3" "95" "6" "35471600" "35471600" "subst" "8.23418E-6" "00234" "TULP1_000021" "g.35471600T>C" "" "{PMID:Ajmal 2012:22665969}" "HpyCH4III-" "c.1138A>G" "" "Germline" "" "" "0" "" "" "g.35503823T>C" "" "pathogenic" "" "0000141480" "3" "95" "6" "35471600" "35471600" "subst" "8.23418E-6" "00234" "TULP1_000021" "g.35471600T>C" "" "{PMID:Iqbal  2011:21987678}" "" "c.1138A>G" "" "Germline" "" "" "0" "" "" "g.35503823T>C" "" "pathogenic" "" "0000141481" "3" "95" "6" "35471600" "35471600" "subst" "8.23418E-6" "00234" "TULP1_000021" "g.35471600T>C" "" "{PMID:Iqbal 2011:21987678}" "" "c.1138A>G" "" "Germline" "" "" "0" "" "" "g.35503823T>C" "" "pathogenic" "" "0000141482" "3" "95" "6" "35471600" "35471600" "subst" "8.23418E-6" "00234" "TULP1_000021" "g.35471600T>C" "" "{PMID:Iqbal  2011:21987678}" "" "c.1138A>G" "" "Germline" "" "" "0" "" "" "g.35503823T>C" "" "pathogenic" "" "0000141483" "3" "95" "6" "35471600" "35471600" "subst" "8.23418E-6" "00234" "TULP1_000021" "g.35471600T>C" "" "{PMID:Iqbal  2011:21987678}" "" "c.1138A>G" "" "Germline" "" "" "0" "" "" "g.35503823T>C" "" "pathogenic" "" "0000141484" "3" "75" "6" "35471593" "35471593" "subst" "4.10529E-6" "00234" "TULP1_000022" "g.35471593A>G" "" "{PMID:Kondo  2004:157452}" "" "c.1145T->C" "" "Germline" "" "" "0" "" "" "g.35503816A>G" "" "likely pathogenic" "" "0000141485" "3" "75" "6" "35471593" "35471593" "subst" "4.10529E-6" "00234" "TULP1_000022" "g.35471593A>G" "" "{PMID:Kondo  2004:157452}" "" "c.1145T->C" "" "Germline" "" "" "0" "" "" "g.35503816A>G" "" "likely pathogenic" "" "0000141486" "3" "35" "6" "35471586" "35471586" "subst" "5.73202E-5" "00234" "TULP1_000023" "g.35471586G>A" "" "{PMID:Gu 1998:09660588}" "" "Asn384Asn" "" "Germline" "" "" "0" "" "" "g.35503809G>A" "" "likely benign" "" "0000141487" "3" "95" "6" "35471540" "35471540" "subst" "0" "00234" "TULP1_000024" "g.35471540G>A" "" "{PMID:Hanein 2004:15024725}" "" "c.1198C>T" "" "Germline" "" "" "0" "" "" "g.35503763G>A" "" "pathogenic" "" "0000141488" "3" "95" "6" "35471539" "35471539" "subst" "4.08787E-6" "00234" "TULP1_000025" "g.35471539C>T" "" "{PMID:Singh 2009:19339744}" "EcoR57I+" "c.1199G>A" "" "Germline" "" "" "0" "" "" "g.35503762C>T" "" "pathogenic" "" "0000141489" "0" "95" "6" "35471534" "35471534" "subst" "0" "00234" "TULP1_000003" "g.35471534C>A" "" "{PMID:Hanein 2004:15024725}" "" "" "" "Germline" "" "" "0" "" "" "g.35503757C>A" "" "pathogenic" "" "0000141490" "1" "75" "6" "35471510" "35471510" "subst" "0" "00234" "TULP1_000026" "g.35471510T>C" "" "{PMID:Gu 1998:09660588}" "" "IVS12+4A->G" "" "Germline" "" "" "0" "" "" "g.35503733T>C" "" "likely pathogenic" "" "0000141491" "1" "55" "6" "35471510" "35471510" "subst" "0" "00234" "TULP1_000026" "g.35471510T>C" "" "{PMID:Gu 1998:09660588}" "" "IVS12+4A->G" "" "Germline" "" "" "0" "" "" "g.35503733T>C" "" "VUS" "" "0000141492" "11" "75" "6" "35471400" "35471400" "subst" "0" "00234" "TULP1_000028" "g.35471400C>G" "" "{PMID:Hagstrom 1998:09462750}" "" "CGC->CCC" "" "Germline" "" "" "0" "" "" "g.35503623C>G" "" "likely pathogenic" "" "0000141493" "11" "75" "6" "35471400" "35471400" "subst" "0" "00234" "TULP1_000028" "g.35471400C>G" "" "{PMID:Hagstrom 1998:09462750}" "" "CGC->CCC" "" "Germline" "" "" "0" "" "" "g.35503623C>G" "" "likely pathogenic" "" "0000141494" "3" "35" "6" "35467767" "35467767" "subst" "0.000869834" "00234" "TULP1_000038" "g.35467767C>T" "1/95" "{PMID:Hagstrom 1998:09462750}" "" "GCT->ACT" "" "Germline" "" "" "0" "" "" "g.35499990C>T" "" "likely benign" "" "0000141495" "3" "35" "6" "35467767" "35467767" "subst" "0.000869834" "00234" "TULP1_000038" "g.35467767C>T" "1/95" "{PMID:Hagstrom 1998:09462750}" "" "GCT->ACT" "" "Germline" "" "" "0" "" "" "g.35499990C>T" "" "likely benign" "" "0000141496" "3" "35" "6" "35467892" "35467892" "subst" "5.68643E-5" "00234" "TULP1_000030" "g.35467892G>A" "" "{PMID:Hagstrom 1998:09462750}" "" "ACG->ATG" "" "Germline" "" "" "0" "" "" "g.35500115G>A" "" "likely benign" "" "0000141497" "3" "35" "6" "35467891" "35467891" "subst" "0" "00234" "TULP1_000032" "g.35467891G>C" "" "{PMID:Gu 1998:09660588}" "" "Thr454Thr" "Variant Error [EREF/EREF]: This genomic variant does not match the reference sequence; the transcript variant does not match the reference sequence either. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "likely benign" "" "0000141498" "3" "35" "6" "35467891" "35467891" "subst" "0.0212222" "00234" "TULP1_000031" "g.35467891C>T" "" "{PMID:Hagstrom 1998:09462750}" "" "ACG->ACA" "" "Germline" "" "" "0" "" "" "g.35500114C>T" "" "likely benign" "" "0000141499" "1" "35" "6" "35467891" "35467891" "subst" "0.0212222" "00234" "TULP1_000031" "g.35467891C>T" "" "{PMID:Mataftsi 2007:17962469}" "" "T454T (ACG-to-ACA)" "" "De novo" "" "" "0" "" "" "g.35500114C>T" "" "likely benign" "" "0000141500" "11" "75" "6" "35467877" "35467877" "subst" "0" "00234" "TULP1_000002" "g.35467877A>T" "" "{PMID:Hagstrom 1998:09462750}" "" "T->A" "" "Germline" "" "" "0" "" "" "g.35500100A>T" "" "likely pathogenic" "" "0000141501" "21" "95" "6" "35467877" "35467877" "subst" "0" "00234" "TULP1_000002" "g.35467877A>T" "" "{PMID:Banerjee 1998:09462751}" "" "c.1376T>A" "" "Germline" "" "" "0" "" "" "g.35500100A>T" "" "pathogenic" "" "0000141502" "3" "75" "6" "35467872" "35467872" "subst" "4.06088E-6" "00234" "TULP1_000033" "g.35467872G>C" "" "{PMID:den Hollander 2007:18055821}" "" "c.1381C>G" "" "Germline" "" "" "0" "" "" "g.35500095G>C" "" "likely pathogenic" "" "0000141503" "11" "95" "6" "35467809" "35467809" "subst" "1.62446E-5" "00234" "TULP1_000034" "g.35467809G>A" "" "{PMID:den Hollander 2007:17620573}" "HpaII-" "c.1444C>T" "" "Germline" "" "" "0" "" "" "g.35500032G>A" "" "pathogenic" "" "0000141504" "11" "95" "6" "35467809" "35467809" "subst" "1.62446E-5" "00234" "TULP1_000034" "g.35467809G>A" "" "{PMID:den Hollander 2007:17620573}" "HpaII-" "c.1444C>T" "" "Germline" "" "" "0" "" "" "g.35500032G>A" "" "pathogenic" "" "0000141505" "11" "95" "6" "35467809" "35467809" "subst" "1.62446E-5" "00234" "TULP1_000034" "g.35467809G>A" "" "{PMID:den Hollander 2007:17620573}" "HpaII-" "c.1444C>T" "" "Germline" "" "" "0" "" "" "g.35500032G>A" "" "pathogenic" "" "0000141506" "11" "95" "6" "35467809" "35467809" "subst" "1.62446E-5" "00234" "TULP1_000034" "g.35467809G>A" "" "{PMID:den Hollander 2007:17620573}" "HpaII-" "c.1444C>T" "" "Germline" "" "" "0" "" "" "g.35500032G>A" "" "pathogenic" "" "0000141507" "11" "95" "6" "35467809" "35467809" "subst" "1.62446E-5" "00234" "TULP1_000034" "g.35467809G>A" "" "{PMID:den Hollander 2007:17620573}" "HpaII-" "c.1444C>T" "" "Germline" "" "" "0" "" "" "g.35500032G>A" "" "pathogenic" "" "0000141508" "3" "75" "6" "35467808" "35467808" "subst" "4.06128E-6" "00234" "TULP1_000036" "g.35467808C>T" "" "{PMID:Ajmal 2012:22665969}" "MspI-" "c.1445G>A" "" "Germline" "" "" "0" "" "" "g.35500031C>T" "" "likely pathogenic" "" "0000141509" "3" "95" "6" "35467787" "35467787" "subst" "2.03075E-5" "00234" "TULP1_000037" "g.35467787T>C" "" "{PMID:Iqbal 2011:21987678}" "" "c.1466A>G" "Technique: also used LInkage Analysis" "Germline" "" "" "0" "" "" "g.35500010T>C" "" "pathogenic" "" "0000141510" "3" "95" "6" "35467787" "35467787" "subst" "2.03075E-5" "00234" "TULP1_000037" "g.35467787T>C" "" "{PMID:Iqbal 2011:21987678}" "" "c.1466A>G" "Technique: also used LInkage Analysis" "Germline" "" "" "0" "" "" "g.35500010T>C" "" "pathogenic" "" "0000141511" "3" "95" "6" "35467787" "35467787" "subst" "2.03075E-5" "00234" "TULP1_000037" "g.35467787T>C" "" "{PMID:Iqbal 2011:21987678}" "" "c.1466A>G" "Technique: also used LInkage Analysis" "Germline" "" "" "0" "" "" "g.35500010T>C" "" "pathogenic" "" "0000141512" "3" "95" "6" "35467787" "35467787" "subst" "2.03075E-5" "00234" "TULP1_000037" "g.35467787T>C" "" "{PMID:Iqbal 2011:21987678}" "" "c.1466A>G" "Technique: also used LInkage Analysis" "Germline" "" "" "0" "" "" "g.35500010T>C" "" "pathogenic" "" "0000141513" "3" "95" "6" "35467787" "35467787" "subst" "2.03075E-5" "00234" "TULP1_000037" "g.35467787T>C" "" "{PMID:Iqbal 2011:21987678}" "" "c.1466A>G" "Technique: also used LInkage Analysis" "Germline" "" "" "0" "" "" "g.35500010T>C" "" "pathogenic" "" "0000141514" "3" "95" "6" "35467787" "35467787" "subst" "2.03075E-5" "00234" "TULP1_000037" "g.35467787T>C" "" "{PMID:Iqbal 2011:21987678}" "" "c.1466A>G" "Technique: also used LInkage Analysis" "Germline" "" "" "0" "" "" "g.35500010T>C" "" "pathogenic" "" "0000141515" "3" "95" "6" "35467787" "35467787" "subst" "2.03075E-5" "00234" "TULP1_000037" "g.35467787T>C" "" "{PMID:Iqbal 2011:21987678}" "" "c.1466A>G" "Technique: also used LInkage Analysis" "Germline" "" "" "0" "" "" "g.35500010T>C" "" "pathogenic" "" "0000141516" "3" "95" "6" "35467787" "35467787" "subst" "2.03075E-5" "00234" "TULP1_000037" "g.35467787T>C" "" "{PMID:Iqbal 2011:21987678}" "" "c.1466A>G" "Technique: also used LInkage Analysis" "Germline" "" "" "0" "" "" "g.35500010T>C" "" "pathogenic" "" "0000141517" "3" "95" "6" "35467787" "35467787" "subst" "2.03075E-5" "00234" "TULP1_000037" "g.35467787T>C" "" "{PMID:Iqbal 2011:21987678}" "" "c.1466A>G" "Technique: also used LInkage Analysis" "Germline" "" "" "0" "" "" "g.35500010T>C" "" "pathogenic" "" "0000141518" "3" "95" "6" "35467787" "35467787" "subst" "2.03075E-5" "00234" "TULP1_000037" "g.35467787T>C" "" "{PMID:Iqbal 2011:21987678}" "" "c.1466A>G" "Technique: also used LInkage Analysis" "Germline" "" "" "0" "" "" "g.35500010T>C" "" "pathogenic" "" "0000141519" "3" "95" "6" "35467787" "35467787" "subst" "2.03075E-5" "00234" "TULP1_000037" "g.35467787T>C" "" "{PMID:Iqbal 2011:21987678}" "" "c.1466A>G" "Technique: also used LInkage Analysis" "Germline" "" "" "0" "" "" "g.35500010T>C" "" "pathogenic" "" "0000141520" "3" "95" "6" "35467787" "35467787" "subst" "2.03075E-5" "00234" "TULP1_000037" "g.35467787T>C" "" "{PMID:Iqbal 2011:21987678}" "" "c.1466A>G" "Technique: also used LInkage Analysis" "Germline" "" "" "0" "" "" "g.35500010T>C" "" "pathogenic" "" "0000141521" "3" "95" "6" "35467787" "35467787" "subst" "2.03075E-5" "00234" "TULP1_000037" "g.35467787T>C" "" "{PMID:Iqbal 2011:21987678}" "" "c.1466A>G" "Technique: also used LInkage Analysis" "Germline" "" "" "0" "" "" "g.35500010T>C" "" "pathogenic" "" "0000141522" "3" "95" "6" "35467787" "35467787" "subst" "2.03075E-5" "00234" "TULP1_000037" "g.35467787T>C" "" "{PMID:Iqbal 2011:21987678}" "" "c.1466A>G" "Technique: also used LInkage Analysis" "Germline" "" "" "0" "" "" "g.35500010T>C" "" "pathogenic" "" "0000141523" "3" "95" "6" "35467787" "35467787" "subst" "2.03075E-5" "00234" "TULP1_000037" "g.35467787T>C" "" "{PMID:Iqbal 2011:21987678}" "" "c.1466A>G" "Technique: also used LInkage Analysis" "Germline" "" "" "0" "" "" "g.35500010T>C" "" "pathogenic" "" "0000141524" "3" "95" "6" "35467787" "35467787" "subst" "2.03075E-5" "00234" "TULP1_000037" "g.35467787T>C" "" "{PMID:Iqbal 2011:21987678}" "" "c.1466A>G" "Technique: also used LInkage Analysis" "Germline" "" "" "0" "" "" "g.35500010T>C" "" "pathogenic" "" "0000141525" "3" "95" "6" "35467787" "35467787" "subst" "2.03075E-5" "00234" "TULP1_000037" "g.35467787T>C" "" "{PMID:Iqbal 2011:21987678}" "" "c.1466A>G" "Technique: also used LInkage Analysis" "Germline" "" "" "0" "" "" "g.35500010T>C" "" "pathogenic" "" "0000141526" "3" "95" "6" "35467787" "35467787" "subst" "2.03075E-5" "00234" "TULP1_000037" "g.35467787T>C" "" "{PMID:Iqbal 2011:21987678}" "" "c.1466A>G" "Technique: also used LInkage Analysis" "Germline" "" "" "0" "" "" "g.35500010T>C" "" "pathogenic" "" "0000141527" "3" "95" "6" "35467787" "35467787" "subst" "2.03075E-5" "00234" "TULP1_000037" "g.35467787T>C" "" "{PMID:Iqbal 2011:21987678}" "" "c.1466A>G" "Technique: also used LInkage Analysis" "Germline" "" "" "0" "" "" "g.35500010T>C" "" "pathogenic" "" "0000141528" "3" "95" "6" "35467787" "35467787" "subst" "2.03075E-5" "00234" "TULP1_000037" "g.35467787T>C" "" "{PMID:Gu 1998:09660588}" "" "1502G->A" "Technique: also used LInkage Analysis" "Germline" "" "" "0" "" "" "g.35500010T>C" "" "pathogenic" "" "0000141529" "21" "75" "6" "35467781" "35467781" "subst" "0" "00234" "TULP1_000029" "g.35467781A>G" "" "{PMID:Hagstrom 1998:09462750}" "" "TTC->CTC" "" "Germline" "" "" "0" "" "" "g.35500004A>G" "" "likely pathogenic" "" "0000141530" "21" "75" "6" "35467781" "35467781" "subst" "0" "00234" "TULP1_000029" "g.35467781A>G" "" "{PMID:Hagstrom 1998:09462750}" "" "TTC->CTC" "" "Germline" "" "" "0" "" "" "g.35500004A>G" "" "likely pathogenic" "" "0000141531" "3" "75" "6" "35467757" "35467757" "subst" "1.22022E-5" "00234" "TULP1_000039" "g.35467757C>T" "" "{PMID:Banerjee 1998:09462751}" "NIaIII+" "IVS14+1G->A" "" "Germline" "" "" "0" "" "" "g.35499980C>T" "" "likely pathogenic" "" "0000141532" "3" "75" "6" "35467757" "35467757" "subst" "1.22022E-5" "00234" "TULP1_000039" "g.35467757C>T" "" "{PMID:Banerjee 1998:09462751}" "NIaIII+" "IVS14+1G->A" "" "Germline" "" "" "0" "" "" "g.35499980C>T" "" "likely pathogenic" "" "0000141533" "3" "75" "6" "35467757" "35467757" "subst" "1.22022E-5" "00234" "TULP1_000039" "g.35467757C>T" "" "{PMID:Banerjee 1998:09462751}" "NIaIII+" "IVS14+1G->A" "" "Germline" "" "" "0" "" "" "g.35499980C>T" "" "likely pathogenic" "" "0000141534" "3" "75" "6" "35467757" "35467757" "subst" "1.22022E-5" "00234" "TULP1_000039" "g.35467757C>T" "" "{PMID:Banerjee 1998:09462751}" "NIaIII+" "IVS14+1G->A" "" "Germline" "" "" "0" "" "" "g.35499980C>T" "" "likely pathogenic" "" "0000141535" "3" "95" "6" "35467756" "35467756" "dup" "0" "00234" "TULP1_000040" "g.35467756dup" "" "{PMID:Abbasi 2008:18432314}" "DrdI+" "c.1495+2_1495+3insT" "Technique: also used LInkage Analysis and Haplotype analysis" "Germline" "" "" "0" "" "" "g.35499979dup" "" "pathogenic" "" "0000141536" "3" "95" "6" "35467756" "35467756" "dup" "0" "00234" "TULP1_000040" "g.35467756dup" "" "{PMID:Abbasi 2008:18432314}" "DrdI+" "c.1495+2_1495+3insT" "" "Germline" "" "" "0" "" "" "g.35499979dup" "" "pathogenic" "" "0000141537" "3" "95" "6" "35467756" "35467756" "dup" "0" "00234" "TULP1_000040" "g.35467756dup" "" "{PMID:Abbasi 2008:18432314}" "DrdI+" "c.1495+2_1495+3insT" "" "Germline" "" "" "0" "" "" "g.35499979dup" "" "pathogenic" "" "0000141538" "3" "95" "6" "35467756" "35467756" "dup" "0" "00234" "TULP1_000040" "g.35467756dup" "" "{PMID:Abbasi 2008:18432314}" "DrdI+" "c.1495+2_1495+3insT" "" "Germline" "" "" "0" "" "" "g.35499979dup" "" "pathogenic" "" "0000141539" "3" "95" "6" "35467756" "35467756" "dup" "0" "00234" "TULP1_000040" "g.35467756dup" "" "{PMID:Abbasi 2008:18432314}" "DrdI+" "c.1495+2_1495+3insT" "" "Germline" "" "" "0" "" "" "g.35499979dup" "" "pathogenic" "" "0000141540" "3" "75" "6" "35466243" "35466243" "subst" "8.60839E-5" "00234" "TULP1_000041" "g.35466243G>T" "" "{PMID:Gu 1998:09660588}" "" "IVS14-6C>A" "Technique: also used LInkage Analysis" "Germline" "" "" "0" "" "" "g.35498466G>T" "" "likely pathogenic" "" "0000141541" "3" "35" "6" "35466243" "35466243" "subst" "8.60839E-5" "00234" "TULP1_000041" "g.35466243G>T" "" "{PMID:Hagstrom 1998:09462750}" "" "IVS14-6C->A/TGTCCAT->TGTACAT" "" "Germline" "" "" "0" "" "" "g.35498466G>T" "" "likely benign" "" "0000141542" "3" "75" "6" "35466243" "35466243" "subst" "8.60839E-5" "00234" "TULP1_000041" "g.35466243G>T" "" "{PMID:Gu 1998:09660588}" "" "IVS14-6C>A" "Technique: also used LInkage Analysis" "Germline" "" "" "0" "" "" "g.35498466G>T" "" "likely pathogenic" "" "0000141543" "21" "95" "6" "35466214" "35466224" "del" "0" "00234" "TULP1_000035" "g.35466214_35466224del" "" "{PMID:den Hollander 2007:17620573}" "" "1511_1521delTGCAGTTCGGC" "" "Germline" "" "" "0" "" "" "g.35498437_35498447del" "" "pathogenic" "" "0000141544" "21" "95" "6" "35466214" "35466224" "del" "0" "00234" "TULP1_000035" "g.35466214_35466224del" "" "{PMID:den Hollander 2007:17620573}" "" "1511_1521delTGCAGTTCGGC" "" "Germline" "" "" "0" "" "" "g.35498437_35498447del" "" "pathogenic" "" "0000141545" "21" "95" "6" "35466214" "35466224" "del" "0" "00234" "TULP1_000035" "g.35466214_35466224del" "" "{PMID:den Hollander 2007:17620573}" "" "1511_1521delTGCAGTTCGGC" "" "Germline" "" "" "0" "" "" "g.35498437_35498447del" "" "pathogenic" "" "0000141546" "21" "95" "6" "35466214" "35466224" "del" "0" "00234" "TULP1_000035" "g.35466214_35466224del" "" "{PMID:den Hollander 2007:17620573}" "" "1511_1521delTGCAGTTCGGC" "" "Germline" "" "" "0" "" "" "g.35498437_35498447del" "" "pathogenic" "" "0000141547" "21" "95" "6" "35466214" "35466224" "del" "0" "00234" "TULP1_000035" "g.35466214_35466224del" "" "{PMID:den Hollander 2007:17620573}" "" "1511_1521delTGCAGTTCGGC" "" "Germline" "" "" "0" "" "" "g.35498437_35498447del" "" "pathogenic" "" "0000141548" "3" "95" "6" "35466149" "35466154" "dup" "0" "00234" "TULP1_000042" "g.35466149_35466154dup" "" "{PMID:Mataftsi 2007:17962469}" "" "1593 to 1594dupTTCGCC" "" "Germline" "" "" "0" "" "" "g.35498372_35498377dup" "" "pathogenic" "" "0000141549" "3" "95" "6" "35466149" "35466154" "dup" "0" "00234" "TULP1_000042" "g.35466149_35466154dup" "" "{PMID:Mataftsi 2007:17962469}" "" "1593 to 1594dupTTCGCC" "" "Germline" "" "" "0" "" "" "g.35498372_35498377dup" "" "pathogenic" "" "0000141550" "3" "95" "6" "35466149" "35466154" "dup" "0" "00234" "TULP1_000042" "g.35466149_35466154dup" "" "{PMID:Mataftsi 2007:17962469}" "" "1593 to 1594dupTTCGCC" "" "Germline" "" "" "0" "" "" "g.35498372_35498377dup" "" "pathogenic" "" "0000141551" "3" "95" "6" "35466149" "35466154" "dup" "0" "00234" "TULP1_000042" "g.35466149_35466154dup" "" "{PMID:Mataftsi 2007:17962469}" "" "1593 to 1594dupTTCGCC" "" "Germline" "" "" "0" "" "" "g.35498372_35498377dup" "" "pathogenic" "" "0000141552" "3" "95" "6" "35466149" "35466154" "dup" "0" "00234" "TULP1_000042" "g.35466149_35466154dup" "" "{PMID:Mataftsi 2007:17962469}" "" "1593 to 1594dupTTCGCC" "" "Germline" "" "" "0" "" "" "g.35498372_35498377dup" "" "pathogenic" "" "0000141553" "3" "95" "6" "35466149" "35466154" "dup" "0" "00234" "TULP1_000042" "g.35466149_35466154dup" "" "{PMID:Mataftsi 2007:17962469}" "" "1593 to 1594dupTTCGCC" "" "Germline" "" "" "0" "" "" "g.35498372_35498377dup" "" "pathogenic" "" "0000141554" "3" "95" "6" "35466149" "35466154" "dup" "0" "00234" "TULP1_000042" "g.35466149_35466154dup" "" "{PMID:Mataftsi 2007:17962469}" "" "1593 to 1594dupTTCGCC" "" "Germline" "" "" "0" "" "" "g.35498372_35498377dup" "" "pathogenic" "" "0000158349" "3" "90" "6" "35471600" "35471600" "subst" "8.23418E-6" "01769" "TULP1_000021" "g.35471600T>C" "" "{PMID:Li 2017:28418496}" "" "" "" "Germline" "yes" "" "0" "" "" "g.35503823T>C" "" "pathogenic" "" "0000162773" "3" "90" "6" "35467787" "35467787" "subst" "2.03075E-5" "01769" "TULP1_000037" "g.35467787T>C" "" "{PMID:Li 2017:28418496}" "" "" "" "Germline" "yes" "" "0" "" "" "g.35500010T>C" "" "pathogenic" "" "0000162777" "3" "90" "6" "35467787" "35467787" "subst" "2.03075E-5" "01769" "TULP1_000037" "g.35467787T>C" "" "{PMID:Li 2017:28418496}" "" "" "" "Germline" "yes" "" "0" "" "" "g.35500010T>C" "" "pathogenic" "" "0000162784" "3" "90" "6" "35467787" "35467787" "subst" "2.03075E-5" "01769" "TULP1_000037" "g.35467787T>C" "" "{PMID:Li 2017:28418496}" "" "" "" "Germline" "yes" "" "0" "" "" "g.35500010T>C" "" "pathogenic" "" "0000162816" "3" "90" "6" "35466172" "35466172" "subst" "0" "01769" "TULP1_000046" "g.35466172G>A" "" "{PMID:Li 2017:28418496}" "" "" "" "Germline" "yes" "" "0" "" "" "g.35498395G>A" "" "pathogenic" "" "0000162818" "3" "90" "6" "35467754" "35467754" "subst" "0" "01769" "TULP1_000047" "g.35467754T>G" "" "{PMID:Li 2017:28418496}" "" "" "" "Germline" "yes" "" "0" "" "" "g.35499977T>G" "" "likely pathogenic" "" "0000256084" "0" "50" "6" "35467877" "35467877" "subst" "0.000418274" "01943" "TULP1_000045" "g.35467877A>G" "" "" "" "TULP1(NM_003322.5):c.1376T>C (p.I459T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.35500100A>G" "" "VUS" "" "0000311063" "0" "10" "6" "35467912" "35467912" "subst" "0.00114582" "02330" "TULP1_000049" "g.35467912C>T" "" "" "" "TULP1(NM_003322.6):c.1341G>A (p.L447=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.35500135C>T" "" "benign" "" "0000311064" "0" "30" "6" "35479951" "35479951" "subst" "0" "02330" "TULP1_000061" "g.35479951G>A" "" "" "" "TULP1(NM_003322.5):c.190+6C>T, TULP1(NM_003322.6):c.190+6C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.35512174G>A" "" "likely benign" "" "0000311065" "0" "50" "6" "35478756" "35478779" "del" "0" "02330" "TULP1_000058" "g.35478756_35478779del" "" "" "" "TULP1(NM_003322.5):c.371_394delACGAGGAGGACGAGGAAGAGGAGG (p.D124_E131del), TULP1(NM_003322.6):c.371_394delACGAGGAGGACGAGGAAGAGGAGG (p.D124_E131del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.35510979_35511002del" "" "VUS" "" "0000311066" "0" "30" "6" "35478626" "35478626" "subst" "0.00231508" "02330" "TULP1_000057" "g.35478626C>G" "" "" "" "TULP1(NM_003322.6):c.499+12G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.35510849C>G" "" "likely benign" "" "0000311067" "0" "30" "6" "35477600" "35477600" "subst" "1.21848E-5" "02330" "TULP1_000053" "g.35477600T>C" "" "" "" "TULP1(NM_003322.6):c.601+4A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.35509823T>C" "" "likely benign" "" "0000311068" "0" "10" "6" "35474064" "35474064" "subst" "0" "02330" "TULP1_000050" "g.35474064C>T" "" "" "" "TULP1(NM_003322.6):c.823-8G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.35506287C>T" "" "benign" "" "0000311069" "0" "10" "6" "35480404" "35480404" "subst" "1.219E-5" "02330" "TULP1_000062" "g.35480404G>T" "" "" "" "TULP1(NM_003322.6):c.99+12C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.35512627G>T" "" "benign" "" "0000312882" "0" "10" "6" "35479574" "35479574" "subst" "0.850602" "02325" "TULP1_000060" "g.35479574G>C" "" "" "" "TULP1(NM_003322.6):c.200C>G (p.T67R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.35511797G>C" "" "benign" "" "0000319126" "0" "50" "6" "35466205" "35466205" "subst" "8.16013E-6" "01943" "TULP1_000048" "g.35466205C>T" "" "" "" "TULP1(NM_003322.5):c.1528G>A (p.A510T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.35498428C>T" "" "VUS" "" "0000319127" "0" "50" "6" "35478756" "35478779" "del" "0" "01943" "TULP1_000058" "g.35478756_35478779del" "" "" "" "TULP1(NM_003322.5):c.371_394delACGAGGAGGACGAGGAAGAGGAGG (p.D124_E131del), TULP1(NM_003322.6):c.371_394delACGAGGAGGACGAGGAAGAGGAGG (p.D124_E131del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.35510979_35511002del" "" "VUS" "" "0000319129" "0" "30" "6" "35477682" "35477682" "subst" "8.20978E-6" "01943" "TULP1_000056" "g.35477682G>C" "" "" "" "TULP1(NM_003322.5):c.523C>G (p.P175A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.35509905G>C" "" "likely benign" "" "0000319130" "0" "50" "6" "35477667" "35477667" "subst" "4.90501E-5" "01943" "TULP1_000055" "g.35477667G>A" "" "" "" "TULP1(NM_003322.5):c.538C>T (p.R180C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.35509890G>A" "" "VUS" "" "0000319131" "0" "70" "6" "35477613" "35477613" "subst" "0" "01943" "TULP1_000054" "g.35477613T>A" "" "" "" "TULP1(NM_003322.5):c.592A>T (p.K198*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.35509836T>A" "" "likely pathogenic" "" "0000319132" "0" "50" "6" "35477075" "35477075" "subst" "8.12163E-6" "01943" "TULP1_000052" "g.35477075C>A" "" "" "" "TULP1(NM_003322.5):c.733G>T (p.A245S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.35509298C>A" "" "VUS" "" "0000319133" "0" "50" "6" "35477011" "35477011" "subst" "0.000706582" "01943" "TULP1_000051" "g.35477011C>A" "" "" "" "TULP1(NM_003322.5):c.797G>T (p.G266V), TULP1(NM_003322.6):c.797G>T (p.G266V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.35509234C>A" "" "VUS" "" "0000342820" "0" "70" "6" "35471539" "35471539" "subst" "4.08787E-6" "02327" "TULP1_000025" "g.35471539C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.35503762C>T" "" "likely pathogenic" "" "0000342873" "0" "70" "6" "35471401" "35471401" "subst" "0" "02327" "TULP1_000063" "g.35471401G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.35503624G>T" "" "likely pathogenic" "" "0000342972" "0" "70" "6" "35467808" "35467808" "subst" "4.06128E-6" "02327" "TULP1_000036" "g.35467808C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.35500031C>T" "" "likely pathogenic" "" "0000345928" "0" "50" "6" "35477011" "35477011" "subst" "0.000706582" "02327" "TULP1_000051" "g.35477011C>A" "" "" "" "TULP1(NM_003322.5):c.797G>T (p.G266V), TULP1(NM_003322.6):c.797G>T (p.G266V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.35509234C>A" "" "VUS" "" "0000347499" "0" "10" "6" "35477025" "35477025" "subst" "0.822024" "02327" "TULP1_000014" "g.35477025C>G" "" "" "" "TULP1(NM_003322.6):c.783G>C (p.K261N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.35509248C>G" "" "benign" "" "0000349601" "0" "10" "6" "35479574" "35479574" "subst" "0.850602" "02327" "TULP1_000060" "g.35479574G>C" "" "" "" "TULP1(NM_003322.6):c.200C>G (p.T67R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.35511797G>C" "" "benign" "" "0000358345" "3" "90" "6" "35467755" "35467755" "dup" "0" "01243" "TULP1_000040" "g.35467755dup" "" "Sharon, submitted" "" "" "Variant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000358346" "3" "90" "6" "35467904" "35467904" "subst" "0" "01243" "TULP1_000065" "g.35467904C>T" "" "Sharon, submitted" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000358347" "3" "90" "6" "35473928" "35473931" "dup" "0" "01243" "TULP1_000066" "g.35473928_35473931dup" "" "{PMID:Beryozkin 2015:26306921}, {PMID:Sharon 2019:31456290}" "" "852_853insTCCC, 832_833insTCCC" "" "Germline" "" "" "0" "" "" "g.35506151_35506154dup" "" "pathogenic (recessive)" "" "0000438661" "1" "90" "6" "35473606" "35473606" "subst" "0" "01244" "TULP1_000067" "g.35473606G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.35505829G>A" "" "pathogenic" "" "0000438662" "2" "90" "6" "35473528" "35473528" "subst" "4.06312E-6" "01244" "TULP1_000019" "g.35473528C>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.35505751C>A" "" "pathogenic" "" "0000438685" "3" "90" "6" "35467757" "35467757" "subst" "1.22022E-5" "01244" "TULP1_000039" "g.35467757C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.35499980C>T" "" "pathogenic" "" "0000476475" "0" "50" "6" "35467875" "35467875" "subst" "0" "02591" "TULP1_000068" "g.35467875C>T" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.35500098C>T" "" "VUS" "" "0000476476" "0" "50" "6" "35467892" "35467892" "subst" "5.68643E-5" "02591" "TULP1_000030" "g.35467892G>A" "2/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs138200747" "0" "" "" "g.35500115G>A" "" "VUS" "" "0000476477" "0" "50" "6" "35471347" "35471347" "subst" "0" "02591" "TULP1_000069" "g.35471347G>A" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs753820059" "0" "" "" "g.35503570G>A" "" "VUS" "" "0000476478" "0" "90" "6" "35471413" "35471413" "subst" "0" "02591" "TULP1_000070" "g.35471413G>A" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs200769197" "0" "" "" "g.35503636G>A" "" "pathogenic" "" "0000476479" "0" "50" "6" "35471425" "35471425" "subst" "0" "02591" "TULP1_000071" "g.35471425C>T" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs761670562" "0" "" "" "g.35503648C>T" "" "VUS" "" "0000476480" "0" "90" "6" "35471593" "35471593" "subst" "4.10529E-6" "02591" "TULP1_000022" "g.35471593A>G" "2/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs121909076" "0" "" "" "g.35503816A>G" "" "pathogenic" "" "0000476481" "0" "50" "6" "35473570" "35473570" "subst" "0" "02591" "TULP1_000072" "g.35473570T>C" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.35505793T>C" "" "VUS" "" "0000476482" "0" "50" "6" "35473875" "35473875" "subst" "1.224E-5" "02591" "TULP1_000073" "g.35473875C>T" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs765321084" "0" "" "" "g.35506098C>T" "" "VUS" "" "0000476483" "0" "10" "6" "35477025" "35477025" "subst" "0.822024" "02591" "TULP1_000014" "g.35477025C>G" "290/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs2064318" "0" "" "" "g.35509248C>G" "" "benign" "" "0000476484" "0" "10" "6" "35477032" "35477032" "subst" "0.380733" "02591" "TULP1_000012" "g.35477032A>G" "591/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs2064317" "0" "" "" "g.35509255A>G" "" "benign" "" "0000476485" "0" "50" "6" "35477055" "35477057" "del" "0" "02591" "TULP1_000074" "g.35477055_35477057del" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs761639321" "0" "" "" "g.35509278_35509280del" "" "VUS" "" "0000476486" "0" "50" "6" "35477667" "35477667" "subst" "4.90501E-5" "02591" "TULP1_000055" "g.35477667G>A" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs139588263" "0" "" "" "g.35509890G>A" "" "VUS" "" "0000476487" "0" "50" "6" "35478767" "35478767" "subst" "0" "02591" "TULP1_000075" "g.35478767C>T" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs565455738" "0" "" "" "g.35510990C>T" "" "VUS" "" "0000476488" "0" "50" "6" "35479526" "35479526" "subst" "0" "02591" "TULP1_000076" "g.35479526G>T" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs765249939" "0" "" "" "g.35511749G>T" "" "VUS" "" "0000476489" "0" "10" "6" "35479574" "35479574" "subst" "0.850602" "02591" "TULP1_000060" "g.35479574G>C" "287/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs7764472" "0" "" "" "g.35511797G>C" "" "benign" "" "0000477491" "3" "10" "6" "35477025" "35477025" "subst" "0.822024" "02591" "TULP1_000014" "g.35477025C>G" "887/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs2064318" "0" "" "" "g.35509248C>G" "" "benign" "" "0000477492" "3" "10" "6" "35477032" "35477032" "subst" "0.380733" "02591" "TULP1_000012" "g.35477032A>G" "189/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs2064317" "0" "" "" "g.35509255A>G" "" "benign" "" "0000477493" "3" "10" "6" "35479574" "35479574" "subst" "0.850602" "02591" "TULP1_000060" "g.35479574G>C" "891/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs7764472" "0" "" "" "g.35511797G>C" "" "benign" "" "0000487583" "3" "70" "6" "35473528" "35473528" "subst" "4.06312E-6" "03335" "TULP1_000077" "g.35473528C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.35505751C>T" "" "pathogenic (recessive)" "" "0000497788" "3" "50" "6" "35466213" "35466227" "del" "0" "01807" "TULP1_000078" "g.35466213_35466227del" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.35498436_35498450del" "" "VUS" "" "0000499707" "3" "90" "6" "35471593" "35471593" "subst" "4.10529E-6" "02591" "TULP1_000022" "g.35471593A>G" "5/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs121909076" "0" "" "" "g.35503816A>G" "" "pathogenic" "" "0000528750" "0" "30" "6" "35467767" "35467767" "subst" "0.000869834" "02330" "TULP1_000038" "g.35467767C>T" "" "" "" "TULP1(NM_003322.5):c.1486G>A (p.A496T), TULP1(NM_003322.6):c.1486G>A (p.A496T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.35499990C>T" "" "likely benign" "" "0000528751" "0" "10" "6" "35471326" "35471326" "subst" "0" "02330" "TULP1_000079" "g.35471326C>T" "" "" "" "TULP1(NM_003322.6):c.1323+10G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.35503549C>T" "" "benign" "" "0000528752" "0" "30" "6" "35471599" "35471599" "subst" "0" "02330" "TULP1_000080" "g.35471599G>A" "" "" "" "TULP1(NM_003322.6):c.1139C>T (p.T380M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.35503822G>A" "" "likely benign" "" "0000528753" "0" "50" "6" "35473796" "35473796" "subst" "0" "02330" "TULP1_000081" "g.35473796A>G" "" "" "" "TULP1(NM_003322.6):c.983T>C (p.L328P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.35506019A>G" "" "VUS" "" "0000528754" "0" "50" "6" "35473923" "35473923" "subst" "0.000328305" "02330" "TULP1_000082" "g.35473923C>T" "" "" "" "TULP1(NM_003322.6):c.856G>A (p.V286M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.35506146C>T" "" "VUS" "" "0000528755" "0" "50" "6" "35477011" "35477011" "subst" "0.000706582" "02330" "TULP1_000051" "g.35477011C>A" "" "" "" "TULP1(NM_003322.5):c.797G>T (p.G266V), TULP1(NM_003322.6):c.797G>T (p.G266V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.35509234C>A" "" "VUS" "" "0000528756" "0" "10" "6" "35477025" "35477025" "subst" "0.822024" "02325" "TULP1_000014" "g.35477025C>G" "" "" "" "TULP1(NM_003322.6):c.783G>C (p.K261N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.35509248C>G" "" "benign" "" "0000528757" "0" "30" "6" "35477037" "35477037" "subst" "0.0002477" "01943" "TULP1_000083" "g.35477037C>T" "" "" "" "TULP1(NM_003322.5):c.771G>A (p.T257=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.35509260C>T" "" "likely benign" "" "0000528758" "0" "50" "6" "35477498" "35477498" "subst" "0" "01943" "TULP1_000084" "g.35477498C>T" "" "" "" "TULP1(NM_003322.5):c.631G>A (p.G211R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.35509721C>T" "" "VUS" "" "0000528759" "0" "50" "6" "35477678" "35477678" "subst" "0" "02330" "TULP1_000085" "g.35477678G>T" "" "" "" "TULP1(NM_003322.6):c.527C>A (p.P176Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.35509901G>T" "" "VUS" "" "0000528760" "0" "90" "6" "35478695" "35478696" "del" "0" "02330" "TULP1_000086" "g.35478695_35478696del" "" "" "" "TULP1(NM_003322.6):c.447_448delGA (p.K150Efs*23)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.35510918_35510919del" "" "pathogenic" "" "0000528761" "0" "10" "6" "35478765" "35478773" "dup" "0" "01943" "TULP1_000087" "g.35478765_35478773dup" "" "" "" "TULP1(NM_003322.5):c.378_386dupGGACGAGGA (p.D127_E129dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.35510988_35510996dup" "" "benign" "" "0000528762" "0" "30" "6" "35480057" "35480057" "subst" "0" "01943" "TULP1_000088" "g.35480057G>A" "" "" "" "TULP1(NM_003322.5):c.100-10C>T, TULP1(NM_003322.6):c.100-10C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.35512280G>A" "" "likely benign" "" "0000528763" "0" "30" "6" "35480606" "35480606" "subst" "4.879E-5" "01943" "TULP1_000089" "g.35480606C>T" "" "" "" "TULP1(NM_003322.5):c.30G>A (p.E10=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.35512829C>T" "" "likely benign" "" "0000528764" "0" "30" "6" "35480640" "35480640" "subst" "2.84824E-5" "02330" "TULP1_000090" "g.35480640C>G" "" "" "" "TULP1(NM_003322.6):c.-5G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.35512863C>G" "" "likely benign" "" "0000597851" "3" "90" "6" "35477637" "35477637" "subst" "0" "01807" "TULP1_000091" "g.35477637C>A" "" "" "" "586G>T" "" "Unknown" "" "" "0" "" "" "g.35509860C>A" "" "pathogenic" "" "0000610333" "0" "90" "6" "35467757" "35467757" "subst" "1.22022E-5" "02330" "TULP1_000039" "g.35467757C>T" "" "" "" "TULP1(NM_003322.6):c.1495+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.35499980C>T" "" "pathogenic" "" "0000610334" "0" "30" "6" "35467767" "35467767" "subst" "0.000869834" "01943" "TULP1_000038" "g.35467767C>T" "" "" "" "TULP1(NM_003322.5):c.1486G>A (p.A496T), TULP1(NM_003322.6):c.1486G>A (p.A496T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.35499990C>T" "" "likely benign" "" "0000610335" "0" "50" "6" "35467923" "35467923" "subst" "6.50369E-5" "02330" "TEAD3_000001" "g.35467923C>T" "" "" "" "TULP1(NM_003322.6):c.1330G>A (p.D444N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.35500146C>T" "" "VUS" "" "0000610336" "0" "50" "6" "35467938" "35467938" "subst" "8.54937E-5" "01943" "TEAD3_000002" "g.35467938C>T" "" "" "" "TULP1(NM_003322.5):c.1324-9G>A, TULP1(NM_003322.6):c.1324-9G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.35500161C>T" "" "VUS" "" "0000610337" "0" "30" "6" "35473768" "35473768" "subst" "0" "02330" "TULP1_000092" "g.35473768C>G" "" "" "" "TULP1(NM_003322.6):c.999+12G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.35505991C>G" "" "likely benign" "" "0000610338" "0" "30" "6" "35474060" "35474060" "subst" "0.000328925" "01943" "TULP1_000093" "g.35474060T>C" "" "" "" "TULP1(NM_003322.5):c.823-4A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.35506283T>C" "" "likely benign" "" "0000610339" "0" "30" "6" "35480057" "35480057" "subst" "0" "02330" "TULP1_000088" "g.35480057G>A" "" "" "" "TULP1(NM_003322.5):c.100-10C>T, TULP1(NM_003322.6):c.100-10C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.35512280G>A" "" "likely benign" "" "0000621707" "0" "50" "6" "35479963" "35479963" "subst" "0.000163416" "01943" "TULP1_000094" "g.35479963G>A" "" "" "" "TULP1(NM_003322.5):c.184C>T (p.P62S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.35512186G>A" "" "VUS" "" "0000651950" "1" "50" "6" "35467891" "35467891" "subst" "0.0212222" "03575" "TULP1_000031" "g.35467891C>T" "30/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "30 heterozygous, no homozygous; {DB:CLININrs41270076}" "Germline" "" "rs41270076" "0" "" "" "g.35500114C>T" "" "VUS" "" "0000651951" "1" "90" "6" "35471593" "35471593" "subst" "4.10529E-6" "03575" "TULP1_000022" "g.35471593A>G" "1/2792 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs121909076}" "Germline" "" "rs121909076" "0" "" "" "g.35503816A>G" "" "pathogenic" "" "0000655585" "0" "30" "6" "35473878" "35473878" "subst" "0.000277732" "01943" "TULP1_000095" "g.35473878G>C" "" "" "" "TULP1(NM_003322.5):c.901C>G (p.Q301E), TULP1(NM_003322.6):c.901C>G (p.Q301E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.35506101G>C" "" "likely benign" "" "0000677767" "0" "70" "6" "35466214" "35466224" "del" "0" "02327" "TULP1_000035" "g.35466214_35466224del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000677768" "0" "50" "6" "35467809" "35467809" "subst" "1.62446E-5" "02327" "TULP1_000034" "g.35467809G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000677769" "0" "90" "6" "35477388" "35477388" "subst" "0" "02330" "TULP1_000096" "g.35477388C>T" "" "" "" "TULP1(NM_003322.6):c.718+23G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000677770" "0" "30" "6" "35477514" "35477514" "subst" "8.52723E-5" "01943" "TULP1_000097" "g.35477514G>A" "" "" "" "TULP1(NM_003322.5):c.615C>T (p.A205=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000684424" "3" "70" "6" "35473543" "35473543" "subst" "0" "00004" "TULP1_000100" "g.35473543C>T" "" "{PMID:Boulanger-Scemama 2015:26103963}, {PMID:Boulanger-Scemama 2019:31574917}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000684588" "1" "70" "6" "35467877" "35467877" "subst" "0" "00004" "TULP1_000002" "g.35467877A>T" "1/899 cases" "{PMID:Holtan 2020:31429209}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000684643" "3" "70" "6" "35473775" "35473775" "subst" "0" "00004" "TULP1_000017" "g.35473775C>G" "1/899 cases" "{PMID:Holtan 2020:31429209}" "" "" "" "Germline" "" "" "0" "" "" "" "" "benign" "" "0000685498" "0" "90" "6" "35467756" "35467756" "dup" "0" "00004" "TULP1_000040" "g.35467756dup" "4/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685499" "0" "90" "6" "35467756" "35467756" "dup" "0" "00004" "TULP1_000040" "g.35467756dup" "2/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685500" "0" "90" "6" "35467904" "35467904" "subst" "0" "00004" "TULP1_000065" "g.35467904C>T" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685501" "0" "90" "6" "35467904" "35467904" "subst" "0" "00004" "TULP1_000065" "g.35467904C>T" "4/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685502" "0" "90" "6" "35471358" "35471358" "subst" "0" "00004" "TULP1_000099" "g.35471358C>T" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685503" "0" "90" "6" "35471358" "35471358" "subst" "0" "00004" "TULP1_000099" "g.35471358C>T" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685504" "0" "70" "6" "35473583" "35473583" "subst" "8.12176E-6" "00004" "TULP1_000018" "g.35473583A>C" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "ACMG" "0000685506" "0" "90" "6" "35477026" "35477027" "ins" "0" "00004" "TULP1_000101" "g.35477026_35477027insGGAG" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685507" "0" "90" "6" "35477676" "35477677" "ins" "0" "00004" "TULP1_000102" "g.35477676_35477677insA" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685754" "3" "90" "6" "35471404" "35471404" "subst" "0" "00006" "TULP1_000098" "g.35471404G>A" "" "{PMID:Chen 2018:29843741}" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000685839" "0" "70" "6" "35480593" "35480593" "subst" "0" "00006" "TULP1_000103" "g.35480593C>T" "" "{PMID:Jinda 2014:24618324}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000689728" "0" "30" "6" "35471370" "35471370" "subst" "0" "01943" "TULP1_000104" "g.35471370G>A" "" "" "" "TULP1(NM_003322.5):c.1289C>T (p.A430V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000689729" "0" "30" "6" "35477666" "35477666" "subst" "7.76258E-5" "01943" "TULP1_000105" "g.35477666C>T" "" "" "" "TULP1(NM_003322.5):c.539G>A (p.R180H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000710242" "3" "70" "6" "35473528" "35473528" "subst" "4.06312E-6" "00006" "TULP1_000077" "g.35473528C>T" "1/143 cases" "{PMID:Zenteno 2020:31736247}" "" "" "ACMG PM2, PM5, PP1, PP3, PP4" "Germline" "" "" "0" "" "" "g.35505751C>T" "" "likely pathogenic" "ACMG" "0000711700" "3" "70" "6" "35480413" "35480413" "subst" "0" "00008" "TULP1_000106" "g.35480413T>C" "" "{PMID:Mandal 2005:16123440}" "" "IVS2+3A>G" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000720911" "0" "30" "6" "35466128" "35466128" "subst" "0" "01943" "TEAD3_000003" "g.35466128G>A" "" "" "" "TULP1(NM_003322.5):c.1605C>T (p.F535=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000720912" "0" "30" "6" "35471426" "35471426" "subst" "0" "01943" "TULP1_000108" "g.35471426G>A" "" "" "" "TULP1(NM_003322.5):c.1233C>T (p.N411=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000720913" "0" "50" "6" "35477089" "35477089" "subst" "4.06105E-6" "01943" "TULP1_000110" "g.35477089C>T" "" "" "" "TULP1(NM_003322.5):c.719G>A (p.G240D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000720914" "0" "30" "6" "35477499" "35477499" "subst" "0.000186788" "01943" "TULP1_000111" "g.35477499T>C" "" "" "" "TULP1(NM_003322.5):c.630A>G (p.S210=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000720915" "0" "30" "6" "35479951" "35479951" "subst" "0" "01943" "TULP1_000061" "g.35479951G>A" "" "" "" "TULP1(NM_003322.5):c.190+6C>T, TULP1(NM_003322.6):c.190+6C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000730126" "1" "90" "6" "35471521" "35471521" "dup" "0" "00000" "TULP1_000109" "g.35471521dup" "" "{PMID:Sun 2018:29625443}" "" "c.1217dupT" "" "Germline" "" "" "0" "" "" "g.35503744dup" "" "pathogenic" "ACMG" "0000730266" "2" "70" "6" "35471403" "35471403" "subst" "0" "00000" "TULP1_000107" "g.35471403C>T" "" "{PMID:Sun 2018:29625443}" "" "" "" "Germline" "" "" "0" "" "" "g.35503626C>T" "" "likely pathogenic" "ACMG" "0000731255" "21" "70" "6" "35477686" "35477686" "dup" "0" "00000" "TULP1_000113" "g.35477686dup" "" "{PMID:Thompson 2017:29178642}" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.35509909dup" "" "likely pathogenic (recessive)" "" "0000731256" "21" "70" "6" "35473549" "35473549" "subst" "4.06134E-6" "00000" "TULP1_000112" "g.35473549G>A" "" "{PMID:Thompson 2017:29178642}" "" "" "" "Germline" "" "" "0" "" "" "g.35505772G>A" "" "likely pathogenic (recessive)" "" "0000731279" "11" "70" "6" "35473775" "35473775" "subst" "0" "00000" "TULP1_000017" "g.35473775C>G" "" "{PMID:Thompson 2017:29178642}" "" "" "" "Germline" "" "" "0" "" "" "g.35505998C>G" "" "likely pathogenic (recessive)" "" "0000731440" "3" "70" "6" "35467808" "35467808" "subst" "4.06128E-6" "00000" "TULP1_000036" "g.35467808C>T" "" "{PMID:DiIorio 2017:29053603}" "" "NM_001289395:c.1286G>A" "" "Germline" "" "" "0" "" "" "g.35500031C>T" "" "likely pathogenic (recessive)" "" "0000731492" "3" "70" "6" "35479999" "35479999" "del" "0.000594667" "00000" "TULP1_000064" "g.35479999del" "" "{PMID:Avela 2018:29068140}" "" "" "" "Germline" "" "" "0" "" "" "g.35512222del" "" "likely pathogenic (recessive)" "" "0000731559" "1" "90" "6" "35466243" "35466243" "subst" "8.60839E-5" "00000" "TULP1_000041" "g.35466243G>T" "" "{PMID:Comander 2017:28981474}" "" "" "" "Germline" "" "" "0" "" "" "g.35498466G>T" "" "pathogenic" "" "0000731574" "2" "90" "6" "35478650" "35478650" "subst" "0" "00000" "TULP1_000114" "g.35478650G>A" "" "{PMID:Comander 2017:28981474}" "" "" "" "Germline" "" "" "0" "" "" "g.35510873G>A" "" "pathogenic" "" "0000733096" "1" "70" "6" "35466243" "35466243" "subst" "8.60839E-5" "00000" "TULP1_000041" "g.35466243G>T" "" "{PMID:Stone 2017:28559085}" "" "IVS14-6C>A" "" "Germline" "" "" "0" "" "" "g.35498466G>T" "" "likely pathogenic" "" "0000733549" "2" "70" "6" "35473847" "35473847" "subst" "2.0351E-5" "00000" "TULP1_000015" "g.35473847C>T" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.35506070C>T" "" "likely pathogenic" "" "0000734701" "0" "70" "6" "35480593" "35480593" "subst" "0" "00000" "TULP1_000103" "g.35480593C>T" "" "{PMID:Jinda 2017:28453600}" "" "" "" "Germline" "" "" "0" "" "" "g.35512816C>T" "" "likely pathogenic (recessive)" "" "0000735163" "3" "70" "6" "35471600" "35471600" "subst" "8.23418E-6" "00000" "TULP1_000021" "g.35471600T>C" "" "{PMID:Li 2017:28418496}" "" "" "" "Germline" "" "" "0" "" "" "g.35503823T>C" "" "likely pathogenic" "" "0000735165" "3" "70" "6" "35467787" "35467787" "subst" "2.03075E-5" "00000" "TULP1_000037" "g.35467787T>C" "" "{PMID:Li 2017:28418496}" "" "" "" "Germline" "" "" "0" "" "" "g.35500010T>C" "" "likely pathogenic" "" "0000735173" "3" "70" "6" "35467787" "35467787" "subst" "2.03075E-5" "00000" "TULP1_000037" "g.35467787T>C" "" "{PMID:Li 2017:28418496}" "" "" "" "Germline" "" "" "0" "" "" "g.35500010T>C" "" "likely pathogenic" "" "0000735174" "3" "70" "6" "35467787" "35467787" "subst" "2.03075E-5" "00000" "TULP1_000037" "g.35467787T>C" "" "{PMID:Li 2017:28418496}" "" "" "" "Germline" "" "" "0" "" "" "g.35500010T>C" "" "likely pathogenic" "" "0000736093" "1" "70" "6" "35479425" "35479425" "subst" "0" "00000" "TULP1_000117" "g.35479425C>T" "" "{PMID:Huang 2018:29641573}" "" "" "" "Germline" "" "" "0" "" "" "g.35511648C>T" "" "likely pathogenic" "" "0000736114" "1" "70" "6" "35471585" "35471585" "subst" "1.63769E-5" "00000" "TULP1_000116" "g.35471585C>T" "" "{PMID:Huang 2018:29641573}" "" "" "" "Germline" "" "" "0" "" "" "g.35503808C>T" "" "likely pathogenic" "" "0000736135" "2" "70" "6" "0" "0" "" "0" "00000" "LAMA2_000000" "g.?" "" "{PMID:Huang 2018:29641573}" "" "del ex9-13" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000736155" "2" "70" "6" "35480047" "35480047" "subst" "0" "00000" "TULP1_000118" "g.35480047G>A" "" "{PMID:Huang 2018:29641573}" "" "" "" "Germline" "" "" "0" "" "" "g.35512270G>A" "" "likely pathogenic" "" "0000736222" "1" "90" "6" "35466143" "35466143" "subst" "0" "00000" "TULP1_000115" "g.35466143G>C" "" "{PMID:Bernardis 2016:28127548}" "" "" "" "Germline" "" "" "0" "" "" "g.35498366G>C" "" "pathogenic" "" "0000736223" "1" "90" "6" "35466143" "35466143" "subst" "0" "00000" "TULP1_000115" "g.35466143G>C" "" "{PMID:Bernardis 2016:28127548}" "" "" "" "Germline" "" "" "0" "" "" "g.35498366G>C" "" "pathogenic" "" "0000736224" "1" "90" "6" "35466243" "35466243" "subst" "8.60839E-5" "00000" "TULP1_000041" "g.35466243G>T" "" "{PMID:Bernardis 2016:28127548}" "" "" "" "Germline" "" "" "0" "" "" "g.35498466G>T" "" "pathogenic" "" "0000736262" "2" "90" "6" "35471404" "35471404" "subst" "0" "00000" "TULP1_000098" "g.35471404G>A" "" "{PMID:Bernardis 2016:28127548}" "" "" "" "Germline" "" "" "0" "" "" "g.35503627G>A" "" "pathogenic" "" "0000736263" "2" "90" "6" "35471404" "35471404" "subst" "0" "00000" "TULP1_000098" "g.35471404G>A" "" "{PMID:Bernardis 2016:28127548}" "" "" "" "Germline" "" "" "0" "" "" "g.35503627G>A" "" "pathogenic" "" "0000736264" "2" "90" "6" "35467808" "35467808" "subst" "4.06128E-6" "00000" "TULP1_000036" "g.35467808C>T" "" "{PMID:Bernardis 2016:28127548}" "" "" "" "Germline" "" "" "0" "" "" "g.35500031C>T" "" "pathogenic" "" "0000736856" "0" "50" "6" "35478756" "35478779" "del" "0" "00000" "TULP1_000058" "g.35478756_35478779del" "2/486 individuals" "{PMID:Sergouniotis 2016:27628848}" "" "" "no genotypes reported" "Germline" "" "rs281865169" "0" "" "" "g.35510979_35511002del" "" "VUS" "" "0000760597" "1" "90" "6" "35471346" "35471346" "subst" "0" "00000" "TULP1_000119" "g.35471346C>G" "" "{PMID:Khan 2017:27160483}" "" "" "" "Germline" "" "" "0" "" "" "g.35503569C>G" "" "pathogenic" "" "0000764900" "3" "70" "6" "35466129" "35466129" "subst" "0" "00000" "TULP1_000120" "g.35466129A>G" "" "{PMID:Weisschuh 2016:26766544}" "" "" "" "Germline" "" "" "0" "" "" "g.35498352A>G" "" "likely pathogenic (recessive)" "" "0000764922" "1" "70" "6" "35473605" "35473605" "subst" "2.03051E-5" "00000" "TULP1_000016" "g.35473605C>T" "" "{PMID:Weisschuh 2016:26766544}" "" "" "" "Germline" "" "" "0" "" "" "g.35505828C>T" "" "likely pathogenic (recessive)" "" "0000764942" "2" "70" "6" "35466243" "35466243" "subst" "8.60839E-5" "00000" "TULP1_000041" "g.35466243G>T" "" "{PMID:Weisschuh 2016:26766544}" "" "" "" "Germline" "" "" "0" "" "" "g.35498466G>T" "" "likely pathogenic (recessive)" "" "0000765577" "1" "90" "6" "35471525" "35471525" "subst" "0" "00000" "TULP1_000122" "g.35471525C>G" "" "{PMID:Ge 2015:26667666}" "" "" "" "Germline" "" "" "0" "" "" "g.35503748C>G" "" "pathogenic" "" "0000765605" "2" "90" "6" "35467758" "35467758" "subst" "7.72672E-5" "00000" "TULP1_000121" "g.35467758G>A" "" "{PMID:Ge 2015:26667666}" "" "" "" "Germline" "" "" "0" "" "" "g.35499981G>A" "" "pathogenic" "" "0000765756" "0" "70" "6" "35473878" "35473878" "subst" "0" "00000" "TULP1_000004" "g.35473878G>A" "" "{PMID:Patel 2016:26355662}" "" "" "" "Germline" "" "" "0" "" "" "g.35506101G>A" "" "likely pathogenic" "" "0000765757" "0" "70" "6" "35473878" "35473878" "subst" "0" "00000" "TULP1_000004" "g.35473878G>A" "" "{PMID:Patel 2016:26355662}" "" "" "" "Germline" "" "" "0" "" "" "g.35506101G>A" "" "likely pathogenic" "" "0000765771" "0" "70" "6" "35479968" "35479968" "del" "0" "00000" "TULP1_000123" "g.35479968del" "" "{PMID:Patel 2016:26355662}" "" "" "" "Germline" "" "" "0" "" "" "g.35512191del" "" "likely pathogenic" "" "0000765812" "0" "70" "6" "35473878" "35473878" "subst" "0" "00000" "TULP1_000004" "g.35473878G>A" "" "{PMID:Patel 2016:26355662}" "" "" "" "Germline" "" "" "0" "" "" "g.35506101G>A" "" "likely pathogenic" "" "0000765833" "0" "70" "6" "35467757" "35467757" "subst" "1.22022E-5" "00000" "TULP1_000039" "g.35467757C>T" "" "{PMID:Patel 2016:26355662}" "" "" "" "Germline" "" "" "0" "" "" "g.35499980C>T" "" "likely pathogenic" "" "0000765861" "0" "70" "6" "35473878" "35473878" "subst" "0" "00000" "TULP1_000004" "g.35473878G>A" "" "{PMID:Patel 2016:26355662}" "" "" "" "Germline" "" "" "0" "" "" "g.35506101G>A" "" "likely pathogenic" "" "0000765878" "0" "70" "6" "35471403" "35471403" "subst" "0" "00000" "TULP1_000107" "g.35471403C>T" "" "{PMID:Patel 2016:26355662}" "" "" "" "Germline" "" "" "0" "" "" "g.35503626C>T" "" "likely pathogenic" "" "0000765887" "0" "70" "6" "35473878" "35473878" "subst" "0" "00000" "TULP1_000004" "g.35473878G>A" "" "{PMID:Patel 2016:26355662}" "" "" "" "Germline" "" "" "0" "" "" "g.35506101G>A" "" "likely pathogenic" "" "0000765913" "0" "70" "6" "35473878" "35473878" "subst" "0" "00000" "TULP1_000004" "g.35473878G>A" "" "{PMID:Patel 2016:26355662}" "" "" "" "Germline" "" "" "0" "" "" "g.35506101G>A" "" "likely pathogenic" "" "0000765916" "0" "70" "6" "35473878" "35473878" "subst" "0" "00000" "TULP1_000004" "g.35473878G>A" "" "{PMID:Patel 2016:26355662}" "" "" "" "Germline" "" "" "0" "" "" "g.35506101G>A" "" "likely pathogenic" "" "0000783837" "1" "90" "6" "35467809" "35467809" "subst" "1.62446E-5" "00000" "TULP1_000034" "g.35467809G>A" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.35500032G>A" "" "pathogenic" "" "0000783838" "3" "90" "6" "35477505" "35477505" "del" "0" "00000" "TULP1_000125" "g.35477505del" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.35509728del" "" "pathogenic" "" "0000783874" "2" "50" "6" "35471585" "35471585" "subst" "1.63769E-5" "00000" "TULP1_000116" "g.35471585C>T" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.35503808C>T" "" "VUS" "" "0000783877" "2" "50" "6" "35471404" "35471404" "subst" "0" "00000" "TULP1_000098" "g.35471404G>A" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.35503627G>A" "" "VUS" "" "0000783934" "2" "90" "6" "35471341" "35471341" "subst" "1.14508E-5" "00000" "TULP1_000124" "g.35471341G>A" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.35503564G>A" "" "pathogenic" "" "0000783966" "1" "50" "6" "35477679" "35477679" "dup" "0" "00000" "TULP1_000126" "g.35477679dup" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.35509902dup" "" "VUS" "" "0000784342" "0" "70" "6" "35477055" "35477057" "del" "0" "00000" "TULP1_000074" "g.35477055_35477057del" "1/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "c.761_763delAGG" "" "Germline" "" "" "0" "" "" "g.35509278_35509280del" "" "likely pathogenic (recessive)" "" "0000784359" "0" "70" "6" "35471412" "35471412" "subst" "0" "00000" "TULP1_000127" "g.35471412C>T" "1/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.35503635C>T" "" "likely pathogenic (recessive)" "" "0000785463" "3" "90" "6" "35467787" "35467787" "subst" "2.03075E-5" "00000" "TULP1_000037" "g.35467787T>C" "" "{PMID:Maria 2015:25775262}" "" "" "" "Germline" "" "" "0" "" "" "g.35500010T>C" "" "pathogenic (recessive)" "" "0000786451" "1" "90" "6" "35467809" "35467809" "subst" "1.62446E-5" "00000" "TULP1_000034" "g.35467809G>A" "" "{PMID:Consugar 2015:25412400}" "" "" "" "Germline" "" "" "0" "" "" "g.35500032G>A" "" "pathogenic (recessive)" "" "0000786495" "2" "90" "6" "35473823" "35473823" "subst" "0" "00000" "TULP1_000128" "g.35473823C>T" "" "{PMID:Consugar 2015:25412400}" "" "" "" "Germline" "" "" "0" "" "" "g.35506046C>T" "" "pathogenic (recessive)" "" "0000787736" "3" "90" "6" "35471404" "35471404" "subst" "0" "00000" "TULP1_000098" "g.35471404G>A" "" "{PMID:Sanchez-Alcudia 2014:25342620}" "" "R419W" "" "Germline" "" "" "0" "" "" "g.35503627G>A" "" "pathogenic" "" "0000787737" "3" "90" "6" "35471404" "35471404" "subst" "0" "00000" "TULP1_000098" "g.35471404G>A" "" "{PMID:Sanchez-Alcudia 2014:25342620}" "" "R419W" "" "Germline" "" "" "0" "" "" "g.35503627G>A" "" "pathogenic" "" "0000788124" "2" "90" "6" "35479425" "35479425" "subst" "0" "00000" "TULP1_000117" "g.35479425C>T" "" "{PMID:Oishi 2014:25324289}" "" "" "" "Germline" "" "" "0" "" "" "g.35511648C>T" "" "pathogenic" "" "0000788125" "3" "90" "6" "35479425" "35479425" "subst" "0" "00000" "TULP1_000117" "g.35479425C>T" "" "{PMID:Oishi 2014:25324289}" "" "" "" "Germline" "" "" "0" "" "" "g.35511648C>T" "" "pathogenic" "" "0000788166" "1" "90" "6" "35471593" "35471593" "subst" "4.10529E-6" "00000" "TULP1_000022" "g.35471593A>G" "" "{PMID:Oishi 2014:25324289}" "" "" "" "Germline" "" "" "0" "" "" "g.35503816A>G" "" "pathogenic" "" "0000788348" "0" "70" "6" "35471413" "35471413" "subst" "0" "00000" "TULP1_000070" "g.35471413G>A" "" "{PMID:Katagiri 2014:25268133}" "" "C1246T" "" "Germline" "" "rs200769197" "0" "" "" "g.35503636G>A" "" "likely pathogenic" "" "0000788437" "0" "70" "6" "35480633" "35480633" "subst" "0" "00000" "TULP1_000129" "g.35480633C>T" "" "{PMID:Katagiri 2014:25268133}" "" "G3A" "" "Germline" "" "" "0" "" "" "g.35512856C>T" "" "likely pathogenic" "" "0000789851" "3" "70" "6" "35479999" "35479999" "del" "0.000594667" "00000" "TULP1_000064" "g.35479999del" "" "{PMID:Avela 2019:31087526}" "" "c.148delG" "Check also: Avela 2018" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000789852" "3" "70" "6" "35479999" "35479999" "del" "0.000594667" "00000" "TULP1_000064" "g.35479999del" "" "{PMID:Avela 2019:31087526}" "" "c.148delG" "Check also: Avela 2018" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000790101" "0" "30" "6" "35477025" "35477025" "subst" "0.822024" "00000" "TULP1_000014" "g.35477025C>G" "" "{PMID:Seong-2008:18682808}" "" "c.783G>C(K261N)" "" "Germline" "" "" "0" "" "" "" "" "likely benign" "" "0000791222" "2" "70" "6" "35471404" "35471404" "subst" "0" "00000" "TULP1_000098" "g.35471404G>A" "0 (in-house database, ~5000 samples)" "Tracewska 2021, MolVis in press" "" "" "" "Germline" "yes" "" "0" "" "" "g.35503627G>A" "" "likely pathogenic" "ACMG" "0000791260" "1" "70" "6" "35473605" "35473605" "subst" "2.03051E-5" "00000" "TULP1_000016" "g.35473605C>T" "0 (in-house database, ~5000 samples)" "Tracewska 2021, MolVis in press" "" "" "" "Germline" "yes" "" "0" "" "" "g.35505828C>T" "" "likely pathogenic" "ACMG" "0000791569" "0" "70" "6" "35471593" "35471593" "subst" "4.10529E-6" "04521" "TULP1_000022" "g.35471593A>G" "" "{PMID:Hosono 2018:29844330}" "" "c.1145T>C" "single heterozygous variant in a recessive gene, probably not causative in the patient" "Germline" "no" "" "0" "" "" "g.35503816A>G" "" "likely pathogenic" "ACMG" "0000793971" "3" "90" "6" "35473583" "35473583" "subst" "8.12176E-6" "00000" "TULP1_000018" "g.35473583A>C" "0/100 unrelated normal controls" "{PMID:kannabiran-2012:22605927}" "" "c.1047T>G" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000793972" "3" "90" "6" "35473583" "35473583" "subst" "8.12176E-6" "00000" "TULP1_000018" "g.35473583A>C" "0/100 unrelated normal controls" "{PMID:kannabiran-2012:22605927}" "" "c.1047T>G" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000794400" "0" "70" "6" "35467794" "35467794" "subst" "0" "00000" "TULP1_000131" "g.35467794A>G" "" "{PMID:Wang 2018:30029497}" "" "NM_003322.5:c.1459T>C, NP_003313.3:p.(Ser487Pro), NC_000006.11:g.35467794A>G" "" "Germline" "?" "" "0" "" "" "g.35500017A>G" "" "likely pathogenic" "ACMG" "0000794401" "0" "90" "6" "35474055" "35474058" "del" "0" "00000" "TULP1_000132" "g.35474055_35474058del" "" "{PMID:Wang 2018:30029497}" "" "NM_003322.5:c.823_826del, NP_003313.3:p.(Lys275ArgfsTer34), NC_000006.11:g.35474055_35474058del" "" "Germline" "?" "" "0" "" "" "g.35506278_35506281del" "" "pathogenic" "ACMG" "0000794847" "3" "70" "6" "35467757" "35467757" "subst" "0" "00000" "TULP1_000130" "g.35467757C>G" "" "{PMID:Ezquerra-Inchausti 2018:30337596}" "" "NM_003322, c.1495+1G>C," "" "Germline" "yes" "" "0" "" "" "g.35499980C>G" "" "likely pathogenic" "" "0000795002" "3" "10" "6" "35473878" "35473878" "subst" "0" "00000" "TULP1_000004" "g.35473878G>A" "" "{PMID:Abu-Safieh-2013:23105016}" "" "c.901C>T" "" "Germline" "" "" "0" "" "" "" "" "benign" "" "0000795003" "3" "10" "6" "35473878" "35473878" "subst" "0" "00000" "TULP1_000004" "g.35473878G>A" "" "{PMID:Abu-Safieh-2013:23105016}" "" "c.901C>T" "" "Germline" "" "" "0" "" "" "" "" "benign" "" "0000795004" "3" "90" "6" "35473878" "35473878" "subst" "0" "00000" "TULP1_000004" "g.35473878G>A" "" "{PMID:Abu-Safieh-2013:23105016}" "" "c.901C>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000795005" "3" "90" "6" "35473878" "35473878" "subst" "0" "00000" "TULP1_000004" "g.35473878G>A" "" "{PMID:Abu-Safieh-2013:23105016}" "" "c.901C>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000795006" "3" "90" "6" "35473878" "35473878" "subst" "0" "00000" "TULP1_000004" "g.35473878G>A" "" "{PMID:Abu-Safieh-2013:23105016}" "" "c.901C>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000795007" "3" "10" "6" "35473878" "35473878" "subst" "0" "00000" "TULP1_000004" "g.35473878G>A" "" "{PMID:Abu-Safieh-2013:23105016}" "" "c.901C>T" "" "Germline" "" "" "0" "" "" "" "" "benign" "" "0000795008" "3" "50" "6" "35473878" "35473878" "subst" "0" "00000" "TULP1_000004" "g.35473878G>A" "" "{PMID:Abu-Safieh-2013:23105016}" "" "c.901C>T" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000795009" "3" "50" "6" "35473878" "35473878" "subst" "0" "00000" "TULP1_000004" "g.35473878G>A" "" "{PMID:Abu-Safieh-2013:23105016}" "" "c.901C>T" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000795010" "3" "50" "6" "35473878" "35473878" "subst" "0" "00000" "TULP1_000004" "g.35473878G>A" "" "{PMID:Abu-Safieh-2013:23105016}" "" "c.901C>T" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000795011" "3" "10" "6" "35473878" "35473878" "subst" "0" "00000" "TULP1_000004" "g.35473878G>A" "" "{PMID:Abu-Safieh-2013:23105016}" "" "c.901C>T" "" "Germline" "" "" "0" "" "" "" "" "benign" "" "0000795927" "0" "90" "6" "0" "0" "" "0" "00000" "LAMA2_000000" "g.?" "" "{PMID:Schorderet-2013:23484092}" "" "p.p.TULP1-F529_A530dup" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000795978" "0" "70" "6" "35471540" "35471540" "subst" "0" "00000" "TULP1_000024" "g.35471540G>A" "0/384 controls" "{PMID:Chen-2013:23661368}" "" "c.[1198C>T];[1444C>T]" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000795979" "0" "70" "6" "35467809" "35467809" "subst" "1.62446E-5" "00000" "TULP1_000034" "g.35467809G>A" "0/384 controls" "{PMID:Chen-2013:23661368}" "" "c.[1198C>T];[1444C>T]" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000796003" "0" "30" "6" "35479464" "35479464" "del" "0" "00000" "TULP1_000140" "g.35479464delC" "" "{PMID:Chen-2013:23661368}" "" "c.310delG" "" "Unknown" "" "" "0" "" "" "" "" "likely benign" "" "0000796216" "3" "90" "6" "35467872" "35467872" "subst" "4.06088E-6" "00000" "TULP1_000033" "g.35467872G>C" "" "{PMID:Wang-2013:23847139}" "" "c.1381C>G" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000796217" "3" "90" "6" "35473878" "35473878" "subst" "0" "00000" "TULP1_000004" "g.35473878G>A" "" "{PMID:Wang-2013:23847139}" "" "c.901C>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000796218" "3" "90" "6" "35473878" "35473878" "subst" "0" "00000" "TULP1_000004" "g.35473878G>A" "" "{PMID:Wang-2013:23847139}" "" "c.901C>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000796249" "0" "90" "6" "35467876" "35467877" "del" "0" "00000" "TULP1_000134" "g.35467876_35467877del" "" "{PMID:Wang-2013:23847139}" "" "c.1376_1377del" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000796250" "3" "90" "6" "35477080" "35477083" "del" "8.12189E-6" "00000" "TULP1_000139" "g.35477080_35477083del" "" "{PMID:Wang-2013:23847139}" "" "c.725_728del" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000796251" "3" "90" "6" "35471627" "35471627" "subst" "0" "00000" "TULP1_000136" "g.35471627T>G" "" "{PMID:Wang-2013:23847139}" "" "c.1113-2A>C" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000796263" "0" "90" "6" "35466215" "35466215" "subst" "0" "00000" "TULP1_000133" "g.35466215G>T" "" "{PMID:Wang-2013:23847139}" "" "c.1518C>A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000796264" "0" "90" "6" "35471382" "35471382" "subst" "0" "00000" "TULP1_000135" "g.35471382G>A" "" "{PMID:Wang-2013:23847139}" "" "c.1277C>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000796265" "0" "90" "6" "35471539" "35471539" "subst" "4.08787E-6" "00000" "TULP1_000025" "g.35471539C>T" "" "{PMID:Wang-2013:23847139}" "" "c.1199G>A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000796266" "0" "90" "6" "35473818" "35473818" "subst" "4.06501E-6" "00000" "TULP1_000138" "g.35473818A>C" "" "{PMID:Wang-2013:23847139}" "" "c.961T>G" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000796267" "0" "90" "6" "35473528" "35473528" "subst" "4.06312E-6" "00000" "TULP1_000019" "g.35473528C>A" "" "{PMID:Wang-2013:23847139}" "" "c.1102G>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000796268" "0" "90" "6" "35473566" "35473566" "subst" "0" "00000" "TULP1_000137" "g.35473566T>A" "" "{PMID:Wang-2013:23847139}" "" "c.1064A>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000796708" "0" "90" "6" "35478743" "35478766" "del" "0" "00000" "TULP1_000058" "g.35478743_35478766del" "" "{PMID:Eisenberger-2013:24265693}" "" "c.371_394del" "Unknown 2nd allele" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000796713" "3" "90" "6" "35473583" "35473583" "subst" "8.12176E-6" "00000" "TULP1_000018" "g.35473583A>C" "" "{PMID:Eisenberger-2013:24265693}" "" "c.1047T>G" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000796715" "3" "90" "6" "35471540" "35471540" "subst" "0" "00000" "TULP1_000024" "g.35471540G>A" "" "{PMID:Eisenberger-2013:24265693}" "" "c.1198C>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000796767" "0" "90" "6" "35478743" "35478766" "del" "0" "00000" "TULP1_000058" "g.35478743_35478766del" "" "{PMID:Eisenberger-2013:24265693}" "" "c.371_394del" "Unknown 2nd allele" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000796797" "3" "90" "6" "35473878" "35473878" "subst" "0" "00000" "TULP1_000004" "g.35473878G>A" "" "{PMID:Eisenberger-2013:24265693}" "" "c.901C>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000796816" "3" "90" "6" "35473878" "35473878" "subst" "0" "00000" "TULP1_000004" "g.35473878G>A" "" "{PMID:Eisenberger-2013:24265693}" "" "c.901C>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000796821" "3" "90" "6" "35466129" "35466129" "subst" "0" "00000" "TULP1_000120" "g.35466129A>G" "" "{PMID:Eisenberger-2013:24265693}" "" "c.1604T>C" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000796825" "3" "90" "6" "35473878" "35473878" "subst" "0" "00000" "TULP1_000004" "g.35473878G>A" "" "{PMID:Eisenberger-2013:24265693}" "" "c.901C>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000796832" "3" "90" "6" "35473878" "35473878" "subst" "0" "00000" "TULP1_000004" "g.35473878G>A" "" "{PMID:Eisenberger-2013:24265693}" "" "c.901C>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000796834" "3" "90" "6" "35473878" "35473878" "subst" "0" "00000" "TULP1_000004" "g.35473878G>A" "" "{PMID:Eisenberger-2013:24265693}" "" "c.901C>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000796904" "0" "90" "6" "35467877" "35467877" "subst" "0.000418274" "00000" "TULP1_000045" "g.35467877A>G" "" "{PMID:Wang-2014:24154662}" "" "c.1376T>C" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000796905" "0" "90" "6" "35473516" "35473516" "subst" "0" "00000" "TULP1_000044" "g.35473516A>G" "" "{PMID:Wang-2014:24154662}" "" "c.1112+2T>C" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000798094" "0" "50" "6" "35466243" "35466243" "subst" "8.60839E-5" "00000" "TULP1_000041" "g.35466243G>T" "" "{PMID:Jespersgaar 2019:30718709}" "" "TULP1 c.1495+6T>C, p.(?), c.1496-6C>A, p.(?)" "" "Germline" "?" "" "0" "" "" "g.35498466G>T" "" "VUS" "ACMG" "0000798095" "0" "50" "6" "35467752" "35467752" "subst" "0" "00000" "TULP1_000141" "g.35467752A>G" "" "{PMID:Jespersgaar 2019:30718709}" "" "TULP1 c.1495+6T>C, p.(?), c.1496-6C>A, p.(?)" "" "Germline" "?" "" "0" "" "" "g.35499975A>G" "" "VUS" "ACMG" "0000798096" "0" "70" "6" "35478776" "35478776" "subst" "0" "00000" "TULP1_000142" "g.35478776C>A" "" "{PMID:Jespersgaar 2019:30718709}" "" "TULP1 c.361G>T, p.(Glu121*)" "single heterozygous variant (recessive)" "Germline" "?" "" "0" "" "" "g.35510999C>A" "" "likely pathogenic" "ACMG" "0000798493" "3" "90" "6" "35467904" "35467904" "subst" "0" "00000" "TULP1_000065" "g.35467904C>T" "" "{PMID:Beryozkin-2014:24474277}" "" "c.1349G>A" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000798497" "3" "90" "6" "35479494" "35479494" "subst" "0" "00000" "TULP1_000143" "g.35479494C>A" "" "{PMID:Beryozkin-2014:24474277}" "" "c.280G>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000802577" "0" "50" "6" "35473878" "35473878" "subst" "0.000277732" "02330" "TULP1_000095" "g.35473878G>C" "" "" "" "TULP1(NM_003322.5):c.901C>G (p.Q301E), TULP1(NM_003322.6):c.901C>G (p.Q301E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000802578" "0" "50" "6" "35478765" "35478773" "del" "0" "02330" "TULP1_000144" "g.35478765_35478773del" "" "" "" "TULP1(NM_003322.6):c.378_386delGGACGAGGA (p.D127_E129del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000812211" "3" "70" "6" "35471591" "35471591" "subst" "0" "00000" "TULP1_000145" "g.35471591C>A" "" "{PMID:Martin Merida 2019:30902645}" "" "TULP1 Ex.12 c.1147G>T p.(Asp383Tyr), Ex.12 c.1147G>T p.(Asp383Tyr)" "homozygous" "Germline" "yes" "" "0" "" "" "g.35503814C>A" "" "likely pathogenic" "" "0000812338" "3" "70" "6" "35471617" "35471617" "subst" "0" "00000" "TULP1_000146" "g.35471617A>C" "" "{PMID:Martin Merida 2019:30902645}" "" "TULP1 Ex.12 c.1121T>G p.(Leu374Arg), Ex.12 c.1121T>G p.(Leu374Arg)" "homozygous" "Germline" "yes" "" "0" "" "" "g.35503840A>C" "" "likely pathogenic" "" "0000812339" "0" "70" "6" "35473826" "35473826" "subst" "0" "00000" "TULP1_000148" "g.35473826C>T" "" "{PMID:Martin Merida 2019:30902645}" "" "TULP1 Ex.10 c.953G>A p.Arg318Gln), Ex.11 c.1043C>A p.(Ala348Asp)" "compound heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.35506049C>T" "" "likely pathogenic" "" "0000812340" "0" "70" "6" "35473587" "35473587" "subst" "0" "00000" "TULP1_000147" "g.35473587G>T" "" "{PMID:Martin Merida 2019:30902645}" "" "TULP1 Ex.10 c.953G>A p.Arg318Gln), Ex.11 c.1043C>A p.(Ala348Asp)" "compound heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.35505810G>T" "" "likely pathogenic" "" "0000813193" "0" "70" "6" "35477666" "35477666" "subst" "7.76258E-5" "00000" "TULP1_000105" "g.35477666C>T" "0/200 controls" "{PMID:González-del Pozo-2011:22164218}" "" "c.539G.A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000813222" "0" "30" "6" "35471488" "35471488" "subst" "0" "00000" "TULP1_000149" "g.35471488G>A" "" "{PMID:González-del Pozo-2011:22164218}" "" "c.1224+26C>T" "" "Germline" "" "" "0" "" "" "" "" "likely benign" "" "0000813633" "3" "90" "6" "35479960" "35479960" "subst" "0" "00000" "TULP1_000150" "g.35479960C>A" "" "{PMID:Xu 2020:31630094}" "" "TULP1 NM_003322: g.756G>T, c.187G>T, p.G63X" "" "Germline" "yes" "" "0" "" "" "g.35512183C>A" "" "pathogenic" "ACMG" "0000813669" "1" "90" "6" "35471403" "35471403" "subst" "0" "00000" "TULP1_000107" "g.35471403C>T" "" "{PMID:Xu 2020:31630094}" "" "TULP1 NM_003322: g.9313G>A, c.1256G>A, p.R419Q" "" "Germline" "yes" "" "0" "" "" "g.35503626C>T" "" "pathogenic" "ACMG" "0000813756" "2" "90" "6" "35471539" "35471539" "subst" "4.08787E-6" "00000" "TULP1_000025" "g.35471539C>T" "" "{PMID:Xu 2020:31630094}" "" "TULP1 NM_003322: g.9177G>A, c.1199G>A, p.R400Q" "" "Germline" "yes" "" "0" "" "" "g.35503762C>T" "" "pathogenic" "ACMG" "0000815570" "0" "50" "6" "35477470" "35477470" "subst" "1.62423E-5" "00000" "TULP1_000151" "g.35477470G>A" "" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "TULP1:NM_003322 c.C659T, p.P220L" "heterozygous, individual unsolved, causality of variants unknown" "Germline" "?" "" "0" "" "" "g.35509693G>A" "" "VUS" "ACMG" "0000815591" "0" "50" "6" "35478756" "35478779" "del" "0" "00000" "TULP1_000058" "g.35478756_35478779del" "" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "TULP1:NM_003322 c.371_394del, p.D124_E131del" "heterozygous, individual unsolved, causality of variants unknown" "Germline" "?" "" "0" "" "" "g.35510979_35511002del" "" "VUS" "ACMG" "0000815622" "0" "50" "6" "35477666" "35477666" "subst" "7.76258E-5" "00000" "TULP1_000105" "g.35477666C>T" "" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "TULP1:NM_003322 c.G539A, p.R180H" "heterozygous, individual unsolved, causality of variants unknown" "Germline" "?" "" "0" "" "" "g.35509889C>T" "" "VUS" "ACMG" "0000816003" "0" "70" "6" "35466243" "35466243" "subst" "8.60839E-5" "00000" "TULP1_000041" "g.35466243G>T" "" "{PMID:Zampaglione 2020:32037395}" "" "TULP1 c.1496-6C>A" "Located at end of transcript, heterozygous" "Unknown" "?" "" "0" "" "" "g.35498466G>T" "" "likely pathogenic" "" "0000816048" "0" "70" "6" "35466243" "35466243" "subst" "8.60839E-5" "00000" "TULP1_000041" "g.35466243G>T" "" "{PMID:Zampaglione 2020:32037395}" "" "TULP1 c.1496-6C>A" "Located at end of transcript, heterozygous" "Unknown" "?" "" "0" "" "" "g.35498466G>T" "" "likely pathogenic" "" "0000816116" "0" "70" "6" "35473731" "35480984" "del" "0" "00000" "TULP1_000153" "g.35473731_35480984del" "" "{PMID:Zampaglione 2020:32037395}" "" "TULP1 chr6:35473733_35480986del" "range 7116-7252 bp in various techniques, heterozygous" "Unknown" "?" "" "0" "" "" "g.35505954_35513207del" "" "likely pathogenic" "" "0000816244" "3" "90" "6" "35473878" "35473878" "subst" "0" "00000" "TULP1_000004" "g.35473878G>A" "" "{PMID:Zampaglione 2020:32037395}" "" "TULP1 c.901C>T, p.Gln301Ter" "homozygous" "Unknown" "?" "" "0" "" "" "g.35506101G>A" "" "pathogenic" "" "0000816345" "0" "70" "6" "35473605" "35473605" "subst" "2.03051E-5" "00000" "TULP1_000016" "g.35473605C>T" "" "{PMID:Zampaglione 2020:32037395}" "" "c.1025G>A, p.Arg342Gln" "heterozygous" "Unknown" "?" "" "0" "" "" "g.35505828C>T" "" "likely pathogenic" "" "0000816385" "0" "50" "6" "35466136" "35466136" "subst" "1.23435E-5" "00000" "TULP1_000152" "g.35466136A>G" "" "{PMID:Zampaglione 2020:32037395}" "" "c.1597T>C, p.Ser533Pro" "Located at end of transcript, heterozygous" "Unknown" "?" "" "0" "" "" "g.35498359A>G" "" "VUS" "" "0000816435" "0" "50" "6" "35467877" "35467877" "subst" "0.000418274" "00000" "TULP1_000045" "g.35467877A>G" "" "{PMID:Zampaglione 2020:32037395}" "" "c.1376T>C, p.Ile459Thr" "heterozygous" "Unknown" "?" "" "0" "" "" "g.35500100A>G" "" "VUS" "" "0000816529" "3" "90" "6" "35473878" "35473878" "subst" "0" "00000" "TULP1_000004" "g.35473878G>A" "" "{PMID:Zampaglione 2020:32037395}" "" "c.901C>T, p.Gln301Ter" "homozygous" "Unknown" "?" "" "0" "" "" "g.35506101G>A" "" "pathogenic" "" "0000816764" "3" "70" "6" "35479425" "35479425" "subst" "0" "00000" "TULP1_000117" "g.35479425C>T" "" "{PMID:Jauregui 2020:32098976}" "" "TULP1 c.349G>A, p.E117K" "homozygous" "Unknown" "?" "" "0" "" "" "g.35511648C>T" "" "likely pathogenic" "" "0000818070" "3" "90" "6" "35471593" "35471593" "subst" "4.10529E-6" "00006" "TULP1_000022" "g.35471593A>G" "" "{PMID:Kondo 2004:15557452}" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000819525" "1" "70" "6" "35477500" "35477500" "subst" "0" "00000" "TULP1_000157" "g.35477500G>C" "" "{PMID:Weisschuh 2020:32531858}" "" "TULP1, variant 1: c.629C>G/p.S210*, variant 2: c.629C>G/p.S210*" "solved, homozygous" "Germline" "yes" "" "0" "" "" "g.35509723G>C" "" "likely pathogenic" "" "0000819690" "1" "70" "6" "35473549" "35473549" "subst" "4.06134E-6" "00000" "TULP1_000112" "g.35473549G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "TULP1, variant 1: c.1081C>T/p.R361*, variant 2: c.1258C>A/p.R420S" "solved, compound heterozygous" "Germline" "yes" "" "0" "" "" "g.35505772G>A" "" "likely pathogenic" "" "0000819691" "1" "70" "6" "35473549" "35473549" "subst" "4.06134E-6" "00000" "TULP1_000112" "g.35473549G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "TULP1, variant 1: c.1081C>T/p.R361*, variant 2: c.1258C>A/p.R420S" "solved, compound heterozygous" "Germline" "yes" "" "0" "" "" "g.35505772G>A" "" "likely pathogenic" "" "0000819752" "1" "70" "6" "35473583" "35473583" "subst" "8.12176E-6" "00000" "TULP1_000018" "g.35473583A>C" "" "{PMID:Weisschuh 2020:32531858}" "" "TULP1, variant 1: c.1047T>G/p.N349K, variant 2: c.1047T>G/p.N349K" "solved, homozygous" "Unknown" "?" "" "0" "" "" "g.35505806A>C" "" "likely pathogenic" "" "0000819753" "1" "70" "6" "35473583" "35473583" "subst" "8.12176E-6" "00000" "TULP1_000018" "g.35473583A>C" "" "{PMID:Weisschuh 2020:32531858}" "" "TULP1, variant 1: c.1047T>G/p.N349K, variant 2: c.1047T>G/p.N349K" "solved, homozygous" "Unknown" "?" "" "0" "" "" "g.35505806A>C" "" "likely pathogenic" "" "0000820039" "1" "70" "6" "35473605" "35473605" "subst" "2.03051E-5" "00000" "TULP1_000016" "g.35473605C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "TULP1, variant 1: c.1025G>A/p.R342Q, variant 2: c.1496-6C>A/p.?" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.35505828C>T" "" "likely pathogenic" "" "0000820040" "1" "70" "6" "35473605" "35473605" "subst" "2.03051E-5" "00000" "TULP1_000016" "g.35473605C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "TULP1, variant 1: c.1025G>A/p.R342Q, variant 2: c.1496-6C>A/p.?" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.35505828C>T" "" "likely pathogenic" "" "0000820179" "1" "70" "6" "35471539" "35471539" "subst" "4.08787E-6" "00000" "TULP1_000025" "g.35471539C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "TULP1, variant 1: c.1199G>A/p.R400Q, variant 2: c.1268T>C/p.V423A" "possibly solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.35503762C>T" "" "likely pathogenic" "" "0000820181" "1" "70" "6" "35467757" "35467757" "subst" "1.22022E-5" "00000" "TULP1_000039" "g.35467757C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "TULP1, variant 1: c.1495+1G>A/p.?, variant 2: c.1495+1G>A/p.?" "solved, homozygous" "Unknown" "?" "" "0" "" "" "g.35499980C>T" "" "likely pathogenic" "" "0000820336" "1" "70" "6" "35466210" "35466210" "subst" "0" "00000" "TULP1_000154" "g.35466210C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "TULP1, variant 1: c.1523G>A/p.R508H, variant 2: c.1523G>A/p.R508H" "possibly solved, homozygous" "Unknown" "?" "" "0" "" "" "g.35498433C>T" "" "likely pathogenic" "" "0000820355" "1" "70" "6" "35467782" "35467782" "subst" "4.06174E-6" "00000" "TULP1_000155" "g.35467782A>G" "" "{PMID:Weisschuh 2020:32531858}" "" "TULP1, variant 1: c.1471T>C/p.F491L, variant 2: c.1496-6C>A/p.?" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.35500005A>G" "" "likely pathogenic" "" "0000820526" "1" "70" "6" "35466243" "35466243" "subst" "8.60839E-5" "00000" "TULP1_000041" "g.35466243G>T" "" "{PMID:Weisschuh 2020:32531858}" "" "TULP1, variant 1: c.1496-6C>A/p.?, variant 2: c.1496-6C>A/p.?" "solved, homozygous" "Unknown" "?" "" "0" "" "" "g.35498466G>T" "" "likely pathogenic" "" "0000820700" "1" "70" "6" "35471401" "35471401" "subst" "0" "00000" "TULP1_000063" "g.35471401G>T" "" "{PMID:Weisschuh 2020:32531858}" "" "TULP1, variant 1: c.1081C>T/p.R361*, variant 2: c.1258C>A/p.R420S" "solved, compound heterozygous" "Germline" "yes" "" "0" "" "" "g.35503624G>T" "" "likely pathogenic" "" "0000820701" "1" "70" "6" "35471401" "35471401" "subst" "0" "00000" "TULP1_000063" "g.35471401G>T" "" "{PMID:Weisschuh 2020:32531858}" "" "TULP1, variant 1: c.1081C>T/p.R361*, variant 2: c.1258C>A/p.R420S" "solved, compound heterozygous" "Germline" "yes" "" "0" "" "" "g.35503624G>T" "" "likely pathogenic" "" "0000820792" "1" "70" "6" "35466243" "35466243" "subst" "8.60839E-5" "00000" "TULP1_000041" "g.35466243G>T" "" "{PMID:Weisschuh 2020:32531858}" "" "TULP1, variant 1: c.1025G>A/p.R342Q, variant 2: c.1496-6C>A/p.?" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.35498466G>T" "" "likely pathogenic" "" "0000820793" "1" "70" "6" "35466243" "35466243" "subst" "8.60839E-5" "00000" "TULP1_000041" "g.35466243G>T" "" "{PMID:Weisschuh 2020:32531858}" "" "TULP1, variant 1: c.1025G>A/p.R342Q, variant 2: c.1496-6C>A/p.?" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.35498466G>T" "" "likely pathogenic" "" "0000820834" "1" "70" "6" "35471391" "35471391" "subst" "0" "00000" "TULP1_000156" "g.35471391A>G" "" "{PMID:Weisschuh 2020:32531858}" "" "TULP1, variant 1: c.1199G>A/p.R400Q, variant 2: c.1268T>C/p.V423A" "possibly solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.35503614A>G" "" "likely pathogenic" "" "0000820881" "1" "70" "6" "35466243" "35466243" "subst" "8.60839E-5" "00000" "TULP1_000041" "g.35466243G>T" "" "{PMID:Weisschuh 2020:32531858}" "" "TULP1, variant 1: c.1471T>C/p.F491L, variant 2: c.1496-6C>A/p.?" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.35498466G>T" "" "likely pathogenic" "" "0000821402" "3" "70" "6" "35466243" "35466243" "subst" "8.60839E-5" "00000" "TULP1_000041" "g.35466243G>T" "" "{PMID:Turro 2020:32581362}" "" "TULP1 c.1496-6C>A," "homozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.35498466G>T" "" "likely pathogenic" "" "0000823266" "0" "70" "6" "35467871" "35467871" "subst" "0" "00000" "TULP1_000034" "g.35467871A>G" "" "{PMID:Hull 2020:32856788}" "" "TULP1 nucleotide 1, protein 1:c.1382T>C, p.Leu461Pro nucleotide 2, protein 2:c.1444C>T, p.Arg482Trp" "heterozygous, ACMG classified, novel (Table 2)" "Germline" "?" "" "0" "" "" "g.35500094A>G" "" "likely pathogenic" "ACMG" "0000823294" "0" "50" "6" "35467809" "35467809" "subst" "1.62446E-5" "00000" "TULP1_000034" "g.35467809G>A" "" "{PMID:Hull 2020:32856788}" "" "TULP1 nucleotide 1, protein 1:c.1382T>C, p.Leu461Pro nucleotide 2, protein 2:c.1444C>T, p.Arg482Trp" "heterozygous, ACMG unclassified - no access to supplementary table 2" "Germline" "?" "" "0" "" "" "g.35500032G>A" "" "VUS" "" "0000824646" "3" "50" "6" "35479425" "35479425" "subst" "0" "00000" "TULP1_000117" "g.35479425C>T" "" "{PMID:Ma 2021:33691693}" "" "TULP1 c.G349A, p.E117K" "marked as causative, homozygous" "Unknown" "?" "" "0" "" "" "g.35511648C>T" "" "VUS" "ACMG" "0000824662" "0" "50" "6" "35473848" "35473848" "subst" "8.141E-6" "00000" "TULP1_000158" "g.35473848G>A" "" "{PMID:Ma 2021:33691693}" "" "TULP1 c.C931T, p.R311W" "marked as possibly causative, single heterozygous change in a recessive gene, heterozygous" "Unknown" "?" "" "0" "" "" "g.35506071G>A" "" "VUS" "ACMG" "0000825785" "0" "70" "6" "35467794" "35467794" "subst" "0" "00000" "TULP1_000131" "g.35467794A>G" "" "{PMID:Liu-2020:33090715}" "" "c.1459T>C" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000825786" "0" "70" "6" "35474053" "35474056" "del" "0" "00000" "TULP1_000132" "g.35474053_35474056del" "" "{PMID:Liu-2020:33090715}" "" "c.823_826delCTTT" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826169" "0" "70" "6" "35471593" "35471593" "subst" "4.10529E-6" "00000" "TULP1_000022" "g.35471593A>G" "" "{PMID:Liu-2020:33090715}" "" "c.1145T>C" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826170" "0" "70" "6" "35479562" "35479563" "dup" "0" "00000" "TULP1_000162" "g.35479562_35479563dup" "" "{PMID:Liu-2020:33090715}" "" "c.212_213insCG" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826391" "0" "70" "6" "35466172" "35466172" "subst" "0" "00000" "TULP1_000046" "g.35466172G>A" "" "{PMID:Liu-2020:33090715}" "" "c.1561C>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826392" "0" "70" "6" "35477502" "35477502" "del" "0" "00000" "TULP1_000125" "g.35477502del" "" "{PMID:Liu-2020:33090715}" "" "c.627delC" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826515" "3" "90" "6" "35473583" "35473583" "subst" "8.12176E-6" "00000" "TULP1_000018" "g.35473583A>C" "" "{PMID:Salmaninejad-202:33173045}" "" "c.1047T>G" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000827008" "0" "90" "6" "35466173" "35466173" "subst" "8.17174E-6" "00000" "TULP1_000159" "g.35466173G>T" "" "{PMID:Thorsteinsson 2021:33851411}" "" "TULP1 c.1560C>A, p.Tyr520*" "homozygous" "Unknown" "?" "" "0" "" "" "g.35498396G>T" "" "pathogenic" "" "0000827335" "0" "70" "6" "35478686" "35478687" "ins" "0" "00000" "TULP1_000161" "g.35478686_35478687insAG" "" "{PMID:Colombo-2020:33576794}" "" "c.450_451insCT" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000827336" "0" "70" "6" "35466243" "35466243" "subst" "8.60839E-5" "00000" "TULP1_000041" "g.35466243G>T" "" "{PMID:Colombo-2020:33576794}" "" "c.1496-6C>A" "" "Germline" "" "rs281865171" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000827337" "0" "70" "6" "35466243" "35466243" "subst" "8.60839E-5" "00000" "TULP1_000041" "g.35466243G>T" "" "{PMID:Colombo-2020:33576794}" "" "c.1496-6C>A" "" "Germline" "" "rs281865171" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000827338" "0" "70" "6" "35473567" "35473567" "subst" "0" "00000" "TULP1_000160" "g.35473567C>T" "" "{PMID:Colombo-2020:33576794}" "" "c.1063G>A" "" "Germline" "" "rs1085307806" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000828793" "1" "90" "6" "35479960" "35479960" "subst" "0" "00000" "TULP1_000150" "g.35479960C>A" "" "{PMID:Chen 2021:43360855}" "" "TULP1 c.[187G>T];[499+5G>C], V1: c.187G>T, (p.Gly63Ter)" "alleles in trans; heterozygous" "Unknown" "?" "" "0" "" "" "g.35512183C>A" "" "pathogenic" "ACMG" "0000828998" "2" "50" "6" "35478633" "35478633" "subst" "6.09974E-5" "00000" "TULP1_000163" "g.35478633C>G" "" "{PMID:Chen 2021:43360855}" "" "TULP1 c.[187G>T];[499+5G>C], V2: c.499+5G>C," "alleles in trans; heterozygous" "Unknown" "?" "" "0" "" "" "g.35510856C>G" "" "VUS" "ACMG" "0000829776" "3" "90" "6" "35473583" "35473583" "subst" "8.12176E-6" "00006" "TULP1_000018" "g.35473583A>C" "" "{PMID:Ellingsford 2018:29074561}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829954" "3" "90" "6" "35471593" "35471593" "subst" "4.10529E-6" "00000" "TULP1_000022" "g.35471593A>G" "" "{PMID:Numa-2020:33247286}" "" "c.1145T>C:p.F382S" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000841434" "3" "90" "6" "35473878" "35473878" "subst" "0" "00006" "TULP1_000004" "g.35473878G>A" "" "{PMID:Aldahmesh 2009:19956407}" "" "895C>T (Q301X)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000841440" "3" "90" "6" "35473878" "35473878" "subst" "0" "00006" "TULP1_000004" "g.35473878G>A" "" "{PMID:Aldahmesh 2009:19956407}" "" "895C>T (Q301X)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000846739" "3" "90" "6" "35467757" "35467757" "subst" "1.22022E-5" "00000" "TULP1_000039" "g.35467757C>T" "" "{PMID:Lewis 1999:10440267}" "" "TULP1 IVS14+1,G->A" "part of a large EOSRD Dominican kindred with founders born around the year 1800; homozygous" "Germline" "yes" "" "0" "" "" "g.35499980C>T" "" "pathogenic" "" "0000846740" "3" "90" "6" "35467757" "35467757" "subst" "1.22022E-5" "00000" "TULP1_000039" "g.35467757C>T" "" "{PMID:Lewis 1999:10440267}" "" "TULP1 IVS14+1,G->A" "part of a large EOSRD Dominican kindred with founders born around the year 1800; homozygous" "Germline" "yes" "" "0" "" "" "g.35499980C>T" "" "pathogenic" "" "0000846741" "3" "90" "6" "35467757" "35467757" "subst" "1.22022E-5" "00000" "TULP1_000039" "g.35467757C>T" "" "{PMID:Lewis 1999:10440267}" "" "TULP1 IVS14+1,G->A" "part of a large EOSRD Dominican kindred with founders born around the year 1800; homozygous" "Germline" "yes" "" "0" "" "" "g.35499980C>T" "" "pathogenic" "" "0000846742" "3" "90" "6" "35467757" "35467757" "subst" "1.22022E-5" "00000" "TULP1_000039" "g.35467757C>T" "" "{PMID:Lewis 1999:10440267}" "" "TULP1 IVS14+1,G->A" "part of a large EOSRD Dominican kindred with founders born around the year 1800; homozygous" "Germline" "yes" "" "0" "" "" "g.35499980C>T" "" "pathogenic" "" "0000846743" "3" "90" "6" "35467757" "35467757" "subst" "1.22022E-5" "00000" "TULP1_000039" "g.35467757C>T" "" "{PMID:Lewis 1999:10440267}" "" "TULP1 IVS14+1,G->A" "part of a large EOSRD Dominican kindred with founders born around the year 1800; homozygous" "Germline" "yes" "" "0" "" "" "g.35499980C>T" "" "pathogenic" "" "0000846744" "3" "90" "6" "35467757" "35467757" "subst" "1.22022E-5" "00000" "TULP1_000039" "g.35467757C>T" "" "{PMID:Lewis 1999:10440267}" "" "TULP1 IVS14+1,G->A" "part of a large EOSRD Dominican kindred with founders born around the year 1800; homozygous" "Germline" "yes" "" "0" "" "" "g.35499980C>T" "" "pathogenic" "" "0000846745" "3" "90" "6" "35467757" "35467757" "subst" "1.22022E-5" "00000" "TULP1_000039" "g.35467757C>T" "" "{PMID:Lewis 1999:10440267}" "" "TULP1 IVS14+1,G->A" "part of a large EOSRD Dominican kindred with founders born around the year 1800; homozygous" "Germline" "yes" "" "0" "" "" "g.35499980C>T" "" "pathogenic" "" "0000846746" "3" "90" "6" "35467757" "35467757" "subst" "1.22022E-5" "00000" "TULP1_000039" "g.35467757C>T" "" "{PMID:Lewis 1999:10440267}" "" "TULP1 IVS14+1,G->A" "part of a large EOSRD Dominican kindred with founders born around the year 1800; homozygous" "Germline" "yes" "" "0" "" "" "g.35499980C>T" "" "pathogenic" "" "0000846747" "3" "90" "6" "35467757" "35467757" "subst" "1.22022E-5" "00000" "TULP1_000039" "g.35467757C>T" "" "{PMID:Lewis 1999:10440267}" "" "TULP1 IVS14+1,G->A" "part of a large EOSRD Dominican kindred with founders born around the year 1800; homozygous" "Germline" "yes" "" "0" "" "" "g.35499980C>T" "" "pathogenic" "" "0000846748" "3" "90" "6" "35467757" "35467757" "subst" "1.22022E-5" "00000" "TULP1_000039" "g.35467757C>T" "" "{PMID:Lewis 1999:10440267}" "" "TULP1 IVS14+1,G->A" "part of a large EOSRD Dominican kindred with founders born around the year 1800; homozygous" "Germline" "yes" "" "0" "" "" "g.35499980C>T" "" "pathogenic" "" "0000846749" "3" "90" "6" "35467757" "35467757" "subst" "1.22022E-5" "00000" "TULP1_000039" "g.35467757C>T" "" "{PMID:Lewis 1999:10440267}" "" "TULP1 IVS14+1,G->A" "part of a large EOSRD Dominican kindred with founders born around the year 1800; homozygous" "Germline" "yes" "" "0" "" "" "g.35499980C>T" "" "pathogenic" "" "0000846750" "3" "90" "6" "35467757" "35467757" "subst" "1.22022E-5" "00000" "TULP1_000039" "g.35467757C>T" "" "{PMID:Lewis 1999:10440267}" "" "TULP1 IVS14+1,G->A" "part of a large EOSRD Dominican kindred with founders born around the year 1800; homozygous" "Germline" "yes" "" "0" "" "" "g.35499980C>T" "" "pathogenic" "" "0000846751" "3" "90" "6" "35467757" "35467757" "subst" "1.22022E-5" "00000" "TULP1_000039" "g.35467757C>T" "" "{PMID:Lewis 1999:10440267}" "" "TULP1 IVS14+1,G->A" "part of a large EOSRD Dominican kindred with founders born around the year 1800; homozygous" "Germline" "yes" "" "0" "" "" "g.35499980C>T" "" "pathogenic" "" "0000846752" "3" "90" "6" "35467757" "35467757" "subst" "1.22022E-5" "00000" "TULP1_000039" "g.35467757C>T" "" "{PMID:Lewis 1999:10440267}" "" "TULP1 IVS14+1,G->A" "part of a large EOSRD Dominican kindred with founders born around the year 1800; homozygous" "Germline" "yes" "" "0" "" "" "g.35499980C>T" "" "pathogenic" "" "0000846753" "3" "90" "6" "35467757" "35467757" "subst" "1.22022E-5" "00000" "TULP1_000039" "g.35467757C>T" "" "{PMID:Lewis 1999:10440267}" "" "TULP1 IVS14+1,G->A" "part of a large EOSRD Dominican kindred with founders born around the year 1800; homozygous" "Germline" "yes" "" "0" "" "" "g.35499980C>T" "" "pathogenic" "" "0000846754" "3" "90" "6" "35467757" "35467757" "subst" "1.22022E-5" "00000" "TULP1_000039" "g.35467757C>T" "" "{PMID:Lewis 1999:10440267}" "" "TULP1 IVS14+1,G->A" "part of a large EOSRD Dominican kindred with founders born around the year 1800; homozygous" "Germline" "yes" "" "0" "" "" "g.35499980C>T" "" "pathogenic" "" "0000846764" "3" "90" "6" "35471401" "35471401" "subst" "0" "00000" "TULP1_000063" "g.35471401G>T" "" "{PMID:Roosing 2013:23499059}" "" "TULP1 c.1258C A; p.Arg420Ser" "homozygous - uniparental disomy (UPD) of chromosome 6" "Germline" "yes" "" "0" "" "" "g.35503624G>T" "" "pathogenic" "" "0000846765" "3" "90" "6" "35471401" "35471401" "subst" "0" "00000" "TULP1_000063" "g.35471401G>T" "" "{PMID:Roosing 2013:23499059}" "" "TULP1 c.1258C A; p.Arg420Ser" "homozygous" "Germline" "yes" "" "0" "" "" "g.35503624G>T" "" "pathogenic" "" "0000846768" "3" "70" "6" "35473878" "35473878" "subst" "0" "00000" "TULP1_000004" "g.35473878G>A" "" "{PMID:Jacobson 2014:25074776}" "" "TULP1 p.Q301Ter" "no nucleotide annotation, extrapolated from protein and databases; homozygous" "Germline" "yes" "" "0" "" "" "g.35506101G>A" "" "likely pathogenic" "" "0000846769" "3" "70" "6" "35473878" "35473878" "subst" "0" "00000" "TULP1_000004" "g.35473878G>A" "" "{PMID:Jacobson 2014:25074776}" "" "TULP1 p.Q301Ter" "no nucleotide annotation, extrapolated from protein and databases; homozygous" "Germline" "yes" "" "0" "" "" "g.35506101G>A" "" "likely pathogenic" "" "0000846770" "3" "70" "6" "35473528" "35473528" "subst" "4.06312E-6" "00000" "TULP1_000019" "g.35473528C>A" "" "{PMID:Jacobson 2014:25074776}" "" "TULP1 p.G368W" "no nucleotide annotation, extrapolated from protein and databases; heterozygous" "Unknown" "?" "" "0" "" "" "g.35505751C>A" "" "likely pathogenic" "" "0000846771" "3" "70" "6" "35471539" "35471539" "subst" "4.08787E-6" "00000" "TULP1_000025" "g.35471539C>T" "" "{PMID:Jacobson 2014:25074776}" "" "TULP1 p.R400Q" "no nucleotide annotation, extrapolated from protein and databases; heterozygous" "Unknown" "?" "" "0" "" "" "g.35503762C>T" "" "likely pathogenic" "" "0000846772" "3" "70" "6" "35471540" "35471540" "subst" "0" "00000" "TULP1_000024" "g.35471540G>A" "" "{PMID:Jacobson 2014:25074776}" "" "TULP1 p.R400W" "no nucleotide annotation, extrapolated from protein and databases; homozygous" "Unknown" "?" "" "0" "" "" "g.35503763G>A" "" "likely pathogenic" "" "0000846773" "3" "70" "6" "10791926" "10791927" "ins" "0" "00000" "MAK_000066" "g.10791926_10791927ins[NC_000004.11:g.106370094_106370420;A[26]]" "" "{PMID:Jacobson 2014:25074776}" "" "MAK p.K429 insAlu_353bp" "no nucleotide annotation, extrapolated from protein and databases; hemizygous" "Unknown" "?" "" "0" "" "" "g.?" "" "likely pathogenic" "" "0000846804" "3" "70" "6" "35473566" "35473566" "subst" "0" "00000" "TULP1_000137" "g.35473566T>A" "" "{PMID:Jacobson 2014:25074776}" "" "TULP1 p.D355V" "no nucleotide annotation, extrapolated from protein and databases; heterozygous" "Unknown" "?" "" "0" "" "" "g.35505789T>A" "" "likely pathogenic" "" "0000846805" "3" "70" "6" "35473818" "35473818" "subst" "4.06501E-6" "00000" "TULP1_000138" "g.35473818A>C" "" "{PMID:Jacobson 2014:25074776}" "" "TULP1 p.Y321D" "no nucleotide annotation, extrapolated from protein and databases; heterozygous" "Unknown" "?" "" "0" "" "" "g.35506041A>C" "" "likely pathogenic" "" "0000846811" "3" "70" "6" "35473549" "35473549" "subst" "4.06134E-6" "00000" "TULP1_000112" "g.35473549G>A" "" "{PMID:Guo 2015:24547928}" "" "TULP1 c.1081C>T, p.Arg361*" "homozygous" "Germline" "yes" "" "0" "" "" "g.35505772G>A" "" "likely pathogenic" "" "0000846812" "3" "70" "6" "35473878" "35473878" "subst" "0" "00000" "TULP1_000004" "g.35473878G>A" "" "{PMID:Khan 2015:25342276}" "" "TULP1 c.901C>T (p.Gln301*)" "homozygous" "Germline" "yes" "" "0" "" "" "g.35506101G>A" "" "likely pathogenic" "" "0000846813" "3" "70" "6" "35473878" "35473878" "subst" "0" "00000" "TULP1_000004" "g.35473878G>A" "" "{PMID:Khan 2015:25342276}" "" "TULP1 c.901C>T (p.Gln301*)" "homozygous" "Germline" "yes" "" "0" "" "" "g.35506101G>A" "" "likely pathogenic" "" "0000846814" "3" "70" "6" "35473878" "35473878" "subst" "0" "00000" "TULP1_000004" "g.35473878G>A" "" "{PMID:Khan 2015:25342276}" "" "TULP1 c.901C>T (p.Gln301*)" "homozygous" "Germline" "yes" "" "0" "" "" "g.35506101G>A" "" "likely pathogenic" "" "0000846815" "3" "70" "6" "35473878" "35473878" "subst" "0" "00000" "TULP1_000004" "g.35473878G>A" "" "{PMID:Khan 2015:25342276}" "" "TULP1 c.901C>T (p.Gln301*)" "homozygous" "Germline" "yes" "" "0" "" "" "g.35506101G>A" "" "likely pathogenic" "" "0000846816" "3" "70" "6" "35473878" "35473878" "subst" "0" "00000" "TULP1_000004" "g.35473878G>A" "" "{PMID:Khan 2015:25342276}" "" "TULP1 c.901C>T (p.Gln301*)" "homozygous" "Germline" "yes" "" "0" "" "" "g.35506101G>A" "" "likely pathogenic" "" "0000846817" "3" "70" "6" "35473878" "35473878" "subst" "0" "00000" "TULP1_000004" "g.35473878G>A" "" "{PMID:Khan 2015:25342276}" "" "TULP1 c.901C>T (p.Gln301*)" "homozygous" "Germline" "yes" "" "0" "" "" "g.35506101G>A" "" "likely pathogenic" "" "0000846818" "3" "70" "6" "35473878" "35473878" "subst" "0" "00000" "TULP1_000004" "g.35473878G>A" "" "{PMID:Khan 2015:25342276}" "" "TULP1 c.901C>T (p.Gln301*)" "homozygous" "Germline" "yes" "" "0" "" "" "g.35506101G>A" "" "likely pathogenic" "" "0000846819" "3" "70" "6" "35473878" "35473878" "subst" "0" "00000" "TULP1_000004" "g.35473878G>A" "" "{PMID:Khan 2015:25342276}" "" "TULP1 c.901C>T (p.Gln301*)" "homozygous" "Germline" "yes" "" "0" "" "" "g.35506101G>A" "" "likely pathogenic" "" "0000846820" "3" "70" "6" "35473878" "35473878" "subst" "0" "00000" "TULP1_000004" "g.35473878G>A" "" "{PMID:Khan 2015:25342276}" "" "TULP1 c.901C>T (p.Gln301*)" "homozygous" "Germline" "yes" "" "0" "" "" "g.35506101G>A" "" "likely pathogenic" "" "0000846821" "3" "70" "6" "35473878" "35473878" "subst" "0" "00000" "TULP1_000004" "g.35473878G>A" "" "{PMID:Khan 2015:25342276}" "" "TULP1 c.901C>T (p.Gln301*)" "homozygous" "Germline" "yes" "" "0" "" "" "g.35506101G>A" "" "likely pathogenic" "" "0000846823" "3" "70" "6" "35466172" "35466172" "subst" "0" "00000" "TULP1_000046" "g.35466172G>A" "" "{PMID:Ullah 2016:27440997}" "" "TULP1 c.1561C>T (p.P521S)" "homozygous" "Germline" "yes" "" "0" "" "" "g.35498395G>A" "" "likely pathogenic" "" "0000846824" "3" "70" "6" "35466172" "35466172" "subst" "0" "00000" "TULP1_000046" "g.35466172G>A" "" "{PMID:Ullah 2016:27440997}" "" "TULP1 c.1561C>T (p.P521S)" "homozygous" "Germline" "yes" "" "0" "" "" "g.35498395G>A" "" "likely pathogenic" "" "0000846825" "3" "70" "6" "35467754" "35467754" "subst" "0" "00000" "TULP1_000047" "g.35467754T>G" "" "{PMID:Ullah 2016:27440997}" "" "TULP1 c.1495+4A>C (p.P499Rfs104*)" "protein annotation from in silico predictions; homozygous" "Germline" "yes" "" "0" "" "" "g.35499977T>G" "" "likely pathogenic" "" "0000846826" "3" "70" "6" "35467754" "35467754" "subst" "0" "00000" "TULP1_000047" "g.35467754T>G" "" "{PMID:Ullah 2016:27440997}" "" "TULP1 c.1495+4A>C (p.P499Rfs104*)" "protein annotation from in silico predictions; homozygous" "Germline" "yes" "" "0" "" "" "g.35499977T>G" "" "likely pathogenic" "" "0000846827" "3" "70" "6" "35467787" "35467787" "subst" "2.03075E-5" "00000" "TULP1_000037" "g.35467787T>C" "" "{PMID:Ullah 2016:27440997}" "" "TULP1 c.1466A>G (p.K489R)" "homozygous" "Germline" "yes" "" "0" "" "" "g.35500010T>C" "" "likely pathogenic" "" "0000846828" "3" "70" "6" "35467787" "35467787" "subst" "2.03075E-5" "00000" "TULP1_000037" "g.35467787T>C" "" "{PMID:Ullah 2016:27440997}" "" "TULP1 c.1466A>G (p.K489R)" "homozygous" "Germline" "yes" "" "0" "" "" "g.35500010T>C" "" "likely pathogenic" "" "0000846829" "3" "70" "6" "35467787" "35467787" "subst" "2.03075E-5" "00000" "TULP1_000037" "g.35467787T>C" "" "{PMID:Ullah 2016:27440997}" "" "TULP1 c.1466A>G (p.K489R)" "homozygous" "Germline" "yes" "" "0" "" "" "g.35500010T>C" "" "likely pathogenic" "" "0000846830" "3" "70" "6" "35467787" "35467787" "subst" "2.03075E-5" "00000" "TULP1_000037" "g.35467787T>C" "" "{PMID:Ullah 2016:27440997}" "" "TULP1 c.1466A>G (p.K489R)" "homozygous" "Germline" "yes" "" "0" "" "" "g.35500010T>C" "" "likely pathogenic" "" "0000846831" "3" "70" "6" "35467787" "35467787" "subst" "2.03075E-5" "00000" "TULP1_000037" "g.35467787T>C" "" "{PMID:Ullah 2016:27440997}" "" "TULP1 c.1466A>G (p.K489R)" "homozygous" "Germline" "yes" "" "0" "" "" "g.35500010T>C" "" "likely pathogenic" "" "0000846832" "3" "70" "6" "35467787" "35467787" "subst" "2.03075E-5" "00000" "TULP1_000037" "g.35467787T>C" "" "{PMID:Ullah 2016:27440997}" "" "TULP1 c.1466A>G (p.K489R)" "homozygous" "Germline" "yes" "" "0" "" "" "g.35500010T>C" "" "likely pathogenic" "" "0000846833" "3" "70" "6" "35479487" "35479488" "del" "0" "00000" "TULP1_000164" "g.35479487_35479488del" "" "{PMID:Ullah 2016:27440997}" "" "TULP1 c.286_287delGA (p.E96Gfs77*)" "homozygous" "Germline" "yes" "" "0" "" "" "g.35511710_35511711del" "" "likely pathogenic" "" "0000846834" "3" "70" "6" "35479487" "35479488" "del" "0" "00000" "TULP1_000164" "g.35479487_35479488del" "" "{PMID:Ullah 2016:27440997}" "" "TULP1 c.286_287delGA (p.E96Gfs77*)" "homozygous" "Germline" "yes" "" "0" "" "" "g.35511710_35511711del" "" "likely pathogenic" "" "0000846835" "3" "70" "6" "35467787" "35467787" "subst" "2.03075E-5" "00000" "TULP1_000037" "g.35467787T>C" "" "{PMID:Ullah 2016:27440997}" "" "TULP1 c.1466A>G (p.K489R)" "homozygous" "Germline" "yes" "" "0" "" "" "g.35500010T>C" "" "likely pathogenic" "" "0000846836" "3" "70" "6" "35467787" "35467787" "subst" "2.03075E-5" "00000" "TULP1_000037" "g.35467787T>C" "" "{PMID:Ullah 2016:27440997}" "" "TULP1 c.1466A>G (p.K489R)" "homozygous" "Germline" "yes" "" "0" "" "" "g.35500010T>C" "" "likely pathogenic" "" "0000846837" "3" "70" "6" "35477686" "35477686" "dup" "0" "00000" "TULP1_000113" "g.35477686dup" "" "{PMID:Souzeau 2018:30090012}" "" "TULP1 c.524dupC, p.(Pro176Thrfs*7)" "homozygous - maternal uniparental isodisomy" "Germline" "yes" "" "0" "" "" "g.35509909dup" "" "likely pathogenic" "" "0000846848" "11" "70" "6" "35467808" "35467808" "subst" "4.06128E-6" "00000" "TULP1_000036" "g.35467808C>T" "" "{PMID:Verbakel 2019:30950243}" "" "TULP1 c.1445G>A, p.(Arg482Gln)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.35500031C>T" "" "likely pathogenic" "" "0000846849" "11" "70" "6" "35467808" "35467808" "subst" "4.06128E-6" "00000" "TULP1_000036" "g.35467808C>T" "" "{PMID:Verbakel 2019:30950243}" "" "TULP1 c.1445G>A, p.(Arg482Gln)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.35500031C>T" "" "likely pathogenic" "" "0000846850" "21" "70" "6" "35477388" "35477388" "subst" "0" "00000" "TULP1_000096" "g.35477388C>T" "" "{PMID:Verbakel 2019:30950243}" "" "TULP1 c.718+23G>A" "heterozygous" "Germline" "yes" "" "0" "" "" "g.35509611C>T" "" "likely pathogenic" "" "0000846851" "21" "70" "6" "35477388" "35477388" "subst" "0" "00000" "TULP1_000096" "g.35477388C>T" "" "{PMID:Verbakel 2019:30950243}" "" "TULP1 c.718+23G>A" "heterozygous" "Germline" "yes" "" "0" "" "" "g.35509611C>T" "" "likely pathogenic" "" "0000846885" "3" "70" "6" "35479999" "35479999" "del" "0.000594667" "00000" "TULP1_000064" "g.35479999del" "" "{PMID:Avela 2019:31087526}" "" "TULP1 c.148delG" "no protein annotation; homozygous" "Germline" "yes" "" "0" "" "" "g.35512222del" "" "likely pathogenic" "" "0000846886" "3" "70" "6" "35479999" "35479999" "del" "0.000594667" "00000" "TULP1_000064" "g.35479999del" "" "{PMID:Avela 2019:31087526}" "" "TULP1 c.148delG" "no protein annotation; homozygous" "Germline" "yes" "" "0" "" "" "g.35512222del" "" "likely pathogenic" "" "0000851214" "0" "30" "6" "35477531" "35477531" "subst" "0" "01943" "TULP1_000166" "g.35477531C>T" "" "" "" "TULP1(NM_003322.5):c.602-4G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000860336" "0" "30" "6" "35471535" "35471535" "subst" "0" "01943" "TULP1_000165" "g.35471535C>T" "" "" "" "TULP1(NM_003322.5):c.1203G>A (p.Q401=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000860337" "0" "30" "6" "35479548" "35479548" "subst" "0" "01943" "TULP1_000167" "g.35479548G>C" "" "" "" "TULP1(NM_003322.5):c.226C>G (p.P76A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000869963" "3" "70" "6" "35473928" "35473931" "dup" "0" "04333" "TULP1_000066" "g.35473928_35473931dup" "" "{PMID:Ben Yosef 2023:37287645}" "" "" "" "Germline" "yes" "" "0" "" "" "g.35506151_35506154dup" "" "pathogenic (recessive)" "" "0000869964" "3" "70" "6" "35473928" "35473931" "dup" "0" "04333" "TULP1_000066" "g.35473928_35473931dup" "" "{PMID:Ben Yosef 2023:37287645}" "" "" "" "Germline" "yes" "" "0" "" "" "g.35506151_35506154dup" "" "pathogenic (recessive)" "" "0000869965" "3" "70" "6" "35473928" "35473931" "dup" "0" "04333" "TULP1_000066" "g.35473928_35473931dup" "" "{PMID:Ben Yosef 2023:37287645}" "" "" "" "Germline" "yes" "" "0" "" "" "g.35506151_35506154dup" "" "pathogenic (recessive)" "" "0000869966" "3" "90" "6" "35473928" "35473931" "dup" "0" "04333" "TULP1_000066" "g.35473928_35473931dup" "" "{PMID:Ben Yosef 2023:37287645}" "" "" "" "Germline" "" "" "0" "" "" "g.35506151_35506154dup" "" "pathogenic (recessive)" "" "0000887231" "0" "30" "6" "35467938" "35467938" "subst" "8.54937E-5" "02330" "TEAD3_000002" "g.35467938C>T" "" "" "" "TULP1(NM_003322.5):c.1324-9G>A, TULP1(NM_003322.6):c.1324-9G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000887232" "0" "30" "6" "35471369" "35471369" "subst" "8.7321E-5" "02330" "TULP1_000168" "g.35471369C>T" "" "" "" "TULP1(NM_003322.6):c.1290G>A (p.A430=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000896490" "1" "90" "6" "35479960" "35479960" "subst" "0" "00000" "TULP1_000150" "g.35479960C>A" "Taiwan Biobank: 0.001214; GnomAD_exome_East: 0.000482; GnomAD_All: 0.0000533" "{PMID:Chen 2021:33608557}" "" "TULP1 c.[187G>T];[499+5G>C]; p.(Gly63Ter)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.35512183C>A" "" "pathogenic" "" "0000896491" "2" "50" "6" "35478633" "35478633" "subst" "6.09974E-5" "00000" "TULP1_000163" "g.35478633C>G" "Taiwan Biobank: 0; GnomAD_exome_East: 0.000218; GnomAD_All: 0.0000637" "{PMID:Chen 2021:33608557}" "" "TULP1 c.[187G>T];[499+5G>C]; p.?" "heterozygous" "Germline" "yes" "" "0" "" "" "g.35510856C>G" "" "VUS" "" "0000908578" "0" "50" "6" "35473548" "35473548" "subst" "8.12301E-6" "01164" "TULP1_000169" "g.35473548C>T" "" "PMID: 30081015" "" "" "ACMG: PM2_SUP, PP3_MOD" "Germline" "?" "" "0" "" "" "g.35505771C>T" "" "VUS" "ACMG" "0000912509" "0" "70" "6" "35471585" "35471585" "subst" "1.63769E-5" "02327" "TULP1_000116" "g.35471585C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000915885" "3" "70" "6" "35471593" "35471593" "subst" "4.10529E-6" "04436" "TULP1_000022" "g.35471593A>G" "" "{PMID:Panneman 2023:36819107}" "" "c.1145T>C" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000915889" "3" "70" "6" "35471593" "35471593" "subst" "4.10529E-6" "04436" "TULP1_000022" "g.35471593A>G" "" "{PMID:Panneman 2023:36819107}" "" "c.1145T>C" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000916031" "3" "70" "6" "35479956" "35479956" "subst" "0" "04436" "TULP1_000174" "g.35479956C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.190+1G>A" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000916087" "1" "90" "6" "35477063" "35477066" "del" "0" "04436" "TULP1_000172" "g.35477063_35477066del" "" "{PMID:Panneman 2023:36819107}" "" "c.742_745del" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916088" "2" "70" "6" "35473567" "35473567" "subst" "0" "04436" "TULP1_000160" "g.35473567C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.1063G>A" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000916139" "1" "90" "6" "35466243" "35466243" "subst" "8.60839E-5" "04436" "TULP1_000041" "g.35466243G>T" "" "{PMID:Panneman 2023:36819107}" "" "c.1496-6C>A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916140" "2" "50" "6" "35466140" "35466145" "dup" "0" "04436" "TULP1_000170" "g.35466140_35466145dup" "" "{PMID:Panneman 2023:36819107}" "" "c.1588_1593dup" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000916170" "1" "90" "6" "35471403" "35471403" "subst" "0" "04436" "TULP1_000107" "g.35471403C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.1256G>A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916171" "2" "50" "6" "35467908" "35467908" "subst" "1.62534E-5" "04436" "TULP1_000171" "g.35467908G>A" "" "{PMID:Panneman 2023:36819107}" "" "c.1345C>T" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000916274" "1" "70" "6" "35471401" "35471401" "subst" "0" "04436" "TULP1_000063" "g.35471401G>T" "" "{PMID:Panneman 2023:36819107}" "" "c.1258C>A" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000916275" "2" "70" "6" "35467871" "35467871" "subst" "0" "04436" "TULP1_000034" "g.35467871A>G" "" "{PMID:Panneman 2023:36819107}" "" "c.1382T>C" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000916278" "1" "70" "6" "35473605" "35473605" "subst" "2.03051E-5" "04436" "TULP1_000016" "g.35473605C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.1025G>A" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000916279" "2" "70" "6" "35471401" "35471401" "subst" "0" "04436" "TULP1_000063" "g.35471401G>T" "" "{PMID:Panneman 2023:36819107}" "" "c.1258C>A" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000916396" "3" "70" "6" "35471401" "35471401" "subst" "0" "04436" "TULP1_000063" "g.35471401G>T" "" "{PMID:Panneman 2023:36819107}" "" "c.1258C>A" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000916527" "3" "90" "6" "35467808" "35467808" "subst" "4.06128E-6" "04436" "TULP1_000036" "g.35467808C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.1445G>A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916763" "3" "70" "6" "35478764" "35478764" "subst" "0" "04436" "TULP1_000173" "g.35478764C>A" "" "{PMID:Panneman 2023:36819107}" "" "c.373G>T" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000929182" "0" "50" "6" "35467862" "35467862" "subst" "0" "02327" "TEAD3_000004" "g.35467862T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000929183" "0" "90" "6" "35471403" "35471403" "subst" "0" "02327" "TULP1_000107" "g.35471403C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000929184" "0" "50" "6" "35474045" "35474045" "subst" "0" "02327" "TULP1_000175" "g.35474045A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000929185" "0" "10" "6" "35474073" "35474073" "subst" "0.290328" "02327" "TULP1_000176" "g.35474073C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000929186" "0" "10" "6" "35477032" "35477032" "subst" "0.380733" "02327" "TULP1_000012" "g.35477032A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000948704" "0" "50" "6" "35466196" "35466196" "subst" "0" "02327" "TEAD3_000005" "g.35466196C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000958036" "3" "90" "6" "35477637" "35477637" "subst" "0" "00006" "TULP1_000091" "g.35477637C>A" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1, PP5" "Germline" "" "" "0" "" "" "g.35509860C>A" "987369" "pathogenic (recessive)" "ACMG" "0000958068" "3" "90" "6" "35473878" "35473878" "subst" "0" "00006" "TULP1_000004" "g.35473878G>A" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1, PP5" "Germline" "" "" "0" "" "" "g.35506101G>A" "" "pathogenic (recessive)" "ACMG" "0000958339" "0" "90" "6" "35473606" "35473606" "subst" "0" "00006" "TULP1_000067" "g.35473606G>A" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1, PP5" "Germline" "" "" "0" "" "" "g.35505829G>A" "" "pathogenic (recessive)" "ACMG" "0000958361" "21" "70" "6" "35467808" "35467808" "subst" "4.06128E-6" "00006" "TULP1_000036" "g.35467808C>T" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PP3, PM2, PM5, PP5" "Germline" "" "" "0" "" "" "g.35500031C>T" "" "likely pathogenic (recessive)" "ACMG" "0000958628" "0" "70" "6" "35466243" "35466243" "subst" "8.60839E-5" "00006" "TULP1_000041" "g.35466243G>T" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PP5_STRONG, BP4, PS4_MODERATE" "Germline" "" "" "0" "" "" "g.35498466G>T" "" "likely pathogenic (recessive)" "ACMG" "0000958646" "11" "70" "6" "35471575" "35471575" "subst" "0" "00006" "TULP1_000178" "g.35471575G>T" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PP3, PM2, PM1_SUPPORTING, PM3" "Germline" "" "" "0" "" "" "g.35503798G>T" "" "likely pathogenic (recessive)" "ACMG" "0000958878" "3" "50" "6" "35471575" "35471575" "subst" "0" "00006" "TULP1_000178" "g.35471575G>T" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PP3, PM2, PM1_SUPPORTING" "Germline" "" "" "0" "" "" "g.35503798G>T" "" "VUS" "ACMG" "0000959069" "0" "70" "6" "35467782" "35467782" "subst" "4.06174E-6" "00006" "TULP1_000155" "g.35467782A>G" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PP3, PM2, PP5_STRONG; no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.35500005A>G" "" "likely pathogenic (recessive)" "ACMG" "0000959277" "3" "50" "6" "35466213" "35466227" "del" "0" "00006" "TULP1_000078" "g.35466213_35466227del" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PM4" "Germline" "" "" "0" "" "" "g.35498436_35498450del" "" "VUS" "ACMG" "0000959466" "0" "50" "6" "35466164" "35466164" "subst" "0" "00006" "TULP1_000177" "g.35466164G>C" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PP3, PM2; no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.35498387G>C" "" "VUS" "ACMG" "0000977217" "0" "50" "6" "35471573" "35471573" "subst" "0" "01804" "TULP1_000179" "g.35471573G>A" "" "" "" "TULP1(NM_003322.6):c.1165C>T (p.(Gln389*))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000977218" "0" "30" "6" "35479937" "35479937" "subst" "0.000605404" "02330" "TULP1_000180" "g.35479937G>A" "" "" "" "TULP1(NM_003322.6):c.190+20C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000986607" "1" "50" "6" "35467877" "35467877" "subst" "0.000418274" "04405" "TULP1_000045" "g.35467877A>G" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "Germline" "" "" "0" "" "" "g.35500100A>G" "" "VUS" "ACMG" "0000986608" "3" "70" "6" "35471400" "35471400" "subst" "0" "04405" "TULP1_000182" "g.35471400C>T" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "Germline" "" "" "0" "" "" "g.35503623C>T" "" "likely pathogenic" "ACMG" "0000986609" "3" "70" "6" "35473543" "35473543" "subst" "0" "04405" "TULP1_000100" "g.35473543C>T" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "Germline" "" "" "0" "" "" "g.35505766C>T" "" "likely pathogenic" "ACMG" "0000986610" "1" "70" "6" "35480004" "35480004" "del" "0" "04405" "TULP1_000183" "g.35480004del" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "Germline" "" "" "0" "" "" "g.35512227del" "" "likely pathogenic" "ACMG" "0000986967" "2" "70" "6" "35467824" "35467824" "subst" "0" "04405" "TULP1_000181" "g.35467824G>C" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "Germline" "" "" "0" "" "" "g.35500047G>C" "" "likely pathogenic" "ACMG" "0000986968" "2" "50" "6" "35466205" "35466205" "subst" "8.16013E-6" "04405" "TULP1_000048" "g.35466205C>T" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "Germline" "" "" "0" "" "" "g.35498428C>T" "" "VUS" "ACMG" "0000987012" "0" "90" "6" "35473528" "35473528" "subst" "4.06312E-6" "00006" "TULP1_000019" "g.35473528C>A" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "case unsolved" "Germline" "" "" "0" "" "" "g.35505751C>A" "" "pathogenic" "ACMG" "0000987195" "0" "90" "6" "35466243" "35466243" "subst" "8.60839E-5" "00006" "TULP1_000041" "g.35466243G>T" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "case unsolved" "Germline" "" "" "0" "" "" "g.35498466G>T" "" "pathogenic" "ACMG" "0000987658" "3" "90" "6" "35467809" "35467809" "subst" "1.62446E-5" "04543" "TULP1_000034" "g.35467809G>A" "" "{PMID:Basharat 2024:38815792}" "" "" "ACMG PP3, PM2, PM5, PP5, PP1" "Germline" "yes" "" "0" "" "" "g.35500032G>A" "" "pathogenic (recessive)" "ACMG" "0000987659" "3" "90" "6" "35467809" "35467809" "subst" "1.62446E-5" "04543" "TULP1_000034" "g.35467809G>A" "" "{PMID:Basharat 2024:38815792}" "" "" "ACMG PP3, PM2, PM5, PP5, PP1" "Germline" "yes" "" "0" "" "" "g.35500032G>A" "" "pathogenic (recessive)" "ACMG" "0000987667" "3" "90" "6" "35473878" "35473878" "subst" "0" "04543" "TULP1_000004" "g.35473878G>A" "" "{PMID:Basharat 2024:38815792}" "" "" "ACMG PVS1, PM2, PP5" "Germline" "yes" "" "0" "" "" "g.35506101G>A" "" "pathogenic (recessive)" "ACMG" "0001014215" "0" "50" "6" "35478756" "35478779" "del" "0" "02325" "TULP1_000058" "g.35478756_35478779del" "" "" "" "TULP1(NM_003322.5):c.371_394delACGAGGAGGACGAGGAAGAGGAGG (p.D124_E131del), TULP1(NM_003322.6):c.371_394delACGAGGAGGACGAGGAAGAGGAGG (p.D124_E131del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes TULP1 ## Count = 555 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000019523" "00022150" "95" "1112" "2" "1112" "2" "c.1112+2T>C" "r.spl?" "p.?" "12" "0000019524" "00022150" "75" "1376" "0" "1376" "0" "c.1376T>C" "r.(?)" "p.(Ile459Thr)" "14" "0000141408" "00022150" "75" "99" "1" "99" "1" "c.99+1G>A" "r.spl?" "p.?" "2i" "0000141409" "00022150" "95" "99" "1" "99" "1" "c.99+1G>A" "r.spl?" "p.?" "2i" "0000141410" "00022150" "95" "99" "1" "99" "1" "c.99+1G>A" "r.spl?" "p.?" "2i" "0000141411" "00022150" "15" "200" "0" "200" "0" "c.200G" "r.(?)" "p.(=)" "4" "0000141412" "00022150" "35" "200" "0" "200" "0" "c.200G" "r.(?)" "p.(=)" "4" "0000141413" "00022150" "35" "200" "0" "200" "0" "c.200G" "r.(?)" "p.(=)" "4" "0000141414" "00022150" "95" "350" "-2" "350" "0" "c.350-2_350del" "r.(?)" "p.?" "4i_5" "0000141415" "00022150" "95" "394" "0" "417" "0" "c.394_417del" "r.(?)" "p.(Glu132_Thr139del)" "5" "0000141416" "00022150" "95" "394" "0" "417" "0" "c.394_417del" "r.(?)" "p.(Glu132_Thr139del)" "5" "0000141417" "00022150" "75" "718" "2" "718" "2" "c.718+2T>C" "r.(spl?)" "p.?" "9i" "0000141418" "00022150" "75" "718" "2" "718" "2" "c.718+2T>C" "r.(spl?)" "p.?" "9i" "0000141419" "00022150" "35" "719" "-19" "719" "-19" "c.719-19T>A" "r.(?)" "p.(=)" "8i" "0000141420" "00022150" "35" "737" "0" "737" "0" "c.737C>T" "r.(?)" "p.(Ala246Val)" "9" "0000141421" "00022150" "15" "776" "0" "776" "0" "c.776T>C" "r.(?)" "p.(Ile259Thr)" "9" "0000141422" "00022150" "35" "776" "0" "776" "0" "c.776T>C" "r.(?)" "p.(Ile259Thr)" "9" "0000141423" "00022150" "75" "776" "0" "776" "0" "c.776T>C" "r.(?)" "p.(Ile259Thr)" "9" "0000141424" "00022150" "75" "776" "0" "776" "0" "c.776T>C" "r.(?)" "p.(Ile259Thr)" "9" "0000141425" "00022150" "75" "776" "0" "776" "0" "c.776T>C" "r.(?)" "p.(Ile259Thr)" "9" "0000141426" "00022150" "75" "783" "0" "783" "0" "c.783C" "r.(?)" "p.(=)" "9" "0000141427" "00022150" "75" "783" "0" "783" "0" "c.783C" "r.(?)" "p.(=)" "9" "0000141428" "00022150" "15" "783" "0" "783" "0" "c.783C" "r.(?)" "p.(=)" "9" "0000141429" "00022150" "15" "783" "0" "783" "0" "c.783C" "r.(?)" "p.(=)" "9" "0000141430" "00022150" "35" "783" "0" "783" "0" "c.783G>C" "r.(?)" "p.(Lys261Asn)" "9" "0000141431" "00022150" "95" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000141432" "00022150" "95" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000141433" "00022150" "95" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000141434" "00022150" "95" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000141435" "00022150" "95" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000141436" "00022150" "95" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000141437" "00022150" "95" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000141438" "00022150" "95" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000141439" "00022150" "95" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000141440" "00022150" "95" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000141441" "00022150" "95" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000141442" "00022150" "95" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000141443" "00022150" "95" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000141444" "00022150" "95" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000141445" "00022150" "95" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000141446" "00022150" "95" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000141447" "00022150" "95" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000141448" "00022150" "95" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000141449" "00022150" "95" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000141450" "00022150" "95" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000141451" "00022150" "95" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000141452" "00022150" "95" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000141453" "00022150" "95" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000141454" "00022150" "95" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000141455" "00022150" "95" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000141456" "00022150" "95" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000141457" "00022150" "95" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000141458" "00022150" "95" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000141459" "00022150" "95" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000141460" "00022150" "95" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000141461" "00022150" "95" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000141462" "00022150" "95" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000141463" "00022150" "75" "932" "0" "932" "0" "c.932G>A" "r.(?)" "p.(Arg311Gln)" "10" "0000141464" "00022150" "75" "932" "0" "932" "0" "c.932G>A" "r.(?)" "p.(Arg311Gln)" "10" "0000141465" "00022150" "95" "901" "0" "901" "0" "c.901del" "r.(?)" "p.(Gln301Argfs*9)" "10" "0000141466" "00022150" "75" "999" "5" "999" "5" "c.999+5G>C" "r.spl?" "p.(=)" "11i" "0000141467" "00022150" "75" "1025" "0" "1025" "0" "c.1025G>A" "r.(?)" "p.(Arg342Gln)" "11" "0000141468" "00022150" "75" "1025" "0" "1025" "0" "c.1025G>A" "r.(?)" "p.(Arg342Gln)" "11" "0000141469" "00022150" "95" "1047" "0" "1047" "0" "c.1047T>G" "r.(?)" "p.(Asn349Lys)" "11" "0000141470" "00022150" "95" "1047" "0" "1047" "0" "c.1047T>G" "r.(?)" "p.(Asn349Lys)" "11" "0000141471" "00022150" "75" "1047" "0" "1047" "0" "c.1047T>G" "r.(?)" "p.(Asn349Lys)" "11" "0000141472" "00022150" "55" "1102" "0" "1102" "0" "c.1102G>T" "r.(?)" "p.(Gly368Trp)" "12" "0000141473" "00022150" "35" "1133" "0" "1133" "0" "c.1133G>A" "r.(?)" "p.(Arg378His)" "12" "0000141474" "00022150" "95" "1138" "0" "1138" "0" "c.1138A>G" "r.(?)" "p.(Thr380Ala)" "12" "0000141475" "00022150" "95" "1138" "0" "1138" "0" "c.1138A>G" "r.(?)" "p.(Thr380Ala)" "12" "0000141476" "00022150" "95" "1138" "0" "1138" "0" "c.1138A>G" "r.(?)" "p.(Thr380Ala)" "12" "0000141477" "00022150" "95" "1138" "0" "1138" "0" "c.1138A>G" "r.(?)" "p.(Thr380Ala)" "12" "0000141478" "00022150" "95" "1138" "0" "1138" "0" "c.1138A>G" "r.(?)" "p.(Thr380Ala)" "12" "0000141479" "00022150" "95" "1138" "0" "1138" "0" "c.1138A>G" "r.(?)" "p.(Thr380Ala)" "12" "0000141480" "00022150" "95" "1138" "0" "1138" "0" "c.1138A>G" "r.(?)" "p.(Thr380Ala)" "12" "0000141481" "00022150" "95" "1138" "0" "1138" "0" "c.1138A>G" "r.(?)" "p.(Thr380Ala)" "12" "0000141482" "00022150" "95" "1138" "0" "1138" "0" "c.1138A>G" "r.(?)" "p.(Thr380Ala)" "12" "0000141483" "00022150" "95" "1138" "0" "1138" "0" "c.1138A>G" "r.(?)" "p.(Thr380Ala)" "12" "0000141484" "00022150" "75" "1145" "0" "1145" "0" "c.1145T>C" "r.(?)" "p.(Val382Ala)" "12" "0000141485" "00022150" "75" "1145" "0" "1145" "0" "c.1145T>C" "r.(?)" "p.(Val382Ala)" "12" "0000141486" "00022150" "35" "1152" "0" "1152" "0" "c.1152C>T" "r.(?)" "p.(=)" "12" "0000141487" "00022150" "95" "1198" "0" "1198" "0" "c.1198C>T" "r.(?)" "p.(Arg400Trp)" "13" "0000141488" "00022150" "95" "1199" "0" "1199" "0" "c.1199G>A" "r.(?)" "p.(Arg400Gln)" "13" "0000141489" "00022150" "95" "1204" "0" "1204" "0" "c.1204G>T" "r.(?)" "p.(Glu402*)" "13" "0000141490" "00022150" "75" "1224" "4" "1224" "4" "c.1224+4A>G" "r.(spl?)" "p.?" "13i" "0000141491" "00022150" "55" "1224" "4" "1224" "4" "c.1224+4A>G" "r.(spl?)" "p.?" "13i" "0000141492" "00022150" "75" "1259" "0" "1259" "0" "c.1259G>C" "r.(?)" "p.(Gly420Ala)" "13" "0000141493" "00022150" "75" "1259" "0" "1259" "0" "c.1259G>C" "r.(?)" "p.(Gly420Ala)" "13" "0000141494" "00022150" "35" "1486" "0" "1486" "0" "c.1486G>A" "r.(?)" "p.(Ala496Thr)" "14" "0000141495" "00022150" "35" "1486" "0" "1486" "0" "c.1486G>A" "r.(?)" "p.(Ala496Thr)" "14" "0000141496" "00022150" "35" "1361" "0" "1361" "0" "c.1361C>T" "r.(?)" "p.(Thr454Met)" "14" "0000141497" "00022150" "35" "1362" "0" "1362" "0" "c.1362C>G" "r.(=)" "p.(=)" "14" "0000141498" "00022150" "35" "1362" "0" "1362" "0" "c.1362G>A" "r.(?)" "p.(=)" "14" "0000141499" "00022150" "35" "1362" "0" "1362" "0" "c.1362G>A" "r.(?)" "p.(=)" "14" "0000141500" "00022150" "75" "1376" "0" "1376" "0" "c.1376T>A" "r.(?)" "p.(Ile459Lys)" "14" "0000141501" "00022150" "95" "1376" "0" "1376" "0" "c.1376T>A" "r.(?)" "p.(Ile459Lys)" "14" "0000141502" "00022150" "75" "1381" "0" "1381" "0" "c.1381C>G" "r.(?)" "p.(Leu461Val)" "14" "0000141503" "00022150" "95" "1444" "0" "1444" "0" "c.1444C>T" "r.(?)" "p.(Arg482Trp)" "14" "0000141504" "00022150" "95" "1444" "0" "1444" "0" "c.1444C>T" "r.(?)" "p.(Arg482Trp)" "14" "0000141505" "00022150" "95" "1444" "0" "1444" "0" "c.1444C>T" "r.(?)" "p.(Arg482Trp)" "14" "0000141506" "00022150" "95" "1444" "0" "1444" "0" "c.1444C>T" "r.(?)" "p.(Arg482Trp)" "14" "0000141507" "00022150" "95" "1444" "0" "1444" "0" "c.1444C>T" "r.(?)" "p.(Arg482Trp)" "14" "0000141508" "00022150" "75" "1445" "0" "1445" "0" "c.1445G>A" "r.(?)" "p.(Arg482Gln)" "14" "0000141509" "00022150" "95" "1466" "0" "1466" "0" "c.1466A>G" "r.(?)" "p.(Glu489Gly)" "14" "0000141510" "00022150" "95" "1466" "0" "1466" "0" "c.1466A>G" "r.(?)" "p.(Glu489Gly)" "14" "0000141511" "00022150" "95" "1466" "0" "1466" "0" "c.1466A>G" "r.(?)" "p.(Glu489Gly)" "14" "0000141512" "00022150" "95" "1466" "0" "1466" "0" "c.1466A>G" "r.(?)" "p.(Glu489Gly)" "14" "0000141513" "00022150" "95" "1466" "0" "1466" "0" "c.1466A>G" "r.(?)" "p.(Glu489Gly)" "14" "0000141514" "00022150" "95" "1466" "0" "1466" "0" "c.1466A>G" "r.(?)" "p.(Glu489Gly)" "14" "0000141515" "00022150" "95" "1466" "0" "1466" "0" "c.1466A>G" "r.(?)" "p.(Glu489Gly)" "14" "0000141516" "00022150" "95" "1466" "0" "1466" "0" "c.1466A>G" "r.(?)" "p.(Glu489Gly)" "14" "0000141517" "00022150" "95" "1466" "0" "1466" "0" "c.1466A>G" "r.(?)" "p.(Glu489Gly)" "14" "0000141518" "00022150" "95" "1466" "0" "1466" "0" "c.1466A>G" "r.(?)" "p.(Glu489Gly)" "14" "0000141519" "00022150" "95" "1466" "0" "1466" "0" "c.1466A>G" "r.(?)" "p.(Glu489Gly)" "14" "0000141520" "00022150" "95" "1466" "0" "1466" "0" "c.1466A>G" "r.(?)" "p.(Glu489Gly)" "14" "0000141521" "00022150" "95" "1466" "0" "1466" "0" "c.1466A>G" "r.(?)" "p.(Glu489Gly)" "14" "0000141522" "00022150" "95" "1466" "0" "1466" "0" "c.1466A>G" "r.(?)" "p.(Glu489Gly)" "14" "0000141523" "00022150" "95" "1466" "0" "1466" "0" "c.1466A>G" "r.(?)" "p.(Glu489Gly)" "14" "0000141524" "00022150" "95" "1466" "0" "1466" "0" "c.1466A>G" "r.(?)" "p.(Glu489Gly)" "14" "0000141525" "00022150" "95" "1466" "0" "1466" "0" "c.1466A>G" "r.(?)" "p.(Glu489Gly)" "14" "0000141526" "00022150" "95" "1466" "0" "1466" "0" "c.1466A>G" "r.(?)" "p.(Glu489Gly)" "14" "0000141527" "00022150" "95" "1466" "0" "1466" "0" "c.1466A>G" "r.(?)" "p.(Glu489Gly)" "14" "0000141528" "00022150" "95" "1466" "0" "1466" "0" "c.1466A>G" "r.(?)" "p.(Glu489Gly)" "14" "0000141529" "00022150" "75" "1472" "0" "1472" "0" "c.1472T>C" "r.(?)" "p.(Phe491Ser)" "14" "0000141530" "00022150" "75" "1472" "0" "1472" "0" "c.1472T>C" "r.(?)" "p.(Phe491Ser)" "14" "0000141531" "00022150" "75" "1495" "1" "1495" "1" "c.1495+1G>A" "r.spl?" "p.?" "14" "0000141532" "00022150" "75" "1495" "1" "1495" "1" "c.1495+1G>A" "r.spl?" "p.?" "14" "0000141533" "00022150" "75" "1495" "1" "1495" "1" "c.1495+1G>A" "r.spl?" "p.?" "14" "0000141534" "00022150" "75" "1495" "1" "1495" "1" "c.1495+1G>A" "r.spl?" "p.?" "14" "0000141535" "00022150" "95" "1495" "2" "1495" "2" "c.1495+2dup" "r.spl?" "p.?" "14" "0000141536" "00022150" "95" "1495" "2" "1495" "2" "c.1495+2dup" "r.spl?" "p.?" "14" "0000141537" "00022150" "95" "1495" "2" "1495" "2" "c.1495+2dup" "r.spl?" "p.?" "14" "0000141538" "00022150" "95" "1495" "2" "1495" "2" "c.1495+2dup" "r.spl?" "p.?" "14" "0000141539" "00022150" "95" "1495" "2" "1495" "2" "c.1495+2dup" "r.spl?" "p.?" "14" "0000141540" "00022150" "75" "1496" "-6" "1496" "-6" "c.1496-6C>A" "r.(spl?)" "p.(=)" "13i" "0000141541" "00022150" "35" "1496" "-6" "1496" "-6" "c.1496-6C>A" "r.(spl?)" "p.(=)" "13i" "0000141542" "00022150" "75" "1496" "-6" "1496" "-6" "c.1496-6C>A" "r.(spl?)" "p.(=)" "13i" "0000141543" "00022150" "95" "1511" "0" "1521" "0" "c.1511_1521del" "r.(=)" "p.(=)" "14" "0000141544" "00022150" "95" "1511" "0" "1521" "0" "c.1511_1521del" "r.(=)" "p.(=)" "14" "0000141545" "00022150" "95" "1511" "0" "1521" "0" "c.1511_1521del" "r.(=)" "p.(=)" "14" "0000141546" "00022150" "95" "1511" "0" "1521" "0" "c.1511_1521del" "r.(=)" "p.(=)" "14" "0000141547" "00022150" "95" "1511" "0" "1521" "0" "c.1511_1521del" "r.(=)" "p.(=)" "14" "0000141548" "00022150" "95" "1582" "0" "1587" "0" "c.1582_1587dup" "r.(=)" "p.(=)" "14" "0000141549" "00022150" "95" "1582" "0" "1587" "0" "c.1582_1587dup" "r.(=)" "p.(=)" "14" "0000141550" "00022150" "95" "1582" "0" "1587" "0" "c.1582_1587dup" "r.(=)" "p.(=)" "14" "0000141551" "00022150" "95" "1582" "0" "1587" "0" "c.1582_1587dup" "r.(=)" "p.(=)" "14" "0000141552" "00022150" "95" "1582" "0" "1587" "0" "c.1582_1587dup" "r.(=)" "p.(=)" "14" "0000141553" "00022150" "95" "1582" "0" "1587" "0" "c.1582_1587dup" "r.(=)" "p.(=)" "14" "0000141554" "00022150" "95" "1582" "0" "1587" "0" "c.1582_1587dup" "r.(=)" "p.(=)" "14" "0000158349" "00022150" "90" "1138" "0" "1138" "0" "c.1138A>G" "r.(?)" "p.(Thr380Ala)" "12" "0000162773" "00022150" "90" "1466" "0" "1466" "0" "c.1466A>G" "r.(?)" "p.(Lys489Arg)" "14" "0000162777" "00022150" "90" "1466" "0" "1466" "0" "c.1466A>G" "r.(?)" "p.(Lys489Arg)" "14" "0000162784" "00022150" "90" "1466" "0" "1466" "0" "c.1466A>G" "r.(?)" "p.(Lys489Arg)" "14" "0000162816" "00022150" "90" "1561" "0" "1561" "0" "c.1561C>T" "r.(?)" "p.(Pro521Ser)" "" "0000162818" "00022150" "90" "1495" "4" "1495" "4" "c.1495+4A>C" "r.spl?" "p.?" "14i" "0000256084" "00022150" "50" "1376" "0" "1376" "0" "c.1376T>C" "r.(?)" "p.(Ile459Thr)" "" "0000311063" "00022150" "10" "1341" "0" "1341" "0" "c.1341G>A" "r.(?)" "p.(Leu447=)" "" "0000311064" "00022150" "30" "190" "6" "190" "6" "c.190+6C>T" "r.(=)" "p.(=)" "" "0000311065" "00022150" "50" "371" "0" "394" "0" "c.371_394del" "r.(?)" "p.(Asp124_Glu131del)" "" "0000311066" "00022150" "30" "499" "12" "499" "12" "c.499+12G>C" "r.(=)" "p.(=)" "" "0000311067" "00022150" "30" "601" "4" "601" "4" "c.601+4A>G" "r.spl?" "p.?" "" "0000311068" "00022150" "10" "823" "-8" "823" "-8" "c.823-8G>A" "r.(=)" "p.(=)" "" "0000311069" "00022150" "10" "99" "12" "99" "12" "c.99+12C>A" "r.(=)" "p.(=)" "" "0000312882" "00022150" "10" "200" "0" "200" "0" "c.200C>G" "r.(?)" "p.(Thr67Arg)" "" "0000319126" "00022150" "50" "1528" "0" "1528" "0" "c.1528G>A" "r.(?)" "p.(Ala510Thr)" "" "0000319127" "00022150" "50" "371" "0" "394" "0" "c.371_394del" "r.(?)" "p.(Asp124_Glu131del)" "" "0000319129" "00022150" "30" "523" "0" "523" "0" "c.523C>G" "r.(?)" "p.(Pro175Ala)" "" "0000319130" "00022150" "50" "538" "0" "538" "0" "c.538C>T" "r.(?)" "p.(Arg180Cys)" "" "0000319131" "00022150" "70" "592" "0" "592" "0" "c.592A>T" "r.(?)" "p.(Lys198Ter)" "" "0000319132" "00022150" "50" "733" "0" "733" "0" "c.733G>T" "r.(?)" "p.(Ala245Ser)" "" "0000319133" "00022150" "50" "797" "0" "797" "0" "c.797G>T" "r.(?)" "p.(Gly266Val)" "" "0000342820" "00022150" "70" "1199" "0" "1199" "0" "c.1199G>A" "r.(?)" "p.(Arg400Gln)" "" "0000342873" "00022150" "70" "1258" "0" "1258" "0" "c.1258C>A" "r.(?)" "p.(Arg420Ser)" "" "0000342972" "00022150" "70" "1445" "0" "1445" "0" "c.1445G>A" "r.(?)" "p.(Arg482Gln)" "" "0000345928" "00022150" "50" "797" "0" "797" "0" "c.797G>T" "r.(?)" "p.(Gly266Val)" "" "0000347499" "00022150" "10" "783" "0" "783" "0" "c.783G>C" "r.(?)" "p.(Lys261Asn)" "" "0000349601" "00022150" "10" "200" "0" "200" "0" "c.200C>G" "r.(?)" "p.(Thr67Arg)" "" "0000358345" "00022150" "90" "1495" "2" "1495" "2" "c.1495+2dup" "r.spl" "p.?" "14i" "0000358346" "00022150" "90" "1349" "0" "1349" "0" "c.1349G>A" "r.(?)" "p.(Trp450*)" "14" "0000358347" "00022150" "90" "849" "0" "852" "0" "c.849_852dup" "r.(?)" "p.(Pro285Serfs*100)" "10" "0000438661" "00022150" "90" "1024" "0" "1024" "0" "c.1024C>T" "r.(?)" "p.(Arg342*)" "11" "0000438662" "00022150" "90" "1102" "0" "1102" "0" "c.1102G>T" "r.(?)" "p.(Gly368Trp)" "11" "0000438685" "00022150" "90" "1495" "1" "1495" "1" "c.1495+1G>A" "r.spl" "p.?" "" "0000476475" "00022150" "50" "1378" "0" "1378" "0" "c.1378G>A" "r.(?)" "p.(Glu460Lys)" "" "0000476476" "00022150" "50" "1361" "0" "1361" "0" "c.1361C>T" "r.(?)" "p.(Thr454Met)" "" "0000476477" "00022150" "50" "1312" "0" "1312" "0" "c.1312C>T" "r.(?)" "p.(Arg438Trp)" "" "0000476478" "00022150" "90" "1246" "0" "1246" "0" "c.1246C>T" "r.(?)" "p.(Arg416Cys)" "" "0000476479" "00022150" "50" "1234" "0" "1234" "0" "c.1234G>A" "r.(?)" "p.(Val412Met)" "" "0000476480" "00022150" "90" "1145" "0" "1145" "0" "c.1145T>C" "r.(?)" "p.(Phe382Ser)" "" "0000476481" "00022150" "50" "1060" "0" "1060" "0" "c.1060A>G" "r.(?)" "p.(Ile354Val)" "" "0000476482" "00022150" "50" "904" "0" "904" "0" "c.904G>A" "r.(?)" "p.(Gly302Ser)" "" "0000476483" "00022150" "10" "783" "0" "783" "0" "c.783G>C" "r.(?)" "p.(Lys261Asn)" "" "0000476484" "00022150" "10" "776" "0" "776" "0" "c.776T>C" "r.(?)" "p.(Ile259Thr)" "" "0000476485" "00022150" "50" "761" "0" "763" "0" "c.761_763del" "r.(?)" "p.(Glu254del)" "" "0000476486" "00022150" "50" "538" "0" "538" "0" "c.538C>T" "r.(?)" "p.(Arg180Cys)" "" "0000476487" "00022150" "50" "370" "0" "370" "0" "c.370G>A" "r.(?)" "p.(Asp124Asn)" "" "0000476488" "00022150" "50" "248" "0" "248" "0" "c.248C>A" "r.(?)" "p.(Ala83Glu)" "" "0000476489" "00022150" "10" "200" "0" "200" "0" "c.200C>G" "r.(?)" "p.(Thr67Arg)" "" "0000477491" "00022150" "10" "783" "0" "783" "0" "c.783G>C" "r.(?)" "p.(Lys261Asn)" "" "0000477492" "00022150" "10" "776" "0" "776" "0" "c.776T>C" "r.(?)" "p.(Ile259Thr)" "" "0000477493" "00022150" "10" "200" "0" "200" "0" "c.200C>G" "r.(?)" "p.(Thr67Arg)" "" "0000487583" "00022150" "70" "1102" "0" "1102" "0" "c.1102G>A" "r.(?)" "p.(Gly368Arg)" "12" "0000497788" "00022150" "50" "1507" "0" "1521" "0" "c.1507_1521del" "r.(?)" "p.(Val503_Gly507del)" "" "0000499707" "00022150" "90" "1145" "0" "1145" "0" "c.1145T>C" "r.(?)" "p.(Val382Ala)" "12" "0000528750" "00022150" "30" "1486" "0" "1486" "0" "c.1486G>A" "r.(?)" "p.(Ala496Thr)" "" "0000528751" "00022150" "10" "1323" "10" "1323" "10" "c.1323+10G>A" "r.(=)" "p.(=)" "" "0000528752" "00022150" "30" "1139" "0" "1139" "0" "c.1139C>T" "r.(?)" "p.(Thr380Met)" "" "0000528753" "00022150" "50" "983" "0" "983" "0" "c.983T>C" "r.(?)" "p.(Leu328Pro)" "" "0000528754" "00022150" "50" "856" "0" "856" "0" "c.856G>A" "r.(?)" "p.(Val286Met)" "" "0000528755" "00022150" "50" "797" "0" "797" "0" "c.797G>T" "r.(?)" "p.(Gly266Val)" "" "0000528756" "00022150" "10" "783" "0" "783" "0" "c.783G>C" "r.(?)" "p.(Lys261Asn)" "" "0000528757" "00022150" "30" "771" "0" "771" "0" "c.771G>A" "r.(?)" "p.(Thr257=)" "" "0000528758" "00022150" "50" "631" "0" "631" "0" "c.631G>A" "r.(?)" "p.(Gly211Arg)" "" "0000528759" "00022150" "50" "527" "0" "527" "0" "c.527C>A" "r.(?)" "p.(Pro176Gln)" "" "0000528760" "00022150" "90" "447" "0" "448" "0" "c.447_448del" "r.(?)" "p.(Lys150GlufsTer23)" "" "0000528761" "00022150" "10" "378" "0" "386" "0" "c.378_386dup" "r.(?)" "p.(Asp127_Glu129dup)" "" "0000528762" "00022150" "30" "100" "-10" "100" "-10" "c.100-10C>T" "r.(=)" "p.(=)" "" "0000528763" "00022150" "30" "30" "0" "30" "0" "c.30G>A" "r.(?)" "p.(Glu10=)" "" "0000528764" "00022150" "30" "-5" "0" "-5" "0" "c.-5G>C" "r.(?)" "p.(=)" "" "0000597851" "00022150" "90" "568" "0" "568" "0" "c.568G>T" "r.(?)" "p.(Glu190*)" "" "0000610333" "00022150" "90" "1495" "1" "1495" "1" "c.1495+1G>A" "r.spl?" "p.?" "" "0000610334" "00022150" "30" "1486" "0" "1486" "0" "c.1486G>A" "r.(?)" "p.(Ala496Thr)" "" "0000610335" "00022150" "50" "1330" "0" "1330" "0" "c.1330G>A" "r.(?)" "p.(Asp444Asn)" "" "0000610336" "00022150" "50" "1324" "-9" "1324" "-9" "c.1324-9G>A" "r.(=)" "p.(=)" "" "0000610337" "00022150" "30" "999" "12" "999" "12" "c.999+12G>C" "r.(=)" "p.(=)" "" "0000610338" "00022150" "30" "823" "-4" "823" "-4" "c.823-4A>G" "r.spl?" "p.?" "" "0000610339" "00022150" "30" "100" "-10" "100" "-10" "c.100-10C>T" "r.(=)" "p.(=)" "" "0000621707" "00022150" "50" "184" "0" "184" "0" "c.184C>T" "r.(?)" "p.(Pro62Ser)" "" "0000651950" "00022150" "50" "1362" "0" "1362" "0" "c.1362G>A" "r.(=)" "p.(=)" "" "0000651951" "00022150" "90" "1145" "0" "1145" "0" "c.1145T>C" "r.(?)" "p.(Phe382Ser)" "" "0000655585" "00022150" "30" "901" "0" "901" "0" "c.901C>G" "r.(?)" "p.(Gln301Glu)" "" "0000677767" "00022150" "70" "1511" "0" "1521" "0" "c.1511_1521del" "r.(?)" "p.(Leu504ProfsTer141)" "" "0000677768" "00022150" "50" "1444" "0" "1444" "0" "c.1444C>T" "r.(?)" "p.(Arg482Trp)" "" "0000677769" "00022150" "90" "718" "23" "718" "23" "c.718+23G>A" "r.(=)" "p.(=)" "" "0000677770" "00022150" "30" "615" "0" "615" "0" "c.615C>T" "r.(?)" "p.(Ala205=)" "" "0000684424" "00022150" "70" "1087" "0" "1087" "0" "c.1087G>A" "r.(?)" "p.(Gly363Arg)" "11" "0000684588" "00022150" "70" "1376" "0" "1376" "0" "c.1376T>A" "r.(?)" "p.(Ile459Lys)" "" "0000684643" "00022150" "70" "999" "5" "999" "5" "c.999+5G>C" "r.spl" "p.?" "" "0000685498" "00022150" "90" "1495" "2" "1495" "2" "c.1495+2dup" "r.spl" "p.?" "" "0000685499" "00022150" "90" "1495" "2" "1495" "2" "c.1495+2dup" "r.spl" "p.?" "" "0000685500" "00022150" "90" "1349" "0" "1349" "0" "c.1349G>A" "r.(?)" "p.(Trp450*)" "" "0000685501" "00022150" "90" "1349" "0" "1349" "0" "c.1349G>A" "r.(?)" "p.(Trp450*)" "" "0000685502" "00022150" "90" "1301" "0" "1301" "0" "c.1301G>A" "r.(?)" "p.(Arg434Lys)" "" "0000685503" "00022150" "90" "1301" "0" "1301" "0" "c.1301G>A" "r.(?)" "p.(Arg434Lys)" "" "0000685504" "00022150" "70" "1047" "0" "1047" "0" "c.1047T>G" "r.(?)" "p.(Asn349Lys)" "" "0000685506" "00022150" "90" "781" "0" "782" "0" "c.781_782insCTCC" "r.(?)" "p.(Lys261Thrfs*124)" "" "0000685507" "00022150" "90" "528" "0" "529" "0" "c.528_529insT" "r.(?)" "p.(Lys177*)" "" "0000685754" "00022150" "90" "1255" "0" "1255" "0" "c.1255C>T" "r.(?)" "p.(Arg419Trp)" "" "0000685839" "00022150" "70" "43" "0" "43" "0" "c.43G>A" "r.(?)" "p.(Asp15Asn)" "" "0000689728" "00022150" "30" "1289" "0" "1289" "0" "c.1289C>T" "r.(?)" "p.(Ala430Val)" "" "0000689729" "00022150" "30" "539" "0" "539" "0" "c.539G>A" "r.(?)" "p.(Arg180His)" "" "0000710242" "00022150" "70" "1102" "0" "1102" "0" "c.1102G>A" "r.(?)" "p.(Gly368Arg)" "" "0000711700" "00022150" "70" "99" "3" "99" "3" "c.99+3A>G" "r.(?)" "p.?" "2i" "0000720911" "00022150" "30" "1605" "0" "1605" "0" "c.1605C>T" "r.(?)" "p.(Phe535=)" "" "0000720912" "00022150" "30" "1233" "0" "1233" "0" "c.1233C>T" "r.(?)" "p.(Asn411=)" "" "0000720913" "00022150" "50" "719" "0" "719" "0" "c.719G>A" "r.(?)" "p.(Gly240Asp)" "" "0000720914" "00022150" "30" "630" "0" "630" "0" "c.630A>G" "r.(?)" "p.(Ser210=)" "" "0000720915" "00022150" "30" "190" "6" "190" "6" "c.190+6C>T" "r.(=)" "p.(=)" "" "0000730126" "00022150" "90" "1217" "0" "1217" "0" "c.1217dup" "r.(?)" "p.(Ile407Aspfs*3)" "" "0000730266" "00022150" "70" "1256" "0" "1256" "0" "c.1256G>A" "r.(?)" "p.(Arg419Gln)" "" "0000731255" "00022150" "70" "524" "0" "524" "0" "c.524dup" "r.(?)" "p.(Pro176Thrfs*7)" "" "0000731256" "00022150" "70" "1081" "0" "1081" "0" "c.1081C>T" "r.(?)" "p.(Arg361*)" "" "0000731279" "00022150" "70" "999" "5" "999" "5" "c.999+5G>C" "r.(?)" "p.?" "" "0000731440" "00022150" "70" "1445" "0" "1445" "0" "c.1445G>A" "r.(?)" "p.(Arg482Gln)" "" "0000731492" "00022150" "70" "148" "0" "148" "0" "c.148del" "r.(?)" "p.(Glu50Asnfs*59)" "" "0000731559" "00022150" "90" "1496" "-6" "1496" "-6" "c.1496-6C>A" "r.spl" "p.?" "" "0000731574" "00022150" "90" "487" "0" "487" "0" "c.487C>T" "r.(?)" "p.(Gln163*)" "" "0000733096" "00022150" "70" "1496" "-6" "1496" "-6" "c.1496-6C>A" "r.spl" "p.?" "" "0000733549" "00022150" "70" "932" "0" "932" "0" "c.932G>A" "r.(?)" "p.(Arg311Gln)" "" "0000734701" "00022150" "70" "43" "0" "43" "0" "c.43G>A" "r.(?)" "p.(Asp15Asn)" "" "0000735163" "00022150" "70" "1138" "0" "1138" "0" "c.1138A>G" "r.(?)" "p.(Thr380Ala)" "" "0000735165" "00022150" "70" "1466" "0" "1466" "0" "c.1466A>G" "r.(?)" "p.(Lys489Arg)" "" "0000735173" "00022150" "70" "1466" "0" "1466" "0" "c.1466A>G" "r.(?)" "p.(Lys489Arg)" "" "0000735174" "00022150" "70" "1466" "0" "1466" "0" "c.1466A>G" "r.(?)" "p.(Lys489Arg)" "" "0000736093" "00022150" "70" "349" "0" "349" "0" "c.349G>A" "r.(?)" "p.(Glu117Lys)" "" "0000736114" "00022150" "70" "1153" "0" "1153" "0" "c.1153G>A" "r.(?)" "p.(Gly385Arg)" "" "0000736135" "00022150" "70" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000736155" "00022150" "70" "100" "0" "100" "0" "c.100C>T" "r.(?)" "p.(Arg34*)" "" "0000736222" "00022150" "90" "1590" "0" "1590" "0" "c.1590C>G" "r.(?)" "p.(Ile530Met)" "15" "0000736223" "00022150" "90" "1590" "0" "1590" "0" "c.1590C>G" "r.(?)" "p.(Ile530Met)" "15" "0000736224" "00022150" "90" "1496" "-6" "1496" "-6" "c.1496-6C>A" "r.spl" "p.?" "14i" "0000736262" "00022150" "90" "1255" "0" "1255" "0" "c.1255C>T" "r.(?)" "p.(Arg419Trp)" "13" "0000736263" "00022150" "90" "1255" "0" "1255" "0" "c.1255C>T" "r.(?)" "p.(Arg419Trp)" "13" "0000736264" "00022150" "90" "1445" "0" "1445" "0" "c.1445G>A" "r.(?)" "p.(Arg482Gln)" "14" "0000736856" "00022150" "50" "371" "0" "394" "0" "c.371_394del" "r.(?)" "p.(Asp124_Glu131del)" "" "0000760597" "00022150" "90" "1313" "0" "1313" "0" "c.1313G>C" "r.(?)" "p.(Arg438Pro)" "" "0000764900" "00022150" "70" "1604" "0" "1604" "0" "c.1604T>C" "r.(?)" "p.(Phe535Ser)" "" "0000764922" "00022150" "70" "1025" "0" "1025" "0" "c.1025G>A" "r.(?)" "p.(Arg342Gln)" "" "0000764942" "00022150" "70" "1496" "-6" "1496" "-6" "c.1496-6C>A" "r.spl" "p.?" "" "0000765577" "00022150" "90" "1213" "0" "1213" "0" "c.1213G>C" "r.(?)" "p.(Ala405Pro)" "" "0000765605" "00022150" "90" "1495" "0" "1495" "0" "c.1495C>T" "r.(?)" "p.(Pro499Ser)" "" "0000765756" "00022150" "70" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301Ter)" "" "0000765757" "00022150" "70" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301Ter)" "" "0000765771" "00022150" "70" "180" "0" "180" "0" "c.180del" "r.(?)" "p.(Lys61SerfsTer48)" "" "0000765812" "00022150" "70" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301Ter)" "" "0000765833" "00022150" "70" "1495" "1" "1495" "1" "c.1495+1G>A" "r.spl" "p.?" "" "0000765861" "00022150" "70" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301Ter)" "" "0000765878" "00022150" "70" "1256" "0" "1256" "0" "c.1256G>A" "r.(?)" "p.(Arg419Gln)" "" "0000765887" "00022150" "70" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301Ter)" "" "0000765913" "00022150" "70" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301Ter)" "" "0000765916" "00022150" "70" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301Ter)" "" "0000783837" "00022150" "90" "1444" "0" "1444" "0" "c.1444C>T" "r.(?)" "p.(Arg482Trp)" "" "0000783838" "00022150" "90" "627" "0" "627" "0" "c.627del" "r.(?)" "p.(Ser210GlnfsTer27)" "" "0000783874" "00022150" "50" "1153" "0" "1153" "0" "c.1153G>A" "r.(?)" "p.(Gly385Arg)" "" "0000783877" "00022150" "50" "1255" "0" "1255" "0" "c.1255C>T" "r.(?)" "p.(Arg419Trp)" "" "0000783934" "00022150" "90" "1318" "0" "1318" "0" "c.1318C>T" "r.(?)" "p.(Arg440Ter)" "" "0000783966" "00022150" "50" "527" "0" "527" "0" "c.527dup" "r.(?)" "p.(Lys177GlufsTer6)" "" "0000784342" "00022150" "70" "761" "0" "763" "0" "c.761_763del" "r.(?)" "p.(Glu254del)" "" "0000784359" "00022150" "70" "1247" "0" "1247" "0" "c.1247G>A" "r.(?)" "p.(Arg416His)" "" "0000785463" "00022150" "90" "1466" "0" "1466" "0" "c.1466A>G" "r.(?)" "p.(Lys489Arg)" "" "0000786451" "00022150" "90" "1444" "0" "1444" "0" "c.1444C>T" "r.(?)" "p.(Arg482Trp)" "" "0000786495" "00022150" "90" "956" "0" "956" "0" "c.956G>A" "r.(?)" "p.(Gly319Asp)" "" "0000787736" "00022150" "90" "1255" "0" "1255" "0" "c.1255C>T" "r.(?)" "p.(Arg419Trp)" "" "0000787737" "00022150" "90" "1255" "0" "1255" "0" "c.1255C>T" "r.(?)" "p.(Arg419Trp)" "" "0000788124" "00022150" "90" "349" "0" "349" "0" "c.349G>A" "r.spl" "p.(Glu117Lys)" "" "0000788125" "00022150" "90" "349" "0" "349" "0" "c.349G>A" "r.spl" "p.(Glu117Lys)" "" "0000788166" "00022150" "90" "1145" "0" "1145" "0" "c.1145T>C" "r.spl" "p.(Phe382Ser)" "" "0000788348" "00022150" "70" "1246" "0" "1246" "0" "c.1246C>T" "r.(?)" "p.(Arg416Cys)" "13" "0000788437" "00022150" "70" "3" "0" "3" "0" "c.3G>A" "r.(?)" "p.(Met1?)" "1" "0000789851" "00022150" "70" "148" "0" "148" "0" "c.148del" "r.(?)" "p.(Glu50Asnfs*45)" "3" "0000789852" "00022150" "70" "148" "0" "148" "0" "c.148del" "r.(?)" "p.(Glu50Asnfs*45)" "3" "0000790101" "00022150" "30" "783" "0" "783" "0" "c.783G>C" "r.(?)" "p.(Lys261Asn)" "9" "0000791222" "00022150" "70" "1255" "0" "1255" "0" "c.1255C>T" "r.(?)" "p.(Arg419Trp)" "13" "0000791260" "00022150" "70" "1025" "0" "1025" "0" "c.1025G>A" "r.(?)" "p.(Arg342Gln)" "11" "0000791569" "00022150" "70" "1145" "0" "1145" "0" "c.1145T>C" "r.(?)" "p.(Phe382Ser)" "12" "0000793971" "00022150" "90" "1047" "0" "1047" "0" "c.1047T>G" "r.(?)" "p.(Asn349Lys)" "11" "0000793972" "00022150" "90" "1047" "0" "1047" "0" "c.1047T>G" "r.(?)" "p.(Asn349Lys)" "11" "0000794400" "00022150" "70" "1459" "0" "1459" "0" "c.1459T>C" "r.(?)" "p.(Ser487Pro)" "14" "0000794401" "00022150" "90" "823" "0" "826" "0" "c.823_826del" "r.(?)" "p.(Lys275Argfs*34)" "9" "0000794847" "00022150" "70" "1495" "1" "1495" "1" "c.1495+1G>C" "r.spl" "p.(?)" "" "0000795002" "00022150" "10" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000795003" "00022150" "10" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000795004" "00022150" "90" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000795005" "00022150" "90" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000795006" "00022150" "90" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000795007" "00022150" "10" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000795008" "00022150" "50" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000795009" "00022150" "50" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000795010" "00022150" "50" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000795011" "00022150" "10" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000795927" "00022150" "90" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" "" "0000795978" "00022150" "70" "1198" "0" "1198" "0" "c.1198C>T" "r.(?)" "p.(Arg400Trp)" "13" "0000795979" "00022150" "70" "1444" "0" "1444" "0" "c.1444C>T" "r.(?)" "p.(Arg482Trp)" "14" "0000796003" "00022150" "30" "310" "0" "310" "0" "c.310del" "r.(?)" "p.(Glu104Lysfs*5)" "4" "0000796216" "00022150" "90" "1381" "0" "1381" "0" "c.1381C>G" "r.?" "p.(Leu461Val)" "14" "0000796217" "00022150" "90" "901" "0" "901" "0" "c.901C>T" "r.?" "p.(Gln301*)" "10" "0000796218" "00022150" "90" "901" "0" "901" "0" "c.901C>T" "r.?" "p.(Gln301*)" "10" "0000796249" "00022150" "90" "1376" "0" "1377" "0" "c.1376_1377del" "r.(?)" "p.(Asp459Glyfs*136)" "14" "0000796250" "00022150" "90" "725" "0" "728" "0" "c.725_728del" "r.(?)" "p.(Val242Alafs*14)" "9" "0000796251" "00022150" "90" "1113" "-2" "1113" "-2" "c.1113-2A>C" "r.?" "p.?" "11i" "0000796263" "00022150" "90" "1518" "0" "1518" "0" "c.1518C>A" "r.?" "p.(Phe506Leu)" "14" "0000796264" "00022150" "90" "1277" "0" "1277" "0" "c.1277C>T" "r.?" "p.(Pro426Leu)" "13" "0000796265" "00022150" "90" "1199" "0" "1199" "0" "c.1199G>A" "r.(?)" "p.(Arg400Gln)" "13" "0000796266" "00022150" "90" "961" "0" "961" "0" "c.961T>G" "r.?" "p.(Tyr321Asp)" "11" "0000796267" "00022150" "90" "1102" "0" "1102" "0" "c.1102G>T" "r.?" "p.(Gly368Trp)" "12" "0000796268" "00022150" "90" "1064" "0" "1064" "0" "c.1064A>T" "r.(?)" "p.(Tyr355Phe)" "11" "0000796708" "00022150" "90" "371" "0" "394" "0" "c.371_394del" "r.(?)" "p.(Pro125_Glu132del)" "5" "0000796713" "00022150" "90" "1047" "0" "1047" "0" "c.1047T>G" "r.(?)" "p.(Asn349Lys)" "11" "0000796715" "00022150" "90" "1198" "0" "1198" "0" "c.1198C>T" "r.(?)" "p.(Arg400Trp)" "13" "0000796767" "00022150" "90" "371" "0" "394" "0" "c.371_394del" "r.(?)" "p.(Pro125_Glu132del)" "5" "0000796797" "00022150" "90" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000796816" "00022150" "90" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000796821" "00022150" "90" "1604" "0" "1604" "0" "c.1604T>C" "r.(?)" "p.(Phe535Ser)" "14" "0000796825" "00022150" "90" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000796832" "00022150" "90" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000796834" "00022150" "90" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000796904" "00022150" "90" "1376" "0" "1376" "0" "c.1376T>C" "r.(?)" "p.(Ile459Thr)" "14" "0000796905" "00022150" "90" "1112" "2" "1112" "2" "c.1112+2T>C" "r.(?)" "p.?" "12i" "0000798094" "00022150" "50" "1496" "-6" "1496" "-6" "c.1496-6C>A" "r.spl?" "p.(?)" "" "0000798095" "00022150" "50" "1495" "6" "1495" "6" "c.1495+6T>C" "r.spl?" "p.(?)" "" "0000798096" "00022150" "70" "361" "0" "361" "0" "c.361G>T" "r.(?)" "p.(Glu121*)" "" "0000798493" "00022150" "90" "1349" "0" "1349" "0" "c.1349G>A" "r.(?)" "p.(Trp450*)" "14" "0000798497" "00022150" "90" "280" "0" "280" "0" "c.280G>T" "r.(?)" "p.(Asp94Tyr)" "4" "0000802577" "00022150" "50" "901" "0" "901" "0" "c.901C>G" "r.(?)" "p.(Gln301Glu)" "" "0000802578" "00022150" "50" "378" "0" "386" "0" "c.378_386del" "r.(?)" "p.(Asp127_Glu129del)" "" "0000812211" "00022150" "70" "1147" "0" "1147" "0" "c.1147G>T" "r.(?)" "p.(Asp383Tyr)" "12" "0000812338" "00022150" "70" "1121" "0" "1121" "0" "c.1121T>G" "r.(?)" "p.(Leu374Arg)" "12" "0000812339" "00022150" "70" "953" "0" "953" "0" "c.953G>A" "r.(?)" "p.(Arg318Gln)" "10" "0000812340" "00022150" "70" "1043" "0" "1043" "0" "c.1043C>A" "r.(?)" "p.(Ala348Asp)" "11" "0000813193" "00022150" "70" "539" "0" "539" "0" "c.539G>A" "r.(?)" "p.(Arg180His)" "6" "0000813222" "00022150" "30" "1224" "26" "1224" "26" "c.1224+26C>T" "r.spl?" "p.?" "13i" "0000813633" "00022150" "90" "187" "0" "187" "0" "c.187G>T" "r.(?)" "p.(Gly63*)" "" "0000813669" "00022150" "90" "1256" "0" "1256" "0" "c.1256G>A" "r.(?)" "p.(Arg419Gln)" "" "0000813756" "00022150" "90" "1199" "0" "1199" "0" "c.1199G>A" "r.(?)" "p.(Arg400Gln)" "" "0000815570" "00022150" "50" "659" "0" "659" "0" "c.659C>T" "r.(?)" "p.(Pro220Leu)" "" "0000815591" "00022150" "50" "371" "0" "394" "0" "c.371_394del" "r.(?)" "p.(Asp124_Glu131del)" "" "0000815622" "00022150" "50" "539" "0" "539" "0" "c.539G>A" "r.(?)" "p.(Arg180His)" "" "0000816003" "00022150" "70" "1496" "-6" "1496" "-6" "c.1496-6C>A" "r.spl?" "p.(?)" "" "0000816048" "00022150" "70" "1496" "-6" "1496" "-6" "c.1496-6C>A" "r.spl?" "p.(?)" "" "0000816116" "00022150" "70" "-349" "0" "999" "49" "c.-349_999+49del" "r.spl" "p.(?)" "" "0000816244" "00022150" "90" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "" "0000816345" "00022150" "70" "1025" "0" "1025" "0" "c.1025G>A" "r.(?)" "p.(Arg342Gln)" "" "0000816385" "00022150" "50" "1597" "0" "1597" "0" "c.1597T>C" "r.(?)" "p.(Ser533Pro)" "" "0000816435" "00022150" "50" "1376" "0" "1376" "0" "c.1376T>C" "r.(?)" "p.(Ile459Thr)" "" "0000816529" "00022150" "90" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "" "0000816764" "00022150" "70" "349" "0" "349" "0" "c.349G>A" "r.(?)" "p.(Glu117Lys)" "" "0000818070" "00022150" "90" "1145" "0" "1145" "0" "c.1145T>C" "r.(?)" "p.(Phe382Ser)" "" "0000819525" "00022150" "70" "629" "0" "629" "0" "c.629C>G" "r.(?)" "p.(Ser210*)" "" "0000819690" "00022150" "70" "1081" "0" "1081" "0" "c.1081C>T" "r.(?)" "p.(Arg361*)" "" "0000819691" "00022150" "70" "1081" "0" "1081" "0" "c.1081C>T" "r.(?)" "p.(Arg361*)" "" "0000819752" "00022150" "70" "1047" "0" "1047" "0" "c.1047T>G" "r.(?)" "p.(Asn349Lys)" "" "0000819753" "00022150" "70" "1047" "0" "1047" "0" "c.1047T>G" "r.(?)" "p.(Asn349Lys)" "" "0000820039" "00022150" "70" "1025" "0" "1025" "0" "c.1025G>A" "r.(?)" "p.(Arg342Gln)" "" "0000820040" "00022150" "70" "1025" "0" "1025" "0" "c.1025G>A" "r.(?)" "p.(Arg342Gln)" "" "0000820179" "00022150" "70" "1199" "0" "1199" "0" "c.1199G>A" "r.(?)" "p.(Arg400Gln)" "" "0000820181" "00022150" "70" "1495" "1" "1495" "1" "c.1495+1G>A" "r.spl" "p.(?)" "" "0000820336" "00022150" "70" "1523" "0" "1523" "0" "c.1523G>A" "r.(?)" "p.(Arg508His)" "" "0000820355" "00022150" "70" "1471" "0" "1471" "0" "c.1471T>C" "r.(?)" "p.(Phe491Leu)" "" "0000820526" "00022150" "70" "1496" "-6" "1496" "-6" "c.1496-6C>A" "r.spl?" "p.(?)" "" "0000820700" "00022150" "70" "1258" "0" "1258" "0" "c.1258C>A" "r.(?)" "p.(Arg420Ser)" "" "0000820701" "00022150" "70" "1258" "0" "1258" "0" "c.1258C>A" "r.(?)" "p.(Arg420Ser)" "" "0000820792" "00022150" "70" "1496" "-6" "1496" "-6" "c.1496-6C>A" "r.spl?" "p.(?)" "" "0000820793" "00022150" "70" "1496" "-6" "1496" "-6" "c.1496-6C>A" "r.spl?" "p.(?)" "" "0000820834" "00022150" "70" "1268" "0" "1268" "0" "c.1268T>C" "r.(?)" "p.(Val423Ala)" "" "0000820881" "00022150" "70" "1496" "-6" "1496" "-6" "c.1496-6C>A" "r.spl?" "p.(?)" "" "0000821402" "00022150" "70" "1496" "-6" "1496" "-6" "c.1496-6C>A" "r.spl?" "p.(?)" "" "0000823266" "00022150" "70" "1382" "0" "1382" "0" "c.1382T>C" "r.(?)" "p.(Leu461Pro)" "" "0000823294" "00022150" "50" "1444" "0" "1444" "0" "c.1444C>T" "r.(?)" "p.(Arg482Trp)" "" "0000824646" "00022150" "50" "349" "0" "349" "0" "c.349G>A" "r.(?)" "p.(Glu117Lys)" "" "0000824662" "00022150" "50" "931" "0" "931" "0" "c.931C>T" "r.(?)" "p.(Arg311Trp)" "" "0000825785" "00022150" "70" "1459" "0" "1459" "0" "c.1459T>C" "r.?" "p.(Ser487Pro)" "14" "0000825786" "00022150" "70" "823" "0" "826" "0" "c.823_826del" "r.(?)" "p.(Leu275Thrfs*42)" "9" "0000826169" "00022150" "70" "1145" "0" "1145" "0" "c.1145T>C" "r.(?)" "p.(Val382Ala)" "12" "0000826170" "00022150" "70" "211" "0" "212" "0" "c.211_212dup" "r.(?)" "p.(Asp71Glufs*25)" "4" "0000826391" "00022150" "70" "1561" "0" "1561" "0" "c.1561C>T" "r.(=)" "p.(Pro521Ser)" "14" "0000826392" "00022150" "70" "627" "0" "627" "0" "c.627del" "r.(?)" "p.(Ser209Argfs*48)" "7" "0000826515" "00022150" "90" "1047" "0" "1047" "0" "c.1047T>G" "r.?" "p.(Asn349Lys)" "11" "0000827008" "00022150" "90" "1560" "0" "1560" "0" "c.1560C>A" "r.(?)" "p.(Tyr520*)" "" "0000827335" "00022150" "70" "450" "0" "451" "0" "c.450_451insCT" "r.(?)" "p.(Glu151Leufs*34)" "6" "0000827336" "00022150" "70" "1496" "-6" "1496" "-6" "c.1496-6C>A" "r.spl?" "p.?" "13i" "0000827337" "00022150" "70" "1496" "-6" "1496" "-6" "c.1496-6C>A" "r.spl?" "p.?" "13i" "0000827338" "00022150" "70" "1063" "0" "1063" "0" "c.1063G>A" "r.(?)" "p.(Asp355Asn)" "11" "0000828793" "00022150" "90" "187" "0" "187" "0" "c.187G>T" "r.(?)" "p.(Gly63*)" "" "0000828998" "00022150" "50" "499" "5" "499" "5" "c.499+5G>C" "r.spl?" "p.(?)" "" "0000829776" "00022150" "90" "1047" "0" "1047" "0" "c.1047T>G" "r.(?)" "p.(Asn349Lys)" "" "0000829954" "00022150" "90" "1145" "0" "1145" "0" "c.1145T>C" "r.(?)" "p.(Phe382Ser)" "12" "0000841434" "00022150" "90" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "" "0000841440" "00022150" "90" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "" "0000846739" "00022150" "90" "1495" "1" "1495" "1" "c.1495+1G>A" "r.spl" "p.(?)" "14i" "0000846740" "00022150" "90" "1495" "1" "1495" "1" "c.1495+1G>A" "r.spl" "p.(?)" "14i" "0000846741" "00022150" "90" "1495" "1" "1495" "1" "c.1495+1G>A" "r.spl" "p.(?)" "14i" "0000846742" "00022150" "90" "1495" "1" "1495" "1" "c.1495+1G>A" "r.spl" "p.(?)" "14i" "0000846743" "00022150" "90" "1495" "1" "1495" "1" "c.1495+1G>A" "r.spl" "p.(?)" "14i" "0000846744" "00022150" "90" "1495" "1" "1495" "1" "c.1495+1G>A" "r.spl" "p.(?)" "14i" "0000846745" "00022150" "90" "1495" "1" "1495" "1" "c.1495+1G>A" "r.spl" "p.(?)" "14i" "0000846746" "00022150" "90" "1495" "1" "1495" "1" "c.1495+1G>A" "r.spl" "p.(?)" "14i" "0000846747" "00022150" "90" "1495" "1" "1495" "1" "c.1495+1G>A" "r.spl" "p.(?)" "14i" "0000846748" "00022150" "90" "1495" "1" "1495" "1" "c.1495+1G>A" "r.spl" "p.(?)" "14i" "0000846749" "00022150" "90" "1495" "1" "1495" "1" "c.1495+1G>A" "r.spl" "p.(?)" "14i" "0000846750" "00022150" "90" "1495" "1" "1495" "1" "c.1495+1G>A" "r.spl" "p.(?)" "14i" "0000846751" "00022150" "90" "1495" "1" "1495" "1" "c.1495+1G>A" "r.spl" "p.(?)" "14i" "0000846752" "00022150" "90" "1495" "1" "1495" "1" "c.1495+1G>A" "r.spl" "p.(?)" "14i" "0000846753" "00022150" "90" "1495" "1" "1495" "1" "c.1495+1G>A" "r.spl" "p.(?)" "14i" "0000846754" "00022150" "90" "1495" "1" "1495" "1" "c.1495+1G>A" "r.spl" "p.(?)" "14i" "0000846764" "00022150" "90" "1258" "0" "1258" "0" "c.1258C>A" "r.(?)" "p.(Arg420Ser)" "13" "0000846765" "00022150" "90" "1258" "0" "1258" "0" "c.1258C>A" "r.(?)" "p.(Arg420Ser)" "13" "0000846768" "00022150" "70" "901" "0" "901" "0" "c.(901C>T)" "r.(?)" "p.(Gln301*)" "" "0000846769" "00022150" "70" "901" "0" "901" "0" "c.(901C>T)" "r.(?)" "p.(Gln301*)" "" "0000846770" "00022150" "70" "1102" "0" "1102" "0" "c.(1102G>T)" "r.(?)" "p.(Gly368Trp)" "" "0000846771" "00022150" "70" "1199" "0" "1199" "0" "c.(1199G>A)" "r.(?)" "p.(Arg400Gln)" "" "0000846772" "00022150" "70" "1198" "0" "1198" "0" "c.(1198C>T)" "r.(?)" "p.(Arg400Trp)" "" "0000846773" "00022150" "70" "1297" "0" "1298" "0" "c.(1297_1298ins[NC_000004.11:g.106370094_106370420;A[26]])" "r.(?)" "p.(Lys429 insAlu_353bp)" "" "0000846804" "00022150" "70" "1064" "0" "1064" "0" "c.(1064A>T)" "r.(?)" "p.(Asp355Val)" "" "0000846805" "00022150" "70" "961" "0" "961" "0" "c.(961T>G)" "r.(?)" "p.(Tyr321Asp)" "" "0000846811" "00022150" "70" "1081" "0" "1081" "0" "c.1081C>T" "r.(?)" "p.(Arg361*)" "" "0000846812" "00022150" "70" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000846813" "00022150" "70" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000846814" "00022150" "70" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000846815" "00022150" "70" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000846816" "00022150" "70" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000846817" "00022150" "70" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000846818" "00022150" "70" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000846819" "00022150" "70" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000846820" "00022150" "70" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000846821" "00022150" "70" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301*)" "10" "0000846823" "00022150" "70" "1561" "0" "1561" "0" "c.1561C>T" "r.(?)" "p.(Pro521Ser)" "" "0000846824" "00022150" "70" "1561" "0" "1561" "0" "c.1561C>T" "r.(?)" "p.(Pro521Ser)" "" "0000846825" "00022150" "70" "1495" "4" "1495" "4" "c.1495+4A>C" "r.spl?" "p.(Pro499Argfs*104)" "" "0000846826" "00022150" "70" "1495" "4" "1495" "4" "c.1495+4A>C" "r.spl?" "p.(Pro499Argfs*104)" "" "0000846827" "00022150" "70" "1466" "0" "1466" "0" "c.1466A>G" "r.(?)" "p.(Lys489Arg)" "" "0000846828" "00022150" "70" "1466" "0" "1466" "0" "c.1466A>G" "r.(?)" "p.(Lys489Arg)" "" "0000846829" "00022150" "70" "1466" "0" "1466" "0" "c.1466A>G" "r.(?)" "p.(Lys489Arg)" "" "0000846830" "00022150" "70" "1466" "0" "1466" "0" "c.1466A>G" "r.(?)" "p.(Lys489Arg)" "" "0000846831" "00022150" "70" "1466" "0" "1466" "0" "c.1466A>G" "r.(?)" "p.(Lys489Arg)" "" "0000846832" "00022150" "70" "1466" "0" "1466" "0" "c.1466A>G" "r.(?)" "p.(Lys489Arg)" "" "0000846833" "00022150" "70" "286" "0" "287" "0" "c.286_287delGA" "r.(?)" "p.(Glu96Glyfs*77)" "" "0000846834" "00022150" "70" "286" "0" "287" "0" "c.286_287delGA" "r.(?)" "p.(Glu96Glyfs*77)" "" "0000846835" "00022150" "70" "1466" "0" "1466" "0" "c.1466A>G" "r.(?)" "p.(Lys489Arg)" "" "0000846836" "00022150" "70" "1466" "0" "1466" "0" "c.1466A>G" "r.(?)" "p.(Lys489Arg)" "" "0000846837" "00022150" "70" "524" "0" "524" "0" "c.524dupC" "r.(?)" "p.(Pro176Thrfs*7)" "" "0000846848" "00022150" "70" "1445" "0" "1445" "0" "c.1445G>A" "r.(?)" "p.(Arg482Gln)" "" "0000846849" "00022150" "70" "1445" "0" "1445" "0" "c.1445G>A" "r.(?)" "p.(Arg482Gln)" "" "0000846850" "00022150" "70" "718" "23" "718" "23" "c.718+23G>A" "r.718_719insGTGGATGGCAAGGGCTTCTG" "p.(Thr241Glyfs*23)" "" "0000846851" "00022150" "70" "718" "23" "718" "23" "c.718+23G>A" "r.718_719insGTGGATGGCAAGGGCTTCTG" "p.(Thr241Glyfs*23)" "" "0000846885" "00022150" "70" "148" "0" "148" "0" "c.148del" "r.(?)" "p.(Glu50Asnfs*59)" "" "0000846886" "00022150" "70" "148" "0" "148" "0" "c.148del" "r.(?)" "p.(Glu50Asnfs*59)" "" "0000851214" "00022150" "30" "602" "-4" "602" "-4" "c.602-4G>A" "r.spl?" "p.?" "" "0000860336" "00022150" "30" "1203" "0" "1203" "0" "c.1203G>A" "r.(?)" "p.(Gln401=)" "" "0000860337" "00022150" "30" "226" "0" "226" "0" "c.226C>G" "r.(?)" "p.(Pro76Ala)" "" "0000869963" "00022150" "70" "849" "0" "852" "0" "c.849_852dup" "r.(?)" "p.(Pro285Serfs*100)" "" "0000869964" "00022150" "70" "849" "0" "852" "0" "c.849_852dup" "r.(?)" "p.(Pro285Serfs*100)" "" "0000869965" "00022150" "70" "849" "0" "852" "0" "c.849_852dup" "r.(?)" "p.(Pro285Serfs*100)" "" "0000869966" "00022150" "90" "849" "0" "852" "0" "c.849_852dup" "r.(?)" "p.(Pro285Serfs*100)" "" "0000887231" "00022150" "30" "1324" "-9" "1324" "-9" "c.1324-9G>A" "r.(=)" "p.(=)" "" "0000887232" "00022150" "30" "1290" "0" "1290" "0" "c.1290G>A" "r.(?)" "p.(Ala430=)" "" "0000896490" "00022150" "90" "187" "0" "187" "0" "c.187G>T" "r.(?)" "p.(Gly63Ter)" "" "0000896491" "00022150" "50" "499" "5" "499" "5" "c.499+5G>C" "r.spl?" "p.?" "" "0000908578" "00022150" "50" "1082" "0" "1082" "0" "c.1082G>A" "r.(?)" "p.(Arg361Gln)" "" "0000912509" "00022150" "70" "1153" "0" "1153" "0" "c.1153G>A" "r.(?)" "p.(Gly385Arg)" "" "0000915885" "00022150" "70" "1145" "0" "1145" "0" "c.1145T>C" "r.(?)" "p.(Phe382Ser)" "12" "0000915889" "00022150" "70" "1145" "0" "1145" "0" "c.1145T>C" "r.(?)" "p.(Phe382Ser)" "12" "0000916031" "00022150" "70" "190" "1" "190" "1" "c.190+1G>A" "r.spl?" "p.(?)" "3i" "0000916087" "00022150" "90" "742" "0" "745" "0" "c.742_745del" "r.(?)" "p.(Glu248Lysfs*10)" "9" "0000916088" "00022150" "70" "1063" "0" "1063" "0" "c.1063G>A" "r.(?)" "p.(Asp355Asn)" "11" "0000916139" "00022150" "90" "1496" "-6" "1496" "-6" "c.1496-6C>A" "r.spl?" "p.(?)" "13i" "0000916140" "00022150" "50" "1588" "0" "1593" "0" "c.1588_1593dup" "r.(=)" "p.(Ile530_Ala531dup)" "14" "0000916170" "00022150" "90" "1256" "0" "1256" "0" "c.1256G>A" "r.(?)" "p.(Arg419Gln)" "13" "0000916171" "00022150" "50" "1345" "0" "1345" "0" "c.1345C>T" "r.(?)" "p.(Arg449Cys)" "14" "0000916274" "00022150" "70" "1258" "0" "1258" "0" "c.1258C>A" "r.(?)" "p.(Arg420Ser)" "13" "0000916275" "00022150" "70" "1382" "0" "1382" "0" "c.1382T>C" "r.(?)" "p.(Leu461Pro)" "14" "0000916278" "00022150" "70" "1025" "0" "1025" "0" "c.1025G>A" "r.(?)" "p.(Arg342Gln)" "11" "0000916279" "00022150" "70" "1258" "0" "1258" "0" "c.1258C>A" "r.(?)" "p.(Arg420Ser)" "13" "0000916396" "00022150" "70" "1258" "0" "1258" "0" "c.1258C>A" "r.(?)" "p.(Arg420Ser)" "13" "0000916527" "00022150" "90" "1445" "0" "1445" "0" "c.1445G>A" "r.(?)" "p.(Arg482Gln)" "14" "0000916763" "00022150" "70" "373" "0" "373" "0" "c.373G>T" "r.(?)" "p.(Glu125*)" "5" "0000929182" "00022150" "50" "1391" "0" "1391" "0" "c.1391A>G" "r.(?)" "p.(Lys464Arg)" "" "0000929183" "00022150" "90" "1256" "0" "1256" "0" "c.1256G>A" "r.(?)" "p.(Arg419Gln)" "" "0000929184" "00022150" "50" "828" "6" "828" "6" "c.828+6T>C" "r.(=)" "p.(=)" "" "0000929185" "00022150" "10" "823" "-17" "823" "-17" "c.823-17G>C" "r.(=)" "p.(=)" "" "0000929186" "00022150" "10" "776" "0" "776" "0" "c.776T>C" "r.(?)" "p.(Ile259Thr)" "" "0000948704" "00022150" "50" "1537" "0" "1537" "0" "c.1537G>C" "r.(?)" "p.(Ala513Pro)" "" "0000958036" "00022150" "90" "568" "0" "568" "0" "c.568G>T" "r.(?)" "p.(Glu190Ter)" "" "0000958068" "00022150" "90" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301Ter)" "" "0000958339" "00022150" "90" "1024" "0" "1024" "0" "c.1024C>T" "r.(?)" "p.(Arg342Ter)" "" "0000958361" "00022150" "70" "1445" "0" "1445" "0" "c.1445G>A" "r.(?)" "p.(Arg482Gln)" "" "0000958628" "00022150" "70" "1496" "-6" "1496" "-6" "c.1496-6C>A" "r.spl?" "p.?" "" "0000958646" "00022150" "70" "1163" "0" "1163" "0" "c.1163C>A" "r.(?)" "p.(Pro388Gln)" "" "0000958878" "00022150" "50" "1163" "0" "1163" "0" "c.1163C>A" "r.(?)" "p.(Pro388Gln)" "" "0000959069" "00022150" "70" "1471" "0" "1471" "0" "c.1471T>C" "r.(?)" "p.(Phe491Leu)" "" "0000959277" "00022150" "50" "1507" "0" "1521" "0" "c.1507_1521del" "r.(?)" "p.(Val503_Gly507del)" "" "0000959466" "00022150" "50" "1569" "0" "1569" "0" "c.1569C>G" "r.(?)" "p.(Cys523Trp)" "" "0000977217" "00022150" "50" "1165" "0" "1165" "0" "c.1165C>T" "r.(?)" "p.(Gln389*)" "" "0000977218" "00022150" "30" "190" "20" "190" "20" "c.190+20C>T" "r.(=)" "p.(=)" "" "0000986607" "00022150" "50" "1376" "0" "1376" "0" "c.1376T>C" "r.(?)" "p.(Ile459Thr)" "14" "0000986608" "00022150" "70" "1259" "0" "1259" "0" "c.1259G>A" "r.(?)" "p.(Arg420His)" "13" "0000986609" "00022150" "70" "1087" "0" "1087" "0" "c.1087G>A" "r.(?)" "p.(Gly363Arg)" "11" "0000986610" "00022150" "70" "147" "0" "147" "0" "c.147del" "r.(?)" "p.(Glu50AsnfsTer59)" "3" "0000986967" "00022150" "70" "1429" "0" "1429" "0" "c.1429C>G" "r.(?)" "p.(Leu477Val)" "14" "0000986968" "00022150" "50" "1528" "0" "1528" "0" "c.1528G>A" "r.(?)" "p.(Ala510Thr)" "15" "0000987012" "00022150" "90" "1102" "0" "1102" "0" "c.1102G>T" "r.(?)" "p.(Gly368Trp)" "" "0000987195" "00022150" "90" "1496" "-6" "1496" "-6" "c.1496-6C>A" "r.spl?" "p.?" "" "0000987658" "00022150" "90" "1444" "0" "1444" "0" "c.1444C>T" "r.(?)" "p.(Arg482Trp)" "" "0000987659" "00022150" "90" "1444" "0" "1444" "0" "c.1444C>T" "r.(?)" "p.(Arg482Trp)" "" "0000987667" "00022150" "90" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Gln301Ter)" "" "0001014215" "00022150" "50" "371" "0" "394" "0" "c.371_394del" "r.(?)" "p.(Asp124_Glu131del)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 481 "{{screeningid}}" "{{variantid}}" "0000001615" "0000019523" "0000001615" "0000019524" "0000014360" "0000141473" "0000014384" "0000141499" "0000087964" "0000141408" "0000087964" "0000141500" "0000087965" "0000141409" "0000087965" "0000141501" "0000087966" "0000141410" "0000087966" "0000141489" "0000087967" "0000141411" "0000087968" "0000141412" "0000087969" "0000141413" "0000087970" "0000141414" "0000087970" "0000141465" "0000087971" "0000141415" "0000087972" "0000141416" "0000087973" "0000141417" "0000087974" "0000141418" "0000087975" "0000141419" "0000087976" "0000141420" "0000087977" "0000141421" "0000087978" "0000141423" "0000087979" "0000141424" "0000087979" "0000141426" "0000087980" "0000141425" "0000087980" "0000141427" "0000087981" "0000141428" "0000087982" "0000141429" "0000087983" "0000141422" "0000087983" "0000141430" "0000087984" "0000141431" "0000087985" "0000141432" "0000087986" "0000141433" "0000087987" "0000141434" "0000087988" "0000141435" "0000087989" "0000141436" "0000087990" "0000141437" "0000087991" "0000141438" "0000087992" "0000141439" "0000087993" "0000141440" "0000087994" "0000141441" "0000087995" "0000141442" "0000087996" "0000141443" "0000087997" "0000141444" "0000087998" "0000141445" "0000087999" "0000141446" "0000088000" "0000141447" "0000088001" "0000141448" "0000088002" "0000141449" "0000088003" "0000141450" "0000088004" "0000141451" "0000088005" "0000141452" "0000088006" "0000141453" "0000088007" "0000141454" "0000088008" "0000141455" "0000088009" "0000141456" "0000088010" "0000141457" "0000088011" "0000141458" "0000088012" "0000141459" "0000088013" "0000141460" "0000088014" "0000141461" "0000088015" "0000141462" "0000088016" "0000141463" "0000088016" "0000141467" "0000088017" "0000141464" "0000088017" "0000141468" "0000088018" "0000141466" "0000088019" "0000141469" "0000088020" "0000141470" "0000088021" "0000141472" "0000088022" "0000141474" "0000088023" "0000141475" "0000088024" "0000141476" "0000088025" "0000141477" "0000088026" "0000141478" "0000088027" "0000141479" "0000088028" "0000141480" "0000088029" "0000141481" "0000088030" "0000141482" "0000088031" "0000141483" "0000088032" "0000141484" "0000088033" "0000141485" "0000088034" "0000141486" "0000088035" "0000141487" "0000088036" "0000141488" "0000088037" "0000141490" "0000088038" "0000141491" "0000088039" "0000141492" "0000088039" "0000141529" "0000088040" "0000141493" "0000088040" "0000141530" "0000088041" "0000141496" "0000088042" "0000141498" "0000088043" "0000141497" "0000088044" "0000141502" "0000088045" "0000141503" "0000088045" "0000141543" "0000088046" "0000141504" "0000088046" "0000141544" "0000088047" "0000141505" "0000088047" "0000141545" "0000088048" "0000141506" "0000088048" "0000141546" "0000088049" "0000141507" "0000088049" "0000141547" "0000088050" "0000141508" "0000088051" "0000141509" "0000088052" "0000141510" "0000088053" "0000141511" "0000088054" "0000141512" "0000088055" "0000141513" "0000088056" "0000141514" "0000088057" "0000141515" "0000088058" "0000141516" "0000088059" "0000141517" "0000088060" "0000141518" "0000088061" "0000141519" "0000088062" "0000141520" "0000088063" "0000141521" "0000088064" "0000141522" "0000088065" "0000141523" "0000088066" "0000141524" "0000088067" "0000141525" "0000088068" "0000141526" "0000088069" "0000141527" "0000088070" "0000141528" "0000088071" "0000141494" "0000088072" "0000141495" "0000088073" "0000141531" "0000088074" "0000141532" "0000088075" "0000141533" "0000088076" "0000141534" "0000088077" "0000141535" "0000088078" "0000141536" "0000088079" "0000141537" "0000088080" "0000141538" "0000088081" "0000141539" "0000088082" "0000141540" "0000088083" "0000141541" "0000088084" "0000141542" "0000088085" "0000141548" "0000088086" "0000141549" "0000088087" "0000141550" "0000088088" "0000141551" "0000088089" "0000141552" "0000088090" "0000141553" "0000088091" "0000141554" "0000088223" "0000141471" "0000096356" "0000158349" "0000100474" "0000162773" "0000100478" "0000162777" "0000100485" "0000162784" "0000100517" "0000162816" "0000100519" "0000162818" "0000156423" "0000358345" "0000156424" "0000358346" "0000156425" "0000358347" "0000208720" "0000438661" "0000208720" "0000438662" "0000208736" "0000438685" "0000233767" "0000476475" "0000233768" "0000476476" "0000233769" "0000476477" "0000233770" "0000476478" "0000233771" "0000476479" "0000233772" "0000476480" "0000233773" "0000476481" "0000233774" "0000476482" "0000233775" "0000476483" "0000233776" "0000476484" "0000233777" "0000476485" "0000233778" "0000476486" "0000233779" "0000476487" "0000233780" "0000476488" "0000233781" "0000476489" "0000234783" "0000477491" "0000234784" "0000477492" "0000234785" "0000477493" "0000241573" "0000487583" "0000245618" "0000497788" "0000246882" "0000499707" "0000267003" "0000597851" "0000295261" "0000651950" "0000295262" "0000651951" "0000309559" "0000684424" "0000309715" "0000684588" "0000309770" "0000684643" "0000310587" "0000685498" "0000310588" "0000685499" "0000310589" "0000685500" "0000310590" "0000685501" "0000310591" "0000685502" "0000310592" "0000685503" "0000310593" "0000685504" "0000310595" "0000685506" "0000310596" "0000685507" "0000310775" "0000685754" "0000310815" "0000685839" "0000326650" "0000710242" "0000327907" "0000711700" "0000332838" "0000730126" "0000332838" "0000730266" "0000333579" "0000731255" "0000333580" "0000731256" "0000333580" "0000731279" "0000333691" "0000731440" "0000333729" "0000731492" "0000333769" "0000731559" "0000333769" "0000731574" "0000335087" "0000733096" "0000335087" "0000733549" "0000335793" "0000734701" "0000336112" "0000735163" "0000336114" "0000735165" "0000336122" "0000735173" "0000336123" "0000735174" "0000336648" "0000736093" "0000336648" "0000736135" "0000336669" "0000736114" "0000336669" "0000736155" "0000336732" "0000736222" "0000336732" "0000736262" "0000336733" "0000736223" "0000336733" "0000736263" "0000336734" "0000736224" "0000336734" "0000736264" "0000337226" "0000736856" "0000360565" "0000760597" "0000364138" "0000764900" "0000364160" "0000764922" "0000364160" "0000764942" "0000364702" "0000765577" "0000364702" "0000765605" "0000364814" "0000765756" "0000364815" "0000765757" "0000364829" "0000765771" "0000364870" "0000765812" "0000364891" "0000765833" "0000364919" "0000765861" "0000364936" "0000765878" "0000364945" "0000765887" "0000364971" "0000765913" "0000364974" "0000765916" "0000373689" "0000783837" "0000373689" "0000783934" "0000373690" "0000783838" "0000373726" "0000783874" "0000373726" "0000783966" "0000373729" "0000783877" "0000373898" "0000784342" "0000373939" "0000784359" "0000374650" "0000785463" "0000375156" "0000786451" "0000375156" "0000786495" "0000376168" "0000787736" "0000376169" "0000787737" "0000376515" "0000788166" "0000376516" "0000788124" "0000376517" "0000788125" "0000376620" "0000788348" "0000376620" "0000788437" "0000377493" "0000789851" "0000377494" "0000789852" "0000377686" "0000790101" "0000378467" "0000791222" "0000378467" "0000791260" "0000378716" "0000791569" "0000380775" "0000793971" "0000380776" "0000793972" "0000381100" "0000794400" "0000381100" "0000794401" "0000381408" "0000794847" "0000381541" "0000795002" "0000381542" "0000795003" "0000381543" "0000795004" "0000381544" "0000795005" "0000381545" "0000795006" "0000381546" "0000795007" "0000381547" "0000795008" "0000381548" "0000795009" "0000381549" "0000795010" "0000381550" "0000795011" "0000382212" "0000795927" "0000382252" "0000795978" "0000382252" "0000795979" "0000382262" "0000796003" "0000382413" "0000796216" "0000382414" "0000796217" "0000382415" "0000796218" "0000382434" "0000796249" "0000382435" "0000796250" "0000382435" "0000796251" "0000382442" "0000796263" "0000382442" "0000796264" "0000382443" "0000796265" "0000382443" "0000796266" "0000382444" "0000796267" "0000382444" "0000796268" "0000382830" "0000796708" "0000382833" "0000796713" "0000382834" "0000796715" "0000382857" "0000796767" "0000382866" "0000796797" "0000382875" "0000796816" "0000382877" "0000796821" "0000382880" "0000796825" "0000382885" "0000796832" "0000382887" "0000796834" "0000382935" "0000796904" "0000382935" "0000796905" "0000383823" "0000798094" "0000383823" "0000798095" "0000383824" "0000798096" "0000384063" "0000798493" "0000384067" "0000798497" "0000385257" "0000812211" "0000385335" "0000812338" "0000385336" "0000812339" "0000385336" "0000812340" "0000385976" "0000813193" "0000386005" "0000813222" "0000386226" "0000813633" "0000386262" "0000813669" "0000386262" "0000813756" "0000387426" "0000815591" "0000387500" "0000815622" "0000387510" "0000815570" "0000387845" "0000816003" "0000387845" "0000816345" "0000387890" "0000816048" "0000387890" "0000816385" "0000387958" "0000816116" "0000387958" "0000816435" "0000388086" "0000816244" "0000388086" "0000816529" "0000388304" "0000816764" "0000389186" "0000818070" "0000389747" "0000829776" "0000390180" "0000819525" "0000390345" "0000819690" "0000390345" "0000820700" "0000390346" "0000819691" "0000390346" "0000820701" "0000390407" "0000819752" "0000390408" "0000819753" "0000390694" "0000820039" "0000390694" "0000820792" "0000390695" "0000820040" "0000390695" "0000820793" "0000390834" "0000820179" "0000390834" "0000820834" "0000390836" "0000820181" "0000390991" "0000820336" "0000391010" "0000820355" "0000391010" "0000820881" "0000391181" "0000820526" "0000391652" "0000821402" "0000392831" "0000823266" "0000392831" "0000823294" "0000393824" "0000824646" "0000393840" "0000824662" "0000394768" "0000825785" "0000394768" "0000825786" "0000395017" "0000826169" "0000395017" "0000826170" "0000395160" "0000826391" "0000395160" "0000826392" "0000395256" "0000826515" "0000395617" "0000827008" "0000395883" "0000827335" "0000395883" "0000827336" "0000395884" "0000827337" "0000395884" "0000827338" "0000397047" "0000828793" "0000397047" "0000828998" "0000397893" "0000829954" "0000405346" "0000841434" "0000405352" "0000841440" "0000409557" "0000846739" "0000409558" "0000846740" "0000409559" "0000846741" "0000409560" "0000846742" "0000409561" "0000846743" "0000409562" "0000846744" "0000409563" "0000846745" "0000409564" "0000846746" "0000409565" "0000846747" "0000409566" "0000846748" "0000409567" "0000846749" "0000409568" "0000846750" "0000409569" "0000846751" "0000409570" "0000846752" "0000409571" "0000846753" "0000409572" "0000846754" "0000409579" "0000846764" "0000409580" "0000846765" "0000409583" "0000846768" "0000409584" "0000846769" "0000409585" "0000846770" "0000409585" "0000846804" "0000409586" "0000846771" "0000409586" "0000846805" "0000409587" "0000846772" "0000409588" "0000846773" "0000409619" "0000846811" "0000409621" "0000846812" "0000409622" "0000846813" "0000409623" "0000846814" "0000409624" "0000846815" "0000409625" "0000846816" "0000409626" "0000846817" "0000409627" "0000846818" "0000409628" "0000846819" "0000409629" "0000846820" "0000409630" "0000846821" "0000409631" "0000846823" "0000409632" "0000846824" "0000409633" "0000846825" "0000409634" "0000846826" "0000409635" "0000846827" "0000409636" "0000846828" "0000409637" "0000846829" "0000409638" "0000846830" "0000409639" "0000846831" "0000409640" "0000846832" "0000409641" "0000846833" "0000409642" "0000846834" "0000409643" "0000846835" "0000409644" "0000846836" "0000409645" "0000846837" "0000409654" "0000846848" "0000409654" "0000846850" "0000409655" "0000846849" "0000409655" "0000846851" "0000409681" "0000846885" "0000409682" "0000846886" "0000412608" "0000869963" "0000412609" "0000869964" "0000412610" "0000869965" "0000412611" "0000869966" "0000421728" "0000896490" "0000421728" "0000896491" "0000429152" "0000908578" "0000430969" "0000915885" "0000430973" "0000915889" "0000431077" "0000916031" "0000431120" "0000916087" "0000431120" "0000916088" "0000431151" "0000916139" "0000431151" "0000916140" "0000431169" "0000916170" "0000431169" "0000916171" "0000431230" "0000916274" "0000431230" "0000916275" "0000431232" "0000916278" "0000431232" "0000916279" "0000431309" "0000916396" "0000431398" "0000916527" "0000431556" "0000916763" "0000448550" "0000958036" "0000448582" "0000958068" "0000448853" "0000958339" "0000448853" "0000958628" "0000448875" "0000958361" "0000448875" "0000958646" "0000449077" "0000959277" "0000449111" "0000958878" "0000449273" "0000959466" "0000449302" "0000959069" "0000452624" "0000986607" "0000452624" "0000986967" "0000452625" "0000986608" "0000452626" "0000986609" "0000452627" "0000986610" "0000452627" "0000986968" "0000452667" "0000987012" "0000452850" "0000987195" "0000453145" "0000987658" "0000453146" "0000987659" "0000453154" "0000987667"