### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = TWIST1) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "TWIST1" "twist basic helix-loop-helix transcription factor 1" "7" "p21" "unknown" "NG_008114.1" "UD_132085443770" "" "http://www.LOVD.nl/TWIST1" "" "1" "12428" "7291" "601622" "1" "1" "1" "1" "" "" "g" "http://databases.lovd.nl/shared/refseq/TWIST1_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2014-11-02 20:21:23" "00006" "2026-09-21 17:34:07" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00022161" "TWIST1" "twist homolog 1 (Drosophila)" "001" "NM_000474.3" "" "NP_000465.1" "" "" "" "-351" "1315" "609" "19157295" "19155091" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 8 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00139" "ID" "intellectual disability (ID)" "" "" "" "" "" "00084" "2013-06-04 18:18:07" "00006" "2015-02-09 10:02:49" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00529" "SCS" "Saethre-Chotzen syndrome, with/without eyelid anomalies (SCS)" "AD" "101400" "" "autosomal dominant" "" "00006" "2014-09-16 22:28:06" "00006" "2021-12-10 21:51:32" "00627" "CRS1" "craniosynostosis, type 1 (CRS-1)" "AD" "123100" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "00628" "RobinowSorauf" "Robinow-Sorauf syndrome" "AD" "180750" "" "autosomal dominant" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "04327" "CRS" "craniosynostosis (CRS)" "" "" "" "" "" "00006" "2015-09-12 20:59:03" "" "" "05517" "skeletal dysplasia" "dysplasia, skeletal" "" "" "" "" "" "00006" "2018-11-16 16:43:21" "" "" "06747" "SWCOS" "Sweeney-Cox syndrome" "AD" "617746" "" "" "" "00006" "2021-12-10 23:20:41" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 5 "{{geneid}}" "{{diseaseid}}" "TWIST1" "00139" "TWIST1" "00529" "TWIST1" "00627" "TWIST1" "00628" "TWIST1" "06747" ## Individuals ## Do not remove or alter this header ## ## Count = 20 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00017822" "" "" "" "1" "" "00738" "{PMID:Paumard-Hernandez 2015:25271085}, {DOI:Paumard-Hernandez 2015:10.1038/ejhg.2014.205}" "" "M" "" "Spain" "" "0" "" "" "" "" "00017823" "" "" "" "1" "" "00738" "{PMID:Paumard-Hernandez 2015:25271085}, {DOI:Paumard-Hernandez 2015:10.1038/ejhg.2014.205}" "" "F" "" "Spain" "" "0" "" "" "" "" "00017824" "" "" "" "1" "" "00738" "{PMID:Paumard-Hernandez 2015:25271085}, {DOI:Paumard-Hernandez 2015:10.1038/ejhg.2014.205}" "" "F" "no" "Spain" "" "0" "" "" "" "" "00017838" "" "" "" "1" "" "00738" "{PMID:Paumard-Hernandez 2015:25271085}, {DOI:Paumard-Hernandez 2015:10.1038/ejhg.2014.205}" "" "F" "no" "Spain" "" "0" "" "" "" "" "00019812" "" "" "" "1" "" "00738" "{PMID:Paumard-Hernandez 2015:25271085}, {DOI:Paumard-Hernandez 2015:10.1038/ejhg.2014.205}" "" "M" "no" "Spain" "" "0" "" "" "" "" "00019813" "" "" "" "1" "" "00738" "{PMID:Paumard-Hernandez 2015:25271085}, {DOI:Paumard-Hernandez 2015:10.1038/ejhg.2014.205}" "" "F" "no" "Spain" "" "0" "" "" "" "" "00019814" "" "" "" "1" "" "00738" "{PMID:Paumard-Hernandez 2015:25271085}, {DOI:Paumard-Hernandez 2015:10.1038/ejhg.2014.205}" "" "M" "no" "Spain" "" "0" "" "" "" "" "00019815" "" "" "" "1" "" "00738" "{PMID:Paumard-Hernandez 2015:25271085}, {DOI:Paumard-Hernandez 2015:10.1038/ejhg.2014.205}" "" "M" "no" "Spain" "" "0" "" "" "" "" "00152044" "" "" "" "1" "" "02380" "" "" "" "" "" "" "0" "" "" "" "" "00152526" "" "" "" "1" "" "02380" "" "" "" "" "" "" "0" "" "" "" "" "00164523" "" "" "" "3" "" "02489" "" "" "M" "no" "United Kingdom (Great Britain)" "" "0" "" "" "" "Family 1" "00164524" "" "" "" "1" "" "02489" "" "" "F" "no" "United Kingdom (Great Britain)" "" "0" "" "" "white" "Family 2" "00208787" "" "" "" "1" "" "01164" "" "" "M" "" "Germany" "" "0" "" "" "" "" "00331589" "" "" "" "1" "" "00000" "{PMID:Maddirevula 2018:29620724}" "isolated case" "F" "yes" "" "" "0" "" "" "Arab" "08DG-0079" "00334948" "" "" "" "1" "" "03789" "" "" "M" "yes" "Saudi Arabia" "" "" "" "" "" "" "00334957" "" "" "" "1" "" "03789" "" "" "M" "yes" "Saudi Arabia" "" "" "" "" "" "" "00335044" "" "" "" "1" "" "03789" "" "" "M" "no" "Saudi Arabia" "" "" "" "" "" "" "00435659" "" "" "" "1" "" "04087" "" "" "M" "no" "Germany" "" "" "" "" "" "HN-F1406-II-1" "00469263" "" "" "" "1" "" "00006" "{PMID:Retterer 2016:26633542}" "analysis proband (1/3040)" "" "" "United States" "" "0" "" "" "" "" "00485027" "" "" "" "1" "" "00006" "{PMID:Lederbogen 2026:42720813}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "Germany" "" "0" "" "" "" "Pat1" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 19 "{{individualid}}" "{{diseaseid}}" "00017822" "00529" "00017823" "00529" "00017824" "00529" "00017838" "00529" "00019812" "00529" "00019813" "00529" "00019814" "00529" "00019815" "00529" "00152044" "04327" "00152526" "04327" "00164523" "00529" "00164524" "00529" "00331589" "05517" "00334948" "00529" "00334957" "00529" "00335044" "00529" "00435659" "00529" "00469263" "00198" "00485027" "00198" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00139, 00198, 00529, 00627, 00628, 04327, 05517, 06747 ## Count = 18 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000017665" "00529" "00019812" "00738" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "0000017666" "00529" "00019813" "00738" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "0000017667" "00529" "00019814" "00738" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "0000017668" "00529" "00019815" "00738" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "0000017674" "00529" "00017838" "00738" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "0000017675" "00529" "00017823" "00738" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "0000017676" "00529" "00017824" "00738" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "0000017677" "00529" "00017822" "00738" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "0000125628" "04327" "00152044" "02380" "Unknown" "" "bicoronal synostosis (HP:0011318), sagittal craniosynostosis (HP:0004442)" "" "" "" "" "" "" "" "" "craniosynostosis affecting bilateral coronal and sagittal sutures" "" "0000125629" "04327" "00152526" "02380" "Unknown" "" "bicoronal synostosis (HP:0011318)" "" "" "" "" "" "" "" "" "craniosynostosis affecting bilateral coronal sutures" "" "0000157401" "00198" "00208787" "01164" "Unknown" "" "HP:0012302 (Herpes simplex encephalitis); HP:0000256 (Macrocephaly); HP:0012758 (Neurodevelopmental delay); HP:0011344 (Severe global developmental delay); HP:0009121 (Abnormal axial skeleton morphology)" "" "" "" "" "" "" "" "" "" "" "0000249781" "05517" "00331589" "00000" "Familial, autosomal dominant" "" "Coronal craniosynostosis, Foot pain, Microcephaly, Hypertelorism, Depressed nasal bridgeNO" "" "" "" "" "" "" "" "Craniosynostosis syndromes" "skeletal dysplasia" "" "0000252696" "00529" "00334948" "03789" "Familial" "" "" "" "01y06m" "" "" "" "" "" "Seather chotzen" "" "" "0000252704" "00529" "00334957" "03789" "Familial, autosomal dominant" "" "" "" "01y" "" "" "" "" "" "Saethre chotzen" "" "" "0000252752" "00529" "00335044" "03789" "Familial, autosomal dominant" "" "" "" "02y" "" "" "" "" "" "Saethre chotzen" "" "" "0000325843" "00529" "00435659" "04087" "Isolated (sporadic)" "" "HP:0002308, HP:0002144, HP:0002650, HP:0002023, HP:0000020, HP:0000452, HP:0005145, HP:0000076, HP:0002979, HP:0001249, HP:0002172, HP:0001252, HP:0001601" "" "" "" "" "" "" "" "101400" "VACTERL Assotiation" "" "0000354416" "00198" "00469263" "00006" "Unknown" "" "hepatomegaly, thrombocytopenia, short stature, developmental delay, intellectual disability, autism, syndactyly" "" "" "" "" "" "" "" "" "multiple congenital anomalies" "" "0000367803" "00198" "00485027" "00006" "Isolated (sporadic)" "03y" "see paper; ..., global developmental delay, hypotonia, complex malformation cervical spine, asoft palate cleft, dysmorphic features" "" "" "" "" "" "" "" "" "" "" ## Screenings ## Do not remove or alter this header ## ## Count = 20 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000017804" "00017822" "1" "00738" "00738" "2014-07-01 15:44:24" "" "" "SEQ" "DNA" "" "" "0000017805" "00017823" "1" "00738" "00738" "2014-07-01 15:48:32" "" "" "SEQ" "DNA" "" "" "0000017806" "00017824" "1" "00738" "00738" "2014-07-01 15:54:44" "" "" "SEQ" "DNA" "" "" "0000017820" "00017838" "1" "00738" "00738" "2014-07-02 10:51:36" "" "" "SEQ" "DNA" "" "" "0000019796" "00019812" "1" "00738" "00738" "2014-08-26 12:43:10" "" "" "SEQ" "DNA" "" "" "0000019797" "00019813" "1" "00738" "00738" "2014-08-26 12:46:16" "" "" "SEQ" "DNA" "" "" "0000019798" "00019814" "1" "00738" "00738" "2014-08-26 12:49:47" "" "" "SEQ" "DNA" "" "" "0000019799" "00019815" "1" "00738" "00738" "2014-08-26 12:54:49" "" "" "SEQ" "DNA" "" "" "0000152899" "00152044" "1" "02380" "02380" "2018-02-01 18:50:25" "" "" "SEQ-NG-I" "DNA" "" "" "0000153383" "00152526" "1" "02380" "02380" "2018-02-02 16:55:33" "" "" "SEQ-NG-I" "DNA" "" "" "0000165388" "00164523" "1" "02489" "02489" "2018-05-30 15:35:09" "" "" "SEQ-NG" "DNA" "Blood" "Capture sequencing over TWIST1 gene" "0000165389" "00164524" "1" "02489" "02489" "2018-05-30 15:48:48" "" "" "SEQ-NG" "DNA" "" "Targetted capture sequencing of TWIST1 gene" "0000209836" "00208787" "1" "01164" "01164" "2018-12-17 10:13:26" "" "" "SEQ-NG" "DNA" "" "" "0000332808" "00331589" "1" "00000" "00006" "2021-02-11 15:29:38" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000336178" "00334948" "1" "03789" "03789" "2021-03-02 14:46:49" "" "" "SEQ-NG" "RNA" "" "" "0000336188" "00334957" "1" "03789" "03789" "2021-03-02 15:37:36" "" "" "SEQ-NG" "RNA" "" "" "0000336273" "00335044" "1" "03789" "03789" "2021-03-03 08:40:59" "" "" "SEQ-NG" "DNA" "" "" "0000437140" "00435659" "1" "04087" "04087" "2023-08-07 13:37:25" "" "" "SEQ-NG" "DNA" "Blood" "WES" "0000470931" "00469263" "1" "00006" "00006" "2025-11-13 13:02:43" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000486682" "00485027" "1" "00006" "00006" "2026-09-21 17:27:32" "" "" "OM" "DNA" "" "" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 17 "{{screeningid}}" "{{geneid}}" "0000017804" "TWIST1" "0000017805" "TWIST1" "0000017806" "TWIST1" "0000017820" "TWIST1" "0000019796" "TWIST1" "0000019797" "TWIST1" "0000019798" "TWIST1" "0000019799" "TWIST1" "0000152899" "TWIST1" "0000153383" "TWIST1" "0000165388" "TWIST1" "0000165389" "TWIST1" "0000332808" "TWIST1" "0000336178" "TWIST1" "0000336188" "TWIST1" "0000336273" "TWIST1" "0000486682" "TWIST1" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 86 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000037972" "0" "70" "7" "19156540" "19456560" "dup" "0" "00738" "TWIST1_000004" "g.19156540_19456560dup" "" "{PMID:Paumard-Hernandez 2015:24939587}, {DOI:Paumard-Hernandez 2015:10.1038/ejhg.2014.205}" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic" "" "0000037973" "0" "70" "7" "19156551" "19156551" "subst" "0" "00738" "TWIST1_000005" "g.19156551G>A" "" "{PMID:Paumard-Hernandez 2015:24939587}, {DOI:Paumard-Hernandez 2015:10.1038/ejhg.2014.205}" "" "" "" "Germline" "yes" "" "0" "" "" "g.19116928G>A" "" "likely pathogenic" "" "0000037974" "0" "70" "7" "19156599" "19156599" "subst" "0" "00738" "TWIST1_000002" "g.19156599G>A" "" "{PMID:Paumard-Hernandez 2015:24939587}, {DOI:Paumard-Hernandez 2015:10.1038/ejhg.2014.205}" "" "" "" "Unknown" "?" "" "0" "" "" "g.19116976G>A" "" "likely pathogenic" "" "0000038014" "0" "70" "7" "19156551" "19156551" "subst" "0" "00738" "TWIST1_000005" "g.19156551G>A" "" "{PMID:Paumard-Hernandez 2015:24939587}, {DOI:Paumard-Hernandez 2015:10.1038/ejhg.2014.205}" "" "" "" "Germline" "yes" "" "0" "" "" "g.19116928G>A" "" "likely pathogenic" "" "0000040243" "0" "70" "7" "19156458" "19156458" "subst" "0" "00738" "TWIST1_000007" "g.19156458G>A" "" "{PMID:Paumard-Hernandez 2015:24939587}, {DOI:Paumard-Hernandez 2015:10.1038/ejhg.2014.205}" "" "" "" "Unknown" "" "" "0" "" "" "g.19116835G>A" "" "likely pathogenic" "" "0000040244" "0" "70" "7" "19156747" "19156747" "del" "0" "00738" "TWIST1_000001" "g.19156747del" "" "{PMID:Paumard-Hernandez 2015:24939587}, {DOI:Paumard-Hernandez 2015:10.1038/ejhg.2014.205}" "" "" "" "Unknown" "" "" "0" "" "" "g.19117124del" "" "likely pathogenic" "" "0000040245" "0" "70" "7" "19156577" "19156577" "subst" "0" "00738" "TWIST1_000003" "g.19156577G>T" "" "{PMID:Paumard-Hernandez 2015:24939587}, {DOI:Paumard-Hernandez 2015:10.1038/ejhg.2014.205}" "" "" "" "Germline" "yes" "" "0" "" "" "g.19116954G>T" "" "likely pathogenic" "" "0000040246" "0" "70" "7" "19156530" "19156530" "subst" "0" "00738" "TWIST1_000006" "g.19156530G>A" "" "{PMID:Paumard-Hernandez 2015:24939587}, {DOI:Paumard-Hernandez 2015:10.1038/ejhg.2014.205}" "" "" "" "Unknown" "" "" "0" "" "" "g.19116907G>A" "" "likely pathogenic" "" "0000255515" "0" "90" "7" "19156553" "19156553" "subst" "0" "01943" "TWIST1_000016" "g.19156553A>T" "" "" "" "TWIST1(NM_000474.3):c.392T>A (p.L131Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.19116930A>T" "" "pathogenic" "" "0000256003" "0" "50" "7" "19156508" "19156508" "subst" "0" "01943" "TWIST1_000008" "g.19156508A>C" "" "" "" "TWIST1(NM_000474.3):c.437T>G (p.I146S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.19116885A>C" "" "VUS" "" "0000319134" "0" "30" "7" "19156283" "19156283" "subst" "0" "01943" "TWIST1_000042" "g.19156283G>A" "" "" "" "TWIST1(NM_000474.3):c.*42+11C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.19116660G>A" "" "likely benign" "" "0000319135" "0" "90" "7" "19156936" "19156936" "del" "0" "01943" "TWIST1_000038" "g.19156936del" "" "" "" "TWIST1(NM_000474.3):c.10delG (p.D4Tfs*14)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.19117313del" "" "pathogenic" "" "0000319136" "0" "90" "7" "19156791" "19156791" "del" "0" "01943" "TWIST1_000035" "g.19156791del" "" "" "" "TWIST1(NM_000474.3):c.156delC (p.G53Afs*72)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.19117168del" "" "pathogenic" "" "0000319139" "0" "30" "7" "19156668" "19156668" "subst" "0" "01943" "TWIST1_000028" "g.19156668T>C" "" "" "" "TWIST1(NM_000474.3):c.277A>G (p.S93G, p.(Ser93Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.19117045T>C" "" "likely benign" "" "0000319140" "0" "90" "7" "19156636" "19156636" "subst" "0" "01943" "TWIST1_000025" "g.19156636G>T" "" "" "" "TWIST1(NM_000474.3):c.309C>A (p.Y103*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.19117013G>T" "" "pathogenic" "" "0000319141" "0" "90" "7" "19156636" "19156636" "subst" "0" "01943" "TWIST1_000026" "g.19156636G>C" "" "" "" "TWIST1(NM_000474.3):c.309C>G (p.Y103*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.19117013G>C" "" "pathogenic" "" "0000319142" "0" "90" "7" "19156602" "19156619" "del" "0" "01943" "TWIST1_000022" "g.19156602_19156619del" "" "" "" "TWIST1(NM_000474.3):c.326_343delAGCGGGTCATGGCCAACG (p.Q109_V115delinsL)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.19116979_19116996del" "" "pathogenic" "" "0000319143" "0" "90" "7" "19156605" "19156605" "subst" "0" "01943" "TWIST1_000024" "g.19156605T>C" "" "" "" "TWIST1(NM_000474.3):c.340A>G (p.N114D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.19116982T>C" "" "pathogenic" "" "0000319144" "0" "90" "7" "19156604" "19156604" "subst" "0" "01943" "TWIST1_000023" "g.19156604T>C" "" "" "" "TWIST1(NM_000474.3):c.341A>G (p.N114S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.19116981T>C" "" "pathogenic" "" "0000319145" "0" "50" "7" "19156599" "19156599" "subst" "0" "01943" "TWIST1_000021" "g.19156599G>C" "" "" "" "TWIST1(NM_000474.3):c.346C>G (p.R116G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.19116976G>C" "" "VUS" "" "0000319146" "0" "50" "7" "19156598" "19156598" "subst" "0" "01943" "TWIST1_000020" "g.19156598C>T" "" "" "" "TWIST1(NM_000474.3):c.347G>A (p.R116Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.19116975C>T" "" "VUS" "" "0000319147" "0" "90" "7" "19156583" "19156583" "subst" "0" "01943" "TWIST1_000019" "g.19156583G>A" "" "" "" "TWIST1(NM_000474.3):c.362C>T (p.T121I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.19116960G>A" "" "pathogenic" "" "0000319148" "0" "90" "7" "19156581" "19156581" "subst" "0" "01943" "TWIST1_000018" "g.19156581G>A" "" "" "" "TWIST1(NM_000474.3):c.364C>T (p.Q122*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.19116958G>A" "" "pathogenic" "" "0000319149" "0" "90" "7" "19156577" "19156577" "subst" "0" "01943" "TWIST1_000003" "g.19156577G>T" "" "" "" "TWIST1(NM_000474.3):c.368C>A (p.S123*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.19116954G>T" "" "pathogenic" "" "0000319150" "0" "90" "7" "19156577" "19156577" "subst" "0" "01943" "TWIST1_000017" "g.19156577G>C" "" "" "" "TWIST1(NM_000474.3):c.368C>G (p.S123W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.19116954G>C" "" "pathogenic" "" "0000319152" "0" "90" "7" "19156539" "19156539" "subst" "0" "01943" "TWIST1_000015" "g.19156539G>A" "" "" "" "TWIST1(NM_000474.3):c.406C>T (p.P136S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.19116916G>A" "" "pathogenic" "" "0000319153" "0" "90" "7" "19156538" "19156538" "subst" "0" "01943" "TWIST1_000014" "g.19156538G>T" "" "" "" "TWIST1(NM_000474.3):c.407C>A (p.P136H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.19116915G>T" "" "pathogenic" "" "0000319154" "0" "90" "7" "19156535" "19156535" "subst" "0" "01943" "TWIST1_000013" "g.19156535G>A" "" "" "" "TWIST1(NM_000474.3):c.410C>T (p.T137M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.19116912G>A" "" "pathogenic" "" "0000319155" "0" "90" "7" "19156530" "19156530" "subst" "0" "01943" "TWIST1_000006" "g.19156530G>A" "" "" "" "TWIST1(NM_000474.3):c.415C>T (p.P139S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.19116907G>A" "" "pathogenic" "" "0000319156" "0" "70" "7" "19156529" "19156529" "subst" "0" "01943" "TWIST1_000012" "g.19156529G>A" "" "" "" "TWIST1(NM_000474.3):c.416C>T (p.P139L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.19116906G>A" "" "likely pathogenic" "" "0000319157" "0" "10" "7" "19156525" "19156525" "subst" "0" "01943" "TWIST1_000010" "g.19156525C>T" "" "" "" "TWIST1(NM_000474.3):c.420G>A (p.S140=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.19116902C>T" "" "benign" "" "0000319158" "0" "50" "7" "19156519" "19156519" "subst" "0" "01943" "TWIST1_000009" "g.19156519C>G" "" "" "" "TWIST1(NM_000474.3):c.426G>C (p.K142N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.19116896C>G" "" "VUS" "" "0000319159" "0" "90" "7" "19156502" "19156502" "subst" "0" "01943" "TWIST1_000044" "g.19156502G>T" "" "" "" "TWIST1(NM_000474.3):c.443C>A (p.T148N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.19116879G>T" "" "pathogenic" "" "0000319160" "0" "50" "7" "19156475" "19156475" "subst" "0" "01943" "TWIST1_000043" "g.19156475T>G" "" "" "" "TWIST1(NM_000474.3):c.470A>C (p.D157A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.19116852T>G" "" "VUS" "" "0000331442" "0" "30" "7" "19156699" "19156701" "dup" "0" "01804" "TWIST1_000033" "g.19156699_19156701dup" "" "" "" "TWIST1(NM_000474.3):c.257_259dupGCG (p.(Gly86dup)), TWIST1(NM_000474.3):c.257_259dupGCG (p.G86dup), TWIST1(NM_000474.4):c.257_259dupGCG (p.G86dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.19117076_19117078dup" "" "likely benign" "" "0000331444" "0" "50" "7" "19156742" "19156742" "subst" "0" "01804" "TWIST1_000034" "g.19156742C>A" "" "" "" "TWIST1(NM_000474.3):c.203G>T (p.(Ser68Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.19117119C>A" "" "VUS" "" "0000331445" "0" "50" "7" "19156803" "19156803" "subst" "0" "01804" "TWIST1_000036" "g.19156803C>G" "" "" "" "TWIST1(NM_000474.3):c.142G>C (p.(Gly48Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.19117180C>G" "" "VUS" "" "0000331446" "0" "30" "7" "19156851" "19156851" "subst" "0.00121499" "01804" "TWIST1_000037" "g.19156851C>T" "" "" "" "TWIST1(NM_000474.3):c.94G>A (p.(Gly32Ser)), TWIST1(NM_000474.4):c.94G>A (p.G32S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.19117228C>T" "" "likely benign" "" "0000352481" "0" "50" "7" "19156510" "19156510" "subst" "0" "02380" "TWIST1_000040" "g.19156510C>G" "" "" "" "" "" "De novo" "" "" "0" "" "" "g.19116887C>G" "" "VUS" "" "0000352482" "0" "50" "7" "19156524" "19156524" "subst" "0" "02380" "TWIST1_000041" "g.19156524C>G" "" "" "" "" "" "De novo" "" "" "0" "" "" "g.19116901C>G" "" "VUS" "" "0000369049" "21" "90" "7" "19157207" "19157207" "subst" "0" "02489" "TWIST1_000045" "g.19157207G>T" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.19117584G>T" "" "pathogenic" "" "0000369050" "0" "90" "7" "19157199" "19157199" "subst" "0" "02489" "TWIST1_000046" "g.19157199C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.19117576C>T" "" "pathogenic" "" "0000440056" "0" "50" "7" "19156359" "19156359" "subst" "0" "01164" "TWIST1_000047" "g.19156359A>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.19116736A>T" "" "VUS" "ACMG" "0000531567" "0" "30" "7" "19155780" "19155781" "del" "0" "02326" "TWIST1_000048" "g.19155780_19155781del" "" "" "" "TWIST1(NM_000474.4):c.*43-17_*43-16delCC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.19116157_19116158del" "" "likely benign" "" "0000531568" "0" "30" "7" "19155781" "19155781" "del" "0" "02326" "TWIST1_000049" "g.19155781del" "" "" "" "TWIST1(NM_000474.4):c.*43-16delC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.19116158del" "" "likely benign" "" "0000531569" "0" "90" "7" "19156520" "19156520" "subst" "0" "02327" "TWIST1_000050" "g.19156520T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.19116897T>C" "" "pathogenic" "" "0000531570" "0" "90" "7" "19156536" "19156556" "dup" "0" "01943" "TWIST1_000051" "g.19156536_19156556dup" "" "" "" "TWIST1(NM_000474.3):c.395_415dupGGAAGATCATCCCCACGCTGC (p.R132_L138dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.19116913_19116933dup" "" "pathogenic" "" "0000531573" "0" "50" "7" "19156570" "19156570" "subst" "0" "02327" "TWIST1_000053" "g.19156570G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.19116947G>C" "" "VUS" "" "0000531574" "0" "90" "7" "19156577" "19156577" "subst" "0" "02327" "TWIST1_000003" "g.19156577G>T" "" "" "" "TWIST1(NM_000474.3):c.368C>A (p.S123*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.19116954G>T" "" "pathogenic" "" "0000531575" "0" "50" "7" "19156617" "19156617" "subst" "0" "01943" "TWIST1_000054" "g.19156617G>A" "" "" "" "TWIST1(NM_000474.3):c.328C>T (p.R110W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.19116994G>A" "" "VUS" "" "0000531577" "0" "50" "7" "19156651" "19156671" "del" "0" "02325" "TWIST1_000056" "g.19156651_19156671del" "" "" "" "TWIST1(NM_000474.3):c.274_294del (p.(Gly92_Gly98del)), TWIST1(NM_000474.4):c.274_294delGGCAGCAGCAGCGGCGGCGGG (p.G92_G98del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.19117028_19117048del" "" "VUS" "" "0000531578" "0" "10" "7" "19156653" "19156671" "dup" "0" "01943" "TWIST1_000057" "g.19156653_19156671dup" "" "" "" "TWIST1(NM_000474.3):c.276_294dupCAGCAGCAGCGGCGGCGGG (p.S99Qfs*145)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.19117030_19117048dup" "" "benign" "" "0000531584" "0" "50" "7" "19156699" "19156701" "dup" "0" "01943" "TWIST1_000033" "g.19156699_19156701dup" "" "" "" "TWIST1(NM_000474.3):c.257_259dupGCG (p.(Gly86dup)), TWIST1(NM_000474.3):c.257_259dupGCG (p.G86dup), TWIST1(NM_000474.4):c.257_259dupGCG (p.G86dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.19117076_19117078dup" "" "VUS" "" "0000531586" "0" "30" "7" "19156765" "19156765" "subst" "0" "01943" "TWIST1_000064" "g.19156765G>A" "" "" "" "TWIST1(NM_000474.3):c.180C>T (p.V60=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.19117142G>A" "" "likely benign" "" "0000531588" "0" "90" "7" "19156795" "19156823" "del" "0" "01943" "TWIST1_000065" "g.19156795_19156823del" "" "" "" "TWIST1(NM_000474.3):c.123_151delCAGCAGGCGCAGCGCGGGCGGCGGCGCGG (p.S41Rfs*187)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.19117172_19117200del" "" "pathogenic" "" "0000611014" "0" "30" "7" "19156668" "19156668" "subst" "0" "01804" "TWIST1_000028" "g.19156668T>C" "" "" "" "TWIST1(NM_000474.3):c.277A>G (p.S93G, p.(Ser93Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.19117045T>C" "" "likely benign" "" "0000611015" "0" "50" "7" "19156684" "19156701" "dup" "0" "02327" "TWIST1_000067" "g.19156684_19156701dup" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.19117061_19117078dup" "" "VUS" "" "0000655804" "0" "30" "7" "19156851" "19156851" "subst" "0.00121499" "02325" "TWIST1_000037" "g.19156851C>T" "" "" "" "TWIST1(NM_000474.3):c.94G>A (p.(Gly32Ser)), TWIST1(NM_000474.4):c.94G>A (p.G32S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.19117228C>T" "" "likely benign" "" "0000678065" "0" "70" "7" "19156529" "19156549" "dup" "0" "02327" "TWIST1_000068" "g.19156529_19156549dup" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000689969" "0" "30" "7" "19156805" "19156805" "subst" "0" "01943" "TWIST1_000069" "g.19156805C>T" "" "" "" "TWIST1(NM_000474.3):c.140G>A (p.G47D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721397" "0" "90" "7" "19156593" "19156593" "subst" "0" "02327" "TWIST1_000071" "g.19156593G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000721398" "0" "10" "7" "19156684" "19156701" "del" "0" "01804" "TWIST1_000072" "g.19156684_19156701del" "" "" "" "TWIST1(NM_000474.3):c.259_276del (p.(Ala87_Gly92del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000721399" "0" "90" "7" "19156745" "19156755" "dup" "0" "01943" "TWIST1_000073" "g.19156745_19156755dup" "" "" "" "TWIST1(NM_000474.3):c.190_200dupGACGAGCCGGG (p.S68Tfs*61)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000730090" "0" "90" "7" "19156539" "19156559" "del" "0" "00000" "TWIST1_000070" "g.19156539_19156559del" "" "{PMID:Maddirevula 2018:29620724}" "" "NM_000474.3:c.388_408del:p.(Ala130_Pro136del)" "" "De novo" "" "" "0" "" "" "g.19116916_19116936del" "" "likely pathogenic (dominant)" "" "0000735318" "0" "70" "7" "19156541" "19156541" "subst" "0" "03789" "TWIST1_000075" "g.19156541A>C" "" "" "" "" "" "Germline" "yes" "" "" "" "" "" "" "VUS" "" "0000735333" "11" "70" "7" "19156528" "19156548" "dup" "0" "03789" "TWIST1_000074" "g.19156528_19156548dup" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.19116905_19116925dup" "" "VUS" "ACMG" "0000735548" "21" "70" "7" "19156526" "19156526" "subst" "0" "03789" "TWIST1_000076" "g.19156526G>A" "" "" "" "" "" "Germline" "?" "" "" "" "" "" "" "VUS" "ACMG" "0000803088" "0" "50" "7" "19156605" "19156605" "subst" "0" "02329" "TWIST1_000077" "g.19156605T>A" "" "" "" "TWIST1(NM_000474.4):c.340A>T (p.N114Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000803089" "0" "30" "7" "19156699" "19156701" "dup" "0" "02325" "TWIST1_000033" "g.19156699_19156701dup" "" "" "" "TWIST1(NM_000474.3):c.257_259dupGCG (p.(Gly86dup)), TWIST1(NM_000474.3):c.257_259dupGCG (p.G86dup), TWIST1(NM_000474.4):c.257_259dupGCG (p.G86dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000860718" "0" "50" "7" "19156800" "19156811" "del" "0" "01804" "TWIST1_000078" "g.19156800_19156811del" "" "" "" "TWIST1(NM_000474.3):c.141_152del (p.(Gly48_Gly51del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000887814" "0" "30" "7" "19156651" "19156671" "del" "0" "01804" "TWIST1_000056" "g.19156651_19156671del" "" "" "" "TWIST1(NM_000474.3):c.274_294del (p.(Gly92_Gly98del)), TWIST1(NM_000474.4):c.274_294delGGCAGCAGCAGCGGCGGCGGG (p.G92_G98del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000924699" "0" "70" "7" "19156605" "19156605" "subst" "0" "02327" "TWIST1_000077" "g.19156605T>A" "" "" "" "TWIST1(NM_000474.4):c.340A>T (p.N114Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000929324" "0" "30" "7" "19156851" "19156851" "subst" "0.00121499" "02326" "TWIST1_000037" "g.19156851C>T" "" "" "" "TWIST1(NM_000474.3):c.94G>A (p.(Gly32Ser)), TWIST1(NM_000474.4):c.94G>A (p.G32S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000931916" "0" "90" "7" "15405139" "21985421" "del" "0" "04087" "TWIST1_000079" "g.15405139_21985421del" "" "" "" "" "" "De novo" "yes" "" "0" "" "" "g.15365516_21945798del" "" "pathogenic" "ACMG" "0000977652" "0" "50" "7" "19156400" "19156400" "subst" "0" "02325" "TWIST1_000080" "g.19156400C>T" "" "" "" "TWIST1(NM_000474.4):c.545G>A (p.R182Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000977653" "0" "50" "7" "19156977" "19156977" "subst" "0" "01804" "TWIST1_000081" "g.19156977C>G" "" "" "" "TWIST1(NM_000474.4):c.-33G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000996396" "0" "30" "7" "19156428" "19156428" "subst" "0" "01804" "TWIST1_000082" "g.19156428C>T" "" "" "" "TWIST1(NM_000474.3):c.517G>A (p.(Ala173Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000996397" "0" "30" "7" "19156644" "19156644" "subst" "0" "01804" "TWIST1_000083" "g.19156644G>C" "" "" "" "TWIST1(NM_000474.3):c.301C>G (p.(Gln101Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000996398" "0" "50" "7" "19156662" "19156676" "dup" "0" "01804" "TWIST1_000084" "g.19156662_19156676dup" "" "" "" "TWIST1(NM_000474.3):c.277_291dupAGCAGCAGCGGCGGC (p.(Gly97_Gly98insSerSerSerGlyGly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000996399" "0" "50" "7" "19156662" "19156679" "dup" "0" "01804" "TWIST1_000085" "g.19156662_19156679dup" "" "" "" "TWIST1(NM_000474.3):c.276_293dupCAGCAGCAGCGGCGGCGG (p.(Gly98_Ser99insSerSerSerGlyGlyGly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000996400" "0" "50" "7" "19156781" "19156781" "subst" "0" "01804" "TWIST1_000086" "g.19156781G>T" "" "" "" "TWIST1(NM_000474.3):c.164C>A (p.(Ala55Asp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000996401" "0" "30" "7" "19156782" "19156782" "subst" "0" "01804" "TWIST1_000087" "g.19156782C>T" "" "" "" "TWIST1(NM_000474.3):c.163G>A (p.(Ala55Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001036305" "0" "50" "7" "19156696" "19156701" "dup" "0" "01804" "TWIST1_000088" "g.19156696_19156701dup" "" "" "" "TWIST1(NM_000474.4):c.254_259dup (p.(Gly85_Gly86dup))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001036306" "0" "50" "7" "19156874" "19156874" "subst" "0" "01804" "TWIST1_000089" "g.19156874G>A" "" "" "" "TWIST1(NM_000474.4):c.71C>T (p.(Pro24Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001059272" "21" "70" "7" "19156851" "19156851" "subst" "0.00121499" "00006" "TWIST1_000037" "g.19156851C>T" "" "{PMID:Retterer 2016:26633542}" "" "" "" "Germline" "" "" "0" "" "" "g.19117228C>T" "" "likely pathogenic" "" "0001089747" "0" "70" "7" "18832967" "21270150" "inv" "0" "00006" "TWIST1_000090" "g.(18818327_18832967)_(21270150_?)inv" "" "{PMID:Lederbogen 2026:42720813}" "" "" "2.45 Mb inversion" "De novo" "" "" "0" "" "7p21.1-p15.3 (~18818327 to ~21270150 bp)" "g.(18778704_18793344)_(21230527_?)inv" "" "likely pathogenic" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes TWIST1 ## Count = 86 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000037972" "00022161" "70" "385" "0" "405" "0" "c.385_405dup" "r.(?)" "p.(Ala129_Ile135dup)" "1" "0000037973" "00022161" "70" "394" "0" "394" "0" "c.394C>T" "r.(?)" "p.(Arg132Trp)" "1" "0000037974" "00022161" "70" "346" "0" "346" "0" "c.346C>T" "r.(?)" "p.(Arg116Trp)" "1" "0000038014" "00022161" "70" "394" "0" "394" "0" "c.394C>T" "r.(?)" "p.(Arg132Trp)" "1" "0000040243" "00022161" "70" "487" "0" "487" "0" "c.487C>T" "r.(?)" "p.(Leu163Phe)" "1" "0000040244" "00022161" "70" "200" "0" "200" "0" "c.200del" "r.(?)" "p.(Gly67Alafs*58)" "1" "0000040245" "00022161" "70" "368" "0" "368" "0" "c.368C>A" "r.(?)" "p.(Ser123*)" "1" "0000040246" "00022161" "70" "415" "0" "415" "0" "c.415C>T" "r.(?)" "p.(Pro139Ser)" "1" "0000255515" "00022161" "90" "392" "0" "392" "0" "c.392T>A" "r.(?)" "p.(Leu131Gln)" "" "0000256003" "00022161" "50" "437" "0" "437" "0" "c.437T>G" "r.(?)" "p.(Ile146Ser)" "" "0000319134" "00022161" "30" "651" "11" "651" "11" "c.*42+11C>T" "r.(=)" "p.(=)" "" "0000319135" "00022161" "90" "10" "0" "10" "0" "c.10del" "r.(?)" "p.(Asp4ThrfsTer14)" "" "0000319136" "00022161" "90" "156" "0" "156" "0" "c.156del" "r.(?)" "p.(Gly53AlafsTer72)" "" "0000319139" "00022161" "30" "277" "0" "277" "0" "c.277A>G" "r.(?)" "p.(Ser93Gly)" "" "0000319140" "00022161" "90" "309" "0" "309" "0" "c.309C>A" "r.(?)" "p.(Tyr103Ter)" "" "0000319141" "00022161" "90" "309" "0" "309" "0" "c.309C>G" "r.(?)" "p.(Tyr103Ter)" "" "0000319142" "00022161" "90" "326" "0" "343" "0" "c.326_343del" "r.(?)" "p.(Gln109_Val115delinsLeu)" "" "0000319143" "00022161" "90" "340" "0" "340" "0" "c.340A>G" "r.(?)" "p.(Asn114Asp)" "" "0000319144" "00022161" "90" "341" "0" "341" "0" "c.341A>G" "r.(?)" "p.(Asn114Ser)" "" "0000319145" "00022161" "50" "346" "0" "346" "0" "c.346C>G" "r.(?)" "p.(Arg116Gly)" "" "0000319146" "00022161" "50" "347" "0" "347" "0" "c.347G>A" "r.(?)" "p.(Arg116Gln)" "" "0000319147" "00022161" "90" "362" "0" "362" "0" "c.362C>T" "r.(?)" "p.(Thr121Ile)" "" "0000319148" "00022161" "90" "364" "0" "364" "0" "c.364C>T" "r.(?)" "p.(Gln122Ter)" "" "0000319149" "00022161" "90" "368" "0" "368" "0" "c.368C>A" "r.(?)" "p.(Ser123Ter)" "" "0000319150" "00022161" "90" "368" "0" "368" "0" "c.368C>G" "r.(?)" "p.(Ser123Trp)" "" "0000319152" "00022161" "90" "406" "0" "406" "0" "c.406C>T" "r.(?)" "p.(Pro136Ser)" "" "0000319153" "00022161" "90" "407" "0" "407" "0" "c.407C>A" "r.(?)" "p.(Pro136His)" "" "0000319154" "00022161" "90" "410" "0" "410" "0" "c.410C>T" "r.(?)" "p.(Thr137Met)" "" "0000319155" "00022161" "90" "415" "0" "415" "0" "c.415C>T" "r.(?)" "p.(Pro139Ser)" "" "0000319156" "00022161" "70" "416" "0" "416" "0" "c.416C>T" "r.(?)" "p.(Pro139Leu)" "" "0000319157" "00022161" "10" "420" "0" "420" "0" "c.420G>A" "r.(?)" "p.(Ser140=)" "" "0000319158" "00022161" "50" "426" "0" "426" "0" "c.426G>C" "r.(?)" "p.(Lys142Asn)" "" "0000319159" "00022161" "90" "443" "0" "443" "0" "c.443C>A" "r.(?)" "p.(Thr148Asn)" "" "0000319160" "00022161" "50" "470" "0" "470" "0" "c.470A>C" "r.(?)" "p.(Asp157Ala)" "" "0000331442" "00022161" "30" "257" "0" "259" "0" "c.257_259dup" "r.(?)" "p.(Gly86dup)" "" "0000331444" "00022161" "50" "203" "0" "203" "0" "c.203G>T" "r.(?)" "p.(Ser68Ile)" "" "0000331445" "00022161" "50" "142" "0" "142" "0" "c.142G>C" "r.(?)" "p.(Gly48Arg)" "" "0000331446" "00022161" "30" "94" "0" "94" "0" "c.94G>A" "r.(?)" "p.(Gly32Ser)" "" "0000352481" "00022161" "50" "435" "0" "435" "0" "c.435G>C" "r.(?)" "p.(Lys145Asn)" "" "0000352482" "00022161" "50" "421" "0" "421" "0" "c.421G>C" "r.(?)" "p.(Asp141His)" "" "0000369049" "00022161" "90" "-263" "0" "-263" "0" "c.-263C>A" "r.(=)" "p.(=)" "1" "0000369050" "00022161" "90" "-255" "0" "-255" "0" "c.-255G>A" "r.(=)" "p.(=)" "1" "0000440056" "00022161" "50" "586" "0" "586" "0" "c.586T>A" "r.(?)" "p.Trp196Arg" "" "0000531567" "00022161" "30" "652" "-17" "652" "-16" "c.*43-17_*43-16del" "r.(=)" "p.(=)" "" "0000531568" "00022161" "30" "652" "-16" "652" "-16" "c.*43-16del" "r.(=)" "p.(=)" "" "0000531569" "00022161" "90" "425" "0" "425" "0" "c.425A>G" "r.(?)" "p.(Lys142Arg)" "" "0000531570" "00022161" "90" "395" "0" "415" "0" "c.395_415dup" "r.(?)" "p.(Arg132_Leu138dup)" "" "0000531573" "00022161" "50" "375" "0" "375" "0" "c.375C>G" "r.(?)" "p.(Asn125Lys)" "" "0000531574" "00022161" "90" "368" "0" "368" "0" "c.368C>A" "r.(?)" "p.(Ser123Ter)" "" "0000531575" "00022161" "50" "328" "0" "328" "0" "c.328C>T" "r.(?)" "p.(Arg110Trp)" "" "0000531577" "00022161" "50" "274" "0" "294" "0" "c.274_294del" "r.(?)" "p.(Gly92_Gly98del)" "" "0000531578" "00022161" "10" "276" "0" "294" "0" "c.276_294dup" "r.(?)" "p.(Ser99GlnfsTer145)" "" "0000531584" "00022161" "50" "257" "0" "259" "0" "c.257_259dup" "r.(?)" "p.(Gly86dup)" "" "0000531586" "00022161" "30" "180" "0" "180" "0" "c.180C>T" "r.(?)" "p.(Val60=)" "" "0000531588" "00022161" "90" "123" "0" "151" "0" "c.123_151del" "r.(?)" "p.(Ser41ArgfsTer187)" "" "0000611014" "00022161" "30" "277" "0" "277" "0" "c.277A>G" "r.(?)" "p.(Ser93Gly)" "" "0000611015" "00022161" "50" "259" "0" "276" "0" "c.259_276dup" "r.(?)" "p.(Ala87_Gly92dup)" "" "0000655804" "00022161" "30" "94" "0" "94" "0" "c.94G>A" "r.(?)" "p.(Gly32Ser)" "" "0000678065" "00022161" "70" "396" "0" "416" "0" "c.396_416dup" "r.(?)" "p.(Lys133_Pro139dup)" "" "0000689969" "00022161" "30" "140" "0" "140" "0" "c.140G>A" "r.(?)" "p.(Gly47Asp)" "" "0000721397" "00022161" "90" "352" "0" "352" "0" "c.352C>T" "r.(?)" "p.(Arg118Cys)" "" "0000721398" "00022161" "10" "259" "0" "276" "0" "c.259_276del" "r.(?)" "p.(Ala87_Gly92del)" "" "0000721399" "00022161" "90" "190" "0" "200" "0" "c.190_200dup" "r.(?)" "p.(Ser68Thrfs*61)" "" "0000730090" "00022161" "90" "386" "0" "406" "0" "c.386_406del" "r.(?)" "p.(Ala130_Pro136del)" "" "0000735318" "00022161" "70" "404" "0" "404" "0" "c.404T>G" "r.(?)" "p.(Ile135Ser)" "" "0000735333" "00022161" "70" "397" "0" "417" "0" "c.397_417dup" "r.(?)" "p.(Lys133_Pro139dup)" "" "0000735548" "00022161" "70" "419" "0" "419" "0" "c.419C>T" "r.(?)" "p.(Ser140Leu)" "" "0000803088" "00022161" "50" "340" "0" "340" "0" "c.340A>T" "r.(?)" "p.(Asn114Tyr)" "" "0000803089" "00022161" "30" "257" "0" "259" "0" "c.257_259dup" "r.(?)" "p.(Gly86dup)" "" "0000860718" "00022161" "50" "141" "0" "152" "0" "c.141_152del" "r.(?)" "p.(Gly48_Gly51del)" "" "0000887814" "00022161" "30" "274" "0" "294" "0" "c.274_294del" "r.(?)" "p.(Gly92_Gly98del)" "" "0000924699" "00022161" "70" "340" "0" "340" "0" "c.340A>T" "r.(?)" "p.(Asn114Tyr)" "" "0000929324" "00022161" "30" "94" "0" "94" "0" "c.94G>A" "r.(?)" "p.(Gly32Ser)" "" "0000931916" "00022161" "90" "0" "0" "0" "0" "c.-351_*706{0}" "r.0?" "p.0?" "" "0000977652" "00022161" "50" "545" "0" "545" "0" "c.545G>A" "r.(?)" "p.(Arg182Gln)" "" "0000977653" "00022161" "50" "-33" "0" "-33" "0" "c.-33G>C" "r.(?)" "p.(=)" "" "0000996396" "00022161" "30" "517" "0" "517" "0" "c.517G>A" "r.(?)" "p.(Ala173Thr)" "" "0000996397" "00022161" "30" "301" "0" "301" "0" "c.301C>G" "r.(?)" "p.(Gln101Glu)" "" "0000996398" "00022161" "50" "277" "0" "291" "0" "c.277_291dup" "r.(?)" "p.(Ser93_Gly97dup)" "" "0000996399" "00022161" "50" "276" "0" "293" "0" "c.276_293dup" "r.(?)" "p.(Ser94_Ser99dup)" "" "0000996400" "00022161" "50" "164" "0" "164" "0" "c.164C>A" "r.(?)" "p.(Ala55Asp)" "" "0000996401" "00022161" "30" "163" "0" "163" "0" "c.163G>A" "r.(?)" "p.(Ala55Thr)" "" "0001036305" "00022161" "50" "254" "0" "259" "0" "c.254_259dup" "r.(?)" "p.(Gly85_Gly86dup)" "" "0001036306" "00022161" "50" "71" "0" "71" "0" "c.71C>T" "r.(?)" "p.(Pro24Leu)" "" "0001059272" "00022161" "70" "94" "0" "94" "0" "c.94G>A" "r.(?)" "p.(Gly32Ser)" "" "0001089747" "00022161" "70" "2215" "-1" "2235074" "0" "c.(2214+11549_2215-1)_(*2234465_?)inv" "r.?" "p.?" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 20 "{{screeningid}}" "{{variantid}}" "0000017804" "0000037972" "0000017805" "0000037973" "0000017806" "0000037974" "0000017820" "0000038014" "0000019796" "0000040243" "0000019797" "0000040244" "0000019798" "0000040245" "0000019799" "0000040246" "0000152899" "0000352481" "0000153383" "0000352482" "0000165388" "0000369049" "0000165389" "0000369050" "0000209836" "0000440056" "0000332808" "0000730090" "0000336178" "0000735318" "0000336188" "0000735333" "0000336273" "0000735548" "0000437140" "0000931916" "0000470931" "0001059272" "0000486682" "0001089747"