### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ###
## Filter: (gene_public = TYMP)
# charset = UTF-8

## Genes ## Do not remove or alter this header ##
## Count = 1
"{{id}}"	"{{name}}"	"{{chromosome}}"	"{{chrom_band}}"	"{{imprinting}}"	"{{refseq_genomic}}"	"{{refseq_UD}}"	"{{reference}}"	"{{url_homepage}}"	"{{url_external}}"	"{{allow_download}}"	"{{id_hgnc}}"	"{{id_entrez}}"	"{{id_omim}}"	"{{show_hgmd}}"	"{{show_genecards}}"	"{{show_genetests}}"	"{{show_orphanet}}"	"{{note_index}}"	"{{note_listing}}"	"{{refseq}}"	"{{refseq_url}}"	"{{disclaimer}}"	"{{disclaimer_text}}"	"{{header}}"	"{{header_align}}"	"{{footer}}"	"{{footer_align}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"	"{{updated_by}}"	"{{updated_date}}"
"TYMP"	"thymidine phosphorylase"	"22"	"q13"	"unknown"	"NG_011860.1"	"UD_132084551956"	""	"https://www.LOVD.nl/TYMP"	""	"1"	"3148"	"1890"	"131222"	"1"	"1"	"1"	"1"	"Establishment of this gene variant database (LSDB) was supported by the <a href=\'http://www.LUMC.nl\' target=\'_blank\'>Leiden University Medical Center (LUMC)</a>, Leiden, Nederland."	""	"g"	"https://databases.lovd.nl/shared/refseq/TYMP_codingDNA.html"	"1"	""	""	"-1"	""	"-1"	"00001"	"2010-04-29 00:00:00"	"00006"	"2018-02-10 18:58:38"	"00006"	"2026-09-16 11:21:38"


## Transcripts ## Do not remove or alter this header ##
## Count = 1
"{{id}}"	"{{geneid}}"	"{{name}}"	"{{id_mutalyzer}}"	"{{id_ncbi}}"	"{{id_ensembl}}"	"{{id_protein_ncbi}}"	"{{id_protein_ensembl}}"	"{{id_protein_uniprot}}"	"{{remarks}}"	"{{position_c_mrna_start}}"	"{{position_c_mrna_end}}"	"{{position_c_cds_end}}"	"{{position_g_mrna_start}}"	"{{position_g_mrna_end}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"
"00026061"	"TYMP"	"transcript variant 2"	"001"	"NM_001953.4"	""	"NP_001944.1"	""	""	""	"-192"	"1467"	"1449"	"50968514"	"50964181"	"00006"	"2026-03-04 16:53:42"	""	""


## Diseases ## Do not remove or alter this header ##
## Count = 5
"{{id}}"	"{{symbol}}"	"{{name}}"	"{{inheritance}}"	"{{id_omim}}"	"{{tissues}}"	"{{features}}"	"{{remarks}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"
"00198"	"?"	"unclassified / mixed"	""	""	""	""	""	"00006"	"2013-09-13 14:21:47"	"00006"	"2024-11-23 09:38:12"
"00244"	"MYOP"	"myopathy (MYOP)"	""	""	""	""	""	"00006"	"2013-10-12 23:00:55"	"00006"	"2019-06-19 11:52:31"
"01052"	"MTDPS1"	"mitochondrial DNA depletion syndrome, type 1 (MTDPS-1, MNGIE type)"	"AR"	"603041"	""	"onset second to fifth decades, ptosis, progressive external ophthalmoplegia, gastrointestinal dysmotility, thin body habitus, peripheral neuropathy, myopathy, leukoencephalopathy, lactic acidosis"	""	"00006"	"2014-09-25 23:29:40"	"00006"	"2026-09-11 15:36:51"
"01926"	"MEOAL;MMDS8"	"mitochondrial myopathy, episodic, with optic atrophy and reversible leukoencephalopathy"	"AR"	"251900"	""	""	""	"00006"	"2014-09-25 23:29:40"	"00006"	"2024-11-25 10:11:25"
"05374"	"MTDPS"	"mitochondrial DNA depletion syndrome (MTDPS)"	""	""	""	""	""	"00006"	"2018-01-01 15:41:06"	""	""


## Genes_To_Diseases ## Do not remove or alter this header ##
## Count = 1
"{{geneid}}"	"{{diseaseid}}"
"TYMP"	"01052"


## Individuals ## Do not remove or alter this header ##
## Count = 218
"{{id}}"	"{{fatherid}}"	"{{motherid}}"	"{{panelid}}"	"{{panel_size}}"	"{{license}}"	"{{owned_by}}"	"{{Individual/Reference}}"	"{{Individual/Remarks}}"	"{{Individual/Gender}}"	"{{Individual/Consanguinity}}"	"{{Individual/Origin/Geographic}}"	"{{Individual/Age_of_death}}"	"{{Individual/VIP}}"	"{{Individual/Data_av}}"	"{{Individual/Treatment}}"	"{{Individual/Origin/Population}}"	"{{Individual/Individual_ID}}"
"00037301"	""	""	""	"1"	""	"01164"	""	""	""	""	"Germany"	""	"0"	""	""	""	""
"00037302"	""	""	""	"1"	""	"01164"	""	""	""	""	"Germany"	""	"0"	""	""	""	""
"00037303"	""	""	""	"1"	""	"01164"	""	""	""	""	"Germany"	""	"0"	""	""	""	""
"00037304"	""	""	""	"1"	""	"01164"	""	""	""	""	"Germany"	""	"0"	""	""	""	""
"00037305"	""	""	""	"1"	""	"01164"	""	""	""	""	"Germany"	""	"0"	""	""	""	""
"00037306"	""	""	""	"1"	""	"01164"	""	""	""	""	"Germany"	""	"0"	""	""	""	""
"00037307"	""	""	""	"1"	""	"01164"	""	""	""	""	"Germany"	""	"0"	""	""	""	""
"00037308"	""	""	""	"1"	""	"01164"	""	""	""	""	"Germany"	""	"0"	""	""	""	""
"00050428"	""	""	""	"1"	""	"00006"	"{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	"Decipher"	""	""	""
"00225598"	""	""	""	"1"	""	"02551"	""	""	"M"	""	""	""	"0"	""	""	""	""
"00250187"	""	""	""	"1"	""	"03387"	""	""	"F"	"no"	"United States"	""	"0"	""	""	""	""
"00250188"	""	""	""	"1"	""	"03387"	""	""	"M"	"no"	"United States"	""	"0"	""	""	"Navajo"	""
"00250189"	""	""	""	"1"	""	"03387"	""	""	"F"	"?"	"United States"	""	"0"	""	""	""	""
"00250190"	""	""	""	"1"	""	"03387"	""	""	"M"	"?"	"United States"	""	"0"	""	""	""	""
"00293158"	""	""	""	"1"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00293159"	""	""	""	"5"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00293160"	""	""	""	"1"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00296610"	""	""	""	"1"	""	"00006"	"{PMID:Taylor 2014:25058219}"	""	"F"	""	"United Kingdom (Great Britain)"	"<01m"	"0"	""	""	"British"	"Pat43"
"00320152"	""	""	""	"1"	""	"01807"	""	""	"F"	""	""	""	"0"	""	""	""	""
"00469483"	""	""	""	"1"	""	"00006"	"{PMID:Retterer 2016:26633542}"	"analysis proband (1/3040); possible combination of variants not reported"	""	""	"United States"	""	"0"	""	""	""	""
"00469484"	""	""	""	"1"	""	"00006"	"{PMID:Retterer 2016:26633542}"	"analysis proband (1/3040); possible combination of variants not reported"	""	""	"United States"	""	"0"	""	""	""	""
"00473135"	""	""	""	"1"	""	"00006"	"{PMID:Molaei 2025:41315541}"	"analysis 2009 neuromuscular disorder individuals; patient, no family history"	"M"	"yes"	"Iran"	""	"0"	""	""	""	"Fam101296Pat269"
"00473426"	""	""	""	"1"	""	"00006"	"{PMID:Molaei 2025:41315541}"	"analysis 2009 neuromuscular disorder individuals; patient, family history"	"F"	"yes"	"Iran"	""	"0"	""	""	""	"Fam209859Pat731"
"00473445"	""	""	""	"1"	""	"00006"	"{PMID:Molaei 2025:41315541}"	"analysis 2009 neuromuscular disorder individuals; patient, no family history"	"M"	"yes"	"Iran"	""	"0"	""	""	""	"Fam211181Pat760"
"00476908"	""	""	""	"1"	""	"00006"	"{PMID:Alhammad 2024:39232665}"	""	""	""	"Saudi Arabia"	""	"0"	""	""	""	""
"00484590"	""	""	""	"1"	""	"05036"	""	""	"F"	"no"	"Malaysia"	""	""	""	""	""	""
"00484677"	""	""	""	"1"	""	"00006"	"{PMID:Nishino 1999:9924029}, {PMID:Nishino 2000:10852545}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	""	""	"United States"	""	"0"	""	""	"jew-Ashkenazi"	"Pat1"
"00484678"	""	""	""	"1"	""	"00006"	"{PMID:Nishino 1999:9924029}, {PMID:Nishino 2000:10852545}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	""	""	"United States"	""	"0"	""	""	"Germany"	"Pat2"
"00484679"	""	""	""	"1"	""	"00006"	"{PMID:Nishino 1999:9924029}, {PMID:Nishino 2000:10852545}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	""	""	"Puerto Rico"	""	"0"	""	""	""	"Pat3"
"00484680"	""	""	""	"1"	""	"00006"	"{PMID:Nishino 1999:9924029}, {PMID:Nishino 2000:10852545}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	""	""	"Jamaica"	""	"0"	""	""	""	"Pat4"
"00484681"	""	""	""	"1"	""	"00006"	"{PMID:Nishino 1999:9924029}, {PMID:Nishino 2000:10852545}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	""	""	"Israel"	""	"0"	""	""	"jew;Iran"	"Pat5"
"00484682"	""	""	""	"1"	""	"00006"	"{PMID:Nishino 1999:9924029}, {PMID:Nishino 2000:10852545}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	""	""	"Puerto Rico"	""	"0"	""	""	""	"Pat6"
"00484683"	""	""	""	"1"	""	"00006"	"{PMID:Nishino 1999:9924029}, {PMID:Nishino 2000:10852545}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	""	""	"Germany"	""	"0"	""	""	""	"Pat7"
"00484684"	""	""	""	"1"	""	"00006"	"{PMID:Nishino 1999:9924029}, {PMID:Nishino 2000:10852545}"	"2-generation family, 1 affected, unaffected parents"	""	""	"United States"	""	"0"	""	""	"Germany"	"Pat8"
"00484685"	""	""	""	"1"	""	"00006"	"{PMID:Nishino 1999:9924029}, {PMID:Nishino 2000:10852545}"	"2-generation family, 1 affected, unaffected parents"	""	""	"Canada"	""	"0"	""	""	"white;Germany"	"Pat9"
"00484686"	""	""	""	"1"	""	"00006"	"{PMID:Nishino 1999:9924029}, {PMID:Nishino 2000:10852545}"	"2-generation family, 1 affected, unaffected parents"	""	""	"United States"	""	"0"	""	""	"Europe"	"Pat10"
"00484687"	""	""	""	"1"	""	"00006"	"{PMID:Nishino 1999:9924029}, {PMID:Nishino 2000:10852545}"	"2-generation family, 1 affected, unaffected parents"	""	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	"Pat11"
"00484688"	""	""	""	"1"	""	"00006"	"{PMID:Nishino 1999:9924029}, {PMID:Nishino 2000:10852545}"	"2-generation family, 1 affected, unaffected parents"	""	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	"Pat12"
"00484689"	""	""	""	"1"	""	"00006"	"{PMID:Nishino 2000:10852545}"	"2-generation family, 1 affected, unaffected parents"	""	""	"Greece"	""	"0"	""	""	""	"Pat13"
"00484690"	""	""	""	"1"	""	"00006"	"{PMID:Nishino 2000:10852545}"	"2-generation family, 1 affected, unaffected parents"	""	""	"United States"	""	"0"	""	""	"Europe;white"	"Pat14"
"00484691"	""	""	""	"1"	""	"00006"	"{PMID:Nishino 2000:10852545}"	"2-generation family, 1 affected, unaffected parents"	""	""	"Belgium"	""	"0"	""	""	""	"Pat15"
"00484692"	""	""	""	"1"	""	"00006"	"{PMID:Nishino 2000:10852545}"	"2-generation family, 1 affected, unaffected parents"	""	""	"Portugal"	""	"0"	""	""	""	"Pat16"
"00484693"	""	""	""	"1"	""	"00006"	"{PMID:Nishino 2000:10852545}"	"2-generation family, 1 affected, unaffected parents"	""	""	"Italy"	""	"0"	""	""	"Sicily"	"Pat17"
"00484694"	""	""	""	"1"	""	"00006"	"{PMID:Nishino 2000:10852545}"	"2-generation family, 1 affected, unaffected parents"	""	""	"Dominican Republic"	""	"0"	""	""	""	"Pat18"
"00484695"	""	""	""	"1"	""	"00006"	"{PMID:Nishino 2000:10852545}"	"2-generation family, 1 affected, unaffected parents"	""	""	"Japan"	""	"0"	""	""	""	"Pat19"
"00484696"	""	""	""	"1"	""	"00006"	"{PMID:Nishino 2000:10852545}"	"2-generation family, 1 affected, unaffected parents"	""	""	"Switzerland"	""	"0"	""	""	""	"Pat20"
"00484697"	""	""	""	"1"	""	"00006"	"{PMID:Nishino 2000:10852545}"	"2-generation family, 1 affected, unaffected parents"	""	""	"Italy"	""	"0"	""	""	""	"Pat21"
"00484698"	""	""	""	"1"	""	"00006"	"{PMID:Gamez 2002:12177387}"	"3-generation family, 2 affected sister, unaffected heterozygous carrier parents/relatives"	"F"	""	"Spain"	""	"0"	""	""	""	"FamPatIII2/4"
"00484699"	""	""	""	"1"	""	"00006"	"{PMID:Szigeti 2004:14757860}"	"2-generation family, 1 affected, unaffected parents"	"M"	""	"United States"	""	"0"	""	""	"white"	"patient"
"00484700"	""	""	""	"1"	""	"00006"	"{PMID:Marti 2005:16178026}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	"F"	""	"United States"	""	"0"	""	""	"United Kingdom (Great Britain)"	"Pat1"
"00484701"	""	""	""	"1"	""	"00006"	"{PMID:Marti 2005:16178026}"	"2-generation family, 1 affected, unaffected parents"	"F"	""	"Netherlands"	""	"0"	""	""	""	"Pat2"
"00484702"	""	""	""	"1"	""	"00006"	"{PMID:Marti 2005:16178026}"	"2-generation family, 1 affected, unaffected parents"	"M"	""	"United States"	""	"0"	""	""	"United Kingdom (Great Britain)"	"Pat3"
"00484703"	""	""	""	"1"	""	"00006"	"{PMID:Ginsberg 2007:17239807}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents/"	"F"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	"patient"
"00484704"	""	""	""	"1"	""	"00006"	"{PMID:Taanman 2009:19056268}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	"F"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	"patient"
"00484705"	""	""	""	"2"	""	"00006"	"{PMID:Mojtabavi 2021:33825174}"	"4-generation family, 2 affected brothers, unaffected heterozygous carrier parents"	"M"	"yes"	"Iran"	""	"0"	""	""	""	"Fam1Pat1"
"00484706"	""	""	"00484705"	"1"	""	"00006"	"{PMID:Mojtabavi 2021:33825174}"	"3-generation family, 1 affected, unaffected parents"	"M"	"yes"	"Iran"	""	"0"	""	""	""	"Fam1Pat2"
"00484707"	""	""	""	"1"	""	"00006"	"{PMID:Mojtabavi 2021:33825174}"	"3-generation family, 1 affected, unaffected parents"	"F"	"yes"	"Iran"	""	"0"	""	""	""	"FamPat3"
"00484708"	""	""	""	"3"	""	"00006"	"{PMID:Mojtabavi 2021:33825174}"	"3-generation family, 3 affected sisters, unaffected parents"	"F"	""	"Iran"	""	"0"	""	""	""	"FamPat4"
"00484709"	""	""	""	"1"	""	"00006"	"{PMID:Mojtabavi 2021:33825174}"	"3-generation family, 1 affected, unaffected parents"	"F"	""	"Iran"	""	"0"	""	""	""	"FamPat5"
"00484710"	""	""	""	"1"	""	"00006"	"{PMID:Mojtabavi 2021:33825174}"	"3-generation family, 1 affected, unaffected parents"	"M"	"yes"	"Iran"	""	"0"	""	""	""	"FamPat6"
"00484807"	""	""	""	"1"	""	"00006"	"{PMID:Bychkov 2021:33486010}"	"analysis 102 patients with mitochondrial DNA maintenance disorders"	"F"	""	"Russia"	""	"0"	""	""	""	"Pat97"
"00484813"	""	""	""	"2"	""	"00006"	"{PMID:Patel 2019:30646848}"	"family, 2 affected sisters"	"F"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	"patient"
"00484814"	""	""	""	"1"	""	"00006"	"{PMID:Vondrackova 2014:23838601}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	"M"	""	"Czech Republic"	""	"0"	""	""	""	"Pat1"
"00484815"	""	""	""	"1"	""	"00006"	"{PMID:Vondrackova 2014:23838601}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	"M"	""	"Czech Republic"	""	"0"	""	""	""	"Pat2"
"00484816"	""	""	""	"1"	""	"00006"	"{PMID:Kintarak 2007:17544574}"	""	"M"	""	"Thailand"	""	"0"	""	""	""	"patient"
"00484824"	""	""	""	"1"	""	"00006"	"{PMID:Kocaefe 2003:12529715}"	""	"F"	""	"Turkey"	""	"0"	""	""	""	"Pat1"
"00484825"	""	""	""	"1"	""	"00006"	"{PMID:Kocaefe 2003:12529715}"	""	"M"	""	"Turkey"	""	"0"	""	""	""	"Pat2"
"00484826"	""	""	""	"1"	""	"00006"	"{PMID:Kocaefe 2003:12529715}"	""	"M"	""	"Turkey"	""	"0"	""	""	""	"Pat3"
"00484827"	""	""	""	"1"	""	"00006"	"{PMID:Kocaefe 2003:12529715}"	""	"M"	""	"Turkey"	""	"0"	""	""	""	"Pat4"
"00484828"	""	""	""	"1"	""	"00006"	"{PMID:Kocaefe 2003:12529715}"	""	"M"	""	"Turkey"	""	"0"	""	""	""	"Pat5"
"00484829"	""	""	""	"1"	""	"00006"	"{PMID:Martin 2004:15505189}"	""	"F"	""	"Spain"	""	"0"	""	""	""	"patient"
"00484830"	""	""	""	"1"	""	"00006"	"{PMID:Slama 2005:15781193}, {PMID:Said 2005:15742109}"	"3-generation family, 1 affected, unaffected heterozygous carrier parents/relatives"	""	""	"France"	""	"0"	""	""	""	"Pat1;Pat2"
"00484831"	""	""	""	"1"	""	"00006"	"{PMID:Slama 2005:15781193}, {PMID:Said 2005:15742109}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents/relatives"	"F"	""	"France"	""	"0"	""	""	""	"Pat2;Pat3"
"00484832"	""	""	""	"1"	""	"00006"	"{PMID:Slama 2005:15781193}"	"2-generation family, 1 affected, unaffected parents"	""	""	"France"	""	"0"	""	""	""	"Pat3"
"00484833"	""	""	""	"1"	""	"00006"	"{PMID:Slama 2005:15781193}"	""	""	""	"France"	""	"0"	""	""	""	"Pat4"
"00484834"	""	""	""	"2"	""	"00006"	"{PMID:Slama 2005:15781193}"	"family, 2 affected"	""	""	"France"	""	"0"	""	""	""	"Pat5"
"00484835"	""	""	""	"1"	""	"00006"	"{PMID:Slama 2005:15781193}"	""	""	""	"France"	""	"0"	""	""	""	"Pat6"
"00484836"	""	""	""	"2"	""	"00006"	"{PMID:Slama 2005:15781193}"	"family, 2 affected"	""	""	"France"	""	"0"	""	""	""	"Pat7"
"00484837"	""	""	""	"1"	""	"00006"	"{PMID:Slama 2005:15781193}, {PMID:Said 2005:15742109}"	""	"F"	""	"France"	""	"0"	""	""	""	"Pat8;Pat1"
"00484838"	""	""	""	"3"	""	"00006"	"{PMID:Schupbach 2007:17294068}"	"2-generation family, 3 affected (3 brothers)"	""	""	"Switzerland"	""	"0"	""	""	""	"FamPat1"
"00484839"	""	""	""	"1"	""	"00006"	"{PMID:Schupbach 2007:17294068}"	"twin brother pair"	""	""	"Switzerland"	""	"0"	""	""	""	"FamPat2"
"00484840"	""	""	""	"1"	""	"00006"	"{PMID:Schupbach 2007:17294068}"	"twin brother"	""	""	"Switzerland"	""	"0"	""	""	""	"FamPat3"
"00484841"	""	""	""	"2"	""	"00006"	"{PMID:Monroy 2008:18280229}"	"5-generation family, 2 affected brothers, unaffected heterozygous carrier parents/relatives"	"M"	"yes"	"Mexico"	""	"0"	""	""	""	"FamPatV10/15"
"00484842"	""	""	""	"1"	""	"00006"	"{PMID:Poulton 2009:19748572}"	""	""	""	""	""	"0"	""	""	""	""
"00484843"	""	""	""	"1"	""	"00006"	"{PMID:Poulton 2009:19748572}"	""	""	""	""	""	"0"	""	""	""	""
"00484844"	""	""	""	"1"	""	"00006"	"{PMID:Poulton 2009:19748572}"	""	""	""	""	""	"0"	""	""	""	""
"00484845"	""	""	""	"2"	""	"00006"	"{PMID:Said 2005:15742109}"	"2-generation family, 2 affected (sister/brother), unaffected heterozygous carrier mother"	"F;M"	""	"France"	""	"0"	""	""	""	"Pat4"
"00484846"	""	""	""	"1"	""	"00006"	"{PMID:Gamez 2005:15607208}"	"4-generation family, 1 affected, unaffected heterozygous carrier parents/relatives"	"M"	"no"	"Spain"	""	"0"	""	""	""	"patient"
"00484847"	""	""	""	"1"	""	"00006"	"{PMID:Blazquez 2005:16198108}"	"family, several affected (most not tested)"	"M"	""	"Spain"	""	"0"	""	""	""	"patient"
"00484848"	""	""	""	"2"	""	"00006"	"{PMID:Vissing 2002:12297582}"	"family, 2 affected sisters"	"F"	""	"Denmark"	""	"0"	""	""	""	"family"
"00484849"	""	""	""	"1"	""	"00006"	"{PMID:Carod-Artal 2007:17437622}"	""	"M"	""	"Brazil"	""	"0"	""	""	"mulatto"	"patient"
"00484850"	""	""	""	"1"	""	"00006"	"{PMID:Massa 2009:19853446}"	"2-generation family, 1 affected, unaffected heterozygous carrier mother"	"F"	""	"Italy"	""	"0"	""	""	""	"patient"
"00484851"	""	""	""	"1"	""	"00006"	"{PMID:Baris 2010:20585803}"	""	"F"	""	"Iraq"	""	"0"	""	""	""	"patient"
"00484852"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	""	""	"0"	""	""	"jew-Ashkenazi"	""
"00484853"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	""	""	"0"	""	""	"jew-Ashkenazi"	""
"00484854"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	""	""	"0"	""	""	"jew-Ashkenazi"	""
"00484855"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	""	""	"0"	""	""	"jew-Ashkenazi"	""
"00484856"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	""	""	"0"	""	""	"jew-Ashkenazi"	""
"00484857"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Italy"	""	"0"	""	""	""	""
"00484858"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Italy"	""	"0"	""	""	""	""
"00484859"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Italy"	""	"0"	""	""	""	""
"00484860"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Italy"	""	"0"	""	""	""	""
"00484861"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Italy"	""	"0"	""	""	""	""
"00484862"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Italy"	""	"0"	""	""	""	""
"00484863"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Italy"	""	"0"	""	""	""	""
"00484864"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Italy"	""	"0"	""	""	""	""
"00484865"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Italy"	""	"0"	""	""	""	""
"00484866"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Belgium"	""	"0"	""	""	""	""
"00484867"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Belgium"	""	"0"	""	""	""	""
"00484868"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Austria"	""	"0"	""	""	""	""
"00484869"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Germany"	""	"0"	""	""	""	""
"00484870"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Germany"	""	"0"	""	""	""	""
"00484871"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Germany"	""	"0"	""	""	""	""
"00484872"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Germany"	""	"0"	""	""	""	""
"00484873"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"England"	""	"0"	""	""	""	""
"00484874"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"England"	""	"0"	""	""	""	""
"00484875"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"England"	""	"0"	""	""	""	""
"00484876"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"England"	""	"0"	""	""	""	""
"00484877"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Spain"	""	"0"	""	""	""	""
"00484878"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Spain"	""	"0"	""	""	""	""
"00484879"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Portugal"	""	"0"	""	""	""	""
"00484880"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"France"	""	"0"	""	""	""	""
"00484881"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"France"	""	"0"	""	""	""	""
"00484882"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Turkey"	""	"0"	""	""	""	""
"00484883"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Turkey"	""	"0"	""	""	""	""
"00484884"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Turkey"	""	"0"	""	""	""	""
"00484885"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Turkey"	""	"0"	""	""	""	""
"00484886"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Turkey"	""	"0"	""	""	""	""
"00484887"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Netherlands"	""	"0"	""	""	""	""
"00484888"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Netherlands"	""	"0"	""	""	""	""
"00484889"	""	""	""	"3"	""	"00006"	"{PMID:Garone 2011:21933806}"	"family, 3 affected"	""	""	"Greece"	""	"0"	""	""	""	""
"00484890"	""	""	"00484889"	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Greece"	""	"0"	""	""	""	""
"00484891"	""	""	"00484889"	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Greece"	""	"0"	""	""	""	""
"00484892"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Switzerland"	""	"0"	""	""	""	""
"00484893"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	""	""	"0"	""	""	"Europe-mixed"	""
"00484894"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	""	""	"0"	""	""	"Europe-mixed"	""
"00484895"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	""	""	"0"	""	""	"Europe-mixed"	""
"00484896"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	""	""	"0"	""	""	"Europe-mixed"	""
"00484897"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	""	""	"0"	""	""	"Europe-mixed"	""
"00484898"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"United Kingdom (Great Britain)"	""	"0"	""	""	"Anglo-Saxon"	""
"00484899"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"United States"	""	"0"	""	""	""	""
"00484900"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"United States"	""	"0"	""	""	""	""
"00484901"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Puerto Rico"	""	"0"	""	""	""	""
"00484902"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Puerto Rico"	""	"0"	""	""	""	""
"00484903"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Puerto Rico;Dominican Republic"	""	"0"	""	""	""	""
"00484904"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Mexico"	""	"0"	""	""	""	""
"00484905"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Mexico"	""	"0"	""	""	""	""
"00484906"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Dominican Republic"	""	"0"	""	""	""	""
"00484907"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Dominican Republic"	""	"0"	""	""	""	""
"00484908"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Dominican Republic"	""	"0"	""	""	""	""
"00484909"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Dominican Republic"	""	"0"	""	""	""	""
"00484910"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Brazil"	""	"0"	""	""	""	""
"00484911"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Brazil"	""	"0"	""	""	""	""
"00484912"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Iran"	""	"0"	""	""	"jew"	""
"00484913"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Iran"	""	"0"	""	""	"jew"	""
"00484914"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Iran"	""	"0"	""	""	"jew"	""
"00484915"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Israel"	""	"0"	""	""	""	""
"00484916"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Israel"	""	"0"	""	""	""	""
"00484917"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Israel"	""	"0"	""	""	""	""
"00484918"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Israel"	""	"0"	""	""	""	""
"00484919"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Iran"	""	"0"	""	""	""	""
"00484920"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Iraq"	""	"0"	""	""	""	""
"00484921"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}, {PMID:Nalini 2011:21794876}"	"4-generation family, 3 affected brothers"	"M"	""	"India"	""	"0"	""	""	""	"FamPatIII13"
"00484922"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Japan"	""	"0"	""	""	""	""
"00484923"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Thailand"	""	"0"	""	""	""	""
"00484924"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Australia"	""	"0"	""	""	""	""
"00484925"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Australia"	""	"0"	""	""	""	""
"00484926"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	"Australia"	""	"0"	""	""	""	""
"00484927"	""	""	""	"1"	""	"00006"	"{PMID:Garone 2011:21933806}"	""	""	""	""	""	"0"	""	""	""	""
"00484928"	""	""	""	"1"	""	"00006"	"{PMID:Scarpelli 2012:23341816}"	""	"M"	""	"Italy"	""	"0"	""	""	""	"patient"
"00484929"	""	""	""	"1"	""	"00006"	"{PMID:Mihaylova 2013:23590577}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	"M"	""	"Bulgaria"	""	"0"	""	""	"Turkey"	"patient"
"00484930"	""	""	""	"1"	""	"00006"	"{PMID:Suh 2013:23685548}"	"3-generation family, 1 affected, unaffected heterozygous carrier parents"	"F"	"no"	"Korea"	""	"0"	""	""	""	"patient"
"00484931"	""	""	""	"1"	""	"00006"	"{PMID:Benureau 2014:25282463}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	"F"	""	"France"	""	"0"	""	""	""	"patient"
"00484932"	""	""	""	"2"	""	"00006"	"{PMID:Peedikayil 2015:25585305}"	"3-generation family, 2 affected (F, M)"	""	""	"Saudi Arabia"	""	"0"	""	""	""	"family"
"00484933"	""	""	""	"1"	""	"00006"	"{PMID:Wang 2015:25954734}"	""	"M"	""	"China"	""	"0"	""	""	""	"patient"
"00484934"	""	""	""	"1"	""	"00006"	"{PMID:Karyampudi 2016:27261974}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	"M"	"no"	"India"	""	"0"	""	""	""	"patient"
"00484935"	""	""	""	"1"	""	"00006"	"{PMID:Laforce 2009:19523753}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	"F"	""	"Canada"	""	"0"	""	""	"France"	"patient"
"00484936"	""	""	""	"2"	""	"00006"	"{PMID:Libernini 2012:22618301}"	"2-generation family, 2 affected brothers, unaffected heterozygous carrier parents/"	"M"	""	"Italy"	""	"0"	""	""	""	"FamPat1/2"
"00484937"	""	""	""	"1"	""	"00006"	"{PMID:Finkenstedt 2013:23430799}"	""	"M"	""	"Austria"	""	"0"	""	""	""	"patient"
"00484938"	""	""	""	"1"	""	"00006"	"{PMID:Bakker 2010:20151198}"	""	"M"	""	"Netherlands"	""	"0"	""	""	""	"patient"
"00484939"	""	""	""	"1"	""	"00006"	"{PMID:Hirano 2006:16971696}, {PMID:Halter 2015:26264513}"	""	"F"	""	""	""	"0"	""	"haematopoietic stem cell transplantation"	""	"Pat1"
"00484940"	""	""	""	"1"	""	"00006"	"{PMID:Hirano 2006:16971696}, {PMID:Halter 2015:26264513}"	""	"M"	""	"Japan"	""	"0"	""	"haematopoietic stem cell transplantation"	""	"Pat2"
"00484941"	""	""	""	"1"	""	"00006"	"{PMID:Halter 2015:26264513}"	""	"F"	""	"Italy"	""	"0"	""	"haematopoietic stem cell transplantation"	""	"Pat3"
"00484942"	""	""	""	"1"	""	"00006"	"{PMID:Halter 2015:26264513}"	""	"M"	""	""	""	"0"	""	"haematopoietic stem cell transplantation"	""	"Pat4"
"00484943"	""	""	""	"1"	""	"00006"	"{PMID:Halter 2015:26264513}"	""	"M"	""	""	""	"0"	""	"haematopoietic stem cell transplantation"	""	"Pat5"
"00484944"	""	""	""	"1"	""	"00006"	"{PMID:Halter 2015:26264513}"	""	"F"	""	""	""	"0"	""	"haematopoietic stem cell transplantation"	""	"Pat6"
"00484945"	""	""	""	"1"	""	"00006"	"{PMID:Halter 2015:26264513}"	""	"M"	""	""	""	"0"	""	"haematopoietic stem cell transplantation"	""	"Pat7"
"00484946"	""	""	""	"1"	""	"00006"	"{PMID:Halter 2015:26264513}"	""	"F"	""	""	""	"0"	""	"haematopoietic stem cell transplantation"	""	"Pat8"
"00484947"	""	""	""	"1"	""	"00006"	"{PMID:Halter 2015:26264513}"	""	"M"	""	""	""	"0"	""	"haematopoietic stem cell transplantation"	""	"Pat9"
"00484948"	""	""	""	"1"	""	"00006"	"{PMID:Halter 2015:26264513}"	""	"M"	""	""	""	"0"	""	"haematopoietic stem cell transplantation"	""	"Pat11"
"00484949"	""	""	""	"1"	""	"00006"	"{PMID:Sicurelli 2012:22532170}, {PMID:Halter 2015:26264513}"	""	"F"	""	"Italy"	""	"0"	""	"haematopoietic stem cell transplantation"	""	"Pat12"
"00484950"	""	""	""	"1"	""	"00006"	"{PMID:Halter 2015:26264513}"	""	"F"	""	""	""	"0"	""	"haematopoietic stem cell transplantation"	""	"Pat13"
"00484951"	""	""	""	"1"	""	"00006"	"{PMID:Halter 2015:26264513}"	""	"F"	""	""	""	"0"	""	"haematopoietic stem cell transplantation"	""	"Pat14"
"00484952"	""	""	""	"1"	""	"00006"	"{PMID:Halter 2015:26264513}"	""	"M"	""	""	""	"0"	""	"haematopoietic stem cell transplantation"	""	"Pat15"
"00484953"	""	""	""	"1"	""	"00006"	"{PMID:Filosto 2012:22711161}, {PMID:Halter 2015:26264513}"	""	"F"	""	"Italy"	""	"0"	""	"haematopoietic stem cell transplantation"	""	"Pat16"
"00484954"	""	""	""	"1"	""	"00006"	"{PMID:Filosto 2012:22711161}, {PMID:Halter 2015:26264513}"	""	"F"	""	"Italy"	""	"0"	""	"haematopoietic stem cell transplantation"	""	"Pat18"
"00484955"	""	""	""	"1"	""	"00006"	"{PMID:Halter 2015:26264513}"	""	"F"	""	""	""	"0"	""	"haematopoietic stem cell transplantation"	""	"Pat19"
"00484956"	""	""	""	"1"	""	"00006"	"{PMID:Halter 2015:26264513}"	""	"M"	""	""	""	"0"	""	"haematopoietic stem cell transplantation"	""	"Pat20"
"00484957"	""	""	""	"1"	""	"00006"	"{PMID:Halter 2015:26264513}"	""	"F"	""	""	""	"0"	""	"haematopoietic stem cell transplantation"	""	"Pat21"
"00484958"	""	""	""	"1"	""	"00006"	"{PMID:Halter 2015:26264513}"	""	"M"	""	""	""	"0"	""	"haematopoietic stem cell transplantation"	""	"Pat23"
"00484959"	""	""	""	"1"	""	"00006"	"{PMID:Halter 2015:26264513}"	""	"M"	""	""	""	"0"	""	"haematopoietic stem cell transplantation"	""	"Pat24"
"00484960"	""	""	""	"1"	""	"00006"	"{PMID:Halter 2015:26264513}"	""	"M"	""	""	""	"0"	""	"haematopoietic stem cell transplantation"	""	"f-1a"
"00484961"	""	""	""	"1"	""	"00006"	"{PMID:Halter 2015:26264513}"	""	"M"	""	""	""	"0"	""	"haematopoietic stem cell transplantation"	""	"f-2a"
"00484962"	""	""	""	"1"	""	"00006"	"{PMID:Torres-Torronteras 2011:21412940}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents/relatives"	"F"	""	"Spain"	""	"0"	""	""	""	"patient"
"00484963"	""	""	""	"1"	""	"00006"	"{PMID:Cardaioli 2010:20232099}"	"2-generation family, 1 affected, unaffected parents"	"M"	"yes"	"Italy"	""	"0"	""	""	""	"patient"
"00484964"	""	""	""	"1"	""	"00006"	"{PMID:Hirano 2004:14720311}"	""	"M"	""	"France"	""	"0"	""	""	""	"MN22-01"
"00484965"	""	""	""	"1"	""	"00006"	"{PMID:Hirano 2004:14720311}"	""	"M"	""	"Iran"	""	"0"	""	""	"jew"	"MN24-01"
"00484966"	""	""	""	"1"	""	"00006"	"{PMID:Hirano 2004:14720311}"	""	"M"	""	"France"	""	"0"	""	""	""	"MN25-01"
"00484967"	""	""	""	"1"	""	"00006"	"{PMID:Hirano 2004:14720311}"	""	"F"	""	"Spain"	""	"0"	""	""	""	"MN26-01"
"00484968"	""	""	""	"1"	""	"00006"	"{PMID:Hirano 2004:14720311}"	""	"F"	""	"Spain"	""	"0"	""	""	""	"MN26-02"
"00484969"	""	""	""	"1"	""	"00006"	"{PMID:Hirano 2004:14720311}"	""	"F"	""	""	""	"0"	""	""	"multi-racial"	"MN27-01"
"00484970"	""	""	""	"1"	""	"00006"	"{PMID:Hirano 2004:14720311}"	""	"M"	""	"Italy"	""	"0"	""	""	""	"MN29-01"
"00484971"	""	""	""	"1"	""	"00006"	"{PMID:Hirano 2004:14720311}"	""	"M"	""	"Canada"	""	"0"	""	""	""	"MN30-01"
"00484972"	""	""	""	"1"	""	"00006"	"{PMID:Hirano 2004:14720311}"	""	"F"	""	"Canada"	""	"0"	""	""	""	"MN31-01"
"00484973"	""	""	""	"1"	""	"00006"	"{PMID:Hirano 2004:14720311}"	""	"M"	""	""	""	"0"	""	""	""	"MN32-01"
"00484974"	""	""	""	"1"	""	"00006"	"{PMID:Hirano 2004:14720311}"	""	"M"	""	"Israel"	""	"0"	""	""	""	"MN33-01"
"00484975"	""	""	""	"1"	""	"00006"	"{PMID:Hirano 2004:14720311}"	""	"F"	""	"Israel"	""	"0"	""	""	""	"MN34-01"
"00484976"	""	""	""	"1"	""	"00006"	"{PMID:Hirano 2004:14720311}"	""	"M"	""	"Israel"	""	"0"	""	""	""	"MN34-02"


## Individuals_To_Diseases ## Do not remove or alter this header ##
## Count = 216
"{{individualid}}"	"{{diseaseid}}"
"00037301"	"00198"
"00037302"	"00198"
"00037304"	"00198"
"00037305"	"00198"
"00037306"	"00198"
"00037307"	"00198"
"00037308"	"01926"
"00050428"	"00198"
"00250187"	"01052"
"00250188"	"01052"
"00250189"	"01052"
"00250190"	"01052"
"00293158"	"00198"
"00293159"	"00198"
"00293160"	"00198"
"00296610"	"00198"
"00320152"	"00198"
"00469483"	"00198"
"00469484"	"00198"
"00473135"	"00244"
"00473426"	"00244"
"00473445"	"00244"
"00476908"	"00244"
"00484590"	"01052"
"00484677"	"01052"
"00484678"	"01052"
"00484679"	"01052"
"00484680"	"01052"
"00484681"	"01052"
"00484682"	"01052"
"00484683"	"01052"
"00484684"	"01052"
"00484685"	"01052"
"00484686"	"01052"
"00484687"	"01052"
"00484688"	"01052"
"00484689"	"01052"
"00484690"	"01052"
"00484691"	"01052"
"00484692"	"01052"
"00484693"	"01052"
"00484694"	"01052"
"00484695"	"01052"
"00484696"	"01052"
"00484697"	"01052"
"00484698"	"01052"
"00484699"	"01052"
"00484700"	"01052"
"00484701"	"01052"
"00484702"	"01052"
"00484703"	"01052"
"00484704"	"01052"
"00484705"	"01052"
"00484706"	"01052"
"00484707"	"01052"
"00484708"	"01052"
"00484709"	"01052"
"00484710"	"01052"
"00484807"	"05374"
"00484813"	"05374"
"00484814"	"00198"
"00484815"	"00198"
"00484816"	"00198"
"00484824"	"05374"
"00484825"	"05374"
"00484826"	"05374"
"00484827"	"05374"
"00484828"	"05374"
"00484829"	"00198"
"00484830"	"00198"
"00484831"	"00198"
"00484832"	"00198"
"00484833"	"00198"
"00484834"	"00198"
"00484835"	"00198"
"00484836"	"00198"
"00484837"	"00198"
"00484838"	"00198"
"00484839"	"00198"
"00484840"	"00198"
"00484841"	"00198"
"00484842"	"05374"
"00484843"	"05374"
"00484844"	"05374"
"00484845"	"00198"
"00484846"	"05374"
"00484847"	"05374"
"00484848"	"00198"
"00484849"	"00198"
"00484850"	"00198"
"00484851"	"00198"
"00484852"	"05374"
"00484853"	"05374"
"00484854"	"05374"
"00484855"	"05374"
"00484856"	"05374"
"00484857"	"05374"
"00484858"	"05374"
"00484859"	"05374"
"00484860"	"05374"
"00484861"	"05374"
"00484862"	"05374"
"00484863"	"05374"
"00484864"	"05374"
"00484865"	"05374"
"00484866"	"05374"
"00484867"	"05374"
"00484868"	"05374"
"00484869"	"05374"
"00484870"	"05374"
"00484871"	"05374"
"00484872"	"05374"
"00484873"	"05374"
"00484874"	"05374"
"00484875"	"05374"
"00484876"	"05374"
"00484877"	"05374"
"00484878"	"05374"
"00484879"	"05374"
"00484880"	"05374"
"00484881"	"05374"
"00484882"	"05374"
"00484883"	"05374"
"00484884"	"05374"
"00484885"	"05374"
"00484886"	"05374"
"00484887"	"05374"
"00484888"	"05374"
"00484889"	"05374"
"00484890"	"05374"
"00484891"	"05374"
"00484892"	"05374"
"00484893"	"05374"
"00484894"	"05374"
"00484895"	"05374"
"00484896"	"05374"
"00484897"	"05374"
"00484898"	"05374"
"00484899"	"05374"
"00484900"	"05374"
"00484901"	"05374"
"00484902"	"05374"
"00484903"	"05374"
"00484904"	"05374"
"00484905"	"05374"
"00484906"	"05374"
"00484907"	"05374"
"00484908"	"05374"
"00484909"	"05374"
"00484910"	"05374"
"00484911"	"05374"
"00484912"	"05374"
"00484913"	"05374"
"00484914"	"05374"
"00484915"	"05374"
"00484916"	"05374"
"00484917"	"05374"
"00484918"	"05374"
"00484919"	"05374"
"00484920"	"05374"
"00484921"	"05374"
"00484922"	"05374"
"00484923"	"05374"
"00484924"	"05374"
"00484925"	"05374"
"00484926"	"05374"
"00484927"	"05374"
"00484928"	"00198"
"00484929"	"00198"
"00484930"	"00198"
"00484931"	"00198"
"00484932"	"00198"
"00484933"	"00198"
"00484934"	"00198"
"00484935"	"00198"
"00484936"	"00198"
"00484937"	"00198"
"00484938"	"00198"
"00484939"	"05374"
"00484940"	"05374"
"00484941"	"05374"
"00484942"	"05374"
"00484943"	"05374"
"00484944"	"05374"
"00484945"	"05374"
"00484946"	"05374"
"00484947"	"05374"
"00484948"	"05374"
"00484949"	"05374"
"00484950"	"05374"
"00484951"	"05374"
"00484952"	"05374"
"00484953"	"05374"
"00484954"	"05374"
"00484955"	"05374"
"00484956"	"05374"
"00484957"	"05374"
"00484958"	"05374"
"00484959"	"05374"
"00484960"	"05374"
"00484961"	"05374"
"00484962"	"00198"
"00484963"	"00198"
"00484964"	"05374"
"00484965"	"05374"
"00484966"	"05374"
"00484967"	"05374"
"00484968"	"05374"
"00484969"	"05374"
"00484970"	"05374"
"00484971"	"05374"
"00484972"	"05374"
"00484973"	"05374"
"00484974"	"05374"
"00484975"	"05374"
"00484976"	"05374"


## Phenotypes ## Do not remove or alter this header ##
## Note: Only showing Phenotype columns active for Diseases 00198, 00244, 01052, 01926, 05374
## Count = 214
"{{id}}"	"{{diseaseid}}"	"{{individualid}}"	"{{owned_by}}"	"{{Phenotype/Inheritance}}"	"{{Phenotype/Age}}"	"{{Phenotype/Additional}}"	"{{Phenotype/Age/Onset}}"	"{{Phenotype/Age/Diagnosis}}"	"{{Phenotype/Onset}}"	"{{Phenotype/Protein}}"	"{{Phenotype/Tumor/MSI}}"	"{{Phenotype/Enzyme/CPK}}"	"{{Phenotype/Heart/Myocardium}}"	"{{Phenotype/Diagnosis/Definite}}"	"{{Phenotype/Diagnosis/Initial}}"	"{{Phenotype/Diagnosis/Criteria}}"
"0000037040"	"00198"	"00050428"	"00006"	"Isolated (sporadic)"	""	"generalized hypotonia, global developmental delay"	""	""	""	""	""	""	""	""	""	""
"0000156873"	"00198"	"00037301"	"01164"	"Unknown"	""	"suspected MNGIE"	""	""	""	""	""	""	""	""	"MNGIE?"	""
"0000156874"	"00198"	"00037302"	"01164"	"Unknown"	""	"suspected MNGIE"	""	""	""	""	""	""	""	""	"MNGIE?"	""
"0000156875"	"00198"	"00037304"	"01164"	"Unknown"	""	"weight loss, demyelinating polyneuropathy, ophtalmoplegia, leukoencephalopathy"	""	""	""	""	""	""	""	""	"Weill-Marchesani syndrome?"	""
"0000156876"	"00198"	"00037305"	"01164"	"Unknown"	""	"suspected mitochondriopathy, status post purulent peritonitis, status post Ileus, hearing loss"	""	""	""	""	""	""	""	""	"mitochondrial disease?"	""
"0000156877"	"00198"	"00037306"	"01164"	"Unknown"	""	"suspected MNGIE"	""	""	""	""	""	""	""	""	"MNGIE?"	""
"0000156878"	"00198"	"00037307"	"01164"	"Unknown"	""	"suspected MNGIE"	""	""	""	""	""	""	""	""	"MNGIE?"	""
"0000156879"	"01926"	"00037308"	"01164"	"Unknown"	""	"MNGIE"	""	""	""	""	""	""	""	""	"mitochondrial DNA depletion syndrome"	""
"0000170710"	"00198"	"00225598"	"02551"	"Unknown"	""	"HP:0001271 (Polyneuropathy)"	""	""	""	""	""	""	""	""	""	""
"0000188751"	"01052"	"00250187"	"03387"	"Familial, autosomal recessive"	"36y"	"Elevated thymidine, ptosis, PEO, peripheral neuropathy"	""	"36y"	"adolescence"	"Thymidine Phosphorylase"	""	""	""	"MNGIE"	"MNGIE"	""
"0000188752"	"01052"	"00250188"	"03387"	"Familial, autosomal recessive"	""	"Elevated thymidine, liver cirrhosis and failure, hearing loss"	"00y14m"	""	"14m"	"Thymidine Phosphorylase"	""	""	""	"MNGIE"	"Liver failure"	""
"0000188753"	"01052"	"00250189"	"03387"	"Familial, autosomal recessive"	""	"severe gastrointestinal dysmotility, fatigue, weakness, extremity paresthesias"	""	"20y"	""	"Thymidine Phosphorylase"	""	""	""	"MNGIE"	"MNGIE"	""
"0000188754"	"01052"	"00250190"	"03387"	"Familial, autosomal recessive"	""	"demyelinating neuropathy, liver cirrhosis, gastric dysmotility"	""	"22y"	"14y"	"Thymidine Phosphorylase"	""	""	""	"MNGIE"	""	""
"0000224016"	"00198"	"00296610"	"00006"	"Unknown"	"<1m"	"deceased; muscle affected; central nervous system not affected; heart not affected; liver not affected; congenital lactic acidosis, mtDNA depletion"	"1d"	""	""	""	""	""	""	""	"multiple mitochondrial respiratory chain complex deficiency"	""
"0000242198"	"00198"	"00320152"	"01807"	"Unknown"	""	"Polycystic kidney dysplasia (HP:0000113); Microcephaly (HP:0000252); Global developmental delay (HP:0001263); Failure to thrive (HP:0001508); Broad toe (HP:0001837); Broad thumb (HP:0011304); Arachnoid cyst (HP:0100702)"	""	""	""	""	""	""	""	""	""	""
"0000354636"	"00198"	"00469483"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	"abnormality of connective tissue"	""
"0000354637"	"00198"	"00469484"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	"abnormality of connective tissue"	""
"0000357930"	"00244"	"00473135"	"00006"	"Familial, autosomal recessive"	"31y"	"onset 21y with weight loss & digestive manifestations including malnutrition, malabsorption, vomiting, and chronic abdominal pain, suspicious of Crohn disease; Facial weakness; Ophthalmoplegia; Progressive proximal & distal muscle weakness & wasting; Pes cavus; Feet drop; Areflexia; Impaired walking, Imbalance; EMG-NCV: chronic demyelinating sensorimotor polyneuropathy."	""	""	""	""	""	""	""	""	"myopathy"	""
"0000358221"	"00244"	"00473426"	"00006"	"Familial, autosomal recessive"	"18y"	"Bilateral ptosis, proximal and distal muscle weakness, paresthesia, inability toe-heel walking, mild facial weakness ,progressive external ophtalmoplegia, diabetes, chronic demyelinating sensorimotor polyneuropathy and evidence of irritable myopathy, mitochondrial myopathy reported in muscle biopsy."	""	""	""	""	""	""	""	""	"mitochondrial myopathy"	""
"0000358240"	"00244"	"00473445"	"00006"	"Unknown"	"26y"	"sporadic case, started since childhood with proximal and distal lower and upper muscle weakness, positive Gowers` sign, facial weakness, bilateral ptosis, chronic demyelinating sensorimotor poly neuropathy reported in EDX"	""	""	""	""	""	""	""	""	"myopathy"	""
"0000361583"	"00244"	"00476908"	"00006"	"Familial, autosomal recessive"	""	"not specified"	""	""	""	""	""	""	""	"MTDPS1"	"myopathy"	""
"0000367378"	"01052"	"00484590"	"05036"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	""
"0000367460"	"01052"	"00484677"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367461"	"01052"	"00484678"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367462"	"01052"	"00484679"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367463"	"01052"	"00484680"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367464"	"01052"	"00484681"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367465"	"01052"	"00484682"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367466"	"01052"	"00484683"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367467"	"01052"	"00484684"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367468"	"01052"	"00484685"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367469"	"01052"	"00484686"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367470"	"01052"	"00484687"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367471"	"01052"	"00484688"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367472"	"01052"	"00484689"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367473"	"01052"	"00484690"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367474"	"01052"	"00484691"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367475"	"01052"	"00484692"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367476"	"01052"	"00484693"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367477"	"01052"	"00484694"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367478"	"01052"	"00484695"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367479"	"01052"	"00484696"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367480"	"01052"	"00484697"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367481"	"01052"	"00484698"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..., ophthalmoparesis/mitochondrial neurogastrointestinal encephalomyopathy"	""	""	""	""	""	""	""	"MTDPS1"	"ophthalmoparesis/mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367482"	"01052"	"00484699"	"00006"	"Familial, autosomal recessive"	"17y"	"see paper; ..."	""	""	""	""	""	""	""	"MTDPS1"	"mtochondrial neurogastrointestinal encephalomyopathy"	""
"0000367483"	"01052"	"00484700"	"00006"	"Familial, autosomal recessive"	"61y"	"see paper; ..."	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367484"	"01052"	"00484701"	"00006"	"Familial, autosomal recessive"	"55y"	"see paper; ..."	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367485"	"01052"	"00484702"	"00006"	"Familial, autosomal recessive"	"57y"	"see paper; ..."	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367486"	"01052"	"00484703"	"00006"	"Familial, autosomal recessive"	"18y"	""	""	""	""	""	""	""	""	"MTDPS1"	"relapsing neuropathy"	""
"0000367487"	"01052"	"00484704"	"00006"	"Familial, autosomal recessive"	"22y"	""	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367488"	"01052"	"00484705"	"00006"	"Unknown"	"18y"	"see paper; ..."	""	""	""	""	""	""	""	""	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367489"	"01052"	"00484706"	"00006"	"Unknown"	"25y"	"see paper; ..."	""	""	""	""	""	""	""	""	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367490"	"01052"	"00484707"	"00006"	"Familial, autosomal recessive"	"48y"	"see paper; ..."	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367491"	"01052"	"00484708"	"00006"	"Familial, autosomal recessive"	"26y"	"see paper; ..."	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367492"	"01052"	"00484709"	"00006"	"Familial, autosomal recessive"	"28y"	"see paper; ..."	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367493"	"01052"	"00484710"	"00006"	"Familial, autosomal recessive"	"31y"	"see paper; ..."	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367590"	"05374"	"00484807"	"00006"	"Familial, autosomal recessive"	"42y"	"not specified"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367596"	"05374"	"00484813"	"00006"	"Familial, autosomal recessive"	"25y"	"see paper; ..., diarrhoea, vomiting, abdominal pain, bloating"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367597"	"00198"	"00484814"	"00006"	"Unknown"	"00y14m"	"see paper; ..., myoclonic movements, extremities; 9m-severe hypotonic syndrome, failure to thrive, bilateral ptosis, divergent strabismus, ataxia, regression psychomotor development"	""	""	""	""	""	""	""	""	"myoclonic movements extremities"	""
"0000367598"	"00198"	"00484815"	"00006"	"Familial, autosomal recessive"	"16y"	"see paper; ..."	""	""	""	""	""	""	""	"MTDPS1"	""	""
"0000367599"	"00198"	"00484816"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..., severe vomiting, volume depletion"	"2oy"	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367606"	"05374"	"00484824"	"00006"	"Familial, autosomal recessive"	"25y"	""	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy (AD)"	""
"0000367607"	"05374"	"00484825"	"00006"	"Familial, autosomal recessive"	"24y"	""	"21y"	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy (AD)"	""
"0000367608"	"05374"	"00484826"	"00006"	"Familial, autosomal recessive"	"19y"	""	"14y"	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy (AD)"	""
"0000367609"	"05374"	"00484827"	"00006"	"Familial, autosomal recessive"	"24y"	""	"18y"	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy (AD)"	""
"0000367610"	"05374"	"00484828"	"00006"	"Familial, autosomal recessive"	"46y"	""	"34y"	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy (AD)"	""
"0000367611"	"00198"	"00484829"	"00006"	"Familial, autosomal recessive"	"60y"	"see paper; ..."	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalopathy"	""
"0000367612"	"00198"	"00484830"	"00006"	"Familial, autosomal recessive"	"25y"	"see paper; ..., severe polyneuropathy"	""	""	""	""	""	""	""	"MTDPS1"	"Charcot-Marie-Tooth disease"	""
"0000367613"	"00198"	"00484831"	"00006"	"Familial, autosomal recessive"	"24y"	"see paper; ..., severe polyneuropathy"	"19y"	""	""	""	""	""	""	"MTDPS1"	"anorexia nervous"	""
"0000367614"	"00198"	"00484832"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	"12y"	""	""	""	""	""	""	"MTDPS1"	"cachexia"	""
"0000367615"	"00198"	"00484833"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	"MTDPS1"	"diabetes"	""
"0000367616"	"00198"	"00484834"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	"27y"	""	""	""	""	""	""	"MTDPS1"	""	""
"0000367617"	"00198"	"00484835"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	"17y"	""	""	""	""	""	""	"MTDPS1"	"chronic diarrhea"	""
"0000367618"	"00198"	"00484836"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	"19y"	""	""	""	""	""	""	"MTDPS1"	"Crohn’s disease"	""
"0000367619"	"00198"	"00484837"	"00006"	"Familial, autosomal recessive"	"25y"	"see paper; ..., severe polyneuropathy"	"10y"	""	""	""	""	""	""	"MTDPS1"	"recurrent diarrhea"	""
"0000367620"	"00198"	"00484838"	"00006"	"Familial, autosomal recessive"	"22y"	"see paper; ..., mitochondrial neurogastrointestinal encephalomyopathy"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367621"	"00198"	"00484839"	"00006"	"Familial, autosomal recessive"	"20y"	"see paper; ..., mitochondrial neurogastrointestinal encephalomyopathy"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367622"	"00198"	"00484840"	"00006"	"Familial, autosomal recessive"	"20y"	"see paper; ..., mitochondrial neurogastrointestinal encephalomyopathy"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367623"	"00198"	"00484841"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..., mitochondrial neurogastrointestinal encephalomyopathy"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367624"	"05374"	"00484842"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367625"	"05374"	"00484843"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367626"	"05374"	"00484844"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367627"	"00198"	"00484845"	"00006"	"Unknown"	"27y"	"see paper; ..., severe polyneuropathy"	""	""	""	""	""	""	""	""	"severe polyneuropathy"	""
"0000367628"	"05374"	"00484846"	"00006"	"Familial, autosomal recessive"	"29y"	"see paper; ..., chronic intestinal pseudo-obstruction, progressive external ophthalmoplegia, peripheral neuropathy, diffuse leukoencephalopathy."	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367629"	"05374"	"00484847"	"00006"	"Familial, autosomal recessive"	"50y"	"see paper; ..., oropharyngeal dysfunction, early satiety, dysphagia, ophthalmoplegia, proximal/distal paresis arms/legs, areflexia"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial gastrointestinal encephalomyopathy"	""
"0000367630"	"00198"	"00484848"	"00006"	"Unknown"	""	"see paper; ..., 15y-gastrointestinal malabsorption, pain, unsteady gait due to polyneuropathy, ophthalmoplegia, neurogenic EMG, COX-negative muscle fibers."	"15y"	""	""	""	""	""	""	""	"polyneuropathy"	""
"0000367631"	"00198"	"00484849"	"00006"	"Familial, autosomal recessive"	"35y"	"see paper; ..., 8y-chronic diarrhoea, poor weight gain, muscular atrophy; 25y-episodic epigastric pain, recurrent nausea, omiting, muscle aching, cramps, progressive loss of weight"	"08y"	""	""	""	""	""	""	"MTDPS1"	"diarrhoea, poor weight gain"	""
"0000367632"	"00198"	"00484850"	"00006"	"Familial, autosomal recessive"	"67y"	"see paper; ..., late onset of MNGIE, no peripheral neuropathy; 53y-profuse melena due to bleeding small intestine ulcers"	"53y"	""	""	""	""	""	""	"MTDPS1"	""	""
"0000367633"	"00198"	"00484851"	"00006"	"Familial, autosomal recessive"	"18y"	"see paper; ..., postprandial vomiting, weight loss, paresthesia hands"	""	""	""	""	""	""	""	"MTDPS1"	"postprandial vomiting, weight loss, paresthesia hands"	""
"0000367634"	"05374"	"00484852"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367635"	"05374"	"00484853"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367636"	"05374"	"00484854"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367637"	"05374"	"00484855"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367638"	"05374"	"00484856"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367639"	"05374"	"00484857"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367640"	"05374"	"00484858"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367641"	"05374"	"00484859"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367642"	"05374"	"00484860"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367643"	"05374"	"00484861"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367644"	"05374"	"00484862"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367645"	"05374"	"00484863"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367646"	"05374"	"00484864"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367647"	"05374"	"00484865"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367648"	"05374"	"00484866"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367649"	"05374"	"00484867"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367650"	"05374"	"00484868"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367651"	"05374"	"00484869"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367652"	"05374"	"00484870"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367653"	"05374"	"00484871"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367654"	"05374"	"00484872"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367655"	"05374"	"00484873"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367656"	"05374"	"00484874"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367657"	"05374"	"00484875"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367658"	"05374"	"00484876"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367659"	"05374"	"00484877"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367660"	"05374"	"00484878"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367661"	"05374"	"00484879"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367662"	"05374"	"00484880"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367663"	"05374"	"00484881"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367664"	"05374"	"00484882"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367665"	"05374"	"00484883"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367666"	"05374"	"00484884"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367667"	"05374"	"00484885"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367668"	"05374"	"00484886"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367669"	"05374"	"00484887"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367670"	"05374"	"00484888"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367671"	"05374"	"00484889"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367672"	"05374"	"00484890"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367673"	"05374"	"00484891"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367674"	"05374"	"00484892"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367675"	"05374"	"00484893"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367676"	"05374"	"00484894"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367677"	"05374"	"00484895"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367678"	"05374"	"00484896"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367679"	"05374"	"00484897"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367680"	"05374"	"00484898"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367681"	"05374"	"00484899"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367682"	"05374"	"00484900"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367683"	"05374"	"00484901"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367684"	"05374"	"00484902"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367685"	"05374"	"00484903"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367686"	"05374"	"00484904"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367687"	"05374"	"00484905"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367688"	"05374"	"00484906"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367689"	"05374"	"00484907"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367690"	"05374"	"00484908"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367691"	"05374"	"00484909"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367692"	"05374"	"00484910"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367693"	"05374"	"00484911"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367694"	"05374"	"00484912"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367695"	"05374"	"00484913"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367696"	"05374"	"00484914"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367697"	"05374"	"00484915"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367698"	"05374"	"00484916"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367699"	"05374"	"00484917"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367700"	"05374"	"00484918"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367701"	"05374"	"00484919"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367702"	"05374"	"00484920"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367703"	"05374"	"00484921"	"00006"	"Familial, autosomal recessive"	"32y"	"see paper; ..., recurrent vomiting, early satiety, progressive weight loss;ptosis, restricted eye movements, generalized muscle wasting, absent tendon reflexes"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367704"	"05374"	"00484922"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367705"	"05374"	"00484923"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367706"	"05374"	"00484924"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367707"	"05374"	"00484925"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367708"	"05374"	"00484926"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367709"	"05374"	"00484927"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367710"	"00198"	"00484928"	"00006"	"Familial, autosomal recessive"	"24y"	"see paper; ..., 7y-intermittent postprandial vomiting, gastrointestinal dysmotility with alternating episodes of diarrhea/constipation, progressive weight loss; 24y-severe cachexia , numbness extremities all 4 limbs"	""	""	""	""	""	""	""	"MTDPS1"	"vomiting, weight loss"	""
"0000367711"	"00198"	"00484929"	"00006"	"Familial, autosomal recessive"	"29y"	"see paper; ..., 15y-diarrhea, abdominal pains, meteorism"	""	""	""	""	""	""	""	"MTDPS1"	"diarrhea"	""
"0000367712"	"00198"	"00484930"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..., gastrointestinal discomfort, external ophthalmoplegia, pigmentary retinopathy,sensory motor polyneuropathy"	""	""	""	""	""	""	""	"MTDPS1"	"gastrointestinal discomfort"	""
"0000367713"	"00198"	"00484931"	"00006"	"Familial, autosomal recessive"	"14y"	"see paper; ..., chronic vomiting, postprandial abdominal pain, problems gaining weight, cachexia"	""	""	""	""	""	""	""	"MTDPS1"	""	""
"0000367714"	"00198"	"00484932"	"00006"	"Familial, autosomal recessive"	""	"see paper; .."	""	""	""	""	""	""	""	"MTDPS1"	""	""
"0000367715"	"00198"	"00484933"	"00006"	"Familial, autosomal recessive"	"32y"	"see paper; ..., 32y-could not eat; 30y-intermittent episodes of intestinal obstruction"	""	""	""	""	""	""	""	"MTDPS1"	"could not eat"	""
"0000367716"	"00198"	"00484934"	"00006"	"Familial, autosomal recessive"	"16y"	"see paper; ..., 9y-recurrent vomiting, loose stools"	""	""	""	""	""	""	""	"MTDPS1"	"vomiting"	""
"0000367717"	"00198"	"00484935"	"00006"	"Familial, autosomal recessive"	"20y"	"see paper; ..., abdominal pain, recurrent episodes of vomiting/diarrhea, weight loss"	""	""	""	""	""	""	""	"MTDPS1"	"vomiting, diarrhea,"	""
"0000367718"	"00198"	"00484936"	"00006"	"Familial, autosomal recessive"	"16y"	"see paper; ..., hyporexia, weight loss, recurring vomiting, reactive mood disorder; 16y-severe muscular hypotrophy, reduced deep tendon reflexes, claw feet, no intellectual disability; brother sensorineural hearing deficit"	""	""	""	""	""	""	""	"MTDPS1"	"hyporexia, weight loss, vomitin"	""
"0000367719"	"00198"	"00484937"	"00006"	"Familial, autosomal recessive"	"23y"	"see paper; ..."	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalopathy"	""
"0000367720"	"00198"	"00484938"	"00006"	"Familial, autosomal recessive"	"16y"	""	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367721"	"05374"	"00484939"	"00006"	"Familial, autosomal recessive"	"10y"	"see paper; ..., no parenteral nutrition; no history of pseudo-obstruction; no liver disease; no external ophthalmoparesis; mild ptosis; no reflexes; BMI 11.5 ; 10y-haematopoietic stem cell transplantation"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367722"	"05374"	"00484940"	"00006"	"Familial, autosomal recessive"	"21y"	"see paper; ..., parenteral nutrition; history of pseudo-obstruction; liver disease; no external ophthalmoparesis; ptosis; no reflexes upper limbs/lower limbs (weak knee jerks); BMI 14.5 ; 21y-haematopoietic stem cell transplantation"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367723"	"05374"	"00484941"	"00006"	"Familial, autosomal recessive"	"30y"	"see paper; ..., parenteral nutrition; history of pseudo-obstruction; no liver disease; vertical/horizontal external ophthalmoparesis; ptosis; no reflexes; BMI 10; 30y-haematopoietic stem cell transplantation"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367724"	"05374"	"00484942"	"00006"	"Familial, autosomal recessive"	"33y"	"see paper; ..., parenteral nutrition; history of pseudo-obstruction; no liver disease; ptosis; weak reflexes upper limbs, no reflexes lower limbs; BMI 11.1 ; 33y-haematopoietic stem cell transplantation"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367725"	"05374"	"00484943"	"00006"	"Familial, autosomal recessive"	"33y"	"see paper; ..., no parenteral nutrition; no history of pseudo-obstruction; liver disease; vertical/horizontal external ophthalmoparesis; ptosis; normal reflexes upper limbs, no reflexes lower limbs; BMI 13.2 ; 33y-haematopoietic stem cell transplantation"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367726"	"05374"	"00484944"	"00006"	"Familial, autosomal recessive"	"41y"	"see paper; ..., parenteral nutrition; history of pseudo-obstruction; no liver disease; vertical/horizontal external ophthalmoparesis; ptosis; no reflexes; BMI 10.7 ; 41y-haematopoietic stem cell transplantation"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367727"	"05374"	"00484945"	"00006"	"Familial, autosomal recessive"	"25y"	"see paper; ..., no parenteral nutrition; no history of pseudo-obstruction; no liver disease; vertical/horizontal external ophthalmoparesis; no ptosis; Normal; BMI 15.5 ; 25y-haematopoietic stem cell transplantation"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367728"	"05374"	"00484946"	"00006"	"Familial, autosomal recessive"	"27y"	"see paper; ..., no parenteral nutrition; history of pseudo-obstruction; no liver disease; no external ophthalmoparesis; ptosis; normal reflexes upper limbs/lower limbs (ankle jerk absent); BMI 13.5 ; 27y-haematopoietic stem cell transplantation"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367729"	"05374"	"00484947"	"00006"	"Familial, autosomal recessive"	"26y"	"see paper; ..., no parenteral nutrition; no history of pseudo-obstruction; no liver disease; vertical/horizontal external ophthalmoparesis; no ptosis; normal reflexes; BMI 15.3 ; 26y-haematopoietic stem cell transplantation"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367730"	"05374"	"00484948"	"00006"	"Familial, autosomal recessive"	"23y"	"see paper; ..., parenteral nutrition; history of pseudo-obstruction; no liver disease; vertical external ophthalmoparesis; ptosis; no reflexes; BMI 13.2 ; 23y-haematopoietic stem cell transplantation"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367731"	"05374"	"00484949"	"00006"	"Familial, autosomal recessive"	"23y"	"see paper; ..., no parenteral nutrition; no history of pseudo-obstruction; no liver disease; no external ophthalmoparesis; ptosis; no reflexes; BMI 15.8 ; 23y-haematopoietic stem cell transplantation"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367732"	"05374"	"00484950"	"00006"	"Familial, autosomal recessive"	"21y"	"see paper; ..., parenteral nutrition; history of pseudo-obstruction; no liver disease; no external ophthalmoparesis; ptosis; no reflexes; BMI 12.3 ; 21y-haematopoietic stem cell transplantation"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367733"	"05374"	"00484951"	"00006"	"Familial, autosomal recessive"	"16y"	"see paper; ..., no parenteral nutrition; history of pseudo-obstruction; no liver disease; vertical external ophthalmoparesis; ptosis; no reflexes; BMI 13.7 ; 16y-haematopoietic stem cell transplantation"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367734"	"05374"	"00484952"	"00006"	"Familial, autosomal recessive"	"34y"	"see paper; ..., parenteral nutrition; no history of pseudo-obstruction; liver disease; vertical/horizontal external ophthalmoparesis; ptosis; no reflexes; BMI 18; 34y-haematopoietic stem cell transplantation"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367735"	"05374"	"00484953"	"00006"	"Familial, autosomal recessive"	"34y"	"see paper; ..., parenteral nutrition; no history of pseudo-obstruction; no liver disease; horizontal external ophthalmoparesis; ptosis; weak reflexes upper limbs, weak reflexes lower limbs (no ankle jerk); BMI 16.4 ; 34y-haematopoietic stem cell transplantation"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367736"	"05374"	"00484954"	"00006"	"Familial, autosomal recessive"	"22y"	"see paper; ..., parenteral nutrition; history of pseudo-obstruction; no liver disease; vertical/horizontal external ophthalmoparesis; ptosis; no reflexes; BMI 12; 22y-haematopoietic stem cell transplantation"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367737"	"05374"	"00484955"	"00006"	"Familial, autosomal recessive"	"25y"	"see paper; ..., no parenteral nutrition; no history of pseudo-obstruction; no liver disease; vertical/horizontal external ophthalmoparesis; ptosis; no reflexes; BMI 13.6 ; 25y-haematopoietic stem cell transplantation"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367738"	"05374"	"00484956"	"00006"	"Familial, autosomal recessive"	"14y"	"see paper; ..., no parenteral nutrition; no history of pseudo-obstruction; no liver disease; no external ophthalmoparesis; no ptosis; no reflexes upper limbs, weak reflexes lower limbs; BMI 14; 14y-haematopoietic stem cell transplantation"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367739"	"05374"	"00484957"	"00006"	"Familial, autosomal recessive"	"17y"	"see paper; ..., parenteral nutrition; history of pseudo-obstruction; no liver disease; vertical/horizontal external ophthalmoparesis; mild ptosis; weak reflexes; BMI 11.2 ; 17y-haematopoietic stem cell transplantation"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367740"	"05374"	"00484958"	"00006"	"Familial, autosomal recessive"	"29y"	"see paper; ..., no parenteral nutrition; no history of pseudo-obstruction; liver disease; no external ophthalmoparesis; no ptosis; no reflexes; BMI 19; 29y-haematopoietic stem cell transplantation"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367741"	"05374"	"00484959"	"00006"	"Familial, autosomal recessive"	"25y"	"see paper; ..., no parenteral nutrition; no history of pseudo-obstruction; no liver disease; horizontal external ophthalmoparesis; ptosis; weak reflexes; BMI 12.9 ; 25y-haematopoietic stem cell transplantation"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367742"	"05374"	"00484960"	"00006"	"Familial, autosomal recessive"	"35y"	"see paper; ..., parenteral nutrition; history of pseudo-obstruction; liver disease; vertical/horizontal external ophthalmoparesis; ptosis; normal reflexes; BMI 12; 35y-haematopoietic stem cell transplantation"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367743"	"05374"	"00484961"	"00006"	"Familial, autosomal recessive"	"38y"	"see paper; ..., parenteral nutrition; history of pseudo-obstruction; liver disease; external ophthalmoparesis; ptosis; no reflexes; BMI 15; 38y-haematopoietic stem cell transplantation"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367744"	"00198"	"00484962"	"00006"	"Familial, autosomal recessive"	"16y"	"see paper; ..."	""	""	""	""	""	""	""	"MTDPS1"	"neuropathy"	""
"0000367745"	"00198"	"00484963"	"00006"	"Familial, autosomal recessive"	"20y"	"see paper; ..., 11y-vomiting, diarrhea"	"11y"	""	""	""	""	""	""	"MTDPS1"	"vomiting, diarrhea"	""
"0000367746"	"05374"	"00484964"	"00006"	"Familial, autosomal recessive"	"24y"	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367747"	"05374"	"00484965"	"00006"	"Familial, autosomal recessive"	"39y"	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367748"	"05374"	"00484966"	"00006"	"Familial, autosomal recessive"	"33y"	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367749"	"05374"	"00484967"	"00006"	"Familial, autosomal recessive"	"23y"	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367750"	"05374"	"00484968"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367751"	"05374"	"00484969"	"00006"	"Familial, autosomal recessive"	"44y"	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367752"	"05374"	"00484970"	"00006"	"Familial, autosomal recessive"	"30y"	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367753"	"05374"	"00484971"	"00006"	"Familial, autosomal recessive"	"6y"	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367754"	"05374"	"00484972"	"00006"	"Familial, autosomal recessive"	"15y"	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367755"	"05374"	"00484973"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367756"	"05374"	"00484974"	"00006"	"Familial, autosomal recessive"	""	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367757"	"05374"	"00484975"	"00006"	"Familial, autosomal recessive"	"12y"	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""
"0000367758"	"05374"	"00484976"	"00006"	"Familial, autosomal recessive"	"10y"	"no details provided"	""	""	""	""	""	""	""	"MTDPS1"	"mitochondrial neurogastrointestinal encephalomyopathy"	""


## Screenings ## Do not remove or alter this header ##
## Count = 218
"{{id}}"	"{{individualid}}"	"{{variants_found}}"	"{{owned_by}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"	"{{Screening/Technique}}"	"{{Screening/Template}}"	"{{Screening/Tissue}}"	"{{Screening/Remarks}}"
"0000037371"	"00037301"	"1"	"01164"	"00008"	"2015-04-02 13:01:39"	""	""	"SEQ"	"DNA"	""	""
"0000037372"	"00037302"	"1"	"01164"	"00008"	"2015-04-02 13:01:39"	""	""	"SEQ"	"DNA"	""	""
"0000037373"	"00037303"	"1"	"01164"	"00008"	"2015-04-02 13:01:39"	""	""	"SEQ"	"DNA"	""	""
"0000037374"	"00037304"	"1"	"01164"	"00008"	"2015-04-02 13:01:39"	""	""	"SEQ"	"DNA"	""	""
"0000037375"	"00037305"	"1"	"01164"	"00008"	"2015-04-02 13:01:39"	""	""	"SEQ"	"DNA"	""	""
"0000037376"	"00037306"	"1"	"01164"	"00008"	"2015-04-02 13:01:39"	""	""	"SEQ"	"DNA"	""	""
"0000037377"	"00037307"	"1"	"01164"	"00008"	"2015-04-02 13:01:39"	""	""	"SEQ"	"DNA"	""	""
"0000037378"	"00037308"	"1"	"01164"	"00008"	"2015-04-02 13:01:39"	""	""	"SEQ"	"DNA"	""	""
"0000050373"	"00050428"	"1"	"00006"	"00006"	"2015-09-27 16:16:40"	""	""	"SEQ;SEQ-NG-I"	"DNA"	""	""
"0000226677"	"00225598"	"1"	"02551"	"02551"	"2019-02-18 19:07:23"	""	""	"SEQ"	"DNA"	""	""
"0000251294"	"00250187"	"1"	"03387"	"03387"	"2019-08-02 20:45:11"	""	""	"SEQ-NG"	"DNA"	"Blood"	"WES"
"0000251295"	"00250188"	"1"	"03387"	"03387"	"2019-08-02 21:09:59"	"00006"	"2019-08-05 08:56:43"	"SEQ"	"DNA"	""	""
"0000251296"	"00250189"	"1"	"03387"	"03387"	"2019-08-02 21:25:43"	"00006"	"2019-08-05 08:56:43"	"SEQ"	"DNA"	""	""
"0000251297"	"00250190"	"1"	"03387"	"03387"	"2019-08-02 21:30:44"	"00006"	"2019-08-05 08:56:43"	"SEQ"	"DNA"	""	""
"0000294326"	"00293158"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000294327"	"00293159"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000294328"	"00293160"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000297720"	"00296610"	"1"	"00006"	"00006"	"2020-04-08 15:05:07"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000321337"	"00320152"	"1"	"01807"	"01807"	"2020-11-23 17:38:12"	""	""	"SEQ"	"DNA"	""	""
"0000471151"	"00469483"	"1"	"00006"	"00006"	"2025-11-13 13:02:43"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000471152"	"00469484"	"1"	"00006"	"00006"	"2025-11-13 13:02:43"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000474804"	"00473135"	"1"	"00006"	"00006"	"2026-03-06 17:24:40"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000475095"	"00473426"	"1"	"00006"	"00006"	"2026-03-06 17:24:40"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000475114"	"00473445"	"1"	"00006"	"00006"	"2026-03-06 17:24:40"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000478552"	"00476908"	"1"	"00006"	"00006"	"2026-04-20 14:19:26"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000486246"	"00484590"	"1"	"05036"	"05036"	"2026-09-09 10:02:30"	""	""	"SEQ-NG-I"	"DNA"	""	""
"0000486332"	"00484677"	"1"	"00006"	"00006"	"2026-09-11 15:54:57"	""	""	"SEQ"	"DNA"	""	""
"0000486333"	"00484678"	"1"	"00006"	"00006"	"2026-09-11 15:54:57"	""	""	"RT-PCR;SEQ"	"DNA;RNA"	""	""
"0000486334"	"00484679"	"1"	"00006"	"00006"	"2026-09-11 15:54:57"	""	""	"SEQ"	"DNA"	""	""
"0000486335"	"00484680"	"1"	"00006"	"00006"	"2026-09-11 15:54:57"	""	""	"SEQ"	"DNA"	""	""
"0000486336"	"00484681"	"1"	"00006"	"00006"	"2026-09-11 15:54:57"	""	""	"SEQ"	"DNA"	""	""
"0000486337"	"00484682"	"1"	"00006"	"00006"	"2026-09-11 15:54:57"	""	""	"SEQ"	"DNA"	""	""
"0000486338"	"00484683"	"1"	"00006"	"00006"	"2026-09-11 15:54:57"	""	""	"RT-PCR;SEQ"	"DNA;RNA"	""	""
"0000486339"	"00484684"	"1"	"00006"	"00006"	"2026-09-11 15:54:57"	""	""	"SEQ"	"DNA"	""	""
"0000486340"	"00484685"	"1"	"00006"	"00006"	"2026-09-11 15:54:57"	""	""	"SEQ"	"DNA"	""	""
"0000486341"	"00484686"	"1"	"00006"	"00006"	"2026-09-11 15:54:57"	""	""	"SEQ"	"DNA"	""	""
"0000486342"	"00484687"	"1"	"00006"	"00006"	"2026-09-11 15:54:57"	""	""	"SEQ"	"DNA"	""	""
"0000486343"	"00484688"	"1"	"00006"	"00006"	"2026-09-11 15:54:57"	""	""	"SEQ"	"DNA"	""	""
"0000486344"	"00484689"	"1"	"00006"	"00006"	"2026-09-11 16:35:43"	""	""	"SEQ"	"DNA"	""	""
"0000486345"	"00484690"	"1"	"00006"	"00006"	"2026-09-11 16:35:43"	""	""	"SEQ"	"DNA"	""	""
"0000486346"	"00484691"	"1"	"00006"	"00006"	"2026-09-11 16:35:43"	""	""	"SEQ"	"DNA"	""	""
"0000486347"	"00484692"	"1"	"00006"	"00006"	"2026-09-11 16:35:43"	""	""	"SEQ"	"DNA"	""	""
"0000486348"	"00484693"	"1"	"00006"	"00006"	"2026-09-11 16:35:43"	""	""	"SEQ"	"DNA"	""	""
"0000486349"	"00484694"	"1"	"00006"	"00006"	"2026-09-11 16:35:43"	""	""	"SEQ"	"DNA"	""	""
"0000486350"	"00484695"	"1"	"00006"	"00006"	"2026-09-11 16:35:43"	""	""	"SEQ"	"DNA"	""	""
"0000486351"	"00484696"	"1"	"00006"	"00006"	"2026-09-11 16:35:43"	""	""	"SEQ"	"DNA"	""	""
"0000486352"	"00484697"	"1"	"00006"	"00006"	"2026-09-11 16:35:43"	""	""	"SEQ"	"DNA"	""	""
"0000486353"	"00484698"	"1"	"00006"	"00006"	"2026-09-11 16:49:18"	""	""	"SEQ"	"DNA"	""	""
"0000486354"	"00484699"	"1"	"00006"	"00006"	"2026-09-11 17:02:10"	""	""	"RT-PCR;SEQ"	"DNA;RNA"	""	""
"0000486355"	"00484700"	"1"	"00006"	"00006"	"2026-09-11 17:26:39"	""	""	"SEQ"	"DNA"	""	""
"0000486356"	"00484701"	"1"	"00006"	"00006"	"2026-09-11 17:26:39"	""	""	"SEQ"	"DNA"	""	""
"0000486357"	"00484702"	"1"	"00006"	"00006"	"2026-09-11 17:26:39"	""	""	"SEQ"	"DNA"	""	""
"0000486358"	"00484703"	"1"	"00006"	"00006"	"2026-09-11 20:37:15"	""	""	"RT-PCR;SEQ"	"DNA;RNA"	""	""
"0000486359"	"00484704"	"1"	"00006"	"00006"	"2026-09-11 20:58:57"	"00006"	"2026-09-11 21:06:19"	"RT-PCR;SEQ"	"DNA;RNA"	""	""
"0000486360"	"00484705"	"1"	"00006"	"00006"	"2026-09-11 22:23:01"	""	""	"SEQ"	"DNA"	""	""
"0000486361"	"00484706"	"1"	"00006"	"00006"	"2026-09-11 22:23:01"	""	""	"SEQ"	"DNA"	""	""
"0000486362"	"00484707"	"1"	"00006"	"00006"	"2026-09-11 22:23:01"	""	""	"SEQ"	"DNA"	""	""
"0000486363"	"00484708"	"1"	"00006"	"00006"	"2026-09-11 22:23:01"	""	""	"SEQ"	"DNA"	""	""
"0000486364"	"00484709"	"1"	"00006"	"00006"	"2026-09-11 22:23:01"	""	""	"SEQ"	"DNA"	""	""
"0000486365"	"00484710"	"1"	"00006"	"00006"	"2026-09-11 22:23:01"	""	""	"SEQ"	"DNA"	""	""
"0000486462"	"00484807"	"1"	"00006"	"00006"	"2026-09-13 21:18:05"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000486468"	"00484813"	"1"	"00006"	"00006"	"2026-09-13 21:27:50"	""	""	"SEQ"	"DNA"	""	""
"0000486469"	"00484814"	"1"	"00006"	"00006"	"2026-09-14 10:00:53"	""	""	"arrayCGH;SEQ"	"DNA"	""	""
"0000486470"	"00484815"	"1"	"00006"	"00006"	"2026-09-14 10:12:26"	""	""	"arrayCGH;SEQ"	"DNA"	""	""
"0000486471"	"00484816"	"1"	"00006"	"00006"	"2026-09-14 11:20:19"	""	""	"SEQ"	"DNA"	""	""
"0000486478"	"00484824"	"1"	"00006"	"00006"	"2026-09-14 19:25:22"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000486479"	"00484825"	"1"	"00006"	"00006"	"2026-09-14 19:25:22"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000486480"	"00484826"	"1"	"00006"	"00006"	"2026-09-14 19:25:22"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000486481"	"00484827"	"1"	"00006"	"00006"	"2026-09-14 19:25:22"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000486482"	"00484828"	"1"	"00006"	"00006"	"2026-09-14 19:25:22"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000486483"	"00484829"	"1"	"00006"	"00006"	"2026-09-14 19:30:47"	""	""	"SEQ"	"DNA"	""	""
"0000486484"	"00484830"	"1"	"00006"	"00006"	"2026-09-15 08:42:51"	""	""	"SEQ"	"DNA"	""	""
"0000486485"	"00484831"	"1"	"00006"	"00006"	"2026-09-15 08:42:51"	""	""	"SEQ"	"DNA"	""	""
"0000486486"	"00484832"	"1"	"00006"	"00006"	"2026-09-15 08:42:51"	""	""	"SEQ"	"DNA"	""	""
"0000486487"	"00484833"	"1"	"00006"	"00006"	"2026-09-15 08:42:51"	""	""	"SEQ"	"DNA"	""	""
"0000486488"	"00484834"	"1"	"00006"	"00006"	"2026-09-15 08:42:51"	""	""	"SEQ"	"DNA"	""	""
"0000486489"	"00484835"	"1"	"00006"	"00006"	"2026-09-15 08:42:51"	""	""	"SEQ"	"DNA"	""	""
"0000486490"	"00484836"	"1"	"00006"	"00006"	"2026-09-15 08:42:51"	""	""	"SEQ"	"DNA"	""	""
"0000486491"	"00484837"	"1"	"00006"	"00006"	"2026-09-15 08:42:51"	""	""	"SEQ"	"DNA"	""	""
"0000486492"	"00484838"	"1"	"00006"	"00006"	"2026-09-15 08:52:16"	""	""	"SEQ"	"DNA"	""	""
"0000486493"	"00484839"	"1"	"00006"	"00006"	"2026-09-15 08:52:16"	""	""	"SEQ"	"DNA"	""	""
"0000486494"	"00484840"	"1"	"00006"	"00006"	"2026-09-15 08:52:16"	""	""	"SEQ"	"DNA"	""	""
"0000486495"	"00484841"	"1"	"00006"	"00006"	"2026-09-15 08:58:54"	""	""	"SEQ"	"DNA"	""	""
"0000486496"	"00484842"	"1"	"00006"	"00006"	"2026-09-15 09:13:17"	""	""	"SEQ"	"DNA"	""	""
"0000486497"	"00484843"	"1"	"00006"	"00006"	"2026-09-15 09:13:17"	""	""	"SEQ"	"DNA"	""	""
"0000486498"	"00484844"	"1"	"00006"	"00006"	"2026-09-15 09:13:17"	""	""	"SEQ"	"DNA"	""	""
"0000486499"	"00484845"	"1"	"00006"	"00006"	"2026-09-15 09:36:24"	""	""	"SEQ"	"DNA"	""	""
"0000486500"	"00484846"	"1"	"00006"	"00006"	"2026-09-15 09:52:46"	""	""	"SEQ"	"DNA"	""	""
"0000486501"	"00484847"	"1"	"00006"	"00006"	"2026-09-15 13:04:13"	""	""	"SEQ"	"DNA"	""	""
"0000486502"	"00484848"	"1"	"00006"	"00006"	"2026-09-15 13:13:16"	""	""	"SEQ"	"DNA"	""	""
"0000486503"	"00484849"	"1"	"00006"	"00006"	"2026-09-15 13:21:05"	""	""	"SEQ"	"DNA"	""	""
"0000486504"	"00484850"	"1"	"00006"	"00006"	"2026-09-15 13:31:33"	""	""	"SEQ"	"DNA"	""	""
"0000486505"	"00484851"	"1"	"00006"	"00006"	"2026-09-15 13:40:00"	""	""	"SEQ"	"DNA"	""	""
"0000486506"	"00484852"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486507"	"00484853"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486508"	"00484854"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486509"	"00484855"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486510"	"00484856"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486511"	"00484857"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486512"	"00484858"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486513"	"00484859"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486514"	"00484860"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486515"	"00484861"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486516"	"00484862"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486517"	"00484863"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486518"	"00484864"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486519"	"00484865"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486520"	"00484866"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486521"	"00484867"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486522"	"00484868"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486523"	"00484869"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486524"	"00484870"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486525"	"00484871"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486526"	"00484872"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486527"	"00484873"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486528"	"00484874"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486529"	"00484875"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486530"	"00484876"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486531"	"00484877"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486532"	"00484878"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486533"	"00484879"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486534"	"00484880"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486535"	"00484881"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486536"	"00484882"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486537"	"00484883"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486538"	"00484884"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486539"	"00484885"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486540"	"00484886"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486541"	"00484887"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486542"	"00484888"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486543"	"00484889"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486544"	"00484890"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486545"	"00484891"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486546"	"00484892"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486547"	"00484893"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486548"	"00484894"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486549"	"00484895"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486550"	"00484896"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486551"	"00484897"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486552"	"00484898"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486553"	"00484899"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486554"	"00484900"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486555"	"00484901"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486556"	"00484902"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486557"	"00484903"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486558"	"00484904"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486559"	"00484905"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486560"	"00484906"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486561"	"00484907"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486562"	"00484908"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486563"	"00484909"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486564"	"00484910"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486565"	"00484911"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486566"	"00484912"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486567"	"00484913"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486568"	"00484914"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486569"	"00484915"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486570"	"00484916"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486571"	"00484917"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486572"	"00484918"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486573"	"00484919"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486574"	"00484920"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486575"	"00484921"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486576"	"00484922"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486577"	"00484923"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486578"	"00484924"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486579"	"00484925"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486580"	"00484926"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486581"	"00484927"	"1"	"00006"	"00006"	"2026-09-15 15:33:01"	""	""	"SEQ"	"DNA"	""	""
"0000486582"	"00484928"	"1"	"00006"	"00006"	"2026-09-15 15:43:10"	""	""	"SEQ"	"DNA"	""	""
"0000486583"	"00484929"	"1"	"00006"	"00006"	"2026-09-15 15:50:24"	""	""	"SEQ"	"DNA"	""	""
"0000486584"	"00484930"	"1"	"00006"	"00006"	"2026-09-15 15:56:17"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000486585"	"00484931"	"1"	"00006"	"00006"	"2026-09-15 16:03:18"	""	""	"SEQ"	"DNA"	""	""
"0000486586"	"00484932"	"1"	"00006"	"00006"	"2026-09-15 16:12:44"	""	""	"SEQ"	"DNA"	""	""
"0000486587"	"00484933"	"1"	"00006"	"00006"	"2026-09-15 16:17:49"	""	""	"SEQ"	"DNA"	""	""
"0000486589"	"00484934"	"1"	"00006"	"00006"	"2026-09-15 16:22:23"	""	""	"SEQ"	"DNA"	""	""
"0000486590"	"00484935"	"1"	"00006"	"00006"	"2026-09-15 16:29:50"	""	""	"SEQ"	"DNA"	""	""
"0000486591"	"00484936"	"1"	"00006"	"00006"	"2026-09-15 16:39:41"	""	""	"SEQ"	"DNA"	""	""
"0000486592"	"00484937"	"1"	"00006"	"00006"	"2026-09-15 17:11:16"	""	""	"SEQ"	"DNA"	""	""
"0000486593"	"00484938"	"1"	"00006"	"00006"	"2026-09-15 17:16:16"	""	""	"SEQ"	"DNA"	""	""
"0000486594"	"00484939"	"1"	"00006"	"00006"	"2026-09-16 09:47:21"	""	""	"SEQ"	"DNA"	""	""
"0000486595"	"00484940"	"1"	"00006"	"00006"	"2026-09-16 09:47:21"	""	""	"SEQ"	"DNA"	""	""
"0000486596"	"00484941"	"1"	"00006"	"00006"	"2026-09-16 09:47:21"	""	""	"SEQ"	"DNA"	""	""
"0000486597"	"00484942"	"1"	"00006"	"00006"	"2026-09-16 09:47:21"	""	""	"SEQ"	"DNA"	""	""
"0000486598"	"00484943"	"1"	"00006"	"00006"	"2026-09-16 09:47:21"	""	""	"SEQ"	"DNA"	""	""
"0000486599"	"00484944"	"1"	"00006"	"00006"	"2026-09-16 09:47:21"	""	""	"SEQ"	"DNA"	""	""
"0000486600"	"00484945"	"1"	"00006"	"00006"	"2026-09-16 09:47:21"	""	""	"SEQ"	"DNA"	""	""
"0000486601"	"00484946"	"1"	"00006"	"00006"	"2026-09-16 09:47:21"	""	""	"SEQ"	"DNA"	""	""
"0000486602"	"00484947"	"1"	"00006"	"00006"	"2026-09-16 09:47:21"	""	""	"SEQ"	"DNA"	""	""
"0000486603"	"00484948"	"1"	"00006"	"00006"	"2026-09-16 09:47:21"	""	""	"SEQ"	"DNA"	""	""
"0000486604"	"00484949"	"1"	"00006"	"00006"	"2026-09-16 09:47:21"	""	""	"SEQ"	"DNA"	""	""
"0000486605"	"00484950"	"1"	"00006"	"00006"	"2026-09-16 09:47:21"	""	""	"SEQ"	"DNA"	""	""
"0000486606"	"00484951"	"1"	"00006"	"00006"	"2026-09-16 09:47:21"	""	""	"SEQ"	"DNA"	""	""
"0000486607"	"00484952"	"1"	"00006"	"00006"	"2026-09-16 09:47:21"	""	""	"SEQ"	"DNA"	""	""
"0000486608"	"00484953"	"1"	"00006"	"00006"	"2026-09-16 09:47:21"	""	""	"SEQ"	"DNA"	""	""
"0000486609"	"00484954"	"1"	"00006"	"00006"	"2026-09-16 09:47:21"	""	""	"SEQ"	"DNA"	""	""
"0000486610"	"00484955"	"1"	"00006"	"00006"	"2026-09-16 09:47:21"	""	""	"SEQ"	"DNA"	""	""
"0000486611"	"00484956"	"1"	"00006"	"00006"	"2026-09-16 09:47:21"	""	""	"SEQ"	"DNA"	""	""
"0000486612"	"00484957"	"1"	"00006"	"00006"	"2026-09-16 09:47:21"	""	""	"SEQ"	"DNA"	""	""
"0000486613"	"00484958"	"1"	"00006"	"00006"	"2026-09-16 09:47:21"	""	""	"SEQ"	"DNA"	""	""
"0000486614"	"00484959"	"1"	"00006"	"00006"	"2026-09-16 09:47:21"	""	""	"SEQ"	"DNA"	""	""
"0000486615"	"00484960"	"1"	"00006"	"00006"	"2026-09-16 09:47:21"	""	""	"SEQ"	"DNA"	""	""
"0000486616"	"00484961"	"1"	"00006"	"00006"	"2026-09-16 09:47:21"	""	""	"SEQ"	"DNA"	""	""
"0000486617"	"00484962"	"1"	"00006"	"00006"	"2026-09-16 09:57:08"	""	""	"RT-PCR;SEQ"	"DNA;RNA"	""	""
"0000486618"	"00484963"	"1"	"00006"	"00006"	"2026-09-16 10:09:57"	""	""	"SEQ"	"DNA"	""	""
"0000486619"	"00484964"	"1"	"00006"	"00006"	"2026-09-16 11:21:36"	""	""	"SEQ"	"DNA"	""	""
"0000486620"	"00484965"	"1"	"00006"	"00006"	"2026-09-16 11:21:36"	""	""	"SEQ"	"DNA"	""	""
"0000486621"	"00484966"	"1"	"00006"	"00006"	"2026-09-16 11:21:36"	""	""	"SEQ"	"DNA"	""	""
"0000486622"	"00484967"	"1"	"00006"	"00006"	"2026-09-16 11:21:36"	""	""	"SEQ"	"DNA"	""	""
"0000486623"	"00484968"	"1"	"00006"	"00006"	"2026-09-16 11:21:36"	""	""	"SEQ"	"DNA"	""	""
"0000486624"	"00484969"	"1"	"00006"	"00006"	"2026-09-16 11:21:36"	""	""	"SEQ"	"DNA"	""	""
"0000486625"	"00484970"	"1"	"00006"	"00006"	"2026-09-16 11:21:36"	""	""	"SEQ"	"DNA"	""	""
"0000486626"	"00484971"	"1"	"00006"	"00006"	"2026-09-16 11:21:36"	""	""	"SEQ"	"DNA"	""	""
"0000486627"	"00484972"	"1"	"00006"	"00006"	"2026-09-16 11:21:36"	""	""	"SEQ"	"DNA"	""	""
"0000486628"	"00484973"	"1"	"00006"	"00006"	"2026-09-16 11:21:36"	""	""	"SEQ"	"DNA"	""	""
"0000486629"	"00484974"	"1"	"00006"	"00006"	"2026-09-16 11:21:36"	""	""	"SEQ"	"DNA"	""	""
"0000486630"	"00484975"	"1"	"00006"	"00006"	"2026-09-16 11:21:36"	""	""	"SEQ"	"DNA"	""	""
"0000486631"	"00484976"	"1"	"00006"	"00006"	"2026-09-16 11:21:36"	""	""	"SEQ"	"DNA"	""	""


## Screenings_To_Genes ## Do not remove or alter this header ##
## Count = 197
"{{screeningid}}"	"{{geneid}}"
"0000037371"	"TYMP"
"0000037372"	"TYMP"
"0000037373"	"TYMP"
"0000037374"	"TYMP"
"0000037375"	"TYMP"
"0000037376"	"TYMP"
"0000037377"	"TYMP"
"0000037378"	"TYMP"
"0000251294"	"TYMP"
"0000251295"	"TYMP"
"0000251296"	"TYMP"
"0000251297"	"TYMP"
"0000486246"	"TYMP"
"0000486332"	"TYMP"
"0000486333"	"TYMP"
"0000486334"	"TYMP"
"0000486335"	"TYMP"
"0000486336"	"TYMP"
"0000486337"	"TYMP"
"0000486338"	"TYMP"
"0000486339"	"TYMP"
"0000486340"	"TYMP"
"0000486341"	"TYMP"
"0000486342"	"TYMP"
"0000486343"	"TYMP"
"0000486344"	"TYMP"
"0000486345"	"TYMP"
"0000486346"	"TYMP"
"0000486347"	"TYMP"
"0000486348"	"TYMP"
"0000486349"	"TYMP"
"0000486350"	"TYMP"
"0000486351"	"TYMP"
"0000486352"	"TYMP"
"0000486353"	"TYMP"
"0000486354"	"TYMP"
"0000486355"	"TYMP"
"0000486356"	"TYMP"
"0000486357"	"TYMP"
"0000486358"	"TYMP"
"0000486359"	"TYMP"
"0000486360"	"TYMP"
"0000486361"	"TYMP"
"0000486362"	"TYMP"
"0000486363"	"TYMP"
"0000486364"	"TYMP"
"0000486365"	"TYMP"
"0000486468"	"TYMP"
"0000486469"	"TYMP"
"0000486471"	"TYMP"
"0000486483"	"TYMP"
"0000486484"	"TYMP"
"0000486485"	"TYMP"
"0000486486"	"TYMP"
"0000486487"	"TYMP"
"0000486488"	"TYMP"
"0000486489"	"TYMP"
"0000486490"	"TYMP"
"0000486491"	"TYMP"
"0000486492"	"TYMP"
"0000486493"	"TYMP"
"0000486494"	"TYMP"
"0000486495"	"TYMP"
"0000486496"	"TYMP"
"0000486497"	"TYMP"
"0000486498"	"TYMP"
"0000486499"	"TYMP"
"0000486500"	"TYMP"
"0000486501"	"TYMP"
"0000486502"	"TYMP"
"0000486503"	"TYMP"
"0000486504"	"TYMP"
"0000486505"	"TYMP"
"0000486506"	"TYMP"
"0000486507"	"TYMP"
"0000486508"	"TYMP"
"0000486509"	"TYMP"
"0000486510"	"TYMP"
"0000486511"	"TYMP"
"0000486512"	"TYMP"
"0000486513"	"TYMP"
"0000486514"	"TYMP"
"0000486515"	"TYMP"
"0000486516"	"TYMP"
"0000486517"	"TYMP"
"0000486518"	"TYMP"
"0000486519"	"TYMP"
"0000486520"	"TYMP"
"0000486521"	"TYMP"
"0000486522"	"TYMP"
"0000486523"	"TYMP"
"0000486524"	"TYMP"
"0000486525"	"TYMP"
"0000486526"	"TYMP"
"0000486527"	"TYMP"
"0000486528"	"TYMP"
"0000486529"	"TYMP"
"0000486530"	"TYMP"
"0000486531"	"TYMP"
"0000486532"	"TYMP"
"0000486533"	"TYMP"
"0000486534"	"TYMP"
"0000486535"	"TYMP"
"0000486536"	"TYMP"
"0000486537"	"TYMP"
"0000486538"	"TYMP"
"0000486539"	"TYMP"
"0000486540"	"TYMP"
"0000486541"	"TYMP"
"0000486542"	"TYMP"
"0000486543"	"TYMP"
"0000486544"	"TYMP"
"0000486545"	"TYMP"
"0000486546"	"TYMP"
"0000486547"	"TYMP"
"0000486548"	"TYMP"
"0000486549"	"TYMP"
"0000486550"	"TYMP"
"0000486551"	"TYMP"
"0000486552"	"TYMP"
"0000486553"	"TYMP"
"0000486554"	"TYMP"
"0000486555"	"TYMP"
"0000486556"	"TYMP"
"0000486557"	"TYMP"
"0000486558"	"TYMP"
"0000486559"	"TYMP"
"0000486560"	"TYMP"
"0000486561"	"TYMP"
"0000486562"	"TYMP"
"0000486563"	"TYMP"
"0000486564"	"TYMP"
"0000486565"	"TYMP"
"0000486566"	"TYMP"
"0000486567"	"TYMP"
"0000486568"	"TYMP"
"0000486569"	"TYMP"
"0000486570"	"TYMP"
"0000486571"	"TYMP"
"0000486572"	"TYMP"
"0000486573"	"TYMP"
"0000486574"	"TYMP"
"0000486575"	"TYMP"
"0000486576"	"TYMP"
"0000486577"	"TYMP"
"0000486578"	"TYMP"
"0000486579"	"TYMP"
"0000486580"	"TYMP"
"0000486581"	"TYMP"
"0000486582"	"TYMP"
"0000486583"	"TYMP"
"0000486585"	"TYMP"
"0000486586"	"TYMP"
"0000486587"	"TYMP"
"0000486589"	"TYMP"
"0000486590"	"TYMP"
"0000486591"	"TYMP"
"0000486592"	"TYMP"
"0000486593"	"TYMP"
"0000486594"	"TYMP"
"0000486595"	"TYMP"
"0000486596"	"TYMP"
"0000486597"	"TYMP"
"0000486598"	"TYMP"
"0000486599"	"TYMP"
"0000486600"	"TYMP"
"0000486601"	"TYMP"
"0000486602"	"TYMP"
"0000486603"	"TYMP"
"0000486604"	"TYMP"
"0000486605"	"TYMP"
"0000486606"	"TYMP"
"0000486607"	"TYMP"
"0000486608"	"TYMP"
"0000486609"	"TYMP"
"0000486610"	"TYMP"
"0000486611"	"TYMP"
"0000486612"	"TYMP"
"0000486613"	"TYMP"
"0000486614"	"TYMP"
"0000486615"	"TYMP"
"0000486616"	"TYMP"
"0000486617"	"TYMP"
"0000486618"	"TYMP"
"0000486619"	"TYMP"
"0000486620"	"TYMP"
"0000486621"	"TYMP"
"0000486622"	"TYMP"
"0000486623"	"TYMP"
"0000486624"	"TYMP"
"0000486625"	"TYMP"
"0000486626"	"TYMP"
"0000486627"	"TYMP"
"0000486628"	"TYMP"
"0000486629"	"TYMP"
"0000486630"	"TYMP"
"0000486631"	"TYMP"


## Variants_On_Genome ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Count = 323
"{{id}}"	"{{allele}}"	"{{effectid}}"	"{{chromosome}}"	"{{position_g_start}}"	"{{position_g_end}}"	"{{type}}"	"{{average_frequency}}"	"{{owned_by}}"	"{{VariantOnGenome/DBID}}"	"{{VariantOnGenome/DNA}}"	"{{VariantOnGenome/Frequency}}"	"{{VariantOnGenome/Reference}}"	"{{VariantOnGenome/Restriction_site}}"	"{{VariantOnGenome/Published_as}}"	"{{VariantOnGenome/Remarks}}"	"{{VariantOnGenome/Genetic_origin}}"	"{{VariantOnGenome/Segregation}}"	"{{VariantOnGenome/dbSNP}}"	"{{VariantOnGenome/VIP}}"	"{{VariantOnGenome/Methylation}}"	"{{VariantOnGenome/ISCN}}"	"{{VariantOnGenome/DNA/hg38}}"	"{{VariantOnGenome/ClinVar}}"	"{{VariantOnGenome/ClinicalClassification}}"	"{{VariantOnGenome/ClinicalClassification/Method}}"
"0000064496"	"1"	"90"	"22"	"50967768"	"50967768"	"subst"	"1.22669E-5"	"01164"	"TYMP_000001"	"g.50967768C>G"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.50529339C>G"	""	"pathogenic"	""
"0000064497"	"1"	"90"	"22"	"50964571"	"50964571"	"subst"	"0"	"01164"	"TYMP_000005"	"g.50964571C>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526142C>T"	""	"pathogenic"	""
"0000064498"	"1"	"10"	"22"	"50964446"	"50964446"	"subst"	"0.111923"	"01164"	"TYMP_000004"	"g.50964446A>T"	""	""	""	""	"c.1284T>A"	"Germline"	""	"rs1138404"	"0"	""	""	"g.50526017A>T"	""	"benign"	""
"0000064499"	"1"	"50"	"22"	"50965674"	"50965674"	"subst"	"0"	"01164"	"TYMP_000008"	"g.50965674C>G"	""	""	""	""	"Alamut: probalbly damaging (PSIC: 0,759)"	"Germline"	""	""	"0"	""	""	"g.50527245C>G"	""	"VUS"	""
"0000064500"	"1"	"50"	"22"	"50964905"	"50964905"	"subst"	"0"	"01164"	"TYMP_000007"	"g.50964905C>T"	""	""	""	""	"c.929G>A,p.Gly310Glu; Polyphen-2: probably damaging (PSIC:1,920)"	"Germline"	""	""	"0"	""	""	"g.50526476C>T"	""	"VUS"	""
"0000064501"	"1"	"90"	"22"	"50967000"	"50967000"	"subst"	"8.12618E-6"	"01164"	"TYMP_000002"	"g.50967000C>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.50528571C>T"	""	"pathogenic"	""
"0000064502"	"1"	"90"	"22"	"50964786"	"50964786"	"subst"	"0"	"01164"	"TYMP_000006"	"g.50964786G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526357G>A"	""	"pathogenic"	""
"0000064503"	"1"	"50"	"22"	"50964163"	"50964163"	"subst"	"0"	"01164"	"TYMP_000003"	"g.50964163G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.50525734G>A"	""	"VUS"	""
"0000079353"	"0"	"90"	"22"	"47182944"	"51666786"	"del"	"0"	"00006"	"ALG12_000022"	"g.47182944_51666786del"	""	"{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}"	""	""	"mosaicism, hemizygous in 0.56 cells"	"Somatic"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000298038"	"0"	"10"	"22"	"50964255"	"50964255"	"subst"	"0.0459774"	"02325"	"TYMP_000058"	"g.50964255C>T"	""	""	""	"SCO2(NM_001169109.2):c.-14+420G>A, TYMP(NM_001113755.2):c.1393G>A (p.(Ala465Thr))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.50525826C>T"	""	"benign"	""
"0000298039"	"0"	"10"	"22"	"50964236"	"50964236"	"subst"	"0.127677"	"02325"	"TYMP_000057"	"g.50964236G>A"	""	""	""	"SCO2(NM_001169109.1):c.-14+439C>T, SCO2(NM_001169109.2):c.-14+439C>T, TYMP(NM_001953.5):c.1412C>T (p.S471L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.50525807G>A"	""	"benign"	""
"0000298040"	"0"	"10"	"22"	"50964862"	"50964862"	"subst"	"0.61063"	"02325"	"TYMP_000062"	"g.50964862G>A"	""	""	""	"SCO2(NM_001169109.2):c.-201C>T, TYMP(NM_001113756.3):c.972C>T (p.A324=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.50526433G>A"	""	"benign"	""
"0000329128"	"0"	"50"	"22"	"50964435"	"50964435"	"subst"	"0.000593336"	"01804"	"TYMP_000059"	"g.50964435C>T"	""	""	""	"TYMP(NM_001257988.1):c.1295G>A (p.(Arg432His))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.50526006C>T"	""	"VUS"	""
"0000329130"	"0"	"30"	"22"	"50964599"	"50964599"	"subst"	"0.0371603"	"01804"	"TYMP_000061"	"g.50964599G>C"	""	""	""	"TYMP(NM_001113755.2):c.1160-29C>G (p.(=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.50526170G>C"	""	"likely benign"	""
"0000329131"	"0"	"30"	"22"	"50964913"	"50964916"	"del"	"0"	"01804"	"TYMP_000009"	"g.50964913_50964916del"	""	""	""	"TYMP(NM_001113755.2):c.929-6_929-3del (p.?)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.50526484_50526487del"	""	"likely benign"	""
"0000329135"	"0"	"30"	"22"	"50967912"	"50967912"	"subst"	"0.00909369"	"01804"	"TYMP_000012"	"g.50967912C>T"	""	""	""	"TYMP(NM_001113755.2):c.214+13G>A (p.(=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.50529483C>T"	""	"likely benign"	""
"0000459017"	"3"	"70"	"22"	"50964906"	"50964906"	"subst"	"0"	"02551"	"TYMP_000013"	"g.50964906C>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526477C>T"	""	"likely pathogenic"	""
"0000572397"	"0"	"10"	"22"	"50964446"	"50964446"	"subst"	"0.111923"	"02327"	"TYMP_000004"	"g.50964446A>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.50526017A>T"	""	"benign"	""
"0000572398"	"0"	"10"	"22"	"50964862"	"50964862"	"subst"	"0.61063"	"02327"	"TYMP_000062"	"g.50964862G>A"	""	""	""	"SCO2(NM_001169109.2):c.-201C>T, TYMP(NM_001113756.3):c.972C>T (p.A324=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.50526433G>A"	""	"benign"	""
"0000572399"	"0"	"30"	"22"	"50967740"	"50967740"	"subst"	"0.00130046"	"01943"	"TYMP_000063"	"g.50967740C>T"	""	""	""	"TYMP(NM_001113755.2):c.242G>A (p.(Arg81Gln)), TYMP(NM_001113756.2):c.242G>A (p.R81Q)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.50529311C>T"	""	"likely benign"	""
"0000572400"	"0"	"30"	"22"	"50967740"	"50967740"	"subst"	"0.00130046"	"01804"	"TYMP_000063"	"g.50967740C>T"	""	""	""	"TYMP(NM_001113755.2):c.242G>A (p.(Arg81Gln)), TYMP(NM_001113756.2):c.242G>A (p.R81Q)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.50529311C>T"	""	"likely benign"	""
"0000572401"	"0"	"30"	"22"	"50967945"	"50967945"	"subst"	"0.000521745"	"01804"	"TYMP_000065"	"g.50967945C>T"	""	""	""	"TYMP(NM_001113755.2):c.194G>A (p.(Ser65Asn))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.50529516C>T"	""	"likely benign"	""
"0000572402"	"0"	"30"	"22"	"50968109"	"50968109"	"subst"	"3.78097E-5"	"01804"	"TYMP_000064"	"g.50968109C>T"	""	""	""	"TYMP(NM_001113755.2):c.30G>A (p.(Gly10=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.50529680C>T"	""	"likely benign"	""
"0000580727"	"21"	"90"	"22"	"50965067"	"50965067"	"subst"	"4.87632E-5"	"03387"	"TYMP_000014"	"g.50965067T>G"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526638T>G"	""	"pathogenic (recessive)"	""
"0000580728"	"0"	"90"	"22"	"50965706"	"50965706"	"subst"	"0"	"03387"	"TYMP_000015"	"g.50965706A>C"	""	""	""	""	""	"De novo"	""	""	"0"	""	""	"g.50527277A>C"	""	"pathogenic (recessive)"	""
"0000580729"	"3"	"90"	"22"	"50966939"	"50966939"	"subst"	"0"	"03387"	"TYMP_000016"	"g.50966939A>T"	""	""	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.50528510A>T"	""	"pathogenic (recessive)"	""
"0000580730"	"3"	"90"	"22"	"50967924"	"50967924"	"subst"	"0"	"03387"	"TYMP_000017"	"g.50967924C>A"	""	""	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.50529495C>A"	""	"pathogenic (recessive)"	""
"0000580731"	"3"	"90"	"22"	"50967768"	"50967768"	"subst"	"1.22669E-5"	"03387"	"TYMP_000001"	"g.50967768C>G"	""	""	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.50529339C>G"	""	"pathogenic (recessive)"	""
"0000618647"	"0"	"10"	"22"	"50964255"	"50964255"	"subst"	"0.0459774"	"02327"	"TYMP_000058"	"g.50964255C>T"	""	""	""	"SCO2(NM_001169109.2):c.-14+420G>A, TYMP(NM_001113755.2):c.1393G>A (p.(Ala465Thr))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.50525826C>T"	""	"benign"	""
"0000624334"	"0"	"30"	"22"	"50965683"	"50965683"	"subst"	"0.000150457"	"01943"	"TYMP_000028"	"g.50965683C>T"	""	""	""	"TYMP(NM_001113755.2):c.676G>A (p.(Gly226Arg)), TYMP(NM_001113756.2):c.676G>A (p.G226R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.50527254C>T"	""	"likely benign"	""
"0000651015"	"1"	"70"	"22"	"50965038"	"50965038"	"subst"	"0"	"03575"	"TYMP_000018"	"g.50965038G>T"	"1/2788 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"1 heterozygous, no homozygous; {DB:CLININrs863224252}"	"Germline"	""	"rs863224252"	"0"	""	""	"g.50526609G>T"	""	"likely pathogenic"	""
"0000651016"	"1"	"50"	"22"	"50967020"	"50967020"	"subst"	"0.000309094"	"03575"	"TYMP_000019"	"g.50967020C>T"	"5/2795 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"conflicting interpretations of pathogenicity; 5 heterozygous, no homozygous; {DB:CLININrs188802138}"	"Germline"	""	"rs188802138"	"0"	""	""	"g.50528591C>T"	""	"VUS"	""
"0000651017"	"1"	"70"	"22"	"50967627"	"50967627"	"subst"	"0"	"03575"	"TYMP_000020"	"g.50967627C>T"	"1/2794 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"1 heterozygous, no homozygous; {DB:CLININrs786205559}"	"Germline"	""	"rs786205559"	"0"	""	""	"g.50529198C>T"	""	"likely pathogenic"	""
"0000658983"	"0"	"30"	"22"	"50966144"	"50966144"	"subst"	"0.000377818"	"01943"	"TYMP_000029"	"g.50966144C>T"	""	""	""	"TYMP(NM_001113756.2):c.519G>A (p.M173I)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.50527715C>T"	""	"likely benign"	""
"0000660329"	"0"	"50"	"22"	"50967740"	"50967740"	"subst"	"0.00130046"	"00006"	"TYMP_000063"	"g.50967740C>T"	""	"{PMID:Taylor 2014:25058219}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50529311C>T"	""	"VUS"	""
"0000681938"	"0"	"30"	"22"	"50964440"	"50964440"	"subst"	"4.0793E-5"	"01943"	"TYMP_000030"	"g.50964440C>T"	""	""	""	"TYMP(NM_001113756.2):c.1290G>A (p.R430=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.50526011C>T"	""	"likely benign"	""
"0000681939"	"0"	"30"	"22"	"50967688"	"50967688"	"subst"	"4.07325E-6"	"01943"	"TYMP_000031"	"g.50967688C>T"	""	""	""	"TYMP(NM_001113756.2):c.294G>A (p.S98=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.50529259C>T"	""	"likely benign"	""
"0000704166"	"3"	"90"	"22"	"50964889"	"50964889"	"subst"	"0"	"01807"	"TYMP_000021"	"g.50964889C>T"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.50526460C>T"	""	"pathogenic"	""
"0000728228"	"0"	"30"	"22"	"50965624"	"50965624"	"subst"	"0.00275506"	"01943"	"TYMP_000032"	"g.50965624C>T"	""	""	""	"TYMP(NM_001113756.2):c.735G>A (p.Q245=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.50527195C>T"	""	"likely benign"	""
"0000856203"	"0"	"30"	"22"	"50964236"	"50964236"	"subst"	"0.127677"	"02326"	"TYMP_000057"	"g.50964236G>A"	""	""	""	"SCO2(NM_001169109.1):c.-14+439C>T, SCO2(NM_001169109.2):c.-14+439C>T, TYMP(NM_001953.5):c.1412C>T (p.S471L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.50525807G>A"	""	"likely benign"	""
"0000856204"	"0"	"30"	"22"	"50966963"	"50966963"	"subst"	"1.21886E-5"	"01943"	"TYMP_000037"	"g.50966963T>C"	""	""	""	"TYMP(NM_001113756.2):c.494A>G (p.N165S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.50528534T>C"	""	"likely benign"	""
"0000856205"	"0"	"30"	"22"	"50968078"	"50968078"	"subst"	"0"	"01943"	"TYMP_000039"	"g.50968078C>G"	""	""	""	"TYMP(NM_001113756.2):c.61G>C (p.E21Q)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.50529649C>G"	""	"likely benign"	""
"0000866907"	"0"	"30"	"22"	"50964255"	"50964255"	"subst"	"0.0459774"	"01804"	"TYMP_000058"	"g.50964255C>T"	""	""	""	"SCO2(NM_001169109.2):c.-14+420G>A, TYMP(NM_001113755.2):c.1393G>A (p.(Ala465Thr))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.50525826C>T"	""	"likely benign"	""
"0000866908"	"0"	"30"	"22"	"50964554"	"50964554"	"subst"	"0.000216035"	"01804"	"TYMP_000033"	"g.50964554G>A"	""	""	""	"TYMP(NM_001113755.2):c.1176C>T (p.(Val392=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.50526125G>A"	""	"likely benign"	""
"0000866909"	"0"	"30"	"22"	"50965102"	"50965102"	"subst"	"0.00801596"	"01804"	"TYMP_000034"	"g.50965102C>T"	""	""	""	"TYMP(NM_001113755.2):c.831G>A (p.(Leu277=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.50526673C>T"	""	"likely benign"	""
"0000866910"	"0"	"90"	"22"	"50966041"	"50966041"	"subst"	"0.000333111"	"01804"	"TYMP_000035"	"g.50966041C>T"	""	""	""	"TYMP(NM_001113755.2):c.622G>A (p.(Val208Met))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.50527612C>T"	""	"pathogenic"	""
"0000866911"	"0"	"50"	"22"	"50966121"	"50966121"	"subst"	"1.21853E-5"	"01804"	"TYMP_000036"	"g.50966121C>T"	""	""	""	"TYMP(NM_001113755.2):c.542G>A (p.(Gly181Asp))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.50527692C>T"	""	"VUS"	""
"0000866912"	"0"	"50"	"22"	"50967908"	"50967908"	"subst"	"0"	"01804"	"TYMP_000038"	"g.50967908C>T"	""	""	""	"TYMP(NM_001113755.2):c.214+17G>A (p.(=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.50529479C>T"	""	"VUS"	""
"0000895819"	"0"	"50"	"22"	"50964222"	"50964222"	"subst"	"0"	"01804"	"TYMP_000040"	"g.50964222G>C"	""	""	""	"TYMP(NM_001113755.2):c.1426C>G (p.(Leu476Val))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.50525793G>C"	""	"VUS"	""
"0000895820"	"0"	"50"	"22"	"50964699"	"50964701"	"del"	"0"	"01804"	"TYMP_000041"	"g.50964699_50964701del"	""	""	""	"TYMP(NM_001113755.2):c.1138_1140del (p.(Glu380del))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.50526270_50526272del"	""	"VUS"	""
"0000915567"	"0"	"30"	"22"	"50964995"	"50964995"	"dup"	"0"	"01804"	"TYMP_000042"	"g.50964995dup"	""	""	""	"TYMP(NM_001113755.2):c.928+10dup (p.(=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.50526566dup"	""	"likely benign"	""
"0000927225"	"0"	"50"	"22"	"50964675"	"50964675"	"subst"	"0"	"02325"	"TYMP_000043"	"g.50964675C>T"	""	""	""	"TYMP(NM_001953.5):c.1159G>A (p.G387S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.50526246C>T"	""	"VUS"	""
"0000931317"	"0"	"30"	"22"	"50964859"	"50964859"	"subst"	"0"	"01804"	"TYMP_000044"	"g.50964859C>T"	""	""	""	"TYMP(NM_001257988.1):c.975G>A (p.(=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.50526430C>T"	""	"likely benign"	""
"0000931318"	"0"	"30"	"22"	"50965597"	"50965597"	"subst"	"1.22171E-5"	"01804"	"TYMP_000045"	"g.50965597C>T"	""	""	""	"TYMP(NM_001113755.2):c.762G>A (p.(Thr254=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.50527168C>T"	""	"likely benign"	""
"0000931319"	"0"	"70"	"22"	"50968129"	"50968129"	"del"	"0"	"01804"	"TYMP_000022"	"g.50968129del"	""	""	""	"TYMP(NM_001257988.1):c.11del (p.(Leu4Ter))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.50529700del"	""	"likely pathogenic"	""
"0000951639"	"0"	"50"	"22"	"50964725"	"50964725"	"subst"	"0"	"01804"	"TYMP_000046"	"g.50964725T>C"	""	""	""	"TYMP(NM_001113755.2):c.1109A>G (p.(Gln370Arg))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.50526296T>C"	""	"VUS"	""
"0000951640"	"0"	"30"	"22"	"50965683"	"50965683"	"subst"	"0.000150457"	"01804"	"TYMP_000028"	"g.50965683C>T"	""	""	""	"TYMP(NM_001113755.2):c.676G>A (p.(Gly226Arg)), TYMP(NM_001113756.2):c.676G>A (p.G226R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.50527254C>T"	""	"likely benign"	""
"0000970543"	"0"	"10"	"22"	"50967935"	"50967935"	"subst"	"0.00409759"	"01804"	"TYMP_000047"	"g.50967935G>A"	""	""	""	"TYMP(NM_001113755.2):c.204C>T (p.(Gly68=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.50529506G>A"	""	"benign"	""
"0000970544"	"0"	"30"	"22"	"50968184"	"50968184"	"subst"	"0.000291976"	"01804"	"TYMP_000048"	"g.50968184C>A"	""	""	""	"TYMP(NM_001113755.2):c.-22-24G>T (p.(=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.50529755C>A"	""	"likely benign"	""
"0000984317"	"0"	"30"	"22"	"50966962"	"50966962"	"subst"	"9.34503E-5"	"01804"	"TYMP_000049"	"g.50966962A>G"	""	""	""	"TYMP(NM_001953.5):c.495T>C (p.(Asn165=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.50528533A>G"	""	"likely benign"	""
"0001006258"	"0"	"50"	"22"	"50965623"	"50965623"	"subst"	"2.0348E-5"	"01804"	"TYMP_000050"	"g.50965623C>T"	""	""	""	"TYMP(NM_001113755.2):c.736G>A (p.(Glu246Lys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.50527194C>T"	""	"VUS"	""
"0001006259"	"0"	"30"	"22"	"50966925"	"50966925"	"subst"	"0"	"01804"	"TYMP_000051"	"g.50966925C>T"	""	""	""	"TYMP(NM_001113755.2):c.516+16G>A (p.(=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.50528496C>T"	""	"likely benign"	""
"0001015961"	"0"	"30"	"22"	"50964760"	"50964760"	"subst"	"0.000176541"	"01804"	"TYMP_000052"	"g.50964760T>C"	""	""	""	"TYMP(NM_001113755.2):c.1074A>G (p.(Arg358=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.50526331T>C"	""	"likely benign"	""
"0001027416"	"0"	"30"	"22"	"50964596"	"50964596"	"subst"	"0"	"01804"	"TYMP_000053"	"g.50964596C>T"	""	""	""	"TYMP(NM_001257988.1):c.1160-26G>A (p.(=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.50526167C>T"	""	"likely benign"	""
"0001046830"	"0"	"90"	"22"	"50965067"	"50965067"	"subst"	"4.87632E-5"	"01804"	"TYMP_000014"	"g.50965067T>G"	""	""	""	"TYMP(NM_001113755.2):c.866A>C (p.(Glu289Ala))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.50526638T>G"	""	"pathogenic"	""
"0001059273"	"0"	"90"	"22"	"50966041"	"50966041"	"subst"	"0.000333111"	"00006"	"TYMP_000035"	"g.50966041C>T"	""	"{PMID:Retterer 2016:26633542}"	""	""	"variants reported seperately, unknown if mono-allelic or bi-allelic"	"Unknown"	""	""	"0"	""	""	"g.50527612C>T"	""	"pathogenic"	""
"0001059274"	"0"	"70"	"22"	"50967591"	"50967591"	"subst"	"0"	"00006"	"TYMP_000023"	"g.50967591G>T"	""	"{PMID:Retterer 2016:26633542}"	""	""	"variants reported seperately, unknown if mono-allelic or bi-allelic"	"Unknown"	""	""	"0"	""	""	"g.50529162G>T"	""	"likely pathogenic"	""
"0001067562"	"0"	"30"	"22"	"50964657"	"50964657"	"subst"	"0.0001874"	"01804"	"TYMP_000054"	"g.50964657G>T"	""	""	""	"TYMP(NM_001113755.2):c.1159+18C>A (p.(=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.50526228G>T"	""	"likely benign"	""
"0001067563"	"0"	"50"	"22"	"50964731"	"50964731"	"subst"	"0"	"01804"	"TYMP_000055"	"g.50964731C>T"	""	""	""	"TYMP(NM_001953.5):c.1103G>A (p.(Arg368His))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.50526302C>T"	""	"VUS"	""
"0001067564"	"0"	"50"	"22"	"50968092"	"50968092"	"subst"	"8.29958E-6"	"01804"	"TYMP_000056"	"g.50968092C>G"	""	""	""	"TYMP(NM_001113755.2):c.47G>C (p.(Gly16Ala))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.50529663C>G"	""	"VUS"	""
"0001069202"	"3"	"90"	"22"	"50967747"	"50967747"	"subst"	"0"	"00006"	"TYMP_000026"	"g.50967747G>A"	""	"{PMID:Molaei 2025:41315541}"	""	""	"ACMG PM2, PVS1, PP5, PP4"	"Germline"	""	""	"0"	""	""	"g.50529318G>A"	"SCV006075352"	"pathogenic"	"ACMG"
"0001069491"	"3"	"70"	"22"	"50967640"	"50967640"	"subst"	"0"	"00006"	"TYMP_000025"	"g.50967640G>C"	""	"{PMID:Molaei 2025:41315541}"	""	""	"ACMG PM3_str, PP3, PM2, PM5, PP2, PP5"	"Germline"	""	""	"0"	""	""	"g.50529211G>C"	"SCV006075351"	"likely pathogenic"	"ACMG"
"0001069510"	"3"	"50"	"22"	"50966109"	"50966109"	"subst"	"0"	"00006"	"TYMP_000024"	"g.50966109A>T"	""	"{PMID:Molaei 2025:41315541}"	""	""	"ACMG PM2, PP3_mod"	"Germline"	""	""	"0"	""	""	"g.50527680A>T"	"SCV006075350"	"VUS"	"ACMG"
"0001074283"	"3"	"70"	"22"	"50967627"	"50967627"	"subst"	"0"	"00006"	"TYMP_000020"	"g.50967627C>T"	""	"{PMID:Alhammad 2024:39232665}"	""	"NM_001257988.1"	""	"Germline"	""	""	"0"	""	""	"g.50529198C>T"	""	"likely pathogenic (recessive)"	""
"0001089084"	"3"	"90"	"22"	"50964543"	"50964543"	"subst"	"0"	"05036"	"TYMP_000027"	"g.50964543G>A"	""	""	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.50526114G>A"	""	"VUS"	"ACMG"
"0001089254"	"3"	"90"	"22"	"50965067"	"50965067"	"subst"	"0"	"00006"	"chr22_003309"	"g.50965067T>C"	""	"{PMID:Nishino 1999:9924029}, {PMID:Nishino 2000:10852545}"	""	"A3371C (E289A)"	"multiple mtDNA deletions"	"Germline"	""	""	"0"	""	""	"g.50526638T>C"	""	"pathogenic (recessive)"	""
"0001089255"	"1"	"90"	"22"	"50966939"	"50966939"	"subst"	"0"	"00006"	"chr22_003310"	"g.50966939A>G"	""	"{PMID:Nishino 1999:9924029}, {PMID:Nishino 2000:10852545}"	""	"t1504c"	"multiple mtDNA deletions"	"Germline"	""	""	"0"	""	""	"g.50528510A>G"	""	"pathogenic (recessive)"	""
"0001089256"	"3"	"90"	"22"	"50967024"	"50967024"	"subst"	"2.03426E-5"	"00006"	"chr22_003311"	"g.50967024C>T"	""	"{PMID:Nishino 1999:9924029}, {PMID:Nishino 2000:10852545}"	""	"G1419A (G145R)"	"multiple mtDNA deletions"	"Germline"	""	""	"0"	""	""	"g.50528595C>T"	""	"pathogenic (recessive)"	""
"0001089257"	"1"	"90"	"22"	"50965694"	"50965694"	"subst"	"1.62696E-5"	"00006"	"chr22_003312"	"g.50965694T>C"	""	"{PMID:Nishino 1999:9924029}, {PMID:Nishino 2000:10852545}"	""	"A2744G (K222S)"	"multiple mtDNA deletions"	"Germline"	""	""	"0"	""	""	"g.50527265T>C"	""	"pathogenic (recessive)"	""
"0001089258"	"3"	"90"	"22"	"50967024"	"50967024"	"subst"	"2.03426E-5"	"00006"	"chr22_003311"	"g.50967024C>T"	""	"{PMID:Nishino 1999:9924029}, {PMID:Nishino 2000:10852545}"	""	"G1419A (G145R)"	""	"Germline"	""	""	"0"	""	""	"g.50528595C>T"	""	"pathogenic (recessive)"	""
"0001089259"	"3"	"90"	"22"	"50967024"	"50967024"	"subst"	"2.03426E-5"	"00006"	"chr22_003311"	"g.50967024C>T"	""	"{PMID:Nishino 1999:9924029}, {PMID:Nishino 2000:10852545}"	""	"G1419A (G145R)"	"multiple mtDNA deletions"	"Germline"	""	""	"0"	""	""	"g.50528595C>T"	""	"pathogenic (recessive)"	""
"0001089260"	"1"	"90"	"22"	"50965067"	"50965067"	"subst"	"0"	"00006"	"chr22_003309"	"g.50965067T>C"	""	"{PMID:Nishino 1999:9924029}, {PMID:Nishino 2000:10852545}"	""	"A3371C (E289A)"	"multiple mtDNA deletions"	"Germline"	""	""	"0"	""	""	"g.50526638T>C"	""	"pathogenic (recessive)"	""
"0001089261"	"0"	"90"	"22"	"50967024"	"50967024"	"subst"	"2.03426E-5"	"00006"	"chr22_003311"	"g.50967024C>T"	""	"{PMID:Nishino 1999:9924029}, {PMID:Nishino 2000:10852545}"	""	"G1419A (G145R)"	"no multiple mtDNA deletions"	"Germline"	""	""	"0"	""	""	"g.50528595C>T"	""	"pathogenic (recessive)"	""
"0001089262"	"0"	"90"	"22"	"50964538"	"50964543"	"del"	"0"	"00006"	"chr22_003313"	"g.50964538_50964543del"	""	"{PMID:Nishino 1999:9924029}, {PMID:Nishino 2000:10852545}"	""	"3895–3900 (loss L397/A398)"	"no multiple mtDNA deletions"	"Germline"	""	""	"0"	""	""	"g.50526109_50526114del"	""	"pathogenic (recessive)"	""
"0001089263"	"0"	"90"	"22"	"50967000"	"50967000"	"subst"	"8.12618E-6"	"00006"	"TYMP_000002"	"g.50967000C>T"	""	"{PMID:Nishino 1999:9924029}, {PMID:Nishino 2000:10852545}"	""	"G1443A (G153S)"	"multiple mtDNA deletions"	"Germline"	""	""	"0"	""	""	"g.50528571C>T"	""	"pathogenic (recessive)"	""
"0001089264"	"0"	"90"	"22"	"50967000"	"50967000"	"subst"	"8.12618E-6"	"00006"	"TYMP_000002"	"g.50967000C>T"	""	"{PMID:Nishino 1999:9924029}, {PMID:Nishino 2000:10852545}"	""	"G1443A (G153S)"	""	"Germline"	""	""	"0"	""	""	"g.50528571C>T"	""	"pathogenic (recessive)"	""
"0001089265"	"3"	"90"	"22"	"50967000"	"50967000"	"subst"	"8.12618E-6"	"00006"	"TYMP_000002"	"g.50967000C>T"	""	"{PMID:Nishino 1999:9924029}, {PMID:Nishino 2000:10852545}"	""	"G1443A (G153S)"	""	"Germline"	""	""	"0"	""	""	"g.50528571C>T"	""	"pathogenic (recessive)"	""
"0001089266"	"2"	"90"	"22"	"50965067"	"50965067"	"subst"	"0"	"00006"	"chr22_003309"	"g.50965067T>C"	""	"{PMID:Nishino 1999:9924029}, {PMID:Nishino 2000:10852545}"	""	"A3371C (E289A)"	"multiple mtDNA deletions"	"Germline"	""	""	"0"	""	""	"g.50526638T>C"	""	"pathogenic (recessive)"	""
"0001089267"	"2"	"90"	"22"	"50964242"	"50964242"	"dup"	"0"	"00006"	"chr22_003314"	"g.50964242dup"	""	"{PMID:Nishino 1999:9924029}, {PMID:Nishino 2000:10852545}"	""	"ins4196C"	"multiple mtDNA deletions"	"Germline"	""	""	"0"	""	""	"g.50525813dup"	""	"pathogenic (recessive)"	""
"0001089268"	"2"	"90"	"22"	"50964571"	"50964571"	"subst"	"0"	"00006"	"chr22_003315"	"g.50964571C>G"	""	"{PMID:Nishino 1999:9924029}, {PMID:Nishino 2000:10852545}"	""	"G3867C (loss 47 aa)"	"multiple mtDNA deletions"	"Germline"	""	""	"0"	""	""	"g.50526142C>G"	""	"pathogenic (recessive)"	""
"0001089269"	"0"	"70"	"22"	"50964913"	"50964916"	"del"	"0"	"00006"	"TYMP_000009"	"g.50964913_50964916del"	""	"{PMID:Nishino 1999:9924029}, {PMID:Nishino 2000:10852545}"	""	"3527–3530del"	"no multiple mtDNA deletions"	"Germline"	""	""	"0"	""	""	"g.50526484_50526487del"	""	"likely pathogenic (recessive)"	""
"0001089270"	"0"	"90"	"22"	"50964348"	"50964348"	"subst"	"0"	"00006"	"chr22_003316"	"g.50964348C>T"	""	"{PMID:Nishino 1999:9924029}, {PMID:Nishino 2000:10852545}"	""	"g4090a?"	"no multiple mtDNA deletions"	"Germline"	""	""	"0"	""	""	"g.50525919C>T"	""	"pathogenic (recessive)"	""
"0001089271"	"0"	"90"	"22"	"50965067"	"50965067"	"subst"	"0"	"00006"	"chr22_003309"	"g.50965067T>C"	""	"{PMID:Nishino 1999:9924029}, {PMID:Nishino 2000:10852545}"	""	"A3371C (E289A)"	"multiple mtDNA deletions"	"Germline"	""	""	"0"	""	""	"g.50526638T>C"	""	"pathogenic (recessive)"	""
"0001089272"	"0"	"90"	"22"	"50965067"	"50965067"	"subst"	"0"	"00006"	"chr22_003309"	"g.50965067T>C"	""	"{PMID:Nishino 1999:9924029}, {PMID:Nishino 2000:10852545}"	""	"A3371C (E289A)"	""	"Germline"	""	""	"0"	""	""	"g.50526638T>C"	""	"pathogenic (recessive)"	""
"0001089273"	"3"	"90"	"22"	"50964571"	"50964571"	"subst"	"0"	"00006"	"TYMP_000005"	"g.50964571C>T"	""	"{PMID:Nishino 2000:9924029}"	""	"G3867A (loss 47 aa)"	""	"Germline"	""	""	"0"	""	""	"g.50526638T>C"	""	"pathogenic (recessive)"	""
"0001089274"	"1"	"90"	"22"	"50965068"	"50965068"	"subst"	"0"	"00006"	"chr22_003317"	"g.50965068C>T"	""	"{PMID:Nishino 2000:9924029}"	""	"G3370A (E289K)"	""	"Germline"	""	""	"0"	""	""	"g.50526639C>T"	""	"pathogenic (recessive)"	""
"0001089275"	"3"	"90"	"22"	"50965067"	"50965067"	"subst"	"0"	"00006"	"chr22_003309"	"g.50965067T>C"	""	"{PMID:Nishino 2000:9924029}"	""	"A3371C (E289A)"	""	"Germline"	""	""	"0"	""	""	"g.50526638T>C"	""	"pathogenic (recessive)"	""
"0001089276"	"3"	"90"	"22"	"50966979"	"50966979"	"subst"	"0"	"00006"	"chr22_003318"	"g.50966979A>G"	""	"{PMID:Nishino 2000:9924029}"	""	"T1464C (S160P)"	""	"Germline"	""	""	"0"	""	""	"g.50528550A>G"	""	"pathogenic (recessive)"	""
"0001089277"	"3"	"90"	"22"	"50964571"	"50964571"	"subst"	"0"	"00006"	"TYMP_000005"	"g.50964571C>T"	""	"{PMID:Nishino 2000:9924029}"	""	"G3867A (loss 47 aa)"	""	"Germline"	""	""	"0"	""	""	"g.50526638T>C"	""	"pathogenic (recessive)"	""
"0001089278"	"3"	"90"	"22"	"50966145"	"50966145"	"subst"	"0"	"00006"	"chr22_003319"	"g.50966145A>C"	""	"{PMID:Nishino 2000:9924029}"	""	"T2293G (M173G)"	""	"Germline"	""	""	"0"	""	""	"g.50527716A>C"	""	"pathogenic (recessive)"	""
"0001089279"	"3"	"90"	"22"	"50964237"	"50964237"	"subst"	"0"	"00006"	"chr22_003320"	"g.50964237A>G"	""	"{PMID:Nishino 2000:9924029}"	""	"C4202T (S471L)"	""	"Germline"	""	""	"0"	""	""	"g.50525808A>G"	""	"pathogenic (recessive)"	""
"0001089280"	"3"	"90"	"22"	"50968087"	"50968088"	"del"	"0"	"00006"	"TYMP_000077"	"g.50968087_50968088del"	""	"{PMID:Nishino 2000:9924029}, {PMID:Poulton 2009:19748572}"	""	"2bp del, 51_52delCT"	""	"Germline"	""	""	"0"	""	""	"g.50529658_50529659del"	""	"pathogenic (recessive)"	""
"0001089281"	"3"	"90"	"22"	"50964571"	"50964571"	"subst"	"0"	"00006"	"TYMP_000005"	"g.50964571C>T"	""	"{PMID:Nishino 2000:9924029}"	""	"G3867A (loss 47 aa)"	""	"Germline"	""	""	"0"	""	""	"g.50526638T>C"	""	"pathogenic (recessive)"	""
"0001089282"	"2"	"90"	"22"	"50964237"	"50964237"	"subst"	"0"	"00006"	"chr22_003320"	"g.50964237A>G"	""	"{PMID:Nishino 2000:9924029}"	""	"C4202T (S471L)"	""	"Germline"	""	""	"0"	""	""	"g.50525808A>G"	""	"pathogenic (recessive)"	""
"0001089283"	"3"	"90"	"22"	"50968008"	"50968008"	"subst"	"0"	"00006"	"TYMP_000066"	"g.50968008C>T"	""	"{PMID:Gamez 2002:12177387}"	""	"G435A"	""	"Germline"	"yes"	""	"0"	""	""	"g.50529579C>T"	""	"pathogenic (recessive)"	""
"0001089284"	"3"	"90"	"22"	"50967768"	"50967768"	"subst"	"1.22669E-5"	"00006"	"TYMP_000001"	"g.50967768C>G"	""	"{PMID:Szigeti 2004:14757860}"	""	"IVS1-1G>C"	""	"Germline"	""	""	"0"	""	""	"g.50529339C>G"	""	"pathogenic (recessive)"	""
"0001089285"	"1"	"90"	"22"	"50966041"	"50966041"	"subst"	"0.000333111"	"00006"	"TYMP_000035"	"g.50966041C>T"	""	"{PMID:Marti 2005:16178026}"	""	"G2398A (V208M)"	""	"Germline"	""	""	"0"	""	""	"g.50527612C>T"	""	"pathogenic (recessive)"	""
"0001089286"	"2"	"90"	"22"	"50964903"	"50964903"	"subst"	"1.24629E-5"	"00006"	"TYMP_000067"	"g.50964903C>G"	""	"{PMID:Marti 2005:16178026}"	""	"G3535C (G311R)"	""	"Germline"	""	""	"0"	""	""	"g.50526474C>G"	""	"pathogenic (recessive)"	""
"0001089287"	"2"	"90"	"22"	"50966058"	"50966058"	"subst"	"0"	"00006"	"TYMP_000068"	"g.50966058C>G"	""	"{PMID:Marti 2005:16178026}"	""	"G2381C (R202T)"	""	"Germline"	""	""	"0"	""	""	"g.50527629C>G"	""	"pathogenic (recessive)"	""
"0001089288"	"1"	"90"	"22"	"50966041"	"50966041"	"subst"	"0.000333111"	"00006"	"TYMP_000035"	"g.50966041C>T"	""	"{PMID:Marti 2005:16178026}"	""	"G2398A (V208M)"	""	"Germline"	""	""	"0"	""	""	"g.50527612C>T"	""	"pathogenic (recessive)"	""
"0001089289"	"0"	"90"	"22"	"50967000"	"50967000"	"subst"	"8.12618E-6"	"00006"	"TYMP_000002"	"g.50967000C>T"	""	"{PMID:Marti 2005:16178026}"	""	"G1443A (G153S)"	""	"Germline"	""	""	"0"	""	""	"g.50528571C>T"	""	"pathogenic (recessive)"	""
"0001089290"	"0"	"90"	"22"	"50965079"	"50965079"	"subst"	"0"	"00006"	"TYMP_000069"	"g.50965079A>G"	""	"{PMID:Marti 2005:16178026}"	""	"T3359C (L285P)"	""	"Germline"	""	""	"0"	""	""	"g.50526650A>G"	""	"pathogenic (recessive)"	""
"0001089291"	"10"	"90"	"22"	"50964538"	"50964543"	"del"	"0"	"00006"	"TYMP_000070"	"g.50964538_50964543del"	""	"{PMID:Ginsberg 2007:17239807}"	""	"3901-3906del6"	""	"Germline"	""	""	"0"	""	""	"g.50526109_50526114del"	""	"pathogenic (recessive)"	""
"0001089292"	"21"	"90"	"22"	"50967768"	"50967768"	"subst"	"1.22669E-5"	"00006"	"TYMP_000001"	"g.50967768C>G"	""	"{PMID:Ginsberg 2007:17239807}"	""	"675G>C (IVS2), NM_001257988.1:r.-45_417del"	"sequence Fig.4 differs from reference (wrong labels nucleotides)"	"Germline"	""	""	"0"	""	""	"g.50529339C>G"	""	"pathogenic (recessive)"	""
"0001089293"	"21"	"90"	"22"	"50967768"	"50967768"	"subst"	"1.22669E-5"	"00006"	"TYMP_000001"	"g.50967768C>G"	""	"{PMID:Taanman 2009:19056268}"	""	"675G>C"	""	"Germline"	""	""	"0"	""	""	"g.50529339C>G"	""	"pathogenic (recessive)"	""
"0001089294"	"11"	"90"	"22"	"50964429"	"50964429"	"subst"	"0"	"00006"	"TYMP_000089"	"g.50964429C>T"	""	"{PMID:Taanman 2009:19056268}"	""	"4009G>A"	""	"Germline"	""	""	"0"	""	""	"g.50526000C>T"	""	"pathogenic (recessive)"	""
"0001089295"	"3"	"30"	"22"	"50964543"	"50964554"	"del"	"0"	"00006"	"chr22_003321"	"g.50964543_50964554del"	""	"{PMID:Mojtabavi 2021:33825174}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526114_50526125del"	""	"likely benign"	""
"0001089296"	"3"	"30"	"22"	"50964543"	"50964554"	"del"	"0"	"00006"	"chr22_003321"	"g.50964543_50964554del"	""	"{PMID:Mojtabavi 2021:33825174}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526114_50526125del"	""	"likely benign"	""
"0001089297"	"3"	"70"	"22"	"50965132"	"50965135"	"dup"	"0"	"00006"	"chr22_003322"	"g.50965132_50965135dup"	""	"{PMID:Mojtabavi 2021:33825174}"	""	"801_802insCGCG"	""	"Germline"	""	""	"0"	""	""	"g.50526703_50526706dup"	""	"likely pathogenic (recessive)"	""
"0001089298"	"3"	"90"	"22"	"50964821"	"50964821"	"subst"	"0"	"00006"	"chr22_003323"	"g.50964821G>T"	""	"{PMID:Mojtabavi 2021:33825174}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526392G>T"	""	"pathogenic (recessive)"	""
"0001089299"	"3"	"50"	"22"	"50967637"	"50967637"	"subst"	"0"	"00006"	"chr22_003324"	"g.50967637C>A"	""	"{PMID:Mojtabavi 2021:33825174}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50529208C>A"	""	"VUS"	""
"0001089300"	"3"	"90"	"22"	"50968009"	"50968009"	"subst"	"0"	"00006"	"chr22_003325"	"g.50968009G>A"	""	"{PMID:Mojtabavi 2021:33825174}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50529580G>A"	""	"pathogenic (recessive)"	""
"0001089397"	"3"	"90"	"22"	"50964833"	"50964833"	"subst"	"8.80266E-6"	"00006"	"chr22_003326"	"g.50964833A>C"	""	"{PMID:Bychkov 2021:33486010}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526404A>C"	""	"pathogenic (recessive)"	""
"0001089459"	"1"	"90"	"22"	"50967581"	"50967581"	"subst"	"0"	"00006"	"TYMP_000072"	"g.50967581G>T"	""	"{PMID:Patel 2019:30646848}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50529152G>T"	""	"pathogenic (recessive)"	""
"0001089460"	"2"	"90"	"22"	"50965088"	"50965088"	"subst"	"6.77176E-6"	"00006"	"TYMP_000073"	"g.50965088C>T"	""	"{PMID:Patel 2019:30646848}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526659C>T"	""	"pathogenic (recessive)"	""
"0001089462"	"11"	"90"	"22"	"50929092"	"51016098"	"del"	"0"	"00006"	"TYMP_000074"	"g.(?_50929092)_(51016098_?)del"	""	"{PMID:Vondrackova 2014:23838601}"	""	""	"87-kb deletion spanning eight genes (LMF2, NCAPH2, SCO2, TYMP, ODF3B, KLHDC7B, c22orf41, CPT1B), known CNV (0.004)"	"Germline"	""	""	"0"	""	"hg18 Chr.22:g.(49275958_49362964)del"	"g.(?_50490663)_(50577669_?)del"	""	"pathogenic (recessive)"	""
"0001089465"	"21"	"90"	"22"	"50929092"	"51104142"	"del"	"0"	"00006"	"TYMP_000075"	"g.(?_50929092)_(51104142_?)del"	""	"{PMID:Vondrackova 2014:23838601}"	""	""	"175-kb deletion spanning 12 genes (LMF2, NCAPH2, SCO2, TYMP, ODF3B, KLHDC7B, c22orf41, CPT1B, CHKB, LOC100144603, MAPKIP2, ARSA); known CNV (0.07) in controls"	"Germline"	""	""	"0"	""	"hg18 Chr.22:g.[49275958_49451008)del"	"g.(?_50490663)_(50665713_?)del"	""	"pathogenic (recessive)"	""
"0001089466"	"11"	"90"	"22"	"50967721"	"50967721"	"subst"	"0"	"00006"	"TYMP_000076"	"g.50967721C>A"	""	"{PMID:Vondrackova 2014:23838601}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50529292C>A"	""	"pathogenic (recessive)"	""
"0001089468"	"3"	"90"	"22"	"50968042"	"50968042"	"dup"	"0"	"00006"	"TYMP_000078"	"g.50968042dup"	""	"{PMID:Kintarak 2007:17544574}"	""	"100insC"	""	"Germline"	""	""	"0"	""	""	"g.50529613dup"	""	"pathogenic (recessive)"	""
"0001089478"	"3"	"90"	"22"	"50964255"	"50964255"	"subst"	"0.0459774"	"00006"	"TYMP_000058"	"g.50964255C>T"	""	"{PMID:Kocaefe 2003:12529715}"	""	"G5629A (A465T)"	""	"Germline"	""	""	"0"	""	""	"g.50525826C>T"	""	"pathogenic (recessive)"	""
"0001089479"	"3"	"90"	"22"	"50964571"	"50964571"	"subst"	"0"	"00006"	"TYMP_000005"	"g.50964571C>T"	""	"{PMID:Kocaefe 2003:12529715}"	""	"g5314a"	""	"Germline"	""	""	"0"	""	""	"g.50526142C>T"	""	"pathogenic (recessive)"	""
"0001089480"	"3"	"90"	"22"	"50964722"	"50964722"	"subst"	"0"	"00006"	"chr22_003327"	"g.50964722A>G"	""	"{PMID:Kocaefe 2003:12529715}"	""	"T5162C (L371P)"	""	"Germline"	""	""	"0"	""	""	"g.50526293A>G"	""	"pathogenic (recessive)"	""
"0001089481"	"1"	"90"	"22"	"50964431"	"50964431"	"subst"	"0"	"00006"	"chr22_003328"	"g.50964431A>T"	""	"{PMID:Kocaefe 2003:12529715}"	""	"T5453A"	"suggested splice site variant"	"Germline"	""	""	"0"	""	""	"g.50526002A>T"	""	"pathogenic (recessive)"	""
"0001089482"	"3"	"90"	"22"	"50964722"	"50964722"	"subst"	"0"	"00006"	"chr22_003327"	"g.50964722A>G"	""	"{PMID:Kocaefe 2003:12529715}"	""	"T5162C (L371P)"	""	"Germline"	""	""	"0"	""	""	"g.50526293A>G"	""	"pathogenic (recessive)"	""
"0001089483"	"2"	"90"	"22"	"50967977"	"50967977"	"subst"	"0"	"00006"	"chr22_003329"	"g.50967977G>C"	""	"{PMID:Kocaefe 2003:12529715}"	""	"C1912G (I54M)"	""	"Germline"	""	""	"0"	""	""	"g.50529548G>C"	""	"pathogenic (recessive)"	""
"0001089484"	"1"	"90"	"22"	"50967754"	"50967754"	"subst"	"0"	"00006"	"TYMP_000079"	"g.50967754C>T"	""	"{PMID:Martin 2004:15505189}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50529325C>T"	""	"pathogenic (recessive)"	""
"0001089485"	"2"	"50"	"22"	"50965086"	"50965086"	"subst"	"0"	"00006"	"TYMP_000080"	"g.50965086G>C"	""	"{PMID:Martin 2004:15505189}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526657G>C"	""	"VUS"	""
"0001089486"	"2"	"90"	"22"	"50964337"	"50964337"	"subst"	"0"	"00006"	"TYMP_000081"	"g.50964337C>T"	""	"{PMID:Martin 2004:15505189}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50525908C>T"	""	"pathogenic (recessive)"	""
"0001089487"	"2"	"10"	"22"	"50964255"	"50964255"	"subst"	"0.0459774"	"00006"	"TYMP_000058"	"g.50964255C>T"	""	"{PMID:Martin 2004:15505189}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50525826C>T"	""	"benign"	""
"0001089488"	"3"	"10"	"22"	"0"	"0"	""	""	"00006"	"TYMP_000000"	"g.?"	""	"{PMID:Kocaefe 2003:12529715}"	""	"T5022C"	""	"Germline"	""	""	"0"	""	""	"g.?"	""	"benign"	""
"0001089489"	"3"	"10"	"22"	"50964446"	"50964446"	"subst"	"0.111923"	"00006"	"TYMP_000004"	"g.50964446A>T"	""	"{PMID:Kocaefe 2003:12529715}"	""	"T5438A"	""	"Germline"	""	""	"0"	""	""	"g.50526017A>T"	""	"benign"	""
"0001089490"	"21"	"90"	"22"	"50966990"	"50966990"	"subst"	"0"	"00006"	"TYMP_000084"	"g.50966990T>C"	""	"{PMID:Slama 2005:15781193}, {PMID:Said 2005:15742109}"	""	"g.1453A>G"	""	"Germline"	""	""	"0"	""	""	"g.50528561T>C"	""	"pathogenic (recessive)"	""
"0001089491"	"21"	"90"	"22"	"50965067"	"50965067"	"subst"	"4.87632E-5"	"00006"	"TYMP_000014"	"g.50965067T>G"	""	"{PMID:Slama 2005:15781193}, {PMID:Said 2005:15742109}"	""	"g.3371A>C"	""	"Germline"	""	""	"0"	""	""	"g.50526638T>G"	""	"pathogenic (recessive)"	""
"0001089492"	"1"	"90"	"22"	"50967721"	"50967721"	"subst"	"4.07199E-6"	"00006"	"chr22_003331"	"g.50967721C>G"	""	"{PMID:Slama 2005:15781193}"	""	"g.722G>C"	""	"Germline"	""	""	"0"	""	""	"g.50529292C>G"	""	"pathogenic (recessive)"	""
"0001089493"	"1"	"90"	"22"	"50965067"	"50965067"	"subst"	"4.87632E-5"	"00006"	"TYMP_000014"	"g.50965067T>G"	""	"{PMID:Slama 2005:15781193}"	""	"g.3371A>C"	""	"Germline"	""	""	"0"	""	""	"g.50526638T>G"	""	"pathogenic (recessive)"	""
"0001089494"	"3"	"90"	"22"	"50967642"	"50967642"	"subst"	"8.14312E-6"	"00006"	"chr22_003332"	"g.50967642C>T"	""	"{PMID:Slama 2005:15781193}"	""	"g.801G>A"	""	"Germline"	"yes"	""	"0"	""	""	"g.50529213C>T"	""	"pathogenic (recessive)"	""
"0001089495"	"3"	"90"	"22"	"50965067"	"50965067"	"subst"	"4.87632E-5"	"00006"	"TYMP_000014"	"g.50965067T>G"	""	"{PMID:Slama 2005:15781193}"	""	"g.3371A>C"	""	"Germline"	""	""	"0"	""	""	"g.50526638T>G"	""	"pathogenic (recessive)"	""
"0001089496"	"3"	"90"	"22"	"50964571"	"50964571"	"subst"	"0"	"00006"	"TYMP_000005"	"g.50964571C>T"	""	"{PMID:Slama 2005:15781193}"	""	"g.3867G>A"	""	"Germline"	"yes"	""	"0"	""	""	"g.50526142C>T"	""	"pathogenic (recessive)"	""
"0001089497"	"1"	"90"	"22"	"50965077"	"50965077"	"subst"	"0"	"00006"	"TYMP_000085"	"g.50965077C>T"	""	"{PMID:Slama 2005:15781193}, {PMID:Said 2005:15742109}"	""	"g.3361G>A"	""	"Germline"	""	""	"0"	""	""	"g.50526648C>T"	""	"pathogenic (recessive)"	""
"0001089498"	"11"	"90"	"22"	"50966133"	"50966133"	"subst"	"0"	"00006"	"TYMP_000083"	"g.50966133A>G"	""	"{PMID:Slama 2005:15781193}, {PMID:Said 2005:15742109}"	""	"g.2306T>C"	""	"Germline"	""	""	"0"	""	""	"g.50527704A>G"	""	"pathogenic (recessive)"	""
"0001089499"	"11"	"90"	"22"	"50964570"	"50964570"	"subst"	"0"	"00006"	"TYMP_000086"	"g.50964570C>T"	""	"{PMID:Slama 2005:15781193}, {PMID:Said 2005:15742109}"	""	"g.3868G>A"	""	"Germline"	""	""	"0"	""	""	"g.50526141C>T"	""	"pathogenic (recessive)"	""
"0001089500"	"2"	"90"	"22"	"50965150"	"50965150"	"del"	"0"	"00006"	"chr22_003336"	"g.50965150del"	""	"{PMID:Slama 2005:15781193}"	""	"g.2799delC"	""	"Germline"	""	""	"0"	""	""	"g.50526721del"	""	"pathogenic (recessive)"	""
"0001089501"	"2"	"90"	"22"	"50965004"	"50965004"	"subst"	"0"	"00006"	"chr22_003337"	"g.50965004C>T"	""	"{PMID:Slama 2005:15781193}"	""	"g.3434G>A"	""	"Germline"	""	""	"0"	""	""	"g.50526575C>T"	""	"pathogenic (recessive)"	""
"0001089502"	"2"	"90"	"22"	"50965067"	"50965067"	"subst"	"4.87632E-5"	"00006"	"TYMP_000014"	"g.50965067T>G"	""	"{PMID:Slama 2005:15781193}, {PMID:Said 2005:15742109}"	""	"g.3371A>C"	""	"Germline"	""	""	"0"	""	""	"g.50526638T>G"	""	"pathogenic (recessive)"	""
"0001089503"	"3"	"90"	"22"	"50967707"	"50967707"	"subst"	"0"	"00006"	"chr22_003338"	"g.50967707G>T"	""	"{PMID:Schupbach 2007:17294068}"	""	"g.2182C>A (T92N)"	""	"Germline"	"yes"	""	"0"	""	""	"g.50529278G>T"	""	"pathogenic (recessive)"	""
"0001089504"	"3"	"90"	"22"	"50967707"	"50967707"	"subst"	"0"	"00006"	"chr22_003338"	"g.50967707G>T"	""	"{PMID:Schupbach 2007:17294068}"	""	"g.2182C>A (T92N)"	""	"Germline"	"yes"	""	"0"	""	""	"g.50529278G>T"	""	"pathogenic (recessive)"	""
"0001089505"	"3"	"90"	"22"	"50967707"	"50967707"	"subst"	"0"	"00006"	"chr22_003338"	"g.50967707G>T"	""	"{PMID:Schupbach 2007:17294068}"	""	"g.2182C>A (T92N)"	""	"Germline"	"yes"	""	"0"	""	""	"g.50529278G>T"	""	"pathogenic (recessive)"	""
"0001089506"	"3"	"90"	"22"	"50967584"	"50967584"	"subst"	"0"	"00006"	"TYMP_000082"	"g.50967584A>G"	""	"{PMID:Monroy 2008:18280229}"	""	"2305T>C (Leu133Pro)"	""	"Germline"	"yes"	""	"0"	""	""	"g.50529155A>G"	""	"pathogenic (recessive)"	""
"0001089507"	"0"	"90"	"22"	"50966058"	"50966058"	"subst"	"4.0619E-6"	"00006"	"chr22_003339"	"g.50966058C>T"	""	"{PMID:Poulton 2009:19748572}"	""	""	"variant reported (Horvath, Czermin pers.comm), no details provided"	"Germline"	""	""	"0"	""	""	"g.50527629C>T"	""	"pathogenic"	""
"0001089508"	"0"	"90"	"22"	"50964748"	"50964748"	"del"	"0"	"00006"	"chr22_003340"	"g.50964748del"	""	"{PMID:Poulton 2009:19748572}"	""	"1088delG"	"variant reported (Hernandez pers.comm), no details provided"	"Germline"	""	""	"0"	""	""	"g.50526319del"	""	"pathogenic"	""
"0001089509"	"0"	"90"	"22"	"50964218"	"50964218"	"dup"	"0"	"00006"	"chr22_003341"	"g.50964218dup"	""	"{PMID:Poulton 2009:19748572}"	""	"1431dupT"	"variant reported (Hernandez, Poulton pers.comm), no details provided"	"Germline"	""	""	"0"	""	""	"g.50525789dup"	""	"pathogenic"	""
"0001089511"	"21"	"90"	"22"	"50965652"	"50965652"	"subst"	"0"	"00006"	"TYMP_000087"	"g.50965652A>G"	""	"{PMID:Said 2005:15742109}"	""	"Phe236Ser"	"no variant 2nd chromosome identified"	"Germline"	""	""	"0"	""	""	"g.50527223A>G"	""	"pathogenic (recessive)"	""
"0001089512"	"3"	"90"	"22"	"50964824"	"50964841"	"dup"	"0"	"00006"	"TYMP_000088"	"g.50964824_50964841dup"	""	"{PMID:Gamez 2005:15607208}"	""	"5044–5061dupGCGGCGCTGGACGACGGC"	""	"Germline"	""	""	"0"	""	""	"g.50526395_50526412dup"	""	"pathogenic (recessive)"	""
"0001089518"	"3"	"90"	"22"	"50964305"	"50964324"	"del"	"0"	"00006"	"TYMP_000090"	"g.50964305_50964324del"	""	"{PMID:Blazquez 2005:16198108}"	""	"1460_1479delGACGGCCCCGCGCTCAGCGG"	""	"Germline"	""	""	"0"	""	""	"g.50525876_50525895del"	""	"pathogenic (recessive)"	""
"0001089519"	"3"	"70"	"22"	"50964255"	"50964255"	"subst"	"0.0459774"	"00006"	"TYMP_000058"	"g.50964255C>T"	""	"{PMID:Vissing 2002:12297582}"	""	"1393G>A (A465T)"	"variant found in 0.06 (3/50) control alleles"	"Germline"	"yes"	""	"0"	""	""	"g.50525826C>T"	""	"VUS (!)"	""
"0001089520"	"3"	"90"	"22"	"50964236"	"50964236"	"subst"	"4.40218E-6"	"00006"	"TYMP_000091"	"g.50964236G>T"	""	"{PMID:Carod-Artal 2007:17437622}"	""	"C4202A (S471X)"	""	"Germline"	""	""	"0"	""	""	"g.50525807G>T"	""	"pathogenic (recessive)"	""
"0001089521"	"21"	"90"	"22"	"50964699"	"50964699"	"subst"	"0"	"00006"	"TYMP_000092"	"g.50964699C>T"	""	"{PMID:Massa 2009:19853446}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526270C>T"	""	"pathogenic (recessive)"	""
"0001089522"	"10"	"90"	"22"	"50964571"	"50964571"	"subst"	"0"	"00006"	"TYMP_000005"	"g.50964571C>T"	""	"{PMID:Massa 2009:19853446}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526142C>T"	""	"pathogenic (recessive)"	""
"0001089523"	"3"	"90"	"22"	"50968027"	"50968027"	"subst"	"4.09574E-6"	"00006"	"TYMP_000093"	"g.50968027C>A"	""	"{PMID:Baris 2010:20585803}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50529598C>A"	""	"pathogenic (recessive)"	""
"0001089526"	"3"	"90"	"22"	"50965067"	"50965067"	"subst"	"4.87632E-5"	"00006"	"TYMP_000014"	"g.50965067T>G"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526638T>G"	""	"pathogenic (recessive)"	""
"0001089527"	"3"	"90"	"22"	"50965067"	"50965067"	"subst"	"4.87632E-5"	"00006"	"TYMP_000014"	"g.50965067T>G"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526638T>G"	""	"pathogenic (recessive)"	""
"0001089528"	"3"	"90"	"22"	"50965067"	"50965067"	"subst"	"4.87632E-5"	"00006"	"TYMP_000014"	"g.50965067T>G"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526638T>G"	""	"pathogenic (recessive)"	""
"0001089529"	"3"	"90"	"22"	"50965067"	"50965067"	"subst"	"4.87632E-5"	"00006"	"TYMP_000014"	"g.50965067T>G"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526638T>G"	""	"pathogenic (recessive)"	""
"0001089530"	"3"	"90"	"22"	"50967581"	"50967581"	"subst"	"0"	"00006"	"TYMP_000072"	"g.50967581G>T"	""	"{PMID:Garone 2011:21933806}"	""	"3371C>A"	""	"Germline"	""	""	"0"	""	""	"g.50529152G>T"	""	"pathogenic (recessive)"	""
"0001089531"	"3"	"90"	"22"	"50967000"	"50967000"	"subst"	"8.12618E-6"	"00006"	"TYMP_000002"	"g.50967000C>T"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50528571C>T"	""	"pathogenic (recessive)"	""
"0001089532"	"3"	"90"	"22"	"0"	"0"	""	""	"00006"	"LARGE_000000"	"g.?"	""	"{PMID:Garone 2011:21933806}"	""	"522T>A"	""	"Germline"	""	""	"0"	""	""	"g.?"	""	"pathogenic (recessive)"	""
"0001089533"	"3"	"90"	"22"	"50967654"	"50967654"	"subst"	"0"	"00006"	"chr22_003342"	"g.50967654G>A"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50529225G>A"	""	"pathogenic (recessive)"	""
"0001089534"	"3"	"90"	"22"	"50964571"	"50964571"	"subst"	"0"	"00006"	"TYMP_000005"	"g.50964571C>T"	""	"{PMID:Garone 2011:21933806}"	""	"IVS9-1G>A"	""	"Germline"	""	""	"0"	""	""	"g.50526142C>T"	""	"pathogenic (recessive)"	""
"0001089535"	"3"	"90"	"22"	"50964571"	"50964571"	"subst"	"0"	"00006"	"TYMP_000005"	"g.50964571C>T"	""	"{PMID:Garone 2011:21933806}"	""	"IVS9-1G>A"	""	"Germline"	""	""	"0"	""	""	"g.50526142C>T"	""	"pathogenic (recessive)"	""
"0001089536"	"3"	"90"	"22"	"50964571"	"50964571"	"subst"	"0"	"00006"	"TYMP_000005"	"g.50964571C>T"	""	"{PMID:Garone 2011:21933806}"	""	"IVS9-1G>A"	""	"Germline"	""	""	"0"	""	""	"g.50526142C>T"	""	"pathogenic (recessive)"	""
"0001089537"	"3"	"90"	"22"	"50964572"	"50964572"	"subst"	"0"	"00006"	"chr22_003343"	"g.50964572T>C"	""	"{PMID:Garone 2011:21933806}"	""	"IVS9-2A>G"	""	"Germline"	""	""	"0"	""	""	"g.50526143T>C"	""	"pathogenic (recessive)"	""
"0001089538"	"1"	"90"	"22"	"50964572"	"50964572"	"subst"	"0"	"00006"	"chr22_003343"	"g.50964572T>C"	""	"{PMID:Garone 2011:21933806}"	""	"IVS9-2A>G"	""	"Germline"	""	""	"0"	""	""	"g.50526143T>C"	""	"pathogenic (recessive)"	""
"0001089539"	"1"	"90"	"22"	"50965067"	"50965067"	"subst"	"4.87632E-5"	"00006"	"TYMP_000014"	"g.50965067T>G"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526638T>G"	""	"pathogenic (recessive)"	""
"0001089540"	"3"	"90"	"22"	"50965067"	"50965067"	"subst"	"4.87632E-5"	"00006"	"TYMP_000014"	"g.50965067T>G"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526638T>G"	""	"pathogenic (recessive)"	""
"0001089541"	"3"	"90"	"22"	"50965067"	"50965067"	"subst"	"4.87632E-5"	"00006"	"TYMP_000014"	"g.50965067T>G"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526638T>G"	""	"pathogenic (recessive)"	""
"0001089542"	"3"	"90"	"22"	"50965067"	"50965067"	"subst"	"4.87632E-5"	"00006"	"TYMP_000014"	"g.50965067T>G"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526638T>G"	""	"pathogenic (recessive)"	""
"0001089543"	"3"	"90"	"22"	"50965067"	"50965067"	"subst"	"4.87632E-5"	"00006"	"TYMP_000014"	"g.50965067T>G"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526638T>G"	""	"pathogenic (recessive)"	""
"0001089544"	"3"	"90"	"22"	"50967721"	"50967721"	"subst"	"0"	"00006"	"TYMP_000076"	"g.50967721C>A"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50529292C>A"	""	"pathogenic (recessive)"	""
"0001089545"	"3"	"90"	"22"	"50967721"	"50967721"	"subst"	"0"	"00006"	"TYMP_000076"	"g.50967721C>A"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50529292C>A"	""	"pathogenic (recessive)"	""
"0001089546"	"1"	"90"	"22"	"50965644"	"50965644"	"subst"	"0"	"00006"	"chr22_003344"	"g.50965644C>T"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50527215C>T"	""	"pathogenic (recessive)"	""
"0001089547"	"3"	"90"	"22"	"50967000"	"50967000"	"subst"	"8.12618E-6"	"00006"	"TYMP_000002"	"g.50967000C>T"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50528571C>T"	""	"pathogenic (recessive)"	""
"0001089548"	"1"	"90"	"22"	"50967000"	"50967000"	"subst"	"8.12618E-6"	"00006"	"TYMP_000002"	"g.50967000C>T"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50528571C>T"	""	"pathogenic (recessive)"	""
"0001089549"	"1"	"90"	"22"	"50965068"	"50965068"	"subst"	"0"	"00006"	"chr22_003317"	"g.50965068C>T"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526639C>T"	""	"pathogenic (recessive)"	""
"0001089550"	"1"	"90"	"22"	"50967040"	"50967040"	"subst"	"0"	"00006"	"chr22_003345"	"g.50967040C>T"	""	"{PMID:Garone 2011:21933806}"	""	"IVS3-1G>A"	""	"Germline"	""	""	"0"	""	""	"g.50528611C>T"	""	"pathogenic (recessive)"	""
"0001089551"	"3"	"90"	"22"	"50968008"	"50968008"	"subst"	"0"	"00006"	"TYMP_000066"	"g.50968008C>T"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50529579C>T"	""	"pathogenic (recessive)"	""
"0001089552"	"3"	"90"	"22"	"50968008"	"50968008"	"subst"	"0"	"00006"	"TYMP_000066"	"g.50968008C>T"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50529579C>T"	""	"pathogenic (recessive)"	""
"0001089553"	"3"	"90"	"22"	"50966979"	"50966979"	"subst"	"0"	"00006"	"chr22_003318"	"g.50966979A>G"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50528550A>G"	""	"pathogenic (recessive)"	""
"0001089554"	"3"	"90"	"22"	"50964448"	"50964448"	"subst"	"0"	"00006"	"chr22_003346"	"g.50964448C>T"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526019C>T"	""	"pathogenic (recessive)"	""
"0001089555"	"1"	"90"	"22"	"50966990"	"50966990"	"subst"	"0"	"00006"	"TYMP_000084"	"g.50966990T>C"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50528561T>C"	""	"pathogenic (recessive)"	""
"0001089556"	"3"	"90"	"22"	"50964767"	"50964767"	"subst"	"0"	"00006"	"chr22_003347"	"g.50964767A>G"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526338A>G"	""	"pathogenic (recessive)"	""
"0001089557"	"3"	"90"	"22"	"50964722"	"50964722"	"subst"	"0"	"00006"	"chr22_003327"	"g.50964722A>G"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526293A>G"	""	"pathogenic (recessive)"	""
"0001089558"	"3"	"90"	"22"	"50964722"	"50964722"	"subst"	"0"	"00006"	"chr22_003327"	"g.50964722A>G"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526293A>G"	""	"pathogenic (recessive)"	""
"0001089559"	"3"	"90"	"22"	"50968027"	"50968027"	"subst"	"4.09574E-6"	"00006"	"TYMP_000093"	"g.50968027C>A"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50529598C>A"	""	"pathogenic (recessive)"	""
"0001089560"	"3"	"90"	"22"	"0"	"0"	""	""	"00006"	"LARGE_000000"	"g.?"	""	"{PMID:Garone 2011:21933806}"	""	"416T>G"	""	"Germline"	""	""	"0"	""	""	"g.?"	""	"pathogenic (recessive)"	""
"0001089561"	"3"	"90"	"22"	"50964675"	"50964675"	"subst"	"0"	"00006"	"TYMP_000043"	"g.50964675C>T"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526246C>T"	""	"pathogenic (recessive)"	""
"0001089562"	"3"	"90"	"22"	"50964675"	"50964675"	"subst"	"0"	"00006"	"TYMP_000043"	"g.50964675C>T"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526246C>T"	""	"pathogenic (recessive)"	""
"0001089563"	"1"	"90"	"22"	"50964571"	"50964571"	"subst"	"0"	"00006"	"TYMP_000005"	"g.50964571C>T"	""	"{PMID:Garone 2011:21933806}"	""	"IVS9-1G>A"	"no variant 2nd chromosome"	"Germline"	""	""	"0"	""	""	"g.50526142C>T"	""	"pathogenic (recessive)"	""
"0001089564"	"1"	"90"	"22"	"50964571"	"50964571"	"subst"	"0"	"00006"	"TYMP_000005"	"g.50964571C>T"	""	"{PMID:Garone 2011:21933806}"	""	"IVS9-1G>A"	"no variant 2nd chromosome"	"Germline"	""	""	"0"	""	""	"g.50526142C>T"	""	"pathogenic (recessive)"	""
"0001089565"	"1"	"90"	"22"	"50964571"	"50964571"	"subst"	"0"	"00006"	"TYMP_000005"	"g.50964571C>T"	""	"{PMID:Garone 2011:21933806}"	""	"IVS9-1G>A"	"no variant 2nd chromosome"	"Germline"	""	""	"0"	""	""	"g.50526142C>T"	""	"pathogenic (recessive)"	""
"0001089566"	"3"	"90"	"22"	"50967718"	"50967719"	"del"	"0"	"00006"	"chr22_003348"	"g.50967718_50967719del"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50529289_50529290del"	""	"pathogenic (recessive)"	""
"0001089567"	"3"	"90"	"22"	"50965067"	"50965067"	"subst"	"4.87632E-5"	"00006"	"TYMP_000014"	"g.50965067T>G"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526638T>G"	""	"pathogenic (recessive)"	""
"0001089568"	"3"	"90"	"22"	"50965067"	"50965067"	"subst"	"4.87632E-5"	"00006"	"TYMP_000014"	"g.50965067T>G"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526638T>G"	""	"pathogenic (recessive)"	""
"0001089569"	"3"	"90"	"22"	"50965079"	"50965079"	"subst"	"0"	"00006"	"TYMP_000069"	"g.50965079A>G"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526650A>G"	""	"pathogenic (recessive)"	""
"0001089570"	"3"	"90"	"22"	"50967040"	"50967040"	"subst"	"0"	"00006"	"chr22_003345"	"g.50967040C>T"	""	"{PMID:Garone 2011:21933806}"	""	"IVS3-1G>C"	""	"Germline"	""	""	"0"	""	""	"g.50528611C>T"	""	"pathogenic (recessive)"	""
"0001089571"	"1"	"90"	"22"	"50967993"	"50967993"	"subst"	"0"	"00006"	"chr22_003349"	"g.50967993A>C"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50529564A>C"	""	"pathogenic (recessive)"	""
"0001089572"	"1"	"90"	"22"	"0"	"0"	""	""	"00006"	"LARGE_000000"	"g.?"	""	"{PMID:Garone 2011:21933806}"	""	"1443A>G"	""	"Germline"	""	""	"0"	""	""	"g.?"	""	"pathogenic (recessive)"	""
"0001089573"	"3"	"90"	"22"	"50965079"	"50965079"	"subst"	"0"	"00006"	"TYMP_000069"	"g.50965079A>G"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526650A>G"	""	"pathogenic (recessive)"	""
"0001089574"	"3"	"90"	"22"	"50965079"	"50965079"	"subst"	"0"	"00006"	"TYMP_000069"	"g.50965079A>G"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526650A>G"	""	"pathogenic (recessive)"	""
"0001089575"	"3"	"90"	"22"	"50967024"	"50967024"	"subst"	"2.03426E-5"	"00006"	"chr22_003311"	"g.50967024C>T"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50528595C>T"	""	"pathogenic (recessive)"	""
"0001089576"	"3"	"90"	"22"	"50967024"	"50967024"	"subst"	"2.03426E-5"	"00006"	"chr22_003311"	"g.50967024C>T"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50528595C>T"	""	"pathogenic (recessive)"	""
"0001089577"	"1"	"90"	"22"	"50967024"	"50967024"	"subst"	"2.03426E-5"	"00006"	"chr22_003311"	"g.50967024C>T"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50528595C>T"	""	"pathogenic (recessive)"	""
"0001089578"	"3"	"90"	"22"	"50967024"	"50967024"	"subst"	"2.03426E-5"	"00006"	"chr22_003311"	"g.50967024C>T"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50528595C>T"	""	"pathogenic (recessive)"	""
"0001089579"	"3"	"90"	"22"	"50967024"	"50967024"	"subst"	"2.03426E-5"	"00006"	"chr22_003311"	"g.50967024C>T"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50528595C>T"	""	"pathogenic (recessive)"	""
"0001089580"	"3"	"90"	"22"	"50966145"	"50966145"	"subst"	"0"	"00006"	"chr22_003319"	"g.50966145A>C"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50527716A>C"	""	"pathogenic (recessive)"	""
"0001089581"	"3"	"90"	"22"	"50966145"	"50966145"	"subst"	"0"	"00006"	"chr22_003319"	"g.50966145A>C"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50527716A>C"	""	"pathogenic (recessive)"	""
"0001089582"	"3"	"90"	"22"	"50966145"	"50966145"	"subst"	"0"	"00006"	"chr22_003319"	"g.50966145A>C"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50527716A>C"	""	"pathogenic (recessive)"	""
"0001089583"	"3"	"90"	"22"	"50964305"	"50964324"	"del"	"0"	"00006"	"TYMP_000090"	"g.50964305_50964324del"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50525876_50525895del"	""	"pathogenic (recessive)"	""
"0001089584"	"3"	"90"	"22"	"50966939"	"50966939"	"subst"	"0"	"00006"	"chr22_003310"	"g.50966939A>G"	""	"{PMID:Garone 2011:21933806}"	""	"IVS4+2T>C"	""	"Germline"	""	""	"0"	""	""	"g.50528510A>G"	""	"pathogenic (recessive)"	""
"0001089585"	"1"	"90"	"22"	"50967024"	"50967024"	"subst"	"2.03426E-5"	"00006"	"chr22_003311"	"g.50967024C>T"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50528595C>T"	""	"pathogenic (recessive)"	""
"0001089586"	"3"	"90"	"22"	"50967024"	"50967024"	"subst"	"2.03426E-5"	"00006"	"chr22_003311"	"g.50967024C>T"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50528595C>T"	""	"pathogenic (recessive)"	""
"0001089587"	"3"	"90"	"22"	"50967024"	"50967024"	"subst"	"2.03426E-5"	"00006"	"chr22_003311"	"g.50967024C>T"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50528595C>T"	""	"pathogenic (recessive)"	""
"0001089588"	"3"	"90"	"22"	"50967024"	"50967024"	"subst"	"2.03426E-5"	"00006"	"chr22_003311"	"g.50967024C>T"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50528595C>T"	""	"pathogenic (recessive)"	""
"0001089589"	"3"	"90"	"22"	"50964896"	"50964896"	"subst"	"0"	"00006"	"chr22_003350"	"g.50964896A>G"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526467A>G"	""	"pathogenic (recessive)"	""
"0001089590"	"3"	"90"	"22"	"50964519"	"50964519"	"dup"	"0"	"00006"	"chr22_003351"	"g.50964519dup"	""	"{PMID:Garone 2011:21933806}"	""	"1211insT"	""	"Germline"	""	""	"0"	""	""	"g.50526090dup"	""	"pathogenic (recessive)"	""
"0001089591"	"3"	"90"	"22"	"50964519"	"50964519"	"dup"	"0"	"00006"	"chr22_003351"	"g.50964519dup"	""	"{PMID:Garone 2011:21933806}"	""	"1211insT"	""	"Germline"	""	""	"0"	""	""	"g.50526090dup"	""	"pathogenic (recessive)"	""
"0001089592"	"1"	"90"	"22"	"50964330"	"50964330"	"dup"	"0"	"00006"	"chr22_003352"	"g.50964330dup"	""	"{PMID:Garone 2011:21933806}"	""	"1319insG"	""	"Germline"	""	""	"0"	""	""	"g.50525901dup"	""	"pathogenic (recessive)"	""
"0001089593"	"3"	"90"	"22"	"50964247"	"50964247"	"subst"	"0"	"00006"	"chr22_003353"	"g.50964247G>T"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50525818G>T"	""	"pathogenic (recessive)"	""
"0001089594"	"3"	"90"	"22"	"50964305"	"50964324"	"del"	"0"	"00006"	"TYMP_000090"	"g.50964305_50964324del"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50525876_50525895del"	""	"pathogenic (recessive)"	""
"0001089595"	"3"	"90"	"22"	"50965040"	"50965040"	"subst"	"0"	"00006"	"TYMP_000094"	"g.50965040C>T"	""	"{PMID:Garone 2011:21933806}, {PMID:Nalini 2011:21794876}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.50526611C>T"	""	"pathogenic (recessive)"	""
"0001089596"	"3"	"90"	"22"	"50965712"	"50965712"	"subst"	"8.13676E-6"	"00006"	"chr22_003355"	"g.50965712G>A"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50527283G>A"	""	"pathogenic (recessive)"	""
"0001089597"	"3"	"90"	"22"	"50968042"	"50968042"	"dup"	"0"	"00006"	"TYMP_000078"	"g.50968042dup"	""	"{PMID:Garone 2011:21933806}"	""	"100insC"	""	"Germline"	""	""	"0"	""	""	"g.50529613dup"	""	"pathogenic (recessive)"	""
"0001089598"	"3"	"90"	"22"	"50964305"	"50964324"	"del"	"0"	"00006"	"TYMP_000090"	"g.50964305_50964324del"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50525876_50525895del"	""	"pathogenic (recessive)"	""
"0001089599"	"3"	"90"	"22"	"50964305"	"50964324"	"del"	"0"	"00006"	"TYMP_000090"	"g.50964305_50964324del"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50525876_50525895del"	""	"pathogenic (recessive)"	""
"0001089600"	"1"	"90"	"22"	"50964903"	"50964903"	"subst"	"0"	"00006"	"chr22_003356"	"g.50964903C>A"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526474C>A"	""	"pathogenic (recessive)"	""
"0001089601"	"0"	"90"	"22"	"50964815"	"50964824"	"delins"	"0"	"00006"	"chr22_003357"	"g.50964815_50964824delinsTT"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526386_50526395delinsTT"	""	"pathogenic (recessive)"	""
"0001089602"	"2"	"90"	"22"	"50964267"	"50964267"	"dup"	"0"	"00006"	"chr22_003358"	"g.50964267dup"	""	"{PMID:Garone 2011:21933806}"	""	"1382insC"	""	"Germline"	""	""	"0"	""	""	"g.50525838dup"	""	"pathogenic (recessive)"	""
"0001089603"	"2"	"90"	"22"	"50964248"	"50964254"	"del"	"0"	"00006"	"chr22_003359"	"g.50964248_50964254del"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50525819_50525825del"	""	"pathogenic (recessive)"	""
"0001089604"	"2"	"90"	"22"	"50966040"	"50966040"	"subst"	"0"	"00006"	"chr22_003360"	"g.50966040A>C"	""	"{PMID:Garone 2011:21933806}"	""	"2633T>G"	""	"Germline"	""	""	"0"	""	""	"g.50527611A>C"	""	"pathogenic (recessive)"	""
"0001089605"	"2"	"90"	"22"	"50965067"	"50965067"	"subst"	"4.87632E-5"	"00006"	"TYMP_000014"	"g.50965067T>G"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526638T>G"	""	"pathogenic (recessive)"	""
"0001089606"	"2"	"90"	"22"	"50964288"	"50964288"	"subst"	"0"	"00006"	"chr22_003361"	"g.50964288C>G"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50525859C>G"	""	"pathogenic (recessive)"	""
"0001089607"	"2"	"90"	"22"	"50964571"	"50964571"	"subst"	"0"	"00006"	"chr22_003315"	"g.50964571C>G"	""	"{PMID:Garone 2011:21933806}"	""	"IVS9-1G>C"	""	"Germline"	""	""	"0"	""	""	"g.50526142C>G"	""	"pathogenic (recessive)"	""
"0001089608"	"2"	"90"	"22"	"50966133"	"50966133"	"subst"	"0"	"00006"	"TYMP_000083"	"g.50966133A>G"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50527704A>G"	""	"pathogenic (recessive)"	""
"0001089609"	"2"	"90"	"22"	"50967642"	"50967642"	"subst"	"8.14312E-6"	"00006"	"chr22_003332"	"g.50967642C>T"	""	"{PMID:Garone 2011:21933806}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50529213C>T"	""	"pathogenic (recessive)"	""
"0001089610"	"2"	"90"	"22"	"0"	"0"	""	""	"00006"	"LARGE_000000"	"g.?"	""	"{PMID:Garone 2011:21933806}"	""	"3359C>T"	""	"Germline"	""	""	"0"	""	""	"g.?"	""	"pathogenic (recessive)"	""
"0001089611"	"2"	"90"	"22"	"50966147"	"50966147"	"subst"	"0"	"00006"	"chr22_003362"	"g.50966147C>T"	""	"{PMID:Garone 2011:21933806}"	""	"IVS4-1G>A"	""	"Germline"	""	""	"0"	""	""	"g.50527718C>T"	""	"pathogenic (recessive)"	""
"0001089612"	"2"	"90"	"22"	"50967040"	"50967040"	"subst"	"0"	"00006"	"chr22_003363"	"g.50967040C>G"	""	"{PMID:Garone 2011:21933806}"	""	"IVS3-1G>C"	""	"Germline"	""	""	"0"	""	""	"g.50528611C>G"	""	"pathogenic (recessive)"	""
"0001089613"	"2"	"90"	"22"	"50964348"	"50964348"	"subst"	"0"	"00006"	"chr22_003316"	"g.50964348C>T"	""	"{PMID:Garone 2011:21933806}"	""	"IVS10-1G>A"	""	"Germline"	""	""	"0"	""	""	"g.50525919C>T"	""	"pathogenic (recessive)"	""
"0001089614"	"2"	"90"	"22"	"50964348"	"50964348"	"subst"	"0"	"00006"	"chr22_003316"	"g.50964348C>T"	""	"{PMID:Garone 2011:21933806}"	""	"IVS10-1G>A"	""	"Germline"	""	""	"0"	""	""	"g.50525919C>T"	""	"pathogenic (recessive)"	""
"0001089615"	"1"	"90"	"22"	"50967940"	"50967940"	"subst"	"0"	"00006"	"TYMP_000095"	"g.50967940G>A"	""	"{PMID:Scarpelli 2012:23341816}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50529511G>A"	""	"pathogenic (recessive)"	""
"0001089616"	"2"	"90"	"22"	"50965067"	"50965067"	"subst"	"4.87632E-5"	"00006"	"TYMP_000014"	"g.50965067T>G"	""	"{PMID:Scarpelli 2012:23341816}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526638T>G"	""	"pathogenic (recessive)"	""
"0001089617"	"3"	"90"	"22"	"50964794"	"50964794"	"subst"	"0"	"00006"	"TYMP_000096"	"g.50964794A>G"	""	"{PMID:Mihaylova 2013:23590577}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526365A>G"	""	"pathogenic (recessive)"	""
"0001089618"	"21"	"90"	"22"	"50967006"	"50967006"	"subst"	"0"	"00006"	"TYMP_000097"	"g.50967006T>G"	""	"{PMID:Suh 2013:23685548}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50528577T>G"	""	"pathogenic (recessive)"	""
"0001089619"	"11"	"90"	"22"	"50965124"	"50965124"	"subst"	"0"	"00006"	"TYMP_000098"	"g.50965124A>G"	""	"{PMID:Suh 2013:23685548}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526695A>G"	""	"pathogenic (recessive)"	""
"0001089620"	"1"	"90"	"22"	"50967768"	"50967768"	"subst"	"1.22669E-5"	"00006"	"TYMP_000001"	"g.50967768C>G"	""	"{PMID:Benureau 2014:25282463}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50529339C>G"	""	"pathogenic (recessive)"	""
"0001089621"	"2"	"90"	"22"	"50964519"	"50964519"	"subst"	"0"	"00006"	"TYMP_000099"	"g.50964519A>G"	""	"{PMID:Benureau 2014:25282463}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526090A>G"	""	"pathogenic (recessive)"	""
"0001089622"	"3"	"90"	"22"	"50965100"	"50965100"	"subst"	"0"	"00006"	"TYMP_000100"	"g.50965100C>T"	""	"{PMID:Peedikayil 2015:25585305}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.50526671C>T"	""	"pathogenic (recessive)"	""
"0001089623"	"3"	"90"	"22"	"50967765"	"50967765"	"subst"	"0"	"00006"	"TYMP_000101"	"g.50967765C>T"	""	"{PMID:Wang 2015:25954734}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50529336C>T"	""	"pathogenic (recessive)"	""
"0001089624"	"11"	"90"	"22"	"50965595"	"50965597"	"del"	"0"	"00006"	"TYMP_000102"	"g.50965595_50965597del"	""	"{PMID:Karyampudi 2016:27261974}"	""	"763_765delCTG"	""	"Germline"	""	""	"0"	""	""	"g.50527166_50527168del"	""	"pathogenic (recessive)"	""
"0001089625"	"21"	"90"	"22"	"50966035"	"50966035"	"subst"	"8.12447E-6"	"00006"	"TYMP_000103"	"g.50966035T>G"	""	"{PMID:Karyampudi 2016:27261974}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50527606T>G"	""	"pathogenic (recessive)"	""
"0001089626"	"3"	"90"	"22"	"50966016"	"50966016"	"subst"	"1.21846E-5"	"00006"	"TYMP_000104"	"g.50966016C>T"	""	"{PMID:Laforce 2009:19523753}"	""	"IVS5+1G>A (130G>A)"	""	"Germline"	""	""	"0"	""	""	"g.50527587C>T"	""	"pathogenic (recessive)"	""
"0001089627"	"11"	"90"	"22"	"50967767"	"50967780"	"delins"	"0"	"00006"	"TYMP_000105"	"g.50967767_50967780delinsTCACGC"	""	"{PMID:Libernini 2012:22618301}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.50529338_50529351delinsTCACGC"	""	"pathogenic (recessive)"	""
"0001089628"	"21"	"90"	"22"	"50964673"	"50964673"	"subst"	"0"	"00006"	"TYMP_000106"	"g.50964673A>T"	""	"{PMID:Libernini 2012:22618301}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.50526244A>T"	""	"pathogenic (recessive)"	""
"0001089629"	"3"	"90"	"22"	"50965067"	"50965067"	"subst"	"4.87632E-5"	"00006"	"TYMP_000014"	"g.50965067T>G"	""	"{PMID:Finkenstedt 2013:23430799}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526638T>G"	""	"pathogenic (recessive)"	""
"0001089630"	"3"	"90"	"22"	"50965067"	"50965067"	"subst"	"4.87632E-5"	"00006"	"TYMP_000014"	"g.50965067T>G"	""	"{PMID:Bakker 2010:20151198}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526638T>G"	""	"pathogenic (recessive)"	""
"0001089633"	"3"	"90"	"22"	"50964519"	"50964519"	"dup"	"0"	"00006"	"chr22_003351"	"g.50964519dup"	""	"{PMID:Hirano 2006:16971696}, {PMID:Halter 2015:26264513}"	""	"1211insT"	""	"Germline"	""	""	"0"	""	""	"g.50526090dup"	""	"pathogenic (recessive)"	""
"0001089634"	"3"	"90"	"22"	"50965079"	"50965079"	"subst"	"0"	"00006"	"TYMP_000069"	"g.50965079A>G"	""	"{PMID:Hirano 2006:16971696}, {PMID:Halter 2015:26264513}"	""	"T3359C"	""	"Germline"	""	""	"0"	""	""	"g.50526650A>G"	""	"pathogenic (recessive)"	""
"0001089635"	"1"	"90"	"22"	"0"	"0"	""	""	"00006"	"LARGE_000000"	"g.?"	""	"{PMID:Halter 2015:26264513}"	""	"1160A>C"	""	"Germline"	""	""	"0"	""	""	"g.?"	""	"pathogenic (recessive)"	""
"0001089636"	"3"	"90"	"22"	"50964824"	"50964841"	"dup"	"0"	"00006"	"TYMP_000088"	"g.50964824_50964841dup"	""	"{PMID:Halter 2015:26264513}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526395_50526412dup"	""	"pathogenic (recessive)"	""
"0001089637"	"3"	"90"	"22"	"50964305"	"50964324"	"del"	"0"	"00006"	"TYMP_000090"	"g.50964305_50964324del"	""	"{PMID:Halter 2015:26264513}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50525876_50525895del"	""	"pathogenic (recessive)"	""
"0001089638"	"1"	"90"	"22"	"50967000"	"50967000"	"subst"	"8.12618E-6"	"00006"	"TYMP_000002"	"g.50967000C>T"	""	"{PMID:Halter 2015:26264513}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50528571C>T"	""	"pathogenic (recessive)"	""
"0001089639"	"3"	"90"	"22"	"50967707"	"50967707"	"subst"	"0"	"00006"	"chr22_003338"	"g.50967707G>T"	""	"{PMID:Halter 2015:26264513}"	""	"g.2182C>A"	""	"Germline"	""	""	"0"	""	""	"g.50529278G>T"	""	"pathogenic (recessive)"	""
"0001089640"	"1"	"90"	"22"	"50967768"	"50967768"	"subst"	"1.22669E-5"	"00006"	"TYMP_000001"	"g.50967768C>G"	""	"{PMID:Halter 2015:26264513}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50529339C>G"	""	"pathogenic (recessive)"	""
"0001089641"	"3"	"90"	"22"	"50967707"	"50967707"	"subst"	"0"	"00006"	"chr22_003338"	"g.50967707G>T"	""	"{PMID:Halter 2015:26264513}"	""	"g.2182C>A"	""	"Germline"	""	""	"0"	""	""	"g.50529278G>T"	""	"pathogenic (recessive)"	""
"0001089642"	"1"	"90"	"22"	"0"	"0"	""	""	"00006"	"LARGE_000000"	"g.?"	""	"{PMID:Halter 2015:26264513}"	""	"1167T>C"	""	"Germline"	""	""	"0"	""	""	"g.?"	""	"pathogenic (recessive)"	""
"0001089643"	"3"	"90"	"22"	"50964482"	"50964482"	"dup"	"0"	"00006"	"chr22_003364"	"g.50964482dup"	""	"{PMID:Sicurelli 2012:22532170}, {PMID:Halter 2015:26264513}"	""	"1249dupC"	""	"Germline"	""	""	"0"	""	""	"g.50526053dup"	""	"pathogenic (recessive)"	""
"0001089644"	"3"	"90"	"22"	"50967040"	"50967040"	"subst"	"0"	"00006"	"chr22_003365"	"g.50967040C>A"	""	"{PMID:Halter 2015:26264513}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50528611C>A"	""	"pathogenic (recessive)"	""
"0001089645"	"3"	"90"	"22"	"50964234"	"50964234"	"del"	"0"	"00006"	"chr22_003366"	"g.50964234del"	""	"{PMID:Halter 2015:26264513}"	""	"1416delC"	""	"Germline"	""	""	"0"	""	""	"g.50525805del"	""	"pathogenic (recessive)"	""
"0001089646"	"3"	"90"	"22"	"50965067"	"50965067"	"subst"	"4.87632E-5"	"00006"	"TYMP_000014"	"g.50965067T>G"	""	"{PMID:Halter 2015:26264513}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526638T>G"	""	"pathogenic (recessive)"	""
"0001089647"	"3"	"90"	"22"	"50964571"	"50964571"	"subst"	"0"	"00006"	"TYMP_000005"	"g.50964571C>T"	""	"{PMID:Filosto 2012:22711161}, {PMID:Halter 2015:26264513}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526142C>T"	""	"pathogenic (recessive)"	""
"0001089648"	"3"	"90"	"22"	"50964571"	"50964571"	"subst"	"0"	"00006"	"TYMP_000005"	"g.50964571C>T"	""	"{PMID:Filosto 2012:22711161}, {PMID:Halter 2015:26264513}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526142C>T"	""	"pathogenic (recessive)"	""
"0001089649"	"3"	"90"	"22"	"50964305"	"50964324"	"del"	"0"	"00006"	"TYMP_000090"	"g.50964305_50964324del"	""	"{PMID:Halter 2015:26264513}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50525876_50525895del"	""	"pathogenic (recessive)"	""
"0001089650"	"1"	"90"	"22"	"50967767"	"50967780"	"delins"	"0"	"00006"	"TYMP_000105"	"g.50967767_50967780delinsTCACGC"	""	"{PMID:Halter 2015:26264513}"	""	"215-14del13ins4"	""	"Germline"	""	""	"0"	""	""	"g.50529338_50529351delinsTCACGC"	""	"pathogenic (recessive)"	""
"0001089651"	"3"	"90"	"22"	"50965067"	"50965067"	"subst"	"4.87632E-5"	"00006"	"TYMP_000014"	"g.50965067T>G"	""	"{PMID:Halter 2015:26264513}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526638T>G"	""	"pathogenic (recessive)"	""
"0001089652"	"3"	"90"	"22"	"50964305"	"50964324"	"del"	"0"	"00006"	"TYMP_000090"	"g.50964305_50964324del"	""	"{PMID:Halter 2015:26264513}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50525876_50525895del"	""	"pathogenic (recessive)"	""
"0001089653"	"1"	"90"	"22"	"50965670"	"50965670"	"subst"	"0"	"00006"	"chr22_003367"	"g.50965670A>G"	""	"{PMID:Halter 2015:26264513}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50527241A>G"	""	"pathogenic (recessive)"	""
"0001089654"	"3"	"90"	"22"	"50967024"	"50967024"	"subst"	"2.03426E-5"	"00006"	"chr22_003311"	"g.50967024C>T"	""	"{PMID:Halter 2015:26264513}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50528595C>T"	""	"pathogenic (recessive)"	""
"0001089655"	"3"	"90"	"22"	"50965067"	"50965067"	"subst"	"4.87632E-5"	"00006"	"TYMP_000014"	"g.50965067T>G"	""	"{PMID:Halter 2015:26264513}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526638T>G"	""	"pathogenic (recessive)"	""
"0001089656"	"2"	"90"	"22"	"50964267"	"50964267"	"dup"	"0"	"00006"	"chr22_003358"	"g.50964267dup"	""	"{PMID:Halter 2015:26264513}"	""	"1382insC"	""	"Germline"	""	""	"0"	""	""	"g.50525838dup"	""	"pathogenic (recessive)"	""
"0001089657"	"2"	"90"	"22"	"50965067"	"50965067"	"subst"	"4.87632E-5"	"00006"	"TYMP_000014"	"g.50965067T>G"	""	"{PMID:Halter 2015:26264513}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526638T>G"	""	"pathogenic (recessive)"	""
"0001089658"	"2"	"90"	"22"	"50965067"	"50965067"	"subst"	"4.87632E-5"	"00006"	"TYMP_000014"	"g.50965067T>G"	""	"{PMID:Halter 2015:26264513}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526638T>G"	""	"pathogenic (recessive)"	""
"0001089659"	"2"	"90"	"22"	"50964531"	"50964536"	"del"	"0"	"00006"	"chr22_003368"	"g.50964531_50964536del"	""	"{PMID:Halter 2015:26264513}"	""	"1198_1203delGTGCTG"	""	"Germline"	""	""	"0"	""	""	"g.50526102_50526107del"	""	"pathogenic (recessive)"	""
"0001089660"	"2"	"90"	"22"	"50964673"	"50964673"	"subst"	"0"	"00006"	"TYMP_000106"	"g.50964673A>T"	""	"{PMID:Halter 2015:26264513}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526244A>T"	""	"pathogenic (recessive)"	""
"0001089661"	"2"	"90"	"22"	"50964722"	"50964722"	"subst"	"0"	"00006"	"chr22_003327"	"g.50964722A>G"	""	"{PMID:Halter 2015:26264513}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526293A>G"	""	"pathogenic (recessive)"	""
"0001089663"	"3"	"90"	"22"	"50964234"	"50964234"	"del"	"0"	"00006"	"TYMP_000107"	"g.50964234del"	""	"{PMID:Torres-Torronteras 2011:21412940}"	""	"1416delC"	""	"Germline"	""	""	"0"	""	""	"g.50525805del"	""	"pathogenic (recessive)"	""
"0001089664"	"3"	"10"	"22"	"50964862"	"50964862"	"subst"	"0.61063"	"00006"	"TYMP_000062"	"g.50964862G>A"	""	"{PMID:Torres-Torronteras 2011:21412940}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50526433G>A"	""	"benign"	""
"0001089665"	"3"	"30"	"22"	"50964255"	"50964255"	"subst"	"0.0459774"	"00006"	"TYMP_000058"	"g.50964255C>T"	""	"{PMID:Torres-Torronteras 2011:21412940}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50525826C>T"	""	"likely benign"	""
"0001089666"	"3"	"90"	"22"	"50967768"	"50967768"	"subst"	"1.22669E-5"	"00006"	"TYMP_000001"	"g.50967768C>G"	""	"{PMID:Cardaioli 2010:20232099}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.50529339C>G"	""	"pathogenic (recessive)"	""
"0001089668"	"1"	"90"	"22"	"50966990"	"50966990"	"subst"	"0"	"00006"	"TYMP_000084"	"g.50966990T>C"	""	"{PMID:Hirano 2004:14720311}"	""	"A1453G"	""	"Germline"	""	""	"0"	""	""	"g.50528561T>C"	""	"pathogenic (recessive)"	""
"0001089669"	"3"	"90"	"22"	"50967024"	"50967024"	"subst"	"2.03426E-5"	"00006"	"chr22_003311"	"g.50967024C>T"	""	"{PMID:Hirano 2004:14720311}"	""	"G1419A"	""	"Germline"	""	""	"0"	""	""	"g.50528595C>T"	""	"pathogenic (recessive)"	""
"0001089670"	"3"	"90"	"22"	"50964448"	"50964448"	"subst"	"0"	"00006"	"chr22_003346"	"g.50964448C>T"	""	"{PMID:Hirano 2004:14720311}"	""	"G3990A"	""	"Germline"	""	""	"0"	""	""	"g.50526019C>T"	""	"pathogenic (recessive)"	""
"0001089671"	"3"	"90"	"22"	"50967000"	"50967000"	"subst"	"8.12618E-6"	"00006"	"TYMP_000002"	"g.50967000C>T"	""	"{PMID:Hirano 2004:14720311}"	""	"G1443A"	""	"Germline"	""	""	"0"	""	""	"g.50528571C>T"	""	"pathogenic (recessive)"	""
"0001089672"	"3"	"90"	"22"	"50967000"	"50967000"	"subst"	"8.12618E-6"	"00006"	"TYMP_000002"	"g.50967000C>T"	""	"{PMID:Hirano 2004:14720311}"	""	"G1443A"	""	"Germline"	""	""	"0"	""	""	"g.50528571C>T"	""	"pathogenic (recessive)"	""
"0001089673"	"1"	"90"	"22"	"50968011"	"50968011"	"subst"	"1.22756E-5"	"00006"	"chr22_003369"	"g.50968011T>G"	""	"{PMID:Hirano 2004:14720311}"	""	"A432C"	""	"Germline"	""	""	"0"	""	""	"g.50529582T>G"	""	"pathogenic (recessive)"	""
"0001089674"	"3"	"90"	"22"	"50967000"	"50967000"	"subst"	"8.12618E-6"	"00006"	"TYMP_000002"	"g.50967000C>T"	""	"{PMID:Hirano 2004:14720311}"	""	"G1443A"	""	"Germline"	""	""	"0"	""	""	"g.50528571C>T"	""	"pathogenic (recessive)"	""
"0001089675"	"3"	"90"	"22"	"50966050"	"50966050"	"subst"	"0"	"00006"	"chr22_003370"	"g.50966050T>G"	""	"{PMID:Hirano 2004:14720311}"	""	"A2839C"	""	"Germline"	""	""	"0"	""	""	"g.50527621T>G"	""	"pathogenic (recessive)"	""
"0001089676"	"1"	"90"	"22"	"50965067"	"50965067"	"subst"	"0"	"00006"	"chr22_003309"	"g.50965067T>C"	""	"{PMID:Hirano 2004:14720311}"	""	"A3371C"	""	"Germline"	""	""	"0"	""	""	"g.50526638T>C"	""	"pathogenic (recessive)"	""
"0001089677"	"3"	"90"	"22"	"50967768"	"50967768"	"subst"	"1.22669E-5"	"00006"	"TYMP_000001"	"g.50967768C>G"	""	"{PMID:Hirano 2004:14720311}"	""	"g675c"	""	"Germline"	""	""	"0"	""	""	"g.50529339C>G"	""	"pathogenic (recessive)"	""
"0001089678"	"3"	"90"	"22"	"50964896"	"50964896"	"subst"	"0"	"00006"	"chr22_003350"	"g.50964896A>G"	""	"{PMID:Hirano 2004:14720311}"	""	"T3542C"	""	"Germline"	""	""	"0"	""	""	"g.50526467A>G"	""	"pathogenic (recessive)"	""
"0001089679"	"3"	"90"	"22"	"50964519"	"50964519"	"dup"	"0"	"00006"	"chr22_003351"	"g.50964519dup"	""	"{PMID:Hirano 2004:14720311}"	""	"ins-T3919"	""	"Germline"	""	""	"0"	""	""	"g.50526090dup"	""	"pathogenic (recessive)"	""
"0001089680"	"3"	"90"	"22"	"50964519"	"50964519"	"dup"	"0"	"00006"	"chr22_003351"	"g.50964519dup"	""	"{PMID:Hirano 2004:14720311}"	""	"ins-T3919"	""	"Germline"	""	""	"0"	""	""	"g.50526090dup"	""	"pathogenic (recessive)"	""
"0001089681"	"2"	"90"	"22"	"50966133"	"50966133"	"subst"	"0"	"00006"	"TYMP_000083"	"g.50966133A>G"	""	"{PMID:Hirano 2004:14720311}"	""	"T2306C"	""	"Germline"	""	""	"0"	""	""	"g.50527704A>G"	""	"pathogenic (recessive)"	""
"0001089682"	"2"	"90"	"22"	"50967807"	"50967807"	"subst"	"0"	"00006"	"chr22_003371"	"g.50967807C>T"	""	"{PMID:Hirano 2004:14720311}"	""	"g635a"	""	"Germline"	""	""	"0"	""	""	"g.50529378C>T"	""	"pathogenic (recessive)"	""
"0001089683"	"2"	"90"	"22"	"50967768"	"50967768"	"subst"	"1.22669E-5"	"00006"	"TYMP_000001"	"g.50967768C>G"	""	"{PMID:Hirano 2004:14720311}"	""	"g675c"	""	"Germline"	""	""	"0"	""	""	"g.50529339C>G"	""	"pathogenic (recessive)"	""


## Variants_On_Transcripts ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Note: Only showing Variants_On_Transcript columns active for Genes TYMP
## Count = 323
"{{id}}"	"{{transcriptid}}"	"{{effectid}}"	"{{position_c_start}}"	"{{position_c_start_intron}}"	"{{position_c_end}}"	"{{position_c_end_intron}}"	"{{VariantOnTranscript/DNA}}"	"{{VariantOnTranscript/RNA}}"	"{{VariantOnTranscript/Protein}}"	"{{VariantOnTranscript/Exon}}"
"0000064496"	"00026061"	"90"	"215"	"-1"	"215"	"-1"	"c.215-1G>C"	"r.spl"	"p.?"	""
"0000064497"	"00026061"	"90"	"1160"	"-1"	"1160"	"-1"	"c.1160-1G>A"	"r.spl"	"p.?"	""
"0000064498"	"00026061"	"10"	"1284"	"0"	"1284"	"0"	"c.1284T>A"	"r.(?)"	"p.(Gly428=)"	""
"0000064499"	"00026061"	"50"	"685"	"0"	"685"	"0"	"c.685G>C"	"r.(?)"	"p.(Ala229Pro)"	""
"0000064500"	"00026061"	"50"	"929"	"0"	"929"	"0"	"c.929G>A"	"r.(?)"	"p.(Gly310Glu)"	""
"0000064501"	"00026061"	"90"	"457"	"0"	"457"	"0"	"c.457G>A"	"r.(?)"	"p.(Gly153Ser)"	""
"0000064502"	"00026061"	"90"	"1048"	"0"	"1048"	"0"	"c.1048C>T"	"r.(?)"	"p.(Gln350Ter)"	""
"0000064503"	"00026061"	"50"	""	"0"	""	"0"	"c.*36C>T"	"r.(?)"	"p.(=)"	""
"0000079353"	"00026061"	"90"	"-192"	"-698272"	"1467"	"3781237"	"c.-698464_*3781255del"	"r.0?"	"p.0?"	""
"0000298038"	"00026061"	"10"	"1393"	"0"	"1393"	"0"	"c.1393G>A"	"r.(?)"	"p.(Ala465Thr)"	""
"0000298039"	"00026061"	"10"	"1412"	"0"	"1412"	"0"	"c.1412C>T"	"r.(?)"	"p.(Ser471Leu)"	""
"0000298040"	"00026061"	"10"	"972"	"0"	"972"	"0"	"c.972C>T"	"r.(?)"	"p.(Ala324=)"	""
"0000329128"	"00026061"	"50"	"1295"	"0"	"1295"	"0"	"c.1295G>A"	"r.(?)"	"p.(Arg432His)"	""
"0000329130"	"00026061"	"30"	"1160"	"-29"	"1160"	"-29"	"c.1160-29C>G"	"r.(=)"	"p.(=)"	""
"0000329131"	"00026061"	"30"	"929"	"-6"	"929"	"-3"	"c.929-6_929-3del"	"r.spl?"	"p.?"	""
"0000329135"	"00026061"	"30"	"214"	"13"	"214"	"13"	"c.214+13G>A"	"r.(=)"	"p.(=)"	""
"0000459017"	"00026061"	"70"	"929"	"-1"	"929"	"-1"	"c.929-1G>A"	"r.spl"	"p.?"	""
"0000572397"	"00026061"	"10"	"1284"	"0"	"1284"	"0"	"c.1284T>A"	"r.(?)"	"p.(Gly428=)"	""
"0000572398"	"00026061"	"10"	"972"	"0"	"972"	"0"	"c.972C>T"	"r.(?)"	"p.(Ala324=)"	""
"0000572399"	"00026061"	"30"	"242"	"0"	"242"	"0"	"c.242G>A"	"r.(?)"	"p.(Arg81Gln)"	""
"0000572400"	"00026061"	"30"	"242"	"0"	"242"	"0"	"c.242G>A"	"r.(?)"	"p.(Arg81Gln)"	""
"0000572401"	"00026061"	"30"	"194"	"0"	"194"	"0"	"c.194G>A"	"r.(?)"	"p.(Ser65Asn)"	""
"0000572402"	"00026061"	"30"	"30"	"0"	"30"	"0"	"c.30G>A"	"r.(?)"	"p.(Gly10=)"	""
"0000580727"	"00026061"	"90"	"866"	"0"	"866"	"0"	"c.866A>C"	"r.(?)"	"p.(Glu289Ala)"	"7"
"0000580728"	"00026061"	"90"	"653"	"0"	"653"	"0"	"c.653T>G"	"r.(?)"	"p.(Ile218Ser)"	"6"
"0000580729"	"00026061"	"90"	"516"	"2"	"516"	"2"	"c.516+2T>A"	"r.spl"	"p.?"	""
"0000580730"	"00026061"	"90"	"214"	"1"	"214"	"1"	"c.214+1G>T"	"r.spl"	"p.?"	""
"0000580731"	"00026061"	"90"	"215"	"-1"	"215"	"-1"	"c.215-1G>C"	"r.spl"	"p.?"	""
"0000618647"	"00026061"	"10"	"1393"	"0"	"1393"	"0"	"c.1393G>A"	"r.(?)"	"p.(Ala465Thr)"	""
"0000624334"	"00026061"	"30"	"676"	"0"	"676"	"0"	"c.676G>A"	"r.(?)"	"p.(Gly226Arg)"	""
"0000651015"	"00026061"	"70"	"895"	"0"	"895"	"0"	"c.895C>A"	"r.(?)"	"p.(Pro299Thr)"	""
"0000651016"	"00026061"	"50"	"437"	"0"	"437"	"0"	"c.437G>A"	"r.(?)"	"p.(Arg146His)"	""
"0000651017"	"00026061"	"70"	"355"	"0"	"355"	"0"	"c.355G>A"	"r.(?)"	"p.(Gly119Arg)"	""
"0000658983"	"00026061"	"30"	"519"	"0"	"519"	"0"	"c.519G>A"	"r.(?)"	"p.(Met173Ile)"	""
"0000660329"	"00026061"	"50"	"242"	"0"	"242"	"0"	"c.242G>A"	"r.(?)"	"p.(Arg81Gln)"	""
"0000681938"	"00026061"	"30"	"1290"	"0"	"1290"	"0"	"c.1290G>A"	"r.(?)"	"p.(Arg430=)"	""
"0000681939"	"00026061"	"30"	"294"	"0"	"294"	"0"	"c.294G>A"	"r.(?)"	"p.(Ser98=)"	""
"0000704166"	"00026061"	"90"	"945"	"0"	"945"	"0"	"c.945G>A"	"r.(?)"	"p.(Trp315Ter)"	""
"0000728228"	"00026061"	"30"	"735"	"0"	"735"	"0"	"c.735G>A"	"r.(?)"	"p.(Gln245=)"	""
"0000856203"	"00026061"	"30"	"1412"	"0"	"1412"	"0"	"c.1412C>T"	"r.(?)"	"p.(Ser471Leu)"	""
"0000856204"	"00026061"	"30"	"494"	"0"	"494"	"0"	"c.494A>G"	"r.(?)"	"p.(Asn165Ser)"	""
"0000856205"	"00026061"	"30"	"61"	"0"	"61"	"0"	"c.61G>C"	"r.(?)"	"p.(Glu21Gln)"	""
"0000866907"	"00026061"	"30"	"1393"	"0"	"1393"	"0"	"c.1393G>A"	"r.(?)"	"p.(Ala465Thr)"	""
"0000866908"	"00026061"	"30"	"1176"	"0"	"1176"	"0"	"c.1176C>T"	"r.(?)"	"p.(Val392=)"	""
"0000866909"	"00026061"	"30"	"831"	"0"	"831"	"0"	"c.831G>A"	"r.(?)"	"p.(Leu277=)"	""
"0000866910"	"00026061"	"90"	"622"	"0"	"622"	"0"	"c.622G>A"	"r.(?)"	"p.(Val208Met)"	""
"0000866911"	"00026061"	"50"	"542"	"0"	"542"	"0"	"c.542G>A"	"r.(?)"	"p.(Gly181Asp)"	""
"0000866912"	"00026061"	"50"	"214"	"17"	"214"	"17"	"c.214+17G>A"	"r.(=)"	"p.(=)"	""
"0000895819"	"00026061"	"50"	"1426"	"0"	"1426"	"0"	"c.1426C>G"	"r.(?)"	"p.(Leu476Val)"	""
"0000895820"	"00026061"	"50"	"1138"	"0"	"1140"	"0"	"c.1138_1140del"	"r.(?)"	"p.(Glu380del)"	""
"0000915567"	"00026061"	"30"	"928"	"10"	"928"	"10"	"c.928+10dup"	"r.(=)"	"p.(=)"	""
"0000927225"	"00026061"	"50"	"1159"	"0"	"1159"	"0"	"c.1159G>A"	"r.(?)"	"p.(Gly387Ser)"	""
"0000931317"	"00026061"	"30"	"975"	"0"	"975"	"0"	"c.975G>A"	"r.(?)"	"p.(Gln325=)"	""
"0000931318"	"00026061"	"30"	"762"	"0"	"762"	"0"	"c.762G>A"	"r.(?)"	"p.(Thr254=)"	""
"0000931319"	"00026061"	"70"	"11"	"0"	"11"	"0"	"c.11del"	"r.(?)"	"p.(Leu4Ter)"	""
"0000951639"	"00026061"	"50"	"1109"	"0"	"1109"	"0"	"c.1109A>G"	"r.(?)"	"p.(Gln370Arg)"	""
"0000951640"	"00026061"	"30"	"676"	"0"	"676"	"0"	"c.676G>A"	"r.(?)"	"p.(Gly226Arg)"	""
"0000970543"	"00026061"	"10"	"204"	"0"	"204"	"0"	"c.204C>T"	"r.(?)"	"p.(Gly68=)"	""
"0000970544"	"00026061"	"30"	"-10"	"-36"	"-10"	"-36"	"c.-10-36G>T"	"r.spl"	"p.(=)"	""
"0000984317"	"00026061"	"30"	"495"	"0"	"495"	"0"	"c.495T>C"	"r.(?)"	"p.(Asn165=)"	""
"0001006258"	"00026061"	"50"	"736"	"0"	"736"	"0"	"c.736G>A"	"r.(?)"	"p.(Glu246Lys)"	""
"0001006259"	"00026061"	"30"	"516"	"16"	"516"	"16"	"c.516+16G>A"	"r.(=)"	"p.(=)"	""
"0001015961"	"00026061"	"30"	"1074"	"0"	"1074"	"0"	"c.1074A>G"	"r.(?)"	"p.(Arg358=)"	""
"0001027416"	"00026061"	"30"	"1160"	"-26"	"1160"	"-26"	"c.1160-26G>A"	"r.(=)"	"p.(=)"	""
"0001046830"	"00026061"	"90"	"866"	"0"	"866"	"0"	"c.866A>C"	"r.(?)"	"p.(Glu289Ala)"	""
"0001059273"	"00026061"	"90"	"622"	"0"	"622"	"0"	"c.622G>A"	"r.(?)"	"p.(Val208Met)"	""
"0001059274"	"00026061"	"70"	"391"	"0"	"391"	"0"	"c.391C>A"	"r.(?)"	"p.(Pro131Thr)"	""
"0001067562"	"00026061"	"30"	"1159"	"18"	"1159"	"18"	"c.1159+18C>A"	"r.(=)"	"p.(=)"	""
"0001067563"	"00026061"	"50"	"1103"	"0"	"1103"	"0"	"c.1103G>A"	"r.(?)"	"p.(Arg368His)"	""
"0001067564"	"00026061"	"50"	"47"	"0"	"47"	"0"	"c.47G>C"	"r.(?)"	"p.(Gly16Ala)"	""
"0001069202"	"00026061"	"90"	"235"	"0"	"235"	"0"	"c.235C>T"	"r.(?)"	"p.(Arg79Ter)"	""
"0001069491"	"00026061"	"70"	"342"	"0"	"342"	"0"	"c.342C>G"	"r.(?)"	"p.(Asp114Glu)"	""
"0001069510"	"00026061"	"50"	"554"	"0"	"554"	"0"	"c.554T>A"	"r.(?)"	"p.(Val185Glu)"	""
"0001074283"	"00026061"	"70"	"355"	"0"	"355"	"0"	"c.355G>A"	"r.(?)"	"p.(Gly119Arg)"	""
"0001089084"	"00026061"	"90"	"1187"	"0"	"1187"	"0"	"c.1187C>T"	"r.(?)"	"p.(Pro396Leu)"	"9"
"0001089254"	"00026061"	"90"	"866"	"0"	"866"	"0"	"c.866A>G"	"r.(?)"	"p.(Glu289Gly)"	"7"
"0001089255"	"00026061"	"90"	"516"	"2"	"516"	"2"	"c.516+2T>C"	"r.418_516del"	"p.Val140_Gln172del"	"4i"
"0001089256"	"00026061"	"90"	"433"	"0"	"433"	"0"	"c.433G>A"	"r.(?)"	"p.(Gly145Arg)"	"4"
"0001089257"	"00026061"	"90"	"665"	"0"	"665"	"0"	"c.665A>G"	"r.(?)"	"p.(Lys222Arg)"	"6"
"0001089258"	"00026061"	"90"	"433"	"0"	"433"	"0"	"c.433G>A"	"r.(?)"	"p.(Gly145Arg)"	"4"
"0001089259"	"00026061"	"90"	"433"	"0"	"433"	"0"	"c.433G>A"	"r.(?)"	"p.(Gly145Arg)"	"4"
"0001089260"	"00026061"	"90"	"866"	"0"	"866"	"0"	"c.866A>G"	"r.(?)"	"p.(Glu289Gly)"	"7"
"0001089261"	"00026061"	"90"	"433"	"0"	"433"	"0"	"c.433G>A"	"r.(?)"	"p.(Gly145Arg)"	"4"
"0001089262"	"00026061"	"90"	"1193"	"0"	"1198"	"0"	"c.1193_1198del"	"r.(?)"	"p.(Ala398_Leu399del)"	"9"
"0001089263"	"00026061"	"90"	"457"	"0"	"457"	"0"	"c.457G>A"	"r.(?)"	"p.(Gly153Ser)"	"4"
"0001089264"	"00026061"	"90"	"457"	"0"	"457"	"0"	"c.457G>A"	"r.(?)"	"p.(Gly153Ser)"	"4"
"0001089265"	"00026061"	"90"	"457"	"0"	"457"	"0"	"c.457G>A"	"r.(?)"	"p.(Gly153Ser)"	"4"
"0001089266"	"00026061"	"90"	"866"	"0"	"866"	"0"	"c.866A>G"	"r.(?)"	"p.(Glu289Gly)"	"7"
"0001089267"	"00026061"	"90"	"1410"	"0"	"1410"	"0"	"c.1410dup"	"r.(?)"	"p.(Ser471LeufsTer?)"	"10"
"0001089268"	"00026061"	"90"	"1160"	"-1"	"1160"	"-1"	"c.1160-1G>C"	"r.1160_1300del"	"p.Thr388_Gly434del"	"8i"
"0001089269"	"00026061"	"70"	"929"	"-6"	"929"	"-3"	"c.929-6_929-3del"	"r.spl"	"p.?"	"7i"
"0001089270"	"00026061"	"90"	"1301"	"-1"	"1301"	"-1"	"c.1301-1G>A"	"r.spl"	"p.?"	"9i"
"0001089271"	"00026061"	"90"	"866"	"0"	"866"	"0"	"c.866A>G"	"r.(?)"	"p.(Glu289Gly)"	"7"
"0001089272"	"00026061"	"90"	"866"	"0"	"866"	"0"	"c.866A>G"	"r.(?)"	"p.(Glu289Gly)"	"7"
"0001089273"	"00026061"	"90"	"1160"	"-1"	"1160"	"-1"	"c.1160-1G>A"	"r.1160_1300del"	"p.Thr388_Gly434del"	"8i"
"0001089274"	"00026061"	"90"	"865"	"0"	"865"	"0"	"c.865G>A"	"r.(?)"	"p.(Glu289Lys)"	"7i"
"0001089275"	"00026061"	"90"	"866"	"0"	"866"	"0"	"c.866A>G"	"r.(?)"	"p.(Glu289Gly)"	"7"
"0001089276"	"00026061"	"90"	"478"	"0"	"478"	"0"	"c.478T>C"	"r.(?)"	"p.(Ser160Pro)"	"4i"
"0001089277"	"00026061"	"90"	"1160"	"-1"	"1160"	"-1"	"c.1160-1G>A"	"r.1160_1300del"	"p.Thr388_Gly434del"	"8i"
"0001089278"	"00026061"	"90"	"518"	"0"	"518"	"0"	"c.518T>G"	"r.(?)"	"p.(Met173Arg)"	"5"
"0001089279"	"00026061"	"90"	"1411"	"0"	"1411"	"0"	"c.1411T>C"	"r.(?)"	"p.(Ser471Pro)"	"10"
"0001089280"	"00026061"	"90"	"51"	"0"	"52"	"0"	"c.51_52del"	"r.(?)"	"p.(Phe18LeufsTer105)"	"2"
"0001089281"	"00026061"	"90"	"1160"	"-1"	"1160"	"-1"	"c.1160-1G>A"	"r.1160_1300del"	"p.Thr388_Gly434del"	"8i"
"0001089282"	"00026061"	"90"	"1411"	"0"	"1411"	"0"	"c.1411T>C"	"r.(?)"	"p.(Ser471Pro)"	"10"
"0001089283"	"00026061"	"90"	"131"	"0"	"131"	"0"	"c.131G>A"	"r.(?)"	"p.(Arg44Gln)"	"2"
"0001089284"	"00026061"	"90"	"215"	"-1"	"215"	"-1"	"c.215-1G>C"	"r.184_417del"	"p.Asn63_Val140del"	"2i"
"0001089285"	"00026061"	"90"	"622"	"0"	"622"	"0"	"c.622G>A"	"r.(?)"	"p.(Val208Met)"	""
"0001089286"	"00026061"	"90"	"931"	"0"	"931"	"0"	"c.931G>C"	"r.(?)"	"p.(Gly311Arg)"	""
"0001089287"	"00026061"	"90"	"605"	"0"	"605"	"0"	"c.605G>C"	"r.(?)"	"p.(Arg202Thr)"	""
"0001089288"	"00026061"	"90"	"622"	"0"	"622"	"0"	"c.622G>A"	"r.(?)"	"p.(Val208Met)"	""
"0001089289"	"00026061"	"90"	"457"	"0"	"457"	"0"	"c.457G>A"	"r.(?)"	"p.(Gly153Ser)"	""
"0001089290"	"00026061"	"90"	"854"	"0"	"854"	"0"	"c.854T>C"	"r.(?)"	"p.(Leu285Pro)"	""
"0001089291"	"00026061"	"90"	"1193"	"0"	"1198"	"0"	"c.1193_1198del"	"r.(?)"	"p.(Ala398_Leu399del)"	"9"
"0001089292"	"00026061"	"90"	"215"	"-1"	"215"	"-1"	"c.215-1G>C"	"r.-10-35_417del"	"p.0?"	"1i"
"0001089293"	"00026061"	"90"	"215"	"-1"	"215"	"-1"	"c.215-1G>C"	"r.spl"	"p.?"	"2i"
"0001089294"	"00026061"	"90"	"1300"	"1"	"1300"	"1"	"c.1300+1G>A"	"r.1160_1300del"	"p.Thr388_Gly434del"	"9i"
"0001089295"	"00026061"	"30"	"1176"	"0"	"1187"	"0"	"c.1176_1187del"	"r.(?)"	"p.(Arg393_Pro396del)"	""
"0001089296"	"00026061"	"30"	"1176"	"0"	"1187"	"0"	"c.1176_1187del"	"r.(?)"	"p.(Arg393_Pro396del)"	""
"0001089297"	"00026061"	"70"	"798"	"0"	"801"	"0"	"c.798_801dup"	"r.(?)"	"p.(Ala268ArgfsTer?)"	""
"0001089298"	"00026061"	"90"	"1013"	"0"	"1013"	"0"	"c.1013C>A"	"r.(?)"	"p.(Ser338Ter)"	""
"0001089299"	"00026061"	"50"	"345"	"0"	"345"	"0"	"c.345G>T"	"r.(?)"	"p.(Lys115Asn)"	""
"0001089300"	"00026061"	"90"	"130"	"0"	"130"	"0"	"c.130C>T"	"r.(?)"	"p.(Arg44Ter)"	""
"0001089397"	"00026061"	"90"	"1001"	"0"	"1001"	"0"	"c.1001T>G"	"r.(?)"	"p.(Leu334Arg)"	""
"0001089459"	"00026061"	"90"	"401"	"0"	"401"	"0"	"c.401C>A"	"r.(?)"	"p.(Ala134Glu)"	""
"0001089460"	"00026061"	"90"	"845"	"0"	"845"	"0"	"c.845G>A"	"r.(?)"	"p.(Gly282Asp)"	""
"0001089462"	"00026061"	"90"	"-47776"	"0"	"36556"	"0"	"c.(?_-47776)_(*35107_?)del"	"r.0"	"p.0"	"_1_10_"
"0001089465"	"00026061"	"90"	"-135820"	"0"	"36556"	"0"	"c.(?_-135820)_(*35107_?)del"	"r.0"	"p.0"	"_1_10_"
"0001089466"	"00026061"	"90"	"261"	"0"	"261"	"0"	"c.261G>T"	"r.(?)"	"p.(Glu87Asp)"	""
"0001089468"	"00026061"	"90"	"99"	"0"	"99"	"0"	"c.99dup"	"r.(?)"	"p.(Lys34GlnfsTer90)"	""
"0001089478"	"00026061"	"90"	"1393"	"0"	"1393"	"0"	"c.1393G>A"	"r.(?)"	"p.(Ala465Thr)"	"10"
"0001089479"	"00026061"	"90"	"1160"	"-1"	"1160"	"-1"	"c.1160-1G>A"	"r.spl"	"p.?"	"8i"
"0001089480"	"00026061"	"90"	"1112"	"0"	"1112"	"0"	"c.1112T>C"	"r.(?)"	"p.(Leu371Pro)"	"8"
"0001089481"	"00026061"	"90"	"1299"	"0"	"1299"	"0"	"c.1299T>A"	"r.spl?"	"r.spl?"	"9"
"0001089482"	"00026061"	"90"	"1112"	"0"	"1112"	"0"	"c.1112T>C"	"r.(?)"	"p.(Leu371Pro)"	"8"
"0001089483"	"00026061"	"90"	"162"	"0"	"162"	"0"	"c.162C>G"	"r.(?)"	"p.(Ile54Met)"	"2"
"0001089484"	"00026061"	"90"	"228"	"0"	"228"	"0"	"c.228G>A"	"r.(?)"	"p.(Met76Ile)"	"3"
"0001089485"	"00026061"	"50"	"847"	"0"	"847"	"0"	"c.847C>G"	"r.(?)"	"p.(His283Asp)"	"7"
"0001089486"	"00026061"	"90"	"1311"	"0"	"1311"	"0"	"c.1311G>A"	"r.(?)"	"p.(Trp437Ter)"	"10"
"0001089487"	"00026061"	"10"	"1393"	"0"	"1393"	"0"	"c.1393G>A"	"r.(?)"	"p.(Ala465Thr)"	""
"0001089488"	"00026061"	"10"	"0"	"0"	"0"	"0"	"c.?"	"r.?"	"p.?"	"9"
"0001089489"	"00026061"	"10"	"1284"	"0"	"1284"	"0"	"c.1284T>A"	"r.(=)"	"p.(Gly428=)"	""
"0001089490"	"00026061"	"90"	"467"	"0"	"467"	"0"	"c.467A>G"	"r.(?)"	"p.(Asp156Gly)"	""
"0001089491"	"00026061"	"90"	"866"	"0"	"866"	"0"	"c.866A>C"	"r.(?)"	"p.(Glu289Ala)"	""
"0001089492"	"00026061"	"90"	"261"	"0"	"261"	"0"	"c.261G>C"	"r.(?)"	"p.(Glu87Asp)"	""
"0001089493"	"00026061"	"90"	"866"	"0"	"866"	"0"	"c.866A>C"	"r.(?)"	"p.(Glu289Ala)"	""
"0001089494"	"00026061"	"90"	"340"	"0"	"340"	"0"	"c.340G>A"	"r.(?)"	"p.(Asp114Asn)"	""
"0001089495"	"00026061"	"90"	"866"	"0"	"866"	"0"	"c.866A>C"	"r.(?)"	"p.(Glu289Ala)"	""
"0001089496"	"00026061"	"90"	"1160"	"-1"	"1160"	"-1"	"c.1160-1G>A"	"r.(1160_1300del)"	"p.(Thr388_Gly434del)"	""
"0001089497"	"00026061"	"90"	"856"	"0"	"856"	"0"	"c.856G>A"	"r.(?)"	"p.(Glu286Lys)"	""
"0001089498"	"00026061"	"90"	"530"	"0"	"530"	"0"	"c.530T>C"	"r.(?)"	"p.(Leu177Pro)"	""
"0001089499"	"00026061"	"90"	"1160"	"0"	"1160"	"0"	"c.1160G>A"	"r.(?)"	"p.(Gly387Asp)"	""
"0001089500"	"00026061"	"90"	"784"	"0"	"784"	"0"	"c.784del"	"r.(?)"	"p.(Leu262Ter)"	""
"0001089501"	"00026061"	"90"	"928"	"1"	"928"	"1"	"c.928+1G>A"	"r.spl"	"p.?"	""
"0001089502"	"00026061"	"90"	"866"	"0"	"866"	"0"	"c.866A>C"	"r.(?)"	"p.(Glu289Ala)"	""
"0001089503"	"00026061"	"90"	"275"	"0"	"275"	"0"	"c.275C>A"	"r.(?)"	"p.(Thr92Asn)"	""
"0001089504"	"00026061"	"90"	"275"	"0"	"275"	"0"	"c.275C>A"	"r.(?)"	"p.(Thr92Asn)"	""
"0001089505"	"00026061"	"90"	"275"	"0"	"275"	"0"	"c.275C>A"	"r.(?)"	"p.(Thr92Asn)"	""
"0001089506"	"00026061"	"90"	"398"	"0"	"398"	"0"	"c.398T>C"	"r.(?)"	"p.(Leu133Pro)"	""
"0001089507"	"00026061"	"90"	"605"	"0"	"605"	"0"	"c.605G>A"	"r.(?)"	"p.(Arg202Lys)"	""
"0001089508"	"00026061"	"90"	"1088"	"0"	"1088"	"0"	"c.1088del"	"r.(?)"	"p.(Gly363GlufsTer?)"	""
"0001089509"	"00026061"	"90"	"1431"	"0"	"1431"	"0"	"c.1431dup"	"r.(?)"	"p.(Leu478SerfsTer?)"	""
"0001089511"	"00026061"	"90"	"707"	"0"	"707"	"0"	"c.707T>C"	"r.(?)"	"p.(Phe236Ser)"	""
"0001089512"	"00026061"	"90"	"994"	"0"	"1011"	"0"	"c.994_1011dup"	"r.(?)"	"p.(Ala332_Gly337dup)"	""
"0001089518"	"00026061"	"90"	"1327"	"0"	"1346"	"0"	"c.1327_1346del"	"r.(?)"	"p.(Asp443ProfsTer?)"	"10"
"0001089519"	"00026061"	"70"	"1393"	"0"	"1393"	"0"	"c.1393G>A"	"r.(?)"	"p.(Ala465Thr)"	""
"0001089520"	"00026061"	"90"	"1412"	"0"	"1412"	"0"	"c.1412C>A"	"r.(?)"	"p.(Ser471Ter)"	""
"0001089521"	"00026061"	"90"	"1135"	"0"	"1135"	"0"	"c.1135G>A"	"r.(?)"	"p.(Glu379Lys)"	""
"0001089522"	"00026061"	"90"	"1160"	"-1"	"1160"	"-1"	"c.1160-1G>A"	"r.(1160_1300del)"	"p.(Thr388_Gly434del)"	""
"0001089523"	"00026061"	"90"	"112"	"0"	"112"	"0"	"c.112G>T"	"r.(?)"	"p.(Glu38Ter)"	""
"0001089526"	"00026061"	"90"	"866"	"0"	"866"	"0"	"c.866A>C"	"r.(?)"	"p.(Glu289Ala)"	""
"0001089527"	"00026061"	"90"	"866"	"0"	"866"	"0"	"c.866A>C"	"r.(?)"	"p.(Glu289Ala)"	""
"0001089528"	"00026061"	"90"	"866"	"0"	"866"	"0"	"c.866A>C"	"r.(?)"	"p.(Glu289Ala)"	""
"0001089529"	"00026061"	"90"	"866"	"0"	"866"	"0"	"c.866A>C"	"r.(?)"	"p.(Glu289Ala)"	""
"0001089530"	"00026061"	"90"	"401"	"0"	"401"	"0"	"c.401C>A"	"r.?"	"p.(Ala134Glu)"	""
"0001089531"	"00026061"	"90"	"457"	"0"	"457"	"0"	"c.457G>A"	"r.(?)"	"p.(Gly153Ser)"	""
"0001089532"	"00026061"	"90"	"0"	"0"	"0"	"0"	"c.?"	"r.?"	"p.?"	""
"0001089533"	"00026061"	"90"	"328"	"0"	"328"	"0"	"c.328C>T"	"r.(?)"	"p.(Gln110Ter)"	""
"0001089534"	"00026061"	"90"	"1160"	"-1"	"1160"	"-1"	"c.1160-1G>A"	"r.spl"	"p.?"	""
"0001089535"	"00026061"	"90"	"1160"	"-1"	"1160"	"-1"	"c.1160-1G>A"	"r.spl"	"p.?"	""
"0001089536"	"00026061"	"90"	"1160"	"-1"	"1160"	"-1"	"c.1160-1G>A"	"r.spl"	"p.?"	""
"0001089537"	"00026061"	"90"	"1160"	"-2"	"1160"	"-2"	"c.1160-2A>G"	"r.spl"	"p.?"	""
"0001089538"	"00026061"	"90"	"1160"	"-2"	"1160"	"-2"	"c.1160-2A>G"	"r.spl"	"p.?"	""
"0001089539"	"00026061"	"90"	"866"	"0"	"866"	"0"	"c.866A>C"	"r.(?)"	"p.(Glu289Ala)"	""
"0001089540"	"00026061"	"90"	"866"	"0"	"866"	"0"	"c.866A>C"	"r.(?)"	"p.(Glu289Ala)"	""
"0001089541"	"00026061"	"90"	"866"	"0"	"866"	"0"	"c.866A>C"	"r.(?)"	"p.(Glu289Ala)"	""
"0001089542"	"00026061"	"90"	"866"	"0"	"866"	"0"	"c.866A>C"	"r.(?)"	"p.(Glu289Ala)"	""
"0001089543"	"00026061"	"90"	"866"	"0"	"866"	"0"	"c.866A>C"	"r.(?)"	"p.(Glu289Ala)"	""
"0001089544"	"00026061"	"90"	"261"	"0"	"261"	"0"	"c.261G>T"	"r.(?)"	"p.(Glu87Asp)"	""
"0001089545"	"00026061"	"90"	"261"	"0"	"261"	"0"	"c.261G>T"	"r.(?)"	"p.(Glu87Asp)"	""
"0001089546"	"00026061"	"90"	"715"	"0"	"715"	"0"	"c.715G>A"	"r.(?)"	"p.(Ala239Thr)"	""
"0001089547"	"00026061"	"90"	"457"	"0"	"457"	"0"	"c.457G>A"	"r.(?)"	"p.(Gly153Ser)"	"5"
"0001089548"	"00026061"	"90"	"457"	"0"	"457"	"0"	"c.457G>A"	"r.(?)"	"p.(Gly153Ser)"	"5"
"0001089549"	"00026061"	"90"	"865"	"0"	"865"	"0"	"c.865G>A"	"r.(?)"	"p.(Glu289Lys)"	"5"
"0001089550"	"00026061"	"90"	"418"	"-1"	"418"	"-1"	"c.418-1G>A"	"r.spl"	"p.?"	"6"
"0001089551"	"00026061"	"90"	"131"	"0"	"131"	"0"	"c.131G>A"	"r.(?)"	"p.(Arg44Gln)"	"6"
"0001089552"	"00026061"	"90"	"131"	"0"	"131"	"0"	"c.131G>A"	"r.(?)"	"p.(Arg44Gln)"	"6"
"0001089553"	"00026061"	"90"	"478"	"0"	"478"	"0"	"c.478T>C"	"r.(?)"	"p.(Ser160Pro)"	"6"
"0001089554"	"00026061"	"90"	"1282"	"0"	"1282"	"0"	"c.1282G>A"	"r.(?)"	"p.(Gly428Ser)"	"6"
"0001089555"	"00026061"	"90"	"467"	"0"	"467"	"0"	"c.467A>G"	"r.(?)"	"p.(Asp156Gly)"	"6"
"0001089556"	"00026061"	"90"	"1067"	"0"	"1067"	"0"	"c.1067T>C"	"r.(?)"	"p.(Leu356Pro)"	"6"
"0001089557"	"00026061"	"90"	"1112"	"0"	"1112"	"0"	"c.1112T>C"	"r.(?)"	"p.(Leu371Pro)"	"6"
"0001089558"	"00026061"	"90"	"1112"	"0"	"1112"	"0"	"c.1112T>C"	"r.(?)"	"p.(Leu371Pro)"	"6"
"0001089559"	"00026061"	"90"	"112"	"0"	"112"	"0"	"c.112G>T"	"r.(?)"	"p.(Glu38Ter)"	"6"
"0001089560"	"00026061"	"90"	"0"	"0"	"0"	"0"	"c.?"	"r.?"	"p.?"	""
"0001089561"	"00026061"	"90"	"1159"	"0"	"1159"	"0"	"c.1159G>A"	"r.(?)"	"p.(Gly387Ser)"	""
"0001089562"	"00026061"	"90"	"1159"	"0"	"1159"	"0"	"c.1159G>A"	"r.(?)"	"p.(Gly387Ser)"	""
"0001089563"	"00026061"	"90"	"1160"	"-1"	"1160"	"-1"	"c.1160-1G>A"	"r.spl"	"p.?"	""
"0001089564"	"00026061"	"90"	"1160"	"-1"	"1160"	"-1"	"c.1160-1G>A"	"r.spl"	"p.?"	""
"0001089565"	"00026061"	"90"	"1160"	"-1"	"1160"	"-1"	"c.1160-1G>A"	"r.spl"	"p.?"	""
"0001089566"	"00026061"	"90"	"263"	"0"	"264"	"0"	"c.263_264del"	"r.(?)"	"p.(Thr88IlefsTer35)"	""
"0001089567"	"00026061"	"90"	"866"	"0"	"866"	"0"	"c.866A>C"	"r.(?)"	"p.(Glu289Ala)"	"5"
"0001089568"	"00026061"	"90"	"866"	"0"	"866"	"0"	"c.866A>C"	"r.(?)"	"p.(Glu289Ala)"	"5"
"0001089569"	"00026061"	"90"	"854"	"0"	"854"	"0"	"c.854T>C"	"r.(?)"	"p.(Leu285Pro)"	"5"
"0001089570"	"00026061"	"90"	"418"	"-1"	"418"	"-1"	"c.418-1G>A"	"r.spl"	"p.?"	"5"
"0001089571"	"00026061"	"90"	"146"	"0"	"146"	"0"	"c.146T>G"	"r.(?)"	"p.(Leu49Arg)"	"5"
"0001089572"	"00026061"	"90"	"0"	"0"	"0"	"0"	"c.?"	"r.?"	"p.?"	"6"
"0001089573"	"00026061"	"90"	"854"	"0"	"854"	"0"	"c.854T>C"	"r.(?)"	"p.(Leu285Pro)"	"6"
"0001089574"	"00026061"	"90"	"854"	"0"	"854"	"0"	"c.854T>C"	"r.(?)"	"p.(Leu285Pro)"	"6"
"0001089575"	"00026061"	"90"	"433"	"0"	"433"	"0"	"c.433G>A"	"r.(?)"	"p.(Gly145Arg)"	"6"
"0001089576"	"00026061"	"90"	"433"	"0"	"433"	"0"	"c.433G>A"	"r.(?)"	"p.(Gly145Arg)"	"6"
"0001089577"	"00026061"	"90"	"433"	"0"	"433"	"0"	"c.433G>A"	"r.(?)"	"p.(Gly145Arg)"	"6"
"0001089578"	"00026061"	"90"	"433"	"0"	"433"	"0"	"c.433G>A"	"r.(?)"	"p.(Gly145Arg)"	"6"
"0001089579"	"00026061"	"90"	"433"	"0"	"433"	"0"	"c.433G>A"	"r.(?)"	"p.(Gly145Arg)"	"6"
"0001089580"	"00026061"	"90"	"518"	"0"	"518"	"0"	"c.518T>G"	"r.(?)"	"p.(Met173Arg)"	""
"0001089581"	"00026061"	"90"	"518"	"0"	"518"	"0"	"c.518T>G"	"r.(?)"	"p.(Met173Arg)"	""
"0001089582"	"00026061"	"90"	"518"	"0"	"518"	"0"	"c.518T>G"	"r.(?)"	"p.(Met173Arg)"	""
"0001089583"	"00026061"	"90"	"1327"	"0"	"1346"	"0"	"c.1327_1346del"	"r.(?)"	"p.(Asp443ProfsTer?)"	""
"0001089584"	"00026061"	"90"	"516"	"2"	"516"	"2"	"c.516+2T>C"	"r.spl"	"p.?"	""
"0001089585"	"00026061"	"90"	"433"	"0"	"433"	"0"	"c.433G>A"	"r.(?)"	"p.(Gly145Arg)"	""
"0001089586"	"00026061"	"90"	"433"	"0"	"433"	"0"	"c.433G>A"	"r.(?)"	"p.(Gly145Arg)"	""
"0001089587"	"00026061"	"90"	"433"	"0"	"433"	"0"	"c.433G>A"	"r.(?)"	"p.(Gly145Arg)"	""
"0001089588"	"00026061"	"90"	"433"	"0"	"433"	"0"	"c.433G>A"	"r.(?)"	"p.(Gly145Arg)"	""
"0001089589"	"00026061"	"90"	"938"	"0"	"938"	"0"	"c.938T>C"	"r.(?)"	"p.(Leu313Pro)"	""
"0001089590"	"00026061"	"90"	"1211"	"0"	"1211"	"0"	"c.1211dup"	"r.(?)"	"p.(Gly405ArgfsTer?)"	""
"0001089591"	"00026061"	"90"	"1211"	"0"	"1211"	"0"	"c.1211dup"	"r.(?)"	"p.(Gly405ArgfsTer?)"	""
"0001089592"	"00026061"	"90"	"1318"	"0"	"1318"	"0"	"c.1318dup"	"r.(?)"	"p.(Val440GlyfsTer?)"	""
"0001089593"	"00026061"	"90"	"1401"	"0"	"1401"	"0"	"c.1401C>A"	"r.(?)"	"p.(Phe467Leu)"	""
"0001089594"	"00026061"	"90"	"1327"	"0"	"1346"	"0"	"c.1327_1346del"	"r.(?)"	"p.(Asp443ProfsTer?)"	""
"0001089595"	"00026061"	"90"	"893"	"0"	"893"	"0"	"c.893G>A"	"r.(?)"	"p.(Gly298Asp)"	""
"0001089596"	"00026061"	"90"	"647"	"0"	"647"	"0"	"c.647C>T"	"r.(?)"	"p.(Ala216Val)"	""
"0001089597"	"00026061"	"90"	"99"	"0"	"99"	"0"	"c.99dup"	"r.(?)"	"p.(Lys34GlnfsTer90)"	""
"0001089598"	"00026061"	"90"	"1327"	"0"	"1346"	"0"	"c.1327_1346del"	"r.(?)"	"p.(Asp443ProfsTer?)"	""
"0001089599"	"00026061"	"90"	"1327"	"0"	"1346"	"0"	"c.1327_1346del"	"r.(?)"	"p.(Asp443ProfsTer?)"	""
"0001089600"	"00026061"	"90"	"931"	"0"	"931"	"0"	"c.931G>T"	"r.(?)"	"p.(Gly311Cys)"	""
"0001089601"	"00026061"	"90"	"1010"	"0"	"1019"	"0"	"c.1010_1019delinAA"	"r.(?)"	"p.(Gly337GlufsTer?)"	""
"0001089602"	"00026061"	"90"	"1381"	"0"	"1381"	"0"	"c.1381dup"	"r.(?)"	"p.(Leu461ProfsTer?)"	""
"0001089603"	"00026061"	"90"	"1394"	"0"	"1400"	"0"	"c.1394_1400del"	"r.(?)"	"p.(Phe467ProfsTer?)"	""
"0001089604"	"00026061"	"90"	"623"	"0"	"623"	"0"	"c.623T>G"	"r.?"	"p.(Val208Gly)"	""
"0001089605"	"00026061"	"90"	"866"	"0"	"866"	"0"	"c.866A>C"	"r.(?)"	"p.(Glu289Ala)"	""
"0001089606"	"00026061"	"90"	"1360"	"0"	"1360"	"0"	"c.1360G>C"	"r.(?)"	"p.(Ala454Pro)"	""
"0001089607"	"00026061"	"90"	"1160"	"-1"	"1160"	"-1"	"c.1160-1G>C"	"r.spl"	"p.?"	""
"0001089608"	"00026061"	"90"	"530"	"0"	"530"	"0"	"c.530T>C"	"r.(?)"	"p.(Leu177Pro)"	""
"0001089609"	"00026061"	"90"	"340"	"0"	"340"	"0"	"c.340G>A"	"r.(?)"	"p.(Asp114Asn)"	""
"0001089610"	"00026061"	"90"	"0"	"0"	"0"	"0"	"c.?"	"r.?"	"p.?"	""
"0001089611"	"00026061"	"90"	"517"	"-1"	"517"	"-1"	"c.517-1G>A"	"r.spl"	"p.?"	""
"0001089612"	"00026061"	"90"	"418"	"-1"	"418"	"-1"	"c.418-1G>C"	"r.spl"	"p.?"	""
"0001089613"	"00026061"	"90"	"1301"	"-1"	"1301"	"-1"	"c.1301-1G>A"	"r.spl"	"p.?"	""
"0001089614"	"00026061"	"90"	"1301"	"-1"	"1301"	"-1"	"c.1301-1G>A"	"r.spl"	"p.?"	""
"0001089615"	"00026061"	"90"	"199"	"0"	"199"	"0"	"c.199C>T"	"r.(?)"	"p.(Gln67Ter)"	""
"0001089616"	"00026061"	"90"	"866"	"0"	"866"	"0"	"c.866A>C"	"r.(?)"	"p.(Glu289Ala)"	""
"0001089617"	"00026061"	"90"	"1040"	"0"	"1040"	"0"	"c.1040T>C"	"r.(?)"	"p.(Leu347Pro)"	""
"0001089618"	"00026061"	"90"	"451"	"0"	"451"	"0"	"c.451A>C"	"r.(?)"	"p.(Thr151Pro)"	""
"0001089619"	"00026061"	"90"	"809"	"0"	"809"	"0"	"c.809T>C"	"r.(?)"	"p.(Leu270Pro)"	""
"0001089620"	"00026061"	"90"	"215"	"-1"	"215"	"-1"	"c.215-1G>C"	"r.spl"	"p.?"	""
"0001089621"	"00026061"	"90"	"1211"	"0"	"1211"	"0"	"c.1211T>C"	"r.(?)"	"p.(Leu404Pro)"	""
"0001089622"	"00026061"	"90"	"833"	"0"	"833"	"0"	"c.833G>A"	"r.(?)"	"p.(Gly278Asp)"	""
"0001089623"	"00026061"	"90"	"217"	"0"	"217"	"0"	"c.217G>A"	"r.(?)"	"p.(Ala73Thr)"	""
"0001089624"	"00026061"	"90"	"763"	"0"	"765"	"0"	"c.763_765del"	"r.(?)"	"p.(Leu255del)"	"5"
"0001089625"	"00026061"	"90"	"628"	"0"	"628"	"0"	"c.628A>C"	"r.(?)"	"p.(Ser210Arg)"	""
"0001089626"	"00026061"	"90"	"646"	"1"	"646"	"1"	"c.646+1G>A"	"r.spl"	"p.?"	"5i"
"0001089627"	"00026061"	"90"	"215"	"-13"	"215"	"0"	"c.215-13_215delinsGCGTGA"	"r.spl"	"p.?"	"2i_2"
"0001089628"	"00026061"	"90"	"1159"	"2"	"1159"	"2"	"c.1159+2T>A"	"r.spl"	"p.?"	"8i"
"0001089629"	"00026061"	"90"	"866"	"0"	"866"	"0"	"c.866A>C"	"r.(?)"	"p.(Glu289Ala)"	""
"0001089630"	"00026061"	"90"	"866"	"0"	"866"	"0"	"c.866A>C"	"r.(?)"	"p.(Glu289Ala)"	""
"0001089633"	"00026061"	"90"	"1211"	"0"	"1211"	"0"	"c.1211dup"	"r.(?)"	"p.(Gly405ArgfsTer?)"	""
"0001089634"	"00026061"	"90"	"854"	"0"	"854"	"0"	"c.854T>C"	"r.(?)"	"p.(Leu285Pro)"	""
"0001089635"	"00026061"	"90"	"0"	"0"	"0"	"0"	"c.?"	"r.?"	"p.?"	""
"0001089636"	"00026061"	"90"	"994"	"0"	"1011"	"0"	"c.994_1011dup"	"r.(?)"	"p.(Ala332_Gly337dup)"	""
"0001089637"	"00026061"	"90"	"1327"	"0"	"1346"	"0"	"c.1327_1346del"	"r.(?)"	"p.(Asp443ProfsTer?)"	""
"0001089638"	"00026061"	"90"	"457"	"0"	"457"	"0"	"c.457G>A"	"r.(?)"	"p.(Gly153Ser)"	""
"0001089639"	"00026061"	"90"	"275"	"0"	"275"	"0"	"c.275C>A"	"r.(?)"	"p.(Thr92Asn)"	""
"0001089640"	"00026061"	"90"	"215"	"-1"	"215"	"-1"	"c.215-1G>C"	"r.(?)"	"p.?"	""
"0001089641"	"00026061"	"90"	"275"	"0"	"275"	"0"	"c.275C>A"	"r.(?)"	"p.(Thr92Asn)"	""
"0001089642"	"00026061"	"90"	"0"	"0"	"0"	"0"	"c.?"	"r.?"	"p.?"	""
"0001089643"	"00026061"	"90"	"1249"	"0"	"1249"	"0"	"c.1249dup"	"r.(?)"	"p.(Leu417ProfsTer?)"	""
"0001089644"	"00026061"	"90"	"418"	"-1"	"418"	"-1"	"c.418-1G>T"	"r.spl"	"p.?"	""
"0001089645"	"00026061"	"90"	"1416"	"0"	"1416"	"0"	"c.1416del"	"r.(?)"	"p.(Phe473SerfsTer?)"	""
"0001089646"	"00026061"	"90"	"866"	"0"	"866"	"0"	"c.866A>C"	"r.(?)"	"p.(Glu289Ala)"	""
"0001089647"	"00026061"	"90"	"1160"	"-1"	"1160"	"-1"	"c.1160-1G>A"	"r.spl"	"p.?"	""
"0001089648"	"00026061"	"90"	"1160"	"-1"	"1160"	"-1"	"c.1160-1G>A"	"r.spl"	"p.?"	""
"0001089649"	"00026061"	"90"	"1327"	"0"	"1346"	"0"	"c.1327_1346del"	"r.(?)"	"p.(Asp443ProfsTer?)"	""
"0001089650"	"00026061"	"90"	"215"	"-13"	"215"	"0"	"c.215-13_215delinsGCGTGA"	"r.spl"	"p.?"	""
"0001089651"	"00026061"	"90"	"866"	"0"	"866"	"0"	"c.866A>C"	"r.(?)"	"p.(Glu289Ala)"	""
"0001089652"	"00026061"	"90"	"1327"	"0"	"1346"	"0"	"c.1327_1346del"	"r.(?)"	"p.(Asp443ProfsTer?)"	""
"0001089653"	"00026061"	"90"	"689"	"0"	"689"	"0"	"c.689T>C"	"r.(?)"	"p.(Leu230Pro)"	""
"0001089654"	"00026061"	"90"	"433"	"0"	"433"	"0"	"c.433G>A"	"r.(?)"	"p.(Gly145Arg)"	"5"
"0001089655"	"00026061"	"90"	"866"	"0"	"866"	"0"	"c.866A>C"	"r.(?)"	"p.(Glu289Ala)"	"5"
"0001089656"	"00026061"	"90"	"1381"	"0"	"1381"	"0"	"c.1381dup"	"r.(?)"	"p.(Leu461ProfsTer?)"	"5"
"0001089657"	"00026061"	"90"	"866"	"0"	"866"	"0"	"c.866A>C"	"r.(?)"	"p.(Glu289Ala)"	"6"
"0001089658"	"00026061"	"90"	"866"	"0"	"866"	"0"	"c.866A>C"	"r.(?)"	"p.(Glu289Ala)"	"6"
"0001089659"	"00026061"	"90"	"1198"	"0"	"1203"	"0"	"c.1198_1203del"	"r.(?)"	"p.(Val400_Leu401del)"	"6"
"0001089660"	"00026061"	"90"	"1159"	"2"	"1159"	"2"	"c.1159+2T>A"	"r.spl"	"p.?"	"6"
"0001089661"	"00026061"	"90"	"1112"	"0"	"1112"	"0"	"c.1112T>C"	"r.(?)"	"p.(Leu371Pro)"	"6"
"0001089663"	"00026061"	"90"	"1416"	"0"	"1416"	"0"	"c.1416del"	"r.1416del"	"p.Phe473Serfs*?"	""
"0001089664"	"00026061"	"10"	"972"	"0"	"972"	"0"	"c.972C>T"	"r.(972C>T)"	"p.(Ala324=)"	""
"0001089665"	"00026061"	"30"	"1393"	"0"	"1393"	"0"	"c.1393G>A"	"r.(1393G>A)"	"-"	""
"0001089666"	"00026061"	"90"	"215"	"-1"	"215"	"-1"	"c.215-1G>C"	"r.spl"	"p.?"	"2i"
"0001089668"	"00026061"	"90"	"467"	"0"	"467"	"0"	"c.467A>G"	"r.(?)"	"p.(Asp156Gly)"	""
"0001089669"	"00026061"	"90"	"433"	"0"	"433"	"0"	"c.433G>A"	"r.(?)"	"p.(Gly145Arg)"	""
"0001089670"	"00026061"	"90"	"1282"	"0"	"1282"	"0"	"c.1282G>A"	"r.(?)"	"p.(Gly428Ser)"	""
"0001089671"	"00026061"	"90"	"457"	"0"	"457"	"0"	"c.457G>A"	"r.(?)"	"p.(Gly153Ser)"	""
"0001089672"	"00026061"	"90"	"457"	"0"	"457"	"0"	"c.457G>A"	"r.(?)"	"p.(Gly153Ser)"	""
"0001089673"	"00026061"	"90"	"128"	"0"	"128"	"0"	"c.128A>C"	"r.(?)"	"p.(Lys43Thr)"	""
"0001089674"	"00026061"	"90"	"457"	"0"	"457"	"0"	"c.457G>A"	"r.(?)"	"p.(Gly153Ser)"	""
"0001089675"	"00026061"	"90"	"613"	"0"	"613"	"0"	"c.613A>C"	"r.(?)"	"p.(Thr205Pro)"	""
"0001089676"	"00026061"	"90"	"866"	"0"	"866"	"0"	"c.866A>G"	"r.(?)"	"p.(Glu289Gly)"	""
"0001089677"	"00026061"	"90"	"215"	"-1"	"215"	"-1"	"c.215-1G>C"	"r.spl"	"p.?"	""
"0001089678"	"00026061"	"90"	"938"	"0"	"938"	"0"	"c.938T>C"	"r.(?)"	"p.(Leu313Pro)"	""
"0001089679"	"00026061"	"90"	"1211"	"0"	"1211"	"0"	"c.1211dup"	"r.(?)"	"p.(Gly405ArgfsTer?)"	""
"0001089680"	"00026061"	"90"	"1211"	"0"	"1211"	"0"	"c.1211dup"	"r.(?)"	"p.(Gly405ArgfsTer?)"	""
"0001089681"	"00026061"	"90"	"530"	"0"	"530"	"0"	"c.530T>C"	"r.(?)"	"p.(Leu177Pro)"	""
"0001089682"	"00026061"	"90"	"215"	"-40"	"215"	"-40"	"c.215-40G>A"	"r.spl?"	"p.?"	""
"0001089683"	"00026061"	"90"	"215"	"-1"	"215"	"-1"	"c.215-1G>C"	"r.spl"	"p.?"	""


## Screenings_To_Variants ## Do not remove or alter this header ##
## Count = 275
"{{screeningid}}"	"{{variantid}}"
"0000037371"	"0000064496"
"0000037372"	"0000064497"
"0000037373"	"0000064498"
"0000037374"	"0000064499"
"0000037375"	"0000064500"
"0000037376"	"0000064501"
"0000037377"	"0000064502"
"0000037378"	"0000064503"
"0000050373"	"0000079353"
"0000226677"	"0000459017"
"0000251294"	"0000580727"
"0000251294"	"0000580728"
"0000251295"	"0000580729"
"0000251296"	"0000580730"
"0000251297"	"0000580731"
"0000294326"	"0000651015"
"0000294327"	"0000651016"
"0000294328"	"0000651017"
"0000297720"	"0000660329"
"0000321337"	"0000704166"
"0000471151"	"0001059273"
"0000471152"	"0001059274"
"0000474804"	"0001069202"
"0000475095"	"0001069491"
"0000475114"	"0001069510"
"0000478552"	"0001074283"
"0000486246"	"0001089084"
"0000486332"	"0001089254"
"0000486333"	"0001089255"
"0000486333"	"0001089266"
"0000486334"	"0001089256"
"0000486335"	"0001089257"
"0000486335"	"0001089267"
"0000486336"	"0001089258"
"0000486337"	"0001089259"
"0000486338"	"0001089260"
"0000486338"	"0001089268"
"0000486339"	"0001089261"
"0000486339"	"0001089269"
"0000486340"	"0001089262"
"0000486340"	"0001089270"
"0000486341"	"0001089263"
"0000486341"	"0001089271"
"0000486342"	"0001089264"
"0000486342"	"0001089272"
"0000486343"	"0001089265"
"0000486344"	"0001089273"
"0000486345"	"0001089274"
"0000486345"	"0001089282"
"0000486346"	"0001089275"
"0000486347"	"0001089276"
"0000486348"	"0001089277"
"0000486349"	"0001089278"
"0000486350"	"0001089279"
"0000486351"	"0001089280"
"0000486352"	"0001089281"
"0000486353"	"0001089283"
"0000486354"	"0001089284"
"0000486355"	"0001089285"
"0000486355"	"0001089286"
"0000486356"	"0001089287"
"0000486356"	"0001089288"
"0000486357"	"0001089289"
"0000486357"	"0001089290"
"0000486358"	"0001089291"
"0000486358"	"0001089292"
"0000486359"	"0001089293"
"0000486359"	"0001089294"
"0000486360"	"0001089295"
"0000486361"	"0001089296"
"0000486362"	"0001089297"
"0000486363"	"0001089298"
"0000486364"	"0001089299"
"0000486365"	"0001089300"
"0000486462"	"0001089397"
"0000486468"	"0001089459"
"0000486468"	"0001089460"
"0000486469"	"0001089462"
"0000486470"	"0001089465"
"0000486470"	"0001089466"
"0000486471"	"0001089468"
"0000486478"	"0001089478"
"0000486479"	"0001089479"
"0000486479"	"0001089488"
"0000486480"	"0001089480"
"0000486481"	"0001089481"
"0000486481"	"0001089483"
"0000486481"	"0001089489"
"0000486482"	"0001089482"
"0000486483"	"0001089484"
"0000486483"	"0001089485"
"0000486483"	"0001089486"
"0000486483"	"0001089487"
"0000486484"	"0001089490"
"0000486484"	"0001089498"
"0000486485"	"0001089491"
"0000486485"	"0001089499"
"0000486486"	"0001089492"
"0000486486"	"0001089500"
"0000486487"	"0001089493"
"0000486487"	"0001089501"
"0000486488"	"0001089494"
"0000486489"	"0001089495"
"0000486490"	"0001089496"
"0000486491"	"0001089497"
"0000486491"	"0001089502"
"0000486492"	"0001089503"
"0000486493"	"0001089504"
"0000486494"	"0001089505"
"0000486495"	"0001089506"
"0000486496"	"0001089507"
"0000486497"	"0001089508"
"0000486498"	"0001089509"
"0000486499"	"0001089511"
"0000486500"	"0001089512"
"0000486501"	"0001089518"
"0000486502"	"0001089519"
"0000486503"	"0001089520"
"0000486504"	"0001089521"
"0000486504"	"0001089522"
"0000486505"	"0001089523"
"0000486506"	"0001089526"
"0000486507"	"0001089527"
"0000486508"	"0001089528"
"0000486509"	"0001089529"
"0000486510"	"0001089530"
"0000486511"	"0001089531"
"0000486512"	"0001089532"
"0000486513"	"0001089533"
"0000486514"	"0001089534"
"0000486515"	"0001089535"
"0000486516"	"0001089536"
"0000486517"	"0001089537"
"0000486518"	"0001089538"
"0000486518"	"0001089602"
"0000486519"	"0001089539"
"0000486519"	"0001089603"
"0000486520"	"0001089540"
"0000486521"	"0001089541"
"0000486522"	"0001089542"
"0000486523"	"0001089543"
"0000486524"	"0001089544"
"0000486525"	"0001089545"
"0000486526"	"0001089546"
"0000486526"	"0001089604"
"0000486527"	"0001089547"
"0000486528"	"0001089548"
"0000486528"	"0001089605"
"0000486529"	"0001089549"
"0000486529"	"0001089606"
"0000486530"	"0001089550"
"0000486530"	"0001089607"
"0000486531"	"0001089551"
"0000486532"	"0001089552"
"0000486533"	"0001089553"
"0000486534"	"0001089554"
"0000486535"	"0001089555"
"0000486535"	"0001089608"
"0000486536"	"0001089556"
"0000486537"	"0001089557"
"0000486538"	"0001089558"
"0000486539"	"0001089559"
"0000486540"	"0001089560"
"0000486541"	"0001089561"
"0000486542"	"0001089562"
"0000486543"	"0001089563"
"0000486544"	"0001089564"
"0000486545"	"0001089565"
"0000486546"	"0001089566"
"0000486547"	"0001089567"
"0000486548"	"0001089568"
"0000486549"	"0001089569"
"0000486550"	"0001089570"
"0000486551"	"0001089571"
"0000486551"	"0001089609"
"0000486552"	"0001089572"
"0000486552"	"0001089610"
"0000486553"	"0001089573"
"0000486554"	"0001089574"
"0000486555"	"0001089575"
"0000486556"	"0001089576"
"0000486557"	"0001089577"
"0000486557"	"0001089611"
"0000486558"	"0001089578"
"0000486559"	"0001089579"
"0000486560"	"0001089580"
"0000486561"	"0001089581"
"0000486562"	"0001089582"
"0000486563"	"0001089583"
"0000486564"	"0001089584"
"0000486565"	"0001089585"
"0000486565"	"0001089612"
"0000486566"	"0001089586"
"0000486567"	"0001089587"
"0000486568"	"0001089588"
"0000486569"	"0001089589"
"0000486570"	"0001089590"
"0000486571"	"0001089591"
"0000486572"	"0001089592"
"0000486572"	"0001089613"
"0000486573"	"0001089593"
"0000486574"	"0001089594"
"0000486575"	"0001089595"
"0000486576"	"0001089596"
"0000486577"	"0001089597"
"0000486578"	"0001089598"
"0000486579"	"0001089599"
"0000486580"	"0001089600"
"0000486580"	"0001089614"
"0000486581"	"0001089601"
"0000486582"	"0001089615"
"0000486582"	"0001089616"
"0000486583"	"0001089617"
"0000486584"	"0001089618"
"0000486584"	"0001089619"
"0000486585"	"0001089620"
"0000486585"	"0001089621"
"0000486586"	"0001089622"
"0000486587"	"0001089623"
"0000486589"	"0001089624"
"0000486589"	"0001089625"
"0000486590"	"0001089626"
"0000486591"	"0001089627"
"0000486591"	"0001089628"
"0000486592"	"0001089629"
"0000486593"	"0001089630"
"0000486594"	"0001089633"
"0000486595"	"0001089634"
"0000486596"	"0001089635"
"0000486596"	"0001089656"
"0000486597"	"0001089636"
"0000486598"	"0001089637"
"0000486599"	"0001089638"
"0000486599"	"0001089657"
"0000486600"	"0001089639"
"0000486601"	"0001089640"
"0000486601"	"0001089658"
"0000486602"	"0001089641"
"0000486603"	"0001089642"
"0000486603"	"0001089659"
"0000486604"	"0001089643"
"0000486605"	"0001089644"
"0000486606"	"0001089645"
"0000486607"	"0001089646"
"0000486608"	"0001089647"
"0000486609"	"0001089648"
"0000486610"	"0001089649"
"0000486611"	"0001089650"
"0000486611"	"0001089660"
"0000486612"	"0001089651"
"0000486613"	"0001089652"
"0000486614"	"0001089653"
"0000486614"	"0001089661"
"0000486615"	"0001089654"
"0000486616"	"0001089655"
"0000486617"	"0001089663"
"0000486617"	"0001089664"
"0000486617"	"0001089665"
"0000486618"	"0001089666"
"0000486619"	"0001089668"
"0000486619"	"0001089681"
"0000486620"	"0001089669"
"0000486621"	"0001089670"
"0000486622"	"0001089671"
"0000486623"	"0001089672"
"0000486624"	"0001089673"
"0000486624"	"0001089682"
"0000486625"	"0001089674"
"0000486626"	"0001089675"
"0000486627"	"0001089676"
"0000486627"	"0001089683"
"0000486628"	"0001089677"
"0000486629"	"0001089678"
"0000486630"	"0001089679"
"0000486631"	"0001089680"