### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = VPS13B) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "VPS13B" "vacuolar protein sorting 13 homolog B (yeast)" "8" "q22-q23" "unknown" "NG_007098.2" "UD_132085332582" "" "https://www.LOVD.nl/VPS13B" "Finnish Disease Database (FinDis) " "1" "2183" "157680" "607817" "1" "1" "1" "1" "The establishment of this gene variant database (LSDB) was supported by the European Community\'s Seventh Framework Programme (FP7/2007-2013) under grant agreement nº 200754 - the GEN2PHEN project.\r\n\r\nThis database was initially part of the Finnish Disease Resource (FinDis; Polvi et al: Hum Mutat. 2013:34:1458-66). We gratefully acknowledge the support of Juha Muilu acting as curator until 2015." "" "g" "http://databases.lovd.nl/shared/refseq/VPS13B_codingDNA.html" "1" "" "" "-1" "" "-1" "00008" "2012-06-27 00:00:00" "00006" "2019-07-21 20:45:56" "00000" "2025-11-01 13:22:20" ## Transcripts ## Do not remove or alter this header ## ## Count = 2 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00000245" "VPS13B" "transcript variant 5" "002" "NM_017890.3" "" "NP_060360.3" "" "" "" "-111" "13983" "12069" "100025494" "100889808" "00008" "2012-06-27 09:59:08" "" "" "00025898" "VPS13B" "transcript variant 1" "002" "NM_152564.4" "" "NP_689777.3" "" "" "" "-111" "13914" "11994" "100025494" "100889814" "00006" "2024-01-25 15:54:45" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 8 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00085" "COH1" "Cohen syndrome, type 1" "AD" "216550" "" "bushy eyebrows and eyelashes, down-slanting palpebral fissures with a wave-shaped outline, high nasal bridge, low-set columella, and a short, upturned philtrum with prominent central incisors; global developmental delay (HP:0001263); intellectual disability (HP:0001249); seizure (HP:0001250); hypotonia (HP:0001252); short stature (HP:0004322); obesity (HP:0001513); digital abnormalities (HP_0011297); high myopia and retinal dystrophy, narrow hands with slender fingers, narrow feet with sandal gap, pubertal delay and neutropenia" "" "00015" "2012-11-16 14:42:10" "00006" "2023-01-03 20:46:21" "00139" "ID" "intellectual disability (ID)" "" "" "" "" "" "00084" "2013-06-04 18:18:07" "00006" "2015-02-09 10:02:49" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "01157" "CHTE" "Hypothyroidism, central, testicular enlargement (CHTE)" "XLR" "300888" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "04214" "-" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00001" "2023-03-09 14:26:26" "04249" "macular dystrophy" "dystrophy, macular" "" "" "" "" "" "00006" "2015-05-04 22:10:58" "00006" "2024-02-15 21:18:39" "05421" "microcephaly" "microcephaly" "" "" "" "" "" "00006" "2018-04-15 11:41:15" "" "" "05611" "NDD" "neurodevelopmental disorder (NDD)" "" "" "" "" "" "00006" "2019-06-19 12:27:20" "00006" "2024-12-13 11:12:21" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 2 "{{geneid}}" "{{diseaseid}}" "VPS13B" "00085" "VPS13B" "00139" ## Individuals ## Do not remove or alter this header ## ## Count = 88 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00000208" "" "" "" "1" "" "00037" "{PMID:Sun 2011:23143598}, {DOI:Sun 2011:10.1038/ng.2453}" "" "M" "no" "Netherlands" "" "0" "" "" "" "" "00000209" "" "" "" "1" "" "00037" "{PMID:Sun 2011:23143598}, {DOI:Sun 2011:10.1038/ng.2453}" "" "M" "no" "Netherlands" "" "0" "" "" "" "" "00024235" "" "" "" "1" "" "00006" "{PMID:Gilissen 2014:24896178}" "" "" "" "" "" "0" "" "" "" "" "00050518" "" "" "" "1" "" "00006" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "family, 1 affected" "M" "" "United Kingdom (Great Britain)" "" "0" "Decipher" "" "" "" "00050555" "" "" "" "1" "" "00006" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "family, 1 affected" "M" "" "United Kingdom (Great Britain)" "" "0" "Decipher" "" "" "" "00131879" "" "" "" "1" "" "01741" "" "" "" "" "Germany" "" "0" "" "" "" "" "00150183" "" "" "" "2" "" "00006" "{PMID:Karaca 2015:26539891}" "" "" "" "" "" "0" "family structure in paper" "" "" "26539891-FamBAB5552" "00150184" "" "" "" "1" "" "00006" "{PMID:Karaca 2015:26539891}" "" "" "" "" "" "0" "family structure in paper" "" "" "26539891-FamBAB5828" "00226217" "" "" "" "2" "" "00006" "{PMID:Parri 2010:20461111}, {DOI:Parri 2010:10.1038/ejhg.2010.59}" "2-generation family, affected brother/sister, unaffected heterozygous carrier parents" "M" "" "" "" "0" "" "" "" "Pat11A" "00226287" "" "" "" "1" "" "00006" "{PMID:Katzaki 2007:17990063}, {PMID:Parri 2010:20461111}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "no" "Italy" "" "0" "" "" "" "Pat1" "00226288" "" "" "" "1" "" "00006" "{PMID:Parri 2010:20461111}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "no" "" "" "0" "" "" "" "Pat2" "00226289" "" "" "" "1" "" "00006" "{PMID:Parri 2010:20461111}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "no" "" "" "0" "" "" "" "Pat3" "00226290" "" "" "" "1" "" "00006" "{PMID:Parri 2010:20461111}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "no" "" "" "0" "" "" "" "Pat4" "00226291" "" "" "" "1" "" "00006" "{PMID:Parri 2010:20461111}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "no" "Italy" "" "0" "" "" "" "Pat5" "00226292" "" "" "" "1" "" "00006" "{PMID:Parri 2010:20461111}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "no" "" "" "0" "" "" "" "Pat6" "00226293" "" "" "" "1" "" "00006" "{PMID:Parri 2010:20461111}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "no" "" "" "0" "" "" "" "Pat7" "00226294" "" "" "" "1" "" "00006" "{PMID:Katzaki 2007:17990063}, {PMID:Parri 2010:20461111}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "yes" "Italy" "" "0" "" "" "" "Pat8" "00226295" "" "" "" "2" "" "00006" "{PMID:Parri 2010:20461111}" "2-generation family, affected sisters, unaffected heterozygous carrier parents" "F" "no" "Italy" "" "0" "" "" "" "Pat9A" "00226296" "" "" "00226295" "1" "" "00006" "{PMID:Parri 2010:20461111}" "sister" "F" "no" "Italy" "" "0" "" "" "" "Pat9B" "00226297" "" "" "" "2" "" "00006" "{PMID:Parri 2010:20461111}" "2-generation family, affected brothers, unaffected heterozygous carrier parents" "M" "no" "" "" "0" "" "" "" "Pat10A" "00226298" "" "" "00226297" "1" "" "00006" "{PMID:Parri 2010:20461111}" "brother" "M" "no" "" "" "0" "" "" "" "Pat10B" "00226299" "" "" "00226217" "1" "" "00006" "{PMID:Parri 2010:20461111}" "sister" "M" "no" "" "" "0" "" "" "" "Pat11B" "00226316" "" "" "" "12" "" "00006" "{PMID:Bugiani 2008:18655112}, {PMID:Parri 2010:20461111}" "7-generation family, 12 affected" "F;M" "yes" "Greece" "" "0" "" "" "" "Fam" "00294522" "" "" "" "5" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294523" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294524" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294525" "" "" "" "2" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294526" "" "" "" "26" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294527" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294528" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294529" "" "" "" "3" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294530" "" "" "" "148" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294531" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294532" "" "" "" "30" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294533" "" "" "" "10" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294534" "" "" "" "4" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00295425" "" "" "" "3" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00300652" "" "" "" "1" "" "03664" "Huang 2020 (submitted)" "GWAS study 3D normal human faces in 2,659 individuals" "-" "" "China" "" "0" "" "" "Han" "" "00305172" "" "" "" "2" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00309513" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00317986" "" "" "" "1" "" "00006" "{PMID:Riazuddin 2017:27457812}" "" "" "yes" "Pakistan" "" "0" "" "" "" "PKMR42" "00325501" "" "" "" "1" "" "00006" "{PMID:Zenteno 2020:31736247}" "family" "" "" "Mexico" "" "0" "" "" "" "3723" "00328322" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Europe" "W000277" "00328510" "" "" "" "1" "" "00000" "{PMID:Taylor 2017:28341476}" "family history retinal disease" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "14017275" "00328511" "" "" "" "1" "" "00000" "{PMID:Taylor 2017:28341476}" "no family history retinal disease" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "14019897" "00331739" "" "" "" "1" "" "00000" "{PMID:Sanchez-Navarro 2018:29588463}" "" "" "" "Spain" "" "0" "" "" "" "RP-1430" "00334108" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "M" "" "(United States)" "" "0" "" "" "" "645" "00334109" "" "" "" "2" "" "00000" "{PMID:Stone 2017:28559085}" "family, 2 affected" "F" "" "(United States)" "" "0" "" "" "" "646" "00334110" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "M" "" "(United States)" "" "0" "" "" "" "647" "00335998" "" "" "" "2" "" "00000" "{PMID:Sergouniotis 2016:27628848}" "analysis 486 cases" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00358949" "" "" "" "1" "" "00000" "{PMID:Tiwari 2016:27353947}" "see paper" "F" "" "Switzerland" "" "0" "" "" "" "Case71674" "00358970" "" "" "" "1" "" "00000" "{PMID:Tiwari 2016:27353947}" "see paper" "F" "" "Switzerland" "" "0" "" "" "" "Case71161" "00358972" "" "" "" "1" "" "00000" "{PMID:Tiwari 2016:27353947}" "see paper" "M" "" "Switzerland" "" "0" "" "" "" "Case70559" "00361664" "" "" "" "1" "" "00006" "{PMID:Anazi 2017:27431290}" "familial" "M" "yes" "Saudi Arabia" "" "0" "" "" "" "12DG2122" "00362734" "" "" "" "1" "" "00006" "{PMID:Tsangaris 2011:21659346}" "" "" "" "Canada" "" "0" "" "" "" "" "00373843" "" "" "" "1" "" "00000" "{PMID:Zhao 2015:25472526}" "simplex case" "" "" "Northern Ireland" "" "0" "" "" "" "Rp83" "00383870" "" "" "" "1" "" "00000" "{PMID:Abu Diab 2019:30925032}" "" "F" "yes" "Israel" "" "0" "" "" "Arabic" "MOL0760 IV:1" "00383871" "" "" "" "1" "" "00000" "{PMID:Abu Diab 2019:30925032}" "" "F" "yes" "Israel" "" "0" "" "" "Arabic" "MOL0760 IV:4" "00385161" "" "" "" "1" "" "00000" "{PMID:Jiman 2020:31836858}" "" "F" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "52" "00387716" "" "" "" "3" "" "00006" "{PMID:Hu 2019:29302074}" "family, 3 affected individuals, second cousin parents" "" "yes" "Iran" "" "0" "" "" "Persia" "M120" "00387741" "" "" "" "2" "" "00006" "{PMID:Hu 2019:29302074}" "family, 2 affected individuals, first cousin parents" "" "yes" "Iran" "" "0" "" "" "Persia" "M256" "00387761" "" "" "" "2" "" "00006" "{PMID:Hu 2019:29302074}" "family, 2 affected individuals, first cousin parents" "" "yes" "Iran" "" "0" "" "" "Persia" "M339" "00387796" "" "" "" "4" "" "00006" "{PMID:Hu 2019:29302074}" "family, 4 affected individuals, first cousin parents" "" "yes" "" "" "0" "" "" "Arab" "M8600571" "00387799" "" "" "" "2" "" "00006" "{PMID:Hu 2019:29302074}" "family, 2 affected individuals, first cousin parents" "" "yes" "Iran" "" "0" "" "" "Persia" "M8700007" "00388823" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 49, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "107" "00389311" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 214, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "595" "00389312" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 214, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "596" "00389372" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 234, unclassified / mixed, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "656" "00389373" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 234, unclassified / mixed, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "657" "00389632" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 390, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "916" "00394810" "" "" "" "1" "" "00000" "{PMID:Kim 2021:33946315}" "" "?" "" "Korea, South (Republic)" "" "0" "" "" "" "207-280" "00395587" "" "" "" "1" "" "00000" "{PMID:Perea-Romero 2021:34448047}" "" "" "" "Spain" "" "0" "" "" "" "RP-1626" "00395606" "" "" "" "1" "" "00000" "{PMID:Perea-Romero 2021:34448047}" "" "" "" "Spain" "" "0" "" "" "" "RP-2879" "00396456" "" "" "" "1" "" "00006" "{PMID:Ellingford 2017:28378820}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "14017275" "00396457" "" "" "" "1" "" "00006" "{PMID:Ellingford 2017:28378820}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "14019897" "00426922" "" "" "" "1" "" "00000" "{PMID:Zhu 2022:35456422}" "family 27, individual 31" "M" "" "" "" "0" "" "" "" "27_31" "00433362" "" "" "" "2" "" "00006" "{PMID:Duerinckx 2021: 34402213}" "family, 2 affected brothers" "M" "yes" "Belgium" "" "0" "" "" "" "Pat31" "00440441" "" "" "" "1" "" "00006" "{PMID:Nambot 2018:29095811}" "" "" "" "France" "" "0" "" "" "" "PED3298.1" "00440451" "" "" "" "1" "" "00006" "{PMID:Nambot 2018:29095811}" "" "" "" "France" "" "0" "" "" "" "PED3072.1" "00444316" "" "" "" "1" "" "00006" "{PMID:Moon 2021:35052368}" "" "" "" "Korea" "" "0" "" "" "" "Pat87" "00447329" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "M" "" "Germany" "" "0" "" "" "" "SRP-1288" "00447568" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "F" "" "Germany" "" "0" "" "" "" "MISC-298" "00451168" "" "" "" "1" "" "00006" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "" "" "0" "" "" "" "071800" "00451203" "" "" "" "1" "" "00006" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "" "" "0" "" "" "" "072031" "00451305" "" "" "" "1" "" "00006" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "" "" "0" "" "" "" "074635" "00460935" "" "" "" "1" "" "04796" "" "" "" "" "Netherlands" "" "0" "" "" "" "" "00460936" "" "" "" "1" "" "04796" "" "" "" "" "Netherlands" "" "0" "" "" "" "" "00467791" "" "" "" "2" "" "00006" "{PMID:Charng 2016:27435318}" "family, 2 affected" "" "yes" "Saudi Arabia" "" "0" "" "" "" "Fam034PatBAB6835" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 89 "{{individualid}}" "{{diseaseid}}" "00000208" "01157" "00000209" "01157" "00024235" "00085" "00024235" "00139" "00050518" "00198" "00050555" "00198" "00131879" "00085" "00150183" "00198" "00150184" "00198" "00226217" "00085" "00226287" "00085" "00226288" "00085" "00226289" "00085" "00226290" "00085" "00226291" "00085" "00226292" "00085" "00226293" "00085" "00226294" "00085" "00226295" "00085" "00226296" "00085" "00226297" "00085" "00226298" "00085" "00226299" "00085" "00226316" "00085" "00294522" "00198" "00294523" "00198" "00294524" "00198" "00294525" "00198" "00294526" "00198" "00294527" "00198" "00294528" "00198" "00294529" "00198" "00294530" "00198" "00294531" "00198" "00294532" "00198" "00294533" "00198" "00294534" "00198" "00295425" "00198" "00300652" "00198" "00305172" "00198" "00309513" "04214" "00317986" "00139" "00325501" "04214" "00328322" "04214" "00328510" "04214" "00328511" "04214" "00331739" "04214" "00334108" "04214" "00334109" "04214" "00334110" "04214" "00335998" "04214" "00358949" "04214" "00358970" "04214" "00358972" "04214" "00361664" "00139" "00362734" "00198" "00373843" "04214" "00383870" "04214" "00383871" "04214" "00385161" "04214" "00387716" "00139" "00387741" "00139" "00387761" "00139" "00387796" "00139" "00387799" "00139" "00388823" "04214" "00389311" "04214" "00389312" "04214" "00389372" "04214" "00389373" "04214" "00389632" "04214" "00394810" "04214" "00395587" "04214" "00395606" "04214" "00396456" "04214" "00396457" "04214" "00426922" "04214" "00433362" "05421" "00440441" "00198" "00440451" "00198" "00444316" "04214" "00447329" "00198" "00447568" "00198" "00451168" "04249" "00451203" "04249" "00451305" "04249" "00460935" "00198" "00460936" "00198" "00467791" "05611" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00085, 00139, 00198, 01157, 04214, 04249, 05421, 05611 ## Count = 68 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000020360" "00085" "00024235" "00006" "Unknown" "" "ID without speech, autism, hypotonia, recurrent infection, sleep disturbances, delayed puberty and obesitas, short stature and microcephaly, deep set eyes, hypertelorism, large ears, large nose, short philtrum, full lips. Kyphosis, narrow hands with tapering fingers, partial cutaneous syndactyly of 2nd and 3rd toes and sandal gaps. No ophthalmologic anomalies." "" "" "" "" "" "" "" "" "" "" "" "0000020365" "00139" "00024235" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000037130" "00198" "00050518" "00006" "Isolated (sporadic)" "" "microcephaly, agenesis of corpus callosum, severe neonatal hypotonia in males, high palate, metatarsus adductus, short broad feet, paroxysmal dyskinesia" "" "" "" "" "" "" "" "" "" "" "" "0000037167" "00198" "00050555" "00006" "Isolated (sporadic)" "" "global developmental delay, microcephaly, macrotia" "" "" "" "" "" "" "" "" "" "" "" "0000038983" "01157" "00000208" "00006" "Familial, X-linked recessive" "" "central hypothyroidism (FT4 0.50-0.99of lower limit normal), no prolactin deficiency, age sonographic determination testicular volume 17.64y, testicular volume right/left 21/20 (7.3–16ml)" "" "3w" "" "" "" "" "" "" "" "" "" "0000038984" "01157" "00000209" "00006" "Familial, X-linked recessive" "" "central hypothyroidism (FT4 0.50-0.99of lower limit normal), prolactin deficiency, age sonographic determination testicular volume 21.36y, testicular volume right/left 30/26 (8.5–18.3ml)" "" "07y04m" "" "" "" "" "" "" "" "" "" "0000122585" "00198" "00150183" "00006" "Familial, autosomal recessive" "" "Microcephaly, mild cortical atrophy without classical Cohen syndrome findings" "" "" "" "" "" "" "" "" "" "" "" "0000122586" "00198" "00150184" "00006" "Familial, autosomal recessive" "" "Intellectual disability and microcephaly without classical Cohen syndrome findings" "" "" "" "" "" "" "" "" "" "" "" "0000171342" "00085" "00226217" "00006" "Familial, autosomal recessive" "04y06m" "moderate intellectual disability, microcephaly, typical facial gestalt, no truncal obesity, narrow hands/feet, slender/tapering fingers, no retinopathy, myopia (diapers), neutropenia, joint hyperlaxity, abnormal social behaviour" "" "" "" "" "" "" "" "" "COH-1" "Cohen syndrome" "" "0000171412" "00085" "00226287" "00006" "Familial, autosomal recessive" "5y" "intellectual disability, microcephaly, typical facial gestalt, no truncal obesity, narrow hands/feet, slender/tapering fingers, retinopathy, myopia (diapers), neutropenia, joint hyperlaxity, normal social behaviour, pet varus" "" "" "" "" "" "" "" "" "COH-1" "Cohen syndrome" "" "0000171413" "00085" "00226288" "00006" "Familial, autosomal recessive" "20y" "severe intellectual disability, microcephaly, typical facial gestalt, no truncal obesity, narrow hands/feet, slender/tapering fingers, retinopathy, myopia (diapers), neutropenia, joint hyperlaxity, mild mitral insufficiency" "" "" "" "" "" "" "" "" "COH-1" "Cohen syndrome" "" "0000171414" "00085" "00226289" "00006" "Familial, autosomal recessive" "1y6m" "mild/moderate intellectual disability, microcephaly, typical facial gestalt, truncal obesity, narrow hands/feet, slender/tapering fingers, retinopathy, myopia (diapers), no neutropenia, joint hyperlaxity, abnormal social behaviour, leg asymmetry" "" "" "" "" "" "" "" "" "COH-1" "Cohen syndrome" "" "0000171415" "00085" "00226290" "00006" "Familial, autosomal recessive" "19y" "moderate intellectual disability, microcephaly, typical facial gestalt, truncal obesity, narrow hands/feet, slender/tapering fingers, retinopathy, myopia (diapers), neutropenia, joint hyperlaxity, abnormal social behaviour, intrauterine growth retardation, hip asymmetry" "" "" "" "" "" "" "" "" "COH-1" "Cohen syndrome" "" "0000171416" "00085" "00226291" "00006" "Familial, autosomal recessive" "17y" "moderate intellectual disability, microcephaly (3rd centile), typical facial gestalt, truncal obesity, narrow hands/feet, slender/tapering fingers, retinopathy, myopia (diapers), neutropenia, joint hyperlaxity" "" "" "" "" "" "" "" "" "COH-1" "Cohen syndrome" "" "0000171417" "00085" "00226292" "00006" "Familial, autosomal recessive" "19y" "mild/moderate intellectual disability, microcephaly, typical facial gestalt, truncal obesity, narrow hands/feet, slender/tapering fingers, retinopathy, myopia (diapers), neutropenia, joint hyperlaxity, abnormal social behaviour" "" "" "" "" "" "" "" "" "COH-1" "Cohen syndrome" "" "0000171418" "00085" "00226293" "00006" "Familial, autosomal recessive" "3y6m" "moderate intellectual disability, microcephaly, typical facial gestalt, no truncal obesity, narrow hands/feet, slender/tapering fingers, retinopathy, myopia (diapers), neutropenia, joint hyperlaxity, abnormal social behaviour, neonatal hypotonia" "" "" "" "" "" "" "" "" "COH-1" "Cohen syndrome" "" "0000171419" "00085" "00226294" "00006" "Familial, autosomal recessive" "6y3m" "moderate intellectual disability, microcephaly, typical facial gestalt, truncal obesity, narrow hands/feet, slender/tapering fingers, retinopathy, myopia (diapers), neutropenia, no joint hyperlaxity, abnormal social behaviour, syndactyly (2nd/3rd toes)" "" "" "" "" "" "" "" "" "COH-1" "Cohen syndrome" "" "0000171420" "00085" "00226295" "00006" "Familial, autosomal recessive" "52y" "intellectual disability, microcephaly, typical facial gestalt, truncal obesity, narrow hands/feet, slender/tapering fingers, retinopathy, myopia (diapers), neutropenia, joint hyperlaxity, abnormal social behaviour, breast cancer, bilateral cataract" "" "" "" "" "" "" "" "" "COH-1" "Cohen syndrome" "" "0000171421" "00085" "00226296" "00006" "Familial, autosomal recessive" "51y" "intellectual disability, microcephaly, typical facial gestalt, truncal obesity, narrow hands/feet, slender/tapering fingers, retinopathy, myopia (diapers), neutropenia, joint hyperlaxity, abnormal social behaviour, breast cancer, bilateral cataract" "" "" "" "" "" "" "" "" "COH-1" "Cohen syndrome" "" "0000171422" "00085" "00226297" "00006" "Familial, autosomal recessive" "45y" "moderate intellectual disability, no microcephaly, typical facial gestalt, no truncal obesity, narrow hands/feet, slender/tapering fingers, retinopathy, myopia (diapers), neutropenia, joint hyperlaxity, mitralic insuficiency" "" "" "" "" "" "" "" "" "COH-1" "Cohen syndrome" "" "0000171423" "00085" "00226298" "00006" "Familial, autosomal recessive" "40y" "moderate intellectual disability, no microcephaly, typical facial gestalt, no truncal obesity, narrow hands/feet, slender/tapering fingers, retinopathy, myopia (diapers), neutropenia, joint hyperlaxity" "" "" "" "" "" "" "" "" "COH-1" "Cohen syndrome" "" "0000171424" "00085" "00226299" "00006" "Familial, autosomal recessive" "2y4m" "moderate intellectual disability, microcephaly, typical facial gestalt, no truncal obesity, narrow hands/feet, slender/tapering fingers, no retinopathy, myopia (diapers), neutropenia, joint hyperlaxity, abnormal social behaviour" "" "" "" "" "" "" "" "" "COH-1" "Cohen syndrome" "" "0000171439" "00085" "00226316" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "COH-1" "Cohen syndrome" "" "0000227963" "00198" "00300652" "03664" "Unknown" "" "facial morphology nose" "" "" "" "" "" "" "" "" "" "" "" "0000234833" "04214" "00309513" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Cohen syndrome" "" "0000241770" "00139" "00317986" "00006" "Familial, autosomal recessive" "" "Severe ID, speech delay, moderate hypotonia, microcephaly, ADHD, aggressive, hypotelorism" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000243988" "04214" "00325501" "00006" "Familial, autosomal recessive" "" "syndromic retinal systrophy" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000246549" "04214" "00328322" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "multiple phenotypes" "" "0000246736" "04214" "00328510" "00000" "Familial, autosomal recessive" "3y" "retinal dystrophy (HP:0000556), neurodevelopmental abnormality (HP:0012759), abnormal facial shape (HP:0001999)" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000246737" "04214" "00328511" "00000" "Familial, autosomal recessive" "3y" "retinal dystrophy (HP:0000556), neurodevelopmental abnormality (HP:0012759), abnormal facial shape (HP:0001999)" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000249931" "04214" "00331739" "00000" "Familial, autosomal recessive" "" "retinitis pigmentosa, intellectual disability" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, intellectual disability" "" "0000252293" "04214" "00334108" "00000" "Familial, autosomal recessive" "10y" "clinical category IB9" "" "" "" "" "" "" "" "" "" "Cohen syndrome" "" "0000252294" "04214" "00334109" "00000" "Familial, autosomal recessive" "33y" "clinical category IB9" "" "" "" "" "" "" "" "" "" "Mirhosseini-Holmes-Walton syndrome" "" "0000252295" "04214" "00334110" "00000" "Familial, autosomal recessive" "17y" "clinical category IB9" "" "" "" "" "" "" "" "" "" "Cohen syndrome" "" "0000253913" "04214" "00335998" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000254247" "04214" "00358949" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinal dystrophy, DD: retinitis pigmentosa" "" "0000254268" "04214" "00358970" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis" "" "0000254270" "04214" "00358972" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Best macular dystrophy" "" "0000257069" "00139" "00361664" "00006" "Familial, autosomal recessive" "8y6m" "syndromic; intellectual disability and dysmorphism" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000258104" "00198" "00362734" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Cohen\'s syndrome" "" "0000269052" "04214" "00373843" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000277655" "04214" "00383870" "00000" "Familial, autosomal recessive" "" "short stature, developmental delay, congenital mental retardation, microcephaly, facial dysmorphism and retinitis pigmentosa" "" "" "" "" "" "" "" "" "Cohen syndrome" "Kabuki syndrome" "" "0000277656" "04214" "00383871" "00000" "Familial, autosomal recessive" "" "short stature, developmental delay, congenital mental retardation, microcephaly, facial dysmorphism and retinitis pigmentosa" "" "" "" "" "" "" "" "" "Cohen syndrome" "Kabuki syndrome" "" "0000278957" "04214" "00385161" "00000" "Familial, autosomal recessive" "49y2m" "HP:0000505 Visual Impairment;; HP:0000750 Delayed speech and language development; HP:0000322:Short philtrum; HP:0000448:Prominent nose; HP:0001270 motor delay; HP:0000252:Microcephaly; HP:0002421 poor head control; HP:0002019:Constipation;" "" "" "" "" "" "" "" "" "" "Cohen syndrome" "" "0000281284" "00139" "00387716" "00006" "Familial, autosomal recessive" "" "syndromic intellectual disability, microcephaly" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000281309" "00139" "00387741" "00006" "Familial, autosomal recessive" "" "syndromic intellectual disability, microcephaly" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000281329" "00139" "00387761" "00006" "Familial, autosomal recessive" "" "syndromic intellectual disability, microcephaly" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000281364" "00139" "00387796" "00006" "Familial, autosomal recessive" "" "syndromic intellectual disability, microcephaly" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000281367" "00139" "00387799" "00006" "Familial, autosomal recessive" "" "syndromic intellectual disability, microcephaly" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000282364" "04214" "00388823" "00000" "Familial, autosomal recessive" "41y" "age at genetic diagnosis mentioned" "" "37y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" "" "0000282852" "04214" "00389311" "00000" "Familial, autosomal recessive" "18y" "age at genetic diagnosis mentioned" "" "11y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" "" "0000282853" "04214" "00389312" "00000" "Familial, autosomal recessive" "15y" "age at genetic diagnosis mentioned" "" "8y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" "" "0000282913" "04214" "00389372" "00000" "Familial, autosomal recessive" "21y" "age at genetic diagnosis mentioned" "" "20y" "" "" "" "" "" "" "unclassified / mixed" "" "" "0000282914" "04214" "00389373" "00000" "Familial, autosomal recessive" "15y" "age at genetic diagnosis mentioned" "" "14y" "" "" "" "" "" "" "unclassified / mixed" "" "" "0000283173" "04214" "00389632" "00000" "Isolated (sporadic)" "23y" "age at genetic diagnosis mentioned" "" "18y" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" "" "0000288010" "04214" "00394810" "00000" "Familial, autosomal recessive" "41y" "macula-dominant diffuse retinal dystrophy with mental retardation" "" "" "" "" "" "" "" "" "Cohen syndrome" "" "" "0000288785" "04214" "00395587" "00000" "Familial, autosomal recessive" "" "myopia, rod-cone dystrophy, global developmental delay, intellectual disability, neutropenia, short finger, kyphosis, ligamentous laxity, microcephaly, scoliosis, short stature, hypertelorism, narrow palate, narrow forehead, thick eyebrow, thick hair, thick vermilion border, toenail dysplasia" "" "" "" "" "" "" "" "" "Cohen syndrome" "Cohen syndrome" "" "0000288804" "04214" "00395606" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Cohen syndrome" "" "" "0000289617" "04214" "00396456" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000289618" "04214" "00396457" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000318060" "04214" "00426922" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "Leber congenital amaurosis" "" "0000323883" "05421" "00433362" "00006" "Familial, autosomal recessive" "15y5m" "primary microcephaly, fluctuant neutropenia, truncal obesity, retinal dystrophy, joints hyperlaxity; birth OFC (SD-2), weigth (SD-2.5), length (SD-3); OFC (SD-4), weigth (SD-1), length (SD-4); no epilepsy; severe intellectual disability, no speech; MRI normal; birth OFC (SD-2), weigth (SD-2.5), length (SD-3); OFC (SD-4), weigth (SD-1), length (SD-4); no epilepsy; severe intellectual disability, no speech; MRI normal" "" "" "" "" "" "" "" "" "" "primary microcephaly" "" "0000330351" "00198" "00440441" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Cohen syndrome (MIM #216550)" "" "" "0000330361" "00198" "00440451" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Cohen syndrome (MIM #216550)" "" "" "0000333569" "04214" "00444316" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "X-linked retinoschisis" "" "0000336528" "00198" "00447329" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, simplex" "" "0000336767" "00198" "00447568" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "eye diseaes" "" "0000352944" "05611" "00467791" "00006" "Familial, autosomal recessive" "" "developmental delay, intellectual disability, attention deficit hyperactivity disorder, microcephaly, hypotonia, joint hyperlaxity, unsteady gait, severe dental caries" "" "" "" "" "" "" "" "" "COH1" "neurodevelopmental disorder" "" ## Screenings ## Do not remove or alter this header ## ## Count = 88 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000000209" "00000208" "1" "00037" "00001" "2012-09-13 12:02:03" "" "" "SEQ-NG-I" "DNA" "" "" "0000000210" "00000209" "1" "00037" "00001" "2012-09-13 12:09:36" "" "" "SEQ-NG-I" "DNA" "" "" "0000024229" "00024235" "1" "00006" "00006" "2014-11-08 15:01:20" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000050463" "00050518" "1" "00006" "00006" "2015-09-27 16:16:40" "" "" "SEQ;SEQ-NG-I" "DNA" "" "" "0000050500" "00050555" "1" "00006" "00006" "2015-09-27 16:16:40" "" "" "SEQ;SEQ-NG-I" "DNA" "" "" "0000132717" "00131879" "1" "01741" "01741" "2017-09-20 10:36:40" "" "" "SEQ" "DNA" "" "" "0000151038" "00150183" "1" "00006" "00006" "2018-01-13 12:41:38" "" "" "SEQ-NG-I" "DNA" "" "WES" "0000151039" "00150184" "1" "00006" "00006" "2018-01-13 12:41:38" "" "" "SEQ-NG-I" "DNA" "" "WES" "0000227293" "00226217" "1" "00006" "00006" "2019-03-03 21:55:02" "" "" "SEQ" "DNA" "" "" "0000227354" "00226287" "1" "00006" "00006" "2019-03-07 09:31:16" "" "" "SEQ" "DNA" "" "" "0000227355" "00226288" "1" "00006" "00006" "2019-03-07 09:31:16" "" "" "SEQ" "DNA" "" "" "0000227356" "00226289" "1" "00006" "00006" "2019-03-07 09:31:16" "" "" "SEQ" "DNA" "" "" "0000227357" "00226290" "1" "00006" "00006" "2019-03-07 09:31:16" "" "" "SEQ" "DNA" "" "" "0000227358" "00226291" "1" "00006" "00006" "2019-03-07 09:31:16" "" "" "SEQ" "DNA" "" "" "0000227359" "00226292" "1" "00006" "00006" "2019-03-07 09:31:16" "" "" "SEQ" "DNA" "" "" "0000227360" "00226293" "1" "00006" "00006" "2019-03-07 09:31:16" "" "" "SEQ" "DNA" "" "" "0000227361" "00226294" "1" "00006" "00006" "2019-03-07 09:31:16" "" "" "SEQ" "DNA" "" "" "0000227362" "00226295" "1" "00006" "00006" "2019-03-07 09:31:16" "" "" "SEQ" "DNA" "" "" "0000227363" "00226296" "1" "00006" "00006" "2019-03-07 09:31:16" "" "" "SEQ" "DNA" "" "" "0000227364" "00226297" "1" "00006" "00006" "2019-03-07 09:31:16" "" "" "SEQ" "DNA" "" "" "0000227365" "00226298" "1" "00006" "00006" "2019-03-07 09:31:16" "" "" "SEQ" "DNA" "" "" "0000227366" "00226299" "1" "00006" "00006" "2019-03-07 09:31:16" "" "" "SEQ" "DNA" "" "" "0000227384" "00226316" "1" "00006" "00006" "2019-03-08 09:58:41" "" "" "MLPA;SEQ" "DNA" "" "" "0000295690" "00294522" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295691" "00294523" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295692" "00294524" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295693" "00294525" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295694" "00294526" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295695" "00294527" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295696" "00294528" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295697" "00294529" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295698" "00294530" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295699" "00294531" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295700" "00294532" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295701" "00294533" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295702" "00294534" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000296593" "00295425" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000301773" "00300652" "1" "03664" "03664" "2020-04-30 05:37:01" "" "" "arraySNP" "DNA" "" "" "0000306301" "00305172" "1" "03575" "00006" "2020-06-24 11:55:42" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000310658" "00309513" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000319168" "00317986" "1" "00006" "00006" "2020-11-05 17:52:36" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000326712" "00325501" "1" "00006" "00006" "2021-01-03 11:36:11" "" "" "SEQ;SEQ-NG" "DNA" "" "199 gene panel" "0000329537" "00328322" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000329725" "00328510" "1" "00000" "00006" "2021-01-28 09:35:56" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000329726" "00328511" "1" "00000" "00006" "2021-01-28 09:35:56" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000332958" "00331739" "1" "00000" "00006" "2021-02-13 09:57:26" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000335334" "00334108" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335335" "00334109" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335336" "00334110" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000337228" "00335998" "1" "00000" "00006" "2021-03-10 17:05:56" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000360186" "00358949" "1" "00000" "00006" "2021-03-18 12:15:00" "" "" "SEQ-NG" "DNA" "" "WES" "0000360207" "00358970" "1" "00000" "00006" "2021-03-18 12:15:00" "" "" "SEQ-NG" "DNA" "" "WES" "0000360209" "00358972" "1" "00000" "00006" "2021-03-18 12:15:00" "" "" "SEQ-NG" "DNA" "" "WES" "0000362892" "00361664" "1" "00006" "00006" "2021-04-07 19:07:03" "" "" "SEQ-NG" "DNA" "" "WES" "0000363962" "00362734" "1" "00006" "00006" "2021-04-23 13:33:15" "" "" "SEQ" "DNA" "" "" "0000375075" "00373843" "1" "00000" "00006" "2021-05-21 13:56:05" "" "" "SEQ-NG" "DNA" "" "86-gene panel" "0000385095" "00383870" "1" "00000" "03840" "2021-09-29 13:08:31" "" "" "SEQ-NG;arraySNP;SEQ" "DNA" "blood" "whole exome sequencing, SNP array homozygosity mapping" "0000385096" "00383871" "1" "00000" "03840" "2021-09-29 13:08:31" "" "" "SEQ-NG;arraySNP;SEQ" "DNA" "blood" "whole exome sequencing, SNP array homozygosity mapping" "0000386390" "00385161" "1" "00000" "03840" "2021-10-08 17:29:22" "" "" "SEQ-NG-I" "DNA" "" "176 genes panel" "0000388947" "00387716" "1" "00006" "00006" "2021-10-31 12:02:46" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000388972" "00387741" "1" "00006" "00006" "2021-10-31 12:02:46" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000388992" "00387761" "1" "00006" "00006" "2021-10-31 12:02:46" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000389027" "00387796" "1" "00006" "00006" "2021-10-31 12:02:46" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000389030" "00387799" "1" "00006" "00006" "2021-10-31 12:02:46" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000390066" "00388823" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET7 targeted sequencing panel - see paper" "0000390554" "00389311" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET3 targeted sequencing panel - see paper" "0000390555" "00389312" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000390615" "00389372" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET9 targeted sequencing panel - see paper" "0000390616" "00389373" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000390875" "00389632" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET6 targeted sequencing panel - see paper" "0000396057" "00394810" "1" "00000" "03840" "2021-12-02 12:05:39" "" "" "SEQ-NG" "DNA" "" "" "0000396825" "00395587" "1" "00000" "03840" "2021-12-08 14:12:08" "" "" "?" "DNA" "" "clinical exome sequencing" "0000396844" "00395606" "1" "00000" "03840" "2021-12-08 14:12:08" "" "" "?" "DNA" "" "clinical exome sequencing" "0000397696" "00396456" "1" "00006" "00006" "2021-12-15 16:38:30" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000397697" "00396457" "1" "00006" "00006" "2021-12-15 16:38:30" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000428242" "00426922" "1" "00000" "03840" "2022-12-03 18:53:15" "" "" "SEQ-NG;SEQ" "DNA" "saliva" "panel-based next generation sequencing" "0000434816" "00433362" "1" "00006" "00006" "2023-03-06 14:23:39" "" "" "SEQ-NG" "DNA" "" "" "0000441926" "00440441" "1" "00006" "00006" "2023-11-02 14:36:08" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000441936" "00440451" "1" "00006" "00006" "2023-11-02 14:36:08" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000445890" "00444316" "1" "00006" "00006" "2023-12-21 19:04:03" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000448906" "00447329" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000449145" "00447568" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000452767" "00451168" "1" "00006" "00006" "2024-05-31 11:39:36" "" "" "SEQ" "DNA" "" "smMIP-based 105 iMD/AMD genes" "0000452802" "00451203" "1" "00006" "00006" "2024-05-31 11:39:36" "" "" "SEQ" "DNA" "" "smMIP-based 105 iMD/AMD genes" "0000452904" "00451305" "1" "00006" "00006" "2024-05-31 11:39:36" "" "" "SEQ" "DNA" "" "smMIP-based 105 iMD/AMD genes" "0000462567" "00460935" "1" "04796" "00006" "2024-11-05 16:15:00" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "blood" "mRNA splicing analysis on tissue" "0000462568" "00460936" "1" "04796" "00006" "2024-11-05 16:15:00" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "blood" "mRNA splicing analysis on tissue" "0000469457" "00467791" "1" "00006" "00006" "2025-10-30 10:25:01" "" "" "SEQ;SEQ-NG" "DNA" "" "trio WES" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 55 "{{screeningid}}" "{{geneid}}" "0000024229" "VPS13B" "0000050463" "VPS13B" "0000050500" "VPS13B" "0000132717" "VPS13B" "0000151038" "VPS13B" "0000151039" "VPS13B" "0000227293" "VPS13B" "0000227354" "VPS13B" "0000227355" "VPS13B" "0000227356" "VPS13B" "0000227357" "VPS13B" "0000227358" "VPS13B" "0000227359" "VPS13B" "0000227360" "VPS13B" "0000227361" "VPS13B" "0000227362" "VPS13B" "0000227363" "VPS13B" "0000227364" "VPS13B" "0000227365" "VPS13B" "0000227366" "VPS13B" "0000227384" "VPS13B" "0000310658" "VPS13B" "0000319168" "VPS13B" "0000326712" "VPS13B" "0000329537" "VPS13B" "0000329725" "VPS13B" "0000329726" "VPS13B" "0000332958" "VPS13B" "0000335334" "VPS13B" "0000335335" "VPS13B" "0000335336" "VPS13B" "0000337228" "VPS13B" "0000362892" "VPS13B" "0000363962" "VPS13B" "0000375075" "VPS13B" "0000385095" "VPS13B" "0000385096" "VPS13B" "0000386390" "VPS13B" "0000388947" "VPS13B" "0000388972" "VPS13B" "0000388992" "VPS13B" "0000389027" "VPS13B" "0000389030" "VPS13B" "0000390066" "VPS13B" "0000390554" "VPS13B" "0000390555" "VPS13B" "0000390615" "VPS13B" "0000390616" "VPS13B" "0000390875" "VPS13B" "0000396057" "VPS13B" "0000396825" "VPS13B" "0000396844" "VPS13B" "0000428242" "AIPL1" "0000462567" "VPS13B" "0000462568" "VPS13B" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 933 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000004654" "3" "50" "8" "100352261" "100352261" "subst" "0" "00037" "VPS13B_000002" "g.100352261G>A" "" "" "" "" "" "Germline" "" "" "" "" "" "g.99340033G>A" "" "VUS" "" "0000004655" "3" "50" "8" "100352316" "100352316" "subst" "0" "00037" "VPS13B_000001" "g.100352316G>C" "" "" "" "" "" "Germline" "" "" "" "" "" "g.99340088G>C" "" "VUS" "" "0000012632" "3" "50" "8" "100042043" "100042043" "subst" "0" "00037" "VPS13B_000004" "g.100042043G>C" "" "" "" "" "" "Germline" "" "" "" "" "" "g.99029815G>C" "" "VUS" "" "0000012633" "0" "50" "8" "100351754" "100351754" "subst" "0" "00037" "VPS13B_000005" "g.100351754C>T" "" "" "" "" "" "Germline" "" "" "" "" "" "g.99339526C>T" "" "VUS" "" "0000012634" "3" "50" "8" "100352261" "100352261" "subst" "0" "00037" "VPS13B_000002" "g.100352261G>A" "" "" "" "" "" "Germline" "" "" "" "" "" "g.99340033G>A" "" "VUS" "" "0000016288" "3" "99" "8" "100013161" "100133463" "" "0" "00015" "VPS13B_000006" "g.(?_100013161)_(100133463_?)del" "" "{PMID:Balikova et al. 2011:21353197}" "" "a 140-kb homozygous deletion with breakpoints between probes A_14_p12741-normal, A_16_p18412462-deleted, A_16_p01978354-deleted, and A_16_p18412663-normal: deletion of exons 1-7." "1 COH1 family (hom)" "SUMMARY record" "yes" "" "" "" "" "" "" "pathogenic" "" "0000016289" "3" "99" "8" "100001615" "100141005" "del" "0" "00015" "VPS13B_000007" "g.100001615_100141005del" "" "{PMID:Balikova et al. 2009:19533689}" "" "Del promotor - 8: 100070791 - 100210181 bp (hg18)" "2 Belgian COH1 families (hom); Deletion of exons 1-9a" "SUMMARY record" "yes" "" "" "" "" "g.98989387_99128777del" "" "pathogenic" "" "0000016290" "21" "99" "8" "99945853" "100278670" "del" "0" "00015" "VPS13B_000008" "g.99945853_100278670del" "0/1612 CON" "Rivera-Brugués 2011" "" "315 kb del: exons 1-17: chr8(hg18):100015029...100347846; c.1-2515del" "1 German/African COH1 family (com-het); Chr8(hg18):g.100015029_100347846del = Chr8(hg19):g.99945853_100278670del" "SUMMARY record" "yes" "" "" "" "" "g.98933625_99266442del" "" "pathogenic" "" "0000016291" "0" "99" "8" "100026038" "100026039" "delins" "0" "00015" "VPS13B_000009" "g.100026038_100026039delinsA" "" "{PMID:Kolehmainen et al. 2004:15141358}" "" "c.22_23delCCinsA: p.Pro8fsX3" "1 Danish COH1 patient (com-het)" "SUMMARY record" "yes" "" "" "" "" "g.99013810_99013811delinsA" "" "pathogenic" "" "0000016292" "0" "99" "8" "100050722" "100050723" "delins" "0" "00015" "VPS13B_000010" "g.100050722_100050723delinsT" "" "" "" "219_20delACinsT" "1 COH1 family (com-het)" "SUMMARY record" "yes" "" "0" "" "" "g.99038494_99038495delinsT" "" "pathogenic (recessive)" "" "0000016293" "0" "99" "8" "100057231" "100201680" "del" "0" "00015" "VPS13B_000011" "g.100057231_100201680del" "" "{PMID:Balikova et al. 2009:19533689}" "" "Del 4-16: 100126407 - 100270856 bp (hg18)" "1 COH1 family (com-het); Deletion of exons 4-17" "SUMMARY record" "yes" "" "" "" "" "g.99045003_99189452del" "" "pathogenic" "" "0000016294" "0" "97" "8" "100115179" "100115179" "subst" "0" "00015" "VPS13B_000012" "g.100115179A>G" "" "" "" "IVS4-2A>G" "1 COH1 family (com-het)" "SUMMARY record" "yes" "" "0" "" "" "g.99102951A>G" "" "likely pathogenic (recessive)" "" "0000016295" "0" "99" "8" "100108539" "100155394" "dup" "0" "00015" "VPS13B_000013" "g.(100050795_100108539)_(100155394_100160068)dup" "" "" "" "dup ex4-13" "1 COH1 family (com-het)" "SUMMARY record" "yes" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000016296" "0" "99" "8" "100108649" "100108650" "ins" "0" "00015" "VPS13B_000014" "g.100108649_100108650insT" "" "" "" "402insT" "1 COH1 family (com-het)" "SUMMARY record" "yes" "" "0" "" "" "g.99096421_99096422insT" "" "pathogenic (recessive)" "" "0000016297" "0" "99" "8" "100108539" "100182392" "del" "0" "00015" "VPS13B_000015" "g.(100050795_100108539)_(100182392_100205103)del" "" "" "" "del ex4-16" "1 COH1 family (com-het)" "SUMMARY record" "yes" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000016298" "3" "99" "8" "100115181" "100160238" "del" "0" "00015" "VPS13B_000016" "g.(?_100115181)_(100160238_?)del" "0/50 CON" "{PMID:Sheifert et al. 2008:19006247}" "" "c.413_2013del: p.Gly138GlufsX4 (exon 5-14)" "1 Iranian COH1 family (hom); Deletion of exons 6-15" "SUMMARY record" "yes" "" "" "" "" "" "" "pathogenic" "" "0000016299" "0" "99" "8" "100123325" "100182392" "del" "0" "00015" "VPS13B_000017" "g.(100115349_100123325)_(100182392_100205103)del" "" "" "" "del ex6-16" "shared haplotype; 1 Greek COH1 family (hom) and 3 Italian COH1 families (2 com-het, 1 hom)" "SUMMARY record" "yes" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000016300" "0" "99" "8" "100115235" "100115238" "del" "0" "00015" "VPS13B_000018" "g.100115235_100115238del" "" "{PMID:Kolehmainen et al. 2004:15141358}" "" "c.463_466delATAA: p.Asn156fsX4" "1 British COH1 patient (hom)" "SUMMARY record" "yes" "" "" "" "" "g.99103007_99103010del" "" "pathogenic" "" "0000016301" "0" "99" "8" "100123371" "100123372" "del" "0" "00015" "VPS13B_000019" "g.100123371_100123372del" "0/50 CON" "{PMID:Sheifert et al. 2008:19006247}" "" "c.625_626delAC: p.Thr209SerfsX4 (exon 6)" "1 Belgian/ Italian COH1 family (com-het)" "SUMMARY record" "yes" "" "" "" "" "g.99111143_99111144del" "" "pathogenic" "" "0000016302" "0" "99" "8" "100128081" "100128082" "del" "0" "00015" "VPS13B_000020" "g.100128081_100128082del" "0/50 CON" "{PMID:Sheifert et al. 2008:19006247}, {PMID:El Chehadeh et al. 2010:20656880}" "" "c.916_917delGA: p.Asp306TyrfsX9 (exon 7)" "1 Belgian COH1 family (com-het), 2 French siblings with COH1 (com-het)" "SUMMARY record" "yes" "" "0" "" "" "g.99115853_99115854del" "" "pathogenic" "" "0000016303" "11" "99" "8" "100146858" "100339991" "del" "0" "00015" "VPS13B_000021" "g.100146858_100339991del" "0/1612 CON" "Rivera-Brugués 2011" "" "193 kb del: exons 9-19: chr8(hg18): 100216034...100409167; c.1207-2824del/p.L403fsX11" "1 German COH1 family (com-het); Chr8(hg18):g.100216034_100409167del = (hg19) g.100146858_100339991del" "SUMMARY record" "yes" "" "" "" "" "g.99134630_99327763del" "" "pathogenic" "" "0000016304" "3" "99" "8" "100146872" "100146872" "subst" "0" "00015" "VPS13B_000022" "g.100146872C>T" "0/82 CON" "{PMID:Mochida et al. 2004:15173253}" "" "1219C>T: Q407X" "1 Saudi Arabian COH1 family (hom)" "SUMMARY record" "yes" "" "" "" "" "g.99134644C>T" "" "pathogenic" "" "0000016305" "0" "99" "8" "100146878" "100146878" "subst" "0" "00015" "VPS13B_000023" "g.100146878G>T" "" "{PMID:Taban et al. 2007:17383910}" "" "c.1225g.t ( p.Glu409X )" "1 Palestinian COH1 family (het)" "SUMMARY record" "yes" "" "" "" "" "g.99134650G>T" "" "pathogenic" "" "0000016306" "0" "99" "8" "100146922" "100146926" "del" "0" "00015" "VPS13B_000024" "g.100146922_100146926del" "0/50 CON" "{PMID:Sheifert et al. 2008:19006247}" "" "c.1269_1273delATTGT: p.Cys425GlyfsX8 (exon 9)" "1 Belgian/ Italian COH1 family (com-het)" "SUMMARY record" "yes" "" "" "" "" "g.99134694_99134698del" "" "pathogenic" "" "0000016307" "0" "99" "8" "100147902" "100147902" "subst" "1.21986E-5" "00015" "VPS13B_000025" "g.100147902C>T" "0/75 CON" "{PMID:Hennies et al. 2004:15154116}, {PMID:Seifert et al. 2006:16648375}" "" "c.1504C>T: p.Arg502X" "1 Brazilian COH1 family (het), 1 English/Scottish COH1 family (com-het)" "SUMMARY record" "yes" "rs180177354" "" "" "" "g.99135674C>T" "" "pathogenic" "" "0000016308" "0" "99" "8" "100147961" "100147961" "subst" "4.06904E-6" "00015" "VPS13B_000026" "g.100147961G>A" "" "{PMID:Seifert et al. 2006:16648375}" "" "c.1563G>A: p.Lys521fsX20, normal transcript in a very low level and abnormal transcript including more than 177 bp of the intron 11, resulting in a new reading frame of 19 codons followed by a stop co" "1 German/English COH1 family (com-het); Splice site mutation" "SUMMARY record" "yes" "rs180177355" "" "" "" "g.99135733G>A" "" "pathogenic" "" "0000016309" "11" "77" "8" "100155318" "100155318" "subst" "0.000861389" "00015" "VPS13B_000027" "g.100155318G>A" "0/50 CON" "{PMID:Katzaki et al. 2007:17990063}" "" "c.1768G>A: p.A590T (exon 13)" "1 Italian COH1 family (com-het)" "SUMMARY record" "yes" "rs140601319" "" "" "" "g.99143090G>A" "" "likely pathogenic" "" "0000016310" "0" "77" "8" "100168775" "100168775" "subst" "0" "00015" "VPS13B_000028" "g.100168775A>G" "" "" "" "IVS14-2A>G" "1 COH1 family (com-het)" "SUMMARY record" "yes" "" "0" "" "" "g.99156547A>G" "" "likely pathogenic (recessive)" "" "0000016311" "11" "99" "8" "100168810" "100168810" "del" "0" "00015" "VPS13B_000029" "g.100168810del" "" "{PMID:Katzaki et al. 2007:17990063}" "" "c.2047delC: p.Q721fsX23 (exon 15)" "1 Italian COH1 family (com-het)" "SUMMARY record" "yes" "" "" "" "" "g.99156582del" "" "pathogenic" "" "0000016312" "0" "99" "8" "100168837" "100168837" "subst" "4.06342E-6" "00015" "VPS13B_000030" "g.100168837C>T" "" "{PMID:Kolehmainen et al. 2003:12730828}, {PMID:Seifert et al. 2006:16648375}; {PMID:El Chehadeh et al. 2010:20656880}" "" "c.2193C>T: R692X (exon 15)" "1 Belgian COH1 patient (com-het) and 2 French COH1 families (com-het)" "SUMMARY record" "yes" "" "0" "" "" "g.99156609C>T" "" "pathogenic" "" "0000016313" "0" "99" "8" "100168777" "100168971" "" "0" "00015" "VPS13B_000031" "g.(?_100168777)_(100168971_?)del" "" "{PMID:Katzaki et al. 2007:17990063}" "" "Partial gene deletion: Deletion of exon 16 (with unidentified 3\' breakpoint between exons 3 and 16 and 5\' breakpoint between exons 16 and 17)" "2 Italian COH1 families (com-het)" "SUMMARY record" "yes" "" "" "" "" "" "" "pathogenic" "" "0000016314" "0" "99" "8" "100196602" "100413814" "del" "0" "00015" "VPS13B_000032" "g.100196602_100413814del" "" "{PMID:Balikova et al. 2009:19533689}" "" "Del 17-21: 100265778 - 100482990 bp (hg18)" "1 COH1 family (com-het); Deletion of exons 18-23" "SUMMARY record" "yes" "" "" "" "" "g.99184374_99401586del" "" "pathogenic" "" "0000016315" "0" "99" "8" "100286426" "100403932" "del" "0" "00015" "VPS13B_000033" "g.(?_100286426)_(100403932_?)del" "" "{PMID:Seifert et al. 2006:16648375}" "" "c.2516_3083del: p.Gly839_Thr1027del (Exons 18–21)" "1 German COH1 family (com-het); Deletion of exons 20-23" "SUMMARY record" "yes" "" "" "" "" "" "" "pathogenic" "" "0000016316" "0" "99" "8" "100286426" "100520139" "del" "0" "00015" "VPS13B_000034" "g.(?_100286426)_(100520139_?)del" "" "{PMID:Seifert et al. 2006:16648375}" "" "c.2516_4299del: p.Gly839fsX19 (Exons 18–28)" "1 Polish COH1 family (com-het); Deletion of exons 20-31" "SUMMARY record" "yes" "" "" "" "" "" "" "pathogenic" "" "0000016317" "0" "99" "8" "100277209" "100307813" "del" "0" "00015" "VPS13B_000035" "g.100277209_100307813del" "" "{PMID:Balikova et al. 2009:19533689}" "" "Del 18-19: 100346384 - 100376988 bp (hg18)" "1 COH1 family (com-het); Deletion of exons 20-21" "SUMMARY record" "yes" "" "" "" "" "g.99264981_99295585del" "" "pathogenic" "" "0000016318" "0" "77" "8" "100287308" "100287308" "subst" "0" "00015" "VPS13B_000036" "g.100287308G>A" "0/50 CON" "{PMID:Sheifert et al. 2008:19006247}" "" "c.2651-1G>A: (i18): splicing at a downstream cryptic exonic splice acceptor site, resulting in a deletion of 7 exonic bases: p.Asp885GlnfsX5" "1 Iranian COH1 family (het)" "SUMMARY record" "yes" "" "" "" "" "g.99275080G>A" "" "likely pathogenic" "" "0000016319" "3" "99" "8" "100287385" "100287388" "dup" "0" "00015" "VPS13B_000037" "g.100287385_100287388dup" "0/75 CON" "{PMID:Hennies et al. 2004:15154116}, {PMID:Seifert et al. 2006:16648375}" "" "c.2727_2730dupGCTC: p.Asn911fsX3" "2 Polish COH1 families (1 hom and 1 com-het)" "SUMMARY record" "yes" "" "" "" "" "g.99275157_99275160dup" "" "pathogenic" "" "0000016320" "0" "99" "8" "100339294" "100408013" "del" "0" "00015" "VPS13B_000038" "g.100339294_100408013del" "" "{PMID:Kolehmainen et al. 2004:15141358}, {PMID:Balikova et al. 2009:19533689}" "" "EX20_21del: p.Gly942_Thr1027del; Del exons 20-21: 100408469 - 100477188 bp (hg18)" "2 Finnish COH1 patients (com-het)" "SUMMARY record" "yes" "" "" "" "" "g.99327066_99395785del" "" "pathogenic" "" "0000016321" "0" "99" "8" "100396435" "100533239" "dup" "0" "00015" "VPS13B_000039" "g.(100287483_100396435)_(100533239_100568677)dup" "" "" "" "dup ex20-30" "1 COH1 family (com-het)" "SUMMARY record" "yes" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000016322" "0" "99" "8" "100396500" "100396500" "subst" "0" "00015" "VPS13B_000040" "g.100396500G>A" "" "{PMID:Kolehmainen et al. 2004:15141358}, {PMID:Yu al. 2013:23352163}" "" "c.2889G>A: p.Trp963X" "1 British COH1 patient (com-het) and 1 patient (com-het) with autism and probable COH1" "SUMMARY record" "yes" "" "0" "" "" "g.99384272G>A" "" "pathogenic" "" "0000016323" "3" "99" "8" "100396522" "100396522" "subst" "4.06676E-6" "00015" "VPS13B_000041" "g.100396522C>T" "0/75 CON" "{PMID:Hennies et al. 2004:15154116}, {PMID:Sheifert et al. 2008:19006247}" "" "c.2911C>T: p.Arg971X" "2 Turkish COH1 families (hom)" "SUMMARY record" "yes" "rs120074152" "" "" "" "g.99384294C>T" "" "pathogenic" "" "0000016324" "0" "99" "8" "100396546" "100396547" "del" "0" "00015" "VPS13B_000042" "g.100396546_100396547del" "" "{PMID:Seifert et al. 2006:16648375}" "" "c.2934+1_2934+2delGT: skipping of exon 20: p.Gly942fsX14" "1 German COH1 family (com-het); Splice site mutation leading to exon 22 skipping" "SUMMARY record" "yes" "" "" "" "" "g.99384318_99384319del" "" "pathogenic" "" "0000016325" "0" "99" "8" "100454766" "100454767" "del" "0" "00015" "VPS13B_000043" "g.100454766_100454767del" "" "{PMID:Kolehmainen et al. 2003:12730828}, {PMID:Kolehmainen et al. 2004:15141358}" "" "c.3348_3349delCT: C1117F…I1124X (exon 23)" "Finnish Major COH1 mutation: 26 Finnish COH1 patients (15 hom and 11 com-het)" "SUMMARY record" "yes" "rs180177327" "" "" "" "g.99442538_99442539del" "" "pathogenic" "" "0000016326" "0" "99" "8" "100454845" "100454845" "subst" "4.06719E-5" "00015" "VPS13B_000044" "g.100454845C>T" "" "{PMID:El Chehadeh et al. 2010:20656880}" "" "c.3427C>T: p.R1143X" "2 COH1 families (com-het) of which 1 Italian and 1 French COH1 patient (com-het)" "SUMMARY record" "yes" "" "0" "" "" "g.99442617C>T" "" "pathogenic (recessive)" "" "0000016327" "0" "99" "8" "100479814" "100479814" "subst" "0" "00015" "VPS13B_000045" "g.100479814T>A" "0/75 CON" "{PMID:Hennies et al. 2004:15154116}" "" "c.3618T>A: p.Cys1206X" "1 German COH1 family (com-het)" "SUMMARY record" "yes" "" "" "" "" "g.99467586T>A" "" "pathogenic" "" "0000016328" "11" "97" "8" "100479864" "100479864" "subst" "0" "00015" "VPS13B_000046" "g.100479864T>C" "" "" "" "IVS24+2T>C" "1 COH1 family (com-het)" "SUMMARY record" "yes" "" "0" "" "" "g.99467636T>C" "" "likely pathogenic (recessive)" "" "0000016329" "11" "77" "8" "100494026" "100494026" "subst" "0.000378751" "00015" "VPS13B_000047" "g.100494026C>G" "0/676 CON" "Rivera-Brugués 2011" "" "c.3866C/G/p.T1289S, exon 25" "1 German/African COH1 family (com-het)" "SUMMARY record" "yes" "rs145569846" "" "" "" "g.99481798C>G" "" "likely pathogenic" "" "0000016330" "21" "99" "8" "100503915" "100570749" "del" "0" "00015" "VPS13B_000048" "g.100503915_100570749del" "0/1612 CON" "Rivera-Brugués 2011" "" "67 kb del: exons 26-31 :chr8(hg18): 100573090...100639924; c.3871-5024del/p.G1291fsX42" "1 Arabian COH1 family (com-het); Chr8(hg18):g.100573090_100639924del = Chr8(hg19):g.100503914_100570748del" "SUMMARY record" "yes" "" "" "" "" "g.99491687_99558521del" "" "pathogenic" "" "0000016332" "0" "55" "8" "100515178" "100519998" "del" "0" "00015" "VPS13B_000050" "g.(?_100515178)_(100519998_?)del" "" "{PMID:Kolehmainen et al. 2003:12730828}" "" "c.EX30del: A1570G…A1573X" "1 Finnish COH1 patient (com-het); Exon 30 is missing in this (NM_017890.3) splice variant but is present in transcript variant 1 (NM_152564.4)" "SUMMARY record" "yes" "" "" "" "" "" "" "VUS" "" "0000016333" "0" "99" "8" "100523366" "100523366" "del" "0" "00015" "VPS13B_000051" "g.100523366del" "" "{PMID:Kolehmainen et al. 2004:15141358}" "" "c.4334delA: p.Gln1445fsX7" "1 British COH1 patient (com-het)" "SUMMARY record" "yes" "" "" "" "" "g.99511138del" "" "pathogenic" "" "0000016334" "0" "99" "8" "100523428" "100523428" "dup" "0" "00015" "VPS13B_000052" "g.100523428dup" "0/75 CON" "{PMID:Hennies et al. 2004:15154116}" "" "c.4396insA: p.Thr1466fsX5" "1 German COH1 family (com-het)" "SUMMARY record" "yes" "" "" "" "" "g.99511200dup" "" "pathogenic" "" "0000016335" "0" "99" "8" "100523443" "100523443" "subst" "2.43964E-5" "00015" "VPS13B_000053" "g.100523443C>T" "0/50 CON" "{PMID:Sheifert et al. 2008:19006247}" "" "c.4411C>T: p.Arg1471X (exon 29)" "1 Dutch COH1 family (het)" "SUMMARY record" "yes" "" "" "" "" "g.99511215C>T" "" "pathogenic" "" "0000016336" "0" "99" "8" "100523503" "100523503" "subst" "8.13418E-6" "00015" "VPS13B_000054" "g.100523503G>T" "" "{PMID:Kolehmainen et al. 2004:15141358}" "" "c.4471G>T: Glu1491X" "1 British sib pair (hom) with COH1" "SUMMARY record" "yes" "rs120074151" "" "" "" "g.99511275G>T" "" "pathogenic" "" "0000016337" "0" "99" "8" "100523506" "100523506" "del" "0" "00015" "VPS13B_000055" "g.100523506del" "" "" "" "4474delA" "1 COH1 family (com-het)" "SUMMARY record" "yes" "" "0" "" "" "g.99511278del" "" "pathogenic (recessive)" "" "0000016338" "0" "77" "8" "100523512" "100523514" "del" "0" "00015" "VPS13B_000056" "g.100523512_100523514del" "0/50 CON" "{PMID:Sheifert et al. 2008:19006247}" "" "c.4478_4480delTTC: p.Leu1494del (exon 29)" "1 Iranian COH1 family (com-het)" "SUMMARY record" "yes" "" "" "" "" "g.99511284_99511286del" "" "likely pathogenic" "" "0000016339" "0" "99" "8" "100523604" "100523604" "dup" "0" "00015" "VPS13B_000057" "g.100523604dup" "" "{PMID:Kolehmainen et al. 2003:12730828}" "" "c.4572_4573insA_E1525R...E1569X (exon 29)" "1 Finnish COH1 patient (com-het)" "SUMMARY record" "yes" "" "" "" "" "g.99511376dup" "" "pathogenic" "" "0000016340" "0" "77" "8" "100533240" "100533240" "subst" "0" "00015" "VPS13B_000058" "g.100533240T>C" "0/50 CON" "{PMID:Sheifert et al. 2008:19006247}, {PMID:El Chehadeh-Djebbar et al. 2013:23188044}" "" "c.4820+2T>C: Splice defect (exon 30)" "1 Albanian/ German COH1 family (het) and 1 COH1 patient (com-het)" "SUMMARY record" "yes" "" "0" "" "" "g.99521012T>C" "" "likely pathogenic" "" "0000016341" "3" "99" "8" "100568735" "100568737" "dup" "0" "00015" "VPS13B_000059" "g.100568735_100568737dup" "" "{PMID:Seifert et al. 2006:16648375}" "" "c.4877_4879dupAAT: p.Tyr1627X" "1 Turkish COH1 family (hom)" "SUMMARY record" "yes" "" "" "" "" "g.99556507_99556509dup" "" "pathogenic" "" "0000016342" "0" "99" "8" "100568780" "100568780" "subst" "0" "00015" "VPS13B_000060" "g.100568780G>A" "" "{PMID:Seifert et al. 2006:16648375}" "" "c.4923G>A: p.Trp1641X" "1 German COH1 family (com-het)" "SUMMARY record" "yes" "rs180177360" "" "" "" "g.99556552G>A" "" "pathogenic" "" "0000016343" "0" "99" "8" "100568812" "100568812" "subst" "0" "00015" "VPS13B_000061" "g.100568812C>G" "" "{PMID:Seifert et al. 2006:16648375}" "" "c.4955C>G: p.Ser1652X" "1 German COH1 family (com-het)" "SUMMARY record" "yes" "rs180177361" "" "" "" "g.99556584C>G" "" "pathogenic" "" "0000016344" "0" "99" "8" "100587885" "100673720" "del" "0" "00015" "VPS13B_000062" "g.(100568882_100587885)_(100673720_100711752)del" "" "" "" "del ex32-35" "1 COH1 family (com-het)" "SUMMARY record" "yes" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000016345" "0" "99" "8" "100587930" "100587930" "subst" "4.06322E-6" "00015" "VPS13B_000063" "g.100587930T>A" "0/75 CON" "{PMID:Hennies et al. 2004:15154116}" "" "c.5069T>A: p.Leu1690X" "1 German COH1 family (com-het)" "SUMMARY record" "yes" "rs150857730" "" "" "" "g.99575702T>A" "" "pathogenic" "" "0000016346" "11" "99" "8" "100587947" "100587947" "subst" "1.21921E-5" "00015" "VPS13B_000049" "g.100587947C>T" "0/676 CON" "Rivera-Brugués 2011" "" "c.5086C/T/p.R1696X, exon 32" "1 Arabian COH1 family (com-het)" "SUMMARY record" "yes" "" "" "" "" "g.99575719C>T" "" "pathogenic" "" "0000016347" "0" "99" "8" "100589719" "100589862" "del" "0" "00015" "VPS13B_000065" "g.100589719_100589862del" "" "{PMID:Seifert et al. 2006:16648375}" "" "c.5152_5295del: p.Glu1718_Glu1765del" "1 Polish COH1 family (com-het); Deletion of exon 36" "SUMMARY record" "yes" "" "" "" "" "g.99577491_99577634del" "" "pathogenic" "" "0000016348" "0" "99" "8" "100589781" "100589798" "del" "0" "00015" "VPS13B_000066" "g.100589781_100589798del" "" "{PMID:Seifert et al. 2006:16648375}" "" "c.5215_5232delAGTGTGGCTCAAGTTCAA: p.Ser1739_Gln1744del" "1 German COH1 family (het)" "SUMMARY record" "yes" "" "" "" "" "g.99577553_99577570del" "" "pathogenic" "" "0000016349" "0" "99" "8" "100654074" "100654074" "dup" "0" "00015" "VPS13B_000067" "g.100654074dup" "" "" "" "" "1 COH1 family (com-het)" "SUMMARY record" "yes" "" "0" "" "" "g.99641846dup" "" "pathogenic (recessive)" "" "0000016350" "0" "99" "8" "100654169" "100654170" "dup" "0" "00015" "VPS13B_000068" "g.100654169_100654170dup" "" "{PMID:Kolehmainen et al. 2003:12730828}, {PMID:Seifert et al. 2006:16648375}; {PMID:El Chehadeh et al. 2010:20656880}" "" "c.5426_5427dupAG: Q1810S…K1830X (exon 34)" "1 Belgian COH1 patient (com-het) and 2 French COH1 families (com-het)" "SUMMARY record" "yes" "" "0" "" "" "g.99641941_99641942dup" "" "pathogenic" "" "0000016351" "0" "99" "8" "100654204" "100654204" "dup" "0" "00015" "VPS13B_000069" "g.100654204dup" "" "{PMID:Seifert et al. 2006:16648375}" "" "c.5461_5462insC: p.Arg1821fsX18" "1 French COH1 family (com-het)" "SUMMARY record" "yes" "" "" "" "" "g.99641976dup" "" "pathogenic" "" "0000016352" "0" "99" "8" "100654356" "100654357" "ins" "0" "00015" "VPS13B_000070" "g.100654356_100654357insT" "" "{PMID:Kolehmainen et al. 2004:15141358}" "" "c.5613_5614insT: p.Ser1873fsX9" "1 British COH1 patient (com-het)" "SUMMARY record" "yes" "" "" "" "" "g.99642128_99642129insT" "" "pathogenic" "" "0000016353" "0" "99" "8" "100654480" "100654480" "dup" "0" "00015" "VPS13B_000071" "g.100654480dup" "" "{PMID:Kolehmainen et al. 2004:15141358}" "" "c.5730_5731insA: p.Ile1913fsX6" "1 Finnish COH1 patient (com-het)" "SUMMARY record" "yes" "" "" "" "" "g.99642252dup" "" "pathogenic" "" "0000016354" "0" "99" "8" "100654493" "100654493" "del" "0" "00015" "VPS13B_000072" "g.100654493del" "" "{PMID:Kolehmainen et al. 2004:15141358}" "" "c.5750delC: p.Ser1917fsX19" "1 British COH1 patient (com-het)" "SUMMARY record" "yes" "" "" "" "" "g.99642265del" "" "pathogenic" "" "0000016355" "3" "99" "8" "100654552" "100654553" "del" "0" "00015" "VPS13B_000073" "g.100654552_100654553del" "" "{PMID:Kondo et al. 2004:15691367}" "" "2-bp deletion affecting codons 1936 and 1937 (c.5808-5809delTA) in exon 34 leading to a frameshift and premature stop codon 11 amino acids downstream" "1 Japanese COH1 family (hom)" "SUMMARY record" "yes" "" "" "" "" "g.99642324_99642325del" "" "pathogenic" "" "0000016356" "0" "99" "8" "100654570" "100654570" "subst" "0" "00015" "VPS13B_000074" "g.100654570C>T" "" "{PMID:Kolehmainen et al. 2004:15141358}" "" "c.5827C>T: p.Arg1943X" "2 Finnish COH1 patients (1 hom, 1 com-het)" "SUMMARY record" "yes" "" "" "" "" "g.99642342C>T" "" "pathogenic" "" "0000016357" "0" "99" "8" "100654663" "100654663" "subst" "1.62795E-5" "00015" "VPS13B_000075" "g.100654663C>T" "" "{PMID:Seifert et al. 2006:16648375}" "" "c.5920C>T: p.Arg1974X" "1 Polish COH1 family (com-het)" "SUMMARY record" "yes" "rs180177365" "" "" "" "g.99642435C>T" "" "pathogenic" "" "0000016358" "0" "99" "8" "100712051" "100712052" "del" "0" "00015" "VPS13B_000076" "g.100712051_100712052del" "" "{PMID:Kolehmainen et al. 2003:12730828}, {PMID:Kolehmainen et al. 2004:15141358}" "" "c.6420_6421delGA: Q2140H…L2167X (exon 36)" "1 Danish COH1 patient (com-het)" "SUMMARY record" "yes" "" "" "" "" "g.99699823_99699824del" "" "pathogenic" "" "0000016359" "0" "99" "8" "100729400" "100729602" "del" "0" "00015" "VPS13B_000077" "g.100729400_100729602del" "" "{PMID:Taban et al. 2007:17383910}" "" "Homozygous c.6530_6732del (del exon 37) p.Va12245fsX16" "1 Syrian COH1 family (hom); Exon 40 deletion" "SUMMARY record" "yes" "" "" "" "" "g.99717172_99717374del" "" "pathogenic" "" "0000016361" "0" "77" "8" "100729447" "100729447" "subst" "0" "00015" "VPS13B_000079" "g.100729447T>G" "" "{PMID:Kolehmainen et al. 2003:12730828}" "" "c.6578T>G: L2193R (exon 37)" "1 Finnish COH1 patient (com-het)" "SUMMARY record" "yes" "rs120074149" "" "" "" "g.99717219T>G" "" "likely pathogenic" "" "0000016362" "0" "99" "8" "100729556" "100729556" "del" "0" "00015" "VPS13B_000080" "g.100729556del" "0/50 CON" "{PMID:Sheifert et al. 2008:19006247}" "" "c.6687delA: p.Gln2229HisfsX10 (exon 37)" "1 German COH1 family (com-het)" "SUMMARY record" "yes" "" "" "" "" "g.99717328del" "" "pathogenic" "" "0000016363" "0" "77" "8" "100729602" "100729602" "subst" "3.25751E-5" "00015" "VPS13B_000081" "g.100729602G>A" "" "{PMID:Kolehmainen et al. 2004:15141358}, {PMID:Seifert et al. 2006:16648375}" "" "c.6732+1G>A: r.spl?;p.?" "1 Israeli COH1 patient (com-het) and 1 English/Scottish COH1 family (com-het)" "SUMMARY record" "yes" "" "" "" "" "g.99717374G>A" "" "likely pathogenic" "" "0000016364" "0" "77" "8" "100732571" "100732571" "subst" "0" "00015" "VPS13B_000082" "g.100732571A>G" "" "{PMID:Kolehmainen et al. 2004:15141358}, {PMID:Taban et al. 2007:17383910}" "" "c.6733-2A>G; 6733-2G>A" "1 American COH1 patient (hom), 1 North American Caucasian COH1 family (het)" "SUMMARY record" "yes" "" "0" "" "" "g.99720343A>G" "" "likely pathogenic" "" "0000016365" "0" "77" "8" "100733172" "100733172" "subst" "8.12817E-6" "00015" "VPS13B_000083" "g.100733172A>G" "0/75 CON" "{PMID:Hennies et al. 2004:15154116}" "" "c.7022A>G: p.Tyr2341Cys" "1 German COH1 family (com-het)" "SUMMARY record" "yes" "" "" "" "" "g.99720944A>G" "" "likely pathogenic" "" "0000016366" "0" "99" "8" "100733201" "100733201" "subst" "4.06547E-6" "00015" "VPS13B_000084" "g.100733201C>T" "" "{PMID:Kolehmainen et al. 2003:12730828}, {PMID:Mochida et al. 2004:15173253}" "" "c.7051C>T: R2351X (exon 39)" "1 Belgian COH1 patient (hom), 1 French COH1 family (com-het)" "SUMMARY record" "yes" "rs120074150" "" "" "" "g.99720973C>T" "" "pathogenic" "" "0000016367" "0" "99" "8" "100779029" "100779029" "subst" "0" "00015" "VPS13B_000085" "g.100779029G>T" "" "{PMID:Seifert et al. 2006:16648375}" "" "c.7153G>T: p.Glu2384X" "1 French COH1 family (com-het)" "SUMMARY record" "yes" "rs180177368" "" "" "" "g.99766801G>T" "" "pathogenic" "" "0000016368" "0" "99" "8" "100779097" "100779097" "del" "0" "00015" "VPS13B_000086" "g.100779097del" "0/82 CON" "{PMID:Mochida et al. 2004:15173253}" "" "7221delG: Q2407H…V2414X" "1 Japanese COH1 family (het)" "SUMMARY record" "yes" "" "" "" "" "g.99766869del" "" "pathogenic" "" "0000016369" "0" "99" "8" "100779110" "100805209" "del" "0" "00015" "VPS13B_000087" "g.100779110_100805209del" "" "{PMID:Balikova et al. 2009:19533689}" "" "Del 40-43: 100848286 - 100874385 bp (hg18)" "1 COH1 family (com-het); Deletion of exons 43-46 (exon 43 partly)" "SUMMARY record" "yes" "" "" "" "" "g.99766882_99792981del" "" "pathogenic" "" "0000016370" "0" "99" "8" "100779001" "100796705" "del" "0" "00015" "VPS13B_000088" "g.(100733276_100779001)_(100796705_100821602)del" "" "" "" "del ex40-43" "1 COH1 family (com-het)" "SUMMARY record" "yes" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000016371" "0" "99" "8" "100779198" "100779199" "delins" "0" "00015" "VPS13B_000089" "g.100779198_100779199delinsATGGAGC" "" "{PMID:Seifert et al. 2006:16648375}" "" "c.7322_7322+1delGGinsATGGAGC: p.Ser2441fsX37, splice donor site, lack of splicing with an altered codon 2441, followed by 35 novel codons and a stop codon" "1 French COH1 family (com-het); Splice site mutation, sequence not shown in publication for checking" "SUMMARY record" "yes" "rs180177367" "" "" "" "g.99766970_99766971delinsATGGAGC" "" "pathogenic" "" "0000016372" "21" "77" "8" "100789185" "100789185" "subst" "8.1279E-6" "00015" "VPS13B_000090" "g.100789185G>A" "" "{PMID:Katzaki et al. 2007:17990063}" "" "c.7504+1G>A: splice site" "1 Italian COH1 family (com-het)" "SUMMARY record" "yes" "" "" "" "" "g.99776957G>A" "" "likely pathogenic" "" "0000016373" "0" "99" "8" "100791008" "100791008" "subst" "0" "00015" "VPS13B_000091" "g.100791008C>T" "0/75 CON" "{PMID:Hennies et al. 2004:15154116}, {PMID:Katzaki et al. 2007:17990063}" "" "c.7603C>T: p.Arg2535X" "1 German COH1 family (com-het), 1 Italian COH1 family (com-het)" "SUMMARY record" "yes" "" "" "" "" "g.99778780C>T" "" "pathogenic" "" "0000016374" "0" "99" "8" "100791015" "100791015" "subst" "0" "00015" "VPS13B_000092" "g.100791015G>A" "0/75 CON" "{PMID:Hennies et al. 2004:15154116}" "" "c.7610G>A: p.Trp2537X" "1 German COH1 family (com-het)" "SUMMARY record" "yes" "" "" "" "" "g.99778787G>A" "" "pathogenic" "" "0000016375" "3" "77" "8" "100796622" "100796622" "subst" "0" "00015" "VPS13B_000093" "g.100796622G>A" "0/75 CON" "{PMID:Hennies et al. 2004:15154116}, {PMID:Mochida et al. 2004:15173253}" "" "" "2 Omani COH1 families (hom)" "SUMMARY record" "yes" "rs120074153" "0" "" "" "g.99784394G>A" "" "likely pathogenic" "" "0000016377" "0" "99" "8" "100796624" "100796624" "del" "0" "00015" "VPS13B_000095" "g.100796624del" "0/75 CON" "{PMID:Hennies et al. 2004:15154116}" "" "c.7935delC: p.Gln2646fsX96" "1 Polish COH1 family (het)" "SUMMARY record" "yes" "" "" "" "" "g.99784396del" "" "pathogenic" "" "0000016378" "0" "99" "8" "100821603" "100821758" "del" "0" "00015" "VPS13B_000096" "g.100821603_100821758del" "" "{PMID:Kolehmainen et al. 2004:15141358}" "" "EX44del: p.Leu2673_Gln2724del" "1 British COH1 patient (com-het)" "SUMMARY record" "yes" "" "" "" "" "g.99809375_99809530del" "" "pathogenic" "" "0000016379" "21" "99" "8" "100821705" "100821705" "subst" "4.06788E-6" "00015" "VPS13B_000097" "g.100821705C>T" "" "{PMID:Katzaki et al. 2007:17990063}" "" "c.8119C>T: p.R2707X" "1 Italian COH1 family (com-het)" "SUMMARY record" "yes" "" "" "" "" "g.99809477C>T" "" "pathogenic" "" "0000016380" "3" "99" "8" "100829887" "100829887" "subst" "0" "00015" "VPS13B_000098" "g.100829887C>A" "" "{PMID:Seifert et al. 2006:16648375}" "" "c.8292C>A: p.Cys2764X" "1 Turkish COH1 family (hom)" "SUMMARY record" "yes" "" "" "" "" "g.99817659C>A" "" "pathogenic" "" "0000016381" "3" "77" "8" "100829913" "100829913" "subst" "0" "00015" "VPS13B_000099" "g.100829913C>T" "" "{PMID:Seifert et al. 2006:16648375}" "" "c.8318C>T: p.Ser2773Leu" "2 Turkish COH1 families (hom)" "SUMMARY record" "yes" "" "" "" "" "g.99817685C>T" "" "likely pathogenic" "" "0000016382" "0" "99" "8" "100829936" "100829936" "del" "0" "00015" "VPS13B_000100" "g.100829936del" "" "{PMID:Kolehmainen et al. 2004:15141358}" "" "c.8341delC: p.Leu2781X" "1 Danish COH1 patient (com-het)" "SUMMARY record" "yes" "" "" "" "" "g.99817708del" "" "pathogenic" "" "0000016383" "0" "99" "8" "100830678" "100833711" "del" "0" "00015" "VPS13B_000101" "g.(100830032_100830678)_(100833711_100836059)del" "" "" "" "del ex46-50" "1 Italian COH1 family (com-het)" "SUMMARY record" "yes" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000016384" "3" "55" "8" "100830701" "100830701" "subst" "0" "00015" "VPS13B_000102" "g.100830701T>C" "0/95 CEPH CON" "{PMID:Falk et al. 2004:15211651}, {PMID:Taban et al. 2007:17383910}" "" "8459T>C" "3 Amish COH1 families (2 hom and 1 com-het)" "SUMMARY record" "yes" "rs120074155" "" "" "" "g.99818473T>C" "" "VUS" "" "0000016385" "0" "99" "8" "100830714" "100830714" "subst" "8.13531E-6" "00015" "VPS13B_000103" "g.100830714G>A" "" "{PMID:Kolehmainen et al. 2003:12730828}" "" "c.8472G>A: W2824X (exon 46)" "1 English COH1 patient (het)" "SUMMARY record" "yes" "" "" "" "" "g.99818486G>A" "" "pathogenic" "" "0000016386" "3" "99" "8" "100830757" "100830757" "subst" "2.03462E-5" "00015" "VPS13B_000104" "g.100830757C>T" "0/50 CON" "{PMID:Sheifert et al. 2008:19006247}, {PMID:El Chehadeh-Djebbar et al. 2013:23188044}" "" "c.8515C>T: p.Arg2839X (exon 46)" "1 French COH1 family (hom) and one patient with COH1 (hom)" "SUMMARY record" "yes" "" "0" "" "" "g.99818529C>T" "" "pathogenic" "" "0000016387" "0" "99" "8" "100831031" "100831031" "del" "0" "00015" "VPS13B_000105" "g.100831031del" "0/75 CON" "{PMID:Hennies et al. 2004:15154116}" "" "c.8609delA: p.Glu2870fsX16" "1 German COH1 family (com-het)" "SUMMARY record" "yes" "" "" "" "" "g.99818803del" "" "pathogenic" "" "0000016388" "21" "99" "8" "100831631" "100831631" "subst" "4.06722E-6" "00015" "VPS13B_000106" "g.100831631A>G" "0/200" "{PMID:Athanasakis et al. 2012:22855652}" "" "c.8697-9A>G: Activation of a cryptic acceptor splice site in exon 48 leading to an extension of 8 nucleotides at RNA level: R2899SfsX24" "1 Italian COH1 family (com-het)" "SUMMARY record" "yes" "" "" "" "" "g.99819403A>G" "" "pathogenic" "" "0000016389" "0" "77" "8" "100831638" "100831638" "subst" "0" "00015" "VPS13B_000107" "g.100831638A>G" "" "{PMID:Kolehmainen et al. 2004:15141358}" "" "c.8697-2A>G: p.Glu2900fsX2" "1 Dutch sib pair (hom) with COH1" "SUMMARY record" "yes" "" "" "" "" "g.99819410A>G" "" "likely pathogenic" "" "0000016390" "0" "77" "8" "100832259" "100832259" "subst" "0.00323142" "00015" "VPS13B_000108" "g.100832259A>G" "" "{PMID:Kolehmainen et al. 2004:15141358}" "" "c.8978A>G: p.Asn2993Ser" "1 Belgian sib pair (hom) with COH1" "SUMMARY record" "yes" "rs28940272" "0" "" "" "g.99820031A>G" "" "likely pathogenic" "" "0000016391" "0" "99" "8" "100833710" "100833711" "ins" "0" "00015" "VPS13B_000109" "g.100833710_100833711insT" "0/95 CEPH" "{PMID:Falk et al. 2004:15211651}, {PMID:Taban et al. 2007:17383910}" "" "c.9258_9259insT; 9258insT" "3 Amish COH1 families (2 hom and 1 com-het)" "SUMMARY record" "yes" "" "0" "" "" "g.99821482_99821483insT" "" "pathogenic" "" "0000016393" "0" "99" "8" "100844596" "100844596" "subst" "0" "00015" "VPS13B_000111" "g.100844596G>T" "0/75 CON" "{PMID:Hennies et al. 2004:15154116}" "" "c.9406-1G>T: p.Tyr3136fsX16" "1 Lebanese COH1 family (hom); Activation of a cryptic splice site in exon 52 leads to a 16-bp deletion and frameshift" "SUMMARY record" "yes" "" "" "" "" "g.99832368G>T" "" "pathogenic" "" "0000016394" "0" "77" "8" "100847423" "100847423" "subst" "0" "00015" "VPS13B_000112" "g.100847423A>G" "" "{PMID:Kolehmainen et al. 2004:15141358}" "" "c.9690-2A>G: p.Arg3230fsX20" "1 British COH1 patient (com-het)" "SUMMARY record" "yes" "" "" "" "" "g.99835195A>G" "" "likely pathogenic" "" "0000016395" "0" "99" "8" "100847441" "100847441" "del" "0" "00015" "VPS13B_000113" "g.100847441del" "0/50 CON" "{PMID:Sheifert et al. 2008:19006247}" "" "c.9706delT: p.Tyr3236IlefsX7 (exon 53)" "1 Belgian COH1 family (com-het)" "SUMMARY record" "yes" "" "" "" "" "g.99835213del" "" "pathogenic" "" "0000016396" "0" "99" "8" "100847466" "100847466" "del" "0" "00015" "VPS13B_000114" "g.100847466del" "0/75 CON" "{PMID:Hennies et al. 2004:15154116}" "" "c.9731delA: p.Tyr3244fsX7" "1 German COH1 family (com-het)" "SUMMARY record" "yes" "" "" "" "" "g.99835238del" "" "pathogenic" "" "0000016397" "0" "99" "8" "100861006" "100861124" "del" "0" "00015" "VPS13B_000115" "g.100861006_100861124del" "" "{PMID:Kolehmainen et al. 2004:15141358}" "" "EX55del: p.Val3340fsX9" "1 British COH1 patient (com-het)" "SUMMARY record" "yes" "" "" "" "" "g.99848778_99848896del" "" "pathogenic" "" "0000016398" "0" "99" "8" "100861062" "100861063" "del" "0" "00015" "VPS13B_000116" "g.100861062_100861063del" "" "{PMID:Katzaki et al. 2007:17990063}" "" "c.10074_10075delCA: p.G3358fs29" "1 Italian COH1 family (com-het)." "SUMMARY record" "yes" "" "" "" "" "g.99848834_99848835del" "" "pathogenic" "" "0000016399" "11" "99" "8" "100865698" "100865698" "dup" "0" "00015" "VPS13B_000117" "g.100865698dup" "0/200" "{PMID:Athanasakis et al. 2012:22855652}" "" "c.10156dup: p.T3361NfsX3" "1 Italian COH1 family (com-het)" "SUMMARY record" "yes" "" "" "" "" "g.99853470dup" "" "pathogenic" "" "0000016400" "3" "99" "8" "100865998" "100865999" "del" "0" "00015" "VPS13B_000118" "g.100865998_100865999del" "" "{PMID:Seifert et al. 2006:16648375}" "" "c.10456_10457delAG: p.Leu3487fsX25" "1 Belgian COH1 family (hom)" "SUMMARY record" "yes" "rs180177371" "" "" "" "g.99853770_99853771del" "" "pathogenic" "" "0000016401" "0" "99" "8" "100866383" "100866386" "del" "0" "00015" "VPS13B_000119" "g.100866383_100866386del" "" "{PMID:Kolehmainen et al. 2004:15141358}" "" "c.10838_10841delCTCT: p.Leu3614fsX36" "2 Finnish COH1 patients (com-het)" "SUMMARY record" "yes" "" "" "" "" "g.99854155_99854158del" "" "pathogenic" "" "0000016402" "3" "99" "8" "100866430" "100866430" "subst" "0" "00015" "VPS13B_000120" "g.100866430C>T" "0/75 CON" "{PMID:Hennies et al. 2004:15154116}" "" "c.10888C>T: p.Gln3630X" "1 Turkish COH1 family (hom)" "SUMMARY record" "yes" "rs120074154" "" "" "" "g.99854202C>T" "" "pathogenic" "" "0000016403" "0" "99" "8" "100871535" "100871535" "subst" "0" "00015" "VPS13B_000121" "g.100871535G>A" "0/50 CON" "{PMID:Sheifert et al. 2008:19006247}" "" "c.10946G>A: p.Trp3649X (exon 57)" "1 German COH1 family (com-het)" "SUMMARY record" "yes" "" "" "" "" "g.99859307G>A" "" "pathogenic" "" "0000016404" "0" "99" "8" "100874009" "100874009" "del" "0" "00015" "VPS13B_000122" "g.100874009del" "" "{PMID:Katzaki et al. 2007:17990063}" "" "c.11125delC: p.T3708fsX61" "3 Italian COH1 families (com-het)" "SUMMARY record" "yes" "" "" "" "" "g.99861781del" "" "pathogenic" "" "0000016405" "0" "99" "8" "100874053" "100874056" "dup" "0" "00015" "VPS13B_000123" "g.100874053_100874056dup" "" "{PMID:Kolehmainen et al. 2004:15141358}, {PMID:Khan et al. 2005:16488969}" "" "c.11169_11172dupGGAC: p.Arg3725fsX7" "1 British COH1 patient (com-het) and 1 COH1 patient (com-het) with corneal ectasia" "SUMMARY record" "yes" "" "0" "" "" "g.99861825_99861828dup" "" "pathogenic" "" "0000016406" "0" "99" "8" "100874100" "100874100" "subst" "0" "00015" "VPS13B_000124" "g.100874100G>A" "0/75 CON" "{PMID:Hennies et al. 2004:15154116}" "" "c.11216G>A: p.Trp3739X" "1 German COH1 family (com-het)" "SUMMARY record" "yes" "" "" "" "" "g.99861872G>A" "" "pathogenic" "" "0000016407" "0" "99" "8" "100874129" "100874129" "subst" "0" "00015" "VPS13B_000125" "g.100874129G>T" "" "{PMID:Seifert et al. 2006:16648375}" "" "c.11245G>T: p.Glu3749X" "1 Turkish COH1 family (com-het)" "SUMMARY record" "yes" "rs180177372" "" "" "" "g.99861901G>T" "" "pathogenic" "" "0000016408" "0" "99" "8" "100880540" "100880540" "subst" "0" "00015" "VPS13B_000126" "g.100880540C>T" "0/75 CON" "{PMID:Hennies et al. 2004:15154116}, {PMID:Katzaki et al. 2007:17990063}" "" "c.11314C>T: p.Gln3772X" "1 German COH1 family (com-het), 1 Italian COH1 family (com-het)" "SUMMARY record" "yes" "" "" "" "" "g.99868312C>T" "" "pathogenic" "" "0000016409" "21" "99" "8" "100883050" "100883050" "del" "0" "00015" "VPS13B_000127" "g.100883050del" "0/676 CON" "{PMID:Rivera-Brugués et al. 2011:20921020}" "" "c.11505delA/p.K3835fsX43, exon 60" "1 German COH1 family (com-het)" "SUMMARY record" "yes" "" "0" "" "" "g.99870822del" "" "pathogenic" "" "0000016410" "21" "99" "8" "100883101" "100883101" "dup" "0" "00015" "VPS13B_000128" "g.100883101dup" "" "" "" "11556insT" "1 COH1 family (com-het)" "SUMMARY record" "yes" "" "0" "" "" "g.99870873dup" "" "pathogenic (recessive)" "" "0000016411" "0" "99" "8" "100883109" "100883109" "del" "0" "00015" "VPS13B_000129" "g.100883109del" "" "{PMID:Katzaki et al. 2007:17990063}" "" "11564delA" "2 Italian COH1 families (com-het)" "SUMMARY record" "yes" "" "0" "" "" "g.99870881del" "" "pathogenic (recessive)" "" "0000016412" "0" "99" "8" "100883109" "100883110" "del" "0" "00015" "VPS13B_000130" "g.100883109_100883110del" "" "{PMID:Seifert et al. 2006:16648375}" "" "c.11564_11565delAT: p.Tyr3855fsX30" "1 Turkish COH1 family (com-het)" "SUMMARY record" "yes" "rs180177373" "" "" "" "g.99870881_99870882del" "" "pathogenic" "" "0000016413" "0" "99" "8" "100883703" "100883703" "del" "0" "00015" "VPS13B_000131" "g.100883703del" "0/82 CON" "{PMID:Mochida et al. 2004:15173253}" "" "11598delA: E3867K…V3877X" "1 French COH1 family (com-het)" "SUMMARY record" "yes" "" "" "" "" "g.99871475del" "" "pathogenic" "" "0000016414" "0" "99" "8" "100883800" "100883803" "del" "0" "00015" "VPS13B_000132" "g.100883800_100883803del" "" "{PMID:El Chehadeh-Djebbar et al. 2013:23188044}" "" "11695delAGTG" "2 COH1 patients (com-het)" "SUMMARY record" "yes" "" "0" "" "" "g.99871572_99871575del" "" "pathogenic (recessive)" "" "0000016415" "0" "99" "8" "100883885" "100883889" "delins" "0" "00015" "VPS13B_000133" "g.100883885_100883889delinsAA" "" "{PMID:Seifert et al. 2006:16648375}" "" "c.11780delC+c.11783TG>AA: p.Thr3927fsX15" "1 German/English COH1 family (com-het)" "SUMMARY record" "yes" "" "" "" "" "g.99871657_99871661delinsAA" "" "pathogenic" "" "0000016416" "11" "77" "8" "100887650" "100887652" "dup" "0" "00015" "VPS13B_000134" "g.100887650_100887652dup" "0/676 CON" "{PMID:Rivera-Brugués et al. 2011:20921020}" "" "c.11827_11828insATG/p.D3942_G3943insD, exon 62c.11827_11828insATG/p.D3942_G3943insD, exon 62" "1 German/African COH1 family (com-het)" "SUMMARY record" "yes" "" "" "" "" "g.99875422_99875424dup" "" "likely pathogenic" "" "0000016417" "0" "99" "8" "100887731" "100887740" "del" "0" "00015" "VPS13B_000135" "g.100887731_100887740del" "" "{PMID:Kolehmainen et al. 2004:15141358}" "" "c.11906_11915delCCAGCTGTTC: p.Pro3969fsX41" "1 Israeli COH1 patient (com-het)" "SUMMARY record" "yes" "" "" "" "" "g.99875503_99875512del" "" "pathogenic" "" "0000016418" "0" "99" "8" "100887732" "100887732" "dup" "0" "00015" "VPS13B_000136" "g.100887732dup" "" "{PMID:Kolehmainen et al. 2004:15141358}, {PMID:Seifert et al. 2006:16648375}, {PMID:Yu al. 2013:23352163" "" "11827_11828insC, 11907dupC: p.Ser3970fsX22" "1 British COH1 patient (com-het) and 1 French COH1 family (com-het), 1 patient (consanguineous parents, hom) with autism and probable COH1" "SUMMARY record" "yes" "" "0" "" "" "g.99875504dup" "" "pathogenic" "" "0000016419" "0" "99" "8" "100866540" "100883818" "dup" "0" "00015" "VPS13B_000137" "g.100866540_100883818dup" "" "" "" "dup ex57-60" "1 COH1 family (com-het)" "SUMMARY record" "yes" "" "0" "" "" "g.99854312_99871590dup" "" "pathogenic (recessive)" "" "0000024443" "0" "99" "8" "100115204" "100115204" "subst" "1.626E-5" "00015" "VPS13B_000138" "g.100115204C>T" "" "{PMID:El Chehadeh et al. 2010:20656880}" "" "EX5" "1 French COH1 patient (com-het)" "SUMMARY record" "yes" "" "0" "" "" "g.99102976C>T" "" "pathogenic" "" "0000024444" "0" "99" "8" "100865681" "100865685" "dup" "0" "00015" "VPS13B_000139" "g.100865681_100865685dup" "" "{PMID:El Chehadeh et al. 2010:20656880}" "" "c.10139_10143dupCGCCA (p.A3380fsX3396)" "1 French COH1 family (het)" "SUMMARY record" "yes" "" "0" "" "" "g.99853453_99853457dup" "" "pathogenic" "" "0000024445" "0" "99" "8" "100146874" "100146874" "del" "0" "00015" "VPS13B_000140" "g.100146874del" "" "{PMID:El Chehadeh et al. 2010:20656880}" "" "c.1220delA (p.Q407fsX418)" "1 French COH1 patient (com-het)" "SUMMARY record" "yes" "" "0" "" "" "g.99134646del" "" "pathogenic" "" "0000024446" "0" "99" "8" "100115246" "100115249" "del" "0" "00015" "VPS13B_000141" "g.100115246_100115249del" "" "{PMID:El Chehadeh et al. 2010:20656880}" "" "c.477_480delACTA (p.I159fsX21)" "1 French COH1 patient (com-het)" "SUMMARY record" "yes" "" "0" "" "" "g.99103018_99103021del" "" "pathogenic" "" "0000024448" "0" "99" "8" "100133473" "100133473" "subst" "0" "00015" "VPS13B_000142" "g.100133473C>T" "" "{PMID:El Chehadeh et al. 2010:20656880}" "" "c.1006C>T (p.Q336X)" "1 French COH1 family (com-het)" "SUMMARY record" "yes" "" "0" "" "" "g.99121245C>T" "" "pathogenic" "" "0000024450" "3" "77" "8" "100568764" "100568764" "subst" "0" "00015" "VPS13B_000143" "g.100568764T>A" "" "{PMID:El Chehadeh et al. 2010:20656880}" "" "" "2 Moroccan siblings (hom)" "SUMMARY record" "yes" "" "0" "" "" "g.99556536T>A" "" "likely pathogenic" "" "0000024451" "0" "99" "8" "100779162" "100779162" "del" "0" "00015" "VPS13B_000144" "g.100779162del" "" "{PMID:El Chehadeh et al. 2010:20656880}" "" "c.7286delT (p.V2429fsX2430)" "1 French COH1 patient (com-het)" "SUMMARY record" "yes" "" "0" "" "" "g.99766934del" "" "pathogenic" "" "0000024452" "0" "99" "8" "100887685" "100887686" "dup" "0" "00015" "VPS13B_000145" "g.100887685_100887686dup" "" "{PMID:El Chehadeh et al. 2010:20656880}" "" "c.11859_11860insAA (p.N3954fsX60)" "1 French COH1 patient (com-het)" "SUMMARY record" "yes" "" "0" "" "" "g.99875457_99875458dup" "" "pathogenic" "" "0000024453" "0" "99" "8" "100866426" "100866443" "del" "0" "00015" "VPS13B_000146" "g.100866426_100866443del" "" "{PMID:El Chehadeh et al. 2010:20656880}" "" "c.10883_10900delCGAGGCAGCTTGTGCACG (p.A3628_H3633del)" "1 French COH1 patient (com-het); In the same haplotype with c.10880C>T, p.(Thr3627Ile)" "SUMMARY record" "yes" "" "0" "" "" "g.99854198_99854215del" "" "pathogenic" "" "0000024454" "0" "99" "8" "100709689" "100729809" "del" "0" "00015" "VPS13B_000147" "g.100709689_100729809del" "" "{PMID:El Chehadeh-Djebbar et al. 2011:21330571}" "" "DelEX36-37 (hg18:g.100778864_100798984del)" "1 French patient (com-het)" "SUMMARY record" "yes" "" "0" "" "" "g.99697461_99717581del" "" "pathogenic" "" "0000024455" "0" "99" "8" "100133678" "100155175" "dup" "0" "00015" "VPS13B_000148" "g.100133678_100155175dup" "" "{PMID:El Chehadeh-Djebbar et al. 2011:21330571}" "" "DupEX9-12 (g.100202854_100224351dup)" "2 French siblings with COH1 (com-het)" "SUMMARY record" "yes" "" "0" "" "" "g.99121450_99142947dup" "" "pathogenic" "" "0000024456" "3" "99" "8" "100587223" "100598874" "dup" "0" "00015" "VPS13B_000149" "g.100587223_100598874dup" "" "{PMID:El Chehadeh-Djebbar et al. 2011:21330571}" "" "DupEX32-33 (hg18:chr8:g.100656398_100668049dup)" "1 patient in consanguineous family (hom)" "SUMMARY record" "yes" "" "0" "" "" "g.99574995_99586646dup" "" "pathogenic" "" "0000024457" "0" "99" "8" "100709688" "100719958" "del" "0" "00015" "VPS13B_000150" "g.100709688_100719958del" "" "{PMID:El Chehadeh-Djebbar et al. 2011:21330571}" "" "DelEX36 (hg18:chr8:g.100778864_100789134del)" "2 siblings with COH1 (com-het)" "SUMMARY record" "yes" "" "0" "" "" "g.99697460_99707730del" "" "pathogenic" "" "0000024458" "0" "77" "8" "100830939" "100830939" "subst" "0" "00015" "VPS13B_000151" "g.100830939A>G" "" "{PMID:El Chehadeh-Djebbar et al. 2011:21330571}" "" "IVS47(-2)A>G" "2 siblings with COH1 (hom)" "SUMMARY record" "yes" "" "0" "" "" "g.99818711A>G" "" "likely pathogenic" "" "0000024459" "0" "99" "8" "100155284" "100155284" "del" "0" "00015" "VPS13B_000152" "g.100155284del" "" "{PMID:El Chehadeh-Djebbar et al. 2013:23188044}" "" "c.1733delT" "One COH1 patient (com-het)" "SUMMARY record" "?" "" "0" "" "" "g.99143056del" "" "pathogenic" "" "0000024460" "0" "99" "8" "100791048" "100791049" "delins" "0" "00015" "VPS13B_000153" "g.100791048_100791049delinsAA" "" "{PMID:El Chehadeh-Djebbar et al. 2013:23188044}" "" "EX42" "One patient with COH1 (com-het)" "SUMMARY record" "yes" "" "0" "" "" "g.99778820_99778821delinsAA" "" "pathogenic" "" "0000024461" "0" "99" "8" "100533238" "100821758" "del" "0" "00015" "VPS13B_000154" "g.(?_100533238)_(100821758_?)del" "" "{PMID:El Chehadeh-Djebbar et al. 2013:23188044}" "" "Del IVS43-44" "1 COH1 patient (com-het)" "SUMMARY record" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000024463" "0" "77" "8" "100836059" "100836059" "subst" "0" "00015" "VPS13B_000155" "g.100836059G>T" "" "{PMID:El Chehadeh-Djebbar et al. 2013:23188044}" "" "IVS51 -1 G>T" "1 patient with COH1 (com-het)" "SUMMARY record" "yes" "" "0" "" "" "g.99823831G>T" "" "likely pathogenic" "" "0000029459" "3" "77" "8" "100205240" "100205240" "subst" "0.000158549" "00015" "VPS13B_000156" "g.100205240T>G" "" "{PMID:Yu al. 2013:23352163}" "" "" "1 patient (consanguineous parents) with autism and COH1 like features (hom)" "SUMMARY record" "yes" "" "0" "" "" "g.99193012T>G" "" "likely pathogenic" "" "0000029461" "0" "77" "8" "100829780" "100829780" "subst" "8.14041E-6" "00015" "VPS13B_000157" "g.100829780G>A" "" "{PMID:Yu al. 2013:23352163}" "" "NM_152564:c.8110G>A" "1 patient (com-het) with autism and probable COH1" "SUMMARY record" "yes" "" "0" "" "" "g.99817552G>A" "" "likely pathogenic" "" "0000029462" "0" "77" "8" "100568761" "100568761" "subst" "0.000138531" "00015" "VPS13B_000158" "g.100568761A>G" "MAF(EVS500) 0.009" "{PMID:Yu al. 2013:23352163}" "" "NM_152564:c.4829A>G" "" "SUMMARY record" "yes" "" "0" "" "" "g.99556533A>G" "" "likely pathogenic" "" "0000029463" "0" "77" "8" "100729575" "100729575" "subst" "2.03356E-5" "00015" "VPS13B_000159" "g.100729575A>C" "" "{PMID:Yu al. 2013:23352163}" "" "NM_152564:c.6631A>C" "1 patient with autism (com-het)" "SUMMARY record" "yes" "" "0" "" "" "g.99717347A>C" "" "likely pathogenic" "" "0000029464" "0" "77" "8" "100847933" "100847933" "subst" "0" "00015" "VPS13B_000160" "g.100847933T>A" "" "{PMID:Yu al. 2013:23352163}" "" "NM_152564:c.9909T>A" "1 patient (com-het) with autism and COH1 like features" "SUMMARY record" "yes" "" "0" "" "" "g.99835705T>A" "" "likely pathogenic" "" "0000029465" "0" "77" "8" "100874030" "100874030" "subst" "0.00241312" "00015" "VPS13B_000161" "g.100874030G>A" "1000g 0.230" "{PMID:Yu al. 2013:23352163}" "" "NM_152564:c.11071G>A" "1 patient (com-het) with autism and COH1 like features" "SUMMARY record" "yes" "rs142476821" "0" "" "" "g.99861802G>A" "" "likely pathogenic" "" "0000029466" "21" "77" "8" "100654728" "100654728" "dup" "0" "00015" "VPS13B_000162" "g.100654728dup" "" "{PMID:Gueneau et al. 2013:24311531}" "" "IVS34+2T_+3AinsT" "1 Caucasian patient (com-het) with microcephaly, retinopathy, and congenital neutropenia , but neither obesity nor ID (which are typical to COH1)" "SUMMARY record" "yes" "" "0" "" "" "g.99642500dup" "" "likely pathogenic" "" "0000029467" "11" "77" "8" "100871710" "100871710" "subst" "0" "00015" "VPS13B_000163" "g.100871710T>C" "" "{PMID:Gueneau et al. 2013:24311531}" "" "IVS57+2T>C" "1 Caucasian patient (com-het) with microcephaly, retinopathy, and congenital neutropenia , but neither obesity nor ID (which are typical to COH1)" "SUMMARY record" "yes" "" "0" "" "" "g.99859482T>C" "" "likely pathogenic" "" "0000029468" "3" "99" "8" "100844596" "100844596" "subst" "0" "00015" "VPS13B_000164" "g.100844596G>C" "" "{PMID:Megarbane et al. 2009:19190672}" "" "" "2 Lebanese brothers with COH1, cutis verticis gyrata and sensorineural deafness; Mutation leads to abnormal splicing and 16-bp frameshift deletion in mRNA" "SUMMARY record" "yes" "" "0" "" "" "g.99832368G>C" "" "pathogenic" "" "0000029470" "0" "99" "8" "100654358" "100654358" "dup" "0" "00015" "VPS13B_000165" "g.100654358dup" "" "{PMID:Khan et al. 2005:16488969}" "" "c.5613_5614insA" "1 COH1 patient (com-het) with corneal ectasia" "SUMMARY record" "yes" "" "0" "" "" "g.99642130dup" "" "pathogenic" "" "0000039751" "3" "77" "8" "100880553" "100880553" "del" "0" "00015" "VPS13B_000166" "g.100880553del" "0/1200 controls" "{PMID:Prokudin et al. 2014:25060287}" "" "" "2 siblings of Lebanese ethnicity with retinal dystrophy, microcephaly and developmental delay and probable COH1" "SUMMARY record" "yes" "" "0" "" "" "g.99868325del" "" "likely pathogenic" "" "0000046781" "11" "90" "8" "100147792" "100270123" "del" "0" "00006" "VPS13B_000167" "g.100147792_100270123del" "" "{PMID:Gilissen 2014:24896178}" "" "" "" "Germline" "yes" "" "0" "" "" "g.99135564_99257895del" "" "pathogenic" "" "0000046782" "21" "90" "8" "100887350" "100889134" "del" "0" "00006" "VPS13B_000168" "g.100887350_100889134del" "" "{PMID:Gilissen 2014:24896178}" "" "" "breakpoint does not match Ext.Fig7 sequence" "Germline" "yes" "" "0" "" "" "g.99875122_99876906del" "" "pathogenic" "" "0000079443" "11" "90" "8" "100654062" "100654062" "dup" "0" "00006" "VPS13B_000170" "g.100654062dup" "" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "" "" "" "Germline" "" "" "0" "" "" "g.99641834dup" "" "pathogenic" "" "0000079480" "3" "90" "8" "100111821" "100115556" "del" "0" "00006" "VPS13B_000169" "g.100111821_100115556del" "" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "" "" "decreased gene dosage" "Germline" "" "" "0" "" "" "g.99099593_99103328del" "" "pathogenic" "" "0000079667" "21" "90" "8" "100729602" "100729602" "subst" "3.25751E-5" "00006" "VPS13B_000081" "g.100729602G>A" "" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "" "" "splice variant" "Germline" "" "" "0" "" "" "g.99717374G>A" "" "pathogenic" "" "0000221901" "0" "70" "8" "100520072" "100520072" "subst" "0" "01741" "VPS13B_000171" "g.100520072G>A" "" "" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.99507844G>A" "" "likely pathogenic" "" "0000244202" "3" "90" "8" "100108661" "100108661" "subst" "0" "00006" "VPS13B_000173" "g.100108661G>T" "" "{PMID:Karaca 2015:26539891}" "" "NM_152564: c.412+1G>T" "" "Germline" "" "" "0" "" "" "g.99096433G>T" "" "pathogenic" "" "0000244203" "3" "90" "8" "100026019" "100026019" "subst" "0" "00006" "VPS13B_000172" "g.100026019G>A" "" "{PMID:Karaca 2015:26539891}" "" "NM_152564: c.G3A; p.M1I" "" "Germline" "" "" "0" "" "" "g.99013791G>A" "" "pathogenic" "" "0000249668" "0" "50" "8" "100832259" "100832259" "subst" "0.00323142" "02325" "VPS13B_000108" "g.100832259A>G" "" "" "" "VPS13B(NM_017890.4):c.8978A>G (p.N2993S), VPS13B(NM_017890.5):c.8978A>G (p.N2993S), VPS13B(NM_152564.5):c.8903A>G (p.(Asn2968Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99820031A>G" "" "VUS" "" "0000249812" "0" "50" "8" "100396528" "100396528" "subst" "6.10014E-5" "02325" "VPS13B_000216" "g.100396528A>G" "" "" "" "VPS13B(NM_017890.5):c.2917A>G (p.S973G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99384300A>G" "" "VUS" "" "0000249831" "0" "50" "8" "100866185" "100866185" "subst" "0.000174609" "02325" "VPS13B_000329" "g.100866185A>G" "" "" "" "VPS13B(NM_017890.4):c.10643A>G (p.Y3548C), VPS13B(NM_017890.5):c.10643A>G (p.Y3548C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99853957A>G" "" "VUS" "" "0000250689" "0" "10" "8" "100733188" "100733188" "subst" "0.0468192" "02326" "VPS13B_000272" "g.100733188A>G" "" "" "" "VPS13B(NM_017890.4):c.7038A>G (p.V2346=), VPS13B(NM_152564.5):c.6963A>G (p.(Val2321=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99720960A>G" "" "benign" "" "0000250712" "0" "10" "8" "100396559" "100396559" "subst" "0.011001" "02326" "VPS13B_000217" "g.100396559A>T" "" "" "" "VPS13B(NM_017890.4):c.2934+14A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99384331A>T" "" "benign" "" "0000250758" "0" "10" "8" "100836215" "100836215" "subst" "0.000640436" "02326" "VPS13B_000306" "g.100836215A>G" "" "" "" "VPS13B(NM_017890.4):c.9405+9A>G, VPS13B(NM_017890.5):c.9405+9A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99823987A>G" "" "benign" "" "0000251022" "0" "10" "8" "100050677" "100050677" "subst" "0" "02326" "VPS13B_000365" "g.100050677A>G" "" "" "" "VPS13B(NM_017890.4):c.174A>G (p.L58=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99038449A>G" "" "benign" "" "0000251023" "0" "10" "8" "100831048" "100831048" "subst" "0" "02326" "VPS13B_000293" "g.100831048A>G" "" "" "" "VPS13B(NM_017890.4):c.8628A>G (p.G2876=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99818820A>G" "" "benign" "" "0000251107" "0" "10" "8" "100155336" "100155336" "subst" "0" "02326" "VPS13B_000194" "g.100155336A>C" "" "" "" "VPS13B(NM_017890.4):c.1786A>C (p.K596Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99143108A>C" "" "benign" "" "0000251404" "0" "10" "8" "100026253" "100026253" "subst" "0" "02326" "VPS13B_000174" "g.100026253A>G" "" "" "" "VPS13B(NM_017890.4):c.147+90A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99014025A>G" "" "benign" "" "0000251405" "0" "10" "8" "100396564" "100396564" "subst" "0" "02326" "VPS13B_000218" "g.100396564A>T" "" "" "" "VPS13B(NM_017890.4):c.2934+19A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99384336A>T" "" "benign" "" "0000251406" "0" "10" "8" "100444076" "100444076" "subst" "0" "02326" "VPS13B_000222" "g.100444076A>C" "" "" "" "VPS13B(NM_017890.4):c.3210+184A>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99431848A>C" "" "benign" "" "0000251407" "0" "10" "8" "100454477" "100454477" "subst" "0" "02326" "VPS13B_000367" "g.100454477A>G" "" "" "" "VPS13B(NM_017890.4):c.3211-152A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99442249A>G" "" "benign" "" "0000251408" "0" "10" "8" "100833451" "100833451" "del" "0" "02326" "VPS13B_000302" "g.100833451del" "" "" "" "VPS13B(NM_017890.4):c.9070-71delA" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99821223del" "" "benign" "" "0000252616" "0" "90" "8" "100168775" "100168775" "subst" "0" "02326" "VPS13B_000028" "g.100168775A>G" "" "" "" "VPS13B(NM_017890.4):c.2014-2A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99156547A>G" "" "pathogenic" "" "0000252749" "0" "50" "8" "100711762" "100711762" "subst" "0" "02326" "VPS13B_000259" "g.100711762A>T" "" "" "" "VPS13B(NM_017890.4):c.6131A>T (p.N2044I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99699534A>T" "" "VUS" "" "0000253041" "0" "10" "8" "100733188" "100733188" "subst" "0.0468192" "01943" "VPS13B_000272" "g.100733188A>G" "" "" "" "VPS13B(NM_017890.4):c.7038A>G (p.V2346=), VPS13B(NM_152564.5):c.6963A>G (p.(Val2321=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99720960A>G" "" "benign" "" "0000253064" "0" "10" "8" "100396559" "100396559" "subst" "0.011001" "01943" "VPS13B_000217" "g.100396559A>T" "" "" "" "VPS13B(NM_017890.4):c.2934+14A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99384331A>T" "" "benign" "" "0000253453" "0" "10" "8" "100883745" "100883745" "subst" "0.00805338" "01943" "VPS13B_000343" "g.100883745A>G" "" "" "" "VPS13B(NM_017890.4):c.11640A>G (p.S3880=), VPS13B(NM_152564.5):c.11565A>G (p.(Ser3855=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99871517A>G" "" "benign" "" "0000253726" "0" "10" "8" "100829841" "100829841" "subst" "0.00179875" "01943" "VPS13B_000287" "g.100829841A>G" "" "" "" "VPS13B(NM_017890.4):c.8246A>G (p.Y2749C), VPS13B(NM_017890.5):c.8246A>G (p.Y2749C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99817613A>G" "" "benign" "" "0000253977" "0" "30" "8" "100836215" "100836215" "subst" "0.000640436" "01943" "VPS13B_000306" "g.100836215A>G" "" "" "" "VPS13B(NM_017890.4):c.9405+9A>G, VPS13B(NM_017890.5):c.9405+9A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99823987A>G" "" "likely benign" "" "0000254215" "0" "30" "8" "100287418" "100287418" "subst" "0.0025759" "01943" "VPS13B_000212" "g.100287418A>G" "" "" "" "VPS13B(NM_017890.4):c.2760A>G (p.L920=), VPS13B(NM_017890.5):c.2760A>G (p.L920=), VPS13B(NM_152564.5):c.2760A>G (p.(Leu920=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99275190A>G" "" "likely benign" "" "0000254216" "0" "30" "8" "100729589" "100729589" "subst" "0.000122059" "01943" "VPS13B_000268" "g.100729589A>C" "" "" "" "VPS13B(NM_017890.4):c.6720A>C (p.G2240=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99717361A>C" "" "likely benign" "" "0000254217" "0" "30" "8" "100831721" "100831721" "subst" "0" "01943" "VPS13B_000297" "g.100831721A>G" "" "" "" "VPS13B(NM_017890.4):c.8778A>G (p.G2926=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99819493A>G" "" "likely benign" "" "0000254490" "0" "30" "8" "100108606" "100108606" "subst" "0.00119871" "01943" "VPS13B_000178" "g.100108606A>G" "" "" "" "VPS13B(NM_017890.4):c.358A>G (p.I120V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99096378A>G" "" "likely benign" "" "0000254493" "0" "30" "8" "100514047" "100514047" "subst" "0" "01943" "VPS13B_000235" "g.100514047A>G" "" "" "" "VPS13B(NM_017890.4):c.4003A>G (p.I1335V, p.(Ile1335Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99501819A>G" "" "likely benign" "" "0000254587" "0" "30" "8" "100454804" "100454804" "subst" "0.00464668" "01943" "VPS13B_000224" "g.100454804A>G" "" "" "" "VPS13B(NM_017890.4):c.3386A>G (p.K1129R), VPS13B(NM_017890.5):c.3386A>G (p.K1129R), VPS13B(NM_152564.5):c.3386A>G (p.(Lys1129Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99442576A>G" "" "likely benign" "" "0000254631" "0" "30" "8" "100287362" "100287362" "subst" "0.000731993" "01943" "VPS13B_000211" "g.100287362A>G" "" "" "" "VPS13B(NM_017890.4):c.2704A>G (p.K902E), VPS13B(NM_017890.5):c.2704A>G (p.K902E), VPS13B(NM_152564.5):c.2704A>G (p.(Lys902Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99275134A>G" "" "likely benign" "" "0000254676" "0" "30" "8" "100847888" "100847888" "subst" "0" "01943" "VPS13B_000319" "g.100847888A>C" "" "" "" "VPS13B(NM_017890.4):c.9939A>C (p.L3313=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99835660A>C" "" "likely benign" "" "0000254948" "0" "30" "8" "100874140" "100874140" "subst" "0.00162417" "01943" "VPS13B_000337" "g.100874140A>G" "" "" "" "VPS13B(NM_017890.4):c.11256A>G (p.R3752=), VPS13B(NM_017890.5):c.11256A>G (p.R3752=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99861912A>G" "" "likely benign" "" "0000254997" "0" "30" "8" "100844615" "100844615" "subst" "0.00947675" "01943" "VPS13B_000313" "g.100844615A>G" "" "" "" "VPS13B(NM_017890.4):c.9424A>G (p.S3142G, p.(Ser3142Gly)), VPS13B(NM_017890.5):c.9424A>G (p.S3142G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99832387A>G" "" "likely benign" "" "0000255001" "0" "30" "8" "100133508" "100133508" "subst" "0.000515946" "01943" "VPS13B_000366" "g.100133508A>G" "" "" "" "VPS13B(NM_017890.4):c.1041A>G (p.S347=), VPS13B(NM_017890.5):c.1041A>G (p.S347=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99121280A>G" "" "likely benign" "" "0000255041" "0" "30" "8" "100479712" "100479712" "subst" "0.000890418" "01943" "VPS13B_000368" "g.100479712A>G" "" "" "" "VPS13B(NM_017890.4):c.3516A>G (p.T1172=), VPS13B(NM_017890.5):c.3516A>G (p.T1172=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99467484A>G" "" "likely benign" "" "0000255248" "0" "30" "8" "100146967" "100146967" "subst" "2.04554E-5" "01943" "VPS13B_000189" "g.100146967A>G" "" "" "" "VPS13B(NM_017890.4):c.1302+12A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99134739A>G" "" "likely benign" "" "0000255249" "0" "30" "8" "100733286" "100733286" "subst" "0.000899691" "01943" "VPS13B_000273" "g.100733286A>G" "" "" "" "VPS13B(NM_017890.4):c.7125+11A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99721058A>G" "" "likely benign" "" "0000255250" "0" "30" "8" "100883121" "100883121" "subst" "0.000158484" "01943" "VPS13B_000339" "g.100883121A>G" "" "" "" "VPS13B(NM_017890.4):c.11570+6A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99870893A>G" "" "likely benign" "" "0000255628" "0" "90" "8" "100712145" "100712145" "del" "0" "01943" "VPS13B_000262" "g.100712145del" "" "" "" "VPS13B(NM_017890.4):c.6514delA (p.T2172Hfs*7)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99699917del" "" "pathogenic" "" "0000255985" "0" "50" "8" "100147957" "100147957" "subst" "0.000569536" "01943" "VPS13B_000192" "g.100147957A>G" "" "" "" "VPS13B(NM_015243.2):c.1559A>G (p.(His520Arg)), VPS13B(NM_017890.4):c.1559A>G (p.H520R), VPS13B(NM_017890.5):c.1559A>G (p.H520R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99135729A>G" "" "VUS" "" "0000256020" "0" "50" "8" "100654723" "100654723" "subst" "0.0015341" "01943" "VPS13B_000255" "g.100654723A>G" "" "" "" "VPS13B(NM_017890.4):c.5980A>G (p.I1994V), VPS13B(NM_017890.5):c.5980A>G (p.I1994V), VPS13B(NM_152564.4):c.5905A>G (p.(Ile1969Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99642495A>G" "" "VUS" "" "0000256050" "0" "50" "8" "100831040" "100831040" "subst" "0" "01943" "VPS13B_000292" "g.100831040A>T" "" "" "" "VPS13B(NM_017890.4):c.8620A>T (p.I2874F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99818812A>T" "" "VUS" "" "0000256531" "0" "50" "8" "100493971" "100493971" "subst" "0.000715843" "01943" "VPS13B_000230" "g.100493971A>T" "" "" "" "VPS13B(NM_017890.4):c.3811A>T (p.T1271S), VPS13B(NM_017890.5):c.3811A>T (p.T1271S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99481743A>T" "" "VUS" "" "0000311319" "0" "30" "8" "100712138" "100712138" "subst" "4.08243E-6" "02330" "VPS13B_000261" "g.100712138C>A" "" "" "" "VPS13B(NM_017890.5):c.6507C>A (p.V2169=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99699910C>A" "" "likely benign" "" "0000313026" "0" "10" "8" "100133706" "100133706" "subst" "0.739861" "02325" "VPS13B_000187" "g.100133706T>G" "" "" "" "VPS13B(NM_181661.2):c.1239T>G (p.Y413*), VPS13B(NM_181661.3):c.1239T>G (p.Y413*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99121478T>G" "" "benign" "" "0000313027" "0" "30" "8" "100205243" "100205243" "subst" "0.000101657" "02325" "VPS13B_000204" "g.100205243G>A" "" "" "" "VPS13B(NM_017890.5):c.2473G>A (p.A825T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99193015G>A" "" "likely benign" "" "0000313028" "0" "10" "8" "100493820" "100493820" "subst" "0.0377581" "02325" "VPS13B_000229" "g.100493820C>T" "" "" "" "VPS13B(NM_017890.4):c.3667-7C>T, VPS13B(NM_017890.5):c.3667-7C>T, VPS13B(NM_152564.5):c.3667-7C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99481592C>T" "" "benign" "" "0000313029" "0" "90" "8" "100654480" "100654480" "dup" "0" "02325" "VPS13B_000251" "g.100654480dup" "" "" "" "VPS13B(NM_017890.5):c.5737dupA (p.I1913Nfs*7)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99642252dup" "" "pathogenic" "" "0000313030" "0" "90" "8" "100712113" "100712113" "subst" "0" "02325" "VPS13B_000260" "g.100712113C>G" "" "" "" "VPS13B(NM_017890.5):c.6482C>G (p.S2161*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99699885C>G" "" "pathogenic" "" "0000313031" "0" "10" "8" "100844758" "100844758" "subst" "0.205032" "02325" "VPS13B_000315" "g.100844758T>C" "" "" "" "VPS13B(NM_017890.4):c.9567T>C (p.S3189=), VPS13B(NM_017890.5):c.9567T>C (p.S3189=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99832530T>C" "" "benign" "" "0000313032" "0" "30" "8" "100844858" "100844858" "subst" "0.00366803" "02325" "VPS13B_000316" "g.100844858C>T" "" "" "" "VPS13B(NM_017890.4):c.9667C>T (p.R3223W), VPS13B(NM_017890.5):c.9667C>T (p.R3223W), VPS13B(NM_152564.4):c.9592C>T (p.(Arg3198Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99832630C>T" "" "likely benign" "" "0000315301" "0" "10" "8" "100861146" "100861146" "subst" "0.172337" "02326" "VPS13B_000324" "g.100861146G>A" "" "" "" "VPS13B(NM_017890.4):c.10136+24G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99848918G>A" "" "benign" "" "0000315302" "0" "10" "8" "100865682" "100865682" "subst" "0.0174041" "02326" "VPS13B_000326" "g.100865682G>T" "" "" "" "VPS13B(NM_017890.4):c.10140G>T (p.A3380=), VPS13B(NM_152564.5):c.10065G>T (p.(Ala3355=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99853454G>T" "" "benign" "" "0000315303" "0" "10" "8" "100865836" "100865836" "subst" "0.123331" "02326" "VPS13B_000328" "g.100865836G>A" "" "" "" "VPS13B(NM_017890.4):c.10294G>A (p.G3432R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99853608G>A" "" "benign" "" "0000315304" "0" "10" "8" "100866540" "100866540" "subst" "0" "02326" "VPS13B_000331" "g.100866540G>A" "" "" "" "VPS13B(NM_017890.4):c.10942+56G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99854312G>A" "" "benign" "" "0000315305" "0" "50" "8" "100871613" "100871613" "subst" "0" "02326" "VPS13B_000333" "g.100871613T>C" "" "" "" "VPS13B(NM_017890.4):c.11024T>C (p.F3675S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99859385T>C" "" "VUS" "" "0000315306" "0" "50" "8" "100883155" "100883155" "subst" "0" "02326" "VPS13B_000341" "g.100883155T>G" "" "" "" "VPS13B(NM_017890.4):c.11570+40T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99870927T>G" "" "VUS" "" "0000315307" "0" "10" "8" "100133706" "100133706" "subst" "0.739861" "02326" "VPS13B_000187" "g.100133706T>G" "" "" "" "VPS13B(NM_181661.2):c.1239T>G (p.Y413*), VPS13B(NM_181661.3):c.1239T>G (p.Y413*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99121478T>G" "" "benign" "" "0000315308" "0" "10" "8" "100026275" "100026275" "subst" "0" "02326" "VPS13B_000175" "g.100026275T>C" "" "" "" "VPS13B(NM_017890.4):c.147+112T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99014047T>C" "" "benign" "" "0000315309" "0" "10" "8" "100160338" "100160338" "subst" "0" "02326" "VPS13B_000198" "g.100160338G>T" "" "" "" "VPS13B(NM_017890.4):c.2013+100G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99148110G>T" "" "benign" "" "0000315310" "0" "10" "8" "100160298" "100160299" "del" "0" "02326" "VPS13B_000197" "g.100160298_100160299del" "" "" "" "VPS13B(NM_017890.4):c.2013+60_2013+61delTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99148070_99148071del" "" "benign" "" "0000315311" "0" "10" "8" "100168680" "100168680" "subst" "0" "02326" "VPS13B_000199" "g.100168680C>G" "" "" "" "VPS13B(NM_017890.4):c.2014-97C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99156452C>G" "" "benign" "" "0000315312" "0" "10" "8" "100221810" "100221810" "del" "0" "02326" "VPS13B_000206" "g.100221810del" "" "" "" "VPS13B(NM_017890.4):c.2515+16525delT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99209582del" "" "benign" "" "0000315313" "0" "10" "8" "100286280" "100286280" "subst" "0" "02326" "VPS13B_000209" "g.100286280T>C" "" "" "" "VPS13B(NM_017890.4):c.2516-146T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99274052T>C" "" "benign" "" "0000315314" "0" "10" "8" "100287535" "100287535" "del" "0" "02326" "VPS13B_000214" "g.100287535del" "" "" "" "VPS13B(NM_017890.4):c.2824+53delT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99275307del" "" "benign" "" "0000315315" "0" "10" "8" "100287579" "100287579" "subst" "0" "02326" "VPS13B_000215" "g.100287579G>C" "" "" "" "VPS13B(NM_017890.4):c.2824+97G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99275351G>C" "" "benign" "" "0000315316" "0" "10" "8" "100403762" "100403762" "subst" "0" "02326" "VPS13B_000219" "g.100403762G>A" "" "" "" "VPS13B(NM_017890.4):c.2935-23G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99391534G>A" "" "benign" "" "0000315317" "0" "90" "8" "100479794" "100479794" "subst" "1.22049E-5" "02326" "VPS13B_000227" "g.100479794C>T" "" "" "" "VPS13B(NM_017890.4):c.3598C>T (p.R1200*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99467566C>T" "" "pathogenic" "" "0000315318" "0" "10" "8" "100479917" "100479917" "subst" "0" "02326" "VPS13B_000228" "g.100479917T>C" "" "" "" "VPS13B(NM_017890.4):c.3666+55T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99467689T>C" "" "benign" "" "0000315319" "0" "10" "8" "100493820" "100493820" "subst" "0.0377581" "02326" "VPS13B_000229" "g.100493820C>T" "" "" "" "VPS13B(NM_017890.4):c.3667-7C>T, VPS13B(NM_017890.5):c.3667-7C>T, VPS13B(NM_152564.5):c.3667-7C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99481592C>T" "" "benign" "" "0000315320" "0" "90" "8" "100494031" "100494031" "subst" "1.62958E-5" "02326" "VPS13B_000233" "g.100494031G>T" "" "" "" "VPS13B(NM_017890.4):c.3870+1G>T (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99481803G>T" "" "pathogenic" "" "0000315321" "0" "10" "8" "100523793" "100523793" "subst" "0" "02326" "VPS13B_000239" "g.100523793C>T" "" "" "" "VPS13B(NM_017890.4):c.4708+53C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99511565C>T" "" "benign" "" "0000315322" "0" "10" "8" "100568664" "100568664" "subst" "0.00180738" "02326" "VPS13B_000242" "g.100568664C>T" "" "" "" "VPS13B(NM_017890.4):c.4821-14C>T, VPS13B(NM_017890.5):c.4821-14C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99556436C>T" "" "benign" "" "0000315323" "0" "10" "8" "100568593" "100568593" "subst" "0" "02326" "VPS13B_000240" "g.100568593C>T" "" "" "" "VPS13B(NM_017890.4):c.4821-85C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99556365C>T" "" "benign" "" "0000315326" "0" "10" "8" "100654424" "100654424" "subst" "0.00090241" "02326" "VPS13B_000249" "g.100654424C>T" "" "" "" "VPS13B(NM_017890.4):c.5681C>T (p.T1894M), VPS13B(NM_017890.5):c.5681C>T (p.T1894M), VPS13B(NM_152564.4):c.5606C>T (p.(Thr1869Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99642196C>T" "" "benign" "" "0000315327" "0" "10" "8" "100123309" "100123309" "subst" "0" "02326" "VPS13B_000181" "g.100123309T>C" "" "" "" "VPS13B(NM_017890.4):c.581-17T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99111081T>C" "" "benign" "" "0000315328" "0" "10" "8" "100654783" "100654783" "subst" "0" "02326" "VPS13B_000256" "g.100654783C>A" "" "" "" "VPS13B(NM_017890.4):c.5983+57C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99642555C>A" "" "benign" "" "0000315329" "0" "10" "8" "100709538" "100709538" "subst" "0" "02326" "VPS13B_000258" "g.100709538G>A" "" "" "" "VPS13B(NM_017890.4):c.6122-2215G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99697310G>A" "" "benign" "" "0000315330" "0" "10" "8" "100709155" "100709155" "subst" "0" "02326" "VPS13B_000257" "g.100709155T>C" "" "" "" "VPS13B(NM_017890.4):c.6122-2598T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99696927T>C" "" "benign" "" "0000315331" "0" "10" "8" "100712250" "100712250" "subst" "0" "02326" "VPS13B_000263" "g.100712250T>C" "" "" "" "VPS13B(NM_017890.4):c.6529+90T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99700022T>C" "" "benign" "" "0000315332" "0" "10" "8" "100729395" "100729395" "del" "0" "02326" "VPS13B_000264" "g.100729395del" "" "" "" "VPS13B(NM_017890.4):c.6530-4delT, VPS13B(NM_017890.5):c.6530-4delT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99717167del" "" "benign" "" "0000315333" "0" "10" "8" "100729394" "100729394" "subst" "0" "02326" "VPS13B_000266" "g.100729394T>C" "" "" "" "VPS13B(NM_017890.4):c.6530-5T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99717166T>C" "" "benign" "" "0000315334" "0" "90" "8" "100729602" "100729602" "subst" "3.25751E-5" "02326" "VPS13B_000081" "g.100729602G>A" "" "" "" "VPS13B(NM_017890.4):c.6732+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99717374G>A" "" "pathogenic" "" "0000315335" "0" "10" "8" "100779103" "100779103" "subst" "0.0039931" "02326" "VPS13B_000276" "g.100779103G>A" "" "" "" "VPS13B(NM_017890.4):c.7227G>A (p.P2409=), VPS13B(NM_017890.5):c.7227G>A (p.P2409=), VPS13B(NM_152564.5):c.7152G>A (p.(Pro2384=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99766875G>A" "" "benign" "" "0000315336" "0" "10" "8" "100788929" "100788929" "subst" "0" "02326" "VPS13B_000277" "g.100788929T>A" "" "" "" "VPS13B(NM_017890.4):c.7323-74T>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99776701T>A" "" "benign" "" "0000315337" "0" "10" "8" "100123526" "100123526" "del" "0" "02326" "VPS13B_000183" "g.100123526del" "" "" "" "VPS13B(NM_017890.4):c.762+19delT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99111298del" "" "benign" "" "0000315338" "0" "10" "8" "100127850" "100127850" "subst" "0" "02326" "VPS13B_000184" "g.100127850C>G" "" "" "" "VPS13B(NM_017890.4):c.763-78C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99115622C>G" "" "benign" "" "0000315339" "0" "10" "8" "100791156" "100791156" "subst" "0.0507001" "02326" "VPS13B_000278" "g.100791156T>C" "" "" "" "VPS13B(NM_017890.4):c.7751T>C (p.V2584A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99778928T>C" "" "benign" "" "0000315340" "0" "90" "8" "100791259" "100791259" "subst" "0" "02326" "VPS13B_000284" "g.100791259G>C" "" "" "" "VPS13B(NM_017890.4):c.7854G>C (p.Q2618H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99779031G>C" "" "pathogenic" "" "0000315341" "0" "70" "8" "100830031" "100830031" "subst" "0" "02326" "VPS13B_000290" "g.100830031G>A" "" "" "" "VPS13B(NM_017890.4):c.8436G>A (p.Q2812=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99817803G>A" "" "likely pathogenic" "" "0000315342" "0" "10" "8" "100831508" "100831508" "subst" "0" "02326" "VPS13B_000295" "g.100831508G>A" "" "" "" "VPS13B(NM_017890.4):c.8697-132G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99819280G>A" "" "benign" "" "0000315343" "0" "10" "8" "100831593" "100831593" "subst" "0.00497075" "02326" "VPS13B_000296" "g.100831593C>T" "" "" "" "VPS13B(NM_017890.4):c.8697-47C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99819365C>T" "" "benign" "" "0000315344" "0" "10" "8" "100832530" "100832530" "del" "0" "02326" "VPS13B_000301" "g.100832530del" "" "" "" "VPS13B(NM_017890.4):c.9069+180delT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99820302del" "" "benign" "" "0000315345" "0" "10" "8" "100836216" "100836216" "subst" "0.0138685" "02326" "VPS13B_000307" "g.100836216T>A" "" "" "" "VPS13B(NM_017890.4):c.9405+10T>A, VPS13B(NM_152564.5):c.9330+10T>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99823988T>A" "" "benign" "" "0000315346" "0" "10" "8" "100844592" "100844594" "dup" "0" "02326" "VPS13B_000308" "g.100844592_100844594dup" "" "" "" "VPS13B(NM_017890.4):c.9406-4_9406-2dupTTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99832364_99832366dup" "" "benign" "" "0000315347" "0" "10" "8" "100844594" "100844594" "del" "0" "02326" "VPS13B_000309" "g.100844594del" "" "" "" "VPS13B(NM_017890.4):c.9406-3delT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99832366del" "" "benign" "" "0000315348" "0" "10" "8" "100844758" "100844758" "subst" "0.205032" "02326" "VPS13B_000315" "g.100844758T>C" "" "" "" "VPS13B(NM_017890.4):c.9567T>C (p.S3189=), VPS13B(NM_017890.5):c.9567T>C (p.S3189=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99832530T>C" "" "benign" "" "0000315349" "0" "30" "8" "100844858" "100844858" "subst" "0.00366803" "02326" "VPS13B_000316" "g.100844858C>T" "" "" "" "VPS13B(NM_017890.4):c.9667C>T (p.R3223W), VPS13B(NM_017890.5):c.9667C>T (p.R3223W), VPS13B(NM_152564.4):c.9592C>T (p.(Arg3198Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99832630C>T" "" "likely benign" "" "0000319660" "0" "50" "8" "100861110" "100861110" "subst" "0.00800188" "01943" "VPS13B_000322" "g.100861110C>T" "" "" "" "VPS13B(NM_017890.4):c.10124C>T (p.T3375I, p.(Thr3375Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99848882C>T" "" "VUS" "" "0000319661" "0" "70" "8" "100861123" "100861123" "subst" "4.06243E-6" "01943" "VPS13B_000323" "g.100861123G>A" "" "" "" "VPS13B(NM_017890.4):c.10136+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99848895G>A" "" "likely pathogenic" "" "0000319662" "0" "10" "8" "100861146" "100861146" "subst" "0.172337" "01943" "VPS13B_000324" "g.100861146G>A" "" "" "" "VPS13B(NM_017890.4):c.10136+24G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99848918G>A" "" "benign" "" "0000319663" "0" "10" "8" "100865682" "100865682" "subst" "0.0174041" "01943" "VPS13B_000326" "g.100865682G>T" "" "" "" "VPS13B(NM_017890.4):c.10140G>T (p.A3380=), VPS13B(NM_152564.5):c.10065G>T (p.(Ala3355=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99853454G>T" "" "benign" "" "0000319664" "0" "30" "8" "100865772" "100865772" "subst" "0.00274125" "01943" "VPS13B_000327" "g.100865772G>A" "" "" "" "VPS13B(NM_017890.4):c.10230G>A (p.E3410=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99853544G>A" "" "likely benign" "" "0000319665" "0" "10" "8" "100865836" "100865836" "subst" "0.123331" "01943" "VPS13B_000328" "g.100865836G>A" "" "" "" "VPS13B(NM_017890.4):c.10294G>A (p.G3432R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99853608G>A" "" "benign" "" "0000319666" "0" "50" "8" "100871664" "100871664" "subst" "0" "01943" "VPS13B_000334" "g.100871664G>A" "" "" "" "VPS13B(NM_017890.4):c.11075G>A (p.G3692D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99859436G>A" "" "VUS" "" "0000319667" "0" "50" "8" "100133575" "100133575" "subst" "2.84375E-5" "01943" "VPS13B_000186" "g.100133575G>C" "" "" "" "VPS13B(NM_017890.4):c.1108G>C (p.D370H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99121347G>C" "" "VUS" "" "0000319668" "0" "10" "8" "100871721" "100871721" "subst" "0.00237611" "01943" "VPS13B_000335" "g.100871721G>A" "" "" "" "VPS13B(NM_017890.4):c.11119+13G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99859493G>A" "" "benign" "" "0000319669" "0" "30" "8" "100874030" "100874030" "subst" "0.00241312" "01943" "VPS13B_000161" "g.100874030G>A" "" "" "" "VPS13B(NM_017890.4):c.11146G>A (p.A3716T, p.(Ala3716Thr)), VPS13B(NM_017890.5):c.11146G>A (p.A3716T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99861802G>A" "" "likely benign" "" "0000319670" "0" "50" "8" "100874117" "100874117" "subst" "0.00021213" "01943" "VPS13B_000336" "g.100874117G>A" "" "" "" "VPS13B(NM_017890.4):c.11233G>A (p.E3745K), VPS13B(NM_152564.5):c.11158G>A (p.(Glu3720Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99861889G>A" "" "VUS" "" "0000319671" "0" "50" "8" "100874154" "100874154" "subst" "0.00185926" "01943" "VPS13B_000338" "g.100874154G>A" "" "" "" "VPS13B(NM_017890.4):c.11270G>A (p.R3757Q, p.(Arg3757Gln)), VPS13B(NM_017890.5):c.11270G>A (p.R3757Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99861926G>A" "" "VUS" "" "0000319672" "0" "30" "8" "100883133" "100883133" "subst" "0.000105811" "01943" "VPS13B_000340" "g.100883133C>T" "" "" "" "VPS13B(NM_017890.4):c.11570+18C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99870905C>T" "" "likely benign" "" "0000319673" "0" "50" "8" "100883717" "100883717" "subst" "4.06111E-6" "01943" "VPS13B_000342" "g.100883717C>A" "" "" "" "VPS13B(NM_017890.4):c.11612C>A (p.A3871D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99871489C>A" "" "VUS" "" "0000319674" "0" "30" "8" "100883793" "100883793" "subst" "0.000690406" "01943" "VPS13B_000344" "g.100883793C>T" "" "" "" "VPS13B(NM_017890.4):c.11688C>T (p.F3896=), VPS13B(NM_017890.5):c.11688C>T (p.F3896=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99871565C>T" "" "likely benign" "" "0000319675" "0" "30" "8" "100883799" "100883799" "subst" "0.000633595" "01943" "VPS13B_000345" "g.100883799G>C" "" "" "" "VPS13B(NM_017890.4):c.11694G>C (p.V3898=), VPS13B(NM_017890.5):c.11694G>C (p.V3898=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99871571G>C" "" "likely benign" "" "0000319676" "0" "50" "8" "100883871" "100883871" "subst" "2.43686E-5" "01943" "VPS13B_000346" "g.100883871G>C" "" "" "" "VPS13B(NM_017890.4):c.11766G>C (p.Q3922H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99871643G>C" "" "VUS" "" "0000319677" "0" "30" "8" "100883895" "100883895" "subst" "5.28129E-5" "01943" "VPS13B_000347" "g.100883895C>A" "" "" "" "VPS13B(NM_017890.4):c.11790C>A (p.L3930=), VPS13B(NM_017890.5):c.11790C>A (p.L3930=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99871667C>A" "" "likely benign" "" "0000319678" "0" "50" "8" "100887659" "100887659" "subst" "7.73761E-5" "01943" "VPS13B_000349" "g.100887659G>A" "" "" "" "VPS13B(NM_017890.4):c.11834G>A (p.R3945Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99875431G>A" "" "VUS" "" "0000319680" "0" "10" "8" "100133706" "100133706" "subst" "0.739861" "01943" "VPS13B_000187" "g.100133706T>G" "" "" "" "VPS13B(NM_181661.2):c.1239T>G (p.Y413*), VPS13B(NM_181661.3):c.1239T>G (p.Y413*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99121478T>G" "" "benign" "" "0000319681" "0" "10" "8" "100146946" "100146946" "subst" "0.00320252" "01943" "VPS13B_000188" "g.100146946T>G" "" "" "" "VPS13B(NM_017890.4):c.1293T>G (p.T431=), VPS13B(NM_152564.5):c.1293T>G (p.(Thr431=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99134718T>G" "" "benign" "" "0000319682" "0" "50" "8" "100155250" "100155250" "subst" "0.000370334" "01943" "VPS13B_000193" "g.100155250G>A" "" "" "" "VPS13B(NM_017890.4):c.1700G>A (p.G567E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99143022G>A" "" "VUS" "" "0000319683" "0" "30" "8" "100155382" "100155382" "subst" "0.00130029" "01943" "VPS13B_000195" "g.100155382G>A" "" "" "" "VPS13B(NM_017890.4):c.1832G>A (p.R611K), VPS13B(NM_017890.5):c.1832G>A (p.R611K), VPS13B(NM_152564.5):c.1832G>A (p.(Arg611Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99143154G>A" "" "likely benign" "" "0000319684" "0" "50" "8" "100168814" "100168814" "subst" "2.84456E-5" "01943" "VPS13B_000201" "g.100168814C>T" "" "" "" "VPS13B(NM_017890.4):c.2051C>T (p.S684F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99156586C>T" "" "VUS" "" "0000319685" "0" "50" "8" "100182340" "100182340" "subst" "4.87801E-5" "01943" "VPS13B_000202" "g.100182340C>A" "" "" "" "VPS13B(NM_017890.4):c.2282C>A (p.P761H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99170112C>A" "" "VUS" "" "0000319686" "0" "50" "8" "100205240" "100205240" "subst" "0.000158549" "01943" "VPS13B_000156" "g.100205240T>G" "" "" "" "VPS13B(NM_017890.4):c.2470T>G (p.S824A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99193012T>G" "" "VUS" "" "0000319687" "0" "30" "8" "100205255" "100205255" "subst" "0.00866549" "01943" "VPS13B_000205" "g.100205255G>A" "" "" "" "VPS13B(NM_015243.2):c.2485G>A (p.(Ala829Thr)), VPS13B(NM_017890.4):c.2485G>A (p.A829T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99193027G>A" "" "likely benign" "" "0000319689" "0" "50" "8" "100454642" "100454642" "subst" "0" "01943" "VPS13B_000223" "g.100454642C>T" "" "" "" "VPS13B(NM_017890.4):c.3224C>T (p.S1075F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99442414C>T" "" "VUS" "" "0000319690" "0" "50" "8" "100454848" "100454848" "subst" "0" "01943" "VPS13B_000225" "g.100454848C>T" "" "" "" "VPS13B(NM_017890.4):c.3430C>T (p.P1144S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99442620C>T" "" "VUS" "" "0000319691" "0" "10" "8" "100493820" "100493820" "subst" "0.0377581" "01943" "VPS13B_000229" "g.100493820C>T" "" "" "" "VPS13B(NM_017890.4):c.3667-7C>T, VPS13B(NM_017890.5):c.3667-7C>T, VPS13B(NM_152564.5):c.3667-7C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99481592C>T" "" "benign" "" "0000319692" "0" "50" "8" "100493987" "100493987" "subst" "0.000362042" "01943" "VPS13B_000231" "g.100493987C>T" "" "" "" "VPS13B(NM_017890.4):c.3827C>T (p.T1276I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99481759C>T" "" "VUS" "" "0000319693" "0" "10" "8" "100493997" "100493997" "subst" "0.00495577" "01943" "VPS13B_000232" "g.100493997C>T" "" "" "" "VPS13B(NM_017890.4):c.3837C>T (p.C1279=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99481769C>T" "" "benign" "" "0000319694" "0" "50" "8" "100494026" "100494026" "subst" "0.000378751" "01943" "VPS13B_000047" "g.100494026C>G" "" "" "" "VPS13B(NM_017890.4):c.3866C>G (p.T1289S), VPS13B(NM_152564.4):c.3866C>G (p.(Thr1289Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99481798C>G" "" "VUS" "" "0000319695" "0" "50" "8" "100513964" "100513964" "subst" "0" "01943" "VPS13B_000234" "g.100513964C>A" "" "" "" "VPS13B(NM_017890.4):c.3920C>A (p.T1307N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99501736C>A" "" "VUS" "" "0000319696" "0" "50" "8" "100523444" "100523444" "subst" "2.43976E-5" "01943" "VPS13B_000236" "g.100523444G>A" "" "" "" "VPS13B(NM_017890.4):c.4412G>A (p.R1471Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99511216G>A" "" "VUS" "" "0000319697" "0" "50" "8" "100523656" "100523656" "subst" "8.22551E-5" "01943" "VPS13B_000237" "g.100523656C>T" "" "" "" "VPS13B(NM_017890.4):c.4624C>T (p.R1542C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99511428C>T" "" "VUS" "" "0000319698" "0" "50" "8" "100523657" "100523657" "subst" "4.52615E-5" "01943" "VPS13B_000238" "g.100523657G>A" "" "" "" "VPS13B(NM_017890.4):c.4625G>A (p.R1542H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99511429G>A" "" "VUS" "" "0000319699" "0" "30" "8" "100568665" "100568665" "subst" "2.8865E-5" "01943" "VPS13B_000243" "g.100568665G>A" "" "" "" "VPS13B(NM_017890.4):c.4821-13G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99556437G>A" "" "likely benign" "" "0000319700" "0" "30" "8" "100568664" "100568664" "subst" "0.00180738" "01943" "VPS13B_000242" "g.100568664C>T" "" "" "" "VPS13B(NM_017890.4):c.4821-14C>T, VPS13B(NM_017890.5):c.4821-14C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99556436C>T" "" "likely benign" "" "0000319701" "0" "10" "8" "100568663" "100568663" "subst" "0.00298803" "01943" "VPS13B_000241" "g.100568663T>C" "" "" "" "VPS13B(NM_017890.4):c.4821-15T>C, VPS13B(NM_017890.5):c.4821-15T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99556435T>C" "" "benign" "" "0000319702" "0" "50" "8" "100654103" "100654103" "subst" "2.8493E-5" "01943" "VPS13B_000246" "g.100654103G>A" "" "" "" "VPS13B(NM_017890.4):c.5360G>A (p.R1787H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99641875G>A" "" "VUS" "" "0000319703" "0" "50" "8" "100654319" "100654319" "subst" "0.00865342" "01943" "VPS13B_000248" "g.100654319C>T" "" "" "" "VPS13B(NM_017890.4):c.5576C>T (p.S1859L), VPS13B(NM_017890.5):c.5576C>T (p.S1859L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99642091C>T" "" "VUS" "" "0000319704" "0" "50" "8" "100115328" "100115328" "subst" "0.000125957" "01943" "VPS13B_000179" "g.100115328G>A" "" "" "" "VPS13B(NM_017890.4):c.560G>A (p.R187H), VPS13B(NM_017890.5):c.560G>A (p.R187H), VPS13B(NM_152564.5):c.560G>A (p.(Arg187His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99103100G>A" "" "VUS" "" "0000319705" "0" "50" "8" "100115333" "100115333" "subst" "4.06329E-6" "01943" "VPS13B_000180" "g.100115333T>C" "" "" "" "VPS13B(NM_017890.4):c.565T>C (p.F189L), VPS13B(NM_017890.5):c.565T>C (p.F189L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99103105T>C" "" "VUS" "" "0000319706" "0" "30" "8" "100654424" "100654424" "subst" "0.00090241" "01943" "VPS13B_000249" "g.100654424C>T" "" "" "" "VPS13B(NM_017890.4):c.5681C>T (p.T1894M), VPS13B(NM_017890.5):c.5681C>T (p.T1894M), VPS13B(NM_152564.4):c.5606C>T (p.(Thr1869Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99642196C>T" "" "likely benign" "" "0000319707" "0" "50" "8" "100654471" "100654471" "subst" "0" "01943" "VPS13B_000250" "g.100654471G>A" "" "" "" "VPS13B(NM_017890.4):c.5728G>A (p.G1910R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99642243G>A" "" "VUS" "" "0000319708" "0" "10" "8" "100729395" "100729395" "dup" "0" "01943" "VPS13B_000265" "g.100729395dup" "" "" "" "VPS13B(NM_017890.4):c.6530-4dupT, VPS13B(NM_152564.5):c.6455-4dup" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99717167dup" "" "benign" "" "0000319709" "0" "30" "8" "100123435" "100123435" "subst" "4.14976E-6" "01943" "VPS13B_000182" "g.100123435C>T" "" "" "" "VPS13B(NM_017890.4):c.690C>T (p.Y230=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99111207C>T" "" "likely benign" "" "0000319710" "0" "30" "8" "100733288" "100733288" "subst" "4.07126E-6" "01943" "VPS13B_000274" "g.100733288C>G" "" "" "" "VPS13B(NM_017890.4):c.7125+13C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99721060C>G" "" "likely benign" "" "0000319711" "0" "50" "8" "100779102" "100779102" "subst" "7.32029E-5" "01943" "VPS13B_000275" "g.100779102C>T" "" "" "" "VPS13B(NM_017890.4):c.7226C>T (p.P2409L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99766874C>T" "" "VUS" "" "0000319712" "0" "30" "8" "100779103" "100779103" "subst" "0.0039931" "01943" "VPS13B_000276" "g.100779103G>A" "" "" "" "VPS13B(NM_017890.4):c.7227G>A (p.P2409=), VPS13B(NM_017890.5):c.7227G>A (p.P2409=), VPS13B(NM_152564.5):c.7152G>A (p.(Pro2384=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99766875G>A" "" "likely benign" "" "0000319713" "0" "10" "8" "100791156" "100791156" "subst" "0.0507001" "01943" "VPS13B_000278" "g.100791156T>C" "" "" "" "VPS13B(NM_017890.4):c.7751T>C (p.V2584A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99778928T>C" "" "benign" "" "0000319714" "0" "30" "8" "100791175" "100791175" "subst" "0.000179163" "01943" "VPS13B_000280" "g.100791175C>T" "" "" "" "VPS13B(NM_017890.4):c.7770C>T (p.C2590=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99778947C>T" "" "likely benign" "" "0000319715" "0" "50" "8" "100791188" "100791188" "subst" "0.000386997" "01943" "VPS13B_000282" "g.100791188G>A" "" "" "" "VPS13B(NM_017890.4):c.7783G>A (p.D2595N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99778960G>A" "" "VUS" "" "0000319716" "0" "50" "8" "100791192" "100791192" "subst" "0.000721277" "01943" "VPS13B_000283" "g.100791192C>T" "" "" "" "VPS13B(NM_017890.4):c.7787C>T (p.S2596F), VPS13B(NM_017890.5):c.7787C>T (p.S2596F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99778964C>T" "" "VUS" "" "0000319717" "0" "30" "8" "100821671" "100821671" "subst" "0.00128503" "01943" "VPS13B_000286" "g.100821671C>T" "" "" "" "VPS13B(NM_017890.4):c.8085C>T (p.A2695=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99809443C>T" "" "likely benign" "" "0000319718" "0" "30" "8" "100830019" "100830019" "subst" "0" "01943" "VPS13B_000289" "g.100830019C>T" "" "" "" "VPS13B(NM_017890.4):c.8424C>T (p.S2808=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99817791C>T" "" "likely benign" "" "0000319719" "0" "10" "8" "100831065" "100831065" "subst" "0.00113322" "01943" "VPS13B_000294" "g.100831065C>T" "" "" "" "VPS13B(NM_017890.4):c.8645C>T (p.P2882L), VPS13B(NM_017890.5):c.8645C>T (p.P2882L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99818837C>T" "" "benign" "" "0000319720" "0" "30" "8" "100831768" "100831768" "subst" "4.88524E-5" "01943" "VPS13B_000299" "g.100831768C>T" "" "" "" "VPS13B(NM_017890.4):c.8825C>T (p.S2942L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99819540C>T" "" "likely benign" "" "0000319721" "0" "50" "8" "100832301" "100832301" "subst" "0" "01943" "VPS13B_000300" "g.100832301T>C" "" "" "" "VPS13B(NM_017890.4):c.9020T>C (p.I3007T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99820073T>C" "" "VUS" "" "0000319722" "0" "30" "8" "100833621" "100833621" "subst" "0.000597911" "01943" "VPS13B_000304" "g.100833621G>T" "" "" "" "VPS13B(NM_017890.4):c.9169G>T (p.D3057Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99821393G>T" "" "likely benign" "" "0000319723" "0" "30" "8" "100128086" "100128086" "subst" "0.000118192" "01943" "VPS13B_000185" "g.100128086G>A" "" "" "" "VPS13B(NM_017890.4):c.921G>A (p.M307I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99115858G>A" "" "likely benign" "" "0000319724" "0" "10" "8" "100836216" "100836216" "subst" "0.0138685" "01943" "VPS13B_000307" "g.100836216T>A" "" "" "" "VPS13B(NM_017890.4):c.9405+10T>A, VPS13B(NM_152564.5):c.9330+10T>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99823988T>A" "" "benign" "" "0000319725" "0" "10" "8" "100844758" "100844758" "subst" "0.205032" "01943" "VPS13B_000315" "g.100844758T>C" "" "" "" "VPS13B(NM_017890.4):c.9567T>C (p.S3189=), VPS13B(NM_017890.5):c.9567T>C (p.S3189=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99832530T>C" "" "benign" "" "0000319726" "0" "30" "8" "100847807" "100847807" "subst" "0.000117874" "01943" "VPS13B_000318" "g.100847807C>T" "" "" "" "VPS13B(NM_017890.4):c.9858C>T (p.S3286=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99835579C>T" "" "likely benign" "" "0000332216" "0" "50" "8" "100050706" "100050706" "subst" "1.62684E-5" "01804" "VPS13B_000176" "g.100050706A>G" "" "" "" "VPS13B(NM_015243.2):c.203A>G (p.(His68Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99038478A>G" "" "VUS" "" "0000332218" "0" "50" "8" "100147294" "100147294" "subst" "4.06461E-6" "01804" "VPS13B_000190" "g.100147294T>G" "" "" "" "VPS13B(NM_015243.2):c.1354T>G (p.(Cys452Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99135066T>G" "" "VUS" "" "0000332219" "0" "30" "8" "100147861" "100147861" "subst" "0.000549263" "01804" "VPS13B_000191" "g.100147861C>T" "" "" "" "VPS13B(NM_015243.2):c.1463C>T (p.(Thr488Met)), VPS13B(NM_017890.5):c.1463C>T (p.T488M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99135633C>T" "" "likely benign" "" "0000332220" "0" "50" "8" "100147957" "100147957" "subst" "0.000569536" "01804" "VPS13B_000192" "g.100147957A>G" "" "" "" "VPS13B(NM_015243.2):c.1559A>G (p.(His520Arg)), VPS13B(NM_017890.4):c.1559A>G (p.H520R), VPS13B(NM_017890.5):c.1559A>G (p.H520R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99135729A>G" "" "VUS" "" "0000332221" "0" "30" "8" "100155382" "100155382" "subst" "0.00130029" "01804" "VPS13B_000195" "g.100155382G>A" "" "" "" "VPS13B(NM_017890.4):c.1832G>A (p.R611K), VPS13B(NM_017890.5):c.1832G>A (p.R611K), VPS13B(NM_152564.5):c.1832G>A (p.(Arg611Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99143154G>A" "" "likely benign" "" "0000332223" "0" "50" "8" "100205241" "100205241" "subst" "0.000158561" "01804" "VPS13B_000203" "g.100205241C>T" "" "" "" "VPS13B(NM_015243.2):c.2471C>T (p.(Ser824Phe)), VPS13B(NM_017890.4):c.2471C>T (p.S824F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99193013C>T" "" "VUS" "" "0000332224" "0" "50" "8" "100221880" "100221880" "subst" "0" "01804" "VPS13B_000208" "g.100221880C>T" "" "" "" "VPS13B(NM_015243.2):c.2576C>T (p.(Pro859Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99209652C>T" "" "VUS" "" "0000332226" "0" "50" "8" "100287441" "100287441" "subst" "0" "01804" "VPS13B_000213" "g.100287441C>G" "" "" "" "VPS13B(NM_017890.4):c.2783C>G (p.(Thr928Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99275213C>G" "" "VUS" "" "0000332227" "0" "50" "8" "100403777" "100403777" "subst" "4.06286E-6" "01804" "VPS13B_000220" "g.100403777C>G" "" "" "" "VPS13B(NM_017890.4):c.2935-8C>G (p.(=)), VPS13B(NM_017890.5):c.2935-8C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99391549C>G" "" "VUS" "" "0000332229" "0" "50" "8" "100454867" "100454867" "subst" "0" "01804" "VPS13B_000226" "g.100454867T>C" "" "" "" "VPS13B(NM_017890.4):c.3445+4T>C (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99442639T>C" "" "VUS" "" "0000332230" "0" "50" "8" "100494031" "100494031" "subst" "1.62958E-5" "01804" "VPS13B_000233" "g.100494031G>T" "" "" "" "VPS13B(NM_017890.4):c.3870+1G>T (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99481803G>T" "" "VUS" "" "0000332231" "0" "50" "8" "100514047" "100514047" "subst" "0" "01804" "VPS13B_000235" "g.100514047A>G" "" "" "" "VPS13B(NM_017890.4):c.4003A>G (p.I1335V, p.(Ile1335Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99501819A>G" "" "VUS" "" "0000332233" "0" "50" "8" "100654621" "100654621" "subst" "0.000113842" "01804" "VPS13B_000253" "g.100654621T>G" "" "" "" "VPS13B(NM_017890.4):c.5878T>G (p.(Ser1960Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99642393T>G" "" "VUS" "" "0000332234" "0" "50" "8" "100654720" "100654720" "subst" "0" "01804" "VPS13B_000254" "g.100654720T>C" "" "" "" "VPS13B(NM_017890.4):c.5977T>C (p.(Cys1993Arg)), VPS13B(NM_017890.5):c.5977T>C (p.C1993R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99642492T>C" "" "VUS" "" "0000332235" "0" "30" "8" "100654723" "100654723" "subst" "0.0015341" "01804" "VPS13B_000255" "g.100654723A>G" "" "" "" "VPS13B(NM_017890.4):c.5980A>G (p.I1994V), VPS13B(NM_017890.5):c.5980A>G (p.I1994V), VPS13B(NM_152564.4):c.5905A>G (p.(Ile1969Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99642495A>G" "" "likely benign" "" "0000332236" "0" "50" "8" "100729474" "100729474" "subst" "9.75562E-5" "01804" "VPS13B_000267" "g.100729474G>A" "" "" "" "VPS13B(NM_017890.4):c.6605G>A (p.(Arg2202His)), VPS13B(NM_017890.5):c.6605G>A (p.R2202H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99717246G>A" "" "VUS" "" "0000332237" "0" "50" "8" "100732628" "100732628" "subst" "2.43986E-5" "01804" "VPS13B_000269" "g.100732628A>G" "" "" "" "VPS13B(NM_017890.4):c.6788A>G (p.(Asn2263Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99720400A>G" "" "VUS" "" "0000332238" "0" "50" "8" "100732634" "100732634" "subst" "8.13332E-6" "01804" "VPS13B_000270" "g.100732634A>T" "" "" "" "VPS13B(NM_017890.4):c.6794A>T (p.(Tyr2265Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99720406A>T" "" "VUS" "" "0000332240" "0" "30" "8" "100791158" "100791158" "subst" "0.00319527" "01804" "VPS13B_000279" "g.100791158G>A" "" "" "" "VPS13B(NM_017890.4):c.7753G>A (p.E2585K, p.(Glu2585Lys)), VPS13B(NM_017890.5):c.7753G>A (p.E2585K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99778930G>A" "" "likely benign" "" "0000332241" "0" "50" "8" "100791179" "100791179" "del" "0" "01804" "VPS13B_000281" "g.100791179del" "" "" "" "VPS13B(NM_017890.4):c.7774del (p.(Val2592Ter))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99778951del" "" "VUS" "" "0000332244" "0" "50" "8" "100830760" "100830760" "subst" "4.06951E-6" "01804" "VPS13B_000291" "g.100830760A>G" "" "" "" "VPS13B(NM_017890.4):c.8518A>G (p.M2840V, p.(Met2840Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99818532A>G" "" "VUS" "" "0000332246" "0" "50" "8" "100833562" "100833562" "subst" "0.00013417" "01804" "VPS13B_000303" "g.100833562C>G" "" "" "" "VPS13B(NM_017890.4):c.9110C>G (p.(Thr3037Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99821334C>G" "" "VUS" "" "0000332248" "0" "30" "8" "100836129" "100836129" "subst" "4.06894E-6" "01804" "VPS13B_000305" "g.100836129A>G" "" "" "" "VPS13B(NM_017890.4):c.9328A>G (p.(Thr3110Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99823901A>G" "" "likely benign" "" "0000332249" "0" "30" "8" "100844603" "100844603" "subst" "0" "01804" "VPS13B_000310" "g.100844603C>T" "" "" "" "VPS13B(NM_017890.4):c.9412C>T (p.(Arg3138Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99832375C>T" "" "likely benign" "" "0000332250" "0" "30" "8" "100844604" "100844604" "subst" "0" "01804" "VPS13B_000311" "g.100844604G>T" "" "" "" "VPS13B(NM_017890.4):c.9413G>T (p.(Arg3138Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99832376G>T" "" "likely benign" "" "0000332251" "0" "30" "8" "100844606" "100844606" "subst" "0" "01804" "VPS13B_000312" "g.100844606G>T" "" "" "" "VPS13B(NM_017890.4):c.9415G>T (p.(Val3139Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99832378G>T" "" "likely benign" "" "0000332252" "0" "30" "8" "100844615" "100844615" "subst" "0.00947675" "01804" "VPS13B_000313" "g.100844615A>G" "" "" "" "VPS13B(NM_017890.4):c.9424A>G (p.S3142G, p.(Ser3142Gly)), VPS13B(NM_017890.5):c.9424A>G (p.S3142G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99832387A>G" "" "likely benign" "" "0000332253" "0" "30" "8" "100844636" "100844636" "subst" "0" "01804" "VPS13B_000314" "g.100844636C>T" "" "" "" "VPS13B(NM_017890.4):c.9445C>T (p.(Pro3149Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99832408C>T" "" "likely benign" "" "0000332257" "0" "30" "8" "100874030" "100874030" "subst" "0.00241312" "01804" "VPS13B_000161" "g.100874030G>A" "" "" "" "VPS13B(NM_017890.4):c.11146G>A (p.A3716T, p.(Ala3716Thr)), VPS13B(NM_017890.5):c.11146G>A (p.A3716T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99861802G>A" "" "likely benign" "" "0000336869" "0" "70" "8" "100133397" "100133397" "subst" "4.13825E-6" "02327" "VPS13B_000354" "g.100133397A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99121169A>G" "" "likely pathogenic" "" "0000336871" "0" "30" "8" "100519980" "100519980" "subst" "0.00135361" "02327" "VPS13B_000357" "g.100519980C>T" "" "" "" "VPS13B(NM_017890.5):c.4158-18C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99507752C>T" "" "likely benign" "" "0000336872" "0" "30" "8" "100587857" "100587857" "subst" "2.44133E-5" "02327" "VPS13B_000360" "g.100587857G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99575629G>A" "" "likely benign" "" "0000336875" "0" "90" "8" "100831638" "100831638" "subst" "0" "02327" "VPS13B_000107" "g.100831638A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99819410A>G" "" "pathogenic" "" "0000339209" "0" "10" "8" "100733188" "100733188" "subst" "0.0468192" "02327" "VPS13B_000272" "g.100733188A>G" "" "" "" "VPS13B(NM_017890.4):c.7038A>G (p.V2346=), VPS13B(NM_152564.5):c.6963A>G (p.(Val2321=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99720960A>G" "" "benign" "" "0000339210" "0" "10" "8" "100844758" "100844758" "subst" "0.205032" "02327" "VPS13B_000315" "g.100844758T>C" "" "" "" "VPS13B(NM_017890.4):c.9567T>C (p.S3189=), VPS13B(NM_017890.5):c.9567T>C (p.S3189=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99832530T>C" "" "benign" "" "0000342138" "0" "30" "8" "100115328" "100115328" "subst" "0.000125957" "02327" "VPS13B_000179" "g.100115328G>A" "" "" "" "VPS13B(NM_017890.4):c.560G>A (p.R187H), VPS13B(NM_017890.5):c.560G>A (p.R187H), VPS13B(NM_152564.5):c.560G>A (p.(Arg187His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99103100G>A" "" "likely benign" "" "0000343528" "0" "90" "8" "100396522" "100396522" "subst" "4.06676E-6" "02327" "VPS13B_000041" "g.100396522C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99384294C>T" "" "pathogenic" "" "0000343676" "0" "50" "8" "100791204" "100791204" "subst" "1.63116E-5" "02327" "VPS13B_000361" "g.100791204A>T" "" "" "" "VPS13B(NM_017890.4):c.7799A>T (p.N2600I), VPS13B(NM_152564.5):c.7724A>T (p.(Asn2575Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99778976A>T" "" "VUS" "" "0000343697" "0" "30" "8" "100832259" "100832259" "subst" "0.00323142" "02327" "VPS13B_000108" "g.100832259A>G" "" "" "" "VPS13B(NM_017890.4):c.8978A>G (p.N2993S), VPS13B(NM_017890.5):c.8978A>G (p.N2993S), VPS13B(NM_152564.5):c.8903A>G (p.(Asn2968Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99820031A>G" "" "likely benign" "" "0000344966" "0" "90" "8" "100205117" "100205117" "subst" "0" "02327" "VPS13B_000356" "g.100205117C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99192889C>T" "" "pathogenic" "" "0000345767" "0" "50" "8" "100568695" "100568695" "subst" "3.26672E-5" "02327" "VPS13B_000359" "g.100568695G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99556467G>T" "" "VUS" "" "0000346007" "0" "10" "8" "100865836" "100865836" "subst" "0.123331" "02327" "VPS13B_000328" "g.100865836G>A" "" "" "" "VPS13B(NM_017890.4):c.10294G>A (p.G3432R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99853608G>A" "" "benign" "" "0000347072" "0" "90" "8" "100831067" "100831067" "del" "0" "02327" "VPS13B_000362" "g.100831067del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99818839del" "" "pathogenic" "" "0000350047" "0" "50" "8" "100133467" "100133467" "subst" "0.000109769" "02327" "VPS13B_000355" "g.100133467T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99121239T>C" "" "VUS" "" "0000350052" "0" "90" "8" "100865919" "100865919" "subst" "0" "02327" "VPS13B_000364" "g.100865919T>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99853691T>A" "" "pathogenic" "" "0000350429" "0" "10" "8" "100791156" "100791156" "subst" "0.0507001" "02327" "VPS13B_000278" "g.100791156T>C" "" "" "" "VPS13B(NM_017890.4):c.7751T>C (p.V2584A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99778928T>C" "" "benign" "" "0000464281" "21" "90" "8" "100654074" "100654074" "dup" "0" "00006" "VPS13B_000067" "g.100654074dup" "" "{PMID:Parri 2010:20461111}, {DOI:Parri 2010:10.1038/ejhg.2010.59}" "" "5331insT" "" "Germline" "yes" "" "0" "" "" "g.99641846dup" "" "pathogenic (recessive)" "" "0000464282" "21" "50" "8" "100866422" "100866441" "del" "0" "00006" "VPS13B_000370" "g.100866422_100866441delinsTT" "" "{PMID:Parri 2010:20461111}, {DOI:Parri 2010:10.1038/ejhg.2010.59}" "" "10880insTTdelCTGCGAGGCAGCTTGTGCAC" "" "Germline" "yes" "" "0" "" "" "g.99854194_99854213delinsTT" "" "VUS" "" "0000464283" "11" "90" "8" "100866540" "100883818" "dup" "0" "00006" "VPS13B_000137" "g.100866540_100883818dup" "" "{PMID:Parri 2010:20461111}, {DOI:Parri 2010:10.1038/ejhg.2010.59}" "" "" "" "Germline" "yes" "" "0" "" "" "g.99854312_99871590dup" "" "pathogenic (recessive)" "" "0000465597" "21" "90" "8" "100454845" "100454845" "subst" "4.06719E-5" "00006" "VPS13B_000044" "g.100454845C>T" "" "{PMID:Katzaki 2007:17990063}, {PMID:Parri 2010:20461111}" "" "" "" "Germline" "" "" "0" "" "" "g.99442617C>T" "" "pathogenic (recessive)" "" "0000465598" "11" "90" "8" "100587885" "100673720" "del" "0" "00006" "VPS13B_000062" "g.(100568882_100587885)_(100673720_100711752)del" "" "{PMID:Parri 2010:20461111}" "" "del ex32-35" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000465599" "0" "90" "8" "100883800" "100883803" "del" "0" "00006" "VPS13B_000132" "g.100883800_100883803del" "" "{PMID:Parri 2010:20461111}" "" "11695delAGTG" "" "De novo" "" "" "0" "" "" "g.99871572_99871575del" "" "pathogenic (recessive)" "" "0000465600" "11" "90" "8" "100108539" "100155394" "dup" "0" "00006" "VPS13B_000013" "g.(100050795_100108539)_(100155394_100160068)dup" "" "{PMID:Parri 2010:20461111}" "" "dup ex4-13" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000465601" "21" "90" "8" "100883101" "100883101" "dup" "0" "00006" "VPS13B_000128" "g.100883101dup" "" "{PMID:Parri 2010:20461111}" "" "11556insT" "" "Germline" "" "" "0" "" "" "g.99870873dup" "" "pathogenic (recessive)" "" "0000465602" "11" "90" "8" "100479864" "100479864" "subst" "0" "00006" "VPS13B_000046" "g.100479864T>C" "" "{PMID:Parri 2010:20461111}" "" "IVS24+2T>C" "" "Germline" "" "" "0" "" "" "g.99467636T>C" "" "pathogenic (recessive)" "" "0000465603" "21" "90" "8" "100108649" "100108650" "ins" "0" "00006" "VPS13B_000014" "g.100108649_100108650insT" "" "{PMID:Parri 2010:20461111}" "" "402insT" "" "Germline" "" "" "0" "" "" "g.99096421_99096422insT" "" "pathogenic (recessive)" "" "0000465604" "11" "90" "8" "100396435" "100533239" "dup" "0" "00006" "VPS13B_000039" "g.(100287483_100396435)_(100533239_100568677)dup" "" "{PMID:Parri 2010:20461111}" "" "dup ex20-30" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000465605" "3" "90" "8" "100123325" "100182392" "del" "0" "00006" "VPS13B_000017" "g.(100115349_100123325)_(100182392_100205103)del" "" "{PMID:Parri 2010:20461111}" "" "del ex6-16" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000465606" "11" "90" "8" "100523506" "100523506" "del" "0" "00006" "VPS13B_000055" "g.100523506del" "" "{PMID:Parri 2010:20461111}" "" "4474delA" "" "Germline" "" "" "0" "" "" "g.99511278del" "" "pathogenic (recessive)" "" "0000465607" "21" "90" "8" "100168775" "100168775" "subst" "0" "00006" "VPS13B_000028" "g.100168775A>G" "" "{PMID:Parri 2010:20461111}" "" "IVS14-2A>G" "" "Germline" "" "" "0" "" "" "g.99156547A>G" "" "pathogenic (recessive)" "" "0000465608" "21" "90" "8" "100050722" "100050723" "del" "0" "00006" "VPS13B_000010" "g.100050722_100050723delinsT" "" "{PMID:Parri 2010:20461111}" "" "219_20delACinsT" "" "Germline" "" "" "0" "" "" "g.99038494_99038495delinsT" "" "pathogenic (recessive)" "" "0000465609" "11" "90" "8" "100779001" "100796705" "del" "0" "00006" "VPS13B_000088" "g.(100733276_100779001)_(100796705_100821602)del" "" "{PMID:Parri 2010:20461111}" "" "del ex40-43" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000465610" "11" "90" "8" "100883109" "100883109" "del" "0" "00006" "VPS13B_000129" "g.100883109del" "" "{PMID:Katzaki 2007:17990063}, {PMID:Parri 2010:20461111}" "" "11564delA" "" "Germline" "" "" "0" "" "" "g.99870881del" "" "pathogenic (recessive)" "" "0000465611" "21" "90" "8" "100123325" "100182392" "del" "0" "00006" "VPS13B_000017" "g.(100115349_100123325)_(100182392_100205103)del" "" "{PMID:Parri 2010:20461111}" "" "del ex6-16" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000465612" "1" "90" "8" "100123325" "100182392" "del" "0" "00006" "VPS13B_000017" "g.(100115349_100123325)_(100182392_100205103)del" "" "{PMID:Parri 2010:20461111}" "" "del ex6-16" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000465613" "2" "90" "8" "100830678" "100833711" "del" "0" "00006" "VPS13B_000101" "g.(100830032_100830678)_(100833711_100836059)del" "" "{PMID:Parri 2010:20461111}" "" "del ex46-50" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000465614" "1" "90" "8" "100123325" "100182392" "del" "0" "00006" "VPS13B_000017" "g.(100115349_100123325)_(100182392_100205103)del" "" "{PMID:Parri 2010:20461111}" "" "del ex6-16" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000465615" "2" "90" "8" "100830678" "100833711" "del" "0" "00006" "VPS13B_000101" "g.(100830032_100830678)_(100833711_100836059)del" "" "{PMID:Parri 2010:20461111}" "" "del ex46-50" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000465616" "21" "90" "8" "100115179" "100115179" "subst" "0" "00006" "VPS13B_000012" "g.100115179A>G" "" "{PMID:Parri 2010:20461111}" "" "IVS4-2A>G" "" "Germline" "yes" "" "0" "" "" "g.99102951A>G" "" "pathogenic (recessive)" "" "0000465617" "11" "90" "8" "100108539" "100182392" "del" "0" "00006" "VPS13B_000015" "g.(100050795_100108539)_(100182392_100205103)del" "" "{PMID:Parri 2010:20461111}" "" "del ex4-16" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000465618" "21" "90" "8" "100115179" "100115179" "subst" "0" "00006" "VPS13B_000012" "g.100115179A>G" "" "{PMID:Parri 2010:20461111}" "" "IVS4-2A>G" "" "Germline" "yes" "" "0" "" "" "g.99102951A>G" "" "pathogenic (recessive)" "" "0000465619" "11" "90" "8" "100108539" "100182392" "del" "0" "00006" "VPS13B_000015" "g.(100050795_100108539)_(100182392_100205103)del" "" "{PMID:Parri 2010:20461111}" "" "del ex4-16" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000465620" "21" "90" "8" "100654074" "100654074" "dup" "0" "00006" "VPS13B_000067" "g.100654074dup" "" "{PMID:Parri 2010:20461111}" "" "5331insT" "" "Germline" "yes" "" "0" "" "" "g.99641846dup" "" "pathogenic (recessive)" "" "0000465621" "21" "50" "8" "100866422" "100866441" "del" "0" "00006" "VPS13B_000370" "g.100866422_100866441delinsTT" "" "{PMID:Parri 2010:20461111}" "" "10880insTTdelCTGCGAGGCAGCTTGTGCAC" "" "Germline" "yes" "" "0" "" "" "g.99854194_99854213delinsTT" "" "VUS" "" "0000465622" "11" "90" "8" "100866540" "100883818" "dup" "0" "00006" "VPS13B_000137" "g.100866540_100883818dup" "" "{PMID:Parri 2010:20461111}" "" "dup ex57-60" "" "Germline" "yes" "" "0" "" "" "g.99854312_99871590dup" "" "pathogenic (recessive)" "" "0000465623" "3" "90" "8" "100123325" "100182392" "del" "0" "00006" "VPS13B_000017" "g.(100115349_100123325)_(100182392_100205103)del" "" "{PMID:Bugiani 2008:18655112}, {PMID:Parri 2010:20461111}" "" "del ex6-16" "deletion on shared haplotype" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000533196" "0" "50" "8" "100026024" "100026024" "subst" "0" "01943" "COX6C_000002" "g.100026024A>T" "" "" "" "VPS13B(NM_017890.4):c.8A>T (p.E3V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99013796A>T" "" "VUS" "" "0000533199" "0" "50" "8" "100115328" "100115328" "subst" "0.000125957" "02325" "VPS13B_000179" "g.100115328G>A" "" "" "" "VPS13B(NM_017890.4):c.560G>A (p.R187H), VPS13B(NM_017890.5):c.560G>A (p.R187H), VPS13B(NM_152564.5):c.560G>A (p.(Arg187His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99103100G>A" "" "VUS" "" "0000533200" "0" "30" "8" "100123318" "100123318" "subst" "0" "01804" "COX6C_000004" "g.100123318C>T" "" "" "" "VPS13B(NM_015243.2):c.581-8C>T (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99111090C>T" "" "likely benign" "" "0000533201" "0" "10" "8" "100127839" "100127839" "subst" "0" "02326" "COX6C_000005" "g.100127839C>A" "" "" "" "VPS13B(NM_017890.4):c.763-89C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99115611C>A" "" "benign" "" "0000533202" "0" "30" "8" "100128039" "100128039" "subst" "3.66113E-5" "01804" "COX6C_000006" "g.100128039T>G" "" "" "" "VPS13B(NM_015243.2):c.874T>G (p.(Phe292Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99115811T>G" "" "likely benign" "" "0000533203" "0" "50" "8" "100128050" "100128050" "subst" "0.000215633" "01943" "COX6C_000007" "g.100128050C>T" "" "" "" "VPS13B(NM_017890.4):c.885C>T (p.G295=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99115822C>T" "" "VUS" "" "0000533204" "0" "30" "8" "100133450" "100133450" "subst" "0.000536913" "01943" "COX6C_000008" "g.100133450A>G" "" "" "" "VPS13B(NM_017890.4):c.983A>G (p.H328R), VPS13B(NM_017890.5):c.983A>G (p.H328R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99121222A>G" "" "likely benign" "" "0000533205" "0" "50" "8" "100146901" "100146901" "subst" "0.00118075" "01943" "COX6C_000009" "g.100146901G>T" "" "" "" "VPS13B(NM_017890.4):c.1248G>T (p.Q416H), VPS13B(NM_152564.4):c.1248G>T (p.(Gln416His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99134673G>T" "" "VUS" "" "0000533206" "0" "30" "8" "100147838" "100147838" "subst" "0.00048848" "01943" "COX6C_000010" "g.100147838C>T" "" "" "" "VPS13B(NM_017890.4):c.1440C>T (p.F480=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99135610C>T" "" "likely benign" "" "0000533208" "0" "30" "8" "100147950" "100147950" "subst" "0" "01804" "COX6C_000012" "g.100147950A>T" "" "" "" "VPS13B(NM_015243.2):c.1552A>T (p.(Thr518Ser)), VPS13B(NM_017890.4):c.1552A>T (p.T518S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99135722A>T" "" "likely benign" "" "0000533209" "0" "30" "8" "100155318" "100155318" "subst" "0.000861389" "01943" "VPS13B_000027" "g.100155318G>A" "" "" "" "VPS13B(NM_017890.4):c.1768G>A (p.A590T), VPS13B(NM_017890.5):c.1768G>A (p.A590T), VPS13B(NM_152564.5):c.1768G>A (p.(Ala590Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99143090G>A" "" "likely benign" "" "0000533210" "0" "30" "8" "100155382" "100155382" "subst" "0.00130029" "02326" "VPS13B_000195" "g.100155382G>A" "" "" "" "VPS13B(NM_017890.4):c.1832G>A (p.R611K), VPS13B(NM_017890.5):c.1832G>A (p.R611K), VPS13B(NM_152564.5):c.1832G>A (p.(Arg611Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99143154G>A" "" "likely benign" "" "0000533211" "0" "50" "8" "100160113" "100160113" "subst" "2.0498E-5" "01943" "COX6C_000013" "g.100160113G>A" "" "" "" "VPS13B(NM_017890.4):c.1888G>A (p.A630T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99147885G>A" "" "VUS" "" "0000533212" "0" "10" "8" "100160299" "100160299" "del" "0" "02326" "COX6C_000014" "g.100160299del" "" "" "" "VPS13B(NM_017890.4):c.2013+61delT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99148071del" "" "benign" "" "0000533213" "0" "50" "8" "100168781" "100168781" "subst" "0" "01943" "COX6C_000015" "g.100168781C>T" "" "" "" "VPS13B(NM_017890.4):c.2018C>T (p.S673L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99156553C>T" "" "VUS" "" "0000533214" "0" "10" "8" "100182333" "100182333" "subst" "0.0108938" "01943" "COX6C_000016" "g.100182333G>C" "" "" "" "VPS13B(NM_017890.4):c.2275G>C (p.V759L), VPS13B(NM_017890.5):c.2275G>C (p.V759L), VPS13B(NM_152564.5):c.2275G>C (p.(Val759Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99170105G>C" "" "benign" "" "0000533215" "0" "30" "8" "100205189" "100205189" "subst" "2.03325E-5" "01804" "COX6C_000017" "g.100205189C>G" "" "" "" "VPS13B(NM_015243.2):c.2419C>G (p.(Leu807Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99192961C>G" "" "likely benign" "" "0000533216" "0" "10" "8" "100205221" "100205221" "subst" "0.00263843" "01943" "COX6C_000018" "g.100205221T>C" "" "" "" "VPS13B(NM_017890.4):c.2451T>C (p.H817=), VPS13B(NM_017890.5):c.2451T>C (p.H817=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99192993T>C" "" "benign" "" "0000533217" "0" "50" "8" "100205241" "100205241" "subst" "0.000158561" "01943" "VPS13B_000203" "g.100205241C>T" "" "" "" "VPS13B(NM_015243.2):c.2471C>T (p.(Ser824Phe)), VPS13B(NM_017890.4):c.2471C>T (p.S824F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99193013C>T" "" "VUS" "" "0000533219" "0" "10" "8" "100205255" "100205255" "subst" "0.00866549" "02327" "VPS13B_000205" "g.100205255G>A" "" "" "" "VPS13B(NM_015243.2):c.2485G>A (p.(Ala829Thr)), VPS13B(NM_017890.4):c.2485G>A (p.A829T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99193027G>A" "" "benign" "" "0000533220" "0" "30" "8" "100221812" "100221812" "subst" "0.00214513" "01804" "COX6C_000019" "g.100221812C>T" "" "" "" "VPS13B(NM_015243.2):c.2516-8C>T (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99209584C>T" "" "likely benign" "" "0000533222" "0" "50" "8" "100286506" "100286506" "subst" "0.000645717" "01943" "COX6C_000021" "g.100286506G>A" "" "" "" "VPS13B(NM_017890.4):c.2596G>A (p.V866I), VPS13B(NM_152564.4):c.2596G>A (p.(Val866Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99274278G>A" "" "VUS" "" "0000533223" "0" "30" "8" "100396491" "100396491" "subst" "0.000117918" "01943" "COX6C_000022" "g.100396491A>T" "" "" "" "VPS13B(NM_017890.4):c.2880A>T (p.L960F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99384263A>T" "" "likely benign" "" "0000533224" "0" "90" "8" "100396546" "100396547" "del" "0" "01943" "COX6C_000023" "g.100396546_100396547del" "" "" "" "VPS13B(NM_017890.4):c.2934+1_2934+2delGT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99384318_99384319del" "" "pathogenic" "" "0000533225" "0" "30" "8" "100403881" "100403881" "subst" "1.21862E-5" "02327" "COX6C_000024" "g.100403881T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99391653T>C" "" "likely benign" "" "0000533226" "0" "10" "8" "100443679" "100443679" "subst" "0" "02326" "COX6C_000025" "g.100443679A>T" "" "" "" "VPS13B(NM_017890.4):c.3083-86A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99431451A>T" "" "benign" "" "0000533227" "0" "30" "8" "100443757" "100443757" "subst" "0.000260557" "01943" "COX6C_000026" "g.100443757G>A" "" "" "" "VPS13B(NM_017890.4):c.3083-8G>A, VPS13B(NM_152564.5):c.3083-8G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99431529G>A" "" "likely benign" "" "0000533228" "0" "50" "8" "100443885" "100443885" "subst" "0.0105605" "01943" "COX6C_000027" "g.100443885C>T" "" "" "" "VPS13B(NM_017890.4):c.3203C>T (p.T1068I, p.(Thr1068Ile)), VPS13B(NM_017890.5):c.3203C>T (p.T1068I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99431657C>T" "" "VUS" "" "0000533229" "0" "30" "8" "100443885" "100443885" "subst" "0.0105605" "01804" "COX6C_000027" "g.100443885C>T" "" "" "" "VPS13B(NM_017890.4):c.3203C>T (p.T1068I, p.(Thr1068Ile)), VPS13B(NM_017890.5):c.3203C>T (p.T1068I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99431657C>T" "" "likely benign" "" "0000533230" "0" "10" "8" "100443885" "100443885" "subst" "0.0105605" "02325" "COX6C_000027" "g.100443885C>T" "" "" "" "VPS13B(NM_017890.4):c.3203C>T (p.T1068I, p.(Thr1068Ile)), VPS13B(NM_017890.5):c.3203C>T (p.T1068I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99431657C>T" "" "benign" "" "0000533231" "0" "10" "8" "100443885" "100443885" "subst" "0.0105605" "02326" "COX6C_000027" "g.100443885C>T" "" "" "" "VPS13B(NM_017890.4):c.3203C>T (p.T1068I, p.(Thr1068Ile)), VPS13B(NM_017890.5):c.3203C>T (p.T1068I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99431657C>T" "" "benign" "" "0000533232" "0" "30" "8" "100454804" "100454804" "subst" "0.00464668" "01804" "VPS13B_000224" "g.100454804A>G" "" "" "" "VPS13B(NM_017890.4):c.3386A>G (p.K1129R), VPS13B(NM_017890.5):c.3386A>G (p.K1129R), VPS13B(NM_152564.5):c.3386A>G (p.(Lys1129Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99442576A>G" "" "likely benign" "" "0000533233" "0" "10" "8" "100454804" "100454804" "subst" "0.00464668" "02327" "VPS13B_000224" "g.100454804A>G" "" "" "" "VPS13B(NM_017890.4):c.3386A>G (p.K1129R), VPS13B(NM_017890.5):c.3386A>G (p.K1129R), VPS13B(NM_152564.5):c.3386A>G (p.(Lys1129Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99442576A>G" "" "benign" "" "0000533234" "0" "30" "8" "100454831" "100454831" "subst" "0.00164264" "01804" "COX6C_000028" "g.100454831C>T" "" "" "" "VPS13B(NM_017890.4):c.3413C>T (p.(Pro1138Leu)), VPS13B(NM_017890.5):c.3413C>T (p.P1138L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99442603C>T" "" "likely benign" "" "0000533235" "0" "50" "8" "100454846" "100454846" "subst" "0" "02325" "COX6C_000029" "g.100454846G>A" "" "" "" "VPS13B(NM_017890.5):c.3428G>A (p.R1143Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99442618G>A" "" "VUS" "" "0000533236" "0" "30" "8" "100479644" "100479644" "subst" "0" "01943" "COX6C_000030" "g.100479644G>A" "" "" "" "VPS13B(NM_017890.4):c.3448G>A (p.D1150N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99467416G>A" "" "likely benign" "" "0000533237" "0" "30" "8" "100479780" "100479780" "subst" "2.03376E-5" "01943" "COX6C_000031" "g.100479780C>T" "" "" "" "VPS13B(NM_017890.4):c.3584C>T (p.T1195M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99467552C>T" "" "likely benign" "" "0000533238" "0" "10" "8" "100480014" "100480014" "subst" "0" "02326" "COX6C_000032" "g.100480014T>C" "" "" "" "VPS13B(NM_017890.4):c.3666+152T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99467786T>C" "" "benign" "" "0000533239" "0" "10" "8" "100480061" "100480061" "subst" "0" "02326" "COX6C_000033" "g.100480061A>G" "" "" "" "VPS13B(NM_017890.4):c.3666+199A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99467833A>G" "" "benign" "" "0000533240" "0" "10" "8" "100493820" "100493820" "subst" "0.0377581" "01804" "VPS13B_000229" "g.100493820C>T" "" "" "" "VPS13B(NM_017890.4):c.3667-7C>T, VPS13B(NM_017890.5):c.3667-7C>T, VPS13B(NM_152564.5):c.3667-7C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99481592C>T" "" "benign" "" "0000533241" "0" "30" "8" "100493911" "100493911" "subst" "0.0014104" "02330" "COX6C_000034" "g.100493911A>G" "" "" "" "VPS13B(NM_017890.4):c.3751A>G (p.T1251A), VPS13B(NM_017890.5):c.3751A>G (p.T1251A), VPS13B(NM_152564.4):c.3751A>G (p.(Thr1251Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99481683A>G" "" "likely benign" "" "0000533242" "0" "50" "8" "100493911" "100493911" "subst" "0.0014104" "01943" "COX6C_000034" "g.100493911A>G" "" "" "" "VPS13B(NM_017890.4):c.3751A>G (p.T1251A), VPS13B(NM_017890.5):c.3751A>G (p.T1251A), VPS13B(NM_152564.4):c.3751A>G (p.(Thr1251Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99481683A>G" "" "VUS" "" "0000533243" "0" "50" "8" "100494026" "100494026" "subst" "0.000378751" "02327" "VPS13B_000047" "g.100494026C>G" "" "" "" "VPS13B(NM_017890.4):c.3866C>G (p.T1289S), VPS13B(NM_152564.4):c.3866C>G (p.(Thr1289Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99481798C>G" "" "VUS" "" "0000533244" "0" "30" "8" "100514081" "100514081" "subst" "0" "01943" "COX6C_000035" "g.100514081G>A" "" "" "" "VPS13B(NM_017890.4):c.4037G>A (p.G1346D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99501853G>A" "" "likely benign" "" "0000533245" "0" "30" "8" "100520120" "100520120" "subst" "4.47002E-5" "01804" "COX6C_000036" "g.100520120G>A" "" "" "" "VPS13B(NM_017890.4):c.4280G>A (p.(Cys1427Tyr)), VPS13B(NM_017890.5):c.4280G>A (p.C1427Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99507892G>A" "" "likely benign" "" "0000533247" "0" "30" "8" "100523644" "100523644" "subst" "0" "01943" "COX6C_000038" "g.100523644A>G" "" "" "" "VPS13B(NM_017890.4):c.4612A>G (p.T1538A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99511416A>G" "" "likely benign" "" "0000533249" "0" "30" "8" "100568689" "100568689" "subst" "7.76245E-5" "01804" "COX6C_000040" "g.100568689A>G" "" "" "" "VPS13B(NM_017890.4):c.4832A>G (p.(Asn1611Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99556461A>G" "" "likely benign" "" "0000533250" "0" "30" "8" "100568723" "100568723" "subst" "2.03844E-5" "01943" "COX6C_000041" "g.100568723C>T" "" "" "" "VPS13B(NM_017890.4):c.4866C>T (p.I1622=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99556495C>T" "" "likely benign" "" "0000533251" "0" "30" "8" "100568732" "100568732" "subst" "0" "01943" "COX6C_000042" "g.100568732A>G" "" "" "" "VPS13B(NM_017890.4):c.4875A>G (p.R1625=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99556504A>G" "" "likely benign" "" "0000533252" "0" "30" "8" "100568820" "100568820" "subst" "0" "01804" "COX6C_000043" "g.100568820G>T" "" "" "" "VPS13B(NM_017890.4):c.4963G>T (p.(Val1655Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99556592G>T" "" "likely benign" "" "0000533253" "0" "10" "8" "100569107" "100569107" "dup" "0" "02326" "COX6C_000044" "g.100569107dup" "" "" "" "VPS13B(NM_017890.4):c.5024+226dupA" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99556879dup" "" "benign" "" "0000533254" "0" "10" "8" "100569112" "100569112" "dup" "0" "02326" "COX6C_000045" "g.100569112dup" "" "" "" "VPS13B(NM_017890.4):c.5024+231dupA" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99556884dup" "" "benign" "" "0000533255" "0" "30" "8" "100587922" "100587922" "subst" "9.34519E-5" "01943" "COX6C_000046" "g.100587922C>T" "" "" "" "VPS13B(NM_017890.4):c.5061C>T (p.T1687=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99575694C>T" "" "likely benign" "" "0000533256" "0" "30" "8" "100587948" "100587948" "subst" "1.21941E-5" "01943" "COX6C_000047" "g.100587948G>A" "" "" "" "VPS13B(NM_017890.4):c.5087G>A (p.R1696Q), VPS13B(NM_152564.5):c.5012G>A (p.(Arg1671Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99575720G>A" "" "likely benign" "" "0000533257" "0" "30" "8" "100589704" "100589704" "subst" "1.21933E-5" "02326" "COX6C_000048" "g.100589704C>T" "" "" "" "VPS13B(NM_017890.4):c.5152-14C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99577476C>T" "" "likely benign" "" "0000533258" "0" "50" "8" "100589861" "100589861" "subst" "4.07063E-6" "01943" "COX6C_000049" "g.100589861G>T" "" "" "" "VPS13B(NM_017890.4):c.5295G>T (p.E1765D), VPS13B(NM_152564.5):c.5220G>T (p.(Glu1740Asp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99577633G>T" "" "VUS" "" "0000533259" "0" "10" "8" "100654335" "100654335" "subst" "0.00165404" "01943" "COX6C_000050" "g.100654335G>A" "" "" "" "VPS13B(NM_017890.4):c.5592G>A (p.Q1864=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99642107G>A" "" "benign" "" "0000533260" "0" "30" "8" "100654424" "100654424" "subst" "0.00090241" "01804" "VPS13B_000249" "g.100654424C>T" "" "" "" "VPS13B(NM_017890.4):c.5681C>T (p.T1894M), VPS13B(NM_017890.5):c.5681C>T (p.T1894M), VPS13B(NM_152564.4):c.5606C>T (p.(Thr1869Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99642196C>T" "" "likely benign" "" "0000533261" "0" "30" "8" "100654425" "100654425" "subst" "0.000117884" "01943" "COX6C_000051" "g.100654425G>A" "" "" "" "VPS13B(NM_017890.4):c.5682G>A (p.T1894=), VPS13B(NM_017890.5):c.5682G>A (p.T1894=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99642197G>A" "" "likely benign" "" "0000533262" "0" "30" "8" "100654723" "100654723" "subst" "0.0015341" "02326" "VPS13B_000255" "g.100654723A>G" "" "" "" "VPS13B(NM_017890.4):c.5980A>G (p.I1994V), VPS13B(NM_017890.5):c.5980A>G (p.I1994V), VPS13B(NM_152564.4):c.5905A>G (p.(Ile1969Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99642495A>G" "" "likely benign" "" "0000533263" "0" "50" "8" "100654728" "100654728" "dup" "0" "01804" "VPS13B_000162" "g.100654728dup" "" "" "" "VPS13B(NM_017890.4):c.5983+2dup (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99642500dup" "" "VUS" "" "0000533264" "0" "10" "8" "100708982" "100708982" "subst" "0" "02326" "COX6C_000052" "g.100708982C>T" "" "" "" "VPS13B(NM_017890.4):c.6122-2771C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99696754C>T" "" "benign" "" "0000533266" "0" "50" "8" "100712122" "100712122" "subst" "0.000868169" "01943" "COX6C_000054" "g.100712122A>G" "" "" "" "VPS13B(NM_017890.4):c.6491A>G (p.N2164S), VPS13B(NM_017890.5):c.6491A>G (p.N2164S), VPS13B(NM_152564.4):c.6416A>G (p.(Asn2139Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99699894A>G" "" "VUS" "" "0000533267" "0" "30" "8" "100712122" "100712122" "subst" "0.000868169" "01804" "COX6C_000054" "g.100712122A>G" "" "" "" "VPS13B(NM_017890.4):c.6491A>G (p.N2164S), VPS13B(NM_017890.5):c.6491A>G (p.N2164S), VPS13B(NM_152564.4):c.6416A>G (p.(Asn2139Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99699894A>G" "" "likely benign" "" "0000533268" "0" "10" "8" "100712122" "100712122" "subst" "0.000868169" "02326" "COX6C_000054" "g.100712122A>G" "" "" "" "VPS13B(NM_017890.4):c.6491A>G (p.N2164S), VPS13B(NM_017890.5):c.6491A>G (p.N2164S), VPS13B(NM_152564.4):c.6416A>G (p.(Asn2139Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99699894A>G" "" "benign" "" "0000533269" "0" "50" "8" "100732723" "100732723" "subst" "4.07E-6" "01943" "COX6C_000055" "g.100732723A>T" "" "" "" "VPS13B(NM_017890.4):c.6883A>T (p.S2295C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99720495A>T" "" "VUS" "" "0000533270" "0" "90" "8" "100733276" "100733276" "subst" "0" "01943" "COX6C_000056" "g.100733276G>T" "" "" "" "VPS13B(NM_017890.4):c.7125+1G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99721048G>T" "" "pathogenic" "" "0000533271" "0" "30" "8" "100789190" "100789190" "subst" "4.06894E-6" "01804" "COX6C_000057" "g.100789190C>T" "" "" "" "VPS13B(NM_017890.4):c.7504+6C>T (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99776962C>T" "" "likely benign" "" "0000533272" "0" "30" "8" "100791149" "100791149" "subst" "0.00018722" "01804" "COX6C_000058" "g.100791149G>A" "" "" "" "VPS13B(NM_017890.4):c.7744G>A (p.(Asp2582Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99778921G>A" "" "likely benign" "" "0000533273" "0" "50" "8" "100791158" "100791158" "subst" "0.00319527" "01943" "VPS13B_000279" "g.100791158G>A" "" "" "" "VPS13B(NM_017890.4):c.7753G>A (p.E2585K, p.(Glu2585Lys)), VPS13B(NM_017890.5):c.7753G>A (p.E2585K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99778930G>A" "" "VUS" "" "0000533274" "0" "30" "8" "100791158" "100791158" "subst" "0.00319527" "02326" "VPS13B_000279" "g.100791158G>A" "" "" "" "VPS13B(NM_017890.4):c.7753G>A (p.E2585K, p.(Glu2585Lys)), VPS13B(NM_017890.5):c.7753G>A (p.E2585K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99778930G>A" "" "likely benign" "" "0000533275" "0" "50" "8" "100791204" "100791204" "subst" "1.63116E-5" "01943" "VPS13B_000361" "g.100791204A>T" "" "" "" "VPS13B(NM_017890.4):c.7799A>T (p.N2600I), VPS13B(NM_152564.5):c.7724A>T (p.(Asn2575Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99778976A>T" "" "VUS" "" "0000533276" "0" "50" "8" "100829831" "100829831" "subst" "0" "01943" "COX6C_000059" "g.100829831G>C" "" "" "" "VPS13B(NM_017890.4):c.8236G>C (p.V2746L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99817603G>C" "" "VUS" "" "0000533279" "0" "50" "8" "100830707" "100830707" "subst" "2.84724E-5" "02327" "COX6C_000062" "g.100830707A>G" "" "" "" "VPS13B(NM_017890.5):c.8465A>G (p.Y2822C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99818479A>G" "" "VUS" "" "0000533282" "0" "50" "8" "100832259" "100832259" "subst" "0.00323142" "01804" "VPS13B_000108" "g.100832259A>G" "" "" "" "VPS13B(NM_017890.4):c.8978A>G (p.N2993S), VPS13B(NM_017890.5):c.8978A>G (p.N2993S), VPS13B(NM_152564.5):c.8903A>G (p.(Asn2968Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99820031A>G" "" "VUS" "" "0000533284" "0" "30" "8" "100844596" "100844596" "subst" "0" "01804" "VPS13B_000111" "g.100844596G>T" "" "" "" "VPS13B(NM_152564.4):c.9331-1G>T (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99832368G>T" "" "likely benign" "" "0000533295" "0" "50" "8" "100844603" "100844604" "del" "0" "01804" "COX6C_000075" "g.100844603_100844604del" "" "" "" "VPS13B(NM_017890.4):c.9412_9413del (p.(Arg3138CysfsTer8))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99832375_99832376del" "" "VUS" "" "0000533296" "0" "30" "8" "100844609" "100844622" "del" "8.50418E-5" "01804" "COX6C_000076" "g.100844609_100844622del" "" "" "" "VPS13B(NM_017890.4):c.9418_9431del (p.(Pro3140PhefsTer2))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99832381_99832394del" "" "likely benign" "" "0000533297" "0" "30" "8" "100844804" "100844804" "subst" "4.06421E-6" "01943" "COX6C_000077" "g.100844804A>G" "" "" "" "VPS13B(NM_017890.4):c.9613A>G (p.I3205V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99832576A>G" "" "likely benign" "" "0000533298" "0" "30" "8" "100844875" "100844875" "subst" "5.30968E-5" "01943" "COX6C_000078" "g.100844875T>C" "" "" "" "VPS13B(NM_017890.4):c.9684T>C (p.C3228=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99832647T>C" "" "likely benign" "" "0000533299" "0" "30" "8" "100847506" "100847506" "subst" "0" "01943" "COX6C_000079" "g.100847506C>A" "" "" "" "VPS13B(NM_017890.4):c.9771C>A (p.I3257=), VPS13B(NM_152564.5):c.9696C>A (p.(Ile3232=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99835278C>A" "" "likely benign" "" "0000533301" "0" "10" "8" "100847646" "100847646" "dup" "0" "02326" "COX6C_000081" "g.100847646dup" "" "" "" "VPS13B(NM_017890.4):c.9817+94dupA" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99835418dup" "" "benign" "" "0000533302" "0" "30" "8" "100861110" "100861110" "subst" "0.00800188" "01804" "VPS13B_000322" "g.100861110C>T" "" "" "" "VPS13B(NM_017890.4):c.10124C>T (p.T3375I, p.(Thr3375Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99848882C>T" "" "likely benign" "" "0000533304" "0" "50" "8" "100865941" "100865941" "subst" "0" "01943" "COX6C_000083" "g.100865941G>A" "" "" "" "VPS13B(NM_017890.4):c.10399G>A (p.A3467T), VPS13B(NM_017890.5):c.10399G>A (p.A3467T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99853713G>A" "" "VUS" "" "0000533306" "0" "30" "8" "100871569" "100871569" "subst" "0.00077158" "01943" "COX6C_000085" "g.100871569T>C" "" "" "" "VPS13B(NM_017890.4):c.10980T>C (p.P3660=), VPS13B(NM_017890.5):c.10980T>C (p.P3660=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99859341T>C" "" "likely benign" "" "0000533307" "0" "30" "8" "100871713" "100871713" "subst" "4.49567E-5" "01804" "COX6C_000086" "g.100871713C>T" "" "" "" "VPS13B(NM_017890.5):c.11119+5C>T, VPS13B(NM_152564.4):c.11044+5C>T (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99859485C>T" "" "likely benign" "" "0000533308" "0" "30" "8" "100874030" "100874030" "subst" "0.00241312" "02325" "VPS13B_000161" "g.100874030G>A" "" "" "" "VPS13B(NM_017890.4):c.11146G>A (p.A3716T, p.(Ala3716Thr)), VPS13B(NM_017890.5):c.11146G>A (p.A3716T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99861802G>A" "" "likely benign" "" "0000533309" "0" "30" "8" "100874030" "100874030" "subst" "0.00241312" "02326" "VPS13B_000161" "g.100874030G>A" "" "" "" "VPS13B(NM_017890.4):c.11146G>A (p.A3716T, p.(Ala3716Thr)), VPS13B(NM_017890.5):c.11146G>A (p.A3716T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99861802G>A" "" "likely benign" "" "0000533310" "0" "30" "8" "100874154" "100874154" "subst" "0.00185926" "01804" "VPS13B_000338" "g.100874154G>A" "" "" "" "VPS13B(NM_017890.4):c.11270G>A (p.R3757Q, p.(Arg3757Gln)), VPS13B(NM_017890.5):c.11270G>A (p.R3757Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99861926G>A" "" "likely benign" "" "0000533311" "0" "50" "8" "100880639" "100880639" "subst" "0.000190914" "01943" "COX6C_000087" "g.100880639G>T" "" "" "" "VPS13B(NM_017890.4):c.11413G>T (p.V3805L), VPS13B(NM_017890.5):c.11413G>T (p.V3805L), VPS13B(NM_152564.4):c.11338G>T (p.(Val3780Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99868411G>T" "" "VUS" "" "0000533313" "0" "30" "8" "100883863" "100883863" "subst" "0" "01943" "COX6C_000089" "g.100883863A>G" "" "" "" "VPS13B(NM_017890.4):c.11758A>G (p.S3920G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99871635A>G" "" "likely benign" "" "0000533314" "0" "30" "8" "100883872" "100883872" "subst" "0" "01943" "COX6C_000090" "g.100883872A>C" "" "" "" "VPS13B(NM_017890.4):c.11767A>C (p.N3923H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99871644A>C" "" "likely benign" "" "0000533315" "0" "30" "8" "100887761" "100887761" "subst" "0" "01804" "COX6C_000091" "g.100887761C>T" "" "" "" "VPS13B(NM_017890.4):c.11936C>T (p.(Pro3979Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99875533C>T" "" "likely benign" "" "0000533317" "0" "50" "8" "100887867" "100887870" "dup" "0" "01943" "COX6C_000093" "g.100887867_100887870dup" "" "" "" "VPS13B(NM_017890.4):c.12038_12039insAAAT (p.(Ala4016Ter)), VPS13B(NM_017890.4):c.12042_12045dupTAAA (p.A4016*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99875639_99875642dup" "" "VUS" "" "0000533318" "0" "10" "8" "100887927" "100887930" "dup" "0" "02326" "COX6C_000094" "g.100887927_100887930dup" "" "" "" "VPS13B(NM_017890.4):c.*33_*36dupGATT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99875699_99875702dup" "" "benign" "" "0000611350" "0" "30" "8" "100133548" "100133548" "subst" "8.12321E-6" "01943" "COX6C_000097" "g.100133548G>A" "" "" "" "VPS13B(NM_017890.4):c.1081G>A (p.D361N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99121320G>A" "" "likely benign" "" "0000611351" "0" "30" "8" "100147950" "100147950" "subst" "0" "01943" "COX6C_000012" "g.100147950A>T" "" "" "" "VPS13B(NM_015243.2):c.1552A>T (p.(Thr518Ser)), VPS13B(NM_017890.4):c.1552A>T (p.T518S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99135722A>T" "" "likely benign" "" "0000611352" "0" "30" "8" "100205255" "100205255" "subst" "0.00866549" "01804" "VPS13B_000205" "g.100205255G>A" "" "" "" "VPS13B(NM_015243.2):c.2485G>A (p.(Ala829Thr)), VPS13B(NM_017890.4):c.2485G>A (p.A829T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99193027G>A" "" "likely benign" "" "0000611353" "0" "30" "8" "100403925" "100403925" "subst" "0.000366178" "01943" "COX6C_000099" "g.100403925G>A" "" "" "" "VPS13B(NM_017890.4):c.3075G>A (p.T1025=), VPS13B(NM_017890.5):c.3075G>A (p.T1025=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99391697G>A" "" "likely benign" "" "0000611355" "0" "30" "8" "100514005" "100514005" "subst" "1.21837E-5" "01804" "COX6C_000103" "g.100514005C>T" "" "" "" "VPS13B(NM_017890.4):c.3961C>T (p.(Arg1321Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99501777C>T" "" "likely benign" "" "0000611356" "0" "50" "8" "100729474" "100729474" "subst" "9.75562E-5" "02325" "VPS13B_000267" "g.100729474G>A" "" "" "" "VPS13B(NM_017890.4):c.6605G>A (p.(Arg2202His)), VPS13B(NM_017890.5):c.6605G>A (p.R2202H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99717246G>A" "" "VUS" "" "0000611357" "0" "30" "8" "100866441" "100866441" "subst" "0.000305178" "01943" "COX6C_000107" "g.100866441C>T" "" "" "" "VPS13B(NM_017890.4):c.10899C>T (p.H3633=), VPS13B(NM_017890.5):c.10899C>T (p.H3633=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99854213C>T" "" "likely benign" "" "0000611358" "0" "30" "8" "100874154" "100874154" "subst" "0.00185926" "02326" "VPS13B_000338" "g.100874154G>A" "" "" "" "VPS13B(NM_017890.4):c.11270G>A (p.R3757Q, p.(Arg3757Gln)), VPS13B(NM_017890.5):c.11270G>A (p.R3757Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99861926G>A" "" "likely benign" "" "0000611359" "0" "30" "8" "100887784" "100887784" "subst" "0.000832508" "01943" "COX6C_000109" "g.100887784C>G" "" "" "" "VPS13B(NM_017890.4):c.11959C>G (p.P3987A), VPS13B(NM_017890.5):c.11959C>G (p.P3987A), VPS13B(NM_152564.5):c.11884C>G (p.(Pro3962Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99875556C>G" "" "likely benign" "" "0000611360" "0" "50" "8" "100887867" "100887870" "dup" "0" "01804" "COX6C_000093" "g.100887867_100887870dup" "" "" "" "VPS13B(NM_017890.4):c.12038_12039insAAAT (p.(Ala4016Ter)), VPS13B(NM_017890.4):c.12042_12045dupTAAA (p.A4016*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99875639_99875642dup" "" "VUS" "" "0000621964" "0" "50" "8" "100115273" "100115273" "subst" "0.000101587" "01943" "COX6C_000096" "g.100115273C>A" "" "" "" "VPS13B(NM_017890.4):c.505C>A (p.L169I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99103045C>A" "" "VUS" "" "0000621965" "0" "30" "8" "100147234" "100147234" "subst" "4.47274E-5" "01943" "COX6C_000098" "g.100147234G>A" "" "" "" "VPS13B(NM_017890.4):c.1303-9G>A, VPS13B(NM_017890.5):c.1303-9G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99135006G>A" "" "likely benign" "" "0000621967" "0" "50" "8" "100493950" "100493950" "subst" "4.06689E-6" "01943" "COX6C_000102" "g.100493950C>T" "" "" "" "VPS13B(NM_017890.4):c.3790C>T (p.P1264S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99481722C>T" "" "VUS" "" "0000621968" "0" "30" "8" "100523326" "100523326" "subst" "0.000247384" "01943" "COX6C_000104" "g.100523326G>A" "" "" "" "VPS13B(NM_017890.4):c.4300-6G>A, VPS13B(NM_017890.5):c.4300-6G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99511098G>A" "" "likely benign" "" "0000621969" "0" "30" "8" "100654579" "100654579" "subst" "4.0625E-6" "02326" "COX6C_000105" "g.100654579A>G" "" "" "" "VPS13B(NM_017890.4):c.5836A>G (p.T1946A), VPS13B(NM_152564.5):c.5761A>G (p.(Thr1921Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99642351A>G" "" "likely benign" "" "0000621970" "0" "30" "8" "100830760" "100830760" "subst" "4.06951E-6" "01943" "VPS13B_000291" "g.100830760A>G" "" "" "" "VPS13B(NM_017890.4):c.8518A>G (p.M2840V, p.(Met2840Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99818532A>G" "" "likely benign" "" "0000621971" "0" "50" "8" "100832259" "100832259" "subst" "0.00323142" "02326" "VPS13B_000108" "g.100832259A>G" "" "" "" "VPS13B(NM_017890.4):c.8978A>G (p.N2993S), VPS13B(NM_017890.5):c.8978A>G (p.N2993S), VPS13B(NM_152564.5):c.8903A>G (p.(Asn2968Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99820031A>G" "" "VUS" "" "0000621972" "0" "30" "8" "100865880" "100865880" "subst" "0" "01943" "COX6C_000106" "g.100865880G>A" "" "" "" "VPS13B(NM_017890.4):c.10338G>A (p.E3446=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99853652G>A" "" "likely benign" "" "0000621973" "0" "50" "8" "100874103" "100874103" "subst" "5.29085E-5" "01943" "COX6C_000108" "g.100874103G>A" "" "" "" "VPS13B(NM_017890.4):c.11219G>A (p.R3740Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99861875G>A" "" "VUS" "" "0000652379" "1" "50" "8" "100146901" "100146901" "subst" "0.00118075" "03575" "COX6C_000009" "g.100146901G>T" "5/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 5 heterozygous, no homozygous; {DB:CLININrs143024324}" "Germline" "" "rs143024324" "0" "" "" "g.99134673G>T" "" "VUS" "" "0000652380" "1" "50" "8" "100147926" "100147926" "subst" "0.000109806" "03575" "VPS13B_000371" "g.100147926C>T" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs139141291}" "Germline" "" "rs139141291" "0" "" "" "g.99135698C>T" "" "VUS" "" "0000652381" "1" "50" "8" "100155318" "100155318" "subst" "0.000861389" "03575" "VPS13B_000027" "g.100155318G>A" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs140601319}" "Germline" "" "rs140601319" "0" "" "" "g.99143090G>A" "" "VUS" "" "0000652382" "1" "90" "8" "100168837" "100168837" "subst" "4.06342E-6" "03575" "VPS13B_000030" "g.100168837C>T" "2/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "2 heterozygous, no homozygous; {DB:CLININrs180177356}" "Germline" "" "rs180177356" "0" "" "" "g.99156609C>T" "" "pathogenic" "" "0000652383" "1" "30" "8" "100205255" "100205255" "subst" "0.00866549" "03575" "VPS13B_000205" "g.100205255G>A" "26/2791 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "26 heterozygous, no homozygous; {DB:CLININrs61753721}" "Germline" "" "rs61753721" "0" "" "" "g.99193027G>A" "" "likely benign" "" "0000652384" "1" "90" "8" "100286501" "100286501" "subst" "0" "03575" "VPS13B_000372" "g.100286501C>A" "1/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs140936527}" "Germline" "" "rs140936527" "0" "" "" "g.99274273C>A" "" "pathogenic" "" "0000652385" "1" "50" "8" "100454781" "100454781" "subst" "6.91029E-5" "03575" "VPS13B_000373" "g.100454781A>G" "1/2790 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs191099208}" "Germline" "" "rs191099208" "0" "" "" "g.99442553A>G" "" "VUS" "" "0000652386" "1" "50" "8" "100454804" "100454804" "subst" "0.00464668" "03575" "VPS13B_000224" "g.100454804A>G" "3/2792 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 3 heterozygous, no homozygous; {DB:CLININrs61759485}" "Germline" "" "rs61759485" "0" "" "" "g.99442576A>G" "" "VUS" "" "0000652387" "1" "30" "8" "100791156" "100791156" "subst" "0.0507001" "03575" "VPS13B_000278" "g.100791156T>C" "148/2793 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "148 heterozygous; {DB:CLININrs7833870}" "Germline" "" "rs7833870" "0" "" "" "g.99778928T>C" "" "likely benign" "" "0000652388" "1" "70" "8" "100832226" "100832226" "subst" "0" "03575" "VPS13B_000374" "g.100832226T>A" "1/2792 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs727504219}" "Germline" "" "rs727504219" "0" "" "" "g.99819998T>A" "" "likely pathogenic" "" "0000652389" "1" "10" "8" "100865682" "100865682" "subst" "0.0174041" "03575" "VPS13B_000326" "g.100865682G>T" "30/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "30 heterozygous, no homozygous; {DB:CLININrs61753726}" "Germline" "" "rs61753726" "0" "" "" "g.99853454G>T" "" "benign" "" "0000652390" "1" "10" "8" "100871741" "100871741" "subst" "0.00876952" "03575" "VPS13B_000375" "g.100871741C>A" "10/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "10 heterozygous, no homozygous; {DB:CLININrs72676269}" "Germline" "" "rs72676269" "0" "" "" "g.99859513C>A" "" "benign" "" "0000652391" "1" "50" "8" "100887797" "100887797" "subst" "0.000263964" "03575" "VPS13B_000377" "g.100887797A>T" "4/2786 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "4 heterozygous, no homozygous; {DB:CLININrs117934093}" "Germline" "" "rs117934093" "0" "" "" "g.99875569A>T" "" "VUS" "" "0000653282" "1" "50" "8" "100887651" "100887654" "dup" "0" "03575" "VPS13B_000376" "g.100887651_100887654dup" "3/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "3 heterozygous, no homozygous; {DB:CLININrs386834068}" "Germline" "" "rs386834068" "0" "" "" "g.99875423_99875426dup" "" "VUS" "" "0000655945" "0" "30" "8" "100123316" "100123316" "subst" "0" "02326" "COX6C_000110" "g.100123316T>C" "" "" "" "VPS13B(NM_017890.4):c.581-10T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99111088T>C" "" "likely benign" "" "0000655946" "0" "30" "8" "100133450" "100133450" "subst" "0.000536913" "02326" "COX6C_000008" "g.100133450A>G" "" "" "" "VPS13B(NM_017890.4):c.983A>G (p.H328R), VPS13B(NM_017890.5):c.983A>G (p.H328R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99121222A>G" "" "likely benign" "" "0000655947" "0" "90" "8" "100523503" "100523503" "subst" "8.13418E-6" "02327" "VPS13B_000054" "g.100523503G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99511275G>T" "" "pathogenic" "" "0000655948" "0" "90" "8" "100587947" "100587947" "subst" "1.21921E-5" "02327" "VPS13B_000049" "g.100587947C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99575719C>T" "" "pathogenic" "" "0000655949" "0" "70" "8" "100654611" "100654611" "subst" "0" "02327" "COX6C_000111" "g.100654611C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99642383C>G" "" "likely pathogenic" "" "0000655950" "0" "30" "8" "100654629" "100654629" "subst" "0.000166729" "01943" "COX6C_000112" "g.100654629T>G" "" "" "" "VPS13B(NM_017890.4):c.5886T>G (p.P1962=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99642401T>G" "" "likely benign" "" "0000655951" "0" "30" "8" "100791139" "100791139" "subst" "1.22078E-5" "01943" "COX6C_000113" "g.100791139A>C" "" "" "" "VPS13B(NM_017890.4):c.7734A>C (p.A2578=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99778911A>C" "" "likely benign" "" "0000655952" "0" "30" "8" "100865769" "100865769" "subst" "2.03056E-5" "01943" "COX6C_000114" "g.100865769T>G" "" "" "" "VPS13B(NM_017890.4):c.10227T>G (p.A3409=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99853541T>G" "" "likely benign" "" "0000655953" "0" "30" "8" "100883793" "100883793" "subst" "0.000690406" "02326" "VPS13B_000344" "g.100883793C>T" "" "" "" "VPS13B(NM_017890.4):c.11688C>T (p.F3896=), VPS13B(NM_017890.5):c.11688C>T (p.F3896=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99871565C>T" "" "likely benign" "" "0000664846" "0" "50" "8" "100078926" "100078926" "subst" "0" "03664" "VPS13B_000378" "g.100078926C>A" "" "Huang 2020 (submitted)" "" "" "associated with facial morphology (nose)" "Germline" "" "rs11988731" "0" "" "" "g.99066698C>A" "" "association" "" "0000669989" "3" "30" "8" "100791156" "100791156" "subst" "0.0507001" "03575" "VPS13B_000278" "g.100791156T>C" "2/2793 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "2 homozygous; {DB:CLININrs7833870}" "Germline" "" "rs7833870" "0" "" "" "g.99778928T>C" "" "likely benign" "" "0000678240" "0" "30" "8" "100205126" "100205126" "subst" "0.000187229" "01943" "COX6C_000115" "g.100205126A>G" "" "" "" "VPS13B(NM_017890.4):c.2356A>G (p.I786V), VPS13B(NM_017890.5):c.2356A>G (p.I786V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000678241" "0" "30" "8" "100791265" "100791265" "subst" "0" "01943" "COX6C_000116" "g.100791265C>T" "" "" "" "VPS13B(NM_017890.4):c.7854+6C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000678242" "0" "30" "8" "100847565" "100847565" "subst" "0.000660963" "02326" "COX6C_000117" "g.100847565C>T" "" "" "" "VPS13B(NM_017890.4):c.9817+13C>T, VPS13B(NM_017890.5):c.9817+13C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000678243" "0" "70" "8" "100871568" "100871568" "del" "0" "01804" "COX6C_000118" "g.100871568del" "" "" "" "VPS13B(NM_017890.4):c.10979del (p.(Pro3660LeufsTer5)), VPS13B(NM_017890.5):c.10979delC (p.P3660Lfs*5)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000685569" "0" "90" "10" "100654160" "100654160" "dup" "0" "00004" "VPS13B_000379" "g.100654160dup" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000690120" "0" "30" "8" "100287294" "100287294" "subst" "0.000373518" "02326" "COX6C_000119" "g.100287294A>C" "" "" "" "VPS13B(NM_017890.4):c.2651-15A>C, VPS13B(NM_017890.5):c.2651-15A>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000690121" "0" "30" "8" "100396536" "100396536" "subst" "6.10302E-5" "02326" "COX6C_000120" "g.100396536T>C" "" "" "" "VPS13B(NM_017890.4):c.2925T>C (p.H975=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000690122" "0" "30" "8" "100791127" "100791127" "subst" "0.000138347" "01943" "COX6C_000121" "g.100791127C>T" "" "" "" "VPS13B(NM_017890.4):c.7722C>T (p.F2574=), VPS13B(NM_017890.5):c.7722C>T (p.F2574=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000690123" "0" "30" "8" "100866058" "100866058" "subst" "4.06062E-5" "01943" "COX6C_000122" "g.100866058T>C" "" "" "" "VPS13B(NM_017890.4):c.10516T>C (p.C3506R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000690124" "0" "50" "8" "100866361" "100866361" "subst" "0.000491618" "01943" "COX6C_000123" "g.100866361A>G" "" "" "" "VPS13B(NM_017890.4):c.10819A>G (p.I3607V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000690125" "0" "70" "8" "100880537" "100880537" "del" "0" "01943" "COX6C_000124" "g.100880537del" "" "" "" "VPS13B(NM_017890.4):c.11311delG (p.D3771Ifs*107)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000690126" "0" "30" "8" "100880701" "100880701" "subst" "0.000582312" "01943" "COX6C_000125" "g.100880701G>A" "" "" "" "VPS13B(NM_017890.4):c.11467+8G>A, VPS13B(NM_017890.5):c.11467+8G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000690127" "0" "30" "8" "100880701" "100880701" "subst" "0.000582312" "02326" "COX6C_000125" "g.100880701G>A" "" "" "" "VPS13B(NM_017890.4):c.11467+8G>A, VPS13B(NM_017890.5):c.11467+8G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000701832" "3" "70" "8" "100654333" "100654333" "subst" "8.1473E-6" "00006" "VPS13B_000379" "g.100654333C>T" "" "{PMID:Riazuddin 2017:27457812}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000710304" "1" "90" "8" "100587947" "100587947" "subst" "1.21921E-5" "00006" "VPS13B_000049" "g.100587947C>T" "1/143 cases" "{PMID:Zenteno 2020:31736247}" "" "" "" "Germline" "" "" "0" "" "" "g.99575719C>T" "" "pathogenic" "" "0000710359" "2" "90" "8" "100832259" "100832259" "subst" "0.00323142" "00006" "VPS13B_000108" "g.100832259A>G" "1/143 cases" "{PMID:Zenteno 2020:31736247}" "" "" "" "Germline" "" "" "0" "" "" "g.99820031A>G" "" "pathogenic" "" "0000713660" "0" "70" "8" "100286501" "100286501" "subst" "0" "00000" "VPS13B_000372" "g.100286501C>A" "" "{PMID:Carss 2017:28041643}" "" "8:100286501C>A ENST00000358544.2:c.2591C>A (Ser864Ter)" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000713898" "0" "70" "8" "100479824" "100479824" "subst" "0" "00000" "VPS13B_000381" "g.100479824G>T" "" "{PMID:Carss 2017:28041643}" "" "8:100479824G>T ENST00000358544.2:c.3628G>T (Asp1210Tyr)" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000713899" "0" "70" "8" "100712001" "100712002" "del" "1.21955E-5" "00000" "VPS13B_000383" "g.100712001_100712002del" "" "{PMID:Carss 2017:28041643}" "" "8:100712000CAT>C ENST00000358544.2:c.6370_6371delAT (Met2124ValfsTer44)" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000714082" "2" "70" "8" "100673720" "100673720" "subst" "0" "00000" "VPS13B_000382" "g.100673720G>C" "" "{PMID:Taylor 2017:28341476}" "" "" "" "Germline" "" "" "0" "" "" "g.99661492G>C" "" "likely pathogenic (recessive)" "" "0000714083" "2" "70" "8" "100791163" "100791163" "del" "4.07057E-6" "00000" "VPS13B_000385" "g.100791163del" "" "{PMID:Taylor 2017:28341476}" "" "" "" "Germline" "" "" "0" "" "" "g.99778935del" "" "likely pathogenic (recessive)" "" "0000714107" "1" "70" "8" "100025494" "100123508" "del" "0" "00000" "VPS13B_000380" "g.(?_100025494)_(100123508_100127927)del" "" "{PMID:Taylor 2017:28341476}" "" "ex1-6 deletion" "" "Germline" "" "" "0" "" "" "g.(?_99013266)_(99111280_99115699)del" "" "likely pathogenic (recessive)" "" "0000714108" "1" "70" "8" "100732572" "100791260" "dup" "0" "00000" "VPS13B_000384" "g.(100729602_100732572)_(100791260_100796542)dup" "" "{PMID:Taylor 2017:28341476}" "" "ex38-42 duplication" "" "Germline" "" "" "0" "" "" "g.(99717374_99720344)_(99779032_99784314)dup" "" "likely pathogenic (recessive)" "" "0000721635" "0" "30" "8" "100108537" "100108537" "subst" "4.06679E-6" "02330" "COX6C_000126" "g.100108537T>C" "" "" "" "VPS13B(NM_017890.5):c.292-3T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721636" "0" "70" "8" "100115204" "100115204" "subst" "1.626E-5" "02329" "VPS13B_000138" "g.100115204C>T" "" "" "" "VPS13B(NM_017890.5):c.436C>T (p.R146*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000721637" "0" "50" "8" "100123329" "100123329" "subst" "4.15901E-6" "02330" "COX6C_000127" "g.100123329C>G" "" "" "" "VPS13B(NM_017890.4):c.584C>G (p.T195S), VPS13B(NM_017890.5):c.584C>G (p.T195S), VPS13B(NM_152564.5):c.584C>G (p.(Thr195Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000721638" "0" "30" "8" "100123495" "100123495" "subst" "8.28034E-6" "02330" "COX6C_000128" "g.100123495A>G" "" "" "" "VPS13B(NM_017890.5):c.750A>G (p.P250=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721639" "0" "30" "8" "100133450" "100133450" "subst" "0.000536913" "02330" "COX6C_000008" "g.100133450A>G" "" "" "" "VPS13B(NM_017890.4):c.983A>G (p.H328R), VPS13B(NM_017890.5):c.983A>G (p.H328R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721640" "0" "30" "8" "100147234" "100147234" "subst" "4.47274E-5" "02330" "COX6C_000098" "g.100147234G>A" "" "" "" "VPS13B(NM_017890.4):c.1303-9G>A, VPS13B(NM_017890.5):c.1303-9G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721641" "0" "50" "8" "100147283" "100147283" "subst" "2.84548E-5" "01943" "COX6C_000129" "g.100147283G>A" "" "" "" "VPS13B(NM_017890.4):c.1343G>A (p.G448E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000721642" "0" "70" "8" "100147841" "100147842" "del" "0" "02330" "COX6C_000130" "g.100147841_100147842del" "" "" "" "VPS13B(NM_017890.5):c.1443_1444delTT (p.I481Mfs*3)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000721643" "0" "50" "8" "100147918" "100147918" "subst" "4.06564E-5" "01943" "COX6C_000131" "g.100147918A>G" "" "" "" "VPS13B(NM_017890.4):c.1520A>G (p.N507S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000721644" "0" "30" "8" "100148968" "100148968" "subst" "0.000243762" "02330" "COX6C_000132" "g.100148968A>G" "" "" "" "VPS13B(NM_017890.5):c.1639A>G (p.T547A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721645" "0" "10" "8" "100155206" "100155206" "subst" "0" "02330" "COX6C_000133" "g.100155206C>A" "" "" "" "VPS13B(NM_017890.5):c.1656C>A (p.S552=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000721646" "0" "30" "8" "100155318" "100155318" "subst" "0.000861389" "02330" "VPS13B_000027" "g.100155318G>A" "" "" "" "VPS13B(NM_017890.4):c.1768G>A (p.A590T), VPS13B(NM_017890.5):c.1768G>A (p.A590T), VPS13B(NM_152564.5):c.1768G>A (p.(Ala590Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721647" "0" "30" "8" "100155382" "100155382" "subst" "0.00130029" "02330" "VPS13B_000195" "g.100155382G>A" "" "" "" "VPS13B(NM_017890.4):c.1832G>A (p.R611K), VPS13B(NM_017890.5):c.1832G>A (p.R611K), VPS13B(NM_152564.5):c.1832G>A (p.(Arg611Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721648" "0" "10" "8" "100155409" "100155409" "subst" "0.000178959" "02330" "COX6C_000134" "g.100155409A>G" "" "" "" "VPS13B(NM_017890.5):c.1843+16A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000721649" "0" "50" "8" "100160089" "100160089" "subst" "1.33791E-5" "02330" "COX6C_000135" "g.100160089A>G" "" "" "" "VPS13B(NM_017890.4):c.1864A>G (p.T622A), VPS13B(NM_017890.5):c.1864A>G (p.T622A), VPS13B(NM_152564.5):c.1864A>G (p.(Thr622Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000721650" "0" "30" "8" "100160206" "100160206" "subst" "0.000410279" "02330" "COX6C_000136" "g.100160206G>A" "" "" "" "VPS13B(NM_017890.4):c.1981G>A (p.D661N), VPS13B(NM_017890.5):c.1981G>A (p.D661N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721651" "0" "10" "8" "100168779" "100168779" "subst" "3.65919E-5" "02330" "COX6C_000137" "g.100168779C>T" "" "" "" "VPS13B(NM_017890.5):c.2016C>T (p.N672=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000721652" "0" "30" "8" "100182306" "100182306" "subst" "4.06488E-6" "02330" "COX6C_000138" "g.100182306A>G" "" "" "" "VPS13B(NM_017890.5):c.2248A>G (p.S750G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721653" "0" "10" "8" "100205242" "100205242" "subst" "6.0985E-5" "02330" "COX6C_000139" "g.100205242C>T" "" "" "" "VPS13B(NM_017890.4):c.2472C>T (p.S824=), VPS13B(NM_017890.5):c.2472C>T (p.S824=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000721654" "0" "30" "8" "100205242" "100205242" "subst" "6.0985E-5" "01943" "COX6C_000139" "g.100205242C>T" "" "" "" "VPS13B(NM_017890.4):c.2472C>T (p.S824=), VPS13B(NM_017890.5):c.2472C>T (p.S824=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721655" "0" "30" "8" "100286499" "100286499" "subst" "0" "02330" "COX6C_000140" "g.100286499A>G" "" "" "" "VPS13B(NM_017890.5):c.2589A>G (p.T863=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721656" "0" "10" "8" "100286574" "100286574" "subst" "4.06108E-5" "02330" "COX6C_000141" "g.100286574G>A" "" "" "" "VPS13B(NM_017890.5):c.2650+14G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000721657" "0" "30" "8" "100287294" "100287294" "subst" "0.000373518" "02330" "COX6C_000119" "g.100287294A>C" "" "" "" "VPS13B(NM_017890.4):c.2651-15A>C, VPS13B(NM_017890.5):c.2651-15A>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721658" "0" "30" "8" "100287362" "100287362" "subst" "0.000731993" "02330" "VPS13B_000211" "g.100287362A>G" "" "" "" "VPS13B(NM_017890.4):c.2704A>G (p.K902E), VPS13B(NM_017890.5):c.2704A>G (p.K902E), VPS13B(NM_152564.5):c.2704A>G (p.(Lys902Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721659" "0" "30" "8" "100287418" "100287418" "subst" "0.0025759" "02330" "VPS13B_000212" "g.100287418A>G" "" "" "" "VPS13B(NM_017890.4):c.2760A>G (p.L920=), VPS13B(NM_017890.5):c.2760A>G (p.L920=), VPS13B(NM_152564.5):c.2760A>G (p.(Leu920=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721660" "0" "10" "8" "100287418" "100287418" "subst" "0.0025759" "02326" "VPS13B_000212" "g.100287418A>G" "" "" "" "VPS13B(NM_017890.4):c.2760A>G (p.L920=), VPS13B(NM_017890.5):c.2760A>G (p.L920=), VPS13B(NM_152564.5):c.2760A>G (p.(Leu920=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000721661" "0" "30" "8" "100403767" "100403767" "subst" "4.06362E-6" "02330" "COX6C_000142" "g.100403767C>A" "" "" "" "VPS13B(NM_017890.5):c.2935-18C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721662" "0" "30" "8" "100403777" "100403777" "subst" "4.06286E-6" "02330" "VPS13B_000220" "g.100403777C>G" "" "" "" "VPS13B(NM_017890.4):c.2935-8C>G (p.(=)), VPS13B(NM_017890.5):c.2935-8C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721663" "0" "30" "8" "100403925" "100403925" "subst" "0.000366178" "02330" "COX6C_000099" "g.100403925G>A" "" "" "" "VPS13B(NM_017890.4):c.3075G>A (p.T1025=), VPS13B(NM_017890.5):c.3075G>A (p.T1025=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721664" "0" "30" "8" "100443751" "100443751" "subst" "5.29428E-5" "02330" "COX6C_000143" "g.100443751A>G" "" "" "" "VPS13B(NM_017890.5):c.3083-14A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721665" "0" "30" "8" "100443798" "100443798" "subst" "0.000248284" "02330" "COX6C_000144" "g.100443798T>C" "" "" "" "VPS13B(NM_017890.5):c.3116T>C (p.M1039T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721666" "0" "30" "8" "100443877" "100443877" "subst" "0" "02330" "COX6C_000145" "g.100443877G>A" "" "" "" "VPS13B(NM_017890.5):c.3195G>A (p.K1065=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721667" "0" "30" "8" "100443885" "100443885" "subst" "0.0105605" "02330" "COX6C_000027" "g.100443885C>T" "" "" "" "VPS13B(NM_017890.4):c.3203C>T (p.T1068I, p.(Thr1068Ile)), VPS13B(NM_017890.5):c.3203C>T (p.T1068I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721668" "0" "30" "8" "100454804" "100454804" "subst" "0.00464668" "02330" "VPS13B_000224" "g.100454804A>G" "" "" "" "VPS13B(NM_017890.4):c.3386A>G (p.K1129R), VPS13B(NM_017890.5):c.3386A>G (p.K1129R), VPS13B(NM_152564.5):c.3386A>G (p.(Lys1129Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721669" "0" "10" "8" "100454850" "100454850" "subst" "1.22049E-5" "02330" "COX6C_000146" "g.100454850C>T" "" "" "" "VPS13B(NM_017890.5):c.3432C>T (p.P1144=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000721670" "0" "10" "8" "100479712" "100479712" "subst" "0.000890418" "02330" "VPS13B_000368" "g.100479712A>G" "" "" "" "VPS13B(NM_017890.4):c.3516A>G (p.T1172=), VPS13B(NM_017890.5):c.3516A>G (p.T1172=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000721671" "0" "30" "8" "100479817" "100479817" "subst" "0.000183088" "02330" "COX6C_000147" "g.100479817C>T" "" "" "" "VPS13B(NM_017890.5):c.3621C>T (p.L1207=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721672" "0" "30" "8" "100479841" "100479841" "subst" "4.07057E-6" "02330" "COX6C_000148" "g.100479841G>A" "" "" "" "VPS13B(NM_017890.5):c.3645G>A (p.E1215=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721673" "0" "50" "8" "100493971" "100493971" "subst" "0.000715843" "02330" "VPS13B_000230" "g.100493971A>T" "" "" "" "VPS13B(NM_017890.4):c.3811A>T (p.T1271S), VPS13B(NM_017890.5):c.3811A>T (p.T1271S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000721674" "0" "30" "8" "100519980" "100519980" "subst" "0.00135361" "02330" "VPS13B_000357" "g.100519980C>T" "" "" "" "VPS13B(NM_017890.5):c.4158-18C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721675" "0" "50" "8" "100520120" "100520120" "subst" "4.47002E-5" "02330" "COX6C_000036" "g.100520120G>A" "" "" "" "VPS13B(NM_017890.4):c.4280G>A (p.(Cys1427Tyr)), VPS13B(NM_017890.5):c.4280G>A (p.C1427Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000721676" "0" "30" "8" "100523326" "100523326" "subst" "0.000247384" "02330" "COX6C_000104" "g.100523326G>A" "" "" "" "VPS13B(NM_017890.4):c.4300-6G>A, VPS13B(NM_017890.5):c.4300-6G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721677" "0" "50" "8" "100523360" "100523360" "subst" "4.07927E-6" "02330" "COX6C_000149" "g.100523360A>G" "" "" "" "VPS13B(NM_017890.5):c.4328A>G (p.H1443R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000721678" "0" "50" "8" "100523369" "100523369" "subst" "7.33688E-5" "01943" "COX6C_000150" "g.100523369A>G" "" "" "" "VPS13B(NM_017890.4):c.4337A>G (p.H1446R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000721679" "0" "30" "8" "100568663" "100568663" "subst" "0.00298803" "02330" "VPS13B_000241" "g.100568663T>C" "" "" "" "VPS13B(NM_017890.4):c.4821-15T>C, VPS13B(NM_017890.5):c.4821-15T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721680" "0" "30" "8" "100568664" "100568664" "subst" "0.00180738" "02330" "VPS13B_000242" "g.100568664C>T" "" "" "" "VPS13B(NM_017890.4):c.4821-14C>T, VPS13B(NM_017890.5):c.4821-14C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721681" "0" "50" "8" "100589851" "100589851" "subst" "0" "02329" "VPS13B_000369" "g.100589851A>G" "" "" "" "VPS13B(NM_017890.5):c.5285A>G (p.K1762R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000721682" "0" "30" "8" "100654320" "100654320" "subst" "8.96393E-5" "02326" "COX6C_000151" "g.100654320G>A" "" "" "" "VPS13B(NM_017890.4):c.5577G>A (p.S1859=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721683" "0" "30" "8" "100654424" "100654424" "subst" "0.00090241" "02330" "VPS13B_000249" "g.100654424C>T" "" "" "" "VPS13B(NM_017890.4):c.5681C>T (p.T1894M), VPS13B(NM_017890.5):c.5681C>T (p.T1894M), VPS13B(NM_152564.4):c.5606C>T (p.(Thr1869Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721684" "0" "30" "8" "100654425" "100654425" "subst" "0.000117884" "02330" "COX6C_000051" "g.100654425G>A" "" "" "" "VPS13B(NM_017890.4):c.5682G>A (p.T1894=), VPS13B(NM_017890.5):c.5682G>A (p.T1894=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721685" "0" "50" "8" "100654559" "100654559" "subst" "0.000560643" "02329" "VPS13B_000252" "g.100654559G>A" "" "" "" "VPS13B(NM_017890.5):c.5816G>A (p.R1939Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000721686" "0" "30" "8" "100654579" "100654579" "subst" "4.0625E-6" "01943" "COX6C_000105" "g.100654579A>G" "" "" "" "VPS13B(NM_017890.4):c.5836A>G (p.T1946A), VPS13B(NM_152564.5):c.5761A>G (p.(Thr1921Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721687" "0" "50" "8" "100654720" "100654720" "subst" "0" "02330" "VPS13B_000254" "g.100654720T>C" "" "" "" "VPS13B(NM_017890.4):c.5977T>C (p.(Cys1993Arg)), VPS13B(NM_017890.5):c.5977T>C (p.C1993R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000721688" "0" "30" "8" "100654723" "100654723" "subst" "0.0015341" "02330" "VPS13B_000255" "g.100654723A>G" "" "" "" "VPS13B(NM_017890.4):c.5980A>G (p.I1994V), VPS13B(NM_017890.5):c.5980A>G (p.I1994V), VPS13B(NM_152564.4):c.5905A>G (p.(Ile1969Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721689" "0" "30" "8" "100673568" "100673568" "subst" "5.6949E-5" "02330" "COX6C_000152" "g.100673568T>C" "" "" "" "VPS13B(NM_017890.5):c.5984-14T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721690" "0" "10" "8" "100711871" "100711871" "subst" "0" "02330" "COX6C_000153" "g.100711871A>G" "" "" "" "VPS13B(NM_017890.5):c.6240A>G (p.E2080=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000721691" "0" "30" "8" "100712122" "100712122" "subst" "0.000868169" "02330" "COX6C_000054" "g.100712122A>G" "" "" "" "VPS13B(NM_017890.4):c.6491A>G (p.N2164S), VPS13B(NM_017890.5):c.6491A>G (p.N2164S), VPS13B(NM_152564.4):c.6416A>G (p.(Asn2139Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721692" "0" "30" "8" "100712179" "100712179" "del" "0" "02330" "COX6C_000154" "g.100712179del" "" "" "" "VPS13B(NM_017890.5):c.6529+19delG" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721693" "0" "10" "8" "100732560" "100732560" "subst" "0.000192484" "02330" "COX6C_000155" "g.100732560T>A" "" "" "" "VPS13B(NM_017890.5):c.6733-13T>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000721694" "0" "10" "8" "100779103" "100779103" "subst" "0.0039931" "02330" "VPS13B_000276" "g.100779103G>A" "" "" "" "VPS13B(NM_017890.4):c.7227G>A (p.P2409=), VPS13B(NM_017890.5):c.7227G>A (p.P2409=), VPS13B(NM_152564.5):c.7152G>A (p.(Pro2384=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000721695" "0" "10" "8" "100791148" "100791148" "subst" "1.628E-5" "02330" "COX6C_000156" "g.100791148C>T" "" "" "" "VPS13B(NM_017890.5):c.7743C>T (p.S2581=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000721696" "0" "30" "8" "100791158" "100791158" "subst" "0.00319527" "02330" "VPS13B_000279" "g.100791158G>A" "" "" "" "VPS13B(NM_017890.4):c.7753G>A (p.E2585K, p.(Glu2585Lys)), VPS13B(NM_017890.5):c.7753G>A (p.E2585K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721697" "0" "50" "8" "100791192" "100791192" "subst" "0.000721277" "02330" "VPS13B_000283" "g.100791192C>T" "" "" "" "VPS13B(NM_017890.4):c.7787C>T (p.S2596F), VPS13B(NM_017890.5):c.7787C>T (p.S2596F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000721698" "0" "10" "8" "100821713" "100821713" "subst" "4.06775E-6" "02330" "COX6C_000157" "g.100821713T>C" "" "" "" "VPS13B(NM_017890.5):c.8127T>C (p.A2709=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000721699" "0" "30" "8" "100829841" "100829841" "subst" "0.00179875" "02330" "VPS13B_000287" "g.100829841A>G" "" "" "" "VPS13B(NM_017890.4):c.8246A>G (p.Y2749C), VPS13B(NM_017890.5):c.8246A>G (p.Y2749C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721700" "0" "10" "8" "100829914" "100829914" "subst" "0.000195376" "02330" "COX6C_000158" "g.100829914G>A" "" "" "" "VPS13B(NM_017890.5):c.8319G>A (p.S2773=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000721701" "0" "10" "8" "100830672" "100830672" "subst" "0" "02330" "COX6C_000159" "g.100830672T>C" "" "" "" "VPS13B(NM_017890.5):c.8437-7T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000721702" "0" "10" "8" "100831679" "100831679" "subst" "0.0001911" "02330" "COX6C_000160" "g.100831679A>G" "" "" "" "VPS13B(NM_017890.5):c.8736A>G (p.S2912=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000721703" "0" "50" "8" "100832259" "100832259" "subst" "0.00323142" "02330" "VPS13B_000108" "g.100832259A>G" "" "" "" "VPS13B(NM_017890.4):c.8978A>G (p.N2993S), VPS13B(NM_017890.5):c.8978A>G (p.N2993S), VPS13B(NM_152564.5):c.8903A>G (p.(Asn2968Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000721704" "0" "30" "8" "100833506" "100833506" "subst" "4.88703E-5" "02330" "COX6C_000161" "g.100833506G>A" "" "" "" "VPS13B(NM_017890.5):c.9070-16G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721705" "0" "30" "8" "100833726" "100833726" "subst" "3.25317E-5" "02330" "COX6C_000162" "g.100833726A>G" "" "" "" "VPS13B(NM_017890.5):c.9258+16A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721706" "0" "10" "8" "100836215" "100836215" "subst" "0.000640436" "02330" "VPS13B_000306" "g.100836215A>G" "" "" "" "VPS13B(NM_017890.4):c.9405+9A>G, VPS13B(NM_017890.5):c.9405+9A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000721707" "0" "10" "8" "100844570" "100844594" "dup" "0" "02330" "COX6C_000163" "g.100844570_100844594dup" "" "" "" "VPS13B(NM_017890.5):c.9406-27_9406-3dupTTTTTTTTTTTTTTTTTTTTTTTTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000721708" "0" "30" "8" "100844571" "100844594" "dup" "0" "02330" "COX6C_000164" "g.100844571_100844594dup" "" "" "" "VPS13B(NM_017890.5):c.9406-26_9406-3dupTTTTTTTTTTTTTTTTTTTTTTTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721709" "0" "30" "8" "100844572" "100844594" "dup" "0" "02330" "COX6C_000165" "g.100844572_100844594dup" "" "" "" "VPS13B(NM_017890.5):c.9406-25_9406-3dupTTTTTTTTTTTTTTTTTTTTTTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721710" "0" "10" "8" "100844573" "100844594" "dup" "0" "02330" "COX6C_000166" "g.100844573_100844594dup" "" "" "" "VPS13B(NM_017890.5):c.9406-24_9406-3dupTTTTTTTTTTTTTTTTTTTTTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000721711" "0" "10" "8" "100844574" "100844594" "dup" "0" "02330" "COX6C_000167" "g.100844574_100844594dup" "" "" "" "VPS13B(NM_017890.5):c.9406-23_9406-3dupTTTTTTTTTTTTTTTTTTTTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000721712" "0" "30" "8" "100844575" "100844594" "dup" "0" "02330" "COX6C_000168" "g.100844575_100844594dup" "" "" "" "VPS13B(NM_017890.5):c.9406-22_9406-3dupTTTTTTTTTTTTTTTTTTTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721713" "0" "30" "8" "100844579" "100844594" "dup" "0" "02330" "COX6C_000169" "g.100844579_100844594dup" "" "" "" "VPS13B(NM_017890.5):c.9406-18_9406-3dupTTTTTTTTTTTTTTTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721714" "0" "10" "8" "100844587" "100844594" "del" "0" "02330" "COX6C_000170" "g.100844587_100844594del" "" "" "" "VPS13B(NM_017890.5):c.9406-10_9406-3delTTTTTTTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000721715" "0" "10" "8" "100844594" "100844595" "ins" "0" "02330" "COX6C_000171" "g.100844594_100844595insTTTTTTTTTTTTTTTTTTTTTTTTTTT" "" "" "" "VPS13B(NM_017890.5):c.9406-3_9406-2insTTTTTTTTTTTTTTTTTTTTTTTTTTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000721716" "0" "30" "8" "100844605" "100844605" "subst" "1.40617E-5" "01943" "COX6C_000172" "g.100844605T>A" "" "" "" "VPS13B(NM_017890.4):c.9414T>A (p.R3138=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721717" "0" "30" "8" "100844858" "100844858" "subst" "0.00366803" "02330" "VPS13B_000316" "g.100844858C>T" "" "" "" "VPS13B(NM_017890.4):c.9667C>T (p.R3223W), VPS13B(NM_017890.5):c.9667C>T (p.R3223W), VPS13B(NM_152564.4):c.9592C>T (p.(Arg3198Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721718" "0" "10" "8" "100844899" "100844899" "subst" "0" "02330" "COX6C_000173" "g.100844899A>G" "" "" "" "VPS13B(NM_017890.5):c.9689+19A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000721719" "0" "30" "8" "100847461" "100847461" "subst" "0" "02330" "COX6C_000174" "g.100847461G>A" "" "" "" "VPS13B(NM_017890.5):c.9726G>A (p.V3242=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721720" "0" "30" "8" "100847749" "100847749" "subst" "5.31428E-5" "02330" "COX6C_000175" "g.100847749C>G" "" "" "" "VPS13B(NM_017890.5):c.9818-18C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721721" "0" "30" "8" "100847927" "100847927" "subst" "0.000211606" "02330" "COX6C_000176" "g.100847927G>A" "" "" "" "VPS13B(NM_017890.5):c.9978G>A (p.E3326=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721722" "0" "30" "8" "100847978" "100847978" "subst" "0" "02330" "COX6C_000177" "g.100847978A>G" "" "" "" "VPS13B(NM_017890.5):c.10017+12A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721723" "0" "50" "8" "100866260" "100866260" "subst" "6.49788E-5" "02329" "VPS13B_000330" "g.100866260C>T" "" "" "" "VPS13B(NM_017890.5):c.10718C>T (p.T3573I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000721724" "0" "30" "8" "100866267" "100866267" "subst" "2.03115E-5" "02330" "COX6C_000178" "g.100866267C>T" "" "" "" "VPS13B(NM_017890.5):c.10725C>T (p.H3575=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721725" "0" "30" "8" "100866441" "100866441" "subst" "0.000305178" "02330" "COX6C_000107" "g.100866441C>T" "" "" "" "VPS13B(NM_017890.4):c.10899C>T (p.H3633=), VPS13B(NM_017890.5):c.10899C>T (p.H3633=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721726" "0" "30" "8" "100866444" "100866444" "subst" "0" "02330" "COX6C_000179" "g.100866444C>T" "" "" "" "VPS13B(NM_017890.5):c.10902C>T (p.A3634=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721727" "0" "10" "8" "100866504" "100866504" "del" "0" "02330" "COX6C_000180" "g.100866504del" "" "" "" "VPS13B(NM_017890.5):c.10942+20delG" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000721728" "0" "70" "8" "100871568" "100871568" "del" "0" "02330" "COX6C_000118" "g.100871568del" "" "" "" "VPS13B(NM_017890.4):c.10979del (p.(Pro3660LeufsTer5)), VPS13B(NM_017890.5):c.10979delC (p.P3660Lfs*5)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000721729" "0" "30" "8" "100871569" "100871569" "subst" "0.00077158" "02330" "COX6C_000085" "g.100871569T>C" "" "" "" "VPS13B(NM_017890.4):c.10980T>C (p.P3660=), VPS13B(NM_017890.5):c.10980T>C (p.P3660=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721730" "0" "10" "8" "100871572" "100871572" "subst" "4.06068E-6" "02330" "COX6C_000181" "g.100871572A>C" "" "" "" "VPS13B(NM_017890.4):c.10983A>C (p.A3661=), VPS13B(NM_017890.5):c.10983A>C (p.A3661=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000721731" "0" "30" "8" "100871713" "100871713" "subst" "4.49567E-5" "02330" "COX6C_000086" "g.100871713C>T" "" "" "" "VPS13B(NM_017890.5):c.11119+5C>T, VPS13B(NM_152564.4):c.11044+5C>T (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721732" "0" "30" "8" "100874030" "100874030" "subst" "0.00241312" "02330" "VPS13B_000161" "g.100874030G>A" "" "" "" "VPS13B(NM_017890.4):c.11146G>A (p.A3716T, p.(Ala3716Thr)), VPS13B(NM_017890.5):c.11146G>A (p.A3716T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721733" "0" "30" "8" "100874154" "100874154" "subst" "0.00185926" "02330" "VPS13B_000338" "g.100874154G>A" "" "" "" "VPS13B(NM_017890.4):c.11270G>A (p.R3757Q, p.(Arg3757Gln)), VPS13B(NM_017890.5):c.11270G>A (p.R3757Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721734" "0" "30" "8" "100880545" "100880545" "subst" "5.68491E-5" "02330" "COX6C_000182" "g.100880545G>C" "" "" "" "VPS13B(NM_017890.5):c.11319G>C (p.P3773=), VPS13B(NM_152564.5):c.11244G>C (p.(Pro3748=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721735" "0" "10" "8" "100883793" "100883793" "subst" "0.000690406" "02330" "VPS13B_000344" "g.100883793C>T" "" "" "" "VPS13B(NM_017890.4):c.11688C>T (p.F3896=), VPS13B(NM_017890.5):c.11688C>T (p.F3896=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000721736" "0" "30" "8" "100883847" "100883847" "subst" "0.00011778" "02330" "COX6C_000183" "g.100883847C>T" "" "" "" "VPS13B(NM_017890.4):c.11742C>T (p.I3914=), VPS13B(NM_017890.5):c.11742C>T (p.I3914=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721737" "0" "50" "8" "100887650" "100887652" "dup" "0" "01943" "VPS13B_000134" "g.100887650_100887652dup" "" "" "" "VPS13B(NM_017890.4):c.11825_11827dupATG (p.D3942dup), VPS13B(NM_017890.5):c.11825_11827dupATG (p.D3942dup), VPS13B(NM_152564.4):c.11750_11752dupATG..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000721738" "0" "30" "8" "100887752" "100887752" "subst" "0.000146215" "02330" "COX6C_000184" "g.100887752T>C" "" "" "" "VPS13B(NM_017890.5):c.11927T>C (p.I3976T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721739" "0" "30" "8" "100887784" "100887784" "subst" "0.000832508" "02330" "COX6C_000109" "g.100887784C>G" "" "" "" "VPS13B(NM_017890.4):c.11959C>G (p.P3987A), VPS13B(NM_017890.5):c.11959C>G (p.P3987A), VPS13B(NM_152564.5):c.11884C>G (p.(Pro3962Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721740" "0" "30" "8" "100887909" "100887912" "dup" "0" "02330" "COX6C_000185" "g.100887909_100887912dup" "" "" "" "VPS13B(NM_017890.5):c.*15_*18dupGTTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000730345" "3" "90" "8" "100147910" "100147910" "del" "0" "00000" "VPS13B_000386" "g.100147910del" "" "{PMID:Sanchez-Navarro 2018:29588463}" "" "" "" "Germline" "" "" "0" "" "" "g.99135682del" "" "pathogenic (recessive)" "" "0000733343" "1" "70" "8" "100160140" "100160140" "subst" "1.21922E-5" "00000" "VPS13B_000387" "g.100160140C>T" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.99147912C>T" "" "likely pathogenic" "" "0000733344" "3" "70" "8" "0" "0" "" "0" "00000" "RP1_000000" "g.?" "" "{PMID:Stone 2017:28559085}" "" "del ex8" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000733345" "1" "70" "8" "100865899" "100865899" "del" "0" "00000" "VPS13B_000388" "g.100865899del" "" "{PMID:Stone 2017:28559085}" "" "10357delC" "" "Germline" "" "" "0" "" "" "g.99853671del" "" "likely pathogenic" "" "0000733722" "2" "70" "8" "0" "0" "" "0" "00000" "RP1_000000" "g.?" "" "{PMID:Stone 2017:28559085}" "" "del ex17-19" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000733723" "2" "70" "8" "100454804" "100454804" "subst" "0.00464668" "00000" "VPS13B_000224" "g.100454804A>G" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.99442576A>G" "" "likely pathogenic" "" "0000736858" "0" "50" "8" "100831776" "100831777" "ins" "8.14219E-6" "00000" "VPS13B_000389" "g.100831776_100831777insGAA" "2/486 individuals" "{PMID:Sergouniotis 2016:27628848}" "" "" "no genotypes reported" "Germline" "" "rs758685660" "0" "" "" "g.99819548_99819549insGAA" "" "VUS" "" "0000759977" "0" "50" "8" "100832259" "100832259" "subst" "0.00323142" "00000" "VPS13B_000108" "g.100832259A>G" "" "{PMID:Tiwari 2016:27353947}" "" "" "" "Germline" "" "" "0" "" "" "g.99820031A>G" "" "VUS" "" "0000760054" "0" "50" "8" "100515183" "100515183" "subst" "1.63819E-5" "00000" "VPS13B_000390" "g.100515183A>G" "" "{PMID:Tiwari 2016:27353947}" "" "" "" "Germline" "" "" "0" "" "" "g.99502955A>G" "" "VUS" "" "0000760066" "0" "50" "8" "100454804" "100454804" "subst" "0.00464668" "00000" "VPS13B_000224" "g.100454804A>G" "" "{PMID:Tiwari 2016:27353947}" "" "" "" "Germline" "" "" "0" "" "" "g.99442576A>G" "" "VUS" "" "0000763266" "3" "70" "8" "100654601" "100654601" "subst" "0" "00006" "VPS13B_000391" "g.100654601C>T" "" "{PMID:Anazi 2017:27431290}" "" "NM_152564.4:c.5783C>T" "ACMG PM2, PP1, PP2, PP3, PP4" "Germline" "" "" "0" "" "" "g.99642373C>T" "" "likely pathogenic" "ACMG" "0000764672" "1" "70" "8" "100147902" "100147902" "subst" "1.21986E-5" "00006" "VPS13B_000025" "g.100147902C>T" "" "{PMID:Tsangaris 2011:21659346}" "" "" "" "Germline" "" "" "0" "" "" "g.99135674C>T" "" "likely pathogenic (recessive)" "" "0000764752" "2" "70" "8" "100729602" "100729602" "subst" "3.25751E-5" "00006" "VPS13B_000081" "g.100729602G>A" "" "{PMID:Tsangaris 2011:21659346}" "" "" "" "Germline" "" "" "0" "" "" "g.99717374G>A" "" "likely pathogenic (recessive)" "" "0000786342" "1" "90" "8" "100729602" "100729602" "subst" "3.25751E-5" "00000" "VPS13B_000081" "g.100729602G>A" "" "{PMID:Zhao 2015:25472526}" "" "" "" "Germline" "" "" "0" "" "" "g.99717374G>A" "" "pathogenic" "" "0000786388" "2" "90" "8" "100883853" "100883854" "del" "0" "00000" "VPS13B_000392" "g.100883853_100883854del" "" "{PMID:Zhao 2015:25472526}" "" "" "" "Germline" "" "" "0" "" "" "g.99871625_99871626del" "" "pathogenic" "" "0000803331" "0" "30" "8" "100147234" "100147234" "subst" "4.47274E-5" "02326" "COX6C_000098" "g.100147234G>A" "" "" "" "VPS13B(NM_017890.4):c.1303-9G>A, VPS13B(NM_017890.5):c.1303-9G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000803332" "0" "50" "8" "100147957" "100147957" "subst" "0.000569536" "02325" "VPS13B_000192" "g.100147957A>G" "" "" "" "VPS13B(NM_015243.2):c.1559A>G (p.(His520Arg)), VPS13B(NM_017890.4):c.1559A>G (p.H520R), VPS13B(NM_017890.5):c.1559A>G (p.H520R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000803333" "0" "30" "8" "100155403" "100155403" "subst" "0.000101645" "01943" "VPS13B_000393" "g.100155403T>C" "" "" "" "VPS13B(NM_017890.4):c.1843+10T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000803334" "0" "10" "8" "100182403" "100182403" "subst" "0.000122268" "02330" "VPS13B_000394" "g.100182403A>T" "" "" "" "VPS13B(NM_017890.5):c.2333+12A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000803335" "0" "30" "8" "100182411" "100182411" "subst" "2.04185E-5" "02326" "COX6C_000186" "g.100182411A>G" "" "" "" "VPS13B(NM_017890.4):c.2333+20A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000803336" "0" "30" "8" "100205126" "100205126" "subst" "0.000187229" "02330" "COX6C_000115" "g.100205126A>G" "" "" "" "VPS13B(NM_017890.4):c.2356A>G (p.I786V), VPS13B(NM_017890.5):c.2356A>G (p.I786V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000803337" "0" "50" "8" "100221865" "100221865" "subst" "0" "02330" "VPS13B_000395" "g.100221865C>G" "" "" "" "VPS13B(NM_015243.3):c.2561C>G (p.A854G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000803338" "0" "10" "8" "100221866" "100221866" "subst" "0" "02330" "VPS13B_000396" "g.100221866C>A" "" "" "" "VPS13B(NM_015243.3):c.2562C>A (p.A854=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000803339" "0" "50" "8" "100287362" "100287362" "subst" "0.000731993" "02325" "VPS13B_000211" "g.100287362A>G" "" "" "" "VPS13B(NM_017890.4):c.2704A>G (p.K902E), VPS13B(NM_017890.5):c.2704A>G (p.K902E), VPS13B(NM_152564.5):c.2704A>G (p.(Lys902Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000803340" "0" "30" "8" "100443832" "100443832" "subst" "1.62897E-5" "01943" "VPS13B_000397" "g.100443832A>G" "" "" "" "VPS13B(NM_017890.4):c.3150A>G (p.E1050=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000803341" "0" "30" "8" "100443886" "100443886" "subst" "8.16373E-6" "01943" "VPS13B_000398" "g.100443886A>G" "" "" "" "VPS13B(NM_017890.4):c.3204A>G (p.T1068=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000803342" "0" "30" "8" "100515185" "100515185" "subst" "0" "02326" "COX6C_000187" "g.100515185A>G" "" "" "" "VPS13B(NM_017890.4):c.4157+7A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000803343" "0" "70" "8" "100520086" "100520086" "subst" "4.06375E-5" "01943" "VPS13B_000399" "g.100520086C>T" "" "" "" "VPS13B(NM_017890.4):c.4246C>T (p.R1416*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000803344" "0" "30" "8" "100523762" "100523762" "dup" "0" "02330" "VPS13B_000400" "g.100523762dup" "" "" "" "VPS13B(NM_017890.5):c.4708+22dupT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000803345" "0" "50" "8" "100587890" "100587890" "subst" "2.03186E-5" "01943" "VPS13B_000401" "g.100587890C>T" "" "" "" "VPS13B(NM_017890.4):c.5029C>T (p.R1677W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000803346" "0" "30" "8" "100587926" "100587926" "subst" "8.12625E-6" "02330" "VPS13B_000402" "g.100587926G>A" "" "" "" "VPS13B(NM_017890.5):c.5065G>A (p.V1689I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000803347" "0" "30" "8" "100654708" "100654708" "subst" "5.71989E-5" "02330" "VPS13B_000403" "g.100654708T>C" "" "" "" "VPS13B(NM_017890.5):c.5965T>C (p.S1989P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000803348" "0" "50" "8" "100711810" "100711810" "subst" "0" "01943" "VPS13B_000404" "g.100711810T>C" "" "" "" "VPS13B(NM_017890.4):c.6179T>C (p.L2060P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000803349" "0" "50" "8" "100789121" "100789121" "subst" "0.000174707" "01943" "VPS13B_000405" "g.100789121G>A" "" "" "" "VPS13B(NM_017890.4):c.7441G>A (p.V2481I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000803350" "0" "30" "8" "100790926" "100790926" "subst" "0" "02326" "COX6C_000188" "g.100790926A>G" "" "" "" "VPS13B(NM_017890.4):c.7521A>G (p.L2507=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000803351" "0" "30" "8" "100831065" "100831065" "subst" "0.00113322" "02330" "VPS13B_000294" "g.100831065C>T" "" "" "" "VPS13B(NM_017890.4):c.8645C>T (p.P2882L), VPS13B(NM_017890.5):c.8645C>T (p.P2882L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000803352" "0" "50" "8" "100833658" "100833658" "subst" "0.000142291" "01943" "VPS13B_000406" "g.100833658A>C" "" "" "" "VPS13B(NM_017890.4):c.9206A>C (p.E3069A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000803353" "0" "30" "8" "100836189" "100836189" "subst" "9.38691E-5" "01943" "VPS13B_000407" "g.100836189C>A" "" "" "" "VPS13B(NM_017890.4):c.9388C>A (p.P3130T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000803354" "0" "30" "8" "100844858" "100844858" "subst" "4.07106E-6" "01943" "VPS13B_000408" "g.100844858C>A" "" "" "" "VPS13B(NM_017890.4):c.9667C>A (p.R3223=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000803355" "0" "30" "8" "100847440" "100847440" "subst" "0" "01943" "VPS13B_000409" "g.100847440A>G" "" "" "" "VPS13B(NM_017890.4):c.9705A>G (p.T3235=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000803356" "0" "30" "8" "100861113" "100861113" "subst" "0.00049149" "01943" "VPS13B_000410" "g.100861113A>T" "" "" "" "VPS13B(NM_017890.4):c.10127A>T (p.N3376I), VPS13B(NM_017890.5):c.10127A>T (p.N3376I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000803357" "0" "50" "8" "100865746" "100865746" "subst" "5.68606E-5" "01943" "VPS13B_000411" "g.100865746C>T" "" "" "" "VPS13B(NM_017890.4):c.10204C>T (p.L3402F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000803358" "0" "30" "8" "100871569" "100871569" "subst" "0.00077158" "02326" "COX6C_000085" "g.100871569T>C" "" "" "" "VPS13B(NM_017890.4):c.10980T>C (p.P3660=), VPS13B(NM_017890.5):c.10980T>C (p.P3660=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000803359" "0" "30" "8" "100874154" "100874154" "subst" "0.00185926" "02325" "VPS13B_000338" "g.100874154G>A" "" "" "" "VPS13B(NM_017890.4):c.11270G>A (p.R3757Q, p.(Arg3757Gln)), VPS13B(NM_017890.5):c.11270G>A (p.R3757Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000803360" "0" "30" "8" "100883847" "100883847" "subst" "0.00011778" "01943" "COX6C_000183" "g.100883847C>T" "" "" "" "VPS13B(NM_017890.4):c.11742C>T (p.I3914=), VPS13B(NM_017890.5):c.11742C>T (p.I3914=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000803361" "0" "30" "8" "100883895" "100883895" "subst" "5.28129E-5" "02330" "VPS13B_000347" "g.100883895C>A" "" "" "" "VPS13B(NM_017890.4):c.11790C>A (p.L3930=), VPS13B(NM_017890.5):c.11790C>A (p.L3930=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000803362" "0" "30" "8" "100887687" "100887687" "subst" "0.000369973" "01943" "VPS13B_000412" "g.100887687C>T" "" "" "" "VPS13B(NM_017890.4):c.11862C>T (p.N3954=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000811972" "3" "70" "8" "100654235" "100654235" "dup" "0" "00000" "VPS13B_000413" "g.100654235dup" "" "{PMID:Abu Diab 2019:30925032}" "" "c.5492dup, p.(Asn1831Lysfs*8)" "homozygous, different transcript version: NM_017890.4 instead of NM_017890.3" "Germline" "yes" "" "0" "" "" "g.99642007dup" "" "likely pathogenic" "" "0000811973" "3" "70" "8" "100654235" "100654235" "dup" "0" "00000" "VPS13B_000413" "g.100654235dup" "" "{PMID:Abu Diab 2019:30925032}" "" "c.5492dup, p.(Asn1831Lysfs*8)" "homozygous, different transcript version: NM_017890.4 instead of NM_017890.4" "Germline" "yes" "" "0" "" "" "g.99642007dup" "" "likely pathogenic" "" "0000813884" "0" "70" "8" "100115236" "100115239" "del" "0" "00000" "VPS13B_000414" "g.100115236_100115239del" "" "{PMID:Jiman 2020:31836858}" "" "VPS13B;NM_017890.4;;c.[468_471del];[10156dup];p.[(Asn157Serfs*3)];[(Thr3386Asnfs*3)]" "compound heterozygous" "Unknown" "?" "" "0" "" "" "g.99103008_99103011del" "" "likely pathogenic" "" "0000813885" "0" "70" "8" "100865698" "100865698" "dup" "0" "00000" "VPS13B_000117" "g.100865698dup" "" "{PMID:Jiman 2020:31836858}" "" "VPS13B;NM_017890.4;c.[468_471del];[10156dup];p.[(Asn157Serfs*3)];[(Thr3386Asnfs*3)]" "compound heterozygous" "Unknown" "?" "" "0" "" "" "g.99853470dup" "" "likely pathogenic" "" "0000817740" "3" "90" "8" "100732719" "100732719" "del" "0" "00006" "VPS13B_000416" "g.100732719del" "" "{PMID:Hu 2019:29302074}" "" "" "" "Germline" "" "" "0" "" "" "g.99720491del" "" "pathogenic (recessive)" "ACMG" "0000817765" "3" "90" "8" "100832347" "100832380" "delins" "0" "00006" "VPS13B_000418" "g.100832347_100832380delinsC" "" "{PMID:Hu 2019:29302074}" "" "" "" "Germline" "" "" "0" "" "" "g.99820119_99820152delinsC" "" "pathogenic (recessive)" "ACMG" "0000817785" "3" "90" "8" "100732719" "100732719" "del" "0" "00006" "VPS13B_000416" "g.100732719del" "" "{PMID:Hu 2019:29302074}" "" "" "" "Germline" "" "" "0" "" "" "g.99720491del" "" "pathogenic (recessive)" "ACMG" "0000817820" "3" "90" "8" "100832269" "100832269" "del" "0" "00006" "VPS13B_000417" "g.100832269del" "" "{PMID:Hu 2019:29302074}" "" "" "" "Germline" "" "" "0" "" "" "g.99820041del" "" "pathogenic (recessive)" "ACMG" "0000817823" "3" "90" "8" "100568867" "100568867" "subst" "0" "00006" "VPS13B_000415" "g.100568867G>A" "" "{PMID:Hu 2019:29302074}" "" "" "" "Germline" "" "" "0" "" "" "g.99556639G>A" "" "pathogenic (recessive)" "ACMG" "0000819411" "1" "70" "8" "100147961" "100147961" "subst" "4.06904E-6" "00000" "VPS13B_000026" "g.100147961G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "VPS13B, variant 1: c.1563G>A/p.?, variant 2 :Deletion exon 46-50" "solved, compound heterozygous" "Germline" "yes" "" "0" "" "" "g.99135733G>A" "" "likely pathogenic" "" "0000819899" "1" "70" "8" "100133446" "100133446" "subst" "0" "00000" "VPS13B_000419" "g.100133446C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "VPS13B, variant 1: c.979C>T/p.Q327*, variant 2: c.7753G>A/p.E2585K" "possibly solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.99121218C>T" "" "likely pathogenic" "" "0000819900" "1" "70" "8" "100133446" "100133446" "subst" "0" "00000" "VPS13B_000419" "g.100133446C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "VPS13B, variant 1: c.979C>T/p.Q327*, variant 2: c.7753G>A/p.E2585K" "possibly solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.99121218C>T" "" "likely pathogenic" "" "0000819960" "1" "70" "8" "100673653" "100673654" "del" "0" "00000" "VPS13B_000420" "g.100673653_100673654del" "" "{PMID:Weisschuh 2020:32531858}" "" "VPS13B, variant 1: c.6055_6056del/p.D2019Qfs*15, variant 2: c.6055_6056del/p.D2019Qfs*15" "solved, homozygous" "Unknown" "?" "" "0" "" "" "g.99661425_99661426del" "" "likely pathogenic" "" "0000819961" "1" "70" "8" "100673653" "100673654" "del" "0" "00000" "VPS13B_000420" "g.100673653_100673654del" "" "{PMID:Weisschuh 2020:32531858}" "" "VPS13B, variant 1: c.6055_6056del/p.D2019Qfs*15, variant 2: c.6055_6056del/p.D2019Qfs*15" "solved, homozygous" "Unknown" "?" "" "0" "" "" "g.99661425_99661426del" "" "likely pathogenic" "" "0000820220" "1" "70" "8" "100821698" "100821698" "subst" "0" "00000" "VPS13B_000421" "g.100821698C>G" "" "{PMID:Weisschuh 2020:32531858}" "" "VPS13B, variant 1: c.8112C>G/p.Y2704*, variant 2: c.8112C>G/p.Y2704*" "solved, homozygous" "Unknown" "?" "" "0" "" "" "g.99809470C>G" "" "likely pathogenic" "" "0000820637" "1" "70" "8" "0" "0" "" "0" "00000" "RP1_000000" "g.?" "" "{PMID:Weisschuh 2020:32531858}" "" "VPS13B, variant 1: c.1563G>A/p.?, variant 2 :Deletion exon 46-50" "solved, compound heterozygous" "Germline" "yes" "" "0" "" "" "g.?" "" "likely pathogenic" "" "0000820753" "1" "70" "8" "100791158" "100791158" "subst" "0.00319527" "00000" "VPS13B_000279" "g.100791158G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "VPS13B, variant 1: c.979C>T/p.Q327*, variant 2: c.7753G>A/p.E2585K" "possibly solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.99778930G>A" "" "likely pathogenic" "" "0000820754" "1" "70" "8" "100791158" "100791158" "subst" "0.00319527" "00000" "VPS13B_000279" "g.100791158G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "VPS13B, variant 1: c.979C>T/p.Q327*, variant 2: c.7753G>A/p.E2585K" "possibly solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.99778930G>A" "" "likely pathogenic" "" "0000827622" "21" "90" "8" "0" "0" "" "0" "00000" "RP1_000000" "g.?" "" "{PMID:Kim 2021:33946315}" "" "VPS13B c.7220_7221A, p.(?)" "error in annotation, actual variant unknown, heterozygous" "Germline" "yes" "" "0" "" "" "g.?" "" "pathogenic" "ACMG" "0000827628" "0" "50" "8" "100883013" "100883013" "subst" "0" "00000" "VPS13B_000422" "g.100883013G>C" "" "{PMID:Kim 2021:33946315}" "" "VPS13B c.11468G>C, p.(Gly3823Ala)" "heterozygous" "Unknown" "?" "" "0" "" "" "g.99870785G>C" "" "VUS" "ACMG" "0000828514" "0" "70" "8" "100832156" "100832156" "subst" "0" "00000" "VPS13B_000423" "g.100832156C>T" "" "{PMID:Perea-Romero 2021:34448047}" "" "VPS13B, c.8875C>T, p.Gln2959*, compound heterozygous" "" "Unknown" "?" "" "0" "" "" "g.99819928C>T" "" "likely pathogenic" "ACMG" "0000828515" "0" "70" "8" "100865978" "100865981" "del" "0" "00000" "VPS13B_000424" "g.100865978_100865981del" "" "{PMID:Perea-Romero 2021:34448047}" "" "VPS13B, c.10436_10439delTTCA, p.Ile3479Serfs*30, compound heterozygous" "" "Unknown" "?" "" "0" "" "" "g.99853750_99853753del" "" "likely pathogenic" "ACMG" "0000828540" "1" "70" "8" "100883703" "100883703" "del" "0" "00000" "VPS13B_000131" "g.100883703del" "" "{PMID:Perea-Romero 2021:34448047}" "" "VPS13B, c.11598delA, p.Glu3867Lysfs*11, compound heterozygous" "" "Germline" "yes" "" "0" "" "" "g.99871475del" "" "likely pathogenic" "ACMG" "0000828541" "2" "70" "8" "100146901" "100146901" "subst" "0.00118075" "00000" "COX6C_000009" "g.100146901G>T" "" "{PMID:Perea-Romero 2021:34448047}" "" "VPS13B, c.1248G>T, p.Gln416His, compound heterozygous" "" "Germline" "yes" "" "0" "" "" "g.99134673G>T" "" "likely pathogenic" "ACMG" "0000829759" "1" "70" "8" "100026016" "100128103" "del" "0" "00006" "VPS13B_000425" "g.(?_100026016)_(100128103_100133404)del" "" "{PMID:Ellingford 2017:28378820}" "" "g.100025966_100128152del" "" "Germline" "" "" "0" "" "" "g.(?_99013788)_(99115875_99121176)del" "" "likely pathogenic" "" "0000829760" "1" "70" "8" "100673581" "100733276" "del" "0" "00006" "VPS13B_000426" "g.(100654727_100673581)_(100733276_100779001)del" "" "{PMID:Ellingford 2017:28378820}" "" "g.100673531_100733325del" "" "Germline" "" "" "0" "" "" "g.(99642499_99661353)_(99721048_99766773)del" "" "likely pathogenic" "" "0000851736" "0" "70" "8" "100050795" "100050795" "subst" "0" "01943" "COX6C_000189" "g.100050795G>A" "" "" "" "VPS13B(NM_017890.4):c.291+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000851737" "0" "50" "8" "100123329" "100123329" "subst" "4.15901E-6" "01943" "COX6C_000127" "g.100123329C>G" "" "" "" "VPS13B(NM_017890.4):c.584C>G (p.T195S), VPS13B(NM_017890.5):c.584C>G (p.T195S), VPS13B(NM_152564.5):c.584C>G (p.(Thr195Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000851738" "0" "30" "8" "100160089" "100160089" "subst" "1.33791E-5" "01943" "COX6C_000135" "g.100160089A>G" "" "" "" "VPS13B(NM_017890.4):c.1864A>G (p.T622A), VPS13B(NM_017890.5):c.1864A>G (p.T622A), VPS13B(NM_152564.5):c.1864A>G (p.(Thr622Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000851739" "0" "90" "8" "100182322" "100182322" "subst" "0" "02330" "COX6C_000191" "g.100182322T>A" "" "" "" "VPS13B(NM_017890.5):c.2264T>A (p.L755*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000851740" "0" "30" "8" "100205203" "100205203" "subst" "3.25328E-5" "02330" "COX6C_000192" "g.100205203A>T" "" "" "" "VPS13B(NM_017890.5):c.2433A>T (p.I811=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000851741" "0" "30" "8" "100205240" "100205240" "subst" "0.000158549" "02326" "VPS13B_000156" "g.100205240T>G" "" "" "" "VPS13B(NM_017890.4):c.2470T>G (p.S824A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000851742" "0" "30" "8" "100443756" "100443756" "subst" "0.000175056" "01943" "COX6C_000194" "g.100443756C>T" "" "" "" "VPS13B(NM_017890.4):c.3083-9C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000851743" "0" "30" "8" "100454751" "100454751" "subst" "3.65869E-5" "02330" "COX6C_000195" "g.100454751G>A" "" "" "" "VPS13B(NM_017890.5):c.3333G>A (p.P1111=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000851744" "0" "30" "8" "100454760" "100454760" "subst" "0" "02330" "COX6C_000196" "g.100454760T>G" "" "" "" "VPS13B(NM_017890.5):c.3342T>G (p.L1114=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000851745" "0" "30" "8" "100711754" "100711754" "subst" "5.29161E-5" "01943" "COX6C_000199" "g.100711754G>A" "" "" "" "VPS13B(NM_017890.4):c.6123G>A (p.A2041=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000851746" "0" "30" "8" "100791127" "100791127" "subst" "0.000138347" "02330" "COX6C_000121" "g.100791127C>T" "" "" "" "VPS13B(NM_017890.4):c.7722C>T (p.F2574=), VPS13B(NM_017890.5):c.7722C>T (p.F2574=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000851747" "0" "30" "8" "100844594" "100844595" "ins" "0" "02330" "COX6C_000203" "g.100844594_100844595insTTTTTTTTTTTTTTTTTTTTTTTTTT" "" "" "" "VPS13B(NM_017890.5):c.9406-3_9406-2insTTTTTTTTTTTTTTTTTTTTTTTTTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000851748" "0" "30" "8" "100865752" "100865752" "subst" "2.0308E-5" "01943" "COX6C_000204" "g.100865752C>T" "" "" "" "VPS13B(NM_017890.4):c.10210C>T (p.H3404Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000851749" "0" "50" "8" "100866185" "100866185" "subst" "0.000174609" "01943" "VPS13B_000329" "g.100866185A>G" "" "" "" "VPS13B(NM_017890.4):c.10643A>G (p.Y3548C), VPS13B(NM_017890.5):c.10643A>G (p.Y3548C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000851750" "0" "50" "8" "100874058" "100874058" "subst" "0" "01943" "COX6C_000205" "g.100874058G>A" "" "" "" "VPS13B(NM_017890.4):c.11174G>A (p.R3725Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000851751" "0" "30" "8" "100880701" "100880701" "subst" "0.000582312" "02330" "COX6C_000125" "g.100880701G>A" "" "" "" "VPS13B(NM_017890.4):c.11467+8G>A, VPS13B(NM_017890.5):c.11467+8G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000851752" "0" "50" "8" "100887785" "100887785" "subst" "1.21831E-5" "01943" "COX6C_000207" "g.100887785C>A" "" "" "" "VPS13B(NM_017890.4):c.11960C>A (p.P3987H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000860985" "0" "50" "8" "100108576" "100108576" "subst" "5.28305E-5" "01943" "COX6C_000190" "g.100108576C>T" "" "" "" "VPS13B(NM_017890.4):c.328C>T (p.R110C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000860986" "0" "30" "8" "100123316" "100123316" "subst" "0" "01943" "COX6C_000110" "g.100123316T>C" "" "" "" "VPS13B(NM_017890.4):c.581-10T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000860987" "0" "30" "8" "100133508" "100133508" "subst" "0.000515946" "02330" "VPS13B_000366" "g.100133508A>G" "" "" "" "VPS13B(NM_017890.4):c.1041A>G (p.S347=), VPS13B(NM_017890.5):c.1041A>G (p.S347=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000860988" "0" "30" "8" "100146946" "100146946" "subst" "0.00320252" "02326" "VPS13B_000188" "g.100146946T>G" "" "" "" "VPS13B(NM_017890.4):c.1293T>G (p.T431=), VPS13B(NM_152564.5):c.1293T>G (p.(Thr431=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000860989" "0" "30" "8" "100147861" "100147861" "subst" "0.000549263" "02330" "VPS13B_000191" "g.100147861C>T" "" "" "" "VPS13B(NM_015243.2):c.1463C>T (p.(Thr488Met)), VPS13B(NM_017890.5):c.1463C>T (p.T488M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000860990" "0" "50" "8" "100287465" "100287465" "subst" "0" "01943" "COX6C_000193" "g.100287465A>T" "" "" "" "VPS13B(NM_017890.4):c.2807A>T (p.D936V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000860991" "0" "30" "8" "100479712" "100479712" "subst" "0.000890418" "02329" "VPS13B_000368" "g.100479712A>G" "" "" "" "VPS13B(NM_017890.4):c.3516A>G (p.T1172=), VPS13B(NM_017890.5):c.3516A>G (p.T1172=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000860992" "0" "50" "8" "100523333" "100523333" "subst" "4.10526E-6" "01943" "COX6C_000197" "g.100523333C>A" "" "" "" "VPS13B(NM_017890.4):c.4301C>A (p.T1434K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000860993" "0" "30" "8" "100568671" "100568671" "subst" "7.79506E-5" "01943" "COX6C_000198" "g.100568671T>C" "" "" "" "VPS13B(NM_017890.4):c.4821-7T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000860994" "0" "30" "8" "100712159" "100712159" "subst" "0.000102306" "02330" "COX6C_000200" "g.100712159T>G" "" "" "" "VPS13B(NM_017890.5):c.6528T>G (p.P2176=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000860995" "0" "30" "8" "100729482" "100729482" "subst" "0" "01943" "COX6C_000201" "g.100729482A>C" "" "" "" "VPS13B(NM_017890.4):c.6613A>C (p.I2205L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000860996" "0" "30" "8" "100832136" "100832136" "subst" "2.84879E-5" "02326" "COX6C_000202" "g.100832136G>T" "" "" "" "VPS13B(NM_017890.4):c.8868-13G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000860997" "0" "30" "8" "100871721" "100871721" "subst" "0.00237611" "02326" "VPS13B_000335" "g.100871721G>A" "" "" "" "VPS13B(NM_017890.4):c.11119+13G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000860998" "0" "90" "8" "100883869" "100883869" "subst" "0" "01943" "COX6C_000206" "g.100883869C>T" "" "" "" "VPS13B(NM_017890.4):c.11764C>T (p.Q3922*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000888072" "0" "50" "8" "100108613" "100108613" "subst" "0.000329156" "02325" "COX6C_000208" "g.100108613C>T" "" "" "" "VPS13B(NM_017890.5):c.365C>T (p.P122L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000888073" "0" "90" "8" "100128066" "100128069" "del" "0" "02329" "VPS13B_000353" "g.100128066_100128069del" "" "" "" "VPS13B(NM_017890.5):c.901_904delACTT (p.T301Vfs*7)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000888074" "0" "30" "8" "100147838" "100147838" "subst" "0.00048848" "02326" "COX6C_000010" "g.100147838C>T" "" "" "" "VPS13B(NM_017890.4):c.1440C>T (p.F480=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000888075" "0" "10" "8" "100147934" "100147934" "subst" "0.00138255" "02330" "COX6C_000209" "g.100147934A>G" "" "" "" "VPS13B(NM_017890.5):c.1536A>G (p.E512=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000888076" "0" "10" "8" "100155332" "100155332" "subst" "0.00138547" "02330" "COX6C_000210" "g.100155332T>C" "" "" "" "VPS13B(NM_017890.5):c.1782T>C (p.I594=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000888077" "0" "10" "8" "100182333" "100182333" "subst" "0.0108938" "02330" "COX6C_000016" "g.100182333G>C" "" "" "" "VPS13B(NM_017890.4):c.2275G>C (p.V759L), VPS13B(NM_017890.5):c.2275G>C (p.V759L), VPS13B(NM_152564.5):c.2275G>C (p.(Val759Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000888078" "0" "30" "8" "100205221" "100205221" "subst" "0.00263843" "02326" "COX6C_000018" "g.100205221T>C" "" "" "" "VPS13B(NM_017890.4):c.2451T>C (p.H817=), VPS13B(NM_017890.5):c.2451T>C (p.H817=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000888079" "0" "30" "8" "100396491" "100396491" "subst" "0.000117918" "02326" "COX6C_000022" "g.100396491A>T" "" "" "" "VPS13B(NM_017890.4):c.2880A>T (p.L960F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000888080" "0" "10" "8" "100454618" "100454618" "subst" "0.00128074" "02330" "COX6C_000211" "g.100454618T>C" "" "" "" "VPS13B(NM_017890.5):c.3211-11T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000888081" "0" "30" "8" "100454715" "100454715" "subst" "0.000146271" "02326" "COX6C_000212" "g.100454715A>C" "" "" "" "VPS13B(NM_017890.4):c.3297A>C (p.T1099=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000888082" "0" "30" "8" "100520158" "100520158" "subst" "0" "02326" "COX6C_000213" "g.100520158T>C" "" "" "" "VPS13B(NM_017890.4):c.4299+19T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000888083" "0" "90" "8" "100523506" "100523506" "del" "0" "02326" "VPS13B_000055" "g.100523506del" "" "" "" "VPS13B(NM_017890.4):c.4474delA (p.I1492Ffs*43)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000888084" "0" "30" "8" "100711884" "100711884" "subst" "8.12955E-6" "02330" "COX6C_000214" "g.100711884A>G" "" "" "" "VPS13B(NM_017890.5):c.6253A>G (p.M2085V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000888085" "0" "30" "8" "100729395" "100729395" "del" "0" "02330" "VPS13B_000264" "g.100729395del" "" "" "" "VPS13B(NM_017890.4):c.6530-4delT, VPS13B(NM_017890.5):c.6530-4delT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000888086" "0" "10" "8" "100733202" "100733202" "subst" "0.00142307" "02330" "COX6C_000215" "g.100733202G>A" "" "" "" "VPS13B(NM_017890.4):c.7052G>A (p.R2351Q), VPS13B(NM_017890.5):c.7052G>A (p.R2351Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000888087" "0" "70" "8" "100733273" "100733273" "subst" "4.06964E-6" "02330" "COX6C_000216" "g.100733273C>T" "" "" "" "VPS13B(NM_017890.5):c.7123C>T (p.Q2375*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000888088" "0" "90" "8" "100733276" "100733276" "subst" "0" "02327" "COX6C_000056" "g.100733276G>T" "" "" "" "VPS13B(NM_017890.4):c.7125+1G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000888089" "0" "10" "8" "100789093" "100789093" "subst" "0.00100757" "02330" "COX6C_000217" "g.100789093T>C" "" "" "" "VPS13B(NM_017890.5):c.7413T>C (p.F2471=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000888090" "0" "30" "8" "100861113" "100861113" "subst" "0.00049149" "02330" "VPS13B_000410" "g.100861113A>T" "" "" "" "VPS13B(NM_017890.4):c.10127A>T (p.N3376I), VPS13B(NM_017890.5):c.10127A>T (p.N3376I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000888091" "0" "50" "8" "100866185" "100866185" "subst" "0.000174609" "02326" "VPS13B_000329" "g.100866185A>G" "" "" "" "VPS13B(NM_017890.4):c.10643A>G (p.Y3548C), VPS13B(NM_017890.5):c.10643A>G (p.Y3548C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000888092" "0" "30" "8" "100866331" "100866331" "subst" "4.87662E-5" "02326" "COX6C_000218" "g.100866331G>A" "" "" "" "VPS13B(NM_017890.4):c.10789G>A (p.V3597I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000888093" "0" "90" "8" "100874100" "100874100" "subst" "0" "02329" "VPS13B_000124" "g.100874100G>A" "" "" "" "VPS13B(NM_017890.5):c.11216G>A (p.W3739*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000888094" "0" "30" "8" "100883799" "100883799" "subst" "0.000633595" "02330" "VPS13B_000345" "g.100883799G>C" "" "" "" "VPS13B(NM_017890.4):c.11694G>C (p.V3898=), VPS13B(NM_017890.5):c.11694G>C (p.V3898=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000888095" "0" "90" "8" "100887815" "100887816" "ins" "0" "02327" "COX6C_000219" "g.100887815_100887816insG" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000905913" "0" "50" "8" "100654250" "100654250" "subst" "0" "00000" "VPS13B_000427" "g.100654250C>G" "" "{PMID:Zhu 2022:35456422}" "" "VPS13B c.5507C>G, p.(Pro1836Arg)" "heterozygous, probably non-causal incidental finding" "Germline/De novo (untested)" "?" "" "0" "" "" "g.99642022C>G" "" "VUS" "ACMG" "0000905914" "0" "50" "8" "100796684" "100796684" "subst" "2.03532E-5" "00000" "VPS13B_000428" "g.100796684C>T" "" "{PMID:Zhu 2022:35456422}" "" "VPS13B c.7996C>T, p.(Arg2666Cys)" "heterozygous, probably non-causal incidental finding" "Germline/De novo (untested)" "?" "" "0" "" "" "g.99784456C>T" "" "VUS" "ACMG" "0000912844" "0" "10" "8" "100520087" "100520087" "subst" "0.00277529" "02326" "COX6C_000220" "g.100520087G>A" "" "" "" "VPS13B(NM_017890.4):c.4247G>A (p.R1416Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000912845" "0" "30" "8" "100568723" "100568723" "subst" "2.03844E-5" "02326" "COX6C_000041" "g.100568723C>T" "" "" "" "VPS13B(NM_017890.4):c.4866C>T (p.I1622=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000912846" "0" "50" "8" "100791246" "100791246" "subst" "0" "02325" "COX6C_000221" "g.100791246A>C" "" "" "" "VPS13B(NM_017890.5):c.7841A>C (p.Q2614P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000912847" "0" "50" "8" "100830707" "100830707" "subst" "2.84724E-5" "02325" "COX6C_000062" "g.100830707A>G" "" "" "" "VPS13B(NM_017890.5):c.8465A>G (p.Y2822C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000912848" "0" "30" "8" "100832137" "100832137" "subst" "9.36109E-5" "02326" "COX6C_000222" "g.100832137T>A" "" "" "" "VPS13B(NM_017890.4):c.8868-12T>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000912849" "0" "30" "8" "100832183" "100832183" "subst" "8.13259E-6" "02330" "COX6C_000223" "g.100832183C>A" "" "" "" "VPS13B(NM_017890.5):c.8902C>A (p.R2968=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000912850" "0" "30" "8" "100861113" "100861113" "subst" "0.00049149" "02326" "VPS13B_000410" "g.100861113A>T" "" "" "" "VPS13B(NM_017890.4):c.10127A>T (p.N3376I), VPS13B(NM_017890.5):c.10127A>T (p.N3376I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000912851" "0" "30" "8" "100874140" "100874140" "subst" "0.00162417" "02330" "VPS13B_000337" "g.100874140A>G" "" "" "" "VPS13B(NM_017890.4):c.11256A>G (p.R3752=), VPS13B(NM_017890.5):c.11256A>G (p.R3752=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000912852" "0" "30" "8" "100883799" "100883799" "subst" "0.000633595" "02326" "VPS13B_000345" "g.100883799G>C" "" "" "" "VPS13B(NM_017890.4):c.11694G>C (p.V3898=), VPS13B(NM_017890.5):c.11694G>C (p.V3898=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000920693" "3" "70" "8" "100788465" "100796588" "del" "0" "00006" "VPS13B_000429" "g.100788465_100796588del" "" "{PMID:Duerinckx 2021: 34402213}" "" "del 8128bp (ex42‐43)" "" "Germline" "" "" "0" "" "" "g.99776237_99784360del" "" "likely pathogenic (recessive)" "" "0000924796" "0" "30" "8" "100133549" "100133549" "subst" "6.49857E-5" "02326" "COX6C_000224" "g.100133549A>G" "" "" "" "VPS13B(NM_017890.4):c.1082A>G (p.D361G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000924797" "0" "30" "8" "100160206" "100160206" "subst" "0.000410279" "02326" "COX6C_000136" "g.100160206G>A" "" "" "" "VPS13B(NM_017890.4):c.1981G>A (p.D661N), VPS13B(NM_017890.5):c.1981G>A (p.D661N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000924798" "0" "30" "8" "100493987" "100493987" "subst" "0.000362042" "02326" "VPS13B_000231" "g.100493987C>T" "" "" "" "VPS13B(NM_017890.4):c.3827C>T (p.T1276I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000924799" "0" "50" "8" "100831746" "100831746" "subst" "3.2555E-5" "02325" "VPS13B_000298" "g.100831746G>A" "" "" "" "VPS13B(NM_017890.5):c.8803G>A (p.E2935K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000924800" "0" "50" "8" "100844837" "100844837" "subst" "1.21966E-5" "02325" "COX6C_000225" "g.100844837G>A" "" "" "" "VPS13B(NM_017890.5):c.9646G>A (p.A3216T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000924801" "0" "50" "8" "100847808" "100847808" "subst" "9.34853E-5" "02325" "COX6C_000226" "g.100847808G>A" "" "" "" "VPS13B(NM_017890.5):c.9859G>A (p.E3287K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000924802" "0" "30" "8" "100847810" "100847810" "subst" "4.06458E-6" "02330" "COX6C_000227" "g.100847810G>A" "" "" "" "VPS13B(NM_017890.5):c.9861G>A (p.E3287=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000924803" "0" "30" "8" "100887784" "100887784" "subst" "0.000832508" "02326" "COX6C_000109" "g.100887784C>G" "" "" "" "VPS13B(NM_017890.4):c.11959C>G (p.P3987A), VPS13B(NM_017890.5):c.11959C>G (p.P3987A), VPS13B(NM_152564.5):c.11884C>G (p.(Pro3962Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000929402" "0" "30" "8" "100520037" "100520037" "subst" "0.010446" "02330" "COX6C_000228" "g.100520037T>C" "" "" "" "VPS13B(NM_017890.5):c.4197T>C (p.G1399=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000929403" "0" "50" "8" "100830698" "100830698" "subst" "4.47445E-5" "02325" "COX6C_000229" "g.100830698C>A" "" "" "" "VPS13B(NM_017890.5):c.8456C>A (p.S2819Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000929404" "0" "30" "8" "100844598" "100844598" "subst" "0.327439" "02330" "COX6C_000074" "g.100844598A>T" "" "" "" "VPS13B(NM_017890.5):c.9407A>T (p.Y3136F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000929405" "0" "50" "8" "100866392" "100866392" "subst" "0" "02325" "COX6C_000230" "g.100866392C>T" "" "" "" "VPS13B(NM_017890.5):c.10850C>T (p.S3617L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000929406" "0" "30" "8" "100871572" "100871572" "subst" "4.06068E-6" "02326" "COX6C_000181" "g.100871572A>C" "" "" "" "VPS13B(NM_017890.4):c.10983A>C (p.A3661=), VPS13B(NM_017890.5):c.10983A>C (p.A3661=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000939868" "3" "70" "8" "100160140" "100160140" "subst" "1.21922E-5" "00006" "VPS13B_000387" "g.100160140C>T" "" "{PMID:Nambot 2018:29095811}" "" "NM_152564.4:c.1915C>T" "" "Germline" "" "" "0" "" "" "g.99147912C>T" "" "likely pathogenic (recessive)" "" "0000939878" "1" "70" "8" "100789002" "100789002" "subst" "4.06726E-6" "00006" "RP1_000000" "g.100789002G>A" "" "{PMID:Nambot 2018:29095811}" "" "NM_017890.3:c.7323-1G>A" "" "Germline" "" "" "0" "" "" "g.99776774G>A" "" "likely pathogenic (recessive)" "" "0000939908" "2" "90" "8" "100866389" "100866391" "del" "0" "00006" "RP1_000000" "g.100866389_100866391del" "" "{PMID:Nambot 2018:29095811}" "" "NM_017890.3:c.10847_10849del" "" "Germline" "" "" "0" "" "" "g.99854161_99854163del" "" "pathogenic (recessive)" "" "0000948981" "0" "50" "8" "100123329" "100123329" "subst" "4.15901E-6" "02325" "COX6C_000127" "g.100123329C>G" "" "" "" "VPS13B(NM_017890.4):c.584C>G (p.T195S), VPS13B(NM_017890.5):c.584C>G (p.T195S), VPS13B(NM_152564.5):c.584C>G (p.(Thr195Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000948982" "0" "30" "8" "100205221" "100205221" "subst" "0.00263843" "02330" "COX6C_000018" "g.100205221T>C" "" "" "" "VPS13B(NM_017890.4):c.2451T>C (p.H817=), VPS13B(NM_017890.5):c.2451T>C (p.H817=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000948983" "0" "30" "8" "100493904" "100493904" "subst" "0.00253572" "02326" "COX6C_000231" "g.100493904A>G" "" "" "" "VPS13B(NM_017890.4):c.3744A>G (p.L1248=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000948984" "0" "50" "8" "100493971" "100493971" "subst" "0.000715843" "02325" "VPS13B_000230" "g.100493971A>T" "" "" "" "VPS13B(NM_017890.4):c.3811A>T (p.T1271S), VPS13B(NM_017890.5):c.3811A>T (p.T1271S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000948985" "0" "30" "8" "100654319" "100654319" "subst" "0.00865342" "02330" "VPS13B_000248" "g.100654319C>T" "" "" "" "VPS13B(NM_017890.4):c.5576C>T (p.S1859L), VPS13B(NM_017890.5):c.5576C>T (p.S1859L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000948986" "0" "50" "8" "100791192" "100791192" "subst" "0.000721277" "02325" "VPS13B_000283" "g.100791192C>T" "" "" "" "VPS13B(NM_017890.4):c.7787C>T (p.S2596F), VPS13B(NM_017890.5):c.7787C>T (p.S2596F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000948987" "0" "30" "8" "100844594" "100844595" "ins" "0" "02330" "COX6C_000232" "g.100844594_100844595insTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT" "" "" "" "VPS13B(NM_017890.5):c.9406-3_9406-2insTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000948988" "0" "30" "8" "100844615" "100844615" "subst" "0.00947675" "02330" "VPS13B_000313" "g.100844615A>G" "" "" "" "VPS13B(NM_017890.4):c.9424A>G (p.S3142G, p.(Ser3142Gly)), VPS13B(NM_017890.5):c.9424A>G (p.S3142G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000948989" "0" "30" "8" "100865857" "100865857" "subst" "0.000150251" "02326" "COX6C_000233" "g.100865857T>C" "" "" "" "VPS13B(NM_017890.4):c.10315T>C (p.L3439=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000948990" "0" "30" "8" "100874140" "100874140" "subst" "0.00162417" "02326" "VPS13B_000337" "g.100874140A>G" "" "" "" "VPS13B(NM_017890.4):c.11256A>G (p.R3752=), VPS13B(NM_017890.5):c.11256A>G (p.R3752=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000954075" "0" "90" "8" "100711831" "100711831" "subst" "1.22032E-5" "00006" "VPS13B_000430" "g.100711831T>A" "" "{PMID:Moon 2021:35052368}" "" "" "" "Germline" "" "" "0" "" "" "g.99699603T>A" "" "pathogenic" "" "0000954090" "0" "90" "8" "100844721" "100844722" "del" "0" "00006" "VPS13B_000431" "g.100844721_100844722del" "" "{PMID:Moon 2021:35052368}" "" "" "" "Germline" "" "" "0" "" "" "g.99832493_99832494del" "" "pathogenic" "" "0000958912" "21" "70" "8" "100205176" "100205176" "del" "0" "00006" "VPS13B_000433" "g.100205176del" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1" "Germline" "" "" "0" "" "" "g.99192948del" "" "likely pathogenic (recessive)" "ACMG" "0000959084" "0" "50" "1" "26769333" "26769333" "subst" "2.84669E-5" "00006" "DHDDS_000006" "g.26769333C>T" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PP2, PP5" "Germline" "" "" "0" "" "" "g.26442842C>T" "" "VUS" "ACMG" "0000959346" "0" "50" "8" "100050635" "100050635" "subst" "0" "00006" "VPS13B_000432" "g.100050635T>A" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, BP7" "Germline" "" "" "0" "" "" "g.99038407T>A" "" "VUS" "ACMG" "0000964736" "0" "50" "8" "100443798" "100443798" "subst" "0.000248284" "02325" "COX6C_000144" "g.100443798T>C" "" "" "" "VPS13B(NM_017890.5):c.3116T>C (p.M1039T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000964738" "0" "30" "8" "100454831" "100454831" "subst" "0.00164264" "02330" "COX6C_000028" "g.100454831C>T" "" "" "" "VPS13B(NM_017890.4):c.3413C>T (p.(Pro1138Leu)), VPS13B(NM_017890.5):c.3413C>T (p.P1138L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000964745" "0" "10" "8" "100844597" "100844598" "ins" "0" "02329" "COX6C_000234" "g.100844597_100844598insTTTTTTTTTTTTTTTTT" "" "" "" "VPS13B(NM_017890.5):c.9406-1_9406insTTTTTTTTTTTTTTTTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000964746" "0" "10" "8" "100844597" "100844598" "ins" "0" "02329" "COX6C_000235" "g.100844597_100844598insTTTTTTTTTTTTTTTTTTTTTTTTTT" "" "" "" "VPS13B(NM_017890.5):c.9406-1_9406insTTTTTTTTTTTTTTTTTTTTTTTTTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000964750" "0" "30" "8" "100847565" "100847565" "subst" "0.000660963" "02330" "COX6C_000117" "g.100847565C>T" "" "" "" "VPS13B(NM_017890.4):c.9817+13C>T, VPS13B(NM_017890.5):c.9817+13C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000964751" "0" "30" "8" "100871686" "100871686" "subst" "1.62547E-5" "02330" "COX6C_000236" "g.100871686G>A" "" "" "" "VPS13B(NM_017890.5):c.11097G>A (p.S3699=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000964752" "0" "50" "8" "100887650" "100887652" "dup" "0" "02325" "VPS13B_000134" "g.100887650_100887652dup" "" "" "" "VPS13B(NM_017890.4):c.11825_11827dupATG (p.D3942dup), VPS13B(NM_017890.5):c.11825_11827dupATG (p.D3942dup), VPS13B(NM_152564.4):c.11750_11752dupATG..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000977949" "0" "50" "8" "100123329" "100123329" "subst" "4.15901E-6" "01804" "COX6C_000127" "g.100123329C>G" "" "" "" "VPS13B(NM_017890.4):c.584C>G (p.T195S), VPS13B(NM_017890.5):c.584C>G (p.T195S), VPS13B(NM_152564.5):c.584C>G (p.(Thr195Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000977950" "0" "50" "8" "100123454" "100123454" "subst" "2.09466E-5" "01804" "COX6C_000237" "g.100123454C>T" "" "" "" "VPS13B(NM_152564.5):c.709C>T (p.(Arg237Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000977951" "0" "50" "8" "100160089" "100160089" "subst" "1.33791E-5" "01804" "COX6C_000135" "g.100160089A>G" "" "" "" "VPS13B(NM_017890.4):c.1864A>G (p.T622A), VPS13B(NM_017890.5):c.1864A>G (p.T622A), VPS13B(NM_152564.5):c.1864A>G (p.(Thr622Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000977952" "0" "30" "8" "100493911" "100493911" "subst" "0.0014104" "01804" "COX6C_000034" "g.100493911A>G" "" "" "" "VPS13B(NM_017890.4):c.3751A>G (p.T1251A), VPS13B(NM_017890.5):c.3751A>G (p.T1251A), VPS13B(NM_152564.4):c.3751A>G (p.(Thr1251Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000977953" "0" "50" "8" "100568884" "100568884" "subst" "0" "01804" "COX6C_000238" "g.100568884A>T" "" "" "" "VPS13B(NM_152564.5):c.4949+3A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000977954" "0" "50" "8" "100832312" "100832312" "subst" "0" "01804" "COX6C_000239" "g.100832312G>T" "" "" "" "VPS13B(NM_152564.5):c.8956G>T (p.(Val2986Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000977957" "0" "30" "8" "100844858" "100844858" "subst" "0.00366803" "01804" "VPS13B_000316" "g.100844858C>T" "" "" "" "VPS13B(NM_017890.4):c.9667C>T (p.R3223W), VPS13B(NM_017890.5):c.9667C>T (p.R3223W), VPS13B(NM_152564.4):c.9592C>T (p.(Arg3198Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000977958" "0" "50" "8" "100866298" "100866298" "subst" "1.62565E-5" "01804" "COX6C_000242" "g.100866298C>T" "" "" "" "VPS13B(NM_152564.5):c.10681C>T (p.(Arg3561Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000987249" "1" "70" "8" "100205212" "100205220" "delins" "0" "00006" "VPS13B_000434" "g.100205212_100205220delinsCCCTGC" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "c.[2441_2445del,c.2447C>G,c.2450_2451insGC]" "case unsolved" "Germline" "" "" "0" "" "" "g.99192984_99192992delinsCCCTGC" "" "likely pathogenic" "ACMG" "0000987323" "0" "90" "8" "100494031" "100494031" "subst" "1.62958E-5" "00006" "VPS13B_000233" "g.100494031G>T" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "no variant 2nd chromosome, case unsolved" "Germline" "" "" "0" "" "" "g.99481803G>T" "" "pathogenic" "ACMG" "0000987329" "0" "90" "8" "100832271" "100832271" "subst" "0" "00006" "VPS13B_000435" "g.100832271G>A" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "no variant 2nd chromosome, case unsolved" "Germline" "" "" "0" "" "" "g.99820043G>A" "" "pathogenic" "ACMG" "0000996811" "0" "50" "8" "100115333" "100115333" "subst" "4.06329E-6" "02325" "VPS13B_000180" "g.100115333T>C" "" "" "" "VPS13B(NM_017890.4):c.565T>C (p.F189L), VPS13B(NM_017890.5):c.565T>C (p.F189L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000996812" "0" "50" "8" "100127961" "100127961" "subst" "8.15681E-6" "01804" "COX6C_000243" "g.100127961A>G" "" "" "" "VPS13B(NM_152564.4):c.796A>G (p.(Ile266Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000996813" "0" "50" "8" "100146901" "100146901" "subst" "0.00118075" "01804" "COX6C_000009" "g.100146901G>T" "" "" "" "VPS13B(NM_017890.4):c.1248G>T (p.Q416H), VPS13B(NM_152564.4):c.1248G>T (p.(Gln416His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000996814" "0" "30" "8" "100182263" "100182263" "subst" "0.000243847" "01804" "COX6C_000244" "g.100182263T>G" "" "" "" "VPS13B(NM_152564.4):c.2209-4T>G (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000996815" "0" "50" "8" "100286506" "100286506" "subst" "0.000645717" "01804" "COX6C_000021" "g.100286506G>A" "" "" "" "VPS13B(NM_017890.4):c.2596G>A (p.V866I), VPS13B(NM_152564.4):c.2596G>A (p.(Val866Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000996816" "0" "50" "8" "100443771" "100443771" "subst" "3.25629E-5" "01804" "COX6C_000245" "g.100443771G>A" "" "" "" "VPS13B(NM_152564.4):c.3089G>A (p.(Arg1030His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000996817" "0" "50" "8" "100494026" "100494026" "subst" "0.000378751" "01804" "VPS13B_000047" "g.100494026C>G" "" "" "" "VPS13B(NM_017890.4):c.3866C>G (p.T1289S), VPS13B(NM_152564.4):c.3866C>G (p.(Thr1289Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000996818" "0" "50" "8" "100589808" "100589808" "subst" "8.12949E-6" "01804" "COX6C_000246" "g.100589808C>T" "" "" "" "VPS13B(NM_152564.4):c.5167C>T (p.(Gln1723*))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000996819" "0" "50" "8" "100589809" "100589809" "subst" "8.12962E-6" "01804" "COX6C_000247" "g.100589809A>C" "" "" "" "VPS13B(NM_152564.4):c.5168A>C (p.(Gln1723Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000996820" "0" "50" "8" "100654053" "100654053" "subst" "8.17341E-6" "01804" "COX6C_000248" "g.100654053A>C" "" "" "" "VPS13B(NM_152564.4):c.5235A>C (p.(Glu1745Asp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000996821" "0" "50" "8" "100673695" "100673695" "subst" "4.07554E-6" "01804" "COX6C_000249" "g.100673695A>T" "" "" "" "VPS13B(NM_152564.4):c.6022A>T (p.(Ile2008Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000996822" "0" "30" "8" "100711936" "100711936" "subst" "2.03305E-5" "01804" "COX6C_000250" "g.100711936G>A" "" "" "" "VPS13B(NM_152564.4):c.6230G>A (p.(Arg2077His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000996823" "0" "30" "8" "100796545" "100796545" "subst" "0" "01804" "COX6C_000251" "g.100796545C>G" "" "" "" "VPS13B(NM_152564.4):c.7782C>G (p.(Asn2594Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000996824" "0" "10" "8" "100844858" "100844858" "subst" "0.00366803" "02327" "VPS13B_000316" "g.100844858C>T" "" "" "" "VPS13B(NM_017890.4):c.9667C>T (p.R3223W), VPS13B(NM_017890.5):c.9667C>T (p.R3223W), VPS13B(NM_152564.4):c.9592C>T (p.(Arg3198Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000996825" "0" "30" "8" "100844859" "100844859" "subst" "2.44296E-5" "01804" "COX6C_000252" "g.100844859G>A" "" "" "" "VPS13B(NM_152564.4):c.9593G>A (p.(Arg3198Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000996826" "0" "50" "8" "100865941" "100865941" "subst" "0" "02325" "COX6C_000083" "g.100865941G>A" "" "" "" "VPS13B(NM_017890.4):c.10399G>A (p.A3467T), VPS13B(NM_017890.5):c.10399G>A (p.A3467T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000996827" "0" "50" "8" "100871603" "100871603" "subst" "4.06101E-6" "01804" "COX6C_000253" "g.100871603G>A" "" "" "" "VPS13B(NM_152564.4):c.10939G>A (p.(Ala3647Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000996828" "0" "50" "8" "100880639" "100880639" "subst" "0.000190914" "01804" "COX6C_000087" "g.100880639G>T" "" "" "" "VPS13B(NM_017890.4):c.11413G>T (p.V3805L), VPS13B(NM_017890.5):c.11413G>T (p.V3805L), VPS13B(NM_152564.4):c.11338G>T (p.(Val3780Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000996829" "0" "50" "8" "100883836" "100883836" "subst" "8.12295E-5" "01804" "COX6C_000254" "g.100883836G>A" "" "" "" "VPS13B(NM_152564.4):c.11656G>A (p.(Val3886Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000996830" "0" "50" "8" "100887650" "100887652" "dup" "0" "01804" "VPS13B_000134" "g.100887650_100887652dup" "" "" "" "VPS13B(NM_017890.4):c.11825_11827dupATG (p.D3942dup), VPS13B(NM_017890.5):c.11825_11827dupATG (p.D3942dup), VPS13B(NM_152564.4):c.11750_11752dupATG..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000996831" "0" "50" "8" "100887804" "100887804" "subst" "0" "02325" "COX6C_000255" "g.100887804C>G" "" "" "" "VPS13B(NM_017890.5):c.11979C>G (p.Y3993*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001014396" "0" "50" "8" "100146901" "100146901" "subst" "0.00118075" "02327" "COX6C_000009" "g.100146901G>T" "" "" "" "VPS13B(NM_017890.4):c.1248G>T (p.Q416H), VPS13B(NM_152564.4):c.1248G>T (p.(Gln416His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001014397" "0" "10" "8" "100844597" "100844598" "ins" "0" "02325" "COX6C_000256" "g.100844597_100844598insTTTTTTTTTTTTTTTTTTTTTTT" "" "" "" "VPS13B(NM_017890.5):c.9406-1_9406insTTTTTTTTTTTTTTTTTTTTTTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001014398" "0" "50" "8" "100866425" "100866425" "subst" "4.06507E-6" "02327" "COX6C_000257" "g.100866425C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001022094" "0" "90" "8" "100396546" "100396547" "del" "0" "04796" "VPS13B_000042" "g.100396546_100396547del" "" "" "" "" "effect on RNA exon skipping" "Germline/De novo (untested)" "" "" "0" "" "" "g.99384318_99384319del" "" "pathogenic" "" "0001022095" "0" "70" "8" "100589861" "100589861" "subst" "4.07063E-6" "04796" "COX6C_000049" "g.100589861G>T" "" "" "" "NM_017890.4:c.5295G>T" "effect on RNA exon skipping" "Germline/De novo (untested)" "" "" "0" "" "" "g.99577633G>T" "" "likely pathogenic" "" "0001025463" "0" "50" "8" "100733202" "100733202" "subst" "0.00142307" "01943" "COX6C_000215" "g.100733202G>A" "" "" "" "VPS13B(NM_017890.4):c.7052G>A (p.R2351Q), VPS13B(NM_017890.5):c.7052G>A (p.R2351Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001025464" "0" "50" "8" "100821738" "100821738" "subst" "0" "02325" "COX6C_000258" "g.100821738C>T" "" "" "" "VPS13B(NM_017890.5):c.8152C>T (p.L2718F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001025465" "0" "10" "8" "100844597" "100844598" "ins" "0" "02325" "COX6C_000259" "g.100844597_100844598insTTTTTTTTTTTTTTTTTTTTTTTT" "" "" "" "VPS13B(NM_017890.5):c.9406-1_9406insTTTTTTTTTTTTTTTTTTTTTTTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001025466" "0" "30" "8" "100865852" "100865852" "subst" "0.000674084" "02330" "COX6C_000260" "g.100865852C>T" "" "" "" "VPS13B(NM_017890.5):c.10310C>T (p.A3437V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001025467" "0" "50" "8" "100880639" "100880639" "subst" "0.000190914" "02325" "COX6C_000087" "g.100880639G>T" "" "" "" "VPS13B(NM_017890.4):c.11413G>T (p.V3805L), VPS13B(NM_017890.5):c.11413G>T (p.V3805L), VPS13B(NM_152564.4):c.11338G>T (p.(Val3780Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001036640" "0" "30" "8" "100146946" "100146946" "subst" "0.00320252" "01804" "VPS13B_000188" "g.100146946T>G" "" "" "" "VPS13B(NM_017890.4):c.1293T>G (p.T431=), VPS13B(NM_152564.5):c.1293T>G (p.(Thr431=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001036641" "0" "30" "8" "100182333" "100182333" "subst" "0.0108938" "01804" "COX6C_000016" "g.100182333G>C" "" "" "" "VPS13B(NM_017890.4):c.2275G>C (p.V759L), VPS13B(NM_017890.5):c.2275G>C (p.V759L), VPS13B(NM_152564.5):c.2275G>C (p.(Val759Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001036642" "0" "30" "8" "100287362" "100287362" "subst" "0.000731993" "01804" "VPS13B_000211" "g.100287362A>G" "" "" "" "VPS13B(NM_017890.4):c.2704A>G (p.K902E), VPS13B(NM_017890.5):c.2704A>G (p.K902E), VPS13B(NM_152564.5):c.2704A>G (p.(Lys902Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001036643" "0" "30" "8" "100287418" "100287418" "subst" "0.0025759" "01804" "VPS13B_000212" "g.100287418A>G" "" "" "" "VPS13B(NM_017890.4):c.2760A>G (p.L920=), VPS13B(NM_017890.5):c.2760A>G (p.L920=), VPS13B(NM_152564.5):c.2760A>G (p.(Leu920=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001036644" "0" "50" "8" "100443757" "100443757" "subst" "0.000260557" "01804" "COX6C_000026" "g.100443757G>A" "" "" "" "VPS13B(NM_017890.4):c.3083-8G>A, VPS13B(NM_152564.5):c.3083-8G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001036645" "0" "50" "8" "100520051" "100520053" "del" "4.46911E-5" "01804" "COX6C_000261" "g.100520051_100520053del" "" "" "" "VPS13B(NM_017890.5):c.4211_4213del (p.(Cys1404_Thr1405delinsSer))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001036646" "0" "30" "8" "100523324" "100523324" "dup" "0" "01804" "COX6C_000262" "g.100523324dup" "" "" "" "VPS13B(NM_152564.5):c.4225-8dup" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001036647" "0" "90" "8" "100523443" "100523443" "subst" "2.43964E-5" "01804" "VPS13B_000053" "g.100523443C>T" "" "" "" "VPS13B(NM_152564.5):c.4336C>T (p.(Arg1446*))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001036648" "0" "50" "8" "100589861" "100589861" "subst" "4.07063E-6" "01804" "COX6C_000049" "g.100589861G>T" "" "" "" "VPS13B(NM_017890.4):c.5295G>T (p.E1765D), VPS13B(NM_152564.5):c.5220G>T (p.(Glu1740Asp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001036649" "0" "50" "8" "100654579" "100654579" "subst" "4.0625E-6" "01804" "COX6C_000105" "g.100654579A>G" "" "" "" "VPS13B(NM_017890.4):c.5836A>G (p.T1946A), VPS13B(NM_152564.5):c.5761A>G (p.(Thr1921Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001036650" "0" "50" "8" "100711753" "100711753" "subst" "4.88532E-5" "01804" "COX6C_000263" "g.100711753C>T" "" "" "" "VPS13B(NM_152564.5):c.6047C>T (p.(Ala2016Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001036651" "0" "30" "8" "100729395" "100729395" "dup" "0" "01804" "VPS13B_000265" "g.100729395dup" "" "" "" "VPS13B(NM_017890.4):c.6530-4dupT, VPS13B(NM_152564.5):c.6455-4dup" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001036652" "0" "10" "8" "100733188" "100733188" "subst" "0.0468192" "01804" "VPS13B_000272" "g.100733188A>G" "" "" "" "VPS13B(NM_017890.4):c.7038A>G (p.V2346=), VPS13B(NM_152564.5):c.6963A>G (p.(Val2321=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001036653" "0" "10" "8" "100836216" "100836216" "subst" "0.0138685" "01804" "VPS13B_000307" "g.100836216T>A" "" "" "" "VPS13B(NM_017890.4):c.9405+10T>A, VPS13B(NM_152564.5):c.9330+10T>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001036654" "0" "50" "8" "100844594" "100844595" "ins" "0" "01804" "COX6C_000264" "g.100844594_100844595insTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT" "" "" "" "VPS13B(NM_152564.5):c.9331-3_9331-2insTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001036655" "0" "10" "8" "100844597" "100844598" "ins" "0" "02325" "COX6C_000265" "g.100844597_100844598insTTTTTTTTTTTTTTTTTTT" "" "" "" "VPS13B(NM_017890.5):c.9406-1_9406insTTTTTTTTTTTTTTTTTTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001036656" "0" "10" "8" "100865682" "100865682" "subst" "0.0174041" "01804" "VPS13B_000326" "g.100865682G>T" "" "" "" "VPS13B(NM_017890.4):c.10140G>T (p.A3380=), VPS13B(NM_152564.5):c.10065G>T (p.(Ala3355=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001036657" "0" "30" "8" "100874117" "100874117" "subst" "0.00021213" "01804" "VPS13B_000336" "g.100874117G>A" "" "" "" "VPS13B(NM_017890.4):c.11233G>A (p.E3745K), VPS13B(NM_152564.5):c.11158G>A (p.(Glu3720Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001036658" "0" "30" "8" "100880545" "100880545" "subst" "5.68491E-5" "01804" "COX6C_000182" "g.100880545G>C" "" "" "" "VPS13B(NM_017890.5):c.11319G>C (p.P3773=), VPS13B(NM_152564.5):c.11244G>C (p.(Pro3748=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001036659" "0" "30" "8" "100883745" "100883745" "subst" "0.00805338" "01804" "VPS13B_000343" "g.100883745A>G" "" "" "" "VPS13B(NM_017890.4):c.11640A>G (p.S3880=), VPS13B(NM_152564.5):c.11565A>G (p.(Ser3855=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001036660" "0" "30" "8" "100887784" "100887784" "subst" "0.000832508" "01804" "COX6C_000109" "g.100887784C>G" "" "" "" "VPS13B(NM_017890.4):c.11959C>G (p.P3987A), VPS13B(NM_017890.5):c.11959C>G (p.P3987A), VPS13B(NM_152564.5):c.11884C>G (p.(Pro3962Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001046134" "0" "50" "8" "100128022" "100128022" "subst" "1.22065E-5" "02325" "COX6C_000266" "g.100128022A>G" "" "" "" "VPS13B(NM_017890.5):c.857A>G (p.Y286C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001046135" "0" "90" "8" "100844595" "100844595" "subst" "0.0657209" "02325" "COX6C_000267" "g.100844595A>T" "" "" "" "VPS13B(NM_017890.5):c.9406-2A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001049755" "3" "90" "8" "100146872" "100146872" "subst" "0" "00006" "VPS13B_000022" "g.100146872C>T" "" "{PMID:Charng 2016:27435318}" "" "" "ACMG PVS1, PM2, PP1" "Germline" "" "" "0" "" "" "g.99134644C>T" "" "pathogenic (recessive)" "" "0001053064" "0" "50" "8" "100115328" "100115328" "subst" "0.000125957" "01804" "VPS13B_000179" "g.100115328G>A" "" "" "" "VPS13B(NM_017890.4):c.560G>A (p.R187H), VPS13B(NM_017890.5):c.560G>A (p.R187H), VPS13B(NM_152564.5):c.560G>A (p.(Arg187His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001053065" "0" "30" "8" "100155318" "100155318" "subst" "0.000861389" "01804" "VPS13B_000027" "g.100155318G>A" "" "" "" "VPS13B(NM_017890.4):c.1768G>A (p.A590T), VPS13B(NM_017890.5):c.1768G>A (p.A590T), VPS13B(NM_152564.5):c.1768G>A (p.(Ala590Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001053066" "0" "50" "8" "100533122" "100533122" "subst" "0" "01804" "COX6C_000268" "g.100533122T>C" "" "" "" "VPS13B(NM_152564.5):c.4634-5T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001053067" "0" "50" "8" "100587948" "100587948" "subst" "1.21941E-5" "01804" "COX6C_000047" "g.100587948G>A" "" "" "" "VPS13B(NM_017890.4):c.5087G>A (p.R1696Q), VPS13B(NM_152564.5):c.5012G>A (p.(Arg1671Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001053068" "0" "50" "8" "100654196" "100654196" "subst" "4.48076E-5" "01804" "COX6C_000269" "g.100654196G>A" "" "" "" "VPS13B(NM_152564.5):c.5378G>A (p.(Arg1793His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001053069" "0" "10" "8" "100779103" "100779103" "subst" "0.0039931" "01804" "VPS13B_000276" "g.100779103G>A" "" "" "" "VPS13B(NM_017890.4):c.7227G>A (p.P2409=), VPS13B(NM_017890.5):c.7227G>A (p.P2409=), VPS13B(NM_152564.5):c.7152G>A (p.(Pro2384=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001053070" "0" "50" "8" "100791204" "100791204" "subst" "1.63116E-5" "01804" "VPS13B_000361" "g.100791204A>T" "" "" "" "VPS13B(NM_017890.4):c.7799A>T (p.N2600I), VPS13B(NM_152564.5):c.7724A>T (p.(Asn2575Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001053071" "0" "70" "8" "100791212" "100791212" "subst" "4.08203E-6" "01804" "COX6C_000270" "g.100791212C>T" "" "" "" "VPS13B(NM_152564.5):c.7732C>T (p.(Gln2578*))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001053072" "0" "50" "8" "100830700" "100830700" "subst" "0" "01804" "COX6C_000271" "g.100830700A>G" "" "" "" "VPS13B(NM_152564.5):c.8383A>G (p.(Ile2795Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001053073" "0" "30" "8" "100847506" "100847506" "subst" "0" "01804" "COX6C_000079" "g.100847506C>A" "" "" "" "VPS13B(NM_017890.4):c.9771C>A (p.I3257=), VPS13B(NM_152564.5):c.9696C>A (p.(Ile3232=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001053074" "0" "50" "8" "100865816" "100865816" "subst" "0" "01804" "COX6C_000272" "g.100865816C>G" "" "" "" "VPS13B(NM_152564.5):c.10199C>G (p.(Pro3400Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001053075" "0" "90" "8" "100865889" "100865889" "subst" "0" "01804" "COX6C_000273" "g.100865889T>A" "" "" "" "VPS13B(NM_152564.5):c.10272T>A (p.(Cys3424*))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001053076" "0" "50" "8" "100874046" "100874046" "subst" "0" "01804" "COX6C_000274" "g.100874046G>A" "" "" "" "VPS13B(NM_152564.5):c.11087G>A (p.(Arg3696Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001053077" "0" "50" "8" "100883803" "100883803" "subst" "8.12249E-6" "01804" "COX6C_000275" "g.100883803G>A" "" "" "" "VPS13B(NM_152564.5):c.11623G>A (p.(Val3875Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes VPS13B ## Count = 1531 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000004654" "00025898" "50" "2825" "-44175" "2825" "-44175" "c.2825-44175G>A" "r.(=)" "p.(=)" "" "0000004654" "00000245" "50" "2825" "-44175" "2825" "-44175" "c.2825-44175G>A" "" "p.(=)" "" "0000004655" "00025898" "50" "2825" "-44120" "2825" "-44120" "c.2825-44120G>C" "r.(=)" "p.(=)" "" "0000004655" "00000245" "50" "2825" "-44120" "2825" "-44120" "c.2825-44120G>C" "" "p.(=)" "" "0000012632" "00025898" "50" "148" "-8608" "148" "-8608" "c.148-8608G>C" "r.(=)" "p.(=)" "" "0000012632" "00000245" "50" "148" "-8608" "148" "-8608" "c.148-8608G>C" "" "p.(=)" "" "0000012633" "00025898" "50" "2825" "-44682" "2825" "-44682" "c.2825-44682C>T" "r.(=)" "p.(=)" "" "0000012633" "00000245" "50" "2825" "-44682" "2825" "-44682" "c.2825-44682C>T" "" "p.(=)" "" "0000012634" "00025898" "50" "2825" "-44175" "2825" "-44175" "c.2825-44175G>A" "r.(=)" "p.(=)" "" "0000012634" "00000245" "50" "2825" "-44175" "2825" "-44175" "c.2825-44175G>A" "" "p.(=)" "" "0000016288" "00000245" "99" "" "" "" "" "c.(?-12444)_996+?del" "r.?" "p.?" "01-09a" "0000016289" "00000245" "99" "-23990" "0" "1207" "-5855" "c.-23990_1207-5855del" "r.?" "p.?" "01-09a" "0000016290" "00000245" "99" "-79752" "0" "2516" "-7756" "c.-79752_2516-7756del" "r.?" "p?" "01-20" "0000016291" "00000245" "99" "22" "0" "23" "0" "c.22_23delCCinsA" "r.22_23delccinsa" "p.Pro8Lysfs*3" "02" "0000016292" "00000245" "99" "219" "0" "220" "0" "c.219_220delinsT" "r.(219_220delinsu)" "p.(Lys73Asnfs*8)" "3" "0000016293" "00000245" "99" "291" "6437" "2334" "-3424" "c.291+6437_2334-3424del" "r.?" "p.?" "04-17" "0000016294" "00000245" "97" "413" "-2" "413" "-2" "c.413-2A>G" "r.spl" "p.?" "4i" "0000016295" "00000245" "99" "292" "-1" "1843" "1" "c.(291+1_292-1)_(1843+1_1844-1)dup" "r.(292_1843dup)" "p.?" "3i_13i" "0000016296" "00000245" "99" "401" "0" "402" "0" "c.401_402insT" "r.(?)" "p.(Pro136Thrfs*10)" "4" "0000016297" "00000245" "99" "292" "-1" "2333" "1" "c.(291+1_292-1)_(2333+1_2334-1)del" "r.(292_2333del)" "p.(Asp99Glnfs*9)" "3i_16i" "0000016298" "00000245" "99" "413" "-1" "2013" "1" "c.413-?_2013+?del" "r.(413_2013del)" "p.(Gly138Glufs*4)" "06-15" "0000016299" "00000245" "99" "581" "-1" "2333" "1" "c.(580+1_581-1)_(2333+1_2334-1)del" "r.(581_2333del)" "p.(Ala194Glyfs*9)" "5i_16i" "0000016300" "00000245" "99" "467" "0" "470" "0" "c.467_470delATAA" "r.467_470delauaa" "p.Asn156Ilefs*4" "06" "0000016301" "00000245" "99" "626" "0" "627" "0" "c.626_627delCA" "r.(626_627delca)" "p.(Thr209Serfs*4)" "07" "0000016302" "00000245" "99" "916" "0" "917" "0" "c.916_917delGA" "r.(916_917delga)" "p.(Asp306Tyrfs*9)" "08" "0000016303" "00000245" "99" "1207" "-2" "2824" "52509" "c.1207-2_2824+52509del" "r.(1207_2824del)" "p.(Leu403Valfs*11)" "10-21" "0000016304" "00000245" "99" "1219" "0" "1219" "0" "c.1219C>T" "r.(1219c>u)" "p.(Gln407*)" "10" "0000016305" "00000245" "99" "1225" "0" "1225" "0" "c.1225G>T" "r.(1225g>u)" "p.(Glu409*)" "10" "0000016306" "00000245" "99" "1269" "0" "1273" "0" "c.1269_1273delATTGT" "r.(1269_1273delauugu)" "p.(Cys425Glyfs*8)" "10" "0000016307" "00000245" "99" "1504" "0" "1504" "0" "c.1504C>T" "r.1504c>u" "p.Arg502*" "12" "0000016308" "00000245" "99" "1563" "0" "1563" "0" "c.1563G>A" "r.[1563G>A, spl]" "p.[=, Lys521fs*20]" "12" "0000016309" "00000245" "77" "1768" "0" "1768" "0" "c.1768G>A" "r.(1768g>a)" "p.(Ala590Thr)" "14" "0000016310" "00000245" "77" "2014" "-2" "2014" "-2" "c.2014-2A>G" "r.spl" "p.?" "14i" "0000016311" "00000245" "99" "2047" "0" "2047" "0" "c.2047delC" "r.(2047delc)" "p.(Gln683Serfs*62)" "16" "0000016312" "00000245" "99" "2074" "0" "2074" "0" "c.2074C>T" "r.(2074c>u)" "p.(Arg692*)" "16" "0000016313" "00000245" "99" "2209" "-1" "2333" "1" "c.2209-?_2333+?del" "r.?" "p.?" "17" "0000016314" "00000245" "99" "2334" "-8502" "3082" "9882" "c.2334-8502_3082+9882del" "r.?" "p.?" "18-23" "0000016315" "00000245" "99" "2516" "-1" "3082" "1" "c.2516-?_3082+?del" "r.(2516_3082del)" "p.(Gly839_Thr1027del)" "20-23" "0000016316" "00000245" "99" "2516" "-1" "4299" "1" "c.2516-?_4299+?del" "r.(2516_4299del)" "p.(Gly839Aspfs*37)" "20-31" "0000016317" "00000245" "99" "2516" "-9218" "2824" "20330" "c.2516-9218_2824+20330del" "r.?" "p.?" "20-21" "0000016318" "00000245" "77" "2651" "-1" "2651" "-1" "c.2651-1G>A" "r.2651_26578del" "p.Asp885Glufs*5" "i20" "0000016319" "00000245" "99" "2727" "0" "2730" "0" "c.2727_2730dupGCTC" "r.2727_2730dupgcuc" "p.Asn911Alafs*3" "21" "0000016320" "00000245" "99" "2824" "51811" "3082" "4080" "c.2824+51811_3082+4080del" "r.2825_3082del" "p.Gly942_Thr1027del" "22-23" "0000016321" "00000245" "99" "2825" "-1" "4820" "1" "c.(2824+1_2825-1)_(4820+1_4821-1)dup" "r.(2825_4820dup)" "p.?" "19i_30i" "0000016322" "00000245" "99" "2889" "0" "2889" "0" "c.2889G>A" "r.2889g>a" "p.Trp963*" "22" "0000016323" "00000245" "99" "2911" "0" "2911" "0" "c.2911C>T" "r.2911c>u" "p.Arg971*" "22" "0000016324" "00000245" "99" "2934" "1" "2934" "2" "c.2934+1_2934+2delGT" "r.2825_2934del" "p.(Gly942Alafs*14)" "i22" "0000016325" "00000245" "99" "3348" "0" "3349" "0" "c.3348_3349delCT" "r.(3348_3349delcu)" "p.(Cys1117Phefs*8)" "25" "0000016326" "00000245" "99" "3427" "0" "3427" "0" "c.3427C>T" "r.(3427c>u)" "p.(Arg1143*)" "23" "0000016327" "00000245" "99" "3618" "0" "3618" "0" "c.3618T>A" "r.3618u>a" "p.Cys1206*" "26" "0000016328" "00000245" "97" "3666" "2" "3666" "2" "c.3666+2T>C" "r.spl" "p?" "24i" "0000016329" "00000245" "77" "3866" "0" "3866" "0" "c.3866C>G" "r.(3866c>g)" "p.(Thr1289Ser)" "27" "0000016330" "00000245" "99" "3870" "9884" "5024" "1867" "c.3870+9884_5024+1867del" "r.(3871_5024del)" "p.(Gly1291Hisfs*42)" "28-34" "0000016332" "00000245" "55" "4157" "-1" "4158" "1" "c.4157-?_4158+?del" "r.4157_4158del" "p.(Ala1570Glyfs*4)" "33" "0000016333" "00000245" "99" "4334" "0" "4334" "0" "c.4334delA" "r.4334dela" "p.Gln1445Argfs*7" "32" "0000016334" "00000245" "99" "4396" "0" "4396" "0" "c.4396dupA" "r.4396dupa" "p.Thr1466Asnfs*5" "32" "0000016335" "00000245" "99" "4411" "0" "4411" "0" "c.4411C>T" "r.(4411c>u)" "p.(Arg1471*)" "32" "0000016336" "00000245" "99" "4471" "0" "4471" "0" "c.4471G>T" "r.4471g>u" "p.Glu1491*" "32" "0000016337" "00000245" "99" "4474" "0" "4474" "0" "c.4474del" "r.(4474del)" "p.(Ile1492Phefs*43)" "29" "0000016338" "00000245" "77" "4480" "0" "4482" "0" "c.4480_4482delCTT" "r.(4480_4482delcuu)" "p.(Leu1494del)" "32" "0000016339" "00000245" "99" "4572" "0" "4572" "0" "c.4572dupA" "r.(4572dupa)" "p.(Glu1525Argfs*45)" "32" "0000016340" "00000245" "77" "4820" "2" "4820" "2" "c.4820+2T>C" "r.spl?" "p.?" "i33" "0000016341" "00000245" "99" "4878" "0" "4880" "0" "c.4878_4880dupATA" "r.(4878_4880dupaua)" "p.(Tyr1627*)" "34" "0000016342" "00000245" "99" "4923" "0" "4923" "0" "c.4923G>A" "r.(4923g>a)" "p.(Trp1641*)" "34" "0000016343" "00000245" "99" "4955" "0" "4955" "0" "c.4955C>G" "r.(4955c>g)" "p.(Ser1652*)" "34" "0000016344" "00000245" "99" "5025" "-1" "6121" "1" "c.(5024+1_5025-1)_(6121+1_6122-1)del" "c.(5025_6121del)" "p.(Ile1676Glyfs*38)" "31i_35i" "0000016345" "00000245" "99" "5069" "0" "5069" "0" "c.5069T>A" "r.5069u>a" "p.Leu1690*" "35" "0000016346" "00000245" "99" "5086" "0" "5086" "0" "c.5086C>T" "r.(5086c>u)" "p.(Arg1696*)" "35" "0000016347" "00000245" "99" "5152" "0" "5295" "0" "c.5152_5295del" "r.(5152_5295del)" "p.(Glu1718_Glu1765del)" "36" "0000016348" "00000245" "99" "5215" "0" "5232" "0" "c.5215_5232del" "r.(5215_5232del)" "p.(Ser1739_Gln1744del)" "36" "0000016349" "00000245" "99" "5331" "0" "5331" "0" "c.5331dup" "r.(5331dup)" "p.(Asp1778*)" "34" "0000016350" "00000245" "99" "5426" "0" "5427" "0" "c.5426_5427dupAG" "r.(5426_5427dupag)" "p.(Gln1810Serfs*21)" "37" "0000016351" "00000245" "99" "5461" "0" "5461" "0" "c.5461dupC" "r.(5461dupc)" "p.(Arg1821Profs*18)" "37" "0000016352" "00000245" "99" "5613" "0" "5614" "0" "c.5613_5614insT" "r.5613_5614insu" "p.Lys1872*" "37" "0000016353" "00000245" "99" "5737" "0" "5737" "0" "c.5737dupA" "r.5737dupa" "p.Ile1913Asnfs*7" "37" "0000016354" "00000245" "99" "5750" "0" "5750" "0" "c.5750delC" "r.5750delc" "p.Ser1917Phefs*19" "37" "0000016355" "00000245" "99" "5809" "0" "5810" "0" "c.5809_5810delAT" "r.5809_5810delAT" "p.Ile1937Cysfs*11" "37" "0000016356" "00000245" "99" "5827" "0" "5827" "0" "c.5827C>T" "r.5827c>u" "p.Arg1943*" "37" "0000016357" "00000245" "99" "5920" "0" "5920" "0" "c.5920C>T" "r.(5920c>u)" "p.(Arg1974*)" "37" "0000016358" "00000245" "99" "6420" "0" "6421" "0" "c.6420_6421delGA" "r.(6420_6421delga)" "p.(Gln2140Hisfs*28)" "39" "0000016359" "00000245" "99" "6530" "0" "6732" "0" "c.6530_6732del" "r.(6530_6732del)" "p.(Ile2178Leufs*15)" "40" "0000016361" "00000245" "77" "6578" "0" "6578" "0" "c.6578T>G" "r.(6578u>g)" "p.(Leu2193Arg)" "40" "0000016362" "00000245" "99" "6687" "0" "6687" "0" "c.6687delA" "r.(6687dela)" "p.(Gln2229Hisfs*10)" "40" "0000016363" "00000245" "77" "6732" "1" "6732" "1" "c.6732+1G>A" "r.spl?" "p.?" "i40" "0000016364" "00000245" "77" "6733" "-2" "6733" "-2" "c.6733-2A>G" "r.spl?" "p.?" "i40" "0000016365" "00000245" "77" "7022" "0" "7022" "0" "c.7022A>G" "r.7022a>g" "p.Tyr2341Cys" "42" "0000016366" "00000245" "99" "7051" "0" "7051" "0" "c.7051C>T" "r.(7051c>u)" "p.(Arg2351*)" "42" "0000016367" "00000245" "99" "7153" "0" "7153" "0" "c.7153G>T" "r.(7153g>u)" "p.(Glu2385*)" "43" "0000016368" "00000245" "99" "7221" "0" "7221" "0" "c.7221delG" "r.(7221delg)" "p.(Gln2407Hisfs*8)" "43" "0000016369" "00000245" "99" "7234" "0" "8016" "8505" "c.7234_8016+8505del" "r.?" "p.?" "43-46" "0000016370" "00000245" "99" "7126" "-1" "8016" "1" "c.(7125+1_7126-1)_(8016+1_8017-1)del" "r.(7126_8016del)" "p.(Val2376_Gln2672del)" "39i_43i" "0000016371" "00000245" "99" "7322" "0" "7322" "1" "c.7322_7322+1delGGinsATGGAGC" "r.spl" "p.Ser2441fs*37" "i43" "0000016372" "00000245" "77" "7504" "1" "7504" "1" "c.7504+1G>A" "r.spl?" "p.?" "i44" "0000016373" "00000245" "99" "7603" "0" "7603" "0" "c.7603C>T" "r.7603c>u" "p.Arg2535*" "45" "0000016374" "00000245" "99" "7610" "0" "7610" "0" "c.7610G>A" "r.7610g>a" "p.Trp2537*" "45" "0000016375" "00000245" "77" "7934" "0" "7934" "0" "c.7934G>A" "r.7934g>a" "p.Gly2645Asp" "46" "0000016377" "00000245" "99" "7936" "0" "7936" "0" "c.7936delC" "r.7936delc" "p.Gln2646Argfs*96" "46" "0000016378" "00000245" "99" "8017" "0" "8172" "0" "c.8017_8172del" "r.8017_8172del" "p.Leu2673_Gln2724del" "47" "0000016379" "00000245" "99" "8119" "0" "8119" "0" "c.8119C>T" "r.(8119c>u)" "p.(Arg2707*)" "47" "0000016380" "00000245" "99" "8292" "0" "8292" "0" "c.8292C>A" "r.(8292c>a)" "p.(Cys2764*)" "48" "0000016381" "00000245" "77" "8318" "0" "8318" "0" "c.8318C>T" "r.(8318c>u)" "p.(Ser2773Leu)" "48" "0000016382" "00000245" "99" "8341" "0" "8341" "0" "c.8341delC" "r.8341del" "p.Leu2781*" "48" "0000016383" "00000245" "99" "8437" "-1" "9258" "1" "c.(8436+1_8437-1)_(9258+1_9259-1)del" "r.(8437_9258del)" "p.(Val2813_Lys3086del)" "45i_50i" "0000016384" "00000245" "55" "8459" "0" "8459" "0" "c.8459T>C" "r.(8459u>c)" "p.(Ile2820Thr)" "49" "0000016385" "00000245" "99" "8472" "0" "8472" "0" "c.8472G>A" "r.(8472g>a)" "p.(Trp2824*)" "49" "0000016386" "00000245" "99" "8515" "0" "8515" "0" "c.8515C>T" "r.(8515c>u)" "p.(Arg2839*)" "49" "0000016387" "00000245" "99" "8611" "0" "8611" "0" "c.8611delA" "r.8611dela" "p.Thr2871Hisfs*16" "50" "0000016388" "00000245" "99" "8697" "-9" "8697" "-9" "c.8697-9A>G" "r.8696_8697instttcctag" "p.?" "i50" "0000016389" "00000245" "77" "8697" "-2" "8697" "-2" "c.8697-2A>G" "r.spl?" "p.?" "i51" "0000016390" "00000245" "77" "8978" "0" "8978" "0" "c.8978A>G" "r.8978a>g" "p.Asn2993Ser" "52" "0000016391" "00000245" "99" "9258" "0" "9259" "0" "c.9258_9259insT" "r.(9258_9259insu)" "p.(Leu3087Phefs*20)" "53" "0000016393" "00000245" "99" "9406" "-1" "9406" "-1" "c.9406-1G>T" "r.9406_9422del" "p.Tyr3136Thrfs*16" "55" "0000016394" "00000245" "77" "9690" "-2" "9690" "-2" "c.9690-2A>G" "r.spl?" "p.?" "56" "0000016395" "00000245" "99" "9706" "0" "9706" "0" "c.9706delT" "r.(9706delu)" "p.(Tyr3236Ilefs*7)" "56" "0000016396" "00000245" "99" "9731" "0" "9731" "0" "c.9731delA" "r.9731dela" "p.Tyr3244Phefs*2" "56" "0000016397" "00000245" "99" "10018" "0" "10136" "0" "c.10018_10136del" "r.10018_10136del" "p.Val3340Serfs*9" "58" "0000016398" "00000245" "99" "10076" "0" "10077" "0" "c.10076_10077delCA" "r.(10076_10077delca)" "p.(Thr3359Serfs*29)" "58" "0000016399" "00000245" "99" "10156" "0" "10156" "0" "c.10156dupA" "r.10156dupa" "p.Thr3386Asnfs*3" "59" "0000016400" "00000245" "99" "10456" "0" "10457" "0" "c.10456_10457delAG" "r.(10456_10457delag)" "p.(Leu3487Profs*24)" "59" "0000016401" "00000245" "99" "10841" "0" "10844" "0" "c.10841_10844delTCTC" "r.10841_10844delucuc" "p.Leu3614Profs*36" "59" "0000016402" "00000245" "99" "10888" "0" "10888" "0" "c.10888C>T" "r.10888c>u" "p.Gln3630*" "59" "0000016403" "00000245" "99" "10946" "0" "10946" "0" "c.10946G>A" "r.(10946g>a)" "p.(Trp3649*)" "60" "0000016404" "00000245" "99" "11125" "0" "11125" "0" "c.11125delC" "r.(11125delc)" "p.(Leu3709Serfs*61)" "61" "0000016405" "00000245" "99" "11169" "0" "11172" "0" "c.11169_11172dupGGAC" "r.11169_11172dupggac" "p.Arg3725Glyfs*7" "61" "0000016406" "00000245" "99" "11216" "0" "11216" "0" "c.11216G>A" "r.11216g>a" "p.Trp3739*" "61" "0000016407" "00000245" "99" "11245" "0" "11245" "0" "c.11245G>T" "r.(11245g>u)" "p.(Glu3749*)" "61" "0000016408" "00000245" "99" "11314" "0" "11314" "0" "c.11314C>T" "r.11314c>u" "p.Gln3772*" "62" "0000016409" "00000245" "99" "11505" "0" "11505" "0" "c.11505delA" "r.(11505dela)" "p.(Lys3835Asnfs*43)" "63" "0000016410" "00000245" "99" "11556" "0" "11556" "0" "c.11556dup" "r.(11556dup)" "p.(Val3853Cysfs*33)" "58" "0000016411" "00000245" "99" "11564" "0" "11564" "0" "c.11564del" "r.(11564del)" "p.(Tyr3855Leufs*23)" "60" "0000016412" "00000245" "99" "11564" "0" "11565" "0" "c.11564_11565delAT" "r.(11564_11565delau)" "p.(Tyr3855Cysfs*30)" "63" "0000016413" "00000245" "99" "11598" "0" "11598" "0" "c.11598delA" "r.(11598dela)" "p.(Glu3867Lysfs*11)" "64" "0000016414" "00000245" "99" "11695" "0" "11698" "0" "c.11695_11698del" "r.(11695_11698del)" "p.(Ser3901Argfs*40)" "64" "0000016415" "00000245" "99" "11780" "0" "11784" "0" "c.11780_11784delCAGTGinsAA" "r.(11780_11784delcaguginsaa)" "p.(Thr3927Lysfs*15)" "64" "0000016416" "00000245" "77" "11825" "0" "11827" "0" "c.11825_11827dupATG" "r.(11825_11827dupaug)" "p.(Asp3942dup)" "65" "0000016417" "00000245" "99" "11906" "0" "11915" "0" "c.11906_11915delCCAGCTGTTC" "r.11906_11915del ccagcuguuc" "p.Pro3969Leufs*41" "65" "0000016418" "00000245" "99" "11907" "0" "11907" "0" "c.11907dupC" "r.11907dupc" "p.Ser3970Glnfs*22" "65" "0000016419" "00000245" "99" "10942" "56" "11713" "0" "c.10942+56_11713dup" "r.?" "p.?" "56i_61" "0000024443" "00000245" "99" "436" "0" "436" "0" "c.436C>T" "r.(?)" "p.(Arg146*)" "06" "0000024444" "00000245" "99" "10139" "0" "10143" "0" "c.10139_10143dupCGCCA" "r.(?)" "p.(Glu3382Argfs*15)" "59" "0000024445" "00000245" "99" "1221" "0" "1221" "0" "c.1221delA" "r.(?)" "p.(Val408Leufs*11)" "10" "0000024446" "00000245" "99" "478" "0" "481" "0" "c.478_481delCTAA" "r.(?)" "p.(Leu160Asnfs*21)" "06" "0000024448" "00000245" "99" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Gln336*)" "9a" "0000024450" "00000245" "77" "4907" "0" "4907" "0" "c.4907T>A" "r.(?)" "p.(Ile1636Asn)" "34" "0000024451" "00000245" "99" "7286" "0" "7286" "0" "c.7286delT" "r.(?)" "p.(Val2429Alafs*2)" "43" "0000024452" "00000245" "99" "11860" "0" "11861" "0" "c.11860_11861dupAA" "r.(?)" "p.(Asn3954Lysfs*60)" "62" "0000024453" "00000245" "99" "10884" "0" "10901" "0" "c.10884_10901delGAGGCAGCTTGTGCACGC" "r.(?)" "p.(Arg3629_Ala3634del)" "59" "0000024454" "00000245" "99" "6122" "-2065" "6732" "207" "c.6122-2065_6732+207del" "r.(?)" "p.(Ala2041Glyfs*16)" "39-40" "0000024455" "00000245" "99" "1206" "5" "1652" "-27" "c.1206+5_1652-27dup" "r.spl?" "p.?" "10-13" "0000024456" "00000245" "99" "5025" "-664" "5295" "9012" "c.5025-664_5295+9012dup" "r.?" "p.?" "35-36" "0000024457" "00000245" "99" "6122" "-2065" "6529" "7798" "c.6122-2065_6529+7798del" "r.(?)" "p.(Ala2041_Pro2176del)" "39" "0000024458" "00000245" "77" "8521" "-2" "8521" "-2" "c.8521-2A>G" "r.spl?" "p.?" "50" "0000024459" "00000245" "99" "1734" "0" "1734" "0" "c.1734delT" "r.(?)" "p.(Ile579*)" "14" "0000024460" "00000245" "99" "7643" "0" "7644" "0" "c.7643_7644delinsAA" "r.(?)" "p.(Phe2548*)" "45" "0000024461" "00000245" "99" "4820" "-1" "8172" "1" "c.4820-?_8172+?del" "r.?" "p.?" "46-47" "0000024463" "00000245" "77" "9259" "-1" "9259" "-1" "c.9259-1G>T" "r.spl?" "p.?" "54" "0000029459" "00000245" "77" "2470" "0" "2470" "0" "c.2470T>G" "r.(?)" "p.(Ser824Ala)" "18" "0000029461" "00000245" "77" "8185" "0" "8185" "0" "c.8185G>A" "r.(?)" "p.(Gly2729Arg)" "48" "0000029462" "00000245" "77" "4904" "0" "4904" "0" "c.4904A>G" "r.(?)" "p.(Asn1635Ser)" "34" "0000029463" "00000245" "77" "6706" "0" "6706" "0" "c.6706A>C" "r.(?)" "p.(Ile2236Leu)" "40" "0000029464" "00000245" "77" "9984" "0" "9984" "0" "c.9984T>A" "r.(?)" "p.(Ser3328Arg)" "57" "0000029465" "00000245" "77" "11146" "0" "11146" "0" "c.11146G>A" "r.(?)" "p.(Ala3716Thr)" "61" "0000029466" "00000245" "77" "5983" "2" "5983" "2" "c.5983+2dup" "r.spl?" "p.?" "37i" "0000029467" "00000245" "77" "11119" "2" "11119" "2" "c.11119+2T>C" "r.spl?" "p.?" "60i" "0000029468" "00000245" "99" "9406" "-1" "9406" "-1" "c.9406-1G>C" "r.9406_9422del" "p.Tyr3136Thrfs*16" "54i" "0000029470" "00000245" "99" "5615" "0" "5615" "0" "c.5615dup" "r.(?)" "p.(Ser1873Glufs*9)" "37" "0000039751" "00000245" "77" "11327" "0" "11327" "0" "c.11327del" "r.(?)" "p.(Asn3776Thrfs*102)" "62" "0000046781" "00000245" "90" "1426" "-32" "2516" "-16303" "c.1426-32_2516-16303del" "r.(del)" "p.(Glu476Valfs*2)" "10i_17i" "0000046782" "00000245" "90" "11821" "-297" "13308" "0" "c.11821-297_*1239del" "r.?" "p.?" "61i_62" "0000079443" "00025898" "90" "5244" "0" "5244" "0" "c.5244dup" "r.(?)" "p.(Val1749Serfs*5)" "" "0000079443" "00000245" "00" "5313" "0" "5313" "0" "c.5313delinsGA" "r.(?)" "p.(Val1774Serfs*5)" "" "0000079480" "00025898" "90" "412" "3161" "580" "208" "c.412+3161_580+208del" "r.(?)" "p.(Gly138_Ser193del)" "" "0000079480" "00000245" "00" "412" "3161" "580" "208" "c.412+3161_580+208del" "r.(?)" "p.(Gly138_Ser193del)" "" "0000079667" "00025898" "90" "6657" "1" "6657" "1" "c.6657+1G>A" "r.spl?" "p.?" "" "0000079667" "00000245" "00" "6732" "1" "6732" "1" "c.6732+1G>A" "r.spl?" "p.?" "" "0000221901" "00000245" "70" "4232" "0" "4232" "0" "c.4232G>A" "r.(?)" "p.(Arg1411His)" "28" "0000244202" "00000245" "90" "412" "1" "412" "1" "c.412+1G>T" "r.spl" "p.?" "4i" "0000244203" "00000245" "90" "3" "0" "3" "0" "c.3G>A" "r.(?)" "p.0?" "2" "0000249668" "00025898" "50" "8903" "0" "8903" "0" "c.8903A>G" "r.(?)" "p.(Asn2968Ser)" "" "0000249668" "00000245" "50" "8978" "0" "8978" "0" "c.8978A>G" "r.(?)" "p.(Asn2993Ser)" "" "0000249812" "00025898" "50" "2917" "0" "2917" "0" "c.2917A>G" "r.(?)" "p.(Ser973Gly)" "" "0000249812" "00000245" "50" "2917" "0" "2917" "0" "c.2917A>G" "r.(?)" "p.(Ser973Gly)" "" "0000249831" "00025898" "50" "10568" "0" "10568" "0" "c.10568A>G" "r.(?)" "p.(Tyr3523Cys)" "" "0000249831" "00000245" "50" "10643" "0" "10643" "0" "c.10643A>G" "r.(?)" "p.(Tyr3548Cys)" "" "0000250689" "00025898" "10" "6963" "0" "6963" "0" "c.6963A>G" "r.(?)" "p.(Val2321=)" "" "0000250689" "00000245" "10" "7038" "0" "7038" "0" "c.7038A>G" "r.(?)" "p.(Val2346=)" "" "0000250712" "00025898" "10" "2934" "14" "2934" "14" "c.2934+14A>T" "r.(=)" "p.(=)" "" "0000250712" "00000245" "10" "2934" "14" "2934" "14" "c.2934+14A>T" "r.(=)" "p.(=)" "" "0000250758" "00025898" "10" "9330" "9" "9330" "9" "c.9330+9A>G" "r.(=)" "p.(=)" "" "0000250758" "00000245" "10" "9405" "9" "9405" "9" "c.9405+9A>G" "r.(=)" "p.(=)" "" "0000251022" "00025898" "10" "174" "0" "174" "0" "c.174A>G" "r.(?)" "p.(Leu58=)" "" "0000251022" "00000245" "10" "174" "0" "174" "0" "c.174A>G" "r.(?)" "p.(Leu58=)" "" "0000251023" "00025898" "10" "8553" "0" "8553" "0" "c.8553A>G" "r.(?)" "p.(Gly2851=)" "" "0000251023" "00000245" "10" "8628" "0" "8628" "0" "c.8628A>G" "r.(?)" "p.(Gly2876=)" "" "0000251107" "00025898" "10" "1786" "0" "1786" "0" "c.1786A>C" "r.(?)" "p.(Lys596Gln)" "" "0000251107" "00000245" "10" "1786" "0" "1786" "0" "c.1786A>C" "r.(?)" "p.(Lys596Gln)" "" "0000251404" "00025898" "10" "147" "90" "147" "90" "c.147+90A>G" "r.(=)" "p.(=)" "" "0000251404" "00000245" "10" "147" "90" "147" "90" "c.147+90A>G" "r.(=)" "p.(=)" "" "0000251405" "00025898" "10" "2934" "19" "2934" "19" "c.2934+19A>T" "r.(=)" "p.(=)" "" "0000251405" "00000245" "10" "2934" "19" "2934" "19" "c.2934+19A>T" "r.(=)" "p.(=)" "" "0000251406" "00025898" "10" "3210" "184" "3210" "184" "c.3210+184A>C" "r.(=)" "p.(=)" "" "0000251406" "00000245" "10" "3210" "184" "3210" "184" "c.3210+184A>C" "r.(=)" "p.(=)" "" "0000251407" "00025898" "10" "3211" "-152" "3211" "-152" "c.3211-152A>G" "r.(=)" "p.(=)" "" "0000251407" "00000245" "10" "3211" "-152" "3211" "-152" "c.3211-152A>G" "r.(=)" "p.(=)" "" "0000251408" "00025898" "10" "8995" "-71" "8995" "-71" "c.8995-71del" "r.(=)" "p.(=)" "" "0000251408" "00000245" "10" "9070" "-71" "9070" "-71" "c.9070-71del" "r.(=)" "p.(=)" "" "0000252616" "00025898" "90" "2014" "-2" "2014" "-2" "c.2014-2A>G" "r.spl?" "p.?" "" "0000252616" "00000245" "90" "2014" "-2" "2014" "-2" "c.2014-2A>G" "r.spl?" "p.?" "" "0000252749" "00025898" "50" "6056" "0" "6056" "0" "c.6056A>T" "r.(?)" "p.(Asn2019Ile)" "" "0000252749" "00000245" "50" "6131" "0" "6131" "0" "c.6131A>T" "r.(?)" "p.(Asn2044Ile)" "" "0000253041" "00025898" "10" "6963" "0" "6963" "0" "c.6963A>G" "r.(?)" "p.(Val2321=)" "" "0000253041" "00000245" "10" "7038" "0" "7038" "0" "c.7038A>G" "r.(?)" "p.(Val2346=)" "" "0000253064" "00025898" "10" "2934" "14" "2934" "14" "c.2934+14A>T" "r.(=)" "p.(=)" "" "0000253064" "00000245" "10" "2934" "14" "2934" "14" "c.2934+14A>T" "r.(=)" "p.(=)" "" "0000253453" "00025898" "10" "11565" "0" "11565" "0" "c.11565A>G" "r.(?)" "p.(Ser3855=)" "" "0000253453" "00000245" "10" "11640" "0" "11640" "0" "c.11640A>G" "r.(?)" "p.(Ser3880=)" "" "0000253726" "00025898" "10" "8171" "0" "8171" "0" "c.8171A>G" "r.(?)" "p.(Tyr2724Cys)" "" "0000253726" "00000245" "10" "8246" "0" "8246" "0" "c.8246A>G" "r.(?)" "p.(Tyr2749Cys)" "" "0000253977" "00025898" "30" "9330" "9" "9330" "9" "c.9330+9A>G" "r.(=)" "p.(=)" "" "0000253977" "00000245" "30" "9405" "9" "9405" "9" "c.9405+9A>G" "r.(=)" "p.(=)" "" "0000254215" "00025898" "30" "2760" "0" "2760" "0" "c.2760A>G" "r.(?)" "p.(Leu920=)" "" "0000254215" "00000245" "30" "2760" "0" "2760" "0" "c.2760A>G" "r.(?)" "p.(Leu920=)" "" "0000254216" "00025898" "30" "6645" "0" "6645" "0" "c.6645A>C" "r.(?)" "p.(Gly2215=)" "" "0000254216" "00000245" "30" "6720" "0" "6720" "0" "c.6720A>C" "r.(?)" "p.(Gly2240=)" "" "0000254217" "00025898" "30" "8703" "0" "8703" "0" "c.8703A>G" "r.(?)" "p.(Gly2901=)" "" "0000254217" "00000245" "30" "8778" "0" "8778" "0" "c.8778A>G" "r.(?)" "p.(Gly2926=)" "" "0000254490" "00025898" "30" "358" "0" "358" "0" "c.358A>G" "r.(?)" "p.(Ile120Val)" "" "0000254490" "00000245" "30" "358" "0" "358" "0" "c.358A>G" "r.(?)" "p.(Ile120Val)" "" "0000254493" "00025898" "30" "4003" "0" "4003" "0" "c.4003A>G" "r.(?)" "p.(Ile1335Val)" "" "0000254493" "00000245" "30" "4003" "0" "4003" "0" "c.4003A>G" "r.(?)" "p.(Ile1335Val)" "" "0000254587" "00025898" "30" "3386" "0" "3386" "0" "c.3386A>G" "r.(?)" "p.(Lys1129Arg)" "" "0000254587" "00000245" "30" "3386" "0" "3386" "0" "c.3386A>G" "r.(?)" "p.(Lys1129Arg)" "" "0000254631" "00025898" "30" "2704" "0" "2704" "0" "c.2704A>G" "r.(?)" "p.(Lys902Glu)" "" "0000254631" "00000245" "30" "2704" "0" "2704" "0" "c.2704A>G" "r.(?)" "p.(Lys902Glu)" "" "0000254676" "00025898" "30" "9864" "0" "9864" "0" "c.9864A>C" "r.(?)" "p.(Leu3288=)" "" "0000254676" "00000245" "30" "9939" "0" "9939" "0" "c.9939A>C" "r.(?)" "p.(Leu3313=)" "" "0000254948" "00025898" "30" "11181" "0" "11181" "0" "c.11181A>G" "r.(?)" "p.(Arg3727=)" "" "0000254948" "00000245" "30" "11256" "0" "11256" "0" "c.11256A>G" "r.(?)" "p.(Arg3752=)" "" "0000254997" "00025898" "30" "9349" "0" "9349" "0" "c.9349A>G" "r.(?)" "p.(Ser3117Gly)" "" "0000254997" "00000245" "30" "9424" "0" "9424" "0" "c.9424A>G" "r.(?)" "p.(Ser3142Gly)" "" "0000255001" "00025898" "30" "1041" "0" "1041" "0" "c.1041A>G" "r.(?)" "p.(Ser347=)" "" "0000255001" "00000245" "30" "1041" "0" "1041" "0" "c.1041A>G" "r.(?)" "p.(Ser347=)" "" "0000255041" "00025898" "30" "3516" "0" "3516" "0" "c.3516A>G" "r.(?)" "p.(Thr1172=)" "" "0000255041" "00000245" "30" "3516" "0" "3516" "0" "c.3516A>G" "r.(?)" "p.(Thr1172=)" "" "0000255248" "00025898" "30" "1302" "12" "1302" "12" "c.1302+12A>G" "r.(=)" "p.(=)" "" "0000255248" "00000245" "30" "1302" "12" "1302" "12" "c.1302+12A>G" "r.(=)" "p.(=)" "" "0000255249" "00025898" "30" "7050" "11" "7050" "11" "c.7050+11A>G" "r.(=)" "p.(=)" "" "0000255249" "00000245" "30" "7125" "11" "7125" "11" "c.7125+11A>G" "r.(=)" "p.(=)" "" "0000255250" "00025898" "30" "11495" "6" "11495" "6" "c.11495+6A>G" "r.(=)" "p.(=)" "" "0000255250" "00000245" "30" "11570" "6" "11570" "6" "c.11570+6A>G" "r.(=)" "p.(=)" "" "0000255628" "00025898" "90" "6439" "0" "6439" "0" "c.6439del" "r.(?)" "p.(Thr2147HisfsTer7)" "" "0000255628" "00000245" "90" "6514" "0" "6514" "0" "c.6514del" "r.(?)" "p.(Thr2172HisfsTer7)" "" "0000255985" "00025898" "50" "1559" "0" "1559" "0" "c.1559A>G" "r.(?)" "p.(His520Arg)" "" "0000255985" "00000245" "50" "1559" "0" "1559" "0" "c.1559A>G" "r.(?)" "p.(His520Arg)" "" "0000256020" "00025898" "50" "5905" "0" "5905" "0" "c.5905A>G" "r.(?)" "p.(Ile1969Val)" "" "0000256020" "00000245" "50" "5980" "0" "5980" "0" "c.5980A>G" "r.(?)" "p.(Ile1994Val)" "" "0000256050" "00025898" "50" "8545" "0" "8545" "0" "c.8545A>T" "r.(?)" "p.(Ile2849Phe)" "" "0000256050" "00000245" "50" "8620" "0" "8620" "0" "c.8620A>T" "r.(?)" "p.(Ile2874Phe)" "" "0000256531" "00025898" "50" "3811" "0" "3811" "0" "c.3811A>T" "r.(?)" "p.(Thr1271Ser)" "" "0000256531" "00000245" "50" "3811" "0" "3811" "0" "c.3811A>T" "r.(?)" "p.(Thr1271Ser)" "" "0000311319" "00025898" "30" "6432" "0" "6432" "0" "c.6432C>A" "r.(?)" "p.(Val2144=)" "" "0000313026" "00025898" "10" "1206" "33" "1206" "33" "c.1206+33T>G" "r.(=)" "p.(=)" "" "0000313026" "00000245" "10" "1206" "33" "1206" "33" "c.1206+33T>G" "r.(=)" "p.(=)" "" "0000313027" "00025898" "30" "2473" "0" "2473" "0" "c.2473G>A" "r.(?)" "p.(Ala825Thr)" "" "0000313027" "00000245" "30" "2473" "0" "2473" "0" "c.2473G>A" "r.(?)" "p.(Ala825Thr)" "" "0000313028" "00025898" "10" "3667" "-7" "3667" "-7" "c.3667-7C>T" "r.(=)" "p.(=)" "" "0000313028" "00000245" "10" "3667" "-7" "3667" "-7" "c.3667-7C>T" "r.(=)" "p.(=)" "" "0000313029" "00025898" "90" "5662" "0" "5662" "0" "c.5662dup" "r.(?)" "p.(Ile1888AsnfsTer7)" "" "0000313029" "00000245" "90" "5737" "0" "5737" "0" "c.5737dup" "r.(?)" "p.(Ile1913AsnfsTer7)" "" "0000313030" "00025898" "90" "6407" "0" "6407" "0" "c.6407C>G" "r.(?)" "p.(Ser2136Ter)" "" "0000313030" "00000245" "90" "6482" "0" "6482" "0" "c.6482C>G" "r.(?)" "p.(Ser2161Ter)" "" "0000313031" "00025898" "10" "9492" "0" "9492" "0" "c.9492T>C" "r.(?)" "p.(Ser3164=)" "" "0000313031" "00000245" "10" "9567" "0" "9567" "0" "c.9567T>C" "r.(?)" "p.(Ser3189=)" "" "0000313032" "00025898" "30" "9592" "0" "9592" "0" "c.9592C>T" "r.(?)" "p.(Arg3198Trp)" "" "0000313032" "00000245" "30" "9667" "0" "9667" "0" "c.9667C>T" "r.(?)" "p.(Arg3223Trp)" "" "0000315301" "00025898" "10" "10061" "24" "10061" "24" "c.10061+24G>A" "r.(=)" "p.(=)" "" "0000315301" "00000245" "10" "10136" "24" "10136" "24" "c.10136+24G>A" "r.(=)" "p.(=)" "" "0000315302" "00025898" "10" "10065" "0" "10065" "0" "c.10065G>T" "r.(?)" "p.(Ala3355=)" "" "0000315302" "00000245" "10" "10140" "0" "10140" "0" "c.10140G>T" "r.(?)" "p.(Ala3380=)" "" "0000315303" "00025898" "10" "10219" "0" "10219" "0" "c.10219G>A" "r.(?)" "p.(Gly3407Arg)" "" "0000315303" "00000245" "10" "10294" "0" "10294" "0" "c.10294G>A" "r.(?)" "p.(Gly3432Arg)" "" "0000315304" "00025898" "10" "10867" "56" "10867" "56" "c.10867+56G>A" "r.(=)" "p.(=)" "" "0000315304" "00000245" "10" "10942" "56" "10942" "56" "c.10942+56G>A" "r.(=)" "p.(=)" "" "0000315305" "00025898" "50" "10949" "0" "10949" "0" "c.10949T>C" "r.(?)" "p.(Phe3650Ser)" "" "0000315305" "00000245" "50" "11024" "0" "11024" "0" "c.11024T>C" "r.(?)" "p.(Phe3675Ser)" "" "0000315306" "00025898" "50" "11495" "40" "11495" "40" "c.11495+40T>G" "r.(=)" "p.(=)" "" "0000315306" "00000245" "50" "11570" "40" "11570" "40" "c.11570+40T>G" "r.(=)" "p.(=)" "" "0000315307" "00025898" "10" "1206" "33" "1206" "33" "c.1206+33T>G" "r.(=)" "p.(=)" "" "0000315307" "00000245" "10" "1206" "33" "1206" "33" "c.1206+33T>G" "r.(=)" "p.(=)" "" "0000315308" "00025898" "10" "147" "112" "147" "112" "c.147+112T>C" "r.(=)" "p.(=)" "" "0000315308" "00000245" "10" "147" "112" "147" "112" "c.147+112T>C" "r.(=)" "p.(=)" "" "0000315309" "00025898" "10" "2013" "100" "2013" "100" "c.2013+100G>T" "r.(=)" "p.(=)" "" "0000315309" "00000245" "10" "2013" "100" "2013" "100" "c.2013+100G>T" "r.(=)" "p.(=)" "" "0000315310" "00025898" "10" "2013" "60" "2013" "61" "c.2013+60_2013+61del" "r.(=)" "p.(=)" "" "0000315310" "00000245" "10" "2013" "60" "2013" "61" "c.2013+60_2013+61del" "r.(=)" "p.(=)" "" "0000315311" "00025898" "10" "2014" "-97" "2014" "-97" "c.2014-97C>G" "r.(=)" "p.(=)" "" "0000315311" "00000245" "10" "2014" "-97" "2014" "-97" "c.2014-97C>G" "r.(=)" "p.(=)" "" "0000315312" "00025898" "10" "2515" "16525" "2515" "16525" "c.2515+16525del" "r.(=)" "p.(=)" "" "0000315312" "00000245" "10" "2515" "16525" "2515" "16525" "c.2515+16525del" "r.(=)" "p.(=)" "" "0000315313" "00025898" "10" "2516" "-146" "2516" "-146" "c.2516-146T>C" "r.(=)" "p.(=)" "" "0000315313" "00000245" "10" "2516" "-146" "2516" "-146" "c.2516-146T>C" "r.(=)" "p.(=)" "" "0000315314" "00025898" "10" "2824" "53" "2824" "53" "c.2824+53del" "r.(=)" "p.(=)" "" "0000315314" "00000245" "10" "2824" "53" "2824" "53" "c.2824+53del" "r.(=)" "p.(=)" "" "0000315315" "00025898" "10" "2824" "97" "2824" "97" "c.2824+97G>C" "r.(=)" "p.(=)" "" "0000315315" "00000245" "10" "2824" "97" "2824" "97" "c.2824+97G>C" "r.(=)" "p.(=)" "" "0000315316" "00025898" "10" "2935" "-23" "2935" "-23" "c.2935-23G>A" "r.(=)" "p.(=)" "" "0000315316" "00000245" "10" "2935" "-23" "2935" "-23" "c.2935-23G>A" "r.(=)" "p.(=)" "" "0000315317" "00025898" "90" "3598" "0" "3598" "0" "c.3598C>T" "r.(?)" "p.(Arg1200Ter)" "" "0000315317" "00000245" "90" "3598" "0" "3598" "0" "c.3598C>T" "r.(?)" "p.(Arg1200Ter)" "" "0000315318" "00025898" "10" "3666" "55" "3666" "55" "c.3666+55T>C" "r.(=)" "p.(=)" "" "0000315318" "00000245" "10" "3666" "55" "3666" "55" "c.3666+55T>C" "r.(=)" "p.(=)" "" "0000315319" "00025898" "10" "3667" "-7" "3667" "-7" "c.3667-7C>T" "r.(=)" "p.(=)" "" "0000315319" "00000245" "10" "3667" "-7" "3667" "-7" "c.3667-7C>T" "r.(=)" "p.(=)" "" "0000315320" "00025898" "90" "3870" "1" "3870" "1" "c.3870+1G>T" "r.spl?" "p.?" "" "0000315320" "00000245" "90" "3870" "1" "3870" "1" "c.3870+1G>T" "r.spl?" "p.?" "" "0000315321" "00025898" "10" "4633" "53" "4633" "53" "c.4633+53C>T" "r.(=)" "p.(=)" "" "0000315321" "00000245" "10" "4708" "53" "4708" "53" "c.4708+53C>T" "r.(=)" "p.(=)" "" "0000315322" "00025898" "10" "4746" "-14" "4746" "-14" "c.4746-14C>T" "r.(=)" "p.(=)" "" "0000315322" "00000245" "10" "4821" "-14" "4821" "-14" "c.4821-14C>T" "r.(=)" "p.(=)" "" "0000315323" "00025898" "10" "4746" "-85" "4746" "-85" "c.4746-85C>T" "r.(=)" "p.(=)" "" "0000315323" "00000245" "10" "4821" "-85" "4821" "-85" "c.4821-85C>T" "r.(=)" "p.(=)" "" "0000315326" "00025898" "10" "5606" "0" "5606" "0" "c.5606C>T" "r.(?)" "p.(Thr1869Met)" "" "0000315326" "00000245" "10" "5681" "0" "5681" "0" "c.5681C>T" "r.(?)" "p.(Thr1894Met)" "" "0000315327" "00025898" "10" "581" "-17" "581" "-17" "c.581-17T>C" "r.(=)" "p.(=)" "" "0000315327" "00000245" "10" "581" "-17" "581" "-17" "c.581-17T>C" "r.(=)" "p.(=)" "" "0000315328" "00025898" "10" "5908" "57" "5908" "57" "c.5908+57C>A" "r.(=)" "p.(=)" "" "0000315328" "00000245" "10" "5983" "57" "5983" "57" "c.5983+57C>A" "r.(=)" "p.(=)" "" "0000315329" "00025898" "10" "6047" "-2215" "6047" "-2215" "c.6047-2215G>A" "r.(=)" "p.(=)" "" "0000315329" "00000245" "10" "6122" "-2215" "6122" "-2215" "c.6122-2215G>A" "r.(=)" "p.(=)" "" "0000315330" "00025898" "10" "6047" "-2598" "6047" "-2598" "c.6047-2598T>C" "r.(=)" "p.(=)" "" "0000315330" "00000245" "10" "6122" "-2598" "6122" "-2598" "c.6122-2598T>C" "r.(=)" "p.(=)" "" "0000315331" "00025898" "10" "6454" "90" "6454" "90" "c.6454+90T>C" "r.(=)" "p.(=)" "" "0000315331" "00000245" "10" "6529" "90" "6529" "90" "c.6529+90T>C" "r.(=)" "p.(=)" "" "0000315332" "00025898" "10" "6455" "-4" "6455" "-4" "c.6455-4del" "r.spl?" "p.?" "" "0000315332" "00000245" "10" "6530" "-4" "6530" "-4" "c.6530-4del" "r.spl?" "p.?" "" "0000315333" "00025898" "10" "6455" "-5" "6455" "-5" "c.6455-5T>C" "r.spl?" "p.?" "" "0000315333" "00000245" "10" "6530" "-5" "6530" "-5" "c.6530-5T>C" "r.spl?" "p.?" "" "0000315334" "00025898" "90" "6657" "1" "6657" "1" "c.6657+1G>A" "r.spl?" "p.?" "" "0000315334" "00000245" "90" "6732" "1" "6732" "1" "c.6732+1G>A" "r.spl?" "p.?" "" "0000315335" "00025898" "10" "7152" "0" "7152" "0" "c.7152G>A" "r.(?)" "p.(Pro2384=)" "" "0000315335" "00000245" "10" "7227" "0" "7227" "0" "c.7227G>A" "r.(?)" "p.(Pro2409=)" "" "0000315336" "00025898" "10" "7248" "-74" "7248" "-74" "c.7248-74T>A" "r.(=)" "p.(=)" "" "0000315336" "00000245" "10" "7323" "-74" "7323" "-74" "c.7323-74T>A" "r.(=)" "p.(=)" "" "0000315337" "00025898" "10" "762" "19" "762" "19" "c.762+19del" "r.(=)" "p.(=)" "" "0000315337" "00000245" "10" "762" "19" "762" "19" "c.762+19del" "r.(=)" "p.(=)" "" "0000315338" "00025898" "10" "763" "-78" "763" "-78" "c.763-78C>G" "r.(=)" "p.(=)" "" "0000315338" "00000245" "10" "763" "-78" "763" "-78" "c.763-78C>G" "r.(=)" "p.(=)" "" "0000315339" "00025898" "10" "7676" "0" "7676" "0" "c.7676T>C" "r.(?)" "p.(Val2559Ala)" "" "0000315339" "00000245" "10" "7751" "0" "7751" "0" "c.7751T>C" "r.(?)" "p.(Val2584Ala)" "" "0000315340" "00025898" "90" "7779" "0" "7779" "0" "c.7779G>C" "r.(?)" "p.(Gln2593His)" "" "0000315340" "00000245" "90" "7854" "0" "7854" "0" "c.7854G>C" "r.(?)" "p.(Gln2618His)" "" "0000315341" "00025898" "70" "8361" "0" "8361" "0" "c.8361G>A" "r.(?)" "p.(Gln2787=)" "" "0000315341" "00000245" "70" "8436" "0" "8436" "0" "c.8436G>A" "r.(?)" "p.(Gln2812=)" "" "0000315342" "00025898" "10" "8622" "-132" "8622" "-132" "c.8622-132G>A" "r.(=)" "p.(=)" "" "0000315342" "00000245" "10" "8697" "-132" "8697" "-132" "c.8697-132G>A" "r.(=)" "p.(=)" "" "0000315343" "00025898" "10" "8622" "-47" "8622" "-47" "c.8622-47C>T" "r.(=)" "p.(=)" "" "0000315343" "00000245" "10" "8697" "-47" "8697" "-47" "c.8697-47C>T" "r.(=)" "p.(=)" "" "0000315344" "00025898" "10" "8994" "180" "8994" "180" "c.8994+180del" "r.(=)" "p.(=)" "" "0000315344" "00000245" "10" "9069" "180" "9069" "180" "c.9069+180del" "r.(=)" "p.(=)" "" "0000315345" "00025898" "10" "9330" "10" "9330" "10" "c.9330+10T>A" "r.(=)" "p.(=)" "" "0000315345" "00000245" "10" "9405" "10" "9405" "10" "c.9405+10T>A" "r.(=)" "p.(=)" "" "0000315346" "00025898" "10" "9331" "-5" "9331" "-3" "c.9331-5_9331-3dup" "r.spl?" "p.?" "" "0000315346" "00000245" "10" "9406" "-5" "9406" "-3" "c.9406-5_9406-3dup" "r.spl?" "p.?" "" "0000315347" "00025898" "10" "9331" "-3" "9331" "-3" "c.9331-3del" "r.spl?" "p.?" "" "0000315347" "00000245" "10" "9406" "-3" "9406" "-3" "c.9406-3del" "r.spl?" "p.?" "" "0000315348" "00025898" "10" "9492" "0" "9492" "0" "c.9492T>C" "r.(?)" "p.(Ser3164=)" "" "0000315348" "00000245" "10" "9567" "0" "9567" "0" "c.9567T>C" "r.(?)" "p.(Ser3189=)" "" "0000315349" "00025898" "30" "9592" "0" "9592" "0" "c.9592C>T" "r.(?)" "p.(Arg3198Trp)" "" "0000315349" "00000245" "30" "9667" "0" "9667" "0" "c.9667C>T" "r.(?)" "p.(Arg3223Trp)" "" "0000319660" "00025898" "50" "10049" "0" "10049" "0" "c.10049C>T" "r.(?)" "p.(Thr3350Ile)" "" "0000319660" "00000245" "50" "10124" "0" "10124" "0" "c.10124C>T" "r.(?)" "p.(Thr3375Ile)" "" "0000319661" "00025898" "70" "10061" "1" "10061" "1" "c.10061+1G>A" "r.spl?" "p.?" "" "0000319661" "00000245" "70" "10136" "1" "10136" "1" "c.10136+1G>A" "r.spl?" "p.?" "" "0000319662" "00025898" "10" "10061" "24" "10061" "24" "c.10061+24G>A" "r.(=)" "p.(=)" "" "0000319662" "00000245" "10" "10136" "24" "10136" "24" "c.10136+24G>A" "r.(=)" "p.(=)" "" "0000319663" "00025898" "10" "10065" "0" "10065" "0" "c.10065G>T" "r.(?)" "p.(Ala3355=)" "" "0000319663" "00000245" "10" "10140" "0" "10140" "0" "c.10140G>T" "r.(?)" "p.(Ala3380=)" "" "0000319664" "00025898" "30" "10155" "0" "10155" "0" "c.10155G>A" "r.(?)" "p.(Glu3385=)" "" "0000319664" "00000245" "30" "10230" "0" "10230" "0" "c.10230G>A" "r.(?)" "p.(Glu3410=)" "" "0000319665" "00025898" "10" "10219" "0" "10219" "0" "c.10219G>A" "r.(?)" "p.(Gly3407Arg)" "" "0000319665" "00000245" "10" "10294" "0" "10294" "0" "c.10294G>A" "r.(?)" "p.(Gly3432Arg)" "" "0000319666" "00025898" "50" "11000" "0" "11000" "0" "c.11000G>A" "r.(?)" "p.(Gly3667Asp)" "" "0000319666" "00000245" "50" "11075" "0" "11075" "0" "c.11075G>A" "r.(?)" "p.(Gly3692Asp)" "" "0000319667" "00025898" "50" "1108" "0" "1108" "0" "c.1108G>C" "r.(?)" "p.(Asp370His)" "" "0000319667" "00000245" "50" "1108" "0" "1108" "0" "c.1108G>C" "r.(?)" "p.(Asp370His)" "" "0000319668" "00025898" "10" "11044" "13" "11044" "13" "c.11044+13G>A" "r.(=)" "p.(=)" "" "0000319668" "00000245" "10" "11119" "13" "11119" "13" "c.11119+13G>A" "r.(=)" "p.(=)" "" "0000319669" "00025898" "30" "11071" "0" "11071" "0" "c.11071G>A" "r.(?)" "p.(Ala3691Thr)" "" "0000319669" "00000245" "30" "11146" "0" "11146" "0" "c.11146G>A" "r.(?)" "p.(Ala3716Thr)" "" "0000319670" "00025898" "50" "11158" "0" "11158" "0" "c.11158G>A" "r.(?)" "p.(Glu3720Lys)" "" "0000319670" "00000245" "50" "11233" "0" "11233" "0" "c.11233G>A" "r.(?)" "p.(Glu3745Lys)" "" "0000319671" "00025898" "50" "11195" "0" "11195" "0" "c.11195G>A" "r.(?)" "p.(Arg3732Gln)" "" "0000319671" "00000245" "50" "11270" "0" "11270" "0" "c.11270G>A" "r.(?)" "p.(Arg3757Gln)" "" "0000319672" "00025898" "30" "11495" "18" "11495" "18" "c.11495+18C>T" "r.(=)" "p.(=)" "" "0000319672" "00000245" "30" "11570" "18" "11570" "18" "c.11570+18C>T" "r.(=)" "p.(=)" "" "0000319673" "00025898" "50" "11537" "0" "11537" "0" "c.11537C>A" "r.(?)" "p.(Ala3846Asp)" "" "0000319673" "00000245" "50" "11612" "0" "11612" "0" "c.11612C>A" "r.(?)" "p.(Ala3871Asp)" "" "0000319674" "00025898" "30" "11613" "0" "11613" "0" "c.11613C>T" "r.(?)" "p.(Phe3871=)" "" "0000319674" "00000245" "30" "11688" "0" "11688" "0" "c.11688C>T" "r.(?)" "p.(Phe3896=)" "" "0000319675" "00025898" "30" "11619" "0" "11619" "0" "c.11619G>C" "r.(?)" "p.(Val3873=)" "" "0000319675" "00000245" "30" "11694" "0" "11694" "0" "c.11694G>C" "r.(?)" "p.(Val3898=)" "" "0000319676" "00025898" "50" "11691" "0" "11691" "0" "c.11691G>C" "r.(?)" "p.(Gln3897His)" "" "0000319676" "00000245" "50" "11766" "0" "11766" "0" "c.11766G>C" "r.(?)" "p.(Gln3922His)" "" "0000319677" "00025898" "30" "11715" "0" "11715" "0" "c.11715C>A" "r.(?)" "p.(Leu3905=)" "" "0000319677" "00000245" "30" "11790" "0" "11790" "0" "c.11790C>A" "r.(?)" "p.(Leu3930=)" "" "0000319678" "00025898" "50" "11759" "0" "11759" "0" "c.11759G>A" "r.(?)" "p.(Arg3920Gln)" "" "0000319678" "00000245" "50" "11834" "0" "11834" "0" "c.11834G>A" "r.(?)" "p.(Arg3945Gln)" "" "0000319680" "00025898" "10" "1206" "33" "1206" "33" "c.1206+33T>G" "r.(=)" "p.(=)" "" "0000319680" "00000245" "10" "1206" "33" "1206" "33" "c.1206+33T>G" "r.(=)" "p.(=)" "" "0000319681" "00025898" "10" "1293" "0" "1293" "0" "c.1293T>G" "r.(?)" "p.(Thr431=)" "" "0000319681" "00000245" "10" "1293" "0" "1293" "0" "c.1293T>G" "r.(?)" "p.(Thr431=)" "" "0000319682" "00025898" "50" "1700" "0" "1700" "0" "c.1700G>A" "r.(?)" "p.(Gly567Glu)" "" "0000319682" "00000245" "50" "1700" "0" "1700" "0" "c.1700G>A" "r.(?)" "p.(Gly567Glu)" "" "0000319683" "00025898" "30" "1832" "0" "1832" "0" "c.1832G>A" "r.(?)" "p.(Arg611Lys)" "" "0000319683" "00000245" "30" "1832" "0" "1832" "0" "c.1832G>A" "r.(?)" "p.(Arg611Lys)" "" "0000319684" "00025898" "50" "2051" "0" "2051" "0" "c.2051C>T" "r.(?)" "p.(Ser684Phe)" "" "0000319684" "00000245" "50" "2051" "0" "2051" "0" "c.2051C>T" "r.(?)" "p.(Ser684Phe)" "" "0000319685" "00025898" "50" "2282" "0" "2282" "0" "c.2282C>A" "r.(?)" "p.(Pro761His)" "" "0000319685" "00000245" "50" "2282" "0" "2282" "0" "c.2282C>A" "r.(?)" "p.(Pro761His)" "" "0000319686" "00025898" "50" "2470" "0" "2470" "0" "c.2470T>G" "r.(?)" "p.(Ser824Ala)" "" "0000319686" "00000245" "50" "2470" "0" "2470" "0" "c.2470T>G" "r.(?)" "p.(Ser824Ala)" "" "0000319687" "00025898" "30" "2485" "0" "2485" "0" "c.2485G>A" "r.(?)" "p.(Ala829Thr)" "" "0000319687" "00000245" "30" "2485" "0" "2485" "0" "c.2485G>A" "r.(?)" "p.(Ala829Thr)" "" "0000319689" "00025898" "50" "3224" "0" "3224" "0" "c.3224C>T" "r.(?)" "p.(Ser1075Phe)" "" "0000319689" "00000245" "50" "3224" "0" "3224" "0" "c.3224C>T" "r.(?)" "p.(Ser1075Phe)" "" "0000319690" "00025898" "50" "3430" "0" "3430" "0" "c.3430C>T" "r.(?)" "p.(Pro1144Ser)" "" "0000319690" "00000245" "50" "3430" "0" "3430" "0" "c.3430C>T" "r.(?)" "p.(Pro1144Ser)" "" "0000319691" "00025898" "10" "3667" "-7" "3667" "-7" "c.3667-7C>T" "r.(=)" "p.(=)" "" "0000319691" "00000245" "10" "3667" "-7" "3667" "-7" "c.3667-7C>T" "r.(=)" "p.(=)" "" "0000319692" "00025898" "50" "3827" "0" "3827" "0" "c.3827C>T" "r.(?)" "p.(Thr1276Ile)" "" "0000319692" "00000245" "50" "3827" "0" "3827" "0" "c.3827C>T" "r.(?)" "p.(Thr1276Ile)" "" "0000319693" "00025898" "10" "3837" "0" "3837" "0" "c.3837C>T" "r.(?)" "p.(Cys1279=)" "" "0000319693" "00000245" "10" "3837" "0" "3837" "0" "c.3837C>T" "r.(?)" "p.(Cys1279=)" "" "0000319694" "00025898" "50" "3866" "0" "3866" "0" "c.3866C>G" "r.(?)" "p.(Thr1289Ser)" "" "0000319694" "00000245" "50" "3866" "0" "3866" "0" "c.3866C>G" "r.(?)" "p.(Thr1289Ser)" "" "0000319695" "00025898" "50" "3920" "0" "3920" "0" "c.3920C>A" "r.(?)" "p.(Thr1307Asn)" "" "0000319695" "00000245" "50" "3920" "0" "3920" "0" "c.3920C>A" "r.(?)" "p.(Thr1307Asn)" "" "0000319696" "00025898" "50" "4337" "0" "4337" "0" "c.4337G>A" "r.(?)" "p.(Arg1446Gln)" "" "0000319696" "00000245" "50" "4412" "0" "4412" "0" "c.4412G>A" "r.(?)" "p.(Arg1471Gln)" "" "0000319697" "00025898" "50" "4549" "0" "4549" "0" "c.4549C>T" "r.(?)" "p.(Arg1517Cys)" "" "0000319697" "00000245" "50" "4624" "0" "4624" "0" "c.4624C>T" "r.(?)" "p.(Arg1542Cys)" "" "0000319698" "00025898" "50" "4550" "0" "4550" "0" "c.4550G>A" "r.(?)" "p.(Arg1517His)" "" "0000319698" "00000245" "50" "4625" "0" "4625" "0" "c.4625G>A" "r.(?)" "p.(Arg1542His)" "" "0000319699" "00025898" "30" "4746" "-13" "4746" "-13" "c.4746-13G>A" "r.(=)" "p.(=)" "" "0000319699" "00000245" "30" "4821" "-13" "4821" "-13" "c.4821-13G>A" "r.(=)" "p.(=)" "" "0000319700" "00025898" "30" "4746" "-14" "4746" "-14" "c.4746-14C>T" "r.(=)" "p.(=)" "" "0000319700" "00000245" "30" "4821" "-14" "4821" "-14" "c.4821-14C>T" "r.(=)" "p.(=)" "" "0000319701" "00025898" "10" "4746" "-15" "4746" "-15" "c.4746-15T>C" "r.(=)" "p.(=)" "" "0000319701" "00000245" "10" "4821" "-15" "4821" "-15" "c.4821-15T>C" "r.(=)" "p.(=)" "" "0000319702" "00025898" "50" "5285" "0" "5285" "0" "c.5285G>A" "r.(?)" "p.(Arg1762His)" "" "0000319702" "00000245" "50" "5360" "0" "5360" "0" "c.5360G>A" "r.(?)" "p.(Arg1787His)" "" "0000319703" "00025898" "50" "5501" "0" "5501" "0" "c.5501C>T" "r.(?)" "p.(Ser1834Leu)" "" "0000319703" "00000245" "50" "5576" "0" "5576" "0" "c.5576C>T" "r.(?)" "p.(Ser1859Leu)" "" "0000319704" "00025898" "50" "560" "0" "560" "0" "c.560G>A" "r.(?)" "p.(Arg187His)" "" "0000319704" "00000245" "50" "560" "0" "560" "0" "c.560G>A" "r.(?)" "p.(Arg187His)" "" "0000319705" "00025898" "50" "565" "0" "565" "0" "c.565T>C" "r.(?)" "p.(Phe189Leu)" "" "0000319705" "00000245" "50" "565" "0" "565" "0" "c.565T>C" "r.(?)" "p.(Phe189Leu)" "" "0000319706" "00025898" "30" "5606" "0" "5606" "0" "c.5606C>T" "r.(?)" "p.(Thr1869Met)" "" "0000319706" "00000245" "30" "5681" "0" "5681" "0" "c.5681C>T" "r.(?)" "p.(Thr1894Met)" "" "0000319707" "00025898" "50" "5653" "0" "5653" "0" "c.5653G>A" "r.(?)" "p.(Gly1885Arg)" "" "0000319707" "00000245" "50" "5728" "0" "5728" "0" "c.5728G>A" "r.(?)" "p.(Gly1910Arg)" "" "0000319708" "00025898" "10" "6455" "-4" "6455" "-4" "c.6455-4dup" "r.spl?" "p.?" "" "0000319708" "00000245" "10" "6530" "-4" "6530" "-4" "c.6530-4dup" "r.spl?" "p.?" "" "0000319709" "00025898" "30" "690" "0" "690" "0" "c.690C>T" "r.(?)" "p.(Tyr230=)" "" "0000319709" "00000245" "30" "690" "0" "690" "0" "c.690C>T" "r.(?)" "p.(Tyr230=)" "" "0000319710" "00025898" "30" "7050" "13" "7050" "13" "c.7050+13C>G" "r.(=)" "p.(=)" "" "0000319710" "00000245" "30" "7125" "13" "7125" "13" "c.7125+13C>G" "r.(=)" "p.(=)" "" "0000319711" "00025898" "50" "7151" "0" "7151" "0" "c.7151C>T" "r.(?)" "p.(Pro2384Leu)" "" "0000319711" "00000245" "50" "7226" "0" "7226" "0" "c.7226C>T" "r.(?)" "p.(Pro2409Leu)" "" "0000319712" "00025898" "30" "7152" "0" "7152" "0" "c.7152G>A" "r.(?)" "p.(Pro2384=)" "" "0000319712" "00000245" "30" "7227" "0" "7227" "0" "c.7227G>A" "r.(?)" "p.(Pro2409=)" "" "0000319713" "00025898" "10" "7676" "0" "7676" "0" "c.7676T>C" "r.(?)" "p.(Val2559Ala)" "" "0000319713" "00000245" "10" "7751" "0" "7751" "0" "c.7751T>C" "r.(?)" "p.(Val2584Ala)" "" "0000319714" "00025898" "30" "7695" "0" "7695" "0" "c.7695C>T" "r.(?)" "p.(Cys2565=)" "" "0000319714" "00000245" "30" "7770" "0" "7770" "0" "c.7770C>T" "r.(?)" "p.(Cys2590=)" "" "0000319715" "00025898" "50" "7708" "0" "7708" "0" "c.7708G>A" "r.(?)" "p.(Asp2570Asn)" "" "0000319715" "00000245" "50" "7783" "0" "7783" "0" "c.7783G>A" "r.(?)" "p.(Asp2595Asn)" "" "0000319716" "00025898" "50" "7712" "0" "7712" "0" "c.7712C>T" "r.(?)" "p.(Ser2571Phe)" "" "0000319716" "00000245" "50" "7787" "0" "7787" "0" "c.7787C>T" "r.(?)" "p.(Ser2596Phe)" "" "0000319717" "00025898" "30" "8010" "0" "8010" "0" "c.8010C>T" "r.(?)" "p.(Ala2670=)" "" "0000319717" "00000245" "30" "8085" "0" "8085" "0" "c.8085C>T" "r.(?)" "p.(Ala2695=)" "" "0000319718" "00025898" "30" "8349" "0" "8349" "0" "c.8349C>T" "r.(?)" "p.(Ser2783=)" "" "0000319718" "00000245" "30" "8424" "0" "8424" "0" "c.8424C>T" "r.(?)" "p.(Ser2808=)" "" "0000319719" "00025898" "10" "8570" "0" "8570" "0" "c.8570C>T" "r.(?)" "p.(Pro2857Leu)" "" "0000319719" "00000245" "10" "8645" "0" "8645" "0" "c.8645C>T" "r.(?)" "p.(Pro2882Leu)" "" "0000319720" "00025898" "30" "8750" "0" "8750" "0" "c.8750C>T" "r.(?)" "p.(Ser2917Leu)" "" "0000319720" "00000245" "30" "8825" "0" "8825" "0" "c.8825C>T" "r.(?)" "p.(Ser2942Leu)" "" "0000319721" "00025898" "50" "8945" "0" "8945" "0" "c.8945T>C" "r.(?)" "p.(Ile2982Thr)" "" "0000319721" "00000245" "50" "9020" "0" "9020" "0" "c.9020T>C" "r.(?)" "p.(Ile3007Thr)" "" "0000319722" "00025898" "30" "9094" "0" "9094" "0" "c.9094G>T" "r.(?)" "p.(Asp3032Tyr)" "" "0000319722" "00000245" "30" "9169" "0" "9169" "0" "c.9169G>T" "r.(?)" "p.(Asp3057Tyr)" "" "0000319723" "00025898" "30" "921" "0" "921" "0" "c.921G>A" "r.(?)" "p.(Met307Ile)" "" "0000319723" "00000245" "30" "921" "0" "921" "0" "c.921G>A" "r.(?)" "p.(Met307Ile)" "" "0000319724" "00025898" "10" "9330" "10" "9330" "10" "c.9330+10T>A" "r.(=)" "p.(=)" "" "0000319724" "00000245" "10" "9405" "10" "9405" "10" "c.9405+10T>A" "r.(=)" "p.(=)" "" "0000319725" "00025898" "10" "9492" "0" "9492" "0" "c.9492T>C" "r.(?)" "p.(Ser3164=)" "" "0000319725" "00000245" "10" "9567" "0" "9567" "0" "c.9567T>C" "r.(?)" "p.(Ser3189=)" "" "0000319726" "00025898" "30" "9783" "0" "9783" "0" "c.9783C>T" "r.(?)" "p.(Ser3261=)" "" "0000319726" "00000245" "30" "9858" "0" "9858" "0" "c.9858C>T" "r.(?)" "p.(Ser3286=)" "" "0000332216" "00025898" "50" "203" "0" "203" "0" "c.203A>G" "r.(?)" "p.(His68Arg)" "" "0000332216" "00000245" "50" "203" "0" "203" "0" "c.203A>G" "r.(?)" "p.(His68Arg)" "" "0000332218" "00025898" "50" "1354" "0" "1354" "0" "c.1354T>G" "r.(?)" "p.(Cys452Gly)" "" "0000332218" "00000245" "50" "1354" "0" "1354" "0" "c.1354T>G" "r.(?)" "p.(Cys452Gly)" "" "0000332219" "00025898" "30" "1463" "0" "1463" "0" "c.1463C>T" "r.(?)" "p.(Thr488Met)" "" "0000332219" "00000245" "30" "1463" "0" "1463" "0" "c.1463C>T" "r.(?)" "p.(Thr488Met)" "" "0000332220" "00025898" "50" "1559" "0" "1559" "0" "c.1559A>G" "r.(?)" "p.(His520Arg)" "" "0000332220" "00000245" "50" "1559" "0" "1559" "0" "c.1559A>G" "r.(?)" "p.(His520Arg)" "" "0000332221" "00025898" "30" "1832" "0" "1832" "0" "c.1832G>A" "r.(?)" "p.(Arg611Lys)" "" "0000332221" "00000245" "30" "1832" "0" "1832" "0" "c.1832G>A" "r.(?)" "p.(Arg611Lys)" "" "0000332223" "00025898" "50" "2471" "0" "2471" "0" "c.2471C>T" "r.(?)" "p.(Ser824Phe)" "" "0000332223" "00000245" "50" "2471" "0" "2471" "0" "c.2471C>T" "r.(?)" "p.(Ser824Phe)" "" "0000332224" "00025898" "50" "2515" "16595" "2515" "16595" "c.2515+16595C>T" "r.(=)" "p.(=)" "" "0000332224" "00000245" "50" "2515" "16595" "2515" "16595" "c.2515+16595C>T" "r.(=)" "p.(=)" "" "0000332226" "00025898" "50" "2783" "0" "2783" "0" "c.2783C>G" "r.(?)" "p.(Thr928Arg)" "" "0000332226" "00000245" "50" "2783" "0" "2783" "0" "c.2783C>G" "r.(?)" "p.(Thr928Arg)" "" "0000332227" "00025898" "50" "2935" "-8" "2935" "-8" "c.2935-8C>G" "r.(=)" "p.(=)" "" "0000332227" "00000245" "50" "2935" "-8" "2935" "-8" "c.2935-8C>G" "r.(=)" "p.(=)" "" "0000332229" "00025898" "50" "3445" "4" "3445" "4" "c.3445+4T>C" "r.spl?" "p.?" "" "0000332229" "00000245" "50" "3445" "4" "3445" "4" "c.3445+4T>C" "r.spl?" "p.?" "" "0000332230" "00025898" "50" "3870" "1" "3870" "1" "c.3870+1G>T" "r.spl?" "p.?" "" "0000332230" "00000245" "50" "3870" "1" "3870" "1" "c.3870+1G>T" "r.spl?" "p.?" "" "0000332231" "00025898" "50" "4003" "0" "4003" "0" "c.4003A>G" "r.(?)" "p.(Ile1335Val)" "" "0000332231" "00000245" "50" "4003" "0" "4003" "0" "c.4003A>G" "r.(?)" "p.(Ile1335Val)" "" "0000332233" "00025898" "50" "5803" "0" "5803" "0" "c.5803T>G" "r.(?)" "p.(Ser1935Ala)" "" "0000332233" "00000245" "50" "5878" "0" "5878" "0" "c.5878T>G" "r.(?)" "p.(Ser1960Ala)" "" "0000332234" "00025898" "50" "5902" "0" "5902" "0" "c.5902T>C" "r.(?)" "p.(Cys1968Arg)" "" "0000332234" "00000245" "50" "5977" "0" "5977" "0" "c.5977T>C" "r.(?)" "p.(Cys1993Arg)" "" "0000332235" "00025898" "30" "5905" "0" "5905" "0" "c.5905A>G" "r.(?)" "p.(Ile1969Val)" "" "0000332235" "00000245" "30" "5980" "0" "5980" "0" "c.5980A>G" "r.(?)" "p.(Ile1994Val)" "" "0000332236" "00025898" "50" "6530" "0" "6530" "0" "c.6530G>A" "r.(?)" "p.(Arg2177His)" "" "0000332236" "00000245" "50" "6605" "0" "6605" "0" "c.6605G>A" "r.(?)" "p.(Arg2202His)" "" "0000332237" "00025898" "50" "6713" "0" "6713" "0" "c.6713A>G" "r.(?)" "p.(Asn2238Ser)" "" "0000332237" "00000245" "50" "6788" "0" "6788" "0" "c.6788A>G" "r.(?)" "p.(Asn2263Ser)" "" "0000332238" "00025898" "50" "6719" "0" "6719" "0" "c.6719A>T" "r.(?)" "p.(Tyr2240Phe)" "" "0000332238" "00000245" "50" "6794" "0" "6794" "0" "c.6794A>T" "r.(?)" "p.(Tyr2265Phe)" "" "0000332240" "00025898" "30" "7678" "0" "7678" "0" "c.7678G>A" "r.(?)" "p.(Glu2560Lys)" "" "0000332240" "00000245" "30" "7753" "0" "7753" "0" "c.7753G>A" "r.(?)" "p.(Glu2585Lys)" "" "0000332241" "00025898" "50" "7699" "0" "7699" "0" "c.7699del" "r.(?)" "p.(Val2567Ter)" "" "0000332241" "00000245" "50" "7774" "0" "7774" "0" "c.7774del" "r.(?)" "p.(Val2592Ter)" "" "0000332244" "00025898" "50" "8443" "0" "8443" "0" "c.8443A>G" "r.(?)" "p.(Met2815Val)" "" "0000332244" "00000245" "50" "8518" "0" "8518" "0" "c.8518A>G" "r.(?)" "p.(Met2840Val)" "" "0000332246" "00025898" "50" "9035" "0" "9035" "0" "c.9035C>G" "r.(?)" "p.(Thr3012Ser)" "" "0000332246" "00000245" "50" "9110" "0" "9110" "0" "c.9110C>G" "r.(?)" "p.(Thr3037Ser)" "" "0000332248" "00025898" "30" "9253" "0" "9253" "0" "c.9253A>G" "r.(?)" "p.(Thr3085Ala)" "" "0000332248" "00000245" "30" "9328" "0" "9328" "0" "c.9328A>G" "r.(?)" "p.(Thr3110Ala)" "" "0000332249" "00025898" "30" "9337" "0" "9337" "0" "c.9337C>T" "r.(?)" "p.(Arg3113Cys)" "" "0000332249" "00000245" "30" "9412" "0" "9412" "0" "c.9412C>T" "r.(?)" "p.(Arg3138Cys)" "" "0000332250" "00025898" "30" "9338" "0" "9338" "0" "c.9338G>T" "r.(?)" "p.(Arg3113Leu)" "" "0000332250" "00000245" "30" "9413" "0" "9413" "0" "c.9413G>T" "r.(?)" "p.(Arg3138Leu)" "" "0000332251" "00025898" "30" "9340" "0" "9340" "0" "c.9340G>T" "r.(?)" "p.(Val3114Phe)" "" "0000332251" "00000245" "30" "9415" "0" "9415" "0" "c.9415G>T" "r.(?)" "p.(Val3139Phe)" "" "0000332252" "00025898" "30" "9349" "0" "9349" "0" "c.9349A>G" "r.(?)" "p.(Ser3117Gly)" "" "0000332252" "00000245" "30" "9424" "0" "9424" "0" "c.9424A>G" "r.(?)" "p.(Ser3142Gly)" "" "0000332253" "00025898" "30" "9370" "0" "9370" "0" "c.9370C>T" "r.(?)" "p.(Pro3124Ser)" "" "0000332253" "00000245" "30" "9445" "0" "9445" "0" "c.9445C>T" "r.(?)" "p.(Pro3149Ser)" "" "0000332257" "00025898" "30" "11071" "0" "11071" "0" "c.11071G>A" "r.(?)" "p.(Ala3691Thr)" "" "0000332257" "00000245" "30" "11146" "0" "11146" "0" "c.11146G>A" "r.(?)" "p.(Ala3716Thr)" "" "0000336869" "00025898" "70" "938" "-8" "938" "-8" "c.938-8A>G" "r.(=)" "p.(=)" "" "0000336869" "00000245" "70" "938" "-8" "938" "-8" "c.938-8A>G" "r.(=)" "p.(=)" "" "0000336871" "00025898" "30" "4224" "549" "4224" "549" "c.4224+549C>T" "r.(=)" "p.(=)" "" "0000336871" "00000245" "30" "4158" "-18" "4158" "-18" "c.4158-18C>T" "r.(=)" "p.(=)" "" "0000336872" "00025898" "30" "4950" "-29" "4950" "-29" "c.4950-29G>A" "r.(=)" "p.(=)" "" "0000336872" "00000245" "30" "5025" "-29" "5025" "-29" "c.5025-29G>A" "r.(=)" "p.(=)" "" "0000336875" "00025898" "90" "8622" "-2" "8622" "-2" "c.8622-2A>G" "r.spl?" "p.?" "" "0000336875" "00000245" "90" "8697" "-2" "8697" "-2" "c.8697-2A>G" "r.spl?" "p.?" "" "0000339209" "00025898" "10" "6963" "0" "6963" "0" "c.6963A>G" "r.(?)" "p.(Val2321=)" "" "0000339209" "00000245" "10" "7038" "0" "7038" "0" "c.7038A>G" "r.(?)" "p.(Val2346=)" "" "0000339210" "00025898" "10" "9492" "0" "9492" "0" "c.9492T>C" "r.(?)" "p.(Ser3164=)" "" "0000339210" "00000245" "10" "9567" "0" "9567" "0" "c.9567T>C" "r.(?)" "p.(Ser3189=)" "" "0000342138" "00025898" "30" "560" "0" "560" "0" "c.560G>A" "r.(?)" "p.(Arg187His)" "" "0000342138" "00000245" "30" "560" "0" "560" "0" "c.560G>A" "r.(?)" "p.(Arg187His)" "" "0000343528" "00025898" "90" "2911" "0" "2911" "0" "c.2911C>T" "r.(?)" "p.(Arg971Ter)" "" "0000343528" "00000245" "90" "2911" "0" "2911" "0" "c.2911C>T" "r.(?)" "p.(Arg971Ter)" "" "0000343676" "00025898" "50" "7724" "0" "7724" "0" "c.7724A>T" "r.(?)" "p.(Asn2575Ile)" "" "0000343676" "00000245" "50" "7799" "0" "7799" "0" "c.7799A>T" "r.(?)" "p.(Asn2600Ile)" "" "0000343697" "00025898" "30" "8903" "0" "8903" "0" "c.8903A>G" "r.(?)" "p.(Asn2968Ser)" "" "0000343697" "00000245" "30" "8978" "0" "8978" "0" "c.8978A>G" "r.(?)" "p.(Asn2993Ser)" "" "0000344966" "00025898" "90" "2347" "0" "2347" "0" "c.2347C>T" "r.(?)" "p.(Gln783Ter)" "" "0000344966" "00000245" "90" "2347" "0" "2347" "0" "c.2347C>T" "r.(?)" "p.(Gln783Ter)" "" "0000345767" "00025898" "50" "4763" "0" "4763" "0" "c.4763G>T" "r.(?)" "p.(Gly1588Val)" "" "0000345767" "00000245" "50" "4838" "0" "4838" "0" "c.4838G>T" "r.(?)" "p.(Gly1613Val)" "" "0000346007" "00025898" "10" "10219" "0" "10219" "0" "c.10219G>A" "r.(?)" "p.(Gly3407Arg)" "" "0000346007" "00000245" "10" "10294" "0" "10294" "0" "c.10294G>A" "r.(?)" "p.(Gly3432Arg)" "" "0000347072" "00025898" "90" "8572" "0" "8572" "0" "c.8572del" "r.(?)" "p.(Leu2858CysfsTer4)" "" "0000347072" "00000245" "90" "8647" "0" "8647" "0" "c.8647del" "r.(?)" "p.(Leu2883CysfsTer4)" "" "0000350047" "00025898" "50" "1000" "0" "1000" "0" "c.1000T>C" "r.(?)" "p.(Tyr334His)" "" "0000350047" "00000245" "50" "1000" "0" "1000" "0" "c.1000T>C" "r.(?)" "p.(Tyr334His)" "" "0000350052" "00025898" "90" "10302" "0" "10302" "0" "c.10302T>A" "r.(?)" "p.(Tyr3434Ter)" "" "0000350052" "00000245" "90" "10377" "0" "10377" "0" "c.10377T>A" "r.(?)" "p.(Tyr3459Ter)" "" "0000350429" "00025898" "10" "7676" "0" "7676" "0" "c.7676T>C" "r.(?)" "p.(Val2559Ala)" "" "0000350429" "00000245" "10" "7751" "0" "7751" "0" "c.7751T>C" "r.(?)" "p.(Val2584Ala)" "" "0000464281" "00000245" "90" "5331" "0" "5331" "0" "c.5331dup" "r.(?)" "p.(Asp1778*)" "" "0000464282" "00000245" "50" "10880" "0" "10899" "0" "c.10880_10899delinsTT" "r.(?)" "-" "" "0000464283" "00000245" "90" "10942" "56" "11713" "0" "c.10942+56_11713dup" "r.spl" "p.?" "56i_61" "0000465597" "00000245" "90" "3427" "0" "3427" "0" "c.3427C>T" "r.(3427c>u)" "p.(Arg1143*)" "23" "0000465598" "00000245" "90" "5025" "-1" "6121" "1" "c.(5024+1_5025-1)_(6121+1_6122-1)del" "r.?" "p.?" "31i_35i" "0000465599" "00000245" "90" "11695" "0" "11698" "0" "c.11695_11698del" "r.(11695_11698del)" "p.(Ser3901Argfs*40)" "64" "0000465600" "00000245" "90" "292" "-1" "1843" "1" "c.(291+1_292-1)_(1843+1_1844-1)dup" "r.?" "p.?" "3i_13i" "0000465601" "00000245" "90" "11556" "0" "11556" "0" "c.11556dup" "r.(11556dup)" "p.(Val3853Cysfs*33)" "58" "0000465602" "00000245" "90" "3666" "2" "3666" "2" "c.3666+2T>C" "r.spl?" "p?" "24i" "0000465603" "00000245" "90" "401" "0" "402" "0" "c.401_402insT" "r.(404dupu)" "p.(Leu135Phefs*11)" "4" "0000465604" "00000245" "90" "2825" "-1" "4820" "1" "c.(2824+1_2825-1)_(4820+1_4821-1)dup" "r.?" "p.?" "19i_30i" "0000465605" "00000245" "90" "581" "-1" "2333" "1" "c.(580+1_581-1)_(2333+1_2334-1)del" "r.?" "p.?" "5i_16i" "0000465606" "00000245" "90" "4474" "0" "4474" "0" "c.4474del" "r.(4474dela)" "p.(Ile1492Phefs*43)" "29" "0000465607" "00000245" "90" "2014" "-2" "2014" "-2" "c.2014-2A>G" "r.spl?" "p?" "14i" "0000465608" "00000245" "90" "219" "0" "220" "0" "c.219_220delinsT" "r.(219_220delinsu)" "p.(Lys73Asnfs*8)" "3" "0000465609" "00000245" "90" "7126" "-1" "8016" "1" "c.(7125+1_7126-1)_(8016+1_8017-1)del" "r.?" "p.?" "39i_43i" "0000465610" "00000245" "90" "11564" "0" "11564" "0" "c.11564del" "r.(11564dela)" "p.(Tyr3855Leufs*23)" "60" "0000465611" "00000245" "90" "581" "-1" "2333" "1" "c.(580+1_581-1)_(2333+1_2334-1)del" "r.?" "p.?" "5i_16i" "0000465612" "00000245" "90" "581" "-1" "2333" "1" "c.(580+1_581-1)_(2333+1_2334-1)del" "r.?" "p.?" "5i_16i" "0000465613" "00000245" "90" "8437" "-1" "9258" "1" "c.(8436+1_8437-1)_(9258+1_9259-1)del" "c.8437_9258del" "p.(Val2813_Lys3086del)" "45i_50i" "0000465614" "00000245" "90" "581" "-1" "2333" "1" "c.(580+1_581-1)_(2333+1_2334-1)del" "r.?" "p.?" "5i_16i" "0000465615" "00000245" "90" "8437" "-1" "9258" "1" "c.(8436+1_8437-1)_(9258+1_9259-1)del" "c.8437_9258del" "p.(Val2813_Lys3086del)" "45i_50i" "0000465616" "00000245" "90" "413" "-2" "413" "-2" "c.413-2A>G" "r.spl?" "p?" "4i" "0000465617" "00000245" "90" "292" "-1" "2333" "1" "c.(291+1_292-1)_(2333+1_2334-1)del" "r.?" "p.?" "3i_16i" "0000465618" "00000245" "90" "413" "-2" "413" "-2" "c.413-2A>G" "r.spl?" "p?" "4i" "0000465619" "00000245" "90" "292" "-1" "2333" "1" "c.(291+1_292-1)_(2333+1_2334-1)del" "r.?" "p.?" "3i_16i" "0000465620" "00000245" "90" "5331" "0" "5331" "0" "c.5331dup" "r.(?)" "p.(Asp1778*)" "34" "0000465621" "00000245" "50" "10880" "0" "10899" "0" "c.10880_10899delinsTT" "r.(?)" "-" "56" "0000465622" "00000245" "90" "10942" "56" "11713" "0" "c.10942+56_11713dup" "r.?" "p.?" "56i_61" "0000465623" "00000245" "90" "581" "-1" "2333" "1" "c.(580+1_581-1)_(2333+1_2334-1)del" "r.?" "p.?" "5i_16i" "0000533196" "00025898" "50" "8" "0" "8" "0" "c.8A>T" "r.(?)" "p.(Glu3Val)" "" "0000533196" "00000245" "50" "8" "0" "8" "0" "c.8A>T" "r.(?)" "p.(Glu3Val)" "" "0000533199" "00025898" "50" "560" "0" "560" "0" "c.560G>A" "r.(?)" "p.(Arg187His)" "" "0000533199" "00000245" "50" "560" "0" "560" "0" "c.560G>A" "r.(?)" "p.(Arg187His)" "" "0000533200" "00025898" "30" "581" "-8" "581" "-8" "c.581-8C>T" "r.(=)" "p.(=)" "" "0000533200" "00000245" "30" "581" "-8" "581" "-8" "c.581-8C>T" "r.(=)" "p.(=)" "" "0000533201" "00025898" "10" "763" "-89" "763" "-89" "c.763-89C>A" "r.(=)" "p.(=)" "" "0000533201" "00000245" "10" "763" "-89" "763" "-89" "c.763-89C>A" "r.(=)" "p.(=)" "" "0000533202" "00025898" "30" "874" "0" "874" "0" "c.874T>G" "r.(?)" "p.(Phe292Val)" "" "0000533202" "00000245" "30" "874" "0" "874" "0" "c.874T>G" "r.(?)" "p.(Phe292Val)" "" "0000533203" "00025898" "50" "885" "0" "885" "0" "c.885C>T" "r.(?)" "p.(Gly295=)" "" "0000533203" "00000245" "50" "885" "0" "885" "0" "c.885C>T" "r.(?)" "p.(Gly295=)" "" "0000533204" "00025898" "30" "983" "0" "983" "0" "c.983A>G" "r.(?)" "p.(His328Arg)" "" "0000533204" "00000245" "30" "983" "0" "983" "0" "c.983A>G" "r.(?)" "p.(His328Arg)" "" "0000533205" "00025898" "50" "1248" "0" "1248" "0" "c.1248G>T" "r.(?)" "p.(Gln416His)" "" "0000533205" "00000245" "50" "1248" "0" "1248" "0" "c.1248G>T" "r.(?)" "p.(Gln416His)" "" "0000533206" "00025898" "30" "1440" "0" "1440" "0" "c.1440C>T" "r.(?)" "p.(Phe480=)" "" "0000533206" "00000245" "30" "1440" "0" "1440" "0" "c.1440C>T" "r.(?)" "p.(Phe480=)" "" "0000533208" "00025898" "30" "1552" "0" "1552" "0" "c.1552A>T" "r.(?)" "p.(Thr518Ser)" "" "0000533208" "00000245" "30" "1552" "0" "1552" "0" "c.1552A>T" "r.(?)" "p.(Thr518Ser)" "" "0000533209" "00025898" "30" "1768" "0" "1768" "0" "c.1768G>A" "r.(?)" "p.(Ala590Thr)" "" "0000533209" "00000245" "30" "1768" "0" "1768" "0" "c.1768G>A" "r.(?)" "p.(Ala590Thr)" "" "0000533210" "00025898" "30" "1832" "0" "1832" "0" "c.1832G>A" "r.(?)" "p.(Arg611Lys)" "" "0000533210" "00000245" "30" "1832" "0" "1832" "0" "c.1832G>A" "r.(?)" "p.(Arg611Lys)" "" "0000533211" "00025898" "50" "1888" "0" "1888" "0" "c.1888G>A" "r.(?)" "p.(Ala630Thr)" "" "0000533211" "00000245" "50" "1888" "0" "1888" "0" "c.1888G>A" "r.(?)" "p.(Ala630Thr)" "" "0000533212" "00025898" "10" "2013" "61" "2013" "61" "c.2013+61del" "r.(=)" "p.(=)" "" "0000533212" "00000245" "10" "2013" "61" "2013" "61" "c.2013+61del" "r.(=)" "p.(=)" "" "0000533213" "00025898" "50" "2018" "0" "2018" "0" "c.2018C>T" "r.(?)" "p.(Ser673Leu)" "" "0000533213" "00000245" "50" "2018" "0" "2018" "0" "c.2018C>T" "r.(?)" "p.(Ser673Leu)" "" "0000533214" "00025898" "10" "2275" "0" "2275" "0" "c.2275G>C" "r.(?)" "p.(Val759Leu)" "" "0000533214" "00000245" "10" "2275" "0" "2275" "0" "c.2275G>C" "r.(?)" "p.(Val759Leu)" "" "0000533215" "00025898" "30" "2419" "0" "2419" "0" "c.2419C>G" "r.(?)" "p.(Leu807Val)" "" "0000533215" "00000245" "30" "2419" "0" "2419" "0" "c.2419C>G" "r.(?)" "p.(Leu807Val)" "" "0000533216" "00025898" "10" "2451" "0" "2451" "0" "c.2451T>C" "r.(?)" "p.(His817=)" "" "0000533216" "00000245" "10" "2451" "0" "2451" "0" "c.2451T>C" "r.(?)" "p.(His817=)" "" "0000533217" "00025898" "50" "2471" "0" "2471" "0" "c.2471C>T" "r.(?)" "p.(Ser824Phe)" "" "0000533217" "00000245" "50" "2471" "0" "2471" "0" "c.2471C>T" "r.(?)" "p.(Ser824Phe)" "" "0000533219" "00025898" "10" "2485" "0" "2485" "0" "c.2485G>A" "r.(?)" "p.(Ala829Thr)" "" "0000533219" "00000245" "10" "2485" "0" "2485" "0" "c.2485G>A" "r.(?)" "p.(Ala829Thr)" "" "0000533220" "00025898" "30" "2515" "16527" "2515" "16527" "c.2515+16527C>T" "r.(=)" "p.(=)" "" "0000533220" "00000245" "30" "2515" "16527" "2515" "16527" "c.2515+16527C>T" "r.(=)" "p.(=)" "" "0000533222" "00025898" "50" "2596" "0" "2596" "0" "c.2596G>A" "r.(?)" "p.(Val866Ile)" "" "0000533222" "00000245" "50" "2596" "0" "2596" "0" "c.2596G>A" "r.(?)" "p.(Val866Ile)" "" "0000533223" "00025898" "30" "2880" "0" "2880" "0" "c.2880A>T" "r.(?)" "p.(Leu960Phe)" "" "0000533223" "00000245" "30" "2880" "0" "2880" "0" "c.2880A>T" "r.(?)" "p.(Leu960Phe)" "" "0000533224" "00025898" "90" "2934" "1" "2934" "2" "c.2934+1_2934+2del" "r.spl?" "p.?" "" "0000533224" "00000245" "90" "2934" "1" "2934" "2" "c.2934+1_2934+2del" "r.spl?" "p.?" "" "0000533225" "00025898" "30" "3031" "0" "3031" "0" "c.3031T>C" "r.(?)" "p.(Tyr1011His)" "" "0000533225" "00000245" "30" "3031" "0" "3031" "0" "c.3031T>C" "r.(?)" "p.(Tyr1011His)" "" "0000533226" "00025898" "10" "3083" "-86" "3083" "-86" "c.3083-86A>T" "r.(=)" "p.(=)" "" "0000533226" "00000245" "10" "3083" "-86" "3083" "-86" "c.3083-86A>T" "r.(=)" "p.(=)" "" "0000533227" "00025898" "30" "3083" "-8" "3083" "-8" "c.3083-8G>A" "r.(=)" "p.(=)" "" "0000533227" "00000245" "30" "3083" "-8" "3083" "-8" "c.3083-8G>A" "r.(=)" "p.(=)" "" "0000533228" "00025898" "50" "3203" "0" "3203" "0" "c.3203C>T" "r.(?)" "p.(Thr1068Ile)" "" "0000533228" "00000245" "50" "3203" "0" "3203" "0" "c.3203C>T" "r.(?)" "p.(Thr1068Ile)" "" "0000533229" "00025898" "30" "3203" "0" "3203" "0" "c.3203C>T" "r.(?)" "p.(Thr1068Ile)" "" "0000533229" "00000245" "30" "3203" "0" "3203" "0" "c.3203C>T" "r.(?)" "p.(Thr1068Ile)" "" "0000533230" "00025898" "10" "3203" "0" "3203" "0" "c.3203C>T" "r.(?)" "p.(Thr1068Ile)" "" "0000533230" "00000245" "10" "3203" "0" "3203" "0" "c.3203C>T" "r.(?)" "p.(Thr1068Ile)" "" "0000533231" "00025898" "10" "3203" "0" "3203" "0" "c.3203C>T" "r.(?)" "p.(Thr1068Ile)" "" "0000533231" "00000245" "10" "3203" "0" "3203" "0" "c.3203C>T" "r.(?)" "p.(Thr1068Ile)" "" "0000533232" "00025898" "30" "3386" "0" "3386" "0" "c.3386A>G" "r.(?)" "p.(Lys1129Arg)" "" "0000533232" "00000245" "30" "3386" "0" "3386" "0" "c.3386A>G" "r.(?)" "p.(Lys1129Arg)" "" "0000533233" "00025898" "10" "3386" "0" "3386" "0" "c.3386A>G" "r.(?)" "p.(Lys1129Arg)" "" "0000533233" "00000245" "10" "3386" "0" "3386" "0" "c.3386A>G" "r.(?)" "p.(Lys1129Arg)" "" "0000533234" "00025898" "30" "3413" "0" "3413" "0" "c.3413C>T" "r.(?)" "p.(Pro1138Leu)" "" "0000533234" "00000245" "30" "3413" "0" "3413" "0" "c.3413C>T" "r.(?)" "p.(Pro1138Leu)" "" "0000533235" "00025898" "50" "3428" "0" "3428" "0" "c.3428G>A" "r.(?)" "p.(Arg1143Gln)" "" "0000533235" "00000245" "50" "3428" "0" "3428" "0" "c.3428G>A" "r.(?)" "p.(Arg1143Gln)" "" "0000533236" "00025898" "30" "3448" "0" "3448" "0" "c.3448G>A" "r.(?)" "p.(Asp1150Asn)" "" "0000533236" "00000245" "30" "3448" "0" "3448" "0" "c.3448G>A" "r.(?)" "p.(Asp1150Asn)" "" "0000533237" "00025898" "30" "3584" "0" "3584" "0" "c.3584C>T" "r.(?)" "p.(Thr1195Met)" "" "0000533237" "00000245" "30" "3584" "0" "3584" "0" "c.3584C>T" "r.(?)" "p.(Thr1195Met)" "" "0000533238" "00025898" "10" "3666" "152" "3666" "152" "c.3666+152T>C" "r.(=)" "p.(=)" "" "0000533238" "00000245" "10" "3666" "152" "3666" "152" "c.3666+152T>C" "r.(=)" "p.(=)" "" "0000533239" "00025898" "10" "3666" "199" "3666" "199" "c.3666+199A>G" "r.(=)" "p.(=)" "" "0000533239" "00000245" "10" "3666" "199" "3666" "199" "c.3666+199A>G" "r.(=)" "p.(=)" "" "0000533240" "00025898" "10" "3667" "-7" "3667" "-7" "c.3667-7C>T" "r.(=)" "p.(=)" "" "0000533240" "00000245" "10" "3667" "-7" "3667" "-7" "c.3667-7C>T" "r.(=)" "p.(=)" "" "0000533241" "00025898" "30" "3751" "0" "3751" "0" "c.3751A>G" "r.(?)" "p.(Thr1251Ala)" "" "0000533241" "00000245" "30" "3751" "0" "3751" "0" "c.3751A>G" "r.(?)" "p.(Thr1251Ala)" "" "0000533242" "00025898" "50" "3751" "0" "3751" "0" "c.3751A>G" "r.(?)" "p.(Thr1251Ala)" "" "0000533242" "00000245" "50" "3751" "0" "3751" "0" "c.3751A>G" "r.(?)" "p.(Thr1251Ala)" "" "0000533243" "00025898" "50" "3866" "0" "3866" "0" "c.3866C>G" "r.(?)" "p.(Thr1289Ser)" "" "0000533243" "00000245" "50" "3866" "0" "3866" "0" "c.3866C>G" "r.(?)" "p.(Thr1289Ser)" "" "0000533244" "00025898" "30" "4037" "0" "4037" "0" "c.4037G>A" "r.(?)" "p.(Gly1346Asp)" "" "0000533244" "00000245" "30" "4037" "0" "4037" "0" "c.4037G>A" "r.(?)" "p.(Gly1346Asp)" "" "0000533245" "00025898" "30" "4224" "689" "4224" "689" "c.4224+689G>A" "r.(=)" "p.(=)" "" "0000533245" "00000245" "30" "4280" "0" "4280" "0" "c.4280G>A" "r.(?)" "p.(Cys1427Tyr)" "" "0000533247" "00025898" "30" "4537" "0" "4537" "0" "c.4537A>G" "r.(?)" "p.(Thr1513Ala)" "" "0000533247" "00000245" "30" "4612" "0" "4612" "0" "c.4612A>G" "r.(?)" "p.(Thr1538Ala)" "" "0000533249" "00025898" "30" "4757" "0" "4757" "0" "c.4757A>G" "r.(?)" "p.(Asn1586Ser)" "" "0000533249" "00000245" "30" "4832" "0" "4832" "0" "c.4832A>G" "r.(?)" "p.(Asn1611Ser)" "" "0000533250" "00025898" "30" "4791" "0" "4791" "0" "c.4791C>T" "r.(?)" "p.(Ile1597=)" "" "0000533250" "00000245" "30" "4866" "0" "4866" "0" "c.4866C>T" "r.(?)" "p.(Ile1622=)" "" "0000533251" "00025898" "30" "4800" "0" "4800" "0" "c.4800A>G" "r.(?)" "p.(Arg1600=)" "" "0000533251" "00000245" "30" "4875" "0" "4875" "0" "c.4875A>G" "r.(?)" "p.(Arg1625=)" "" "0000533252" "00025898" "30" "4888" "0" "4888" "0" "c.4888G>T" "r.(?)" "p.(Val1630Leu)" "" "0000533252" "00000245" "30" "4963" "0" "4963" "0" "c.4963G>T" "r.(?)" "p.(Val1655Leu)" "" "0000533253" "00025898" "10" "4949" "226" "4949" "226" "c.4949+226dup" "r.(=)" "p.(=)" "" "0000533253" "00000245" "10" "5024" "226" "5024" "226" "c.5024+226dup" "r.(=)" "p.(=)" "" "0000533254" "00025898" "10" "4949" "231" "4949" "231" "c.4949+231dup" "r.(=)" "p.(=)" "" "0000533254" "00000245" "10" "5024" "231" "5024" "231" "c.5024+231dup" "r.(=)" "p.(=)" "" "0000533255" "00025898" "30" "4986" "0" "4986" "0" "c.4986C>T" "r.(?)" "p.(Thr1662=)" "" "0000533255" "00000245" "30" "5061" "0" "5061" "0" "c.5061C>T" "r.(?)" "p.(Thr1687=)" "" "0000533256" "00025898" "30" "5012" "0" "5012" "0" "c.5012G>A" "r.(?)" "p.(Arg1671Gln)" "" "0000533256" "00000245" "30" "5087" "0" "5087" "0" "c.5087G>A" "r.(?)" "p.(Arg1696Gln)" "" "0000533257" "00025898" "30" "5077" "-14" "5077" "-14" "c.5077-14C>T" "r.(=)" "p.(=)" "" "0000533257" "00000245" "30" "5152" "-14" "5152" "-14" "c.5152-14C>T" "r.(=)" "p.(=)" "" "0000533258" "00025898" "50" "5220" "0" "5220" "0" "c.5220G>T" "r.(?)" "p.(Glu1740Asp)" "" "0000533258" "00000245" "50" "5295" "0" "5295" "0" "c.5295G>T" "r.(?)" "p.(Glu1765Asp)" "" "0000533259" "00025898" "10" "5517" "0" "5517" "0" "c.5517G>A" "r.(?)" "p.(Gln1839=)" "" "0000533259" "00000245" "10" "5592" "0" "5592" "0" "c.5592G>A" "r.(?)" "p.(Gln1864=)" "" "0000533260" "00025898" "30" "5606" "0" "5606" "0" "c.5606C>T" "r.(?)" "p.(Thr1869Met)" "" "0000533260" "00000245" "30" "5681" "0" "5681" "0" "c.5681C>T" "r.(?)" "p.(Thr1894Met)" "" "0000533261" "00025898" "30" "5607" "0" "5607" "0" "c.5607G>A" "r.(?)" "p.(Thr1869=)" "" "0000533261" "00000245" "30" "5682" "0" "5682" "0" "c.5682G>A" "r.(?)" "p.(Thr1894=)" "" "0000533262" "00025898" "30" "5905" "0" "5905" "0" "c.5905A>G" "r.(?)" "p.(Ile1969Val)" "" "0000533262" "00000245" "30" "5980" "0" "5980" "0" "c.5980A>G" "r.(?)" "p.(Ile1994Val)" "" "0000533263" "00025898" "50" "5908" "2" "5908" "2" "c.5908+2dup" "r.spl?" "p.?" "" "0000533263" "00000245" "50" "5983" "2" "5983" "2" "c.5983+2dup" "r.spl?" "p.?" "" "0000533264" "00025898" "10" "6047" "-2771" "6047" "-2771" "c.6047-2771C>T" "r.(=)" "p.(=)" "" "0000533264" "00000245" "10" "6122" "-2771" "6122" "-2771" "c.6122-2771C>T" "r.(=)" "p.(=)" "" "0000533266" "00025898" "50" "6416" "0" "6416" "0" "c.6416A>G" "r.(?)" "p.(Asn2139Ser)" "" "0000533266" "00000245" "50" "6491" "0" "6491" "0" "c.6491A>G" "r.(?)" "p.(Asn2164Ser)" "" "0000533267" "00025898" "30" "6416" "0" "6416" "0" "c.6416A>G" "r.(?)" "p.(Asn2139Ser)" "" "0000533267" "00000245" "30" "6491" "0" "6491" "0" "c.6491A>G" "r.(?)" "p.(Asn2164Ser)" "" "0000533268" "00025898" "10" "6416" "0" "6416" "0" "c.6416A>G" "r.(?)" "p.(Asn2139Ser)" "" "0000533268" "00000245" "10" "6491" "0" "6491" "0" "c.6491A>G" "r.(?)" "p.(Asn2164Ser)" "" "0000533269" "00025898" "50" "6808" "0" "6808" "0" "c.6808A>T" "r.(?)" "p.(Ser2270Cys)" "" "0000533269" "00000245" "50" "6883" "0" "6883" "0" "c.6883A>T" "r.(?)" "p.(Ser2295Cys)" "" "0000533270" "00025898" "90" "7050" "1" "7050" "1" "c.7050+1G>T" "r.spl?" "p.?" "" "0000533270" "00000245" "90" "7125" "1" "7125" "1" "c.7125+1G>T" "r.spl?" "p.?" "" "0000533271" "00025898" "30" "7429" "6" "7429" "6" "c.7429+6C>T" "r.(=)" "p.(=)" "" "0000533271" "00000245" "30" "7504" "6" "7504" "6" "c.7504+6C>T" "r.(=)" "p.(=)" "" "0000533272" "00025898" "30" "7669" "0" "7669" "0" "c.7669G>A" "r.(?)" "p.(Asp2557Asn)" "" "0000533272" "00000245" "30" "7744" "0" "7744" "0" "c.7744G>A" "r.(?)" "p.(Asp2582Asn)" "" "0000533273" "00025898" "50" "7678" "0" "7678" "0" "c.7678G>A" "r.(?)" "p.(Glu2560Lys)" "" "0000533273" "00000245" "50" "7753" "0" "7753" "0" "c.7753G>A" "r.(?)" "p.(Glu2585Lys)" "" "0000533274" "00025898" "30" "7678" "0" "7678" "0" "c.7678G>A" "r.(?)" "p.(Glu2560Lys)" "" "0000533274" "00000245" "30" "7753" "0" "7753" "0" "c.7753G>A" "r.(?)" "p.(Glu2585Lys)" "" "0000533275" "00025898" "50" "7724" "0" "7724" "0" "c.7724A>T" "r.(?)" "p.(Asn2575Ile)" "" "0000533275" "00000245" "50" "7799" "0" "7799" "0" "c.7799A>T" "r.(?)" "p.(Asn2600Ile)" "" "0000533276" "00025898" "50" "8161" "0" "8161" "0" "c.8161G>C" "r.(?)" "p.(Val2721Leu)" "" "0000533276" "00000245" "50" "8236" "0" "8236" "0" "c.8236G>C" "r.(?)" "p.(Val2746Leu)" "" "0000533279" "00025898" "50" "8390" "0" "8390" "0" "c.8390A>G" "r.(?)" "p.(Tyr2797Cys)" "" "0000533279" "00000245" "50" "8465" "0" "8465" "0" "c.8465A>G" "r.(?)" "p.(Tyr2822Cys)" "" "0000533282" "00025898" "50" "8903" "0" "8903" "0" "c.8903A>G" "r.(?)" "p.(Asn2968Ser)" "" "0000533282" "00000245" "50" "8978" "0" "8978" "0" "c.8978A>G" "r.(?)" "p.(Asn2993Ser)" "" "0000533284" "00025898" "30" "9331" "-1" "9331" "-1" "c.9331-1G>T" "r.spl?" "p.?" "" "0000533295" "00025898" "50" "9337" "0" "9338" "0" "c.9337_9338del" "r.(?)" "p.(Arg3113CysfsTer8)" "" "0000533295" "00000245" "50" "9412" "0" "9413" "0" "c.9412_9413del" "r.(?)" "p.(Arg3138CysfsTer8)" "" "0000533296" "00025898" "30" "9343" "0" "9356" "0" "c.9343_9356del" "r.(?)" "p.(Pro3115PhefsTer2)" "" "0000533296" "00000245" "30" "9418" "0" "9431" "0" "c.9418_9431del" "r.(?)" "p.(Pro3140PhefsTer2)" "" "0000533297" "00025898" "30" "9538" "0" "9538" "0" "c.9538A>G" "r.(?)" "p.(Ile3180Val)" "" "0000533297" "00000245" "30" "9613" "0" "9613" "0" "c.9613A>G" "r.(?)" "p.(Ile3205Val)" "" "0000533298" "00025898" "30" "9609" "0" "9609" "0" "c.9609T>C" "r.(?)" "p.(Cys3203=)" "" "0000533298" "00000245" "30" "9684" "0" "9684" "0" "c.9684T>C" "r.(?)" "p.(Cys3228=)" "" "0000533299" "00025898" "30" "9696" "0" "9696" "0" "c.9696C>A" "r.(?)" "p.(Ile3232=)" "" "0000533299" "00000245" "30" "9771" "0" "9771" "0" "c.9771C>A" "r.(?)" "p.(Ile3257=)" "" "0000533301" "00025898" "10" "9742" "94" "9742" "94" "c.9742+94dup" "r.(=)" "p.(=)" "" "0000533301" "00000245" "10" "9817" "94" "9817" "94" "c.9817+94dup" "r.(=)" "p.(=)" "" "0000533302" "00025898" "30" "10049" "0" "10049" "0" "c.10049C>T" "r.(?)" "p.(Thr3350Ile)" "" "0000533302" "00000245" "30" "10124" "0" "10124" "0" "c.10124C>T" "r.(?)" "p.(Thr3375Ile)" "" "0000533304" "00025898" "50" "10324" "0" "10324" "0" "c.10324G>A" "r.(?)" "p.(Ala3442Thr)" "" "0000533304" "00000245" "50" "10399" "0" "10399" "0" "c.10399G>A" "r.(?)" "p.(Ala3467Thr)" "" "0000533306" "00025898" "30" "10905" "0" "10905" "0" "c.10905T>C" "r.(?)" "p.(Pro3635=)" "" "0000533306" "00000245" "30" "10980" "0" "10980" "0" "c.10980T>C" "r.(?)" "p.(Pro3660=)" "" "0000533307" "00025898" "30" "11044" "5" "11044" "5" "c.11044+5C>T" "r.spl?" "p.?" "" "0000533307" "00000245" "30" "11119" "5" "11119" "5" "c.11119+5C>T" "r.spl?" "p.?" "" "0000533308" "00025898" "30" "11071" "0" "11071" "0" "c.11071G>A" "r.(?)" "p.(Ala3691Thr)" "" "0000533308" "00000245" "30" "11146" "0" "11146" "0" "c.11146G>A" "r.(?)" "p.(Ala3716Thr)" "" "0000533309" "00025898" "30" "11071" "0" "11071" "0" "c.11071G>A" "r.(?)" "p.(Ala3691Thr)" "" "0000533309" "00000245" "30" "11146" "0" "11146" "0" "c.11146G>A" "r.(?)" "p.(Ala3716Thr)" "" "0000533310" "00025898" "30" "11195" "0" "11195" "0" "c.11195G>A" "r.(?)" "p.(Arg3732Gln)" "" "0000533310" "00000245" "30" "11270" "0" "11270" "0" "c.11270G>A" "r.(?)" "p.(Arg3757Gln)" "" "0000533311" "00025898" "50" "11338" "0" "11338" "0" "c.11338G>T" "r.(?)" "p.(Val3780Leu)" "" "0000533311" "00000245" "50" "11413" "0" "11413" "0" "c.11413G>T" "r.(?)" "p.(Val3805Leu)" "" "0000533313" "00025898" "30" "11683" "0" "11683" "0" "c.11683A>G" "r.(?)" "p.(Ser3895Gly)" "" "0000533313" "00000245" "30" "11758" "0" "11758" "0" "c.11758A>G" "r.(?)" "p.(Ser3920Gly)" "" "0000533314" "00025898" "30" "11692" "0" "11692" "0" "c.11692A>C" "r.(?)" "p.(Asn3898His)" "" "0000533314" "00000245" "30" "11767" "0" "11767" "0" "c.11767A>C" "r.(?)" "p.(Asn3923His)" "" "0000533315" "00025898" "30" "11861" "0" "11861" "0" "c.11861C>T" "r.(?)" "p.(Pro3954Leu)" "" "0000533315" "00000245" "30" "11936" "0" "11936" "0" "c.11936C>T" "r.(?)" "p.(Pro3979Leu)" "" "0000533317" "00025898" "50" "11967" "0" "11970" "0" "c.11967_11970dup" "r.(?)" "p.(Ala3991Ter)" "" "0000533317" "00000245" "50" "12042" "0" "12045" "0" "c.12042_12045dup" "r.(?)" "p.(Ala4016Ter)" "" "0000533318" "00025898" "10" "12027" "0" "12030" "0" "c.*33_*36dup" "r.(=)" "p.(=)" "" "0000533318" "00000245" "10" "12102" "0" "12105" "0" "c.*33_*36dup" "r.(=)" "p.(=)" "" "0000611350" "00025898" "30" "1081" "0" "1081" "0" "c.1081G>A" "r.(?)" "p.(Asp361Asn)" "" "0000611350" "00000245" "30" "1081" "0" "1081" "0" "c.1081G>A" "r.(?)" "p.(Asp361Asn)" "" "0000611351" "00025898" "30" "1552" "0" "1552" "0" "c.1552A>T" "r.(?)" "p.(Thr518Ser)" "" "0000611351" "00000245" "30" "1552" "0" "1552" "0" "c.1552A>T" "r.(?)" "p.(Thr518Ser)" "" "0000611352" "00025898" "30" "2485" "0" "2485" "0" "c.2485G>A" "r.(?)" "p.(Ala829Thr)" "" "0000611352" "00000245" "30" "2485" "0" "2485" "0" "c.2485G>A" "r.(?)" "p.(Ala829Thr)" "" "0000611353" "00025898" "30" "3075" "0" "3075" "0" "c.3075G>A" "r.(?)" "p.(Thr1025=)" "" "0000611353" "00000245" "30" "3075" "0" "3075" "0" "c.3075G>A" "r.(?)" "p.(Thr1025=)" "" "0000611355" "00025898" "30" "3961" "0" "3961" "0" "c.3961C>T" "r.(?)" "p.(Arg1321Cys)" "" "0000611355" "00000245" "30" "3961" "0" "3961" "0" "c.3961C>T" "r.(?)" "p.(Arg1321Cys)" "" "0000611356" "00025898" "50" "6530" "0" "6530" "0" "c.6530G>A" "r.(?)" "p.(Arg2177His)" "" "0000611356" "00000245" "50" "6605" "0" "6605" "0" "c.6605G>A" "r.(?)" "p.(Arg2202His)" "" "0000611357" "00025898" "30" "10824" "0" "10824" "0" "c.10824C>T" "r.(?)" "p.(His3608=)" "" "0000611357" "00000245" "30" "10899" "0" "10899" "0" "c.10899C>T" "r.(?)" "p.(His3633=)" "" "0000611358" "00025898" "30" "11195" "0" "11195" "0" "c.11195G>A" "r.(?)" "p.(Arg3732Gln)" "" "0000611358" "00000245" "30" "11270" "0" "11270" "0" "c.11270G>A" "r.(?)" "p.(Arg3757Gln)" "" "0000611359" "00025898" "30" "11884" "0" "11884" "0" "c.11884C>G" "r.(?)" "p.(Pro3962Ala)" "" "0000611359" "00000245" "30" "11959" "0" "11959" "0" "c.11959C>G" "r.(?)" "p.(Pro3987Ala)" "" "0000611360" "00025898" "50" "11967" "0" "11970" "0" "c.11967_11970dup" "r.(?)" "p.(Ala3991Ter)" "" "0000611360" "00000245" "50" "12042" "0" "12045" "0" "c.12042_12045dup" "r.(?)" "p.(Ala4016Ter)" "" "0000621964" "00025898" "50" "505" "0" "505" "0" "c.505C>A" "r.(?)" "p.(Leu169Ile)" "" "0000621964" "00000245" "50" "505" "0" "505" "0" "c.505C>A" "r.(?)" "p.(Leu169Ile)" "" "0000621965" "00025898" "30" "1303" "-9" "1303" "-9" "c.1303-9G>A" "r.(=)" "p.(=)" "" "0000621965" "00000245" "30" "1303" "-9" "1303" "-9" "c.1303-9G>A" "r.(=)" "p.(=)" "" "0000621967" "00025898" "50" "3790" "0" "3790" "0" "c.3790C>T" "r.(?)" "p.(Pro1264Ser)" "" "0000621967" "00000245" "50" "3790" "0" "3790" "0" "c.3790C>T" "r.(?)" "p.(Pro1264Ser)" "" "0000621968" "00025898" "30" "4225" "-6" "4225" "-6" "c.4225-6G>A" "r.(=)" "p.(=)" "" "0000621968" "00000245" "30" "4300" "-6" "4300" "-6" "c.4300-6G>A" "r.(=)" "p.(=)" "" "0000621969" "00025898" "30" "5761" "0" "5761" "0" "c.5761A>G" "r.(?)" "p.(Thr1921Ala)" "" "0000621969" "00000245" "30" "5836" "0" "5836" "0" "c.5836A>G" "r.(?)" "p.(Thr1946Ala)" "" "0000621970" "00025898" "30" "8443" "0" "8443" "0" "c.8443A>G" "r.(?)" "p.(Met2815Val)" "" "0000621970" "00000245" "30" "8518" "0" "8518" "0" "c.8518A>G" "r.(?)" "p.(Met2840Val)" "" "0000621971" "00025898" "50" "8903" "0" "8903" "0" "c.8903A>G" "r.(?)" "p.(Asn2968Ser)" "" "0000621971" "00000245" "50" "8978" "0" "8978" "0" "c.8978A>G" "r.(?)" "p.(Asn2993Ser)" "" "0000621972" "00025898" "30" "10263" "0" "10263" "0" "c.10263G>A" "r.(?)" "p.(Glu3421=)" "" "0000621972" "00000245" "30" "10338" "0" "10338" "0" "c.10338G>A" "r.(?)" "p.(Glu3446=)" "" "0000621973" "00025898" "50" "11144" "0" "11144" "0" "c.11144G>A" "r.(?)" "p.(Arg3715Gln)" "" "0000621973" "00000245" "50" "11219" "0" "11219" "0" "c.11219G>A" "r.(?)" "p.(Arg3740Gln)" "" "0000652379" "00025898" "50" "1248" "0" "1248" "0" "c.1248G>T" "r.(?)" "p.(Gln416His)" "" "0000652379" "00000245" "50" "1248" "0" "1248" "0" "c.1248G>T" "r.(?)" "p.(Gln416His)" "" "0000652380" "00025898" "50" "1528" "0" "1528" "0" "c.1528C>T" "r.(?)" "p.(Arg510Cys)" "" "0000652380" "00000245" "50" "1528" "0" "1528" "0" "c.1528C>T" "r.(?)" "p.(Arg510Cys)" "" "0000652381" "00025898" "50" "1768" "0" "1768" "0" "c.1768G>A" "r.(?)" "p.(Ala590Thr)" "" "0000652381" "00000245" "50" "1768" "0" "1768" "0" "c.1768G>A" "r.(?)" "p.(Ala590Thr)" "" "0000652382" "00025898" "90" "2074" "0" "2074" "0" "c.2074C>T" "r.(?)" "p.(Arg692*)" "" "0000652382" "00000245" "90" "2074" "0" "2074" "0" "c.2074C>T" "r.(?)" "p.(Arg692*)" "" "0000652383" "00025898" "30" "2485" "0" "2485" "0" "c.2485G>A" "r.(?)" "p.(Ala829Thr)" "" "0000652383" "00000245" "30" "2485" "0" "2485" "0" "c.2485G>A" "r.(?)" "p.(Ala829Thr)" "" "0000652384" "00025898" "90" "2591" "0" "2591" "0" "c.2591C>A" "r.(?)" "p.(Ser864*)" "" "0000652384" "00000245" "90" "2591" "0" "2591" "0" "c.2591C>A" "" "" "" "0000652385" "00025898" "50" "3363" "0" "3363" "0" "c.3363A>G" "r.(?)" "p.(Ile1121Met)" "" "0000652385" "00000245" "50" "3363" "0" "3363" "0" "c.3363A>G" "r.(?)" "p.(Ile1121Met)" "" "0000652386" "00025898" "50" "3386" "0" "3386" "0" "c.3386A>G" "r.(?)" "p.(Lys1129Arg)" "" "0000652386" "00000245" "50" "3386" "0" "3386" "0" "c.3386A>G" "r.(?)" "p.(Lys1129Arg)" "" "0000652387" "00025898" "30" "7676" "0" "7676" "0" "c.7676T>C" "r.(?)" "p.(Val2559Ala)" "" "0000652387" "00000245" "30" "7751" "0" "7751" "0" "c.7751T>C" "r.(?)" "p.(Val2584Ala)" "" "0000652388" "00025898" "70" "8870" "0" "8870" "0" "c.8870T>A" "r.(?)" "p.(Leu2957*)" "" "0000652388" "00000245" "70" "8945" "0" "8945" "0" "c.8945T>A" "r.(?)" "p.(Leu2982*)" "" "0000652389" "00025898" "10" "10065" "0" "10065" "0" "c.10065G>T" "r.(=)" "p.(=)" "" "0000652389" "00000245" "10" "10140" "0" "10140" "0" "c.10140G>T" "r.(=)" "p.(=)" "" "0000652390" "00025898" "10" "11044" "33" "11044" "33" "c.11044+33C>A" "r.(=)" "p.(=)" "" "0000652390" "00000245" "10" "11119" "33" "11119" "33" "c.11119+33C>A" "r.(=)" "p.(=)" "" "0000652391" "00025898" "50" "11897" "0" "11897" "0" "c.11897A>T" "r.(?)" "p.(Lys3966Ile)" "" "0000652391" "00000245" "50" "11972" "0" "11972" "0" "c.11972A>T" "r.(?)" "p.(Lys3991Ile)" "" "0000653282" "00025898" "50" "11751" "0" "11754" "0" "c.11751_11754dup" "r.(?)" "p.(Val3919Trpfs*49)" "" "0000653282" "00000245" "50" "11824" "0" "11827" "0" "c.11824_11827dup" "r.(?)" "p.(Val3944Trpfs*49)" "" "0000655945" "00025898" "30" "581" "-10" "581" "-10" "c.581-10T>C" "r.(=)" "p.(=)" "" "0000655945" "00000245" "30" "581" "-10" "581" "-10" "c.581-10T>C" "r.(=)" "p.(=)" "" "0000655946" "00025898" "30" "983" "0" "983" "0" "c.983A>G" "r.(?)" "p.(His328Arg)" "" "0000655946" "00000245" "30" "983" "0" "983" "0" "c.983A>G" "r.(?)" "p.(His328Arg)" "" "0000655947" "00025898" "90" "4396" "0" "4396" "0" "c.4396G>T" "r.(?)" "p.(Glu1466Ter)" "" "0000655947" "00000245" "90" "4471" "0" "4471" "0" "c.4471G>T" "r.(?)" "p.(Glu1491Ter)" "" "0000655948" "00025898" "90" "5011" "0" "5011" "0" "c.5011C>T" "r.(?)" "p.(Arg1671Ter)" "" "0000655948" "00000245" "90" "5086" "0" "5086" "0" "c.5086C>T" "r.(?)" "p.(Arg1696Ter)" "" "0000655949" "00025898" "70" "5793" "0" "5793" "0" "c.5793C>G" "r.(?)" "p.(Tyr1931Ter)" "" "0000655949" "00000245" "70" "5868" "0" "5868" "0" "c.5868C>G" "r.(?)" "p.(Tyr1956Ter)" "" "0000655950" "00025898" "30" "5811" "0" "5811" "0" "c.5811T>G" "r.(?)" "p.(Pro1937=)" "" "0000655950" "00000245" "30" "5886" "0" "5886" "0" "c.5886T>G" "r.(?)" "p.(Pro1962=)" "" "0000655951" "00025898" "30" "7659" "0" "7659" "0" "c.7659A>C" "r.(?)" "p.(Ala2553=)" "" "0000655951" "00000245" "30" "7734" "0" "7734" "0" "c.7734A>C" "r.(?)" "p.(Ala2578=)" "" "0000655952" "00025898" "30" "10152" "0" "10152" "0" "c.10152T>G" "r.(?)" "p.(Ala3384=)" "" "0000655952" "00000245" "30" "10227" "0" "10227" "0" "c.10227T>G" "r.(?)" "p.(Ala3409=)" "" "0000655953" "00025898" "30" "11613" "0" "11613" "0" "c.11613C>T" "r.(?)" "p.(Phe3871=)" "" "0000655953" "00000245" "30" "11688" "0" "11688" "0" "c.11688C>T" "r.(?)" "p.(Phe3896=)" "" "0000664846" "00000245" "50" "291" "28132" "291" "28132" "c.291+28132C>A" "r.(?)" "p.(=)" "" "0000669989" "00025898" "30" "7676" "0" "7676" "0" "c.7676T>C" "r.(?)" "p.(Val2559Ala)" "" "0000669989" "00000245" "30" "7751" "0" "7751" "0" "c.7751T>C" "r.(?)" "p.(Val2584Ala)" "" "0000678240" "00025898" "30" "2356" "0" "2356" "0" "c.2356A>G" "r.(?)" "p.(Ile786Val)" "" "0000678240" "00000245" "30" "2356" "0" "2356" "0" "c.2356A>G" "r.(?)" "p.(Ile786Val)" "" "0000678241" "00025898" "30" "7779" "6" "7779" "6" "c.7779+6C>T" "r.(=)" "p.(=)" "" "0000678241" "00000245" "30" "7854" "6" "7854" "6" "c.7854+6C>T" "r.(=)" "p.(=)" "" "0000678242" "00025898" "30" "9742" "13" "9742" "13" "c.9742+13C>T" "r.(=)" "p.(=)" "" "0000678242" "00000245" "30" "9817" "13" "9817" "13" "c.9817+13C>T" "r.(=)" "p.(=)" "" "0000678243" "00025898" "70" "10904" "0" "10904" "0" "c.10904del" "r.(?)" "p.(Pro3635LeufsTer5)" "" "0000678243" "00000245" "70" "10979" "0" "10979" "0" "c.10979del" "r.(?)" "p.(Pro3660LeufsTer5)" "" "0000685569" "00000245" "90" "5417" "0" "5417" "0" "c.5417dup" "r.(?)" "p.(Gln1807Alafs*32)" "" "0000690120" "00025898" "30" "2651" "-15" "2651" "-15" "c.2651-15A>C" "r.(=)" "p.(=)" "" "0000690120" "00000245" "30" "2651" "-15" "2651" "-15" "c.2651-15A>C" "r.(=)" "p.(=)" "" "0000690121" "00025898" "30" "2925" "0" "2925" "0" "c.2925T>C" "r.(?)" "p.(His975=)" "" "0000690121" "00000245" "30" "2925" "0" "2925" "0" "c.2925T>C" "r.(?)" "p.(His975=)" "" "0000690122" "00025898" "30" "7647" "0" "7647" "0" "c.7647C>T" "r.(?)" "p.(Phe2549=)" "" "0000690122" "00000245" "30" "7722" "0" "7722" "0" "c.7722C>T" "r.(?)" "p.(Phe2574=)" "" "0000690123" "00025898" "30" "10441" "0" "10441" "0" "c.10441T>C" "r.(?)" "p.(Cys3481Arg)" "" "0000690123" "00000245" "30" "10516" "0" "10516" "0" "c.10516T>C" "r.(?)" "p.(Cys3506Arg)" "" "0000690124" "00025898" "50" "10744" "0" "10744" "0" "c.10744A>G" "r.(?)" "p.(Ile3582Val)" "" "0000690124" "00000245" "50" "10819" "0" "10819" "0" "c.10819A>G" "r.(?)" "p.(Ile3607Val)" "" "0000690125" "00025898" "70" "11236" "0" "11236" "0" "c.11236del" "r.(?)" "p.(Asp3746IlefsTer107)" "" "0000690125" "00000245" "70" "11311" "0" "11311" "0" "c.11311del" "r.(?)" "p.(Asp3771IlefsTer107)" "" "0000690126" "00025898" "30" "11392" "8" "11392" "8" "c.11392+8G>A" "r.(=)" "p.(=)" "" "0000690126" "00000245" "30" "11467" "8" "11467" "8" "c.11467+8G>A" "r.(=)" "p.(=)" "" "0000690127" "00025898" "30" "11392" "8" "11392" "8" "c.11392+8G>A" "r.(=)" "p.(=)" "" "0000690127" "00000245" "30" "11467" "8" "11467" "8" "c.11467+8G>A" "r.(=)" "p.(=)" "" "0000701832" "00000245" "70" "5590" "0" "5590" "0" "c.5590C>T" "r.(?)" "p.(Gln1864*)" "" "0000710304" "00000245" "90" "5086" "0" "5086" "0" "c.5086C>T" "r.(?)" "p.(Arg1696*)" "" "0000710359" "00000245" "90" "8978" "0" "8978" "0" "c.8978A>G" "r.(?)" "p.(Asn2993Ser)" "" "0000713660" "00025898" "70" "2591" "0" "2591" "0" "c.2591C>A" "r.(?)" "p.(Ser864*)" "" "0000713660" "00000245" "70" "2591" "0" "2591" "0" "c.2591C>A" "r.(?)" "p.(Ser864*)" "" "0000713898" "00025898" "70" "3628" "0" "3628" "0" "c.3628G>T" "r.(?)" "p.(Asp1210Tyr)" "" "0000713898" "00000245" "70" "3628" "0" "3628" "0" "c.3628G>T" "r.(?)" "p.(Asp1210Tyr)" "" "0000713899" "00025898" "70" "6295" "0" "6296" "0" "c.6295_6296del" "r.(?)" "p.(Met2099Valfs*44)" "" "0000713899" "00000245" "70" "6370" "0" "6371" "0" "c.6370_6371del" "r.(?)" "p.(Met2124Valfs*44)" "" "0000714082" "00000245" "70" "6121" "1" "6121" "1" "c.6121+1G>C" "r.spl" "p.?" "" "0000714083" "00000245" "70" "7758" "0" "7758" "0" "c.7758del" "p.(Lys2586fs)" "p.(Lys2586Asnfs*7)" "" "0000714107" "00000245" "70" "" "0" "" "0" "c.-111_(762+1_763-1){0}" "r.0?" "p.0?" "" "0000714108" "00000245" "70" "6733" "-1" "7854" "1" "c.(6732+1_6733-1)_(7854+1_7855-1)dup" "r.?" "p.?" "" "0000721635" "00025898" "30" "292" "-3" "292" "-3" "c.292-3T>C" "r.spl?" "p.?" "" "0000721635" "00000245" "30" "292" "-3" "292" "-3" "c.292-3T>C" "r.spl?" "p.?" "" "0000721636" "00025898" "70" "436" "0" "436" "0" "c.436C>T" "r.(?)" "p.(Arg146Ter)" "" "0000721636" "00000245" "70" "436" "0" "436" "0" "c.436C>T" "r.(?)" "p.(Arg146Ter)" "" "0000721637" "00025898" "50" "584" "0" "584" "0" "c.584C>G" "r.(?)" "p.(Thr195Ser)" "" "0000721637" "00000245" "50" "584" "0" "584" "0" "c.584C>G" "r.(?)" "p.(Thr195Ser)" "" "0000721638" "00025898" "30" "750" "0" "750" "0" "c.750A>G" "r.(?)" "p.(Pro250=)" "" "0000721638" "00000245" "30" "750" "0" "750" "0" "c.750A>G" "r.(?)" "p.(Pro250=)" "" "0000721639" "00025898" "30" "983" "0" "983" "0" "c.983A>G" "r.(?)" "p.(His328Arg)" "" "0000721639" "00000245" "30" "983" "0" "983" "0" "c.983A>G" "r.(?)" "p.(His328Arg)" "" "0000721640" "00025898" "30" "1303" "-9" "1303" "-9" "c.1303-9G>A" "r.(=)" "p.(=)" "" "0000721640" "00000245" "30" "1303" "-9" "1303" "-9" "c.1303-9G>A" "r.(=)" "p.(=)" "" "0000721641" "00025898" "50" "1343" "0" "1343" "0" "c.1343G>A" "r.(?)" "p.(Gly448Glu)" "" "0000721641" "00000245" "50" "1343" "0" "1343" "0" "c.1343G>A" "r.(?)" "p.(Gly448Glu)" "" "0000721642" "00025898" "70" "1443" "0" "1444" "0" "c.1443_1444del" "r.(?)" "p.(Ile481Metfs*3)" "" "0000721642" "00000245" "70" "1443" "0" "1444" "0" "c.1443_1444del" "r.(?)" "p.(Ile481Metfs*3)" "" "0000721643" "00025898" "50" "1520" "0" "1520" "0" "c.1520A>G" "r.(?)" "p.(Asn507Ser)" "" "0000721643" "00000245" "50" "1520" "0" "1520" "0" "c.1520A>G" "r.(?)" "p.(Asn507Ser)" "" "0000721644" "00025898" "30" "1639" "0" "1639" "0" "c.1639A>G" "r.(?)" "p.(Thr547Ala)" "" "0000721644" "00000245" "30" "1639" "0" "1639" "0" "c.1639A>G" "r.(?)" "p.(Thr547Ala)" "" "0000721645" "00025898" "10" "1656" "0" "1656" "0" "c.1656C>A" "r.(?)" "p.(Ser552=)" "" "0000721645" "00000245" "10" "1656" "0" "1656" "0" "c.1656C>A" "r.(?)" "p.(Ser552=)" "" "0000721646" "00025898" "30" "1768" "0" "1768" "0" "c.1768G>A" "r.(?)" "p.(Ala590Thr)" "" "0000721646" "00000245" "30" "1768" "0" "1768" "0" "c.1768G>A" "r.(?)" "p.(Ala590Thr)" "" "0000721647" "00025898" "30" "1832" "0" "1832" "0" "c.1832G>A" "r.(?)" "p.(Arg611Lys)" "" "0000721647" "00000245" "30" "1832" "0" "1832" "0" "c.1832G>A" "r.(?)" "p.(Arg611Lys)" "" "0000721648" "00025898" "10" "1843" "16" "1843" "16" "c.1843+16A>G" "r.(=)" "p.(=)" "" "0000721648" "00000245" "10" "1843" "16" "1843" "16" "c.1843+16A>G" "r.(=)" "p.(=)" "" "0000721649" "00025898" "50" "1864" "0" "1864" "0" "c.1864A>G" "r.(?)" "p.(Thr622Ala)" "" "0000721649" "00000245" "50" "1864" "0" "1864" "0" "c.1864A>G" "r.(?)" "p.(Thr622Ala)" "" "0000721650" "00025898" "30" "1981" "0" "1981" "0" "c.1981G>A" "r.(?)" "p.(Asp661Asn)" "" "0000721650" "00000245" "30" "1981" "0" "1981" "0" "c.1981G>A" "r.(?)" "p.(Asp661Asn)" "" "0000721651" "00025898" "10" "2016" "0" "2016" "0" "c.2016C>T" "r.(?)" "p.(Asn672=)" "" "0000721651" "00000245" "10" "2016" "0" "2016" "0" "c.2016C>T" "r.(?)" "p.(Asn672=)" "" "0000721652" "00025898" "30" "2248" "0" "2248" "0" "c.2248A>G" "r.(?)" "p.(Ser750Gly)" "" "0000721652" "00000245" "30" "2248" "0" "2248" "0" "c.2248A>G" "r.(?)" "p.(Ser750Gly)" "" "0000721653" "00025898" "10" "2472" "0" "2472" "0" "c.2472C>T" "r.(?)" "p.(Ser824=)" "" "0000721653" "00000245" "10" "2472" "0" "2472" "0" "c.2472C>T" "r.(?)" "p.(Ser824=)" "" "0000721654" "00025898" "30" "2472" "0" "2472" "0" "c.2472C>T" "r.(?)" "p.(Ser824=)" "" "0000721654" "00000245" "30" "2472" "0" "2472" "0" "c.2472C>T" "r.(?)" "p.(Ser824=)" "" "0000721655" "00025898" "30" "2589" "0" "2589" "0" "c.2589A>G" "r.(?)" "p.(Thr863=)" "" "0000721655" "00000245" "30" "2589" "0" "2589" "0" "c.2589A>G" "r.(?)" "p.(Thr863=)" "" "0000721656" "00025898" "10" "2650" "14" "2650" "14" "c.2650+14G>A" "r.(=)" "p.(=)" "" "0000721656" "00000245" "10" "2650" "14" "2650" "14" "c.2650+14G>A" "r.(=)" "p.(=)" "" "0000721657" "00025898" "30" "2651" "-15" "2651" "-15" "c.2651-15A>C" "r.(=)" "p.(=)" "" "0000721657" "00000245" "30" "2651" "-15" "2651" "-15" "c.2651-15A>C" "r.(=)" "p.(=)" "" "0000721658" "00025898" "30" "2704" "0" "2704" "0" "c.2704A>G" "r.(?)" "p.(Lys902Glu)" "" "0000721658" "00000245" "30" "2704" "0" "2704" "0" "c.2704A>G" "r.(?)" "p.(Lys902Glu)" "" "0000721659" "00025898" "30" "2760" "0" "2760" "0" "c.2760A>G" "r.(?)" "p.(Leu920=)" "" "0000721659" "00000245" "30" "2760" "0" "2760" "0" "c.2760A>G" "r.(?)" "p.(Leu920=)" "" "0000721660" "00025898" "10" "2760" "0" "2760" "0" "c.2760A>G" "r.(?)" "p.(Leu920=)" "" "0000721660" "00000245" "10" "2760" "0" "2760" "0" "c.2760A>G" "r.(?)" "p.(Leu920=)" "" "0000721661" "00025898" "30" "2935" "-18" "2935" "-18" "c.2935-18C>A" "r.(=)" "p.(=)" "" "0000721661" "00000245" "30" "2935" "-18" "2935" "-18" "c.2935-18C>A" "r.(=)" "p.(=)" "" "0000721662" "00025898" "30" "2935" "-8" "2935" "-8" "c.2935-8C>G" "r.(=)" "p.(=)" "" "0000721662" "00000245" "30" "2935" "-8" "2935" "-8" "c.2935-8C>G" "r.(=)" "p.(=)" "" "0000721663" "00025898" "30" "3075" "0" "3075" "0" "c.3075G>A" "r.(?)" "p.(Thr1025=)" "" "0000721663" "00000245" "30" "3075" "0" "3075" "0" "c.3075G>A" "r.(?)" "p.(Thr1025=)" "" "0000721664" "00025898" "30" "3083" "-14" "3083" "-14" "c.3083-14A>G" "r.(=)" "p.(=)" "" "0000721664" "00000245" "30" "3083" "-14" "3083" "-14" "c.3083-14A>G" "r.(=)" "p.(=)" "" "0000721665" "00025898" "30" "3116" "0" "3116" "0" "c.3116T>C" "r.(?)" "p.(Met1039Thr)" "" "0000721665" "00000245" "30" "3116" "0" "3116" "0" "c.3116T>C" "r.(?)" "p.(Met1039Thr)" "" "0000721666" "00025898" "30" "3195" "0" "3195" "0" "c.3195G>A" "r.(?)" "p.(Lys1065=)" "" "0000721666" "00000245" "30" "3195" "0" "3195" "0" "c.3195G>A" "r.(?)" "p.(Lys1065=)" "" "0000721667" "00025898" "30" "3203" "0" "3203" "0" "c.3203C>T" "r.(?)" "p.(Thr1068Ile)" "" "0000721667" "00000245" "30" "3203" "0" "3203" "0" "c.3203C>T" "r.(?)" "p.(Thr1068Ile)" "" "0000721668" "00025898" "30" "3386" "0" "3386" "0" "c.3386A>G" "r.(?)" "p.(Lys1129Arg)" "" "0000721668" "00000245" "30" "3386" "0" "3386" "0" "c.3386A>G" "r.(?)" "p.(Lys1129Arg)" "" "0000721669" "00025898" "10" "3432" "0" "3432" "0" "c.3432C>T" "r.(?)" "p.(Pro1144=)" "" "0000721669" "00000245" "10" "3432" "0" "3432" "0" "c.3432C>T" "r.(?)" "p.(Pro1144=)" "" "0000721670" "00025898" "10" "3516" "0" "3516" "0" "c.3516A>G" "r.(?)" "p.(Thr1172=)" "" "0000721670" "00000245" "10" "3516" "0" "3516" "0" "c.3516A>G" "r.(?)" "p.(Thr1172=)" "" "0000721671" "00025898" "30" "3621" "0" "3621" "0" "c.3621C>T" "r.(?)" "p.(Leu1207=)" "" "0000721671" "00000245" "30" "3621" "0" "3621" "0" "c.3621C>T" "r.(?)" "p.(Leu1207=)" "" "0000721672" "00025898" "30" "3645" "0" "3645" "0" "c.3645G>A" "r.(?)" "p.(Glu1215=)" "" "0000721672" "00000245" "30" "3645" "0" "3645" "0" "c.3645G>A" "r.(?)" "p.(Glu1215=)" "" "0000721673" "00025898" "50" "3811" "0" "3811" "0" "c.3811A>T" "r.(?)" "p.(Thr1271Ser)" "" "0000721673" "00000245" "50" "3811" "0" "3811" "0" "c.3811A>T" "r.(?)" "p.(Thr1271Ser)" "" "0000721674" "00025898" "30" "4224" "549" "4224" "549" "c.4224+549C>T" "r.(=)" "p.(=)" "" "0000721674" "00000245" "30" "4158" "-18" "4158" "-18" "c.4158-18C>T" "r.(=)" "p.(=)" "" "0000721675" "00025898" "50" "4224" "689" "4224" "689" "c.4224+689G>A" "r.(=)" "p.(=)" "" "0000721675" "00000245" "50" "4280" "0" "4280" "0" "c.4280G>A" "r.(?)" "p.(Cys1427Tyr)" "" "0000721676" "00025898" "30" "4225" "-6" "4225" "-6" "c.4225-6G>A" "r.(=)" "p.(=)" "" "0000721676" "00000245" "30" "4300" "-6" "4300" "-6" "c.4300-6G>A" "r.(=)" "p.(=)" "" "0000721677" "00025898" "50" "4253" "0" "4253" "0" "c.4253A>G" "r.(?)" "p.(His1418Arg)" "" "0000721677" "00000245" "50" "4328" "0" "4328" "0" "c.4328A>G" "r.(?)" "p.(His1443Arg)" "" "0000721678" "00025898" "50" "4262" "0" "4262" "0" "c.4262A>G" "r.(?)" "p.(His1421Arg)" "" "0000721678" "00000245" "50" "4337" "0" "4337" "0" "c.4337A>G" "r.(?)" "p.(His1446Arg)" "" "0000721679" "00025898" "30" "4746" "-15" "4746" "-15" "c.4746-15T>C" "r.(=)" "p.(=)" "" "0000721679" "00000245" "30" "4821" "-15" "4821" "-15" "c.4821-15T>C" "r.(=)" "p.(=)" "" "0000721680" "00025898" "30" "4746" "-14" "4746" "-14" "c.4746-14C>T" "r.(=)" "p.(=)" "" "0000721680" "00000245" "30" "4821" "-14" "4821" "-14" "c.4821-14C>T" "r.(=)" "p.(=)" "" "0000721681" "00025898" "50" "5210" "0" "5210" "0" "c.5210A>G" "r.(?)" "p.(Lys1737Arg)" "" "0000721681" "00000245" "50" "5285" "0" "5285" "0" "c.5285A>G" "r.(?)" "p.(Lys1762Arg)" "" "0000721682" "00025898" "30" "5502" "0" "5502" "0" "c.5502G>A" "r.(?)" "p.(Ser1834=)" "" "0000721682" "00000245" "30" "5577" "0" "5577" "0" "c.5577G>A" "r.(?)" "p.(Ser1859=)" "" "0000721683" "00025898" "30" "5606" "0" "5606" "0" "c.5606C>T" "r.(?)" "p.(Thr1869Met)" "" "0000721683" "00000245" "30" "5681" "0" "5681" "0" "c.5681C>T" "r.(?)" "p.(Thr1894Met)" "" "0000721684" "00025898" "30" "5607" "0" "5607" "0" "c.5607G>A" "r.(?)" "p.(Thr1869=)" "" "0000721684" "00000245" "30" "5682" "0" "5682" "0" "c.5682G>A" "r.(?)" "p.(Thr1894=)" "" "0000721685" "00025898" "50" "5741" "0" "5741" "0" "c.5741G>A" "r.(?)" "p.(Arg1914Gln)" "" "0000721685" "00000245" "50" "5816" "0" "5816" "0" "c.5816G>A" "r.(?)" "p.(Arg1939Gln)" "" "0000721686" "00025898" "30" "5761" "0" "5761" "0" "c.5761A>G" "r.(?)" "p.(Thr1921Ala)" "" "0000721686" "00000245" "30" "5836" "0" "5836" "0" "c.5836A>G" "r.(?)" "p.(Thr1946Ala)" "" "0000721687" "00025898" "50" "5902" "0" "5902" "0" "c.5902T>C" "r.(?)" "p.(Cys1968Arg)" "" "0000721687" "00000245" "50" "5977" "0" "5977" "0" "c.5977T>C" "r.(?)" "p.(Cys1993Arg)" "" "0000721688" "00025898" "30" "5905" "0" "5905" "0" "c.5905A>G" "r.(?)" "p.(Ile1969Val)" "" "0000721688" "00000245" "30" "5980" "0" "5980" "0" "c.5980A>G" "r.(?)" "p.(Ile1994Val)" "" "0000721689" "00025898" "30" "5909" "-14" "5909" "-14" "c.5909-14T>C" "r.(=)" "p.(=)" "" "0000721689" "00000245" "30" "5984" "-14" "5984" "-14" "c.5984-14T>C" "r.(=)" "p.(=)" "" "0000721690" "00025898" "10" "6165" "0" "6165" "0" "c.6165A>G" "r.(?)" "p.(Glu2055=)" "" "0000721690" "00000245" "10" "6240" "0" "6240" "0" "c.6240A>G" "r.(?)" "p.(Glu2080=)" "" "0000721691" "00025898" "30" "6416" "0" "6416" "0" "c.6416A>G" "r.(?)" "p.(Asn2139Ser)" "" "0000721691" "00000245" "30" "6491" "0" "6491" "0" "c.6491A>G" "r.(?)" "p.(Asn2164Ser)" "" "0000721692" "00025898" "30" "6454" "19" "6454" "19" "c.6454+19del" "r.(=)" "p.(=)" "" "0000721692" "00000245" "30" "6529" "19" "6529" "19" "c.6529+19del" "r.(=)" "p.(=)" "" "0000721693" "00025898" "10" "6658" "-13" "6658" "-13" "c.6658-13T>A" "r.(=)" "p.(=)" "" "0000721693" "00000245" "10" "6733" "-13" "6733" "-13" "c.6733-13T>A" "r.(=)" "p.(=)" "" "0000721694" "00025898" "10" "7152" "0" "7152" "0" "c.7152G>A" "r.(?)" "p.(Pro2384=)" "" "0000721694" "00000245" "10" "7227" "0" "7227" "0" "c.7227G>A" "r.(?)" "p.(Pro2409=)" "" "0000721695" "00025898" "10" "7668" "0" "7668" "0" "c.7668C>T" "r.(?)" "p.(Ser2556=)" "" "0000721695" "00000245" "10" "7743" "0" "7743" "0" "c.7743C>T" "r.(?)" "p.(Ser2581=)" "" "0000721696" "00025898" "30" "7678" "0" "7678" "0" "c.7678G>A" "r.(?)" "p.(Glu2560Lys)" "" "0000721696" "00000245" "30" "7753" "0" "7753" "0" "c.7753G>A" "r.(?)" "p.(Glu2585Lys)" "" "0000721697" "00025898" "50" "7712" "0" "7712" "0" "c.7712C>T" "r.(?)" "p.(Ser2571Phe)" "" "0000721697" "00000245" "50" "7787" "0" "7787" "0" "c.7787C>T" "r.(?)" "p.(Ser2596Phe)" "" "0000721698" "00025898" "10" "8052" "0" "8052" "0" "c.8052T>C" "r.(?)" "p.(Ala2684=)" "" "0000721698" "00000245" "10" "8127" "0" "8127" "0" "c.8127T>C" "r.(?)" "p.(Ala2709=)" "" "0000721699" "00025898" "30" "8171" "0" "8171" "0" "c.8171A>G" "r.(?)" "p.(Tyr2724Cys)" "" "0000721699" "00000245" "30" "8246" "0" "8246" "0" "c.8246A>G" "r.(?)" "p.(Tyr2749Cys)" "" "0000721700" "00025898" "10" "8244" "0" "8244" "0" "c.8244G>A" "r.(?)" "p.(Ser2748=)" "" "0000721700" "00000245" "10" "8319" "0" "8319" "0" "c.8319G>A" "r.(?)" "p.(Ser2773=)" "" "0000721701" "00025898" "10" "8362" "-7" "8362" "-7" "c.8362-7T>C" "r.(=)" "p.(=)" "" "0000721701" "00000245" "10" "8437" "-7" "8437" "-7" "c.8437-7T>C" "r.(=)" "p.(=)" "" "0000721702" "00025898" "10" "8661" "0" "8661" "0" "c.8661A>G" "r.(?)" "p.(Ser2887=)" "" "0000721702" "00000245" "10" "8736" "0" "8736" "0" "c.8736A>G" "r.(?)" "p.(Ser2912=)" "" "0000721703" "00025898" "50" "8903" "0" "8903" "0" "c.8903A>G" "r.(?)" "p.(Asn2968Ser)" "" "0000721703" "00000245" "50" "8978" "0" "8978" "0" "c.8978A>G" "r.(?)" "p.(Asn2993Ser)" "" "0000721704" "00025898" "30" "8995" "-16" "8995" "-16" "c.8995-16G>A" "r.(=)" "p.(=)" "" "0000721704" "00000245" "30" "9070" "-16" "9070" "-16" "c.9070-16G>A" "r.(=)" "p.(=)" "" "0000721705" "00025898" "30" "9183" "16" "9183" "16" "c.9183+16A>G" "r.(=)" "p.(=)" "" "0000721705" "00000245" "30" "9258" "16" "9258" "16" "c.9258+16A>G" "r.(=)" "p.(=)" "" "0000721706" "00025898" "10" "9330" "9" "9330" "9" "c.9330+9A>G" "r.(=)" "p.(=)" "" "0000721706" "00000245" "10" "9405" "9" "9405" "9" "c.9405+9A>G" "r.(=)" "p.(=)" "" "0000721707" "00025898" "10" "9331" "-27" "9331" "-3" "c.9331-27_9331-3dup" "r.spl?" "p.?" "" "0000721707" "00000245" "10" "9406" "-27" "9406" "-3" "c.9406-27_9406-3dup" "r.spl?" "p.?" "" "0000721708" "00025898" "30" "9331" "-26" "9331" "-3" "c.9331-26_9331-3dup" "r.spl?" "p.?" "" "0000721708" "00000245" "30" "9406" "-26" "9406" "-3" "c.9406-26_9406-3dup" "r.spl?" "p.?" "" "0000721709" "00025898" "30" "9331" "-25" "9331" "-3" "c.9331-25_9331-3dup" "r.spl?" "p.?" "" "0000721709" "00000245" "30" "9406" "-25" "9406" "-3" "c.9406-25_9406-3dup" "r.spl?" "p.?" "" "0000721710" "00025898" "10" "9331" "-24" "9331" "-3" "c.9331-24_9331-3dup" "r.spl?" "p.?" "" "0000721710" "00000245" "10" "9406" "-24" "9406" "-3" "c.9406-24_9406-3dup" "r.spl?" "p.?" "" "0000721711" "00025898" "10" "9331" "-23" "9331" "-3" "c.9331-23_9331-3dup" "r.spl?" "p.?" "" "0000721711" "00000245" "10" "9406" "-23" "9406" "-3" "c.9406-23_9406-3dup" "r.spl?" "p.?" "" "0000721712" "00025898" "30" "9331" "-22" "9331" "-3" "c.9331-22_9331-3dup" "r.spl?" "p.?" "" "0000721712" "00000245" "30" "9406" "-22" "9406" "-3" "c.9406-22_9406-3dup" "r.spl?" "p.?" "" "0000721713" "00025898" "30" "9331" "-18" "9331" "-3" "c.9331-18_9331-3dup" "r.spl?" "p.?" "" "0000721713" "00000245" "30" "9406" "-18" "9406" "-3" "c.9406-18_9406-3dup" "r.spl?" "p.?" "" "0000721714" "00025898" "10" "9331" "-10" "9331" "-3" "c.9331-10_9331-3del" "r.spl?" "p.?" "" "0000721714" "00000245" "10" "9406" "-10" "9406" "-3" "c.9406-10_9406-3del" "r.spl?" "p.?" "" "0000721715" "00025898" "10" "9331" "-3" "9331" "-2" "c.9331-3_9331-2insTTTTTTTTTTTTTTTTTTTTTTTTTTT" "r.spl?" "p.?" "" "0000721715" "00000245" "10" "9406" "-3" "9406" "-2" "c.9406-3_9406-2insTTTTTTTTTTTTTTTTTTTTTTTTTTT" "r.spl?" "p.?" "" "0000721716" "00025898" "30" "9339" "0" "9339" "0" "c.9339T>A" "r.(?)" "p.(Arg3113=)" "" "0000721716" "00000245" "30" "9414" "0" "9414" "0" "c.9414T>A" "r.(?)" "p.(Arg3138=)" "" "0000721717" "00025898" "30" "9592" "0" "9592" "0" "c.9592C>T" "r.(?)" "p.(Arg3198Trp)" "" "0000721717" "00000245" "30" "9667" "0" "9667" "0" "c.9667C>T" "r.(?)" "p.(Arg3223Trp)" "" "0000721718" "00025898" "10" "9614" "19" "9614" "19" "c.9614+19A>G" "r.(=)" "p.(=)" "" "0000721718" "00000245" "10" "9689" "19" "9689" "19" "c.9689+19A>G" "r.(=)" "p.(=)" "" "0000721719" "00025898" "30" "9651" "0" "9651" "0" "c.9651G>A" "r.(?)" "p.(Val3217=)" "" "0000721719" "00000245" "30" "9726" "0" "9726" "0" "c.9726G>A" "r.(?)" "p.(Val3242=)" "" "0000721720" "00025898" "30" "9743" "-18" "9743" "-18" "c.9743-18C>G" "r.(=)" "p.(=)" "" "0000721720" "00000245" "30" "9818" "-18" "9818" "-18" "c.9818-18C>G" "r.(=)" "p.(=)" "" "0000721721" "00025898" "30" "9903" "0" "9903" "0" "c.9903G>A" "r.(?)" "p.(Glu3301=)" "" "0000721721" "00000245" "30" "9978" "0" "9978" "0" "c.9978G>A" "r.(?)" "p.(Glu3326=)" "" "0000721722" "00025898" "30" "9942" "12" "9942" "12" "c.9942+12A>G" "r.(=)" "p.(=)" "" "0000721722" "00000245" "30" "10017" "12" "10017" "12" "c.10017+12A>G" "r.(=)" "p.(=)" "" "0000721723" "00025898" "50" "10643" "0" "10643" "0" "c.10643C>T" "r.(?)" "p.(Thr3548Ile)" "" "0000721723" "00000245" "50" "10718" "0" "10718" "0" "c.10718C>T" "r.(?)" "p.(Thr3573Ile)" "" "0000721724" "00025898" "30" "10650" "0" "10650" "0" "c.10650C>T" "r.(?)" "p.(His3550=)" "" "0000721724" "00000245" "30" "10725" "0" "10725" "0" "c.10725C>T" "r.(?)" "p.(His3575=)" "" "0000721725" "00025898" "30" "10824" "0" "10824" "0" "c.10824C>T" "r.(?)" "p.(His3608=)" "" "0000721725" "00000245" "30" "10899" "0" "10899" "0" "c.10899C>T" "r.(?)" "p.(His3633=)" "" "0000721726" "00025898" "30" "10827" "0" "10827" "0" "c.10827C>T" "r.(?)" "p.(Ala3609=)" "" "0000721726" "00000245" "30" "10902" "0" "10902" "0" "c.10902C>T" "r.(?)" "p.(Ala3634=)" "" "0000721727" "00025898" "10" "10867" "20" "10867" "20" "c.10867+20del" "r.(=)" "p.(=)" "" "0000721727" "00000245" "10" "10942" "20" "10942" "20" "c.10942+20del" "r.(=)" "p.(=)" "" "0000721728" "00025898" "70" "10904" "0" "10904" "0" "c.10904del" "r.(?)" "p.(Pro3635LeufsTer5)" "" "0000721728" "00000245" "70" "10979" "0" "10979" "0" "c.10979del" "r.(?)" "p.(Pro3660LeufsTer5)" "" "0000721729" "00025898" "30" "10905" "0" "10905" "0" "c.10905T>C" "r.(?)" "p.(Pro3635=)" "" "0000721729" "00000245" "30" "10980" "0" "10980" "0" "c.10980T>C" "r.(?)" "p.(Pro3660=)" "" "0000721730" "00025898" "10" "10908" "0" "10908" "0" "c.10908A>C" "r.(?)" "p.(Ala3636=)" "" "0000721730" "00000245" "10" "10983" "0" "10983" "0" "c.10983A>C" "r.(?)" "p.(Ala3661=)" "" "0000721731" "00025898" "30" "11044" "5" "11044" "5" "c.11044+5C>T" "r.spl?" "p.?" "" "0000721731" "00000245" "30" "11119" "5" "11119" "5" "c.11119+5C>T" "r.spl?" "p.?" "" "0000721732" "00025898" "30" "11071" "0" "11071" "0" "c.11071G>A" "r.(?)" "p.(Ala3691Thr)" "" "0000721732" "00000245" "30" "11146" "0" "11146" "0" "c.11146G>A" "r.(?)" "p.(Ala3716Thr)" "" "0000721733" "00025898" "30" "11195" "0" "11195" "0" "c.11195G>A" "r.(?)" "p.(Arg3732Gln)" "" "0000721733" "00000245" "30" "11270" "0" "11270" "0" "c.11270G>A" "r.(?)" "p.(Arg3757Gln)" "" "0000721734" "00025898" "30" "11244" "0" "11244" "0" "c.11244G>C" "r.(?)" "p.(Pro3748=)" "" "0000721734" "00000245" "30" "11319" "0" "11319" "0" "c.11319G>C" "r.(?)" "p.(Pro3773=)" "" "0000721735" "00025898" "10" "11613" "0" "11613" "0" "c.11613C>T" "r.(?)" "p.(Phe3871=)" "" "0000721735" "00000245" "10" "11688" "0" "11688" "0" "c.11688C>T" "r.(?)" "p.(Phe3896=)" "" "0000721736" "00025898" "30" "11667" "0" "11667" "0" "c.11667C>T" "r.(?)" "p.(Ile3889=)" "" "0000721736" "00000245" "30" "11742" "0" "11742" "0" "c.11742C>T" "r.(?)" "p.(Ile3914=)" "" "0000721737" "00025898" "50" "11750" "0" "11752" "0" "c.11750_11752dup" "r.(?)" "p.(Asp3917dup)" "" "0000721737" "00000245" "50" "11825" "0" "11827" "0" "c.11825_11827dup" "r.(?)" "p.(Asp3942dup)" "" "0000721738" "00025898" "30" "11852" "0" "11852" "0" "c.11852T>C" "r.(?)" "p.(Ile3951Thr)" "" "0000721738" "00000245" "30" "11927" "0" "11927" "0" "c.11927T>C" "r.(?)" "p.(Ile3976Thr)" "" "0000721739" "00025898" "30" "11884" "0" "11884" "0" "c.11884C>G" "r.(?)" "p.(Pro3962Ala)" "" "0000721739" "00000245" "30" "11959" "0" "11959" "0" "c.11959C>G" "r.(?)" "p.(Pro3987Ala)" "" "0000721740" "00025898" "30" "12009" "0" "12012" "0" "c.*15_*18dup" "r.(=)" "p.(=)" "" "0000721740" "00000245" "30" "12084" "0" "12087" "0" "c.*15_*18dup" "r.(=)" "p.(=)" "" "0000730345" "00000245" "90" "1512" "0" "1512" "0" "c.1512del" "r.(?)" "p.(Glu505Lysfs*23)" "" "0000733343" "00000245" "70" "1915" "0" "1915" "0" "c.1915C>T" "r.(?)" "p.(Arg639*)" "" "0000733344" "00000245" "70" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000733345" "00000245" "70" "10357" "0" "10357" "0" "c.10357del" "r.(?)" "p.(Gln3453Serfs*2)" "" "0000733722" "00000245" "70" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000733723" "00000245" "70" "3386" "0" "3386" "0" "c.3386A>G" "r.(?)" "p.(Lys1129Arg)" "" "0000736858" "00000245" "50" "8833" "0" "8834" "0" "c.8833_8834insGAA" "r.(?)" "p.(Pro2945delinsArgThr)" "" "0000759977" "00000245" "50" "8978" "0" "8978" "0" "c.8978A>G" "r.(?)" "p.(Asn2993Ser)" "" "0000760054" "00000245" "50" "4157" "5" "4157" "5" "c.4157+5A>G" "r.spl" "p.?" "" "0000760066" "00000245" "50" "3386" "0" "3386" "0" "c.3386A>G" "r.(?)" "p.(Lys1129Arg)" "" "0000763266" "00025898" "70" "5783" "0" "5783" "0" "c.5783C>T" "r.(?)" "p.(Pro1928Leu)" "" "0000763266" "00000245" "70" "5858" "0" "5858" "0" "c.5858C>T" "r.(?)" "p.(Pro1953Leu)" "" "0000764672" "00000245" "70" "1504" "0" "1504" "0" "c.1504C>T" "r.(?)" "p.(Arg502*)" "" "0000764752" "00000245" "70" "6732" "1" "6732" "1" "c.6732+1G>A" "r.(?)" "p.(Val2245fs)" "" "0000786342" "00000245" "90" "6732" "1" "6732" "1" "c.6732+1G>A" "r.spl" "p.?" "" "0000786388" "00000245" "90" "11746" "0" "11747" "0" "c.11746_11747del" "p.(Ala3917Thrfs)" "p.(Ala3917ThrfsTer21)" "" "0000803331" "00025898" "30" "1303" "-9" "1303" "-9" "c.1303-9G>A" "r.(=)" "p.(=)" "" "0000803331" "00000245" "30" "1303" "-9" "1303" "-9" "c.1303-9G>A" "r.(=)" "p.(=)" "" "0000803332" "00025898" "50" "1559" "0" "1559" "0" "c.1559A>G" "r.(?)" "p.(His520Arg)" "" "0000803332" "00000245" "50" "1559" "0" "1559" "0" "c.1559A>G" "r.(?)" "p.(His520Arg)" "" "0000803333" "00025898" "30" "1843" "10" "1843" "10" "c.1843+10T>C" "r.(=)" "p.(=)" "" "0000803333" "00000245" "30" "1843" "10" "1843" "10" "c.1843+10T>C" "r.(=)" "p.(=)" "" "0000803334" "00025898" "10" "2333" "12" "2333" "12" "c.2333+12A>T" "r.(=)" "p.(=)" "" "0000803334" "00000245" "10" "2333" "12" "2333" "12" "c.2333+12A>T" "r.(=)" "p.(=)" "" "0000803335" "00025898" "30" "2333" "20" "2333" "20" "c.2333+20A>G" "r.(=)" "p.(=)" "" "0000803336" "00025898" "30" "2356" "0" "2356" "0" "c.2356A>G" "r.(?)" "p.(Ile786Val)" "" "0000803336" "00000245" "30" "2356" "0" "2356" "0" "c.2356A>G" "r.(?)" "p.(Ile786Val)" "" "0000803337" "00025898" "50" "2515" "16580" "2515" "16580" "c.2515+16580C>G" "r.(=)" "p.(=)" "" "0000803337" "00000245" "50" "2515" "16580" "2515" "16580" "c.2515+16580C>G" "r.(=)" "p.(=)" "" "0000803338" "00025898" "10" "2515" "16581" "2515" "16581" "c.2515+16581C>A" "r.(=)" "p.(=)" "" "0000803338" "00000245" "10" "2515" "16581" "2515" "16581" "c.2515+16581C>A" "r.(=)" "p.(=)" "" "0000803339" "00025898" "50" "2704" "0" "2704" "0" "c.2704A>G" "r.(?)" "p.(Lys902Glu)" "" "0000803339" "00000245" "50" "2704" "0" "2704" "0" "c.2704A>G" "r.(?)" "p.(Lys902Glu)" "" "0000803340" "00025898" "30" "3150" "0" "3150" "0" "c.3150A>G" "r.(?)" "p.(Glu1050=)" "" "0000803340" "00000245" "30" "3150" "0" "3150" "0" "c.3150A>G" "r.(?)" "p.(=)" "" "0000803341" "00025898" "30" "3204" "0" "3204" "0" "c.3204A>G" "r.(?)" "p.(Thr1068=)" "" "0000803341" "00000245" "30" "3204" "0" "3204" "0" "c.3204A>G" "r.(?)" "p.(=)" "" "0000803342" "00025898" "30" "4157" "7" "4157" "7" "c.4157+7A>G" "r.(=)" "p.(=)" "" "0000803343" "00025898" "70" "4224" "655" "4224" "655" "c.4224+655C>T" "r.(=)" "p.(=)" "" "0000803343" "00000245" "70" "4246" "0" "4246" "0" "c.4246C>T" "r.(?)" "p.(Arg1416*)" "" "0000803344" "00025898" "30" "4633" "22" "4633" "22" "c.4633+22dup" "r.(=)" "p.(=)" "" "0000803344" "00000245" "30" "4708" "22" "4708" "22" "c.4708+22dup" "r.(=)" "p.(=)" "" "0000803345" "00025898" "50" "4954" "0" "4954" "0" "c.4954C>T" "r.(?)" "p.(Arg1652Trp)" "" "0000803345" "00000245" "50" "5029" "0" "5029" "0" "c.5029C>T" "r.(?)" "p.(Arg1677Trp)" "" "0000803346" "00025898" "30" "4990" "0" "4990" "0" "c.4990G>A" "r.(?)" "p.(Val1664Ile)" "" "0000803346" "00000245" "30" "5065" "0" "5065" "0" "c.5065G>A" "r.(?)" "p.(Val1689Ile)" "" "0000803347" "00025898" "30" "5890" "0" "5890" "0" "c.5890T>C" "r.(?)" "p.(Ser1964Pro)" "" "0000803347" "00000245" "30" "5965" "0" "5965" "0" "c.5965T>C" "r.(?)" "p.(Ser1989Pro)" "" "0000803348" "00025898" "50" "6104" "0" "6104" "0" "c.6104T>C" "r.(?)" "p.(Leu2035Pro)" "" "0000803348" "00000245" "50" "6179" "0" "6179" "0" "c.6179T>C" "r.(?)" "p.(Leu2060Pro)" "" "0000803349" "00025898" "50" "7366" "0" "7366" "0" "c.7366G>A" "r.(?)" "p.(Val2456Ile)" "" "0000803349" "00000245" "50" "7441" "0" "7441" "0" "c.7441G>A" "r.(?)" "p.(Val2481Ile)" "" "0000803350" "00025898" "30" "7446" "0" "7446" "0" "c.7446A>G" "r.(?)" "p.(Leu2482=)" "" "0000803351" "00025898" "30" "8570" "0" "8570" "0" "c.8570C>T" "r.(?)" "p.(Pro2857Leu)" "" "0000803351" "00000245" "30" "8645" "0" "8645" "0" "c.8645C>T" "r.(?)" "p.(Pro2882Leu)" "" "0000803352" "00025898" "50" "9131" "0" "9131" "0" "c.9131A>C" "r.(?)" "p.(Glu3044Ala)" "" "0000803352" "00000245" "50" "9206" "0" "9206" "0" "c.9206A>C" "r.(?)" "p.(Glu3069Ala)" "" "0000803353" "00025898" "30" "9313" "0" "9313" "0" "c.9313C>A" "r.(?)" "p.(Pro3105Thr)" "" "0000803353" "00000245" "30" "9388" "0" "9388" "0" "c.9388C>A" "r.(?)" "p.(Pro3130Thr)" "" "0000803354" "00025898" "30" "9592" "0" "9592" "0" "c.9592C>A" "r.(?)" "p.(Arg3198=)" "" "0000803354" "00000245" "30" "9667" "0" "9667" "0" "c.9667C>A" "r.(?)" "p.(=)" "" "0000803355" "00025898" "30" "9630" "0" "9630" "0" "c.9630A>G" "r.(?)" "p.(Thr3210=)" "" "0000803355" "00000245" "30" "9705" "0" "9705" "0" "c.9705A>G" "r.(?)" "p.(=)" "" "0000803356" "00025898" "30" "10052" "0" "10052" "0" "c.10052A>T" "r.(?)" "p.(Asn3351Ile)" "" "0000803356" "00000245" "30" "10127" "0" "10127" "0" "c.10127A>T" "r.(?)" "p.(Asn3376Ile)" "" "0000803357" "00025898" "50" "10129" "0" "10129" "0" "c.10129C>T" "r.(?)" "p.(Leu3377Phe)" "" "0000803357" "00000245" "50" "10204" "0" "10204" "0" "c.10204C>T" "r.(?)" "p.(Leu3402Phe)" "" "0000803358" "00025898" "30" "10905" "0" "10905" "0" "c.10905T>C" "r.(?)" "p.(Pro3635=)" "" "0000803358" "00000245" "30" "10980" "0" "10980" "0" "c.10980T>C" "r.(?)" "p.(Pro3660=)" "" "0000803359" "00025898" "30" "11195" "0" "11195" "0" "c.11195G>A" "r.(?)" "p.(Arg3732Gln)" "" "0000803359" "00000245" "30" "11270" "0" "11270" "0" "c.11270G>A" "r.(?)" "p.(Arg3757Gln)" "" "0000803360" "00025898" "30" "11667" "0" "11667" "0" "c.11667C>T" "r.(?)" "p.(Ile3889=)" "" "0000803360" "00000245" "30" "11742" "0" "11742" "0" "c.11742C>T" "r.(?)" "p.(Ile3914=)" "" "0000803361" "00025898" "30" "11715" "0" "11715" "0" "c.11715C>A" "r.(?)" "p.(Leu3905=)" "" "0000803361" "00000245" "30" "11790" "0" "11790" "0" "c.11790C>A" "r.(?)" "p.(Leu3930=)" "" "0000803362" "00025898" "30" "11787" "0" "11787" "0" "c.11787C>T" "r.(?)" "p.(Asn3929=)" "" "0000803362" "00000245" "30" "11862" "0" "11862" "0" "c.11862C>T" "r.(?)" "p.(=)" "" "0000811972" "00000245" "70" "5492" "0" "5492" "0" "c.5492dup" "r.(?)" "p.(Asn1831Lysfs*8)" "" "0000811973" "00000245" "70" "5492" "0" "5492" "0" "c.5492dup" "r.(?)" "p.(Asn1831Lysfs*8)" "" "0000813884" "00025898" "70" "468" "0" "471" "0" "c.468_471del" "r.(?)" "p.(Asn157Serfs*3)" "" "0000813884" "00000245" "70" "468" "0" "471" "0" "c.468_471del" "r.(?)" "p.(Asn157Serfs*3)" "" "0000813885" "00025898" "70" "10081" "0" "10081" "0" "c.10081dup" "r.(?)" "p.(Thr3361Asnfs*3)" "" "0000813885" "00000245" "70" "10156" "0" "10156" "0" "c.10156dup" "r.(?)" "p.(Thr3386Asnfs*3)" "" "0000817740" "00000245" "90" "6879" "0" "6879" "0" "c.6879del" "r.(?)" "p.(Phe2293LeufsTer24)" "" "0000817765" "00000245" "90" "9066" "0" "9069" "30" "c.9066_9069+30delinsC" "r.spl" "p.?" "" "0000817785" "00000245" "90" "6879" "0" "6879" "0" "c.6879del" "r.(?)" "p.(Phe2293LeufsTer24)" "" "0000817820" "00000245" "90" "8988" "0" "8988" "0" "c.8988del" "r.(?)" "p.(Lys2996AsnfsTer47)" "" "0000817823" "00000245" "90" "5010" "0" "5010" "0" "c.5010G>A" "r.(?)" "p.(Trp1670Ter)" "" "0000819411" "00025898" "70" "1563" "0" "1563" "0" "c.1563G>A" "r.(=)" "p.(=)" "" "0000819411" "00000245" "70" "1563" "0" "1563" "0" "c.1563G>A" "r.(?)" "p.(Lys521=)" "" "0000819899" "00025898" "70" "979" "0" "979" "0" "c.979C>T" "r.(?)" "p.(Gln327*)" "" "0000819899" "00000245" "70" "979" "0" "979" "0" "c.979C>T" "r.(?)" "p.(Gln327*)" "" "0000819900" "00025898" "70" "979" "0" "979" "0" "c.979C>T" "r.(?)" "p.(Gln327*)" "" "0000819900" "00000245" "70" "979" "0" "979" "0" "c.979C>T" "r.(?)" "p.(Gln327*)" "" "0000819960" "00025898" "70" "5980" "0" "5981" "0" "c.5980_5981del" "r.(?)" "p.(Asp1994Glnfs*15)" "" "0000819960" "00000245" "70" "6055" "0" "6056" "0" "c.6055_6056del" "r.(?)" "p.(Asp2019Glnfs*15)" "" "0000819961" "00025898" "70" "5980" "0" "5981" "0" "c.5980_5981del" "r.(?)" "p.(Asp1994Glnfs*15)" "" "0000819961" "00000245" "70" "6055" "0" "6056" "0" "c.6055_6056del" "r.(?)" "p.(Asp2019Glnfs*15)" "" "0000820220" "00025898" "70" "8037" "0" "8037" "0" "c.8037C>G" "r.(?)" "p.(Tyr2679*)" "" "0000820220" "00000245" "70" "8112" "0" "8112" "0" "c.8112C>G" "r.(?)" "p.(Tyr2704*)" "" "0000820637" "00000245" "70" "7855" "-1" "8696" "1" "c.(7854+1_7855-1)_(8696+1_8697-1)del" "r.spl" "p.(?)" "" "0000820753" "00025898" "70" "7678" "0" "7678" "0" "c.7678G>A" "r.(?)" "p.(Glu2560Lys)" "" "0000820753" "00000245" "70" "7753" "0" "7753" "0" "c.7753G>A" "r.(?)" "p.(Glu2585Lys)" "" "0000820754" "00025898" "70" "7678" "0" "7678" "0" "c.7678G>A" "r.(?)" "p.(Glu2560Lys)" "" "0000820754" "00000245" "70" "7753" "0" "7753" "0" "c.7753G>A" "r.(?)" "p.(Glu2585Lys)" "" "0000827622" "00000245" "90" "" "0" "" "0" "c.7220_7221A" "r.(?)" "p.(?)" "" "0000827628" "00025898" "50" "11393" "0" "11393" "0" "c.11393G>C" "r.(?)" "p.(Gly3798Ala)" "" "0000827628" "00000245" "50" "11468" "0" "11468" "0" "c.11468G>C" "r.(?)" "p.(Gly3823Ala)" "" "0000828514" "00025898" "70" "8800" "0" "8800" "0" "c.8800C>T" "r.(?)" "p.(Gln2934*)" "" "0000828514" "00000245" "70" "8875" "0" "8875" "0" "c.8875C>T" "r.(?)" "p.(Gln2959*)" "" "0000828515" "00025898" "70" "10361" "0" "10364" "0" "c.10361_10364del" "r.(?)" "p.(Ile3454Serfs*30)" "" "0000828515" "00000245" "70" "10436" "0" "10439" "0" "c.10436_10439del" "r.(?)" "p.(Ile3479Serfs*30)" "" "0000828540" "00025898" "70" "11523" "0" "11523" "0" "c.11523del" "r.(?)" "p.(Glu3842Lysfs*11)" "" "0000828540" "00000245" "70" "11598" "0" "11598" "0" "c.11598del" "r.(?)" "p.(Glu3867Lysfs*11)" "" "0000828541" "00025898" "70" "1248" "0" "1248" "0" "c.1248G>T" "r.(?)" "p.(Gln416His)" "" "0000828541" "00000245" "70" "1248" "0" "1248" "0" "c.1248G>T" "r.(?)" "p.(Gln416His)" "" "0000829759" "00000245" "70" "-1" "0" "937" "1" "c.(?_-1)_(937+1_938-1)del" "r.0?" "p.0?" "" "0000829760" "00000245" "70" "5984" "-1" "7125" "1" "c.(5983+1_5984-1)_(7125+1_7126-1)dup" "r.?" "p.?" "" "0000851736" "00025898" "70" "291" "1" "291" "1" "c.291+1G>A" "r.spl?" "p.?" "" "0000851737" "00025898" "50" "584" "0" "584" "0" "c.584C>G" "r.(?)" "p.(Thr195Ser)" "" "0000851737" "00000245" "50" "584" "0" "584" "0" "c.584C>G" "r.(?)" "p.(Thr195Ser)" "" "0000851738" "00025898" "30" "1864" "0" "1864" "0" "c.1864A>G" "r.(?)" "p.(Thr622Ala)" "" "0000851738" "00000245" "30" "1864" "0" "1864" "0" "c.1864A>G" "r.(?)" "p.(Thr622Ala)" "" "0000851739" "00025898" "90" "2264" "0" "2264" "0" "c.2264T>A" "r.(?)" "p.(Leu755*)" "" "0000851740" "00025898" "30" "2433" "0" "2433" "0" "c.2433A>T" "r.(?)" "p.(Ile811=)" "" "0000851741" "00025898" "30" "2470" "0" "2470" "0" "c.2470T>G" "r.(?)" "p.(Ser824Ala)" "" "0000851741" "00000245" "30" "2470" "0" "2470" "0" "c.2470T>G" "r.(?)" "p.(Ser824Ala)" "" "0000851742" "00025898" "30" "3083" "-9" "3083" "-9" "c.3083-9C>T" "r.(=)" "p.(=)" "" "0000851743" "00025898" "30" "3333" "0" "3333" "0" "c.3333G>A" "r.(?)" "p.(Pro1111=)" "" "0000851744" "00025898" "30" "3342" "0" "3342" "0" "c.3342T>G" "r.(?)" "p.(Leu1114=)" "" "0000851745" "00025898" "30" "6048" "0" "6048" "0" "c.6048G>A" "r.(?)" "p.(Ala2016=)" "" "0000851746" "00025898" "30" "7647" "0" "7647" "0" "c.7647C>T" "r.(?)" "p.(Phe2549=)" "" "0000851746" "00000245" "30" "7722" "0" "7722" "0" "c.7722C>T" "r.(?)" "p.(Phe2574=)" "" "0000851747" "00025898" "30" "9331" "-3" "9331" "-2" "c.9331-3_9331-2insTTTTTTTTTTTTTTTTTTTTTTTTTT" "r.spl?" "p.?" "" "0000851748" "00025898" "30" "10135" "0" "10135" "0" "c.10135C>T" "r.(?)" "p.(His3379Tyr)" "" "0000851749" "00025898" "50" "10568" "0" "10568" "0" "c.10568A>G" "r.(?)" "p.(Tyr3523Cys)" "" "0000851749" "00000245" "50" "10643" "0" "10643" "0" "c.10643A>G" "r.(?)" "p.(Tyr3548Cys)" "" "0000851750" "00025898" "50" "11099" "0" "11099" "0" "c.11099G>A" "r.(?)" "p.(Arg3700Gln)" "" "0000851751" "00025898" "30" "11392" "8" "11392" "8" "c.11392+8G>A" "r.(=)" "p.(=)" "" "0000851751" "00000245" "30" "11467" "8" "11467" "8" "c.11467+8G>A" "r.(=)" "p.(=)" "" "0000851752" "00025898" "50" "11885" "0" "11885" "0" "c.11885C>A" "r.(?)" "p.(Pro3962His)" "" "0000860985" "00025898" "50" "328" "0" "328" "0" "c.328C>T" "r.(?)" "p.(Arg110Cys)" "" "0000860986" "00025898" "30" "581" "-10" "581" "-10" "c.581-10T>C" "r.(=)" "p.(=)" "" "0000860986" "00000245" "30" "581" "-10" "581" "-10" "c.581-10T>C" "r.(=)" "p.(=)" "" "0000860987" "00025898" "30" "1041" "0" "1041" "0" "c.1041A>G" "r.(?)" "p.(Ser347=)" "" "0000860987" "00000245" "30" "1041" "0" "1041" "0" "c.1041A>G" "r.(?)" "p.(Ser347=)" "" "0000860988" "00025898" "30" "1293" "0" "1293" "0" "c.1293T>G" "r.(?)" "p.(Thr431=)" "" "0000860988" "00000245" "30" "1293" "0" "1293" "0" "c.1293T>G" "r.(?)" "p.(Thr431=)" "" "0000860989" "00025898" "30" "1463" "0" "1463" "0" "c.1463C>T" "r.(?)" "p.(Thr488Met)" "" "0000860989" "00000245" "30" "1463" "0" "1463" "0" "c.1463C>T" "r.(?)" "p.(Thr488Met)" "" "0000860990" "00025898" "50" "2807" "0" "2807" "0" "c.2807A>T" "r.(?)" "p.(Asp936Val)" "" "0000860991" "00025898" "30" "3516" "0" "3516" "0" "c.3516A>G" "r.(?)" "p.(Thr1172=)" "" "0000860991" "00000245" "30" "3516" "0" "3516" "0" "c.3516A>G" "r.(?)" "p.(Thr1172=)" "" "0000860992" "00025898" "50" "4226" "0" "4226" "0" "c.4226C>A" "r.(?)" "p.(Thr1409Lys)" "" "0000860993" "00025898" "30" "4746" "-7" "4746" "-7" "c.4746-7T>C" "r.(=)" "p.(=)" "" "0000860994" "00025898" "30" "6453" "0" "6453" "0" "c.6453T>G" "r.(?)" "p.(Pro2151=)" "" "0000860995" "00025898" "30" "6538" "0" "6538" "0" "c.6538A>C" "r.(?)" "p.(Ile2180Leu)" "" "0000860996" "00025898" "30" "8793" "-13" "8793" "-13" "c.8793-13G>T" "r.(=)" "p.(=)" "" "0000860997" "00025898" "30" "11044" "13" "11044" "13" "c.11044+13G>A" "r.(=)" "p.(=)" "" "0000860997" "00000245" "30" "11119" "13" "11119" "13" "c.11119+13G>A" "r.(=)" "p.(=)" "" "0000860998" "00025898" "90" "11689" "0" "11689" "0" "c.11689C>T" "r.(?)" "p.(Gln3897*)" "" "0000888072" "00025898" "50" "365" "0" "365" "0" "c.365C>T" "r.(?)" "p.(Pro122Leu)" "" "0000888073" "00025898" "90" "901" "0" "904" "0" "c.901_904del" "r.(?)" "p.(Thr301ValfsTer7)" "" "0000888073" "00000245" "90" "901" "0" "904" "0" "c.901_904del" "r.(?)" "p.(Thr301ValfsTer7)" "" "0000888074" "00025898" "30" "1440" "0" "1440" "0" "c.1440C>T" "r.(?)" "p.(Phe480=)" "" "0000888074" "00000245" "30" "1440" "0" "1440" "0" "c.1440C>T" "r.(?)" "p.(Phe480=)" "" "0000888075" "00025898" "10" "1536" "0" "1536" "0" "c.1536A>G" "r.(?)" "p.(Glu512=)" "" "0000888076" "00025898" "10" "1782" "0" "1782" "0" "c.1782T>C" "r.(?)" "p.(Ile594=)" "" "0000888077" "00025898" "10" "2275" "0" "2275" "0" "c.2275G>C" "r.(?)" "p.(Val759Leu)" "" "0000888077" "00000245" "10" "2275" "0" "2275" "0" "c.2275G>C" "r.(?)" "p.(Val759Leu)" "" "0000888078" "00025898" "30" "2451" "0" "2451" "0" "c.2451T>C" "r.(?)" "p.(His817=)" "" "0000888078" "00000245" "30" "2451" "0" "2451" "0" "c.2451T>C" "r.(?)" "p.(His817=)" "" "0000888079" "00025898" "30" "2880" "0" "2880" "0" "c.2880A>T" "r.(?)" "p.(Leu960Phe)" "" "0000888079" "00000245" "30" "2880" "0" "2880" "0" "c.2880A>T" "r.(?)" "p.(Leu960Phe)" "" "0000888080" "00025898" "10" "3211" "-11" "3211" "-11" "c.3211-11T>C" "r.(=)" "p.(=)" "" "0000888081" "00025898" "30" "3297" "0" "3297" "0" "c.3297A>C" "r.(?)" "p.(Thr1099=)" "" "0000888082" "00025898" "30" "4224" "727" "4224" "727" "c.4224+727T>C" "r.(=)" "p.(=)" "" "0000888083" "00025898" "90" "4399" "0" "4399" "0" "c.4399del" "r.(?)" "p.(Ile1467PhefsTer43)" "" "0000888083" "00000245" "90" "4474" "0" "4474" "0" "c.4474del" "r.(?)" "p.(Ile1492PhefsTer43)" "" "0000888084" "00025898" "30" "6178" "0" "6178" "0" "c.6178A>G" "r.(?)" "p.(Met2060Val)" "" "0000888085" "00025898" "30" "6455" "-4" "6455" "-4" "c.6455-4del" "r.spl?" "p.?" "" "0000888085" "00000245" "30" "6530" "-4" "6530" "-4" "c.6530-4del" "r.spl?" "p.?" "" "0000888086" "00025898" "10" "6977" "0" "6977" "0" "c.6977G>A" "r.(?)" "p.(Arg2326Gln)" "" "0000888087" "00025898" "70" "7048" "0" "7048" "0" "c.7048C>T" "r.(?)" "p.(Gln2350*)" "" "0000888088" "00025898" "90" "7050" "1" "7050" "1" "c.7050+1G>T" "r.spl?" "p.?" "" "0000888088" "00000245" "90" "7125" "1" "7125" "1" "c.7125+1G>T" "r.spl?" "p.?" "" "0000888089" "00025898" "10" "7338" "0" "7338" "0" "c.7338T>C" "r.(?)" "p.(Phe2446=)" "" "0000888090" "00025898" "30" "10052" "0" "10052" "0" "c.10052A>T" "r.(?)" "p.(Asn3351Ile)" "" "0000888090" "00000245" "30" "10127" "0" "10127" "0" "c.10127A>T" "r.(?)" "p.(Asn3376Ile)" "" "0000888091" "00025898" "50" "10568" "0" "10568" "0" "c.10568A>G" "r.(?)" "p.(Tyr3523Cys)" "" "0000888091" "00000245" "50" "10643" "0" "10643" "0" "c.10643A>G" "r.(?)" "p.(Tyr3548Cys)" "" "0000888092" "00025898" "30" "10714" "0" "10714" "0" "c.10714G>A" "r.(?)" "p.(Val3572Ile)" "" "0000888093" "00025898" "90" "11141" "0" "11141" "0" "c.11141G>A" "r.(?)" "p.(Trp3714*)" "" "0000888094" "00025898" "30" "11619" "0" "11619" "0" "c.11619G>C" "r.(?)" "p.(Val3873=)" "" "0000888094" "00000245" "30" "11694" "0" "11694" "0" "c.11694G>C" "r.(?)" "p.(Val3898=)" "" "0000888095" "00025898" "90" "11915" "0" "11916" "0" "c.11915_11916insG" "r.(?)" "p.(Asp3973*)" "" "0000905913" "00025898" "50" "5432" "0" "5432" "0" "c.5432C>G" "r.(?)" "p.(Pro1811Arg)" "" "0000905913" "00000245" "50" "5507" "0" "5507" "0" "c.5507C>G" "r.(?)" "p.(Pro1836Arg)" "" "0000905914" "00025898" "50" "7921" "0" "7921" "0" "c.7921C>T" "r.(?)" "p.(Arg2641Cys)" "" "0000905914" "00000245" "50" "7996" "0" "7996" "0" "c.7996C>T" "r.(?)" "p.(Arg2666Cys)" "" "0000912844" "00025898" "10" "4224" "656" "4224" "656" "c.4224+656G>A" "r.(=)" "p.(=)" "" "0000912845" "00025898" "30" "4791" "0" "4791" "0" "c.4791C>T" "r.(?)" "p.(Ile1597=)" "" "0000912845" "00000245" "30" "4866" "0" "4866" "0" "c.4866C>T" "r.(?)" "p.(Ile1622=)" "" "0000912846" "00025898" "50" "7766" "0" "7766" "0" "c.7766A>C" "r.(?)" "p.(Gln2589Pro)" "" "0000912847" "00025898" "50" "8390" "0" "8390" "0" "c.8390A>G" "r.(?)" "p.(Tyr2797Cys)" "" "0000912847" "00000245" "50" "8465" "0" "8465" "0" "c.8465A>G" "r.(?)" "p.(Tyr2822Cys)" "" "0000912848" "00025898" "30" "8793" "-12" "8793" "-12" "c.8793-12T>A" "r.(=)" "p.(=)" "" "0000912849" "00025898" "30" "8827" "0" "8827" "0" "c.8827C>A" "r.(?)" "p.(Arg2943=)" "" "0000912850" "00025898" "30" "10052" "0" "10052" "0" "c.10052A>T" "r.(?)" "p.(Asn3351Ile)" "" "0000912850" "00000245" "30" "10127" "0" "10127" "0" "c.10127A>T" "r.(?)" "p.(Asn3376Ile)" "" "0000912851" "00025898" "30" "11181" "0" "11181" "0" "c.11181A>G" "r.(?)" "p.(Arg3727=)" "" "0000912851" "00000245" "30" "11256" "0" "11256" "0" "c.11256A>G" "r.(?)" "p.(Arg3752=)" "" "0000912852" "00025898" "30" "11619" "0" "11619" "0" "c.11619G>C" "r.(?)" "p.(Val3873=)" "" "0000912852" "00000245" "30" "11694" "0" "11694" "0" "c.11694G>C" "r.(?)" "p.(Val3898=)" "" "0000920693" "00000245" "70" "7323" "-538" "7900" "0" "c.7323-538_7900del" "r.?" "p.?" "" "0000924796" "00025898" "30" "1082" "0" "1082" "0" "c.1082A>G" "r.(?)" "p.(Asp361Gly)" "" "0000924797" "00025898" "30" "1981" "0" "1981" "0" "c.1981G>A" "r.(?)" "p.(Asp661Asn)" "" "0000924797" "00000245" "30" "1981" "0" "1981" "0" "c.1981G>A" "r.(?)" "p.(Asp661Asn)" "" "0000924798" "00025898" "30" "3827" "0" "3827" "0" "c.3827C>T" "r.(?)" "p.(Thr1276Ile)" "" "0000924798" "00000245" "30" "3827" "0" "3827" "0" "c.3827C>T" "r.(?)" "p.(Thr1276Ile)" "" "0000924799" "00025898" "50" "8728" "0" "8728" "0" "c.8728G>A" "r.(?)" "p.(Glu2910Lys)" "" "0000924800" "00025898" "50" "9571" "0" "9571" "0" "c.9571G>A" "r.(?)" "p.(Ala3191Thr)" "" "0000924801" "00025898" "50" "9784" "0" "9784" "0" "c.9784G>A" "r.(?)" "p.(Glu3262Lys)" "" "0000924802" "00025898" "30" "9786" "0" "9786" "0" "c.9786G>A" "r.(?)" "p.(Glu3262=)" "" "0000924803" "00025898" "30" "11884" "0" "11884" "0" "c.11884C>G" "r.(?)" "p.(Pro3962Ala)" "" "0000924803" "00000245" "30" "11959" "0" "11959" "0" "c.11959C>G" "r.(?)" "p.(Pro3987Ala)" "" "0000929402" "00025898" "30" "4224" "606" "4224" "606" "c.4224+606T>C" "r.(=)" "p.(=)" "" "0000929403" "00025898" "50" "8381" "0" "8381" "0" "c.8381C>A" "r.(?)" "p.(Ser2794Tyr)" "" "0000929404" "00025898" "30" "9332" "0" "9332" "0" "c.9332A>T" "r.(?)" "p.(Tyr3111Phe)" "" "0000929405" "00025898" "50" "10775" "0" "10775" "0" "c.10775C>T" "r.(?)" "p.(Ser3592Leu)" "" "0000929406" "00025898" "30" "10908" "0" "10908" "0" "c.10908A>C" "r.(?)" "p.(Ala3636=)" "" "0000929406" "00000245" "30" "10983" "0" "10983" "0" "c.10983A>C" "r.(?)" "p.(Ala3661=)" "" "0000939868" "00025898" "70" "1915" "0" "1915" "0" "c.1915C>T" "r.(?)" "p.(Arg639*)" "" "0000939868" "00000245" "70" "1915" "0" "1915" "0" "c.1915C>T" "r.(?)" "p.(Arg639*)" "" "0000939878" "00000245" "70" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000939908" "00000245" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" "56" "0000948981" "00025898" "50" "584" "0" "584" "0" "c.584C>G" "r.(?)" "p.(Thr195Ser)" "" "0000948981" "00000245" "50" "584" "0" "584" "0" "c.584C>G" "r.(?)" "p.(Thr195Ser)" "" "0000948982" "00025898" "30" "2451" "0" "2451" "0" "c.2451T>C" "r.(?)" "p.(His817=)" "" "0000948982" "00000245" "30" "2451" "0" "2451" "0" "c.2451T>C" "r.(?)" "p.(His817=)" "" "0000948983" "00025898" "30" "3744" "0" "3744" "0" "c.3744A>G" "r.(?)" "p.(=)" "" "0000948984" "00025898" "50" "3811" "0" "3811" "0" "c.3811A>T" "r.(?)" "p.(Thr1271Ser)" "" "0000948984" "00000245" "50" "3811" "0" "3811" "0" "c.3811A>T" "r.(?)" "p.(Thr1271Ser)" "" "0000948985" "00025898" "30" "5501" "0" "5501" "0" "c.5501C>T" "r.(?)" "p.(Ser1834Leu)" "" "0000948985" "00000245" "30" "5576" "0" "5576" "0" "c.5576C>T" "r.(?)" "p.(Ser1859Leu)" "" "0000948986" "00025898" "50" "7712" "0" "7712" "0" "c.7712C>T" "r.(?)" "p.(Ser2571Phe)" "" "0000948986" "00000245" "50" "7787" "0" "7787" "0" "c.7787C>T" "r.(?)" "p.(Ser2596Phe)" "" "0000948987" "00025898" "30" "9331" "-3" "9331" "-2" "c.9331-3_9331-2insTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT" "r.spl?" "p.?" "" "0000948988" "00025898" "30" "9349" "0" "9349" "0" "c.9349A>G" "r.(?)" "p.(Ser3117Gly)" "" "0000948988" "00000245" "30" "9424" "0" "9424" "0" "c.9424A>G" "r.(?)" "p.(Ser3142Gly)" "" "0000948989" "00025898" "30" "10240" "0" "10240" "0" "c.10240T>C" "r.(?)" "p.(=)" "" "0000948990" "00025898" "30" "11181" "0" "11181" "0" "c.11181A>G" "r.(?)" "p.(Arg3727=)" "" "0000948990" "00000245" "30" "11256" "0" "11256" "0" "c.11256A>G" "r.(?)" "p.(Arg3752=)" "" "0000954075" "00000245" "90" "6200" "0" "6200" "0" "c.6200T>A" "r.(?)" "p.(Leu2067Ter)" "" "0000954090" "00000245" "90" "9530" "0" "9531" "0" "c.9530_9531del" "r.(?)" "p.(Ala3177ValfsTer18)" "" "0000958912" "00025898" "70" "2406" "0" "2406" "0" "c.2406del" "r.(?)" "p.(Ala803HisfsTer24)" "" "0000959084" "00025898" "50" "292" "0" "292" "0" "c.292C>T" "r.(?)" "p.(Arg98Trp)" "" "0000959346" "00025898" "50" "148" "-16" "148" "-16" "c.148-16T>A" "r.spl?" "p.?" "" "0000964736" "00025898" "50" "3116" "0" "3116" "0" "c.3116T>C" "r.(?)" "p.(Met1039Thr)" "" "0000964736" "00000245" "50" "3116" "0" "3116" "0" "c.3116T>C" "r.(?)" "p.(Met1039Thr)" "" "0000964738" "00025898" "30" "3413" "0" "3413" "0" "c.3413C>T" "r.(?)" "p.(Pro1138Leu)" "" "0000964738" "00000245" "30" "3413" "0" "3413" "0" "c.3413C>T" "r.(?)" "p.(Pro1138Leu)" "" "0000964745" "00025898" "10" "9331" "0" "9332" "0" "c.9331_9332insTTTTTTTTTTTTTTTTT" "r.(?)" "p.(Tyr3111Phefs*27)" "" "0000964746" "00025898" "10" "9331" "0" "9332" "0" "c.9331_9332insTTTTTTTTTTTTTTTTTTTTTTTTTT" "r.(?)" "p.(Tyr3111Phefs*30)" "" "0000964750" "00025898" "30" "9742" "13" "9742" "13" "c.9742+13C>T" "r.(=)" "p.(=)" "" "0000964750" "00000245" "30" "9817" "13" "9817" "13" "c.9817+13C>T" "r.(=)" "p.(=)" "" "0000964751" "00025898" "30" "11022" "0" "11022" "0" "c.11022G>A" "r.(?)" "p.(=)" "" "0000964752" "00025898" "50" "11750" "0" "11752" "0" "c.11750_11752dup" "r.(?)" "p.(Asp3917dup)" "" "0000964752" "00000245" "50" "11825" "0" "11827" "0" "c.11825_11827dup" "r.(?)" "p.(Asp3942dup)" "" "0000977949" "00025898" "50" "584" "0" "584" "0" "c.584C>G" "r.(?)" "p.(Thr195Ser)" "" "0000977949" "00000245" "50" "584" "0" "584" "0" "c.584C>G" "r.(?)" "p.(Thr195Ser)" "" "0000977950" "00025898" "50" "709" "0" "709" "0" "c.709C>T" "r.(?)" "p.(Arg237Cys)" "" "0000977951" "00025898" "50" "1864" "0" "1864" "0" "c.1864A>G" "r.(?)" "p.(Thr622Ala)" "" "0000977951" "00000245" "50" "1864" "0" "1864" "0" "c.1864A>G" "r.(?)" "p.(Thr622Ala)" "" "0000977952" "00025898" "30" "3751" "0" "3751" "0" "c.3751A>G" "r.(?)" "p.(Thr1251Ala)" "" "0000977952" "00000245" "30" "3751" "0" "3751" "0" "c.3751A>G" "r.(?)" "p.(Thr1251Ala)" "" "0000977953" "00025898" "50" "4949" "3" "4949" "3" "c.4949+3A>T" "r.spl?" "p.?" "" "0000977954" "00025898" "50" "8956" "0" "8956" "0" "c.8956G>T" "r.(?)" "p.(Val2986Phe)" "" "0000977957" "00025898" "30" "9592" "0" "9592" "0" "c.9592C>T" "r.(?)" "p.(Arg3198Trp)" "" "0000977957" "00000245" "30" "9667" "0" "9667" "0" "c.9667C>T" "r.(?)" "p.(Arg3223Trp)" "" "0000977958" "00025898" "50" "10681" "0" "10681" "0" "c.10681C>T" "r.(?)" "p.(Arg3561Trp)" "" "0000987249" "00025898" "70" "2442" "0" "2450" "0" "c.2442_2450delinsCCCTGC" "r.(?)" "p.(Trp815_His817delinsProAla)" "" "0000987323" "00025898" "90" "3870" "1" "3870" "1" "c.3870+1G>T" "r.spl" "p.?" "" "0000987329" "00025898" "90" "8915" "0" "8915" "0" "c.8915G>A" "r.(?)" "p.(Trp2972Ter)" "" "0000996811" "00025898" "50" "565" "0" "565" "0" "c.565T>C" "r.(?)" "p.(Phe189Leu)" "" "0000996811" "00000245" "50" "565" "0" "565" "0" "c.565T>C" "r.(?)" "p.(Phe189Leu)" "" "0000996812" "00025898" "50" "796" "0" "796" "0" "c.796A>G" "r.(?)" "p.(Ile266Val)" "" "0000996813" "00025898" "50" "1248" "0" "1248" "0" "c.1248G>T" "r.(?)" "p.(Gln416His)" "" "0000996813" "00000245" "50" "1248" "0" "1248" "0" "c.1248G>T" "r.(?)" "p.(Gln416His)" "" "0000996814" "00025898" "30" "2209" "-4" "2209" "-4" "c.2209-4T>G" "r.spl?" "p.?" "" "0000996815" "00025898" "50" "2596" "0" "2596" "0" "c.2596G>A" "r.(?)" "p.(Val866Ile)" "" "0000996815" "00000245" "50" "2596" "0" "2596" "0" "c.2596G>A" "r.(?)" "p.(Val866Ile)" "" "0000996816" "00025898" "50" "3089" "0" "3089" "0" "c.3089G>A" "r.(?)" "p.(Arg1030His)" "" "0000996817" "00025898" "50" "3866" "0" "3866" "0" "c.3866C>G" "r.(?)" "p.(Thr1289Ser)" "" "0000996817" "00000245" "50" "3866" "0" "3866" "0" "c.3866C>G" "r.(?)" "p.(Thr1289Ser)" "" "0000996818" "00025898" "50" "5167" "0" "5167" "0" "c.5167C>T" "r.(?)" "p.(Gln1723*)" "" "0000996819" "00025898" "50" "5168" "0" "5168" "0" "c.5168A>C" "r.(?)" "p.(Gln1723Pro)" "" "0000996820" "00025898" "50" "5235" "0" "5235" "0" "c.5235A>C" "r.(?)" "p.(Glu1745Asp)" "" "0000996821" "00025898" "50" "6022" "0" "6022" "0" "c.6022A>T" "r.(?)" "p.(Ile2008Phe)" "" "0000996822" "00025898" "30" "6230" "0" "6230" "0" "c.6230G>A" "r.(?)" "p.(Arg2077His)" "" "0000996823" "00025898" "30" "7782" "0" "7782" "0" "c.7782C>G" "r.(?)" "p.(Asn2594Lys)" "" "0000996824" "00025898" "10" "9592" "0" "9592" "0" "c.9592C>T" "r.(?)" "p.(Arg3198Trp)" "" "0000996824" "00000245" "10" "9667" "0" "9667" "0" "c.9667C>T" "r.(?)" "p.(Arg3223Trp)" "" "0000996825" "00025898" "30" "9593" "0" "9593" "0" "c.9593G>A" "r.(?)" "p.(Arg3198Gln)" "" "0000996826" "00025898" "50" "10324" "0" "10324" "0" "c.10324G>A" "r.(?)" "p.(Ala3442Thr)" "" "0000996826" "00000245" "50" "10399" "0" "10399" "0" "c.10399G>A" "r.(?)" "p.(Ala3467Thr)" "" "0000996827" "00025898" "50" "10939" "0" "10939" "0" "c.10939G>A" "r.(?)" "p.(Ala3647Thr)" "" "0000996828" "00025898" "50" "11338" "0" "11338" "0" "c.11338G>T" "r.(?)" "p.(Val3780Leu)" "" "0000996828" "00000245" "50" "11413" "0" "11413" "0" "c.11413G>T" "r.(?)" "p.(Val3805Leu)" "" "0000996829" "00025898" "50" "11656" "0" "11656" "0" "c.11656G>A" "r.(?)" "p.(Val3886Ile)" "" "0000996830" "00025898" "50" "11750" "0" "11752" "0" "c.11750_11752dup" "r.(?)" "p.(Asp3917dup)" "" "0000996830" "00000245" "50" "11825" "0" "11827" "0" "c.11825_11827dup" "r.(?)" "p.(Asp3942dup)" "" "0000996831" "00025898" "50" "11904" "0" "11904" "0" "c.11904C>G" "r.(?)" "p.(Tyr3968*)" "" "0001014396" "00025898" "50" "1248" "0" "1248" "0" "c.1248G>T" "r.(?)" "p.(Gln416His)" "" "0001014396" "00000245" "50" "1248" "0" "1248" "0" "c.1248G>T" "r.(?)" "p.(Gln416His)" "" "0001014397" "00025898" "10" "9331" "0" "9332" "0" "c.9331_9332insTTTTTTTTTTTTTTTTTTTTTTT" "r.(?)" "p.(Tyr3111Phefs*29)" "" "0001014398" "00025898" "50" "10808" "0" "10808" "0" "c.10808C>T" "r.(?)" "p.(Ala3603Val)" "" "0001022094" "00025898" "90" "2934" "1" "2934" "2" "c.2934+1_2934+2del" "r.2825_2934del" "p.Gly942fs" "20i" "0001022095" "00025898" "70" "5220" "0" "5220" "0" "c.5220G>T" "r.[5077_5220del,?]" "p.[Glu1693_Glu1740del,?]" "33" "0001025463" "00025898" "50" "6977" "0" "6977" "0" "c.6977G>A" "r.(?)" "p.(Arg2326Gln)" "" "0001025464" "00025898" "50" "8077" "0" "8077" "0" "c.8077C>T" "r.(?)" "p.(Leu2693Phe)" "" "0001025465" "00025898" "10" "9331" "0" "9332" "0" "c.9331_9332insTTTTTTTTTTTTTTTTTTTTTTTT" "r.(?)" "p.(Glu3110_Tyr3111insPhePhePhePhePhePhePhePhe)" "" "0001025466" "00025898" "30" "10235" "0" "10235" "0" "c.10235C>T" "r.(?)" "p.(Ala3412Val)" "" "0001025467" "00025898" "50" "11338" "0" "11338" "0" "c.11338G>T" "r.(?)" "p.(Val3780Leu)" "" "0001025467" "00000245" "50" "11413" "0" "11413" "0" "c.11413G>T" "r.(?)" "p.(Val3805Leu)" "" "0001036640" "00025898" "30" "1293" "0" "1293" "0" "c.1293T>G" "r.(?)" "p.(Thr431=)" "" "0001036640" "00000245" "30" "1293" "0" "1293" "0" "c.1293T>G" "r.(?)" "p.(Thr431=)" "" "0001036641" "00025898" "30" "2275" "0" "2275" "0" "c.2275G>C" "r.(?)" "p.(Val759Leu)" "" "0001036641" "00000245" "30" "2275" "0" "2275" "0" "c.2275G>C" "r.(?)" "p.(Val759Leu)" "" "0001036642" "00025898" "30" "2704" "0" "2704" "0" "c.2704A>G" "r.(?)" "p.(Lys902Glu)" "" "0001036642" "00000245" "30" "2704" "0" "2704" "0" "c.2704A>G" "r.(?)" "p.(Lys902Glu)" "" "0001036643" "00025898" "30" "2760" "0" "2760" "0" "c.2760A>G" "r.(?)" "p.(Leu920=)" "" "0001036643" "00000245" "30" "2760" "0" "2760" "0" "c.2760A>G" "r.(?)" "p.(Leu920=)" "" "0001036644" "00025898" "50" "3083" "-8" "3083" "-8" "c.3083-8G>A" "r.(=)" "p.(=)" "" "0001036644" "00000245" "50" "3083" "-8" "3083" "-8" "c.3083-8G>A" "r.(=)" "p.(=)" "" "0001036645" "00025898" "50" "4224" "620" "4224" "622" "c.4224+620_4224+622del" "r.(=)" "p.(=)" "" "0001036646" "00025898" "30" "4225" "-8" "4225" "-8" "c.4225-8dup" "r.(=)" "p.(=)" "" "0001036647" "00025898" "90" "4336" "0" "4336" "0" "c.4336C>T" "r.(?)" "p.(Arg1446*)" "" "0001036648" "00025898" "50" "5220" "0" "5220" "0" "c.5220G>T" "r.(?)" "p.(Glu1740Asp)" "" "0001036648" "00000245" "50" "5295" "0" "5295" "0" "c.5295G>T" "r.(?)" "p.(Glu1765Asp)" "" "0001036649" "00025898" "50" "5761" "0" "5761" "0" "c.5761A>G" "r.(?)" "p.(Thr1921Ala)" "" "0001036649" "00000245" "50" "5836" "0" "5836" "0" "c.5836A>G" "r.(?)" "p.(Thr1946Ala)" "" "0001036650" "00025898" "50" "6047" "0" "6047" "0" "c.6047C>T" "r.(?)" "p.(Ala2016Val)" "" "0001036651" "00025898" "30" "6455" "-4" "6455" "-4" "c.6455-4dup" "r.spl?" "p.?" "" "0001036651" "00000245" "30" "6530" "-4" "6530" "-4" "c.6530-4dup" "r.spl?" "p.?" "" "0001036652" "00025898" "10" "6963" "0" "6963" "0" "c.6963A>G" "r.(?)" "p.(Val2321=)" "" "0001036652" "00000245" "10" "7038" "0" "7038" "0" "c.7038A>G" "r.(?)" "p.(Val2346=)" "" "0001036653" "00025898" "10" "9330" "10" "9330" "10" "c.9330+10T>A" "r.(=)" "p.(=)" "" "0001036653" "00000245" "10" "9405" "10" "9405" "10" "c.9405+10T>A" "r.(=)" "p.(=)" "" "0001036654" "00025898" "50" "9331" "-3" "9331" "-2" "c.9331-3_9331-2insTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT" "r.spl?" "p.?" "" "0001036655" "00025898" "10" "9331" "0" "9332" "0" "c.9331_9332insTTTTTTTTTTTTTTTTTTT" "r.(?)" "p.(Tyr3111Phefs*17)" "" "0001036656" "00025898" "10" "10065" "0" "10065" "0" "c.10065G>T" "r.(?)" "p.(Ala3355=)" "" "0001036656" "00000245" "10" "10140" "0" "10140" "0" "c.10140G>T" "r.(?)" "p.(Ala3380=)" "" "0001036657" "00025898" "30" "11158" "0" "11158" "0" "c.11158G>A" "r.(?)" "p.(Glu3720Lys)" "" "0001036657" "00000245" "30" "11233" "0" "11233" "0" "c.11233G>A" "r.(?)" "p.(Glu3745Lys)" "" "0001036658" "00025898" "30" "11244" "0" "11244" "0" "c.11244G>C" "r.(?)" "p.(Pro3748=)" "" "0001036658" "00000245" "30" "11319" "0" "11319" "0" "c.11319G>C" "r.(?)" "p.(Pro3773=)" "" "0001036659" "00025898" "30" "11565" "0" "11565" "0" "c.11565A>G" "r.(?)" "p.(Ser3855=)" "" "0001036659" "00000245" "30" "11640" "0" "11640" "0" "c.11640A>G" "r.(?)" "p.(Ser3880=)" "" "0001036660" "00025898" "30" "11884" "0" "11884" "0" "c.11884C>G" "r.(?)" "p.(Pro3962Ala)" "" "0001036660" "00000245" "30" "11959" "0" "11959" "0" "c.11959C>G" "r.(?)" "p.(Pro3987Ala)" "" "0001046134" "00025898" "50" "857" "0" "857" "0" "c.857A>G" "r.(?)" "p.(Tyr286Cys)" "" "0001046135" "00025898" "90" "9331" "-2" "9331" "-2" "c.9331-2A>T" "r.spl?" "p.?" "" "0001049755" "00025898" "90" "1219" "0" "1219" "0" "c.1219C>T" "r.(?)" "p.(Gln407Ter)" "" "0001053064" "00025898" "50" "560" "0" "560" "0" "c.560G>A" "r.(?)" "p.(Arg187His)" "" "0001053064" "00000245" "50" "560" "0" "560" "0" "c.560G>A" "r.(?)" "p.(Arg187His)" "" "0001053065" "00025898" "30" "1768" "0" "1768" "0" "c.1768G>A" "r.(?)" "p.(Ala590Thr)" "" "0001053065" "00000245" "30" "1768" "0" "1768" "0" "c.1768G>A" "r.(?)" "p.(Ala590Thr)" "" "0001053066" "00025898" "50" "4634" "-5" "4634" "-5" "c.4634-5T>C" "r.spl?" "p.?" "" "0001053067" "00025898" "50" "5012" "0" "5012" "0" "c.5012G>A" "r.(?)" "p.(Arg1671Gln)" "" "0001053067" "00000245" "50" "5087" "0" "5087" "0" "c.5087G>A" "r.(?)" "p.(Arg1696Gln)" "" "0001053068" "00025898" "50" "5378" "0" "5378" "0" "c.5378G>A" "r.(?)" "p.(Arg1793His)" "" "0001053069" "00025898" "10" "7152" "0" "7152" "0" "c.7152G>A" "r.(?)" "p.(Pro2384=)" "" "0001053069" "00000245" "10" "7227" "0" "7227" "0" "c.7227G>A" "r.(?)" "p.(Pro2409=)" "" "0001053070" "00025898" "50" "7724" "0" "7724" "0" "c.7724A>T" "r.(?)" "p.(Asn2575Ile)" "" "0001053070" "00000245" "50" "7799" "0" "7799" "0" "c.7799A>T" "r.(?)" "p.(Asn2600Ile)" "" "0001053071" "00025898" "70" "7732" "0" "7732" "0" "c.7732C>T" "r.(?)" "p.(Gln2578*)" "" "0001053072" "00025898" "50" "8383" "0" "8383" "0" "c.8383A>G" "r.(?)" "p.(Ile2795Val)" "" "0001053073" "00025898" "30" "9696" "0" "9696" "0" "c.9696C>A" "r.(?)" "p.(Ile3232=)" "" "0001053073" "00000245" "30" "9771" "0" "9771" "0" "c.9771C>A" "r.(?)" "p.(Ile3257=)" "" "0001053074" "00025898" "50" "10199" "0" "10199" "0" "c.10199C>G" "r.(?)" "p.(Pro3400Arg)" "" "0001053075" "00025898" "90" "10272" "0" "10272" "0" "c.10272T>A" "r.(?)" "p.(Cys3424*)" "" "0001053076" "00025898" "50" "11087" "0" "11087" "0" "c.11087G>A" "r.(?)" "p.(Arg3696Gln)" "" "0001053077" "00025898" "50" "11623" "0" "11623" "0" "c.11623G>A" "r.(?)" "p.(Val3875Ile)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 128 "{{screeningid}}" "{{variantid}}" "0000000209" "0000004654" "0000000209" "0000004655" "0000000210" "0000012632" "0000000210" "0000012633" "0000000210" "0000012634" "0000024229" "0000046781" "0000024229" "0000046782" "0000050463" "0000079443" "0000050463" "0000079667" "0000050500" "0000079480" "0000132717" "0000221901" "0000151038" "0000244202" "0000151039" "0000244203" "0000227293" "0000464281" "0000227293" "0000464282" "0000227293" "0000464283" "0000227354" "0000465597" "0000227354" "0000465598" "0000227355" "0000465599" "0000227355" "0000465600" "0000227356" "0000465601" "0000227356" "0000465602" "0000227357" "0000465603" "0000227357" "0000465604" "0000227358" "0000465605" "0000227359" "0000465606" "0000227359" "0000465607" "0000227360" "0000465608" "0000227360" "0000465609" "0000227361" "0000465610" "0000227361" "0000465611" "0000227362" "0000465612" "0000227362" "0000465613" "0000227363" "0000465614" "0000227363" "0000465615" "0000227364" "0000465616" "0000227364" "0000465617" "0000227365" "0000465618" "0000227365" "0000465619" "0000227366" "0000465620" "0000227366" "0000465621" "0000227366" "0000465622" "0000227384" "0000465623" "0000295690" "0000652379" "0000295691" "0000652380" "0000295692" "0000652381" "0000295693" "0000652382" "0000295694" "0000652383" "0000295695" "0000652384" "0000295696" "0000652385" "0000295697" "0000652386" "0000295698" "0000652387" "0000295699" "0000652388" "0000295700" "0000652389" "0000295701" "0000652390" "0000295702" "0000652391" "0000296593" "0000653282" "0000301773" "0000664846" "0000306301" "0000669989" "0000310658" "0000685569" "0000319168" "0000701832" "0000326712" "0000710304" "0000326712" "0000710359" "0000329537" "0000713660" "0000329537" "0000713898" "0000329537" "0000713899" "0000329725" "0000714082" "0000329725" "0000714107" "0000329726" "0000714083" "0000329726" "0000714108" "0000332958" "0000730345" "0000335334" "0000733343" "0000335334" "0000733722" "0000335335" "0000733344" "0000335336" "0000733345" "0000335336" "0000733723" "0000337228" "0000736858" "0000360186" "0000759977" "0000360207" "0000760054" "0000360209" "0000760066" "0000362892" "0000763266" "0000363962" "0000764672" "0000363962" "0000764752" "0000375075" "0000786342" "0000375075" "0000786388" "0000385095" "0000811972" "0000385096" "0000811973" "0000386390" "0000813884" "0000386390" "0000813885" "0000388947" "0000817740" "0000388972" "0000817765" "0000388992" "0000817785" "0000389027" "0000817820" "0000389030" "0000817823" "0000390066" "0000819411" "0000390066" "0000820637" "0000390554" "0000819899" "0000390554" "0000820753" "0000390555" "0000819900" "0000390555" "0000820754" "0000390615" "0000819960" "0000390616" "0000819961" "0000390875" "0000820220" "0000396057" "0000827622" "0000396057" "0000827628" "0000396825" "0000828514" "0000396825" "0000828515" "0000396844" "0000828540" "0000396844" "0000828541" "0000397696" "0000829759" "0000397697" "0000829760" "0000428242" "0000905913" "0000428242" "0000905914" "0000434816" "0000920693" "0000441926" "0000939868" "0000441936" "0000939878" "0000441936" "0000939908" "0000445890" "0000954075" "0000445890" "0000954090" "0000448906" "0000959084" "0000449145" "0000958912" "0000449145" "0000959346" "0000452767" "0000987323" "0000452802" "0000987329" "0000452904" "0000987249" "0000462567" "0001022094" "0000462568" "0001022095" "0000469457" "0001049755"