### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = WDPCP) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "WDPCP" "WD repeat containing planar cell polarity effector" "2" "p15" "unknown" "NG_028144.2" "UD_132119301597" "" "https://www.LOVD.nl/WDPCP" "" "1" "28027" "51057" "613580" "1" "1" "1" "1" "This database is one of the \"Eye disease\" gene variant databases.\r\nEstablishment of this gene variant database (LSDB) was performed by Johan den Dunnen, supported by Global Variome." "" "g" "https://databases.lovd.nl/shared/refseq/WDPCP_codingDNA.html" "1" "" "This database is one of the \"Eye disease\" gene variant databases." "-1" "" "-1" "00001" "2013-05-06 00:00:00" "00006" "2020-11-26 19:43:41" "00000" "2025-05-05 21:14:00" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00022736" "WDPCP" "WD repeat containing planar cell polarity effector" "001" "NM_015910.5" "" "NP_056994.3" "" "" "" "-462" "2864" "2241" "63815867" "63348518" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 5 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "04212" "BBS" "Bardet-Biedl syndrome (BBS)" "" "" "" "" "" "00006" "2015-02-27 19:01:43" "" "" "04214" "-" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00001" "2023-03-09 14:26:26" "05062" "BBS15" "Bardet-Biedl syndrome?, type 15 (BBS-15)" "AR" "615992" "" "" "" "00000" "2015-09-23 11:00:40" "00006" "2021-12-10 21:51:32" "05063" "CHDTHP" "heart defects, congential?, hamartomas of tongue, and polysyndactyly (CHDTHP)" "AR" "217085" "" "" "" "00000" "2015-09-23 11:00:40" "00006" "2021-12-10 21:51:32" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 2 "{{geneid}}" "{{diseaseid}}" "WDPCP" "05062" "WDPCP" "05063" ## Individuals ## Do not remove or alter this header ## ## Count = 12 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00144158" "" "" "" "1" "" "01780" "{PMID:Katagiri 2014:25268133}" "index patient" "M" "no" "Japan" "" "0" "" "" "Japanese" "" "00292799" "" "" "" "2" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00380364" "" "" "" "1" "" "00000" "{PMID:M\'hamdi_2014:23432027}" "" "F" "yes" "Tunisia" "" "0" "" "" "Tunisian" "" "00385232" "" "" "" "1" "" "00000" "{PMID:Redin-2012:22773737}" "" "" "" "France" "" "0" "" "" "" "" "00385285" "" "" "" "1" "" "00000" "{PMID:M\'hamdi-2014:23432027}" "" "F" "yes" "Tunisia" "" "0" "" "" "Tunisian" "" "00386873" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "121-024" "00386885" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "OGI1165_002272" "00395608" "" "" "" "1" "" "00000" "{PMID:Perea-Romero 2021:34448047}" "" "" "" "Spain" "" "0" "" "" "" "RP-2966" "00417830" "" "" "" "1" "" "00000" "{PMID:Kim 2010:20671153}" "" "M" "" "" "" "0" "" "" "" "AR248" "00417831" "" "" "" "1" "" "00000" "{PMID:Kim 2010:20671153}" "" "?" "" "" "" "0" "" "" "" "AR316" "00417832" "" "" "" "1" "" "00000" "{PMID:Kim 2010:20671153}" "" "?" "" "" "" "0" "" "" "" "MR-1" "00417833" "" "" "" "1" "" "00000" "{PMID:Kim 2010:20671153}" "" "?" "" "" "" "0" "" "" "" "MKS142" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 12 "{{individualid}}" "{{diseaseid}}" "00144158" "04214" "00292799" "00198" "00380364" "04214" "00385232" "04214" "00385285" "04214" "00386873" "04214" "00386885" "04214" "00395608" "04214" "00417830" "04212" "00417831" "04212" "00417832" "04212" "00417833" "04214" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00198, 04212, 04214, 05062, 05063 ## Count = 11 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000116936" "04214" "00144158" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000274215" "04214" "00380364" "00000" "Familial, autosomal recessive" "11y" "retinitis pigmentaria" "" "" "" "" "" "" "" "" "" "Bardet–Biedl syndrome" "" "0000279028" "04214" "00385232" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Bardet–Biedl Syndrome (BBS)" "" "0000279081" "04214" "00385285" "00000" "Familial, autosomal recessive" "7y" "obesity, retinitis pigmentosa, polydactyly, hypogenitalism,mental retardation" "" "" "" "" "" "" "" "" "" "Bardet–Biedl Syndrome (BBS)" "" "0000280673" "04214" "00386873" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280685" "04214" "00386885" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000288806" "04214" "00395608" "00000" "Familial, autosomal recessive" "" "cone/cone-rod dystrophy, myopia, oligomenorrhea, global developmental delay, intellectual disability, polydactyly" "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome" "Bardet-Biedl-like syndrome" "" "0000309198" "04212" "00417830" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome (BBS)" "" "" "0000309199" "04212" "00417831" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome (BBS)" "" "" "0000309200" "04212" "00417832" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome (BBS)" "" "" "0000309201" "04214" "00417833" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Meckel syndrome" "" "" ## Screenings ## Do not remove or alter this header ## ## Count = 12 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000145017" "00144158" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000293967" "00292799" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000381578" "00380364" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "SEQ" "DNA" "blood" "" "0000386461" "00385232" "1" "00000" "00008" "2021-10-09 03:44:00" "" "" "arrayCNV;SEQ" "DNA" "blood" "" "0000386514" "00385285" "1" "00000" "00008" "2021-10-09 03:44:00" "" "" "SEQ" "DNA" "" "targeted exon capture strategy" "0000388101" "00386873" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000388113" "00386885" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;PCRq" "DNA" "blood" "" "0000396846" "00395608" "1" "00000" "03840" "2021-12-08 14:12:08" "" "" "?" "DNA" "" "clinical exome sequencing" "0000419125" "00417830" "1" "00000" "03840" "2022-09-24 20:09:21" "" "" "?" "DNA" "" "" "0000419126" "00417831" "1" "00000" "03840" "2022-09-24 20:09:21" "" "" "?" "DNA" "" "" "0000419127" "00417832" "1" "00000" "03840" "2022-09-24 20:09:21" "" "" "?" "DNA" "" "" "0000419128" "00417833" "1" "00000" "03840" "2022-09-24 20:09:21" "" "" "?" "DNA" "" "" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 11 "{{screeningid}}" "{{geneid}}" "0000145017" "EYS" "0000381578" "WDPCP" "0000386461" "ALMS1" "0000386514" "MKKS" "0000388101" "WDPCP" "0000388113" "WDPCP" "0000396846" "C8orf37" "0000419125" "WDPCP" "0000419126" "WDPCP" "0000419127" "WDPCP" "0000419128" "WDPCP" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 103 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000245676" "0" "30" "2" "63720089" "63720089" "subst" "0.00385091" "02330" "WDPCP_000026" "g.63720089A>T" "" "" "" "WDPCP(NM_015910.6):c.76-15T>A, WDPCP(NM_015910.7):c.76-15T>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63492955A>T" "" "likely benign" "" "0000245846" "0" "10" "2" "63631343" "63631343" "subst" "0" "02330" "WDPCP_000009" "g.63631343A>C" "" "" "" "WDPCP(NM_001354044.1):c.1203T>G (p.T401=), WDPCP(NM_015910.7):c.1275T>G (p.T425=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63404208A>C" "" "benign" "" "0000250748" "0" "10" "2" "63720089" "63720089" "subst" "0.00385091" "02326" "WDPCP_000026" "g.63720089A>T" "" "" "" "WDPCP(NM_015910.6):c.76-15T>A, WDPCP(NM_015910.7):c.76-15T>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63492955A>T" "" "benign" "" "0000250802" "0" "30" "2" "63714613" "63714613" "subst" "0.00130614" "02326" "WDPCP_000020" "g.63714613A>T" "" "" "" "WDPCP(NM_015910.6):c.176T>A (p.I59N), WDPCP(NM_015910.7):c.176T>A (p.I59N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63487479A>T" "" "likely benign" "" "0000253967" "0" "30" "2" "63720089" "63720089" "subst" "0.00385091" "01943" "WDPCP_000026" "g.63720089A>T" "" "" "" "WDPCP(NM_015910.6):c.76-15T>A, WDPCP(NM_015910.7):c.76-15T>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63492955A>T" "" "likely benign" "" "0000254021" "0" "30" "2" "63714613" "63714613" "subst" "0.00130614" "01943" "WDPCP_000020" "g.63714613A>T" "" "" "" "WDPCP(NM_015910.6):c.176T>A (p.I59N), WDPCP(NM_015910.7):c.176T>A (p.I59N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63487479A>T" "" "likely benign" "" "0000311330" "0" "10" "2" "63720034" "63720034" "subst" "0" "02330" "WDPCP_000024" "g.63720034G>T" "" "" "" "WDPCP(NM_001354044.1):c.44C>A (p.T15N), WDPCP(NM_015910.7):c.116C>A (p.T39N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63492900G>T" "" "benign" "" "0000311331" "0" "10" "2" "63667017" "63667017" "subst" "0.000150691" "02330" "WDPCP_000017" "g.63667017T>C" "" "" "" "WDPCP(NM_015910.7):c.385-12A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63439883T>C" "" "benign" "" "0000311332" "0" "30" "2" "63664607" "63664607" "subst" "1.67013E-5" "02330" "WDPCP_000015" "g.63664607T>C" "" "" "" "WDPCP(NM_015910.7):c.581A>G (p.E194G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63437473T>C" "" "likely benign" "" "0000311333" "0" "50" "2" "63660921" "63660947" "del" "0" "02330" "WDPCP_000013" "g.63660921_63660947del" "" "" "" "WDPCP(NM_015910.6):c.760_786delCCCATTTCTTCTGAGAAGGACAGAGCC (p.P254_A262del), WDPCP(NM_015910.7):c.760_786del (p.(Pro254_Ala262del)), WDPCP(NM_0159...)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63433787_63433813del" "" "VUS" "" "0000313052" "0" "50" "2" "63631239" "63631239" "subst" "2.44176E-5" "02325" "WDPCP_000006" "g.63631239T>A" "" "" "" "WDPCP(NM_015910.7):c.1379A>T (p.D460V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63404104T>A" "" "VUS" "" "0000313053" "0" "10" "2" "63486429" "63486429" "subst" "0.602731" "02325" "WDPCP_000003" "g.63486429C>T" "" "" "" "WDPCP(NM_015910.6):c.1915+13G>A, WDPCP(NM_015910.7):c.1915+13G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63259294C>T" "" "benign" "" "0000315378" "0" "10" "2" "63631285" "63631285" "subst" "0.00567594" "02326" "WDPCP_000007" "g.63631285C>G" "" "" "" "WDPCP(NM_015910.6):c.1333G>C (p.A445P), WDPCP(NM_015910.7):c.1333G>C (p.A445P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63404150C>G" "" "benign" "" "0000315379" "0" "10" "2" "63609217" "63609217" "subst" "0.000114681" "02326" "WDPCP_000005" "g.63609217C>T" "" "" "" "WDPCP(NM_015910.6):c.1448G>A (p.R483Q), WDPCP(NM_015910.7):c.1448G>A (p.R483Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63382082C>T" "" "benign" "" "0000315380" "0" "90" "2" "63719990" "63719990" "subst" "0.000118266" "02326" "WDPCP_000022" "g.63719990C>T" "" "" "" "WDPCP(NM_015910.6):c.160G>A (p.D54N), WDPCP(NM_015910.7):c.160G>A (p.D54N, p.(Asp54Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63492856C>T" "" "pathogenic" "" "0000315381" "0" "10" "2" "63401820" "63401820" "subst" "0.00945613" "02326" "WDPCP_000001" "g.63401820T>C" "" "" "" "WDPCP(NM_015910.6):c.2063A>G (p.N688S), WDPCP(NM_015910.7):c.2063A>G (p.N688S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63174685T>C" "" "benign" "" "0000315382" "0" "30" "2" "63815338" "63815338" "subst" "0.000777852" "02326" "WDPCP_000028" "g.63815338G>T" "" "" "" "WDPCP(NM_015910.6):c.68C>A (p.P23Q), WDPCP(NM_015910.7):c.68C>A (p.P23Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63588204G>T" "" "likely benign" "" "0000315383" "0" "30" "2" "63815318" "63815318" "subst" "0.000165903" "02326" "WDPCP_000027" "g.63815318G>A" "" "" "" "WDPCP(NM_015910.7):c.75+13C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63588184G>A" "" "likely benign" "" "0000315384" "0" "10" "2" "63631800" "63631800" "subst" "8.23079E-5" "02326" "WDPCP_000011" "g.63631800G>T" "" "" "" "WDPCP(NM_015910.7):c.826-8C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63404665G>T" "" "benign" "" "0000315385" "0" "10" "2" "63720067" "63720067" "subst" "0.00158487" "02326" "WDPCP_000025" "g.63720067T>A" "" "" "" "WDPCP(NM_015910.6):c.83A>T (p.D28V), WDPCP(NM_015910.7):c.83A>T (p.D28V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63492933T>A" "" "benign" "" "0000319785" "0" "30" "2" "63609217" "63609217" "subst" "0.000114681" "01943" "WDPCP_000005" "g.63609217C>T" "" "" "" "WDPCP(NM_015910.6):c.1448G>A (p.R483Q), WDPCP(NM_015910.7):c.1448G>A (p.R483Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63382082C>T" "" "likely benign" "" "0000319786" "0" "30" "2" "63719991" "63719991" "subst" "5.7086E-5" "01943" "WDPCP_000023" "g.63719991C>T" "" "" "" "WDPCP(NM_015910.6):c.159G>A (p.A53=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63492857C>T" "" "likely benign" "" "0000319787" "0" "50" "2" "63714617" "63714617" "subst" "0" "01943" "WDPCP_000021" "g.63714617C>T" "" "" "" "WDPCP(NM_015910.6):c.172G>A (p.G58R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63487483C>T" "" "VUS" "" "0000319788" "0" "10" "2" "63486429" "63486429" "subst" "0.602731" "01943" "WDPCP_000003" "g.63486429C>T" "" "" "" "WDPCP(NM_015910.6):c.1915+13G>A, WDPCP(NM_015910.7):c.1915+13G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63259294C>T" "" "benign" "" "0000319789" "0" "10" "2" "63401973" "63401973" "subst" "0.158597" "01943" "WDPCP_000002" "g.63401973G>A" "" "" "" "WDPCP(NM_015910.6):c.1916-6C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63174838G>A" "" "benign" "" "0000319790" "0" "30" "2" "63401820" "63401820" "subst" "0.00945613" "01943" "WDPCP_000001" "g.63401820T>C" "" "" "" "WDPCP(NM_015910.6):c.2063A>G (p.N688S), WDPCP(NM_015910.7):c.2063A>G (p.N688S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63174685T>C" "" "likely benign" "" "0000319791" "0" "50" "2" "63714578" "63714578" "subst" "2.04283E-5" "01943" "WDPCP_000019" "g.63714578T>C" "" "" "" "WDPCP(NM_015910.6):c.208+3A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63487444T>C" "" "VUS" "" "0000319792" "0" "30" "2" "63712120" "63712120" "subst" "8.14558E-6" "01943" "WDPCP_000018" "g.63712120T>C" "" "" "" "WDPCP(NM_015910.6):c.255A>G (p.S85=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63484986T>C" "" "likely benign" "" "0000319793" "0" "10" "2" "63666871" "63666871" "subst" "0.00029718" "01943" "WDPCP_000016" "g.63666871T>C" "" "" "" "WDPCP(NM_015910.6):c.499+20A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63439737T>C" "" "benign" "" "0000319794" "0" "50" "2" "63660921" "63660947" "del" "0" "01943" "WDPCP_000013" "g.63660921_63660947del" "" "" "" "WDPCP(NM_015910.6):c.760_786delCCCATTTCTTCTGAGAAGGACAGAGCC (p.P254_A262del), WDPCP(NM_015910.7):c.760_786del (p.(Pro254_Ala262del)), WDPCP(NM_0159...)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63433787_63433813del" "" "VUS" "" "0000319795" "0" "10" "2" "63660902" "63660902" "subst" "0.0463419" "01943" "WDPCP_000012" "g.63660902C>T" "" "" "" "WDPCP(NM_015910.6):c.802G>A (p.G268S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63433768C>T" "" "benign" "" "0000319796" "0" "30" "2" "63720067" "63720067" "subst" "0.00158487" "01943" "WDPCP_000025" "g.63720067T>A" "" "" "" "WDPCP(NM_015910.6):c.83A>T (p.D28V), WDPCP(NM_015910.7):c.83A>T (p.D28V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63492933T>A" "" "likely benign" "" "0000327037" "0" "50" "2" "63631314" "63631314" "subst" "0" "01804" "WDPCP_000008" "g.63631314G>T" "" "" "" "WDPCP(NM_015910.5):c.1304C>A (p.(Ser435Tyr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63404179G>T" "" "VUS" "" "0000327038" "0" "50" "2" "63661043" "63661043" "subst" "0.000187042" "01804" "WDPCP_000014" "g.63661043T>C" "" "" "" "WDPCP(NM_015910.5):c.661A>G (p.(Ile221Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63433909T>C" "" "VUS" "" "0000327039" "0" "50" "2" "63824541" "63824541" "subst" "0.000877763" "01804" "MDH1_000001" "g.63824541G>A" "" "" "" "MDH1(NM_001199111.1):c.262G>A (p.(Ala88Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63597407G>A" "" "VUS" "" "0000338564" "0" "10" "2" "63401973" "63401973" "subst" "0.158597" "02327" "WDPCP_000002" "g.63401973G>A" "" "" "" "WDPCP(NM_015910.6):c.1916-6C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63174838G>A" "" "benign" "" "0000338565" "0" "10" "2" "63486429" "63486429" "subst" "0.602731" "02327" "WDPCP_000003" "g.63486429C>T" "" "" "" "WDPCP(NM_015910.6):c.1915+13G>A, WDPCP(NM_015910.7):c.1915+13G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63259294C>T" "" "benign" "" "0000516554" "0" "50" "2" "63605535" "63605535" "subst" "0" "01943" "WDPCP_000030" "g.63605535G>C" "" "" "" "WDPCP(NM_015910.6):c.1734C>G (p.F578L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63378400G>C" "" "VUS" "" "0000516555" "0" "50" "2" "63609065" "63609065" "subst" "4.07641E-6" "02325" "WDPCP_000031" "g.63609065G>T" "" "" "" "WDPCP(NM_001354044.1):c.1528C>A (p.Q510K), WDPCP(NM_015910.7):c.1600C>A (p.Q534K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63381930G>T" "" "VUS" "" "0000516557" "0" "50" "2" "63631303" "63631303" "subst" "0.000761649" "02330" "WDPCP_000032" "g.63631303C>T" "" "" "" "WDPCP(NM_015910.6):c.1315G>A (p.V439I), WDPCP(NM_015910.7):c.1315G>A (p.V439I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63404168C>T" "" "VUS" "" "0000516558" "0" "30" "2" "63631303" "63631303" "subst" "0.000761649" "01943" "WDPCP_000032" "g.63631303C>T" "" "" "" "WDPCP(NM_015910.6):c.1315G>A (p.V439I), WDPCP(NM_015910.7):c.1315G>A (p.V439I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63404168C>T" "" "likely benign" "" "0000516559" "0" "30" "2" "63631308" "63631308" "subst" "0.000289199" "01804" "WDPCP_000033" "g.63631308C>A" "" "" "" "WDPCP(NM_001354044.1):c.1238G>T (p.S413I), WDPCP(NM_015910.5):c.1310G>T (p.(Ser437Ile)), WDPCP(NM_015910.7):c.1310G>T (p.S437I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63404173C>A" "" "likely benign" "" "0000516560" "0" "30" "2" "63631424" "63631424" "subst" "0" "01943" "WDPCP_000034" "g.63631424T>C" "" "" "" "WDPCP(NM_015910.6):c.1194A>G (p.Q398=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63404289T>C" "" "likely benign" "" "0000516561" "0" "30" "2" "63631749" "63631749" "subst" "4.08834E-6" "02330" "WDPCP_000035" "g.63631749C>T" "" "" "" "WDPCP(NM_015910.7):c.869G>A (p.R290H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63404614C>T" "" "likely benign" "" "0000516562" "0" "50" "2" "63660921" "63660947" "del" "0" "02325" "WDPCP_000013" "g.63660921_63660947del" "" "" "" "WDPCP(NM_015910.6):c.760_786delCCCATTTCTTCTGAGAAGGACAGAGCC (p.P254_A262del), WDPCP(NM_015910.7):c.760_786del (p.(Pro254_Ala262del)), WDPCP(NM_0159...)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63433787_63433813del" "" "VUS" "" "0000516563" "0" "30" "2" "63664596" "63664596" "subst" "0" "01804" "WDPCP_000036" "g.63664596C>T" "" "" "" "WDPCP(NM_015910.5):c.592G>A (p.(Val198Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63437462C>T" "" "likely benign" "" "0000516564" "0" "50" "2" "63665010" "63665010" "subst" "0" "01943" "WDPCP_000037" "g.63665010G>A" "" "" "" "WDPCP(NM_001042692.3):c.8C>T (p.S3L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63437876G>A" "" "VUS" "" "0000516565" "0" "50" "2" "63667005" "63667005" "subst" "0.000476412" "01943" "WDPCP_000038" "g.63667005G>C" "" "" "" "WDPCP(NM_015910.6):c.385C>G (p.L129V), WDPCP(NM_015910.7):c.385C>G (p.L129V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63439871G>C" "" "VUS" "" "0000516567" "0" "30" "2" "63667011" "63667011" "del" "0" "01943" "WDPCP_000039" "g.63667011del" "" "" "" "WDPCP(NM_015910.6):c.385-3delT, WDPCP(NM_015910.7):c.385-3delT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63439877del" "" "likely benign" "" "0000516570" "0" "30" "2" "63714613" "63714613" "subst" "0.00130614" "02330" "WDPCP_000020" "g.63714613A>T" "" "" "" "WDPCP(NM_015910.6):c.176T>A (p.I59N), WDPCP(NM_015910.7):c.176T>A (p.I59N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63487479A>T" "" "likely benign" "" "0000516571" "0" "70" "2" "63719990" "63719990" "subst" "0.000118266" "01943" "WDPCP_000022" "g.63719990C>T" "" "" "" "WDPCP(NM_015910.6):c.160G>A (p.D54N), WDPCP(NM_015910.7):c.160G>A (p.D54N, p.(Asp54Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63492856C>T" "" "likely pathogenic" "" "0000516574" "0" "10" "2" "63815338" "63815338" "subst" "0.000777852" "02330" "WDPCP_000028" "g.63815338G>T" "" "" "" "WDPCP(NM_015910.6):c.68C>A (p.P23Q), WDPCP(NM_015910.7):c.68C>A (p.P23Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63588204G>T" "" "benign" "" "0000516575" "0" "30" "2" "63815338" "63815338" "subst" "0.000777852" "01943" "WDPCP_000028" "g.63815338G>T" "" "" "" "WDPCP(NM_015910.6):c.68C>A (p.P23Q), WDPCP(NM_015910.7):c.68C>A (p.P23Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63588204G>T" "" "likely benign" "" "0000516576" "0" "30" "2" "63815393" "63815393" "subst" "0.000201644" "01943" "MDH1_000002" "g.63815393A>G" "" "" "" "WDPCP(NM_015910.6):c.13T>C (p.F5L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63588259A>G" "" "likely benign" "" "0000516577" "0" "50" "2" "63816516" "63816516" "subst" "0" "01943" "MDH1_000003" "g.63816516A>T" "" "" "" "MDH1(NM_001199111.1):c.55A>T (p.K19*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63589382A>T" "" "VUS" "" "0000650656" "1" "50" "2" "63631539" "63631539" "subst" "0.000183046" "03575" "WDPCP_000042" "g.63631539G>A" "2/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "2 heterozygous, no homozygous; {DB:CLININrs141011629}" "Germline" "" "rs141011629" "0" "" "" "g.63404404G>A" "" "VUS" "" "0000676696" "0" "50" "2" "63486469" "63486469" "subst" "2.44437E-5" "01943" "WDPCP_000043" "g.63486469C>T" "" "" "" "WDPCP(NM_001354044.1):c.1816G>A (p.D606N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000676697" "0" "30" "2" "63667005" "63667005" "subst" "0.000476412" "02326" "WDPCP_000038" "g.63667005G>C" "" "" "" "WDPCP(NM_015910.6):c.385C>G (p.L129V), WDPCP(NM_015910.7):c.385C>G (p.L129V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000688834" "0" "50" "2" "63609065" "63609065" "subst" "4.07641E-6" "01943" "WDPCP_000031" "g.63609065G>T" "" "" "" "WDPCP(NM_001354044.1):c.1528C>A (p.Q510K), WDPCP(NM_015910.7):c.1600C>A (p.Q534K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000718917" "0" "30" "2" "63540407" "63540407" "subst" "8.96225E-5" "02330" "WDPCP_000004" "g.63540407G>A" "" "" "" "WDPCP(NM_015910.7):c.1788C>T (p.D596=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000718918" "0" "30" "2" "63631343" "63631343" "subst" "0" "01943" "WDPCP_000009" "g.63631343A>C" "" "" "" "WDPCP(NM_001354044.1):c.1203T>G (p.T401=), WDPCP(NM_015910.7):c.1275T>G (p.T425=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000718919" "0" "50" "2" "63631390" "63631390" "subst" "0" "02330" "WDPCP_000010" "g.63631390G>A" "" "" "" "WDPCP(NM_015910.7):c.1228C>T (p.P410S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000718920" "0" "50" "2" "63631515" "63631515" "subst" "2.44151E-5" "02325" "WDPCP_000044" "g.63631515C>T" "" "" "" "WDPCP(NM_015910.7):c.1103G>A (p.R368H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000718921" "0" "70" "2" "63714580" "63714580" "subst" "0.000245118" "02330" "WDPCP_000040" "g.63714580C>T" "" "" "" "WDPCP(NM_015910.7):c.208+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000718922" "0" "50" "2" "63719990" "63719990" "subst" "0.000118266" "02330" "WDPCP_000022" "g.63719990C>T" "" "" "" "WDPCP(NM_015910.6):c.160G>A (p.D54N), WDPCP(NM_015910.7):c.160G>A (p.D54N, p.(Asp54Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000718923" "0" "50" "2" "63720034" "63720034" "subst" "0" "01943" "WDPCP_000024" "g.63720034G>T" "" "" "" "WDPCP(NM_001354044.1):c.44C>A (p.T15N), WDPCP(NM_015910.7):c.116C>A (p.T39N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000788331" "0" "50" "2" "63631776" "63631776" "subst" "5.32638E-5" "00000" "WDPCP_000045" "g.63631776C>T" "" "{PMID:Katagiri 2014:25268133}" "" "G842A" "" "Germline" "" "" "0" "" "" "g.63404641C>T" "" "VUS" "" "0000795051" "0" "90" "2" "63816417" "63816417" "subst" "0" "00000" "WDPCP_000046" "g.63816417G>A" "" "{PMID:M\'hamdi 2014:23432027}" "" "c.-1012C >T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000800761" "0" "50" "2" "63660921" "63660947" "del" "0" "02326" "WDPCP_000013" "g.63660921_63660947del" "" "" "" "WDPCP(NM_015910.6):c.760_786delCCCATTTCTTCTGAGAAGGACAGAGCC (p.P254_A262del), WDPCP(NM_015910.7):c.760_786del (p.(Pro254_Ala262del)), WDPCP(NM_0159...)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000800762" "0" "90" "2" "63664647" "63664647" "subst" "1.27192E-5" "02326" "WDPCP_000047" "g.63664647G>A" "" "" "" "WDPCP(NM_001354044.1):c.469C>T (p.Q157*), WDPCP(NM_015910.7):c.541C>T (p.Q181*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000800763" "0" "30" "2" "63815373" "63815373" "subst" "3.67242E-5" "01943" "MDH1_000004" "g.63815373G>A" "" "" "" "WDPCP(NM_015910.6):c.33C>T (p.S11=), WDPCP(NM_015910.7):c.33C>T (p.S11=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000813990" "0" "50" "2" "63631633" "63631633" "subst" "0.00117609" "00000" "WDPCP_000048" "g.63631633C>T" "" "{PMID:Redin-2012:22773737}" "" "WDPCP/BBS15:p.[V329M];=" "normal 2nd chromosome" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000814072" "0" "50" "2" "63816417" "63816417" "subst" "0" "00000" "WDPCP_000046" "g.63816417G>A" "" "{PMID:M\'hamdi-2014:23432027}" "" "BBS15: c.-1012C>T" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000816259" "0" "50" "2" "63664554" "63664554" "subst" "0" "00000" "WDPCP_000049" "g.63664554C>T" "" "{PMID:Zampaglione 2020:32037395}" "" "WDPCP c.633+1G>A" "unsolved" "Unknown" "?" "" "0" "" "" "g.63437420C>T" "" "VUS" "" "0000816271" "0" "50" "2" "63711458" "63720341" "del" "0" "00000" "WDPCP_000046" "g.63711458_63720341del" "" "{PMID:Zampaglione 2020:32037395}" "" "WDPCP chr2:63711458_63720341del" "gene associated with BBS, deletion of exons 2-6, of 18. patient has maculopathy, unsolved" "Unknown" "?" "" "0" "" "" "" "" "VUS" "" "0000828544" "3" "70" "2" "63631586" "63631586" "subst" "0" "00000" "WDPCP_000050" "g.63631586G>T" "" "{PMID:Perea-Romero 2021:34448047}" "" "WDPCP, c.1032C>A, p.Cys344*, Triallelism" "" "Unknown" "?" "" "0" "" "" "g.63404451G>T" "" "likely pathogenic" "ACMG" "0000849981" "0" "30" "2" "63380070" "63380070" "subst" "8.13994E-6" "02330" "WDPCP_000051" "g.63380070C>T" "" "" "" "WDPCP(NM_015910.7):c.2169G>A (p.L723=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000849982" "0" "50" "2" "63631777" "63631777" "subst" "2.45807E-5" "01943" "WDPCP_000053" "g.63631777G>A" "" "" "" "WDPCP(NM_001354044.1):c.769C>T (p.R257C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000849983" "0" "30" "2" "63720067" "63720067" "subst" "0.00158487" "02330" "WDPCP_000025" "g.63720067T>A" "" "" "" "WDPCP(NM_015910.6):c.83A>T (p.D28V), WDPCP(NM_015910.7):c.83A>T (p.D28V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000858631" "0" "30" "2" "63631308" "63631308" "subst" "0.000289199" "01943" "WDPCP_000033" "g.63631308C>A" "" "" "" "WDPCP(NM_001354044.1):c.1238G>T (p.S413I), WDPCP(NM_015910.5):c.1310G>T (p.(Ser437Ile)), WDPCP(NM_015910.7):c.1310G>T (p.S437I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000858632" "0" "30" "2" "63631740" "63631740" "subst" "4.08507E-5" "01943" "WDPCP_000052" "g.63631740G>C" "" "" "" "WDPCP(NM_001354044.1):c.806C>G (p.T269S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000858633" "0" "90" "2" "63664647" "63664647" "subst" "1.27192E-5" "01943" "WDPCP_000047" "g.63664647G>A" "" "" "" "WDPCP(NM_001354044.1):c.469C>T (p.Q157*), WDPCP(NM_015910.7):c.541C>T (p.Q181*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000879044" "3" "70" "2" "63720075" "63720075" "subst" "0" "00000" "WDPCP_000057" "g.63720075C>A" "" "{PMID:Kim 2010:20671153}" "" "WDPCP c.76-1G>T" "homozygous" "Germline" "yes" "" "0" "" "" "g.63492941C>A" "" "likely pathogenic" "" "0000879045" "0" "50" "2" "63664564" "63664564" "subst" "0" "00000" "WDPCP_000055" "g.63664564C>A" "" "{PMID:Kim 2010:20671153}" "" "WDPCP L208F" "no nucleotide annotation, extrapolated from protein and databases; heterozygous" "Unknown" "?" "" "0" "" "" "g.63437430C>A" "" "VUS" "" "0000879046" "0" "50" "2" "63380665" "63380665" "subst" "0" "00000" "WDPCP_000054" "g.63380665G>A" "" "{PMID:Kim 2010:20671153}" "" "WDPCP S708F" "no nucleotide annotation, extrapolated from protein and databases; heterozygous" "Unknown" "?" "" "0" "" "" "g.63153530G>A" "" "VUS" "" "0000879047" "0" "50" "2" "63714625" "63714625" "subst" "4.08513E-6" "00000" "WDPCP_000056" "g.63714625C>T" "" "{PMID:Kim 2010:20671153}" "" "WDPCP R55K" "no nucleotide annotation, extrapolated from protein and databases; heterozygous" "Unknown" "?" "" "0" "" "" "g.63487491C>T" "" "VUS" "" "0000885349" "0" "30" "2" "63631308" "63631308" "subst" "0.000289199" "02326" "WDPCP_000033" "g.63631308C>A" "" "" "" "WDPCP(NM_001354044.1):c.1238G>T (p.S413I), WDPCP(NM_015910.5):c.1310G>T (p.(Ser437Ile)), WDPCP(NM_015910.7):c.1310G>T (p.S437I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000885350" "0" "30" "2" "63631355" "63631355" "subst" "0.000342731" "02326" "WDPCP_000058" "g.63631355T>G" "" "" "" "WDPCP(NM_015910.7):c.1263A>C (p.L421F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000885351" "0" "30" "2" "63660996" "63660996" "subst" "8.12949E-6" "02330" "WDPCP_000059" "g.63660996A>G" "" "" "" "WDPCP(NM_015910.7):c.708T>C (p.D236=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000885352" "0" "30" "2" "63667011" "63667011" "del" "0" "02326" "WDPCP_000039" "g.63667011del" "" "" "" "WDPCP(NM_015910.6):c.385-3delT, WDPCP(NM_015910.7):c.385-3delT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000885353" "0" "30" "2" "63815373" "63815373" "subst" "3.67242E-5" "02326" "MDH1_000004" "g.63815373G>A" "" "" "" "WDPCP(NM_015910.6):c.33C>T (p.S11=), WDPCP(NM_015910.7):c.33C>T (p.S11=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000928651" "0" "30" "2" "63380070" "63380070" "subst" "1.22099E-5" "02330" "WDPCP_000060" "g.63380070C>G" "" "" "" "WDPCP(NM_001354044.2):c.2097G>C (p.L699=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000928652" "0" "30" "2" "63631303" "63631303" "subst" "0.000761649" "02326" "WDPCP_000032" "g.63631303C>T" "" "" "" "WDPCP(NM_015910.6):c.1315G>A (p.V439I), WDPCP(NM_015910.7):c.1315G>A (p.V439I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000947952" "0" "30" "2" "63609232" "63609232" "subst" "0" "01804" "WDPCP_000061" "g.63609232A>G" "" "" "" "WDPCP(NM_001042692.2):c.959-3T>C (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000947953" "0" "30" "2" "63666880" "63666880" "subst" "4.88397E-5" "02330" "WDPCP_000062" "g.63666880G>C" "" "" "" "WDPCP(NM_001354044.2):c.427+11C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000947954" "0" "50" "2" "63821667" "63821667" "subst" "0" "02325" "MDH1_000005" "g.63821667G>A" "" "" "" "MDH1(NM_005917.4):c.49G>A (p.A17T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000947955" "0" "50" "2" "63832005" "63832005" "subst" "2.84604E-5" "02325" "MDH1_000006" "g.63832005C>T" "" "" "" "MDH1(NM_005917.4):c.674C>T (p.T225M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000975390" "0" "50" "2" "63631539" "63631539" "subst" "0.000183046" "01804" "WDPCP_000042" "g.63631539G>A" "" "" "" "WDPCP(NM_015910.7):c.1079C>T (p.(Ser360Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001024667" "0" "50" "2" "63631285" "63631285" "subst" "0.00567594" "01943" "WDPCP_000007" "g.63631285C>G" "" "" "" "WDPCP(NM_015910.6):c.1333G>C (p.A445P), WDPCP(NM_015910.7):c.1333G>C (p.A445P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001033432" "0" "50" "2" "63631524" "63631524" "subst" "0.000122051" "01804" "WDPCP_000064" "g.63631524T>C" "" "" "" "WDPCP(NM_015910.7):c.1094A>G (p.(Glu365Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001033433" "0" "50" "2" "63660921" "63660947" "del" "0" "01804" "WDPCP_000013" "g.63660921_63660947del" "" "" "" "WDPCP(NM_015910.6):c.760_786delCCCATTTCTTCTGAGAAGGACAGAGCC (p.P254_A262del), WDPCP(NM_015910.7):c.760_786del (p.(Pro254_Ala262del)), WDPCP(NM_0159...)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001033434" "0" "50" "2" "63719990" "63719990" "subst" "0.000118266" "01804" "WDPCP_000022" "g.63719990C>T" "" "" "" "WDPCP(NM_015910.6):c.160G>A (p.D54N), WDPCP(NM_015910.7):c.160G>A (p.D54N, p.(Asp54Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001033435" "0" "50" "2" "63719992" "63719992" "subst" "4.07933E-5" "01804" "WDPCP_000065" "g.63719992G>A" "" "" "" "WDPCP(NM_015910.7):c.158C>T (p.(Ala53Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes WDPCP ## Count = 103 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000245676" "00022736" "30" "76" "-15" "76" "-15" "c.76-15T>A" "r.(=)" "p.(=)" "" "0000245846" "00022736" "10" "1275" "0" "1275" "0" "c.1275T>G" "r.(?)" "p.(Thr425=)" "" "0000250748" "00022736" "10" "76" "-15" "76" "-15" "c.76-15T>A" "r.(=)" "p.(=)" "" "0000250802" "00022736" "30" "176" "0" "176" "0" "c.176T>A" "r.(?)" "p.(Ile59Asn)" "" "0000253967" "00022736" "30" "76" "-15" "76" "-15" "c.76-15T>A" "r.(=)" "p.(=)" "" "0000254021" "00022736" "30" "176" "0" "176" "0" "c.176T>A" "r.(?)" "p.(Ile59Asn)" "" "0000311330" "00022736" "10" "116" "0" "116" "0" "c.116C>A" "r.(?)" "p.(Thr39Asn)" "" "0000311331" "00022736" "10" "385" "-12" "385" "-12" "c.385-12A>G" "r.(=)" "p.(=)" "" "0000311332" "00022736" "30" "581" "0" "581" "0" "c.581A>G" "r.(?)" "p.(Glu194Gly)" "" "0000311333" "00022736" "50" "760" "0" "786" "0" "c.760_786del" "r.(?)" "p.(Pro254_Ala262del)" "" "0000313052" "00022736" "50" "1379" "0" "1379" "0" "c.1379A>T" "r.(?)" "p.(Asp460Val)" "" "0000313053" "00022736" "10" "1915" "13" "1915" "13" "c.1915+13G>A" "r.(=)" "p.(=)" "" "0000315378" "00022736" "10" "1333" "0" "1333" "0" "c.1333G>C" "r.(?)" "p.(Ala445Pro)" "" "0000315379" "00022736" "10" "1448" "0" "1448" "0" "c.1448G>A" "r.(?)" "p.(Arg483Gln)" "" "0000315380" "00022736" "90" "160" "0" "160" "0" "c.160G>A" "r.(?)" "p.(Asp54Asn)" "" "0000315381" "00022736" "10" "2063" "0" "2063" "0" "c.2063A>G" "r.(?)" "p.(Asn688Ser)" "" "0000315382" "00022736" "30" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23Gln)" "" "0000315383" "00022736" "30" "75" "13" "75" "13" "c.75+13C>T" "r.(=)" "p.(=)" "" "0000315384" "00022736" "10" "826" "-8" "826" "-8" "c.826-8C>A" "r.(=)" "p.(=)" "" "0000315385" "00022736" "10" "83" "0" "83" "0" "c.83A>T" "r.(?)" "p.(Asp28Val)" "" "0000319785" "00022736" "30" "1448" "0" "1448" "0" "c.1448G>A" "r.(?)" "p.(Arg483Gln)" "" "0000319786" "00022736" "30" "159" "0" "159" "0" "c.159G>A" "r.(?)" "p.(Ala53=)" "" "0000319787" "00022736" "50" "172" "0" "172" "0" "c.172G>A" "r.(?)" "p.(Gly58Arg)" "" "0000319788" "00022736" "10" "1915" "13" "1915" "13" "c.1915+13G>A" "r.(=)" "p.(=)" "" "0000319789" "00022736" "10" "1916" "-6" "1916" "-6" "c.1916-6C>T" "r.(=)" "p.(=)" "" "0000319790" "00022736" "30" "2063" "0" "2063" "0" "c.2063A>G" "r.(?)" "p.(Asn688Ser)" "" "0000319791" "00022736" "50" "208" "3" "208" "3" "c.208+3A>G" "r.spl?" "p.?" "" "0000319792" "00022736" "30" "255" "0" "255" "0" "c.255A>G" "r.(?)" "p.(Ser85=)" "" "0000319793" "00022736" "10" "499" "20" "499" "20" "c.499+20A>G" "r.(=)" "p.(=)" "" "0000319794" "00022736" "50" "760" "0" "786" "0" "c.760_786del" "r.(?)" "p.(Pro254_Ala262del)" "" "0000319795" "00022736" "10" "802" "0" "802" "0" "c.802G>A" "r.(?)" "p.(Gly268Ser)" "" "0000319796" "00022736" "30" "83" "0" "83" "0" "c.83A>T" "r.(?)" "p.(Asp28Val)" "" "0000327037" "00022736" "50" "1304" "0" "1304" "0" "c.1304C>A" "r.(?)" "p.(Ser435Tyr)" "" "0000327038" "00022736" "50" "661" "0" "661" "0" "c.661A>G" "r.(?)" "p.(Ile221Val)" "" "0000327039" "00022736" "50" "-9136" "0" "-9136" "0" "c.-9136C>T" "r.(?)" "p.(=)" "" "0000338564" "00022736" "10" "1916" "-6" "1916" "-6" "c.1916-6C>T" "r.(=)" "p.(=)" "" "0000338565" "00022736" "10" "1915" "13" "1915" "13" "c.1915+13G>A" "r.(=)" "p.(=)" "" "0000516554" "00022736" "50" "1734" "0" "1734" "0" "c.1734C>G" "r.(?)" "p.(Phe578Leu)" "" "0000516555" "00022736" "50" "1600" "0" "1600" "0" "c.1600C>A" "r.(?)" "p.(Gln534Lys)" "" "0000516557" "00022736" "50" "1315" "0" "1315" "0" "c.1315G>A" "r.(?)" "p.(Val439Ile)" "" "0000516558" "00022736" "30" "1315" "0" "1315" "0" "c.1315G>A" "r.(?)" "p.(Val439Ile)" "" "0000516559" "00022736" "30" "1310" "0" "1310" "0" "c.1310G>T" "r.(?)" "p.(Ser437Ile)" "" "0000516560" "00022736" "30" "1194" "0" "1194" "0" "c.1194A>G" "r.(?)" "p.(Gln398=)" "" "0000516561" "00022736" "30" "869" "0" "869" "0" "c.869G>A" "r.(?)" "p.(Arg290His)" "" "0000516562" "00022736" "50" "760" "0" "786" "0" "c.760_786del" "r.(?)" "p.(Pro254_Ala262del)" "" "0000516563" "00022736" "30" "592" "0" "592" "0" "c.592G>A" "r.(?)" "p.(Val198Ile)" "" "0000516564" "00022736" "50" "500" "-322" "500" "-322" "c.500-322C>T" "r.(=)" "p.(=)" "" "0000516565" "00022736" "50" "385" "0" "385" "0" "c.385C>G" "r.(?)" "p.(Leu129Val)" "" "0000516567" "00022736" "30" "385" "-3" "385" "-3" "c.385-3del" "r.spl?" "p.?" "" "0000516570" "00022736" "30" "176" "0" "176" "0" "c.176T>A" "r.(?)" "p.(Ile59Asn)" "" "0000516571" "00022736" "70" "160" "0" "160" "0" "c.160G>A" "r.(?)" "p.(Asp54Asn)" "" "0000516574" "00022736" "10" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23Gln)" "" "0000516575" "00022736" "30" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23Gln)" "" "0000516576" "00022736" "30" "13" "0" "13" "0" "c.13T>C" "r.(?)" "p.(Phe5Leu)" "" "0000516577" "00022736" "50" "-1111" "0" "-1111" "0" "c.-1111T>A" "r.(?)" "p.(=)" "" "0000650656" "00022736" "50" "1079" "0" "1079" "0" "c.1079C>T" "r.(?)" "p.(Ser360Leu)" "" "0000676696" "00022736" "50" "1888" "0" "1888" "0" "c.1888G>A" "r.(?)" "p.(Asp630Asn)" "" "0000676697" "00022736" "30" "385" "0" "385" "0" "c.385C>G" "r.(?)" "p.(Leu129Val)" "" "0000688834" "00022736" "50" "1600" "0" "1600" "0" "c.1600C>A" "r.(?)" "p.(Gln534Lys)" "" "0000718917" "00022736" "30" "1788" "0" "1788" "0" "c.1788C>T" "r.(?)" "p.(Asp596=)" "" "0000718918" "00022736" "30" "1275" "0" "1275" "0" "c.1275T>G" "r.(?)" "p.(Thr425=)" "" "0000718919" "00022736" "50" "1228" "0" "1228" "0" "c.1228C>T" "r.(?)" "p.(Pro410Ser)" "" "0000718920" "00022736" "50" "1103" "0" "1103" "0" "c.1103G>A" "r.(?)" "p.(Arg368His)" "" "0000718921" "00022736" "70" "208" "1" "208" "1" "c.208+1G>A" "r.spl?" "p.?" "" "0000718922" "00022736" "50" "160" "0" "160" "0" "c.160G>A" "r.(?)" "p.(Asp54Asn)" "" "0000718923" "00022736" "50" "116" "0" "116" "0" "c.116C>A" "r.(?)" "p.(Thr39Asn)" "" "0000788331" "00022736" "50" "842" "0" "842" "0" "c.842G>A" "r.(?)" "p.(Arg281His)" "10" "0000795051" "00022736" "90" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" "1" "0000800761" "00022736" "50" "760" "0" "786" "0" "c.760_786del" "r.(?)" "p.(Pro254_Ala262del)" "" "0000800762" "00022736" "90" "541" "0" "541" "0" "c.541C>T" "r.(?)" "p.(Gln181*)" "" "0000800763" "00022736" "30" "33" "0" "33" "0" "c.33C>T" "r.(?)" "p.(Ser11=)" "" "0000813990" "00022736" "50" "985" "0" "985" "0" "c.985G>A" "r.(?)" "p.(Val329Met)" "10" "0000814072" "00022736" "50" "-1012" "0" "-1012" "0" "c.-1012C>T" "r.(?)" "p.?" "1" "0000816259" "00022736" "50" "633" "1" "633" "1" "c.633+1G>A" "r.spl" "p.(?)" "" "0000816271" "00022736" "50" "0" "0" "0" "0" "c.?" "r.spl" "p.(?)" "" "0000828544" "00022736" "70" "1032" "0" "1032" "0" "c.1032C>A" "r.(?)" "p.(Cys344*)" "" "0000849981" "00022736" "30" "2169" "0" "2169" "0" "c.2169G>A" "r.(?)" "p.(Leu723=)" "" "0000849982" "00022736" "50" "841" "0" "841" "0" "c.841C>T" "r.(?)" "p.(Arg281Cys)" "" "0000849983" "00022736" "30" "83" "0" "83" "0" "c.83A>T" "r.(?)" "p.(Asp28Val)" "" "0000858631" "00022736" "30" "1310" "0" "1310" "0" "c.1310G>T" "r.(?)" "p.(Ser437Ile)" "" "0000858632" "00022736" "30" "878" "0" "878" "0" "c.878C>G" "r.(?)" "p.(Thr293Ser)" "" "0000858633" "00022736" "90" "541" "0" "541" "0" "c.541C>T" "r.(?)" "p.(Gln181*)" "" "0000879044" "00022736" "70" "76" "-1" "76" "-1" "c.76-1G>T" "r.spl" "p.?" "" "0000879045" "00022736" "50" "624" "0" "624" "0" "c.624G>T" "r.(?)" "p.(Leu208Phe)" "" "0000879046" "00022736" "50" "2123" "0" "2123" "0" "c.2123C>T" "r.(?)" "p.(Ser708Phe)" "" "0000879047" "00022736" "50" "164" "0" "164" "0" "c.164G>A" "r.(?)" "p.(Arg55Lys)" "" "0000885349" "00022736" "30" "1310" "0" "1310" "0" "c.1310G>T" "r.(?)" "p.(Ser437Ile)" "" "0000885350" "00022736" "30" "1263" "0" "1263" "0" "c.1263A>C" "r.(?)" "p.(Leu421Phe)" "" "0000885351" "00022736" "30" "708" "0" "708" "0" "c.708T>C" "r.(?)" "p.(Asp236=)" "" "0000885352" "00022736" "30" "385" "-3" "385" "-3" "c.385-3del" "r.spl?" "p.?" "" "0000885353" "00022736" "30" "33" "0" "33" "0" "c.33C>T" "r.(?)" "p.(Ser11=)" "" "0000928651" "00022736" "30" "2169" "0" "2169" "0" "c.2169G>C" "r.(?)" "p.(=)" "" "0000928652" "00022736" "30" "1315" "0" "1315" "0" "c.1315G>A" "r.(?)" "p.(Val439Ile)" "" "0000947952" "00022736" "30" "1436" "-3" "1436" "-3" "c.1436-3T>C" "r.spl?" "p.?" "" "0000947953" "00022736" "30" "499" "11" "499" "11" "c.499+11C>G" "r.(=)" "p.(=)" "" "0000947954" "00022736" "50" "-6262" "0" "-6262" "0" "c.-6262C>T" "r.(?)" "p.(=)" "" "0000947955" "00022736" "50" "-16600" "0" "-16600" "0" "c.-16600G>A" "r.(?)" "p.(=)" "" "0000975390" "00022736" "50" "1079" "0" "1079" "0" "c.1079C>T" "r.(?)" "p.(Ser360Leu)" "" "0001024667" "00022736" "50" "1333" "0" "1333" "0" "c.1333G>C" "r.(?)" "p.(Ala445Pro)" "" "0001033432" "00022736" "50" "1094" "0" "1094" "0" "c.1094A>G" "r.(?)" "p.(Glu365Gly)" "" "0001033433" "00022736" "50" "760" "0" "786" "0" "c.760_786del" "r.(?)" "p.(Pro254_Ala262del)" "" "0001033434" "00022736" "50" "160" "0" "160" "0" "c.160G>A" "r.(?)" "p.(Asp54Asn)" "" "0001033435" "00022736" "50" "158" "0" "158" "0" "c.158C>T" "r.(?)" "p.(Ala53Val)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 12 "{{screeningid}}" "{{variantid}}" "0000145017" "0000788331" "0000293967" "0000650656" "0000381578" "0000795051" "0000386461" "0000813990" "0000386514" "0000814072" "0000388101" "0000816259" "0000388113" "0000816271" "0000396846" "0000828544" "0000419125" "0000879044" "0000419126" "0000879045" "0000419127" "0000879046" "0000419128" "0000879047"