### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = WDR45) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "WDR45" "WD repeat domain 45" "X" "p11.23" "unknown" "NG_033004.1" "UD_134752170844" "" "https://www.LOVD.nl/WDR45" "" "1" "28912" "11152" "300526" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "" "g" "https://databases.lovd.nl/shared/refseq/WDR45_codingDNA.html" "1" "" "" "-1" "" "-1" "00000" "2012-09-13 00:00:00" "00006" "2018-01-26 21:39:04" "00000" "2025-05-05 21:14:00" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00000550" "WDR45" "transcript variant 1" "001" "NM_007075.3" "" "NP_009006.2" "" "" "" "-439" "1456" "1086" "48932092" "48958059" "00000" "2012-09-13 12:31:28" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 10 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00000" "Healthy/Control" "Healthy individual / control" "" "" "" "" "" "00000" "2012-07-26 17:29:43" "" "" "00139" "ID" "intellectual disability (ID)" "" "" "" "" "" "00084" "2013-06-04 18:18:07" "00006" "2015-02-09 10:02:49" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "01155" "NBIA5" "neurodegeneration, with brain iron accululation, type 5 (NBIA5)" "XLD" "300894" "" "global developmental delay in early childhood, slow motor and cognitive gains until adolescence or early adulthood, when dystonia, parkinsonism, and dementia manifests; MRI brain pattern characteristic of high iron: markedly hypointense signal on T2-weighted sequences substantia nigra and globus pallidus, cerebral atrophy, T1 hyperintensity surrounding central linear region of signal hypointensity within substantia nigra and cerebral peduncles" "possibly male lethal, somatic mosaicism in males, skewed X-inactivation in females" "00006" "2014-09-25 23:29:40" "00006" "2020-05-30 16:30:37" "01157" "CHTE" "Hypothyroidism, central, testicular enlargement (CHTE)" "XLR" "300888" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "03237" "ALL" "leukemia, lymphoid, acute (ALL)" "" "613065" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2016-03-20 12:15:43" "05229" "NBIA" "neurodegeneration, with brain iron accumulation (NBIA)" "" "" "" "" "" "00006" "2017-03-02 13:09:37" "" "" "05517" "skeletal dysplasia" "dysplasia, skeletal" "" "" "" "" "" "00006" "2018-11-16 16:43:21" "" "" "05521" "seizures" "seizures" "" "" "" "" "" "00006" "2018-11-18 17:02:13" "" "" "05611" "NDD" "neurodevelopmental disorder (NDD)" "" "" "" "" "" "00006" "2019-06-19 12:27:20" "00006" "2024-12-13 11:12:21" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 2 "{{geneid}}" "{{diseaseid}}" "WDR45" "00139" "WDR45" "01155" ## Individuals ## Do not remove or alter this header ## ## Count = 153 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00000208" "" "" "" "1" "" "00037" "{PMID:Sun 2011:23143598}, {DOI:Sun 2011:10.1038/ng.2453}" "" "M" "no" "Netherlands" "" "0" "" "" "" "" "00000209" "" "" "" "1" "" "00037" "{PMID:Sun 2011:23143598}, {DOI:Sun 2011:10.1038/ng.2453}" "" "M" "no" "Netherlands" "" "0" "" "" "" "" "00019841" "" "" "" "1" "" "00705" "{PMID:Gilissen 2014:24896178}" "" "F" "?" "" "" "0" "" "" "" "" "00050479" "" "" "" "1" "" "00006" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "family, 1 affected" "F" "" "United Kingdom (Great Britain)" "" "0" "Decipher" "" "" "" "00050606" "" "" "" "1" "" "00006" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "family, 1 affected" "F" "" "United Kingdom (Great Britain)" "" "0" "Decipher" "" "" "" "00050610" "" "" "" "2" "" "00006" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "family, affected sibling(s)" "F" "" "United Kingdom (Great Britain)" "" "0" "Decipher" "" "" "" "00050612" "" "" "" "2" "" "00006" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "family, affected sibling(s)" "F" "" "United Kingdom (Great Britain)" "" "0" "Decipher" "" "" "" "00144506" "" "" "" "1" "" "01807" "" "" "F" "" "(Germany)" "" "0" "" "" "" "" "00152028" "" "" "" "1" "" "01741" "" "" "" "" "" "" "0" "" "" "" "" "00174870" "" "" "" "1" "" "01807" "" "" "F" "" "(Germany)" "" "0" "" "" "" "" "00180178" "" "" "" "1" "" "00006" "{PMID:Tumienė 2018:29286531}" "" "" "" "(Slovenia)" "" "0" "" "" "" "29286531-Pat30" "00302684" "" "" "" "1" "" "01164" "" "" "M" "" "" "" "0" "" "" "" "" "00302726" "" "" "" "1" "" "00006" "{PMID:Haack 2012:23176820}, {PMID:Hayflick 2013:23435086}" "2-generation family, 1 affected, unaffected non-carrier parents/relatives" "F" "" "Germany;Ireland;England;Austria" "" "0" "" "" "" "60251" "00302727" "" "" "" "1" "" "00006" "{PMID:Haack 2012:23176820}, {PMID:Hayflick 2013:23435086}" "2-generation family, 1 affected, unaffected non-carrier parents/relatives" "F" "" "Germany;United States" "" "0" "" "" "native American (Sioux, Cherokee)" "63700" "00302728" "" "" "" "1" "" "00006" "{PMID:Haack 2012:23176820}, {PMID:Hayflick 2013:23435086}" "2-generation family, 1 affected, unaffected parents" "F" "" "Germany;France;Ireland" "" "0" "" "" "" "63701" "00302729" "" "" "" "1" "" "00006" "{PMID:Haack 2012:23176820}, {PMID:Hayflick 2013:23435086}" "2-generation family, 1 affected, unaffected parents/relatives" "F" "" "United States" "" "0" "" "" "African American" "63702" "00302730" "" "" "" "1" "" "00006" "{PMID:Haack 2012:23176820}, {PMID:Hayflick 2013:23435086}" "2-generation family, 1 affected, unaffected parents" "F" "" "United States" "" "0" "" "" "African American" "63703" "00302731" "" "" "" "1" "" "00006" "{PMID:Haack 2012:23176820}, {PMID:Hayflick 2013:23435086}" "2-generation family, 1 affected, unaffected parents" "F" "" "Puerto Rico" "" "0" "" "" "Hispanic" "63704" "00302732" "" "" "" "1" "" "00006" "{PMID:Haack 2012:23176820}, {PMID:Hayflick 2013:23435086}" "2-generation family, 1 affected, unaffected parents" "F" "" "Romania;France" "" "0" "" "" "" "63705" "00302733" "" "" "" "1" "" "00006" "{PMID:Haack 2012:23176820}, {PMID:Hayflick 2013:23435086}" "2-generation family, 1 affected, unaffected parents/relatives" "F" "" "Germany;Ireland;England" "" "0" "" "" "" "63706" "00302734" "" "" "" "1" "" "00006" "{PMID:Haack 2012:23176820}, {PMID:Hayflick 2013:23435086}" "2-generation family, 1 affected, unaffected non-carrier parents/relatives" "F" "" "" "" "0" "" "" "" "63707" "00302735" "" "" "" "1" "" "00006" "{PMID:Haack 2012:23176820}, {PMID:Hayflick 2013:23435086}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "" "Germany;Scotland;Ireland" "" "0" "" "" "" "63708" "00302736" "" "" "" "1" "" "00006" "{PMID:Haack 2012:23176820}, {PMID:Hayflick 2013:23435086}" "2-generation family, 1 affected, unaffected parents" "F" "" "Italy;United States" "" "0" "" "" "northern Europe, native American" "63709" "00302737" "" "" "" "1" "" "00006" "{PMID:Haack 2012:23176820}, {PMID:Hayflick 2013:23435086}" "2-generation family, 1 affected, unaffected non-carrier parents/relatives" "F" "" "Netherlands" "" "0" "" "" "" "63711" "00302738" "" "" "" "1" "" "00006" "{PMID:Haack 2012:23176820}, {PMID:Hayflick 2013:23435086}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "Scotland;Ireland" "" "0" "" "" "" "63712" "00302739" "" "" "" "1" "" "00006" "{PMID:Haack 2012:23176820}, {PMID:Hayflick 2013:23435086}" "2-generation family, 1 affected, unaffected parents" "M" "" "Germany" "" "0" "" "" "" "49841" "00302740" "" "" "" "1" "" "00006" "{PMID:Haack 2012:23176820}, {PMID:Hayflick 2013:23435086}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "Italy" "" "0" "" "" "" "411-201" "00302741" "" "" "" "1" "" "00006" "{PMID:Haack 2012:23176820}, {PMID:Hayflick 2013:23435086}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "" "" "0" "" "" "" "HH56" "00302742" "" "" "" "1" "" "00006" "{PMID:Haack 2012:23176820}, {PMID:Hayflick 2013:23435086}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "" "" "0" "" "" "" "HH84" "00302743" "" "" "" "1" "" "00006" "{PMID:Haack 2012:23176820}, {PMID:Hayflick 2013:23435086}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "Pakistan" "" "0" "" "" "" "NBIA10" "00302744" "" "" "" "1" "" "00006" "{PMID:Haack 2012:23176820}, {PMID:Hayflick 2013:23435086}" "2-generation family, 1 affected, unaffected parents" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "463" "00302745" "" "" "" "1" "" "00006" "{PMID:Haack 2012:23176820}, {PMID:Hayflick 2013:23435086}" "" "" "" "" "" "0" "" "" "" "control" "00302747" "" "" "" "1" "" "00006" "{PMID:Saitsu 2013:23435086}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "Japan" "" "0" "" "" "" "subject 1" "00302748" "" "" "" "1" "" "00006" "{PMID:Saitsu 2013:23435086}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "Japan" "" "0" "" "" "" "subject 2" "00302749" "" "" "" "1" "" "00006" "{PMID:Saitsu 2013:23435086}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "Japan" "" "0" "" "" "" "subject 3" "00302750" "" "" "" "1" "" "00006" "{PMID:Saitsu 2013:23435086}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "Japan" "" "0" "" "" "" "subject 4" "00302751" "" "" "" "1" "" "00006" "{PMID:Saitsu 2013:23435086}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "Japan" "" "0" "" "" "" "subject 5" "00302752" "" "" "" "1" "" "00006" "{PMID:Hayflick 2013:23435086}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "" "" "0" "" "" "" "HS152" "00302753" "" "" "" "1" "" "00006" "{PMID:Hayflick 2013:23435086}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "" "27y" "0" "" "" "" "NBIA18" "00302754" "" "" "" "1" "" "00006" "{PMID:Hayflick 2013:23435086}, {PMID:Crisp 2015:30713886}" "2-generation family, 1 affected, unaffected parents" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "NBIA21, patient" "00302755" "" "" "" "1" "" "00006" "{PMID:Hayflick 2013:23435086}" "2-generation family, 1 affected, unaffected parents" "F" "" "" "" "0" "" "" "" "HS415" "00302756" "" "" "" "1" "" "00006" "{PMID:Verhoeven 2014:24368176}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "Netherlands" "" "0" "" "" "" "Pat1" "00302757" "" "" "" "1" "" "00006" "{PMID:Verhoeven 2014:24368176}" "2-generation family, 1 affected, unaffected parents" "F" "" "Netherlands" "" "0" "" "" "" "Pat2" "00302758" "" "" "" "1" "" "00006" "{PMID:Verhoeven 2014:24368176}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "Netherlands" "" "0" "" "" "" "Pat3" "00302759" "" "" "" "1" "" "00006" "{PMID:Rathore 2014:24610255}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "United States" "" "0" "" "" "" "patient" "00302760" "" "" "" "1" "" "00006" "{PMID:Ohba 2014:24621584}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "Japan" "" "0" "" "" "" "patient" "00302761" "" "" "" "1" "" "00006" "{PMID:Ichinose 2014:24790802}" "2-generation family, 1 affected, unaffected parents" "F" "" "Japan" "" "0" "" "" "" "patient" "00302762" "" "" "" "1" "" "00006" "{PMID:Ozawa 2014:25044655}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "Japan" "" "0" "" "" "" "patient" "00302763" "" "" "" "1" "" "00006" "{PMID:Okamoto 2014:25263061}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "Japan" "" "0" "" "" "" "patient" "00302764" "" "" "" "1" "" "00006" "{PMID:Van Goethem 2015:25301227}" "" "F" "" "" "" "0" "" "" "white" "patient" "00302788" "" "" "" "1" "" "00006" "{PMID:Hamdan 2015:25356899}" "" "F" "" "Canada" "" "0" "" "" "" "1883.659" "00302809" "" "" "" "1" "" "00006" "{PMID:Tschentscher 2015:25592411}" "" "F" "" "Germany" "" "0" "" "" "" "BPAN-1" "00302810" "" "" "" "1" "" "00006" "{PMID:Khalifa 2015:26096995}, comment {PMID:Thiffault 2016:27535217}" "" "F" "" "Egypt" "" "0" "" "" "" "patient" "00302811" "" "" "" "1" "" "00006" "{PMID:Paudel 2015:26123052}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "patient" "00302812" "" "" "" "1" "" "00006" "{PMID:Abidi 2016:26173968}" "" "M" "" "France" "" "0" "" "" "" "patient" "00302813" "" "" "" "1" "" "00006" "{PMID:Nishioka 2015:25744623}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "Japan" "" "0" "" "" "" "Case 1" "00302814" "" "" "" "1" "" "00006" "{PMID:Nishioka 2015:25744623}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "Japan" "" "0" "" "" "" "Case 2" "00302815" "" "" "" "1" "" "00006" "{PMID:Nishioka 2015:25744623}" "2-generation family, 1 affected, unaffected parents" "F" "" "Japan" "" "0" "" "" "" "Case 3" "00302816" "" "" "" "1" "" "00006" "{PMID:Nishioka 2015:25744623}" "2-generation family, 1 affected, unaffected parents" "F" "" "Japan" "" "0" "" "" "" "Case 4" "00302817" "" "" "" "1" "" "00006" "{PMID:Nishioka 2015:25744623}" "2-generation family, 1 affected, unaffected parents" "F" "" "Japan" "" "0" "" "" "" "Case 5" "00302818" "" "" "" "1" "" "00006" "{PMID:Nishioka 2015:25744623}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "Japan" "" "0" "" "" "" "Case 6" "00302819" "" "" "" "1" "" "00006" "{PMID:Nishioka 2015:25744623}" "2-generation family, 1 affected, unaffected parents" "F" "" "Japan" "" "0" "" "" "" "Case 7" "00302820" "" "" "" "1" "" "00006" "{PMID:Ryu 2015:26022463}" "" "F" "" "Korea" "" "0" "" "" "" "patient" "00302821" "" "" "" "1" "" "00006" "{PMID:Long 2015:26240209}" "" "F" "" "Canada" "" "0" "" "" "" "patient" "00302822" "" "" "" "1" "" "00006" "{PMID:Takano 2016:26481852}" "" "F" "" "Japan" "" "0" "" "" "" "patient" "00302825" "" "" "" "2" "" "00006" "{PMID:Zarate 2016:26577041}, {DOI:Zarate 2016:10.1038/ejhg.2015.242}" "2-generation family, affected brother sister, unaffected mosaic mother" "F;M" "no" "United States" "" "0" "" "" "" "patient" "00302826" "" "" "" "1" "" "00006" "{PMID:Xixis 2015:26609730}, {PMID:Xixis 2016:27435640}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "United States" "" "0" "" "" "" "patient" "00302827" "" "" "" "1" "" "00006" "{PMID:Hoffjan 2016:26790960}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "Argentina" "" "0" "" "" "" "patient" "00302828" "" "" "" "1" "" "00006" "{PMID:Morisada 2016:27349085}" "" "F" "" "Japan" "" "0" "" "" "" "patient" "00302829" "" "" "" "1" "" "00006" "{PMID:Spiegel 2016:27681470}" "2-generation family, 1 affected, unaffected parents" "M" "" "Israel" "" "0" "" "" "" "patient" "00302830" "" "" "" "1" "" "00006" "{PMID:Wynn 2016:27957548}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "United States" "" "0" "" "" "" "patient" "00302831" "" "" "" "1" "" "00006" "{PMID:Ingrassia 2017:28261264}" "" "" "" "Italy" "" "0" "" "" "" "patient" "00302832" "" "" "" "2" "" "00006" "{PMID:Araújo 2017:28361255}" "3-generation family, affected twin pair, unaffected non-carrier parents" "F" "" "Portugal" "" "0" "" "" "" "twins" "00302833" "" "" "" "1" "" "00006" "{PMID:Redon 2017:28371320}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "" "France" "" "0" "" "" "" "patient" "00302835" "" "" "" "1" "" "00006" "{PMID:Morikawa 2017:28551038}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "Japan" "" "0" "" "" "" "patient" "00302836" "" "" "" "1" "" "00006" "{PMID:Hattingen 2017:28643035}" "2-generation family, 1 affected, unaffected parents" "M" "" "Germany" "" "0" "" "" "" "patient" "00302837" "" "" "" "1" "" "00006" "{PMID:Takano 2018:28711740}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "" "Japan" "" "0" "" "" "" "patient" "00302838" "" "" "" "1" "" "00006" "{PMID:Fonderico 2017:28878728}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "Italy" "" "0" "" "" "" "patient" "00302839" "" "" "" "1" "" "00006" "{PMID:Endo 2017:28932395}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "Japan" "" "0" "" "" "" "patient" "00302840" "" "" "" "1" "" "00006" "{PMID:Burger 2017:29075622}" "2-generation family, 1 affected, unaffected non-carrier parents, sister of #302841" "F" "" "United States" "" "0" "" "" "" "FamCase1" "00302842" "" "" "" "1" "" "00006" "{PMID:Hermann 2017:29082105}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "Germany" "" "0" "" "" "" "patient" "00302849" "" "" "" "1" "" "00006" "{PMID:Kulikovskaja 2018:29600274}" "" "F" "" "Serbia" "" "0" "" "" "" "PatA" "00302853" "" "" "" "1" "" "00006" "{PMID:Kulikovskaja 2018:29600274}" "" "F" "" "Germany" "" "0" "" "" "" "PatB" "00302854" "" "" "" "1" "" "00006" "{PMID:Willoughby 2018:29681108}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "patient" "00302870" "" "" "" "1" "" "00006" "{PMID:Carvill 2018:29171013}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "" "" "0" "" "" "" "Pat1" "00302871" "" "" "" "1" "" "00006" "{PMID:Carvill 2018:29171013}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "" "" "0" "" "" "" "Pat2" "00302872" "" "" "" "1" "" "00006" "{PMID:Carvill 2018:29171013}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "" "" "0" "" "" "" "Pat3" "00302873" "" "" "" "1" "" "00006" "{PMID:Carvill 2018:29171013}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "" "" "0" "" "" "" "Pat4" "00302874" "" "" "" "1" "" "00006" "{PMID:Carvill 2018:29171013}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "" "" "0" "" "" "" "Pat5" "00302875" "" "" "" "1" "" "00006" "{PMID:Carvill 2018:29171013}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "" "" "0" "" "" "" "Pat6" "00302876" "" "" "" "1" "" "00006" "{PMID:Carvill 2018:29171013}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "" "" "0" "" "" "" "Pat7" "00302877" "" "" "" "1" "" "00006" "{PMID:Nakashima 2016:27030146}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "" "Japan" "" "0" "" "" "" "Pat1" "00302878" "" "" "" "1" "" "00006" "{PMID:Nakashima 2016:27030146}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "" "Japan" "" "0" "" "" "" "Pat2" "00302879" "" "" "" "1" "" "00006" "{PMID:Nakashima 2016:27030146}" "2-generation family, 1 affected, unaffected parents" "M" "" "Japan" "" "0" "" "" "" "Pat3" "00302881" "" "" "" "1" "" "00006" "{PMID:Srivastava 2018:29322350}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "United States" "" "0" "" "" "" "Pat2" "00302888" "" "" "" "1" "" "00006" "{PMID:Percy 2018:29682453}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "United States" "" "0" "" "" "" "PatB" "00302892" "" "" "" "1" "" "00006" "{PMID:Ishiyama 2018:29695595}" "2-generation family, 1 affected, unaffected parents" "F" "" "Japan" "" "0" "" "" "" "Pat1" "00302894" "" "" "" "1" "" "00006" "{PMID:Ishiyama 2018:29695595}" "2-generation family, 1 affected, unaffected parents" "F" "" "Japan" "" "0" "" "" "" "Pat2" "00302895" "" "" "" "1" "" "00006" "{PMID:Lim 2018:29860786}" "2-generation family, 1 affected, unaffected parents" "F" "no" "Malaysia" "" "0" "" "" "India" "patient" "00302896" "" "" "" "1" "" "00006" "{PMID:Chen 2019:29981852}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "China" "" "0" "" "" "" "Pat1" "00302898" "" "" "" "1" "" "00006" "{PMID:Chen 2019:29981852}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "China" "" "0" "" "" "" "Pat2" "00302899" "" "" "" "1" "" "00006" "{PMID:Chen 2019:29981852}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "China" "" "0" "" "" "" "Pat3" "00302900" "" "" "" "1" "" "00006" "{PMID:Chen 2019:29981852}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "China" "" "0" "" "" "" "Pat4" "00302901" "" "" "" "1" "" "00006" "{PMID:Chen 2019:29981852}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "China" "" "0" "" "" "" "Pat5" "00302902" "" "" "" "1" "" "00006" "{PMID:Uchino 2015:30713893}" "2-generation family, 1 affected, unaffected parents" "F" "" "Japan" "" "0" "" "" "" "patient" "00302903" "" "" "" "1" "" "00006" "{PMID:Seibler 2018:30169597}" "" "F" "" "Germany" "" "0" "" "" "" "patient" "00302904" "" "" "" "1" "" "00006" "{PMID:Rohani 2019:30455156}" "3-generation family, 1 affected, unaffected non-carrier parents" "F" "yes" "Iran" "" "0" "" "" "" "Pat1" "00302905" "" "" "" "1" "" "00006" "{PMID:Rohani 2019:30455156}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "Iran" "" "0" "" "" "" "Pat2" "00302906" "" "" "" "1" "" "00006" "{PMID:Rohani 2019:30455156}" "3-generation family, 1 affected, unaffected non-carrier parents" "F" "yes" "Iran" "" "0" "" "" "" "Pat3" "00302907" "" "" "" "1" "" "00006" "{PMID:Liu 2018:30539914}" "" "M" "" "China" "" "0" "" "" "" "patient" "00302908" "" "" "" "1" "" "00006" "{PMID:Russo 2018:30746416}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "Italy" "" "0" "" "" "" "Pat1" "00302909" "" "" "" "1" "" "00006" "{PMID:Russo 2018:30746416}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "Italy" "" "0" "" "" "" "Pat2" "00302910" "" "" "" "1" "" "00006" "{PMID:Russo 2018:30746416}" "2-generation family, 1 affected, unaffected parents" "F" "" "Italy" "" "0" "" "" "" "Pat3" "00302911" "" "" "" "1" "" "00006" "{PMID:Russo 2018:30746416}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "Italy" "" "0" "" "" "" "Pat4" "00302922" "" "" "" "1" "" "00006" "Xiao 2018, {PMID:Xiong 2019:31332960}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "China" "" "0" "" "" "" "patient" "00302923" "" "" "" "1" "" "00006" "{PMID:Khoury 2019:31466010}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "" "United States" "" "0" "" "" "" "patient" "00302924" "" "" "" "1" "" "00006" "{PMID:Kaleka 2019:31632858}" "2-generation family, 1 affected, unaffected parents" "F" "" "United States" "" "0" "" "" "" "patient" "00302925" "" "" "" "1" "" "00006" "{PMID:Özgün 2020:32253879}" "2-generation family, 1 affected, unaffected parents" "F" "" "Turkey" "" "0" "" "" "" "patient" "00302926" "" "" "" "1" "" "00006" "{PMID:Sato 2020:32307390}" "" "F" "" "Japan" "" "0" "" "" "" "patient" "00302927" "" "" "" "1" "" "00006" "{PMID:Adang 2020:32387008}" "2-generation family, 1 affected, unaffected parents" "M" "" "" "" "0" "" "" "" "Pat1" "00302928" "" "" "" "1" "" "00006" "{PMID:Adang 2020:32387008}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "" "" "0" "" "" "" "Pat2" "00302929" "" "" "" "1" "" "00006" "{PMID:Adang 2020:32387008}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "" "" "0" "" "" "" "Pat3" "00302930" "" "" "" "1" "" "00006" "{PMID:Adang 2020:32387008}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "" "" "0" "" "" "" "Pat4" "00302931" "" "" "" "1" "" "00006" "{PMID:Adang 2020:32387008}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "" "" "0" "" "" "" "Pat5" "00302932" "" "" "" "1" "" "00006" "{PMID:Adang 2020:32387008}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "" "" "0" "" "" "" "Pat6" "00302933" "" "" "" "1" "" "00006" "{PMID:Adang 2020:32387008}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "" "" "0" "" "" "" "Pat7" "00302934" "" "" "" "1" "" "00006" "{PMID:Adang 2020:32387008}" "2-generation family, 1 affected, unaffected parents" "M" "" "" "" "0" "" "" "" "Pat8" "00302935" "" "" "" "1" "" "00006" "{PMID:Adang 2020:32387008}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "" "" "0" "" "" "" "Pat9" "00302936" "" "" "" "1" "" "00006" "{PMID:Adang 2020:32387008}" "2-generation family, 1 affected, unaffected parents" "M" "" "" "" "0" "" "" "" "Pat10" "00302937" "" "" "" "1" "" "00006" "{PMID:Adang 2020:32387008}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "" "" "0" "" "" "" "Pat12" "00302938" "" "" "" "1" "" "00006" "{PMID:Adang 2020:32387008}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "" "" "0" "" "" "" "Pat13" "00302939" "" "" "" "1" "" "00006" "{PMID:Adang 2020:32387008}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "" "" "0" "" "" "" "Pat14" "00302940" "" "" "" "1" "" "00006" "{PMID:Adang 2020:32387008}" "2-generation family, 1 affected, unaffected parents" "M" "" "" "" "0" "" "" "" "Pat15" "00302941" "" "" "" "1" "" "00006" "{PMID:Adang 2020:32387008}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "" "" "0" "" "" "" "Pat16" "00302942" "" "" "" "1" "" "00006" "{PMID:Adang 2020:32387008}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "" "" "0" "" "" "" "Pat17" "00302943" "" "" "" "1" "" "00006" "{PMID:Adang 2020:32387008}" "2-generation family, 1 affected, unaffected parents" "M" "" "" "" "0" "" "" "" "Pat18" "00302944" "" "" "" "1" "" "00006" "{PMID:Stige 2018:29445477}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "Norway" "" "0" "" "" "" "patient" "00302948" "" "" "" "1" "" "00006" "{PMID:Fieremans 2016:27159028}" "" "F" "" "" "" "0" "" "" "" "Pat4" "00303028" "" "" "" "1" "" "00006" "{PMID:Helbig 2016:26795593}" "" "" "" "United States" "" "0" "" "" "" "Pat73" "00303056" "" "" "" "1" "" "00006" "{PMID:Helbig 2016:26795593}" "" "" "" "United States" "" "0" "" "" "" "Pat101" "00303090" "" "" "" "1" "" "00006" "{PMID:Brassesco 2018:30553463}" "" "" "" "Brazil" "" "0" "" "" "" "patient" "00374535" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-96" "00375651" "" "" "" "1" "" "00006" "{PMID:Srivastava 2014:25131622}" "" "" "" "United States" "" "0" "" "" "" "Pat39" "00376971" "" "" "" "1" "" "01741" "" "" "" "" "" "" "" "" "" "" "" "00377154" "" "" "" "1" "" "01164" "" "" "F" "" "Germany" "" "0" "" "" "" "182657" "00391878" "" "" "" "1" "" "02494" "" "" "F" "no" "" "" "" "" "" "" "138P" "00409867" "" "" "" "1" "" "03322" "{PMID:Masunaga 2022:36224347}" "2-generation family, 1 affected, unaffected carrier parents" "M" "no" "Japan" "" "0" "" "" "" "Pat3" "00410540" "" "" "" "1" "" "00006" "{PMID:Schuermans 2022:35606766}" "analysis 329 adult patients suffering from undiagnosed rare disease" "F" "" "Belgium" "" "0" "" "" "" "Pat2" "00426168" "" "" "" "1" "" "00006" "{PMID:Al-Kasbi 2022:36344539}" "patient, no other affecteds in family" "F" "" "Oman" "" "0" "" "" "" "10DK6300" "00428012" "" "" "" "1" "" "00006" "{PMID:Bournazos 2022:34906502}" "family, 1 affected" "" "" "Australia" "" "0" "" "" "" "A143" "00455863" "" "" "" "1" "" "00006" "{PMID:Salinas 2020:33084218}" "patient" "F" "" "" "" "0" "" "" "" "Pat103" "00458079" "" "" "" "1" "" "03544" "" "" "M" "-" "- (not applicable)" "" "" "" "" "white" "" "00460906" "" "" "" "1" "" "04796" "" "" "" "" "Netherlands" "" "0" "" "" "" "" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 154 "{{individualid}}" "{{diseaseid}}" "00000208" "01157" "00000209" "01157" "00019841" "00139" "00050479" "00198" "00050606" "00198" "00050610" "00198" "00050612" "00198" "00144506" "00198" "00152028" "01155" "00174870" "00198" "00180178" "00198" "00302684" "00198" "00302726" "05229" "00302727" "05229" "00302728" "05229" "00302729" "05229" "00302730" "05229" "00302731" "05229" "00302732" "05229" "00302733" "05229" "00302734" "05229" "00302735" "05229" "00302736" "05229" "00302737" "05229" "00302738" "05229" "00302739" "05229" "00302740" "05229" "00302741" "05229" "00302742" "05229" "00302743" "05229" "00302744" "05229" "00302745" "00000" "00302747" "05229" "00302748" "05229" "00302749" "05229" "00302750" "05229" "00302751" "05229" "00302752" "05229" "00302753" "05229" "00302754" "05229" "00302755" "05229" "00302756" "05229" "00302757" "05229" "00302758" "05229" "00302759" "05229" "00302760" "05229" "00302761" "05229" "00302762" "05229" "00302763" "05229" "00302764" "05229" "00302788" "00139" "00302809" "05229" "00302810" "00198" "00302811" "05229" "00302812" "05229" "00302813" "05229" "00302814" "05229" "00302815" "05229" "00302816" "05229" "00302817" "05229" "00302818" "05229" "00302819" "05229" "00302820" "05229" "00302821" "05229" "00302822" "05229" "00302825" "05229" "00302826" "05229" "00302827" "05229" "00302828" "05229" "00302829" "05229" "00302830" "05229" "00302831" "05229" "00302832" "05229" "00302833" "05229" "00302835" "05229" "00302836" "05229" "00302837" "05229" "00302838" "05229" "00302839" "05229" "00302840" "05229" "00302842" "05229" "00302849" "05229" "00302853" "00198" "00302854" "05229" "00302870" "05229" "00302871" "05229" "00302872" "05229" "00302873" "05229" "00302874" "05229" "00302875" "05229" "00302876" "05229" "00302877" "05229" "00302878" "05229" "00302879" "05229" "00302881" "05229" "00302888" "05229" "00302892" "05229" "00302894" "05229" "00302895" "05229" "00302896" "05229" "00302898" "05229" "00302899" "05229" "00302900" "05229" "00302901" "05229" "00302902" "05229" "00302903" "05229" "00302904" "05229" "00302905" "05229" "00302906" "05229" "00302907" "05229" "00302908" "05229" "00302909" "05229" "00302910" "05229" "00302911" "05229" "00302922" "05229" "00302923" "05229" "00302924" "05229" "00302925" "05229" "00302926" "05229" "00302927" "05229" "00302928" "05229" "00302929" "05229" "00302930" "05229" "00302931" "05229" "00302932" "05229" "00302933" "05229" "00302934" "05229" "00302935" "05229" "00302936" "05229" "00302937" "05229" "00302938" "05229" "00302939" "05229" "00302940" "05229" "00302941" "05229" "00302942" "05229" "00302943" "05229" "00302944" "05229" "00302948" "00139" "00303028" "05521" "00303056" "05521" "00303090" "03237" "00374535" "00198" "00375651" "00198" "00376971" "01155" "00377154" "01155" "00391878" "00139" "00391878" "01155" "00409867" "05517" "00410540" "00198" "00426168" "00139" "00428012" "00198" "00455863" "00198" "00458079" "05611" "00460906" "00198" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00000, 00139, 00198, 01155, 01157, 03237, 05229, 05517, 05521, 05611 ## Count = 147 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000017580" "00139" "00019841" "00705" "Isolated (sporadic)" "?" "ID from infancy, regression at adult age; shows parkinsonism and dystonia" "" "" "" "" "" "" "" "" "" "" "" "0000037091" "00198" "00050479" "00006" "Isolated (sporadic)" "" "intellectual disability, generalized hypotonia, brachycephaly, delayed cns myelination, hypodensity of cerebral white matter on mri" "" "" "" "" "" "" "" "" "" "" "" "0000037218" "00198" "00050606" "00006" "Isolated (sporadic)" "" "global developmental delay, seizures, scoliosis, abnormal cns myelination, delayed speech and language development" "" "" "" "" "" "" "" "" "" "" "" "0000037222" "00198" "00050610" "00006" "Unknown" "" "constipation, generalized hypotonia, global developmental delay, specific learning disability, autism, thick eyebrow, prominent nose" "" "" "" "" "" "" "" "" "" "" "" "0000037224" "00198" "00050612" "00006" "Unknown" "" "constipation, generalized hypotonia, global developmental delay, specific learning disability, seizures, generalized myoclonic seizures, scoliosis, cerebral atrophy, medial flaring of the eyebrow, joint contracture of the hand, wrist flexion contracture" "" "" "" "" "" "" "" "" "" "" "" "0000038983" "01157" "00000208" "00006" "Familial, X-linked recessive" "" "central hypothyroidism (FT4 0.50-0.99of lower limit normal), no prolactin deficiency, age sonographic determination testicular volume 17.64y, testicular volume right/left 21/20 (7.3–16ml)" "" "3w" "" "" "" "" "" "" "" "" "" "0000038984" "01157" "00000209" "00006" "Familial, X-linked recessive" "" "central hypothyroidism (FT4 0.50-0.99of lower limit normal), prolactin deficiency, age sonographic determination testicular volume 21.36y, testicular volume right/left 30/26 (8.5–18.3ml)" "" "07y04m" "" "" "" "" "" "" "" "" "" "0000117244" "00198" "00144506" "01807" "Unknown" "" "Spastic gait (HP:0002064); Postnatal microcephaly (HP:0005484); Global developmental delay (HP:0001263); Strabismus (HP:0000486)" "" "" "" "" "" "" "" "" "" "" "" "0000139695" "00198" "00174870" "01807" "Unknown" "" "HP:0001263 (Global developmental delay)" "" "" "" "" "" "" "" "" "" "" "" "0000142632" "00198" "00180178" "00006" "Familial, X-linked dominant" "" "Epilepsy (HP:0001250), myoclonic seizures (HP:0002123), global developmental delay (HP:0001263), autism (HP:0000717). Head MRI: corpus callosum hypoplasia (HP:0002079), abnormal CNS myelination (HP:0011400).Epilepsy (HP:0001250), myoclonic seizures (HP:0002123), global developmental delay (HP:0001263), autism (HP:0000717). Head MRI: corpus callosum hypoplasia (HP:0002079), abnormal CNS myelination (HP:0011400)." "" "" "" "" "" "" "" "" "" "epilepsy or seizures associated with neurodevelopmental disorders and/or congenital malformations" "" "0000229768" "00198" "00302684" "01164" "Unknown" "" "Abnormal CNS myelination (HP:0011400); Seizures (HP:0001250); Muscular hypotonia (HP:0001252); Abnormality of nervous system physiology (HP:0012638); Epileptic encephalopathy (HP:0200134); Delayed CNS myelination (HP:0002188); Abnormal muscle tone (HP:0003808)" "" "" "" "" "" "" "" "" "" "" "" "0000229809" "05229" "00302726" "00006" "Isolated (sporadic)" "" "age at deterioration >23y; developmental delay, intellectual disability; progressive psychomotor slowing adolescence/adulthood; Rett-like repetitive midline handwringing; dystonia; Parkinsonism; limited expressive language; REM sleep disorder; EEG diffuse background slowing with bursts of generalized 3/s spike and wave discharges; staring, absence or atonic seizures; astigmatism, myopia; T2 hypointense substantia nigra and globus pallidus (high iron); T1 hyperintense ‘halo’ midbrain; cerebral atrophy; no cerebellar atrophy" "" "" "" "" "" "" "" "" "NBIA5" "neurodegeneration with brain iron accumulation" "" "0000229810" "05229" "00302727" "00006" "Isolated (sporadic)" "" "age at deterioration 26y; developmental delay, intellectual disability; progressive psychomotor slowing adolescence/adulthood; no Rett-like features; dystonia; Parkinsonism; l-DOPA responsive; limited expressive language; no sleep problems; no epliepsy; no ocular defects; T2 hypointense substantia nigra and globus pallidus (high iron); T1 hyperintense ‘halo’ midbrain; no cerebral atrophy" "" "" "" "" "" "" "" "" "NBIA5" "neurodegeneration with brain iron accumulation" "" "0000229811" "05229" "00302728" "00006" "Isolated (sporadic)" "" "age at deterioration 26y; developmental delay, intellectual disability; progressive psychomotor slowing adolescence/adulthood; Rett-like features; dystonia; Parkinsonism; l-DOPA responsive; limited expressive language; excessive movement during sleep; staring, absence or atonic seizures; high myopia, abnormal pupil shape; T2 hypointense substantia nigra and globus pallidus (high iron); T1 hyperintense ‘halo’ midbrain; cerebral atrophy; no cerebellar atrophy" "" "" "" "" "" "" "" "" "NBIA5" "neurodegeneration with brain iron accumulation" "" "0000229812" "05229" "00302729" "00006" "Isolated (sporadic)" "" "age at deterioration >29y; developmental delay, intellectual disability; progressive psychomotor slowing adolescence/adulthood; no Rett-like features; dystonia; no Parkinsonism; limited expressive language; no sleep problems; staring, absence or atonic seizures; no ocular defects; T2 hypointense substantia nigra and globus pallidus (high iron); T1 hyperintense ‘halo’ midbrain; cerebral atrophy; no cerebellar atrophy; posterior ventriculo- megaly" "" "" "" "" "" "" "" "" "NBIA5" "neurodegeneration with brain iron accumulation" "" "0000229813" "05229" "00302730" "00006" "Isolated (sporadic)" "" "age at deterioration 26y; developmental delay, intellectual disability; progressive psychomotor slowing adolescence/adulthood; no Rett-like features; dystonia; Parkinsonism; limited expressive language; sleep-wake cycle disorder; no epliepsy; no ocular defects; T2 hypointense substantia nigra and globus pallidus (high iron); T1 hyperintense ‘halo’ midbrain; cerebral atrophy; no cerebellar atrophy" "" "" "" "" "" "" "" "" "NBIA5" "neurodegeneration with brain iron accumulation" "" "0000229814" "05229" "00302731" "00006" "Isolated (sporadic)" "" "age at deterioration 25y; developmental delay, intellectual disability; progressive psychomotor slowing adolescence/adulthood; no Rett-like features; dystonia; Parkinsonism; l-DOPA responsive; limited expressive language; no sleep problems; no epliepsy; spontaneous retinal detachment; T2 hypointense substantia nigra and globus pallidus (high iron); T1 hyperintense ‘halo’ midbrain; cerebral atrophy" "" "" "" "" "" "" "" "" "NBIA5" "neurodegeneration with brain iron accumulation" "" "0000229815" "05229" "00302732" "00006" "Isolated (sporadic)" "" "age at deterioration 15y; developmental delay, intellectual disability; progressive psychomotor slowing adolescence/adulthood; Rett-like hand sterotypies; dystonia; Parkinsonism; limited expressive language; no sleep problems; EEG diffuse background slowing with bursts of generalized 3/s spike and wave discharges; staring, absence or atonic seizures; bilateral partial retinal coloboma; T2 hypointense substantia nigra and globus pallidus (high iron); T1 hyperintense ‘halo’ midbrain; no cerebral atrophy; no cerebellar atrophy" "" "" "" "" "" "" "" "" "NBIA5" "neurodegeneration with brain iron accumulation" "" "0000229816" "05229" "00302733" "00006" "Isolated (sporadic)" "" "age at deterioration 29y; developmental delay, intellectual disability; progressive psychomotor slowing adolescence/adulthood; no Rett-like features; dystonia; Parkinsonism; l-DOPA responsive; limited expressive language; no sleep problems; staring, absence or atonic seizures, febrile seizures; no ocular defects; T2 hypointense substantia nigra and globus pallidus (high iron); T1 hyperintense ‘halo’ midbrain; no cerebral atrophy; stroke" "" "" "" "" "" "" "" "" "NBIA5" "neurodegeneration with brain iron accumulation" "" "0000229817" "05229" "00302734" "00006" "Isolated (sporadic)" "" "age at deterioration 37y; developmental delay, intellectual disability; progressive psychomotor slowing adolescence/adulthood; no Rett-like features; dystonia; Parkinsonism; l-DOPA responsive; limited expressive language; hypersomnolence with choreiform movements at onset of sleep; febrile seizures; no ocular defects; T2 hypointense substantia nigra and globus pallidus (high iron); T1 hyperintense ‘halo’ midbrain; cerebral atrophy; no cerebellar atrophy" "" "" "" "" "" "" "" "" "NBIA5" "neurodegeneration with brain iron accumulation" "" "0000229818" "05229" "00302735" "00006" "Isolated (sporadic)" "" "age at deterioration 27y; developmental delay, intellectual disability; progressive psychomotor slowing adolescence/adulthood; no Rett-like features; dystonia; Parkinsonism; l-DOPA responsive; limited expressive language; no sleep problems; no epliepsy; no ocular defects; T2 hypointense substantia nigra and globus pallidus (high iron); T1 hyperintense ‘halo’ midbrain; cerebral atrophy; no cerebellar atrophy; mega cisterna magna; stroke" "" "" "" "" "" "" "" "" "NBIA5" "neurodegeneration with brain iron accumulation" "" "0000229819" "05229" "00302736" "00006" "Isolated (sporadic)" "" "age at deterioration 30y; developmental delay, intellectual disability; progressive psychomotor slowing adolescence/adulthood; no Rett-like features; dystonia; Parkinsonism; l-DOPA responsive; limited expressive language; no sleep problems; no epliepsy; patchy loss of pupillary ruff; T2 hypointense substantia nigra and globus pallidus (high iron); T1 hyperintense ‘halo’ midbrain; cerebral atrophy; cerebellar atrophy" "" "" "" "" "" "" "" "" "NBIA5" "neurodegeneration with brain iron accumulation" "" "0000229820" "05229" "00302737" "00006" "Isolated (sporadic)" "" "age at deterioration 31y; developmental delay, intellectual disability; progressive psychomotor slowing adolescence/adulthood; no Rett-like features; dystonia; Parkinsonism; limited expressive language; no sleep problems; no epliepsy; no ocular defects; T2 hypointense substantia nigra and globus pallidus (high iron); T1 hyperintense ‘halo’ midbrain; cerebral atrophy" "" "" "" "" "" "" "" "" "NBIA5" "neurodegeneration with brain iron accumulation" "" "0000229821" "05229" "00302738" "00006" "Isolated (sporadic)" "" "age at deterioration 26y; developmental delay, intellectual disability; progressive psychomotor slowing adolescence/adulthood; Rett-like features; dystonia; Parkinsonism; limited expressive language; parasomnia with nocturnal screaming; no epliepsy; no ocular defects; T2 hypointense substantia nigra and globus pallidus (high iron); T1 hyperintense ‘halo’ midbrain; cerebral atrophy; cerebellar atrophy" "" "" "" "" "" "" "" "" "NBIA5" "neurodegeneration with brain iron accumulation" "" "0000229822" "05229" "00302739" "00006" "Isolated (sporadic)" "" "age at deterioration 28y; developmental delay, intellectual disability; progressive psychomotor slowing adolescence/adulthood; no Rett-like features; dystonia; Parkinsonism; limited expressive language; sleep problems; febrile seizures; visual evoked potential increased latency; T2 hypointense substantia nigra and globus pallidus (high iron); no T1 hyperintense ‘halo’ midbrain; cerebral atrophy; no cerebellar atrophy" "" "" "" "" "" "" "" "" "NBIA5" "neurodegeneration with brain iron accumulation" "" "0000229823" "05229" "00302740" "00006" "Isolated (sporadic)" "" "age at deterioration 30y; developmental delay, intellectual disability; progressive psychomotor slowing adolescence/adulthood; no Rett-like features; dystonia; Parkinsonism; limited expressive language; no sleep problems; no epliepsy; no ocular defects; T2 hypointense substantia nigra and globus pallidus (high iron); T1 hyperintense ‘halo’ midbrain; cerebral atrophy; cerebellar atrophy" "" "" "" "" "" "" "" "" "NBIA5" "neurodegeneration with brain iron accumulation" "" "0000229824" "05229" "00302741" "00006" "Isolated (sporadic)" "" "age at deterioration 19y; developmental delay, intellectual disability; progressive psychomotor slowing adolescence/adulthood; no Rett-like features; dystonia; Parkinsonism; limited expressive language; no sleep problems; myoclonic seizures; no ocular defects; T2 hypointense substantia nigra and globus pallidus (high iron); T1 hyperintense ‘halo’ midbrain; cerebral atrophy; no cerebellar atrophy" "" "" "" "" "" "" "" "" "NBIA5" "neurodegeneration with brain iron accumulation" "" "0000229825" "05229" "00302742" "00006" "Isolated (sporadic)" "" "developmental delay, intellectual disability; progressive psychomotor slowing adolescence/adulthood; no Rett-like features; dystonia; Parkinsonism; l-DOPA responsive; limited expressive language; no sleep problems; no epliepsy; no ocular defects; T2 hypointense substantia nigra and globus pallidus (high iron); T1 hyperintense ‘halo’ midbrain; cerebral atrophy; no cerebellar atrophy; uterine tumour" "" "" "" "" "" "" "" "" "NBIA5" "neurodegeneration with brain iron accumulation" "" "0000229826" "05229" "00302743" "00006" "Isolated (sporadic)" "" "age at deterioration 16y; developmental delay, intellectual disability; progressive psychomotor slowing adolescence/adulthood; no Rett-like features; dystonia; minimal Parkinsonism, only freezing of gait, hesitancy at doorway; l-DOPA responsive; limited expressive language; no sleep problems; staring, absence or atonic seizures; no ocular defects; T2 hypointense substantia nigra and globus pallidus (high iron); T1 hyperintense ‘halo’ midbrain; no cerebral atrophy; cerebellar atrophy" "" "" "" "" "" "" "" "" "NBIA5" "neurodegeneration with brain iron accumulation" "" "0000229827" "05229" "00302744" "00006" "Isolated (sporadic)" "" "age at deterioration 26y; developmental delay, intellectual disability; progressive psychomotor slowing adolescence/adulthood; no Rett-like features; dystonia; Parkinsonism; l-DOPA responsive; limited expressive language; no sleep problems; staring, absence or atonic seizures; no ocular defects; T2 hypointense substantia nigra and globus pallidus (high iron); T1 hyperintense ‘halo’ midbrain; cerebral atrophy; no cerebellar atrophy" "" "" "" "" "" "" "" "" "" "neurodegeneration with brain iron accumulation" "" "0000229829" "05229" "00302747" "00006" "Isolated (sporadic)" "33y" "bedridden; psychomotor retardation; walk-3y; speech no word; nonprogressive cognitive dysfunction during childhood; 26y start cognitive decline; 4y until bedridden after decline; dystonia; rigidity, akinesia; adulthood progressive dementia; aggressive behaviors; epileptic seizure; MRI iron deposition globus pallidus, substantia nigra, central band of T1 hypointensity, 25y-moderate cerebral atrophy, 32y/33y-remarkable cerebral atrophy, no eye of the tiger sign, no white matter involvement, 25y/32y/33y-mild cerebellar atrophy, CT high density in globus pallidus; EEG bilateral frontal spike; visual evoked potential normal; auditory brainstem response low amplitude, normal latency" "" "" "psychomotor retardation" "" "" "" "" "" "NBIA5" "static encephalopathy of childhood with neurodegeneration in adulthood (SENDA)" "" "0000229830" "05229" "00302748" "00006" "Isolated (sporadic)" "28y" "wheelchair bound; psychomotor retardation; walk-2y7m; speech one word; nonprogressive cognitive dysfunction during childhood; 25y start cognitive decline; dystonia; rigidity, akinesia; adulthood progressive dementia; aggressive behaviors; epileptic seizure; MRI iron deposition globus pallidus, substantia nigra, central band of T1 hypointensity, 25y/27y-moderate cerebral atrophy, no eye of the tiger sign, no white matter involvement, 25y/27y-mild cerebellar atrophy, CT mild high density in substantia nigra; EEG bilateral frontal spike, low voltage, slow wave" "" "" "psychomotor retardation" "" "" "" "" "" "NBIA5" "static encephalopathy of childhood with neurodegeneration in adulthood (SENDA)" "" "0000229831" "05229" "00302749" "00006" "Isolated (sporadic)" "40y" "bedridden; psychomotor retardation; walk-2y2m; speech no word; nonprogressive cognitive dysfunction during childhood; 30y start cognitive decline; 3y until bedridden after decline; dystonia; rigidity; adulthood progressive dementia; no psychiatric symptoms; febrile seizure; MRI iron deposition globus pallidus, substantia nigra, central band of T1 hypointensity, 32y-moderate cerebral atrophy, 39y-remarkable cerebral atrophy, no eye of the tiger sign, no white matter involvement, 33y/39y-mild cerebellar atrophy, CT high density in substantia nigra; EEG low voltage; EMG dystonic pattern; evoked potential normal prolonged P100 latency; auditory brainstem response no response at 100 dB" "" "" "psychomotor retardation" "" "" "" "" "" "NBIA5" "static encephalopathy of childhood with neurodegeneration in adulthood (SENDA)" "" "0000229832" "05229" "00302750" "00006" "Isolated (sporadic)" "51y" "bedridden; psychomotor retardation; walk-1y6m; speech two-word sentences; nonprogressive cognitive dysfunction during childhood; 24y start cognitive decline; 1y until bedridden after decline; dystonia; rigidity; adulthood progressive dementia; no psychiatric symptoms; no epileptic seizure; MRI iron deposition globus pallidus, substantia nigra, central band of T1 hypointensity, 27y-moderate cerebral atrophy, 46y-remarkable cerebral atrophy, no eye of the tiger sign, no white matter involvement, 37y/46y-mild cerebellar atrophy, CT high density in ventral midbrain; EEG abnormal; EMG normal" "" "" "psychomotor retardation" "" "" "" "" "" "NBIA5" "static encephalopathy of childhood with neurodegeneration in adulthood (SENDA)" "" "0000229833" "05229" "00302751" "00006" "Isolated (sporadic)" "33y" "bedridden; psychomotor retardation; walk-1y6m; speech few words; nonprogressive cognitive dysfunction during childhood; 23y start cognitive decline; 1y until bedridden after decline; dystonia; rigidity, tremor, impairment of postural reflex; adulthood progressive dementia; anxiety; epileptic seizure; MRI iron deposition globus pallidus, substantia nigra, central band of T1 hypointensity, 33y-remarkable cerebral atrophy, no eye of the tiger sign, no white matter involvement, 33y-mild cerebellar atrophy, CT high density in globus pallidus; EEG abnormal; visual evoked potential normal" "" "" "psychomotor retardation" "" "" "" "" "" "NBIA5" "static encephalopathy of childhood with neurodegeneration in adulthood (SENDA)" "" "0000229834" "05229" "00302752" "00006" "Isolated (sporadic)" "4y" "age at deterioration 25y; developmental delay, intellectual disability; progressive psychomotor slowing adolescence/adulthood; Rett-like features; dystonia; Parkinsonism; l-DOPA responsive; limited expressive language; no sleep problems; EEG diffuse background slowing with bursts of generalized 3/s spike and wave discharges; staring, absence or atonic seizures; no ocular defects; T2 hypointense substantia nigra and globus pallidus (high iron); T1 hyperintense ‘halo’ midbrain; cerebral atrophy; no cerebellar atrophy" "" "" "" "" "" "" "" "" "NBIA5" "neurodegeneration with brain iron accumulation" "" "0000229835" "05229" "00302753" "00006" "Isolated (sporadic)" "27y" "age at deterioration 20y; 27y-deceased; developmental delay, intellectual disability; progressive psychomotor slowing adolescence/adulthood; no Rett-like features; dystonia; Parkinsonism; limited expressive language; no sleep problems; no epliepsy; no ocular defects; cerebral atrophy; no cerebellar atrophy; neuro-pathology" "" "" "" "" "" "" "" "" "NBIA5" "neurodegeneration with brain iron accumulation" "" "0000229836" "05229" "00302754" "00006" "Isolated (sporadic)" "31y" "see paper; ..., age at deterioration 29y; developmental delay, intellectual disability; progressive psychomotor slowing adolescence/adulthood; Rett-like features; dystonia; no Parkinsonism; limited expressive language; no sleep problems; febrile seizures; no ocular defects; T2 hypointense substantia nigra and globus pallidus (high iron); T1 hyperintense ‘halo’ midbrain; cerebral atrophy; cerebellar atrophy" "" "" "" "" "" "" "" "" "NBIA5" "neurodegeneration with brain iron accumulation" "" "0000229837" "05229" "00302755" "00006" "Isolated (sporadic)" "16y" "age at deterioration 15y; developmental delay, intellectual disability; progressive psychomotor slowing adolescence/adulthood; Rett-like features; dystonia; minimal Parkinsonism, only rigidity; limited expressive language; no sleep problems; staring, absence or atonic seizures; high myopia; T2 hypointense substantia nigra and globus pallidus (high iron); no T1 hyperintense ‘halo’ midbrain; cerebral atrophy; cerebellar atrophy" "" "" "" "" "" "" "" "" "NBIA5" "neurodegeneration with brain iron accumulation" "" "0000229838" "05229" "00302756" "00006" "Isolated (sporadic)" "33y" "see paper; ..., moderate intellectual disability; behavioural problems; nonprogressive cognitive dysfunction during childhood; 32y start of progressive cognitive decline; no psychopathology; wheelchair bound; speech single word; no myopia; dystonia; no Parkinsonism; EEG epileptic seizures focal in early infancy?; urinary incontinence; MRI brain iIron deposition globus pallidus, mesencephalic peduncles; MRI brain cerebral atrophy" "" "" "psychomotor retardation" "" "" "" "" "" "NBIA5" "neurodegeneration with brain iron accumulation" "" "0000229839" "05229" "00302757" "00006" "Isolated (sporadic)" "52y" "see paper; ..., severe intellectual disability; behavioural problems; nonprogressive cognitive dysfunction during childhood; 35y start of progressive cognitive decline; depressive symptoms in adulthood?; wheelchair bound; no speech; myopia; dystonia; Parkinsonism rigidity, tremor; EEG epileptic seizures absences, tonic-clonic, tonic (multiple spikes); urinary incontinence; MRI brain iIron deposition globus pallidus, substantia nigra, nucleus ruber; MRI brain cerebral atrophy" "" "" "psychomotor retardation" "" "" "" "" "" "NBIA5" "neurodegeneration with brain iron accumulation" "" "0000229840" "05229" "00302758" "00006" "Isolated (sporadic)" "42y" "see paper; ..., moderate intellectual disability; behavioural problems; nonprogressive cognitive dysfunction during childhood; 33y start of progressive cognitive decline; autistic features in early age; walking with support; speech few words; no myopia; dystonia; Parkinsonism rigidity; EEG no epileptic seizures; urinary incontinence; CT cerebral atrophy" "" "" "psychomotor retardation" "" "" "" "" "" "NBIA5" "neurodegeneration with brain iron accumulation" "" "0000229841" "05229" "00302759" "00006" "Isolated (sporadic)" "15y" "see paper; …" "" "" "" "" "" "" "" "" "NBIA5" "neurodegeneration with brain iron accumulation" "" "0000229842" "05229" "00302760" "00006" "Isolated (sporadic)" "14y" "see paper; …" "" "" "" "" "" "" "" "" "NBIA5" "Rett syndrome" "" "0000229843" "05229" "00302761" "00006" "Isolated (sporadic)" "31y" "see paper; …" "" "" "" "" "" "" "" "" "NBIA5" "severe dystonia-parkinsonism." "" "0000229844" "05229" "00302762" "00006" "Isolated (sporadic)" "39y" "see paper; …" "" "" "" "" "" "" "" "" "NBIA5" "tatic encephalopathy of childhood with neurodegeneration in adulthood" "" "0000229845" "05229" "00302763" "00006" "Isolated (sporadic)" "6y" "see paper; ..., peculiar facial appearance, mildly elevated serum enzymes, MRI brain iron accumulation" "" "" "" "" "" "" "" "" "NBIA5" "Rett syndrome-like" "" "0000229846" "05229" "00302764" "00006" "Isolated (sporadic)" "25y" "see paper; ..., significant developmental delay in early childhood, severe intellectual disability, neurodegeneration with progressive dystonia and dementia in third decade; MRI brain low signal substantia nigra and both globus pallidi on T2-weighted imaging, no eye-of-the-tiger sign; computed tomography bilateral dense calcification globus pallidus" "" "" "" "" "" "" "" "" "NBIA5" "intellectual disability" "" "0000229870" "00139" "00302788" "00006" "Isolated (sporadic)" "3y" "severe intellectual disability; no speech; not walking; no epilepsy; autistic features; no microcephaly, decelerating head growth; no macrocephaly; MRI brain normal; mild spasticity; no congenitial malformations; no cardiac malformations; no urogenitory abnormalities" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000229891" "05229" "00302809" "00006" "Familial, autosomal recessive" "83y" "see paper; ..., severe global developmental delay in early infancy, expressive speech disorder, generalized seizures, hypertonia, secondary worsening, 27y-progressive gait disturbance, MRI brain hypointensities of globus pallidus in T2-weighed" "" "" "" "" "" "" "" "" "NBIA5" "global developmental delay" "" "0000229892" "00198" "00302810" "00006" "Unknown" "11y" "see paper; ..." "" "" "" "" "" "" "" "" "" "developmental delay" "" "0000229893" "05229" "00302811" "00006" "Isolated (sporadic)" "51y" "see paper; ..." "" "" "" "" "" "" "" "" "NBIA5" "learning difficulties" "" "0000229894" "05229" "00302812" "00006" "Isolated (sporadic)" "00y19m" "see paper; ..." "" "" "epileptic spasms associated with focal seizures" "" "" "" "" "" "NBIA5" "early-onset epileptic encephalopathy" "" "0000229895" "05229" "00302813" "00006" "Isolated (sporadic)" "30y" "walk-3y; febrile convulsion at infant; no speech; cognitive dysfunction during childhood; developmental delay, intellectual disability; wheelchair bound; cognitive dysfunction; 29y-Parkinsonism, rigidity, no tremor; postural abnormality; dystonia; increasing deep tendon reflex; appearances of pathologic reflex; progressive dementia during adulthood; no psychiatric symptoms; epileptic seizure; good Levodopa responsive; Levodopa-induced dyskinesia; no RETT-like features; no sleep problems; no ocular defects" "" "" "cognitive dysfunction" "" "" "" "" "" "NBIA5" "neurodegeneration with brain iron accumulation" "" "0000229896" "05229" "00302814" "00006" "Isolated (sporadic)" "37y" "walk-17m; febrile convulsion at infant; no speech; cognitive dysfunction during childhood; developmental delay, intellectual disability; wheelchair bound; cognitive dysfunction; 30y-Parkinsonism, rigidity, no tremor; no postural abnormality; dystonia; increasing deep tendon reflex; appearances of pathologic reflex; progressive dementia during adulthood; no psychiatric symptoms; epileptic seizure; good Levodopa responsive; Levodopa-induced dyskinesia; no RETT-like features; sleep problems; ocular defects; EEG abnormal; MRI brain T2 hypointense substantia nigra and globus pallidus (high iron), T1 hyperintense ‘halo’ in midbrain, no eye-of-the-tiger sign, no white matter involvement, diffuse cerebral atrophy, no cerebellar atrophy" "" "" "cognitive dysfunction" "" "" "" "" "" "NBIA5" "neurodegeneration with brain iron accumulation" "" "0000229897" "05229" "00302815" "00006" "Isolated (sporadic)" "36y" "walk-18m; febrile convulsion at infant; speech few words; cognitive dysfunction during childhood; developmental delay, intellectual disability; gait possible; cognitive dysfunction; 32y-Parkinsonism, rigidity, no tremor; postural abnormality; no dystonia; no increasing deep tendon reflex; appearances of pathologic reflex; progressive dementia during adulthood; no psychiatric symptoms; epileptic seizure; good Levodopa responsive; Levodopa-induced dyskinesia; no RETT-like features; no sleep problems; no ocular defects; EEG abnormal; MRI brain T2 hypointense substantia nigra and globus pallidus (high iron), T1 hyperintense ‘halo’ in midbrain, no eye-of-the-tiger sign, no white matter involvement, diffuse cerebral atrophy temporal (lt > rt), no cerebellar atrophy, SPECT hypoperfusion left frontotemporal, no MIBG myocardial scintigraphy washout" "" "" "cognitive dysfunction" "" "" "" "" "" "NBIA5" "neurodegeneration with brain iron accumulation" "" "0000229898" "05229" "00302816" "00006" "Isolated (sporadic)" "33y" "walk-2y; febrile convulsion at infant; no speech; cognitive dysfunction during childhood; developmental delay, intellectual disability; wheelchair bound; cognitive dysfunction; 32y-Parkinsonism, rigidity, no tremor; postural abnormality; no dystonia; increasing deep tendon reflex; no appearances of pathologic reflex; progressive dementia during adulthood; no psychiatric symptoms; epileptic seizure; excellent Levodopa responsive; no Levodopa-induced dyskinesia; no RETT-like features; no sleep problems; no ocular defects; EEG normal; MRI brain T2 hypointense substantia nigra and globus pallidus (high iron), T1 hyperintense ‘halo’ in midbrain, no eye-of-the-tiger sign, no white matter involvement, diffuse cerebral atrophy (rt < lt), no cerebellar atrophy" "" "" "cognitive dysfunction" "" "" "" "" "" "NBIA5" "neurodegeneration with brain iron accumulation" "" "0000229899" "05229" "00302817" "00006" "Isolated (sporadic)" "35y" "febrile convulsion at infant; no speech; cognitive dysfunction during childhood; developmental delay, intellectual disability; wheelchair bound; cognitive dysfunction; 34y-Parkinsonism, rigidity, tremor; postural abnormality; no dystonia; no increasing deep tendon reflex; appearances of pathologic reflex; progressive dementia during adulthood; no psychiatric symptoms; no epileptic seizure; good Levodopa responsive; no Levodopa-induced dyskinesia; no RETT-like features; no sleep problems; no ocular defects; MRI brain T2 hypointense substantia nigra and globus pallidus (high iron), T1 hyperintense ‘halo’ in midbrain, no eye-of-the-tiger sign, no white matter involvement, diffuse cerebral atrophy, no cerebellar atrophy" "" "" "cognitive dysfunction" "" "" "" "" "" "NBIA5" "neurodegeneration with brain iron accumulation" "" "0000229900" "05229" "00302818" "00006" "Isolated (sporadic)" "33y" "walk-15m; no febrile convulsion at infant; no speech; cognitive dysfunction during childhood; developmental delay, intellectual disability; gait possible; cognitive dysfunction; 28y-Parkinsonism, rigidity, tremor; postural abnormality; dystonia; no increasing deep tendon reflex; appearances of pathologic reflex; progressive dementia during adulthood; no psychiatric symptoms; no epileptic seizure; excellent Levodopa responsive; Levodopa-induced dyskinesia; no RETT-like features; sleep problems; no ocular defects; EEG abnormal; MRI brain T2 hypointense substantia nigra and globus pallidus (high iron), T1 hyperintense ‘halo’ in midbrain, no eye-of-the-tiger sign, no white matter involvement, cerebral atrophy hemisphere (rt > lt), cerebellar atrophy, SPECT hypoperfusion rigth hemisphere, no MIBG myocardial scintigraphy washout" "" "" "cognitive dysfunction" "" "" "" "" "" "NBIA5" "neurodegeneration with brain iron accumulation" "" "0000229901" "05229" "00302819" "00006" "Isolated (sporadic)" "41y" "walk-14m; febrile convulsion at infant; speech dysarthria, small voice; cognitive dysfunction during childhood; developmental delay, intellectual disability; gait possible; cognitive dysfunction; 39y-Parkinsonism, rigidity, no tremor; no postural abnormality; no dystonia; increasing deep tendon reflex; progressive dementia during adulthood; progressive dementia during adulthood; no psychiatric symptoms; no epileptic seizure; excellent Levodopa responsive; no Levodopa-induced dyskinesia; no RETT-like features; no sleep problems; no ocular defects; EEG normal; MRI brain T2 hypointense substantia nigra and globus pallidus (high iron), T1 hyperintense ‘halo’ in midbrain, no eye-of-the-tiger sign, no white matter involvement, no cerebral atrophy, no cerebellar atrophy, SPECT hypoperfusion occipital, no MIBG myocardial scintigraphy washout" "" "" "cognitive dysfunction" "" "" "" "" "" "NBIA5" "neurodegeneration with brain iron accumulation" "" "0000229902" "05229" "00302820" "00006" "Isolated (sporadic)" "38y" "see paper; …" "" "" "" "" "" "" "" "" "NBIA5" "neurodegeneration with brain iron accumulation" "" "0000229903" "05229" "00302821" "00006" "Isolated (sporadic)" "18y" "see paper; ..., mild speech development issue, cognitive difficulties" "" "" "" "" "" "" "" "" "NBIA5" "neurodegeneration with brain iron accumulation" "" "0000229904" "05229" "00302822" "00006" "Isolated (sporadic)" "03y" "see paper; ..., severe developmental delay, characteristic facial features, chronic elevation of serum aspartate transaminase, lactate dehydrogenase, creatine kinase, and soluble interleukin‐2 receptor, persistent elevation of neuron specific enolase (NSE) in serum and cerebrospinal fluid; MRI brain using susceptibility‐weighted imaging (SWI) demonstrated iron accumulation in the GP and SN bilaterally" "" "" "" "" "" "" "" "" "NBIA5" "severe developmental delay" "" "0000229907" "05229" "00302825" "00006" "Familial, autosomal dominant" "" "see paper; ..., profound neurocognitive impairment, seizure" "" "" "" "" "" "" "" "" "NBIA5" "neurodegeneration with brain iron accumulation" "" "0000229908" "05229" "00302826" "00006" "Isolated (sporadic)" "06y" "see paper; ..., 3m-focal‐onset seizure" "00y03m" "" "focal‐onset seizure" "" "" "" "" "" "NBIA5" "neurodegeneration with brain iron accumulation" "" "0000229909" "05229" "00302827" "00006" "Isolated (sporadic)" "05y" "see paper; ..., developmental delay, microcephaly, seizures, stereotypic hand movements" "" "" "" "" "" "" "" "" "NBIA5" "Rett-like syndrome" "" "0000229910" "05229" "00302828" "00006" "Isolated (sporadic)" "42y" "see paper; ..., early childhood global developmental delay, frequently sucked hand; 6m-febrile convulsion, no history of epilepsy; delay in language development more severe than delay in motor development; able to dress, walk unaided, follow simple instructions until adolescence; after 20y movement ability rapidly declined; 42y-bedridden, unable to communicateMRI brain 21y-no abnormality except non-specific cerebral atrophy, 39y-abnormalities globus pallidus and substantia nigra, with neurodegeneration and iron accumulation brain" "" "" "" "" "" "" "" "" "NBIA5" "Rett-like syndrome" "" "0000229911" "05229" "00302829" "00006" "Isolated (sporadic)" "02y" "see paper; ..." "" "" "2m" "" "" "" "" "" "NBIA5" "severe infantile male encephalopathy" "" "0000229912" "05229" "00302830" "00006" "Isolated (sporadic)" "34y" "see paper; ..., global developmental delay" "02y" "" "" "" "" "" "" "" "NBIA5" "global developmental delay" "" "0000229913" "05229" "00302832" "00006" "Isolated (sporadic)" "08y" "see paper; ..." "" "" "" "" "" "" "" "" "NBIA5" "" "" "0000229914" "05229" "00302833" "00006" "Isolated (sporadic)" "" "see paper; ..., encephalopathy, severe psychomotor disability, epilepsy" "" "" "" "" "" "" "" "" "NBIA5" "" "" "0000229916" "05229" "00302835" "00006" "Isolated (sporadic)" "04y" "see paper; ..., 3y10m-onset infantile spasms, developmental delay, intellectual disability, no speech, walk alone, MRI brain atrophy, myelination delay, iron deposition" "" "" "" "" "" "" "" "" "NBIA5" "" "" "0000229917" "05229" "00302836" "00006" "Isolated (sporadic)" "33y" "see paper; ..., gait disturbance, spontaneous drops without adverse-effects reflexes, resulting in injuries face and teeth, Parkinsonian gait with short and shuffling steps, body rotation impaired, increasing oral motor dysfunction with dysphagia" "" "" "" "" "" "" "" "" "NBIA5" "" "" "0000229918" "05229" "00302837" "00006" "Isolated (sporadic)" "04y" "see paper; ..., profound developmental delay, intellectual disability, non-syndromic epileptic encephalopathy, early brain atrophy, no speech, bedridden, no sleep disturbance, age at regression 1y4m, no Rett-like features, spasticity quadriparesis, hypotonia, no extrapyramidal signs, optic disc atrophy, no microcephaly, 14m-epilepsy, MRI brain atrophy, no myelination delay, 3y-no iron deposition T2WI" "" "" "" "" "" "" "" "" "NBIA5" "developmental delay" "" "0000229919" "05229" "00302838" "00006" "Isolated (sporadic)" "36y" "see paper; ..., stable intellectual disability, hypo-bradykinetic and hypertonic syndrome with juvenile onset" "" "" "" "" "" "" "" "" "NBIA5" "" "" "0000229920" "05229" "00302839" "00006" "Isolated (sporadic)" "40y" "see paper; ..., slowly progressing Parkinsonism in adulthood, epilepsy, intellectual disability in childhood; MRI brain T2‐weighted low signal intensity areas globus pallidus and substantia nigra, T1‐weighted imaging halo in nigra" "" "" "" "" "" "" "" "" "NBIA5" "slowly progressing parkinsonism" "" "0000229921" "05229" "00302840" "00006" "Isolated (sporadic)" "" "see paper; ..., developmental delay, autism" "" "" "" "" "" "" "" "" "NBIA5" "Rett-like syndrome" "" "0000229923" "05229" "00302842" "00006" "Isolated (sporadic)" "30y" "see paper; ..." "" "" "" "" "" "" "" "" "NBIA5" "delayed psychomotor development" "" "0000229930" "05229" "00302849" "00006" "Isolated (sporadic)" "06y" "see paper; ..., classic Rett syndrome, early motor development normal, sit-7m, walk-24m, no speech development, microcephaly; 24m-bruxism, stereotypic movements; 36m-epileptic seizures" "" "" "" "" "" "" "" "" "NBIA5" "Rett-like syndrome" "" "0000229934" "00198" "00302853" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Rett-like syndrome" "" "0000229935" "05229" "00302854" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "NBIA5" "" "" "0000229948" "05229" "00302870" "00006" "Isolated (sporadic)" "8y" "delayed development prior to seizure onset, fixed and followed by 6w, never rolled over, never sat, non-ambulatory; 7m-onset infantile spasms (18m-ceased, 5y-recurred); profound intellectual disability, non-verba, regression with seizure onset: stopped smiling, reduced eye contact; myo conic seizures (onset uncertain, by 15m), absence seizures, tonic seizures, focal impaired awareness seizures (onset 5y); seizure offset 6y10m following bilateral femoral osteotomy; EEG-posterior quadrant epileptiform discharges evolving to abundant posterior spike-wave discharges, polyspike wave and low voltage paroxysmal fast activity L>R, multifocal epileptiform activity, diffuse background slowing, spasms associated with bilateral slow & fast paroxysms (10m and 15m), tonic seizures lasting 2–40 seconds associated with low voltage fast activity R>L, myolconic jerks in sleep associated with polyspike wave;1y4m: large ventricles especially frontal horns, small incompletely rotated hippocampi, thin corpus callosum, decreased white matter volume, delayed myelination (approx 9m), large extra axial spaces; MRI brain 4y1m larger ventricles, round hippocampi, no internal architecture in hippocampi, bright on T2 and improved rotation, very thin corpus callosum, decreased white matter volume and very delayed myelination, blooming in cerebral peduncles and both globus pallidi, FDG-PET 2y4m-extensive bilateral frontal cortical hypometabolism L>R; profound myopia, cortical visual impairment, asymmetric spastic quadriparesis, dislocated left hip, kyphosis, scoliosis, no dysmorphic or behavioral features" "" "" "" "" "" "" "" "" "NBIA5" "infantile spasms evolving to Lennox-Gastaut syndrome" "" "0000229949" "05229" "00302871" "00006" "Isolated (sporadic)" "7y" "delayed development prior to onset seizures, sat with support 6–8m, “babbling”, sit-16m; onset seizures 16m tonic seizures; development after onset seizures profound intellectual disability, no speech, non-ambulatory, cannot sit, regression with seizure onset, lost ability to sit, roll over, “babble”, use a fork; myoclonic (onset 18m), focal impaired, awareness seizures (onset 3.5y), absence seizures (onset 4.5y), focal impaired awareness seizures evolving to bilateral tonic-clonic seizures (3y 10m); seizure offset ongoing; EEG occipital slowing and sharp waves evolving to generalized spike-wave in sleep followed by decrements, fast activity in wakefulness, then posterior predominant slow spike and wave, polyspike wave and paroxysmal fast activity in sleep, tonic seizures associated with diffuse fast activity and bilateral paroxysmal fast activity; MRI brain 1y2m-large ventricles especially frontal horns, very thin corpus callosum, decreased white matter volume and delayed myelination, 1y11m-large ventricles especially frontal horns, round hippocampi but no internal architecture, thin corpus callosum, decreased white matter volume and severe myelination delay, large extra axial cerebrospinal fluid spaces; peripheral spasticity, no behavioral features, brachycephaly" "" "" "" "" "" "" "" "" "NBIA5" "Lennox-Gastaut syndrome" "" "0000229950" "05229" "00302872" "00006" "Isolated (sporadic)" "11y" "development delayed priot to seizure onset, speech acquisition; seizure onset 12m myoclonic; development after onset seizures severe intellectual disability, 18m-single words, 9y-rare word combinations, currently 20 single words, follows simple commands, regression with frequent seizures, loss of speech, less response to painful stimuli; febrile non-convulsive status epilepticus (14m), focal impaired awareness seizures with clonic component, seizure offset 10.5y; EEG-frequent irregular generalized spike-wave, background slowing with occipital predominance, myoclonic jerks associated with irregular generalized spike-wave, staring episodes with irregular generalized spike-wave with variable lead from central and posterior regions, focal clonic seizures emanating from L or R central region; MRI brain 9y4m-mild ventriculomegaly, thin corpus callosum in posterior body and splenium, subtle white matter volume reduction, normal myelination, SWI blooming in cerebral peduncles and globus pallidi, 10y5m:-mild subtle white matter volume reduction, normal myelination; sleep disturbance, dental issues, oro-motor apraxia, moderate pes planus, peripheral hypotonia, intoeing with wide-based gait, poor coordination, high pain threshold, seizure trigger: fever, head flexion, aggression, broad nasal bridge, hypertelorism, mild facial asymmetry" "" "" "" "" "" "" "" "" "NBIA5" "developmental and epileptic encephalopathy" "" "0000229951" "05229" "00302873" "00006" "Isolated (sporadic)" "2y" "delayed development prior to seizure onset, rolled over=5m, sat-10m; seizure onset 8m infantile spasms; delayed development after seizure onset, no speech, pulls to stand, cruising, eats with spoon, no regression; focal impaired awareness seizures (9m), infantile spasms with head deviation to L (16m); seizure offset ongoing; EEG-8m modified hypsarrhythmia, 9m-bi-temporal epileptiform activity during sleep, hypsarrhythmia resolved, from 10m-multifocal epileptiform activity, generalized spike-wave; MRI brain 7m-prominence of ventricles and extra axial cerebrospinal fluid spaces, incomplete rotation of L hippocampi, generally thin corpus callosum, normal white matter volume and myelination; hypertension (frusemide 1mg/kg daily), diarrhoea, no behavioral features, cushingoid features" "" "" "" "" "" "" "" "" "NBIA5" "infantile spasms" "" "0000229952" "05229" "00302874" "00006" "Isolated (sporadic)" "7y" "delayed development prior to seizure onset, smiling; seizure onset 17m, febrile seizure; after seizure onset severe intellectual disability, few single words, walks independently, regression with seizure onset loss of speech; atonic seizures (onset 24m), myoclonic (onset uncertain), non-convulsive status epilepticus (onset 2y10m), atypical absence seizures (onset 27m), seizure offset 5y, rare febrile tonic-clonic seizures from 4y2m; EEG generalized spike-wave, polyspike wave, biposterior quadrant epileptiform activity R>L, slow background, atypical absence seizure with 1.5–2.5 Hz generalized spike-wave; MRI brain 23m-normal, 5y-mild cerebellar atrophy, mild reduction in white matter volume; Genua valgum (knock knees), no dysmorphic or behavioral features" "" "" "" "" "" "" "" "" "NBIA5" "myoclonic-atonic seizures" "" "0000229953" "05229" "00302875" "00006" "Isolated (sporadic)" "4y" "development prior to seizure onset delayed speech acquisition, no spontaneous speech, could repeat and imitate intonation and speech sounds at 12m; 12m- onset seizures, focal seizure with fever; after seizure onset severe intellectual disability, few single words, walks independently, regression with seizure onset: loss of “babble”; febrile focal impaired awareness seizures (onset 1y); seizure offset 3y; EEG no definite epileptiform discharges, background slowing; MRI brain 1y6m-thin corpus callosum, normal white matter volume and myelination, 3y6m-mild cerebellar atrophy of superior vermis, prominent ventricles, extra axial cerebrospinal fluid spaces, thin corpus callosum, mild reduction in white matter, myelination normal; sleep disturbance, no dysmorphic or behavioral features" "" "" "" "" "" "" "" "" "NBIA5" "focal seizures with fever" "" "0000229954" "05229" "00302876" "00006" "Isolated (sporadic)" "3y" "delayed development prior to seizure onset, sat-2.5y, no speech, standing with support, not walking; onset seizures 36m, drop attacks, severe intellectual disability, walks with assistance, reaches for spoon; focal impaired awareness seizures; seizure offset ongoing; EEG diffuse moderate background slowing, multifocal discharges, generalized spike-wave, generalised paroxysmal fast activity; MRI brain normal; episodes of hyperventilation, severe autistic behavior, no dysmorphic features" "" "" "" "" "" "" "" "" "NBIA5" "developmental and epileptic encephalopathy" "" "0000229955" "05229" "00302877" "00006" "Isolated (sporadic)" "" "see paper; ..., 6m-onset seizures, spasms; EEG-14m hypsarrhythmia, high-amplitude slow waves and multifocal spikes; no neurological findings; intellectual disability; bed-ridden, no speech; MRI brain no iron deposition, cerebral atrophy, subdural hematoma" "" "21m" "" "" "" "" "" "" "NBIA5" "West syndrome" "" "0000229956" "05229" "00302878" "00006" "Isolated (sporadic)" "" "see paper; ..., 5m-onset seizures, spasms; EEG-19m hypsarrhythmia, high-amplitude slow waves and multifocal spikes; no neurological findings; intellectual disability; bed-ridden, no speech; MRI brain no iron deposition, cerebral atrophy, delayed myelination" "" "27" "" "" "" "" "" "" "NBIA5" "West syndrome" "" "0000229957" "05229" "00302879" "00006" "Isolated (sporadic)" "" "see paper; ..., 5m-onset seizures, spasms > tonic seizures; EEG hypsarrhythmia; hypotonia; intellectual disability; bed-ridden, no speech; MRI brain susceptibility-weighted imaging iron deposition, cerebral atrophy, delayed myelination, cerebellar atrophy" "" "7y" "" "" "" "" "" "" "NBIA5" "West syndrome" "" "0000229959" "05229" "00302881" "00006" "Isolated (sporadic)" "" "see paper; ..., intellectual disability, epilepsy, microcephaly, hypotonia, spasticity" "" "" "" "" "" "" "" "" "NBIA5" "intellectual disability, RETT-like syndrome" "" "0000229966" "05229" "00302888" "00006" "Isolated (sporadic)" "22y" "see paper; ..." "" "" "" "" "" "" "" "" "NBIA5" "developmental delay" "" "0000229971" "05229" "00302892" "00006" "Isolated (sporadic)" "01y10m" "see paper; ..." "" "" "" "" "" "" "" "" "NBIA5" "developmental delay" "" "0000229972" "05229" "00302894" "00006" "Isolated (sporadic)" "02y02m" "head control-3m, sit-6m, unable tostand up, unable to walk without assistance, speech not acquired meaningful words; 10m-initial episode of status epilepticus associated with pyrexia, EEG normal, CTbrain normal; multiple episodes occurred, 2y2m-status epilepticus induced by pyrexia, flu test negative, MRI brain hypointensity to isointensity on T1-weighted images, hyperintensity on T2-weighted images, swelling globus pallidus and substantia nigra, QSM showed increased magnetic susceptibility globus pallidus (381 ppb) and substantia nigra (425 ppb)" "" "" "" "" "" "" "" "" "NBIA5" "developmental delay" "" "0000229973" "05229" "00302895" "00006" "Isolated (sporadic)" "29y" "see paper; ..., 13m-seizures associated with fever and urinary tract infections" "00y13m" "" "seizures" "" "" "" "" "" "NBIA5" "Rett-like syndrome" "" "0000229974" "05229" "00302896" "00006" "Isolated (sporadic)" "" "walk unsteadily-22m to 3y; speech single word; no dystonia; epileptic seizure; cognitive dysfunction; MRI brain reduced cerebral white matter, thin corpus callosum, clear gray matter boundaries, cerebral lateral ventricle expanded, SWI hypointensity in bilateral globus pallidus and brainstem ventral side, SEEG/VEEG wide spike wave, sharp wave, spine slow wave; milk allergy, thrombocytopenia, atelencephalia, developmental delay" "00y19m" "" "19m upper limbs jittered repeatedly" "" "" "" "" "" "NBIA5" "developmental delay" "" "0000229975" "05229" "00302898" "00006" "Isolated (sporadic)" "" "walking-15m; speech slower than peers; no dystonia; epileptic seizure; cognitive dysfunction; MRI brain normal cerebral white matter, normal corpus callosum, clear gray matter boundaries, normal cerebral ventricle, abnormal SEEG/VEEG; developmental delay" "15m" "" "15m febrile seizures" "" "" "" "" "" "NBIA5" "developmental dealy" "" "0000229976" "05229" "00302899" "00006" "Isolated (sporadic)" "" "walk unsteadily-3y; 3y-speech “baba”, “mama”; no dystonia; epileptic seizure; cognitive dysfunction; MRI brain reduced cerebral white matter, thin corpus callosum, clear gray matter boundaries, cerebral lateral ventricle expanded, SWI hypointensity in bilateral globus pallidus and brainstem ventral side, SEEG/VEEG epilepsy discharge; obesity, low hairline, atelencephalia, developmental delay, autism" "26m" "" "26m febrile seizures" "" "" "" "" "" "NBIA5" "developmental dealy" "" "0000229977" "05229" "00302900" "00006" "Isolated (sporadic)" "" "not walking; no speech; no dystonia; epileptic seizure; cognitive dysfunction; MRI brain reduced cerebral white matter, thin corpus callosum, clear gray matter boundaries, cerebral lateral ventricle and the third ventricle expanded, SWI hyperintensity in bilateral globus pallidus, abnormal SEEG/VEEG; atelencephalia, developmental delay" "10m" "" "10m-developmental delay, 2y-seizures" "" "" "" "" "" "NBIA5" "developmental dealy" "" "0000229978" "05229" "00302901" "00006" "Isolated (sporadic)" "" "not walking; speech just “yi ya”; hypertonia; epileptic seizure; cognitive dysfunction; MRI brain reduced cerebral white matter, thin corpus callosum, clear gray matter boundaries, cerebral lateral ventricle expanded, abnormal SEEG/VEEG; atelencephalia, developmental delay" "10m" "" "10m-spasm" "" "" "" "" "" "NBIA5" "developmental dealy" "" "0000229980" "05229" "00302902" "00006" "Isolated (sporadic)" "09y" "see paper; ..." "" "" "" "" "" "" "" "" "NBIA5" "global developmental delay" "" "0000229981" "05229" "00302903" "00006" "Isolated (sporadic)" "20y" "global developmental delay all motor and cognitive milestones; walk-3y, impaired comprehension, speech only single words; fine motor skills impaired, gait unstable with recurrent falls; 1y-febrile seizures with recurrent epileptic discharges in EEG recordings until 16y; 20y-mental retardation, autistic features, hand-clapping stereotypies, vertical supranuclear gaze palsy, generalized axial more than appendicular bradykinesia, generalized dystonia with involvement arms, legs and trunk, mild spasticity legs; gait slow with small steps not shuffling, walked with both feet slightly plantar-flexed and right foot also everted, when walking trunk flexed by 20degrees and slightly tilted to left" "" "" "" "" "" "" "" "" "NBIA5" "global developmental delay" "" "0000229982" "05229" "00302904" "00006" "Isolated (sporadic)" "24y" "see paper; …" "" "" "" "" "" "" "" "" "NBIA5" "developmental dealy" "" "0000229983" "05229" "00302905" "00006" "Isolated (sporadic)" "39y" "see paper; …" "" "" "" "" "" "" "" "" "NBIA5" "developmental dealy" "" "0000229984" "05229" "00302906" "00006" "Isolated (sporadic)" "22y" "see paper; …" "" "" "" "" "" "" "" "" "NBIA5" "developmental dealy" "" "0000229985" "05229" "00302907" "00006" "Isolated (sporadic)" "00y09m" "see paper; ..., 3m-epileptic spasm bilateral eye gazing toward right or left with head deviation, followed by generalized tonic-clonic seizures lasting several minutes occurring in clusters of 2-4 per day with approximately four spams per cluster" "00y03m" "" "epileptic spasm" "" "" "" "" "" "NBIA5" "epileptic spasm" "" "0000229986" "05229" "00302908" "00006" "Isolated (sporadic)" "6y6m" "see paper; …" "" "" "" "" "" "" "" "" "NBIA5" "developmental dealy" "" "0000229987" "05229" "00302909" "00006" "Isolated (sporadic)" "1y7m" "see paper; …" "" "" "" "" "" "" "" "" "NBIA5" "developmental dealy" "" "0000229988" "05229" "00302910" "00006" "Isolated (sporadic)" "7y8m" "see paper; …" "" "" "" "" "" "" "" "" "NBIA5" "developmental dealy" "" "0000229989" "05229" "00302911" "00006" "Isolated (sporadic)" "3y9m" "see paper; …" "" "" "" "" "" "" "" "" "NBIA5" "developmental dealy" "" "0000230006" "05229" "00302922" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "NBIA5" "" "" "0000230007" "05229" "00302923" "00006" "Isolated (sporadic)" "10y" "see paper; ..., profound developmental delay, spastic quadriparesis, intractable epilepsy with tonic and atypical absence seizures" "00y09m" "" "" "" "" "" "" "" "NBIA5" "developmental delay" "" "0000230008" "05229" "00302924" "00006" "Isolated (sporadic)" "13y" "see paper; ..." "" "" "" "" "" "" "" "" "NBIA5" "epileptic spasms" "" "0000230009" "05229" "00302925" "00006" "Isolated (sporadic)" "03y" "see paper; ..., epilepsy, growth retardation, autism, 7m/12m-tonic seizures, 16m-continual seizures, 7m/12m-EEG normal, 7m/12m/35m-MRI brain normal" "" "" "" "" "" "" "" "" "NBIA5" "epilepsy" "" "0000230010" "05229" "00302926" "00006" "Isolated (sporadic)" "31y" "see paper; ..., 9y-intellectual disability; 31y-left dominant progressive parkinsonism; MRI brain T1-weighted signal hyperintensity substantia nigra with central band of hypointensity, T2 star weighted image hypointensity substantia nigra and globus pallidus presenting dominant at right side" "" "" "" "" "" "" "" "" "NBIA5" "intellectual disability" "" "0000230011" "05229" "00302927" "00006" "Isolated (sporadic)" "" "see paper; …" "" "" "" "" "" "" "" "" "NBIA5" "developmental delay" "" "0000230012" "05229" "00302928" "00006" "Isolated (sporadic)" "" "see paper; …" "" "" "" "" "" "" "" "" "NBIA5" "developmental delay" "" "0000230013" "05229" "00302929" "00006" "Isolated (sporadic)" "" "see paper; …" "" "" "" "" "" "" "" "" "NBIA5" "developmental delay" "" "0000230014" "05229" "00302930" "00006" "Isolated (sporadic)" "" "see paper; …" "" "" "" "" "" "" "" "" "NBIA5" "developmental delay" "" "0000230015" "05229" "00302931" "00006" "Isolated (sporadic)" "" "see paper; …" "" "" "" "" "" "" "" "" "NBIA5" "developmental delay" "" "0000230016" "05229" "00302932" "00006" "Isolated (sporadic)" "" "see paper; …" "" "" "" "" "" "" "" "" "NBIA5" "developmental delay" "" "0000230017" "05229" "00302933" "00006" "Isolated (sporadic)" "" "see paper; …" "" "" "" "" "" "" "" "" "NBIA5" "developmental delay" "" "0000230018" "05229" "00302934" "00006" "Isolated (sporadic)" "" "see paper; …" "" "" "" "" "" "" "" "" "NBIA5" "developmental delay" "" "0000230019" "05229" "00302935" "00006" "Isolated (sporadic)" "" "see paper; …" "" "" "" "" "" "" "" "" "NBIA5" "developmental delay" "" "0000230020" "05229" "00302936" "00006" "Isolated (sporadic)" "" "see paper; …" "" "" "" "" "" "" "" "" "NBIA5" "developmental delay" "" "0000230021" "05229" "00302937" "00006" "Isolated (sporadic)" "" "see paper; …" "" "" "" "" "" "" "" "" "NBIA5" "developmental delay" "" "0000230022" "05229" "00302938" "00006" "Isolated (sporadic)" "" "see paper; …" "" "" "" "" "" "" "" "" "NBIA5" "developmental delay" "" "0000230023" "05229" "00302939" "00006" "Isolated (sporadic)" "" "see paper; …" "" "" "" "" "" "" "" "" "NBIA5" "developmental delay" "" "0000230024" "05229" "00302940" "00006" "Isolated (sporadic)" "" "see paper; …" "" "" "" "" "" "" "" "" "NBIA5" "developmental delay" "" "0000230025" "05229" "00302941" "00006" "Isolated (sporadic)" "" "see paper; …" "" "" "" "" "" "" "" "" "NBIA5" "developmental delay" "" "0000230026" "05229" "00302942" "00006" "Isolated (sporadic)" "" "see paper; …" "" "" "" "" "" "" "" "" "NBIA5" "developmental delay" "" "0000230027" "05229" "00302943" "00006" "Isolated (sporadic)" "" "see paper; …" "" "" "" "" "" "" "" "" "NBIA5" "developmental delay" "" "0000230028" "05229" "00302944" "00006" "Isolated (sporadic)" "33y" "see paper; ..., rapid motor deterioration" "" "" "" "" "" "" "" "" "NBIA5" "rapid motor deterioration" "" "0000230032" "00139" "00302948" "00006" "Isolated (sporadic)" "" "see paper; ..., severe intellectual disability, progressive spasticity, short stature (29y-145 cm)" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000230111" "05521" "00303028" "00006" "Isolated (sporadic)" "" "Generalized epilepsy, infantile onset; age onset infantile" "" "" "" "" "" "" "" "" "" "seizures" "" "0000230139" "05521" "00303056" "00006" "Isolated (sporadic)" "" "Focal epilepsy, unclassified; age onset unknown" "" "" "" "" "" "" "" "" "" "seizures" "" "0000230174" "03237" "00303090" "00006" "-" "" "7m-vomiting, bruising, pallor" "" "" "" "" "" "" "" "" "" "acute lymphoid leukemia" "" "0000269745" "00198" "00374535" "00006" "Familial, X-linked" "" "Seizures, slurred speech and progressive abnormal behaviour. MRI was suggestive of NBIA" "" "" "" "" "" "" "" "" "" "epilepsy" "" "0000270864" "00198" "00375651" "00006" "Isolated (sporadic)" "" "intellectual disability/developmental delay; microcephaly; seizures; hypotonia; MRI brain delayed myelination, thin corpus callosum, basal ganglia and thalamus signal changes, cerebellum dentate nuclei signal changes" "" "14y" "" "" "" "" "" "" "" "" "" "0000272317" "01155" "00377154" "01164" "Unknown" "" "Focal epilepsy, generalized developmental delay, blood-liquor-glucose ratio 0, 46" "" "" "" "" "" "" "" "" "9month" "" "" "0000301982" "05517" "00409867" "03322" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "SEMDG" "NANS-CDG" "" "0000302643" "00198" "00410540" "00006" "Isolated (sporadic)" "" "see paper; ..., onset neonatal, intellectual disability, spastic paraparesis, central iron accumulation, no family history" "" "" "" "" "" "" "" "" "NBIA5" "" "" "0000317318" "00139" "00426168" "00006" "Familial, X-linked dominant" "11y" "" "" "" "" "" "" "" "" "" "Neurodegeneration with brain iron accumulation 5" "intellectual disability" "" "0000318958" "00198" "00428012" "00006" "Familial, X-linked dominant" "2y" "" "" "" "" "" "" "" "" "" "" "" "" "0000344396" "00198" "00455863" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "NBIA5" "neurogenetic diseases" "" "0000346527" "05611" "00458079" "03544" "Isolated (sporadic)" "" "HP:0000347, HP:0001263, HP:0030799, HP:0001252, HP:0012448, HP:0000348, HP:0000369, HP:0025325" "" "" "" "" "" "" "" "" "NBIA5" "complex neurodevelopmental disorder" "" ## Screenings ## Do not remove or alter this header ## ## Count = 153 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000000209" "00000208" "1" "00037" "00001" "2012-09-13 12:02:03" "" "" "SEQ-NG-I" "DNA" "" "" "0000000210" "00000209" "1" "00037" "00001" "2012-09-13 12:09:36" "" "" "SEQ-NG-I" "DNA" "" "" "0000019833" "00019841" "1" "00705" "00705" "2014-09-03 12:57:01" "00006" "2014-11-07 20:22:53" "SEQ" "DNA" "" "" "0000050424" "00050479" "1" "00006" "00006" "2015-09-27 16:16:40" "" "" "SEQ;SEQ-NG-I" "DNA" "" "" "0000050551" "00050606" "1" "00006" "00006" "2015-09-27 16:16:40" "" "" "SEQ;SEQ-NG-I" "DNA" "" "" "0000050555" "00050610" "1" "00006" "00006" "2015-09-27 16:16:40" "" "" "SEQ;SEQ-NG-I" "DNA" "" "" "0000050557" "00050612" "1" "00006" "00006" "2015-09-27 16:16:40" "" "" "SEQ;SEQ-NG-I" "DNA" "" "" "0000145363" "00144506" "0" "01807" "01807" "2017-12-15 14:21:12" "" "" "SEQ" "DNA" "" "" "0000152882" "00152028" "1" "01741" "01741" "2018-02-01 14:25:18" "" "" "SEQ" "DNA" "" "" "0000175761" "00174870" "1" "01807" "01807" "2018-08-14 11:05:35" "" "" "SEQ" "DNA" "" "" "0000181081" "00180178" "1" "00006" "00006" "2018-08-24 19:40:22" "" "" "SEQ-NG" "DNA" "" "WES" "0000303810" "00302684" "1" "01164" "01164" "2020-05-29 15:08:01" "" "" "SEQ-NG-S" "DNA" "" "" "0000303852" "00302726" "1" "00006" "00006" "2020-05-30 18:20:39" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000303853" "00302727" "1" "00006" "00006" "2020-05-30 18:20:39" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000303854" "00302728" "1" "00006" "00006" "2020-05-30 18:20:39" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000303855" "00302729" "1" "00006" "00006" "2020-05-30 18:20:39" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000303856" "00302730" "1" "00006" "00006" "2020-05-30 18:20:39" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000303857" "00302731" "1" "00006" "00006" "2020-05-30 18:20:39" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000303858" "00302732" "1" "00006" "00006" "2020-05-30 18:20:39" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000303859" "00302733" "1" "00006" "00006" "2020-05-30 18:20:39" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000303860" "00302734" "1" "00006" "00006" "2020-05-30 18:20:39" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000303861" "00302735" "1" "00006" "00006" "2020-05-30 18:20:39" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000303862" "00302736" "1" "00006" "00006" "2020-05-30 18:20:39" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000303863" "00302737" "1" "00006" "00006" "2020-05-30 18:20:39" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000303864" "00302738" "1" "00006" "00006" "2020-05-30 18:20:39" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000303865" "00302739" "1" "00006" "00006" "2020-05-30 18:20:39" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000303866" "00302740" "1" "00006" "00006" "2020-05-30 18:20:39" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000303867" "00302741" "1" "00006" "00006" "2020-05-30 18:20:39" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000303868" "00302742" "1" "00006" "00006" "2020-05-30 18:20:39" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000303869" "00302743" "1" "00006" "00006" "2020-05-30 18:20:39" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000303870" "00302744" "1" "00006" "00006" "2020-05-30 18:20:39" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000303871" "00302745" "1" "00006" "00006" "2020-05-30 18:20:39" "" "" "SEQ" "DNA" "" "" "0000303873" "00302747" "1" "00006" "00006" "2020-05-31 10:03:40" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "" "WES" "0000303874" "00302748" "1" "00006" "00006" "2020-05-31 10:03:40" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "" "WES" "0000303875" "00302749" "1" "00006" "00006" "2020-05-31 10:03:40" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "" "WES" "0000303876" "00302750" "1" "00006" "00006" "2020-05-31 10:03:40" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "" "WES" "0000303877" "00302751" "1" "00006" "00006" "2020-05-31 10:03:40" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "" "WES" "0000303878" "00302752" "1" "00006" "00006" "2020-05-31 10:22:39" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000303879" "00302753" "1" "00006" "00006" "2020-05-31 10:22:39" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000303880" "00302754" "1" "00006" "00006" "2020-05-31 10:22:39" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000303881" "00302755" "1" "00006" "00006" "2020-05-31 10:22:39" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000303882" "00302756" "1" "00006" "00006" "2020-05-31 12:18:39" "" "" "SEQ" "DNA" "" "" "0000303883" "00302757" "1" "00006" "00006" "2020-05-31 12:18:39" "" "" "SEQ" "DNA" "" "" "0000303884" "00302758" "1" "00006" "00006" "2020-05-31 12:18:39" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000303885" "00302759" "1" "00006" "00006" "2020-05-31 12:18:39" "" "" "SEQ" "DNA" "" "" "0000303886" "00302760" "1" "00006" "00006" "2020-05-31 12:18:39" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "" "WES" "0000303887" "00302761" "1" "00006" "00006" "2020-05-31 12:18:39" "" "" "SEQ" "DNA" "" "" "0000303888" "00302762" "1" "00006" "00006" "2020-05-31 12:18:39" "" "" "SEQ" "DNA" "" "" "0000303889" "00302763" "1" "00006" "00006" "2020-05-31 12:18:39" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000303890" "00302764" "1" "00006" "00006" "2020-05-31 12:18:39" "" "" "SEQ" "DNA" "" "" "0000303914" "00302788" "1" "00006" "00006" "2020-06-01 10:33:11" "" "" "SEQ-NG" "DNA" "" "WES" "0000303935" "00302809" "1" "00006" "00006" "2020-06-01 11:51:13" "" "" "SEQ" "DNA" "" "" "0000303936" "00302810" "1" "00006" "00006" "2020-06-01 13:05:28" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000303937" "00302811" "1" "00006" "00006" "2020-06-01 13:16:06" "00006" "2020-06-01 13:19:18" "SEQ" "DNA" "" "" "0000303938" "00302812" "1" "00006" "00006" "2020-06-01 13:28:54" "" "" "arrayCGH" "DNA" "" "" "0000303939" "00302813" "1" "00006" "00006" "2020-06-01 13:42:38" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000303940" "00302814" "1" "00006" "00006" "2020-06-01 13:42:38" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000303941" "00302815" "1" "00006" "00006" "2020-06-01 13:42:38" "" "" "SEQ" "DNA" "" "" "0000303942" "00302816" "1" "00006" "00006" "2020-06-01 13:42:38" "" "" "SEQ" "DNA" "" "" "0000303943" "00302817" "1" "00006" "00006" "2020-06-01 13:42:38" "" "" "SEQ" "DNA" "" "" "0000303944" "00302818" "1" "00006" "00006" "2020-06-01 13:42:38" "" "" "SEQ" "DNA" "" "" "0000303945" "00302819" "1" "00006" "00006" "2020-06-01 13:42:38" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000303946" "00302820" "1" "00006" "00006" "2020-06-01 13:42:38" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000303947" "00302821" "1" "00006" "00006" "2020-06-01 13:45:57" "" "" "SEQ" "DNA" "" "" "0000303948" "00302822" "1" "00006" "00006" "2020-06-01 13:58:32" "" "" "SEQ" "DNA" "" "" "0000303951" "00302825" "1" "00006" "00006" "2020-06-01 19:26:03" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000303952" "00302826" "1" "00006" "00006" "2020-06-01 19:34:00" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000303953" "00302827" "1" "00006" "00006" "2020-06-01 19:40:10" "" "" "SEQ" "DNA" "" "" "0000303954" "00302828" "1" "00006" "00006" "2020-06-01 19:50:04" "" "" "SEQ" "DNA" "" "" "0000303955" "00302829" "1" "00006" "00006" "2020-06-01 20:02:23" "" "" "PCRdd" "DNA" "" "" "0000303956" "00302830" "1" "00006" "00006" "2020-06-01 20:33:47" "" "" "SEQ" "DNA" "" "" "0000303957" "00302831" "1" "00006" "00006" "2020-06-01 20:42:10" "" "" "SEQ" "DNA" "" "" "0000303958" "00302832" "1" "00006" "00006" "2020-06-01 20:48:42" "" "" "SEQ" "DNA" "" "" "0000303959" "00302833" "1" "00006" "00006" "2020-06-01 20:54:51" "" "" "SEQ" "DNA" "" "WES" "0000303962" "00302835" "1" "00006" "00006" "2020-06-02 08:43:54" "" "" "SEQ" "DNA" "" "" "0000303963" "00302836" "1" "00006" "00006" "2020-06-02 08:48:50" "" "" "SEQ" "DNA" "" "" "0000303964" "00302837" "1" "00006" "00006" "2020-06-02 08:54:58" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000303965" "00302838" "1" "00006" "00006" "2020-06-02 09:07:13" "" "" "SEQ" "DNA" "" "" "0000303966" "00302839" "1" "00006" "00006" "2020-06-02 09:11:59" "" "" "SEQ" "DNA" "" "WES" "0000303967" "00302840" "1" "00006" "00006" "2020-06-02 09:18:56" "00006" "2020-06-02 09:39:03" "SEQ;SEQ-NG" "DNA" "" "WES" "0000303969" "00302842" "1" "00006" "00006" "2020-06-02 09:32:59" "" "" "PCRq;SEQ" "DNA" "" "" "0000303976" "00302849" "1" "00006" "00006" "2020-06-02 13:05:10" "" "" "SEQ" "DNA" "" "" "0000303980" "00302853" "1" "00006" "00006" "2020-06-02 15:21:49" "" "" "SEQ" "DNA" "" "" "0000303981" "00302854" "1" "00006" "00006" "2020-06-02 15:29:51" "" "" "SEQ;SEQ-NG" "DNA" "" "WES trio" "0000303996" "00302870" "1" "00006" "00006" "2020-06-02 21:08:08" "" "" "SEQ" "DNA" "" "" "0000303997" "00302871" "1" "00006" "00006" "2020-06-02 21:08:08" "" "" "SEQ" "DNA" "" "" "0000303998" "00302872" "1" "00006" "00006" "2020-06-02 21:08:08" "" "" "SEQ" "DNA" "" "" "0000303999" "00302873" "1" "00006" "00006" "2020-06-02 21:08:08" "" "" "SEQ" "DNA" "" "" "0000304000" "00302874" "1" "00006" "00006" "2020-06-02 21:08:08" "" "" "SEQ" "DNA" "" "" "0000304001" "00302875" "1" "00006" "00006" "2020-06-02 21:08:08" "" "" "SEQ" "DNA" "" "" "0000304002" "00302876" "1" "00006" "00006" "2020-06-02 21:08:08" "" "" "SEQ" "DNA" "" "" "0000304003" "00302877" "1" "00006" "00006" "2020-06-02 21:08:08" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "" "WES" "0000304004" "00302878" "1" "00006" "00006" "2020-06-02 21:08:08" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000304005" "00302879" "1" "00006" "00006" "2020-06-02 21:08:08" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000304007" "00302881" "1" "00006" "00006" "2020-06-02 21:28:09" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA" "" "WES" "0000304014" "00302888" "1" "00006" "00006" "2020-06-03 15:03:35" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000304019" "00302892" "1" "00006" "00006" "2020-06-03 15:10:20" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000304020" "00302894" "1" "00006" "00006" "2020-06-03 15:18:13" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000304021" "00302895" "1" "00006" "00006" "2020-06-03 15:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000304022" "00302896" "1" "00006" "00006" "2020-06-03 15:29:16" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000304023" "00302898" "1" "00006" "00006" "2020-06-03 15:56:13" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA" "" "WES" "0000304024" "00302899" "1" "00006" "00006" "2020-06-03 15:56:13" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA" "" "WES" "0000304025" "00302900" "1" "00006" "00006" "2020-06-03 15:56:13" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA" "" "WES" "0000304026" "00302901" "1" "00006" "00006" "2020-06-03 15:56:13" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA" "" "WES" "0000304028" "00302902" "1" "00006" "00006" "2020-06-03 16:16:06" "" "" "SEQ" "DNA" "" "" "0000304029" "00302903" "1" "00006" "00006" "2020-06-03 16:26:57" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000304030" "00302904" "1" "00006" "00006" "2020-06-03 16:47:21" "" "" "SEQ" "DNA" "" "" "0000304031" "00302905" "1" "00006" "00006" "2020-06-03 16:47:21" "" "" "SEQ" "DNA" "" "" "0000304032" "00302906" "1" "00006" "00006" "2020-06-03 16:47:21" "" "" "SEQ" "DNA" "" "" "0000304033" "00302907" "1" "00006" "00006" "2020-06-03 17:21:15" "" "" "SEQ" "DNA" "" "" "0000304034" "00302908" "1" "00006" "00006" "2020-06-03 17:48:34" "" "" "SEQ" "DNA" "" "" "0000304035" "00302909" "1" "00006" "00006" "2020-06-03 17:48:34" "" "" "SEQ" "DNA" "" "" "0000304036" "00302910" "1" "00006" "00006" "2020-06-03 17:48:34" "" "" "SEQ" "DNA" "" "" "0000304037" "00302911" "1" "00006" "00006" "2020-06-03 17:48:34" "" "" "SEQ" "DNA" "" "" "0000304047" "00302922" "1" "00006" "00006" "2020-06-04 17:38:33" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000304048" "00302923" "1" "00006" "00006" "2020-06-04 18:18:19" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000304049" "00302924" "1" "00006" "00006" "2020-06-04 18:24:16" "" "" "SEQ" "DNA" "" "" "0000304050" "00302925" "1" "00006" "00006" "2020-06-04 18:32:48" "00006" "2020-06-04 18:34:14" "SEQ;SEQ-NG" "DNA" "" "WES" "0000304051" "00302926" "1" "00006" "00006" "2020-06-04 18:39:08" "" "" "SEQ" "DNA" "" "" "0000304052" "00302927" "1" "00006" "00006" "2020-06-04 19:10:55" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA" "" "WES" "0000304053" "00302928" "1" "00006" "00006" "2020-06-04 19:10:55" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA" "" "WGS" "0000304054" "00302929" "1" "00006" "00006" "2020-06-04 19:10:55" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA" "" "WGS" "0000304055" "00302930" "1" "00006" "00006" "2020-06-04 19:10:55" "" "" "SEQ" "DNA" "" "" "0000304056" "00302931" "1" "00006" "00006" "2020-06-04 19:10:55" "" "" "SEQ" "DNA" "" "" "0000304057" "00302932" "1" "00006" "00006" "2020-06-04 19:10:55" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA" "" "WGS" "0000304058" "00302933" "1" "00006" "00006" "2020-06-04 19:10:55" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA" "" "WES" "0000304059" "00302934" "1" "00006" "00006" "2020-06-04 19:10:55" "" "" "SEQ" "DNA" "" "" "0000304060" "00302935" "1" "00006" "00006" "2020-06-04 19:10:55" "" "" "SEQ" "DNA" "" "" "0000304061" "00302936" "1" "00006" "00006" "2020-06-04 19:10:55" "" "" "SEQ" "DNA" "" "" "0000304062" "00302937" "1" "00006" "00006" "2020-06-04 19:10:55" "" "" "SEQ" "DNA" "" "" "0000304063" "00302938" "1" "00006" "00006" "2020-06-04 19:10:55" "" "" "SEQ" "DNA" "" "" "0000304064" "00302939" "1" "00006" "00006" "2020-06-04 19:10:55" "" "" "SEQ" "DNA" "" "" "0000304065" "00302940" "1" "00006" "00006" "2020-06-04 19:10:55" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA" "" "WGS" "0000304066" "00302941" "1" "00006" "00006" "2020-06-04 19:10:55" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA" "" "WES" "0000304067" "00302942" "1" "00006" "00006" "2020-06-04 19:10:55" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA" "" "WES" "0000304068" "00302943" "1" "00006" "00006" "2020-06-04 19:10:55" "" "" "SEQ" "DNA" "" "" "0000304069" "00302944" "1" "00006" "00006" "2020-06-04 19:31:20" "" "" "SEQ;SEQ-ON" "DNA" "" "" "0000304073" "00302948" "1" "00006" "00006" "2020-06-05 09:01:06" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "" "WES" "0000304153" "00303028" "1" "00006" "00006" "2020-06-05 14:08:27" "" "" "SEQ-NG" "DNA" "" "WES" "0000304181" "00303056" "1" "00006" "00006" "2020-06-05 14:08:27" "" "" "SEQ-NG" "DNA" "" "WES" "0000304215" "00303090" "1" "00006" "00006" "2020-06-05 19:38:33" "" "" "microscope;PCRlr;SEQ" "DNA" "" "" "0000375729" "00374535" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000376848" "00375651" "1" "00006" "00006" "2021-06-14 20:30:20" "" "" "SEQ-NG" "DNA" "" "WES" "0000378176" "00376971" "1" "01741" "01741" "2021-06-28 13:07:16" "" "" "SEQ" "DNA" "" "" "0000378358" "00377154" "1" "01164" "01164" "2021-07-14 10:26:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000393120" "00391878" "1" "02494" "02494" "2021-11-19 13:40:03" "" "" "SEQ-NG" "DNA" "" "WES" "0000411131" "00409867" "1" "03322" "03322" "2022-05-13 03:21:29" "00006" "2022-05-16 09:58:40" "RT-PCR;SEQ;SEQ-NG-I" "DNA;RNA" "blood" "" "0000411805" "00410540" "1" "00006" "00006" "2022-05-29 10:39:10" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000427488" "00426168" "1" "00006" "00006" "2022-11-28 11:02:11" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000429425" "00428012" "1" "00006" "00006" "2022-12-19 13:11:26" "" "" "RT-PCR;SEQ;SEQ-NG-RNA" "DNA;RNA" "whole blood" "singleton WES" "0000457479" "00455863" "1" "00006" "00006" "2024-10-20 15:03:37" "" "" "SEQ-NG" "DNA" "" "WES" "0000459697" "00458079" "1" "03544" "03544" "2024-11-28 11:46:33" "" "" "SEQ-NG-I" "DNA" "peripheral blood" "WES" "0000462538" "00460906" "1" "04796" "00006" "2024-11-05 16:15:00" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "blood" "mRNA splicing analysis on tissue" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 144 "{{screeningid}}" "{{geneid}}" "0000019833" "CARD8" "0000019833" "ELP2" "0000019833" "WDR45" "0000050424" "WDR45" "0000050551" "WDR45" "0000050555" "WDR45" "0000050557" "WDR45" "0000152882" "WDR45" "0000181081" "WDR45" "0000303852" "WDR45" "0000303853" "WDR45" "0000303854" "WDR45" "0000303855" "WDR45" "0000303856" "WDR45" "0000303857" "WDR45" "0000303858" "WDR45" "0000303859" "WDR45" "0000303860" "WDR45" "0000303861" "WDR45" "0000303862" "WDR45" "0000303863" "WDR45" "0000303864" "WDR45" "0000303865" "WDR45" "0000303866" "WDR45" "0000303867" "WDR45" "0000303868" "WDR45" "0000303869" "WDR45" "0000303870" "WDR45" "0000303871" "WDR45" "0000303873" "WDR45" "0000303874" "WDR45" "0000303875" "WDR45" "0000303876" "WDR45" "0000303877" "WDR45" "0000303878" "WDR45" "0000303879" "WDR45" "0000303880" "WDR45" "0000303881" "WDR45" "0000303882" "WDR45" "0000303883" "WDR45" "0000303884" "WDR45" "0000303885" "WDR45" "0000303886" "WDR45" "0000303887" "WDR45" "0000303888" "WDR45" "0000303889" "WDR45" "0000303890" "WDR45" "0000303914" "WDR45" "0000303935" "WDR45" "0000303937" "WDR45" "0000303938" "WDR45" "0000303939" "WDR45" "0000303940" "WDR45" "0000303941" "WDR45" "0000303942" "WDR45" "0000303943" "WDR45" "0000303944" "WDR45" "0000303945" "WDR45" "0000303946" "WDR45" "0000303947" "WDR45" "0000303948" "WDR45" "0000303951" "WDR45" "0000303952" "WDR45" "0000303953" "WDR45" "0000303954" "WDR45" "0000303955" "WDR45" "0000303956" "WDR45" "0000303957" "WDR45" "0000303958" "WDR45" "0000303959" "WDR45" "0000303962" "WDR45" "0000303963" "WDR45" "0000303964" "WDR45" "0000303965" "WDR45" "0000303966" "WDR45" "0000303967" "WDR45" "0000303969" "WDR45" "0000303976" "WDR45" "0000303980" "WDR45" "0000303981" "WDR45" "0000303996" "WDR45" "0000303997" "WDR45" "0000303998" "WDR45" "0000303999" "WDR45" "0000304000" "WDR45" "0000304001" "WDR45" "0000304002" "WDR45" "0000304003" "WDR45" "0000304004" "WDR45" "0000304005" "WDR45" "0000304007" "WDR45" "0000304014" "WDR45" "0000304019" "WDR45" "0000304020" "WDR45" "0000304021" "WDR45" "0000304022" "WDR45" "0000304023" "WDR45" "0000304024" "WDR45" "0000304025" "WDR45" "0000304026" "WDR45" "0000304028" "WDR45" "0000304029" "WDR45" "0000304030" "WDR45" "0000304031" "WDR45" "0000304032" "WDR45" "0000304033" "WDR45" "0000304034" "WDR45" "0000304035" "WDR45" "0000304036" "WDR45" "0000304037" "WDR45" "0000304047" "WDR45" "0000304048" "WDR45" "0000304049" "WDR45" "0000304050" "WDR45" "0000304051" "WDR45" "0000304052" "WDR45" "0000304053" "WDR45" "0000304054" "WDR45" "0000304055" "WDR45" "0000304056" "WDR45" "0000304057" "WDR45" "0000304058" "WDR45" "0000304059" "WDR45" "0000304060" "WDR45" "0000304061" "WDR45" "0000304062" "WDR45" "0000304063" "WDR45" "0000304064" "WDR45" "0000304065" "WDR45" "0000304066" "WDR45" "0000304067" "WDR45" "0000304068" "WDR45" "0000304069" "WDR45" "0000304073" "WDR45" "0000304153" "NOTCH1" "0000304153" "WDR45" "0000304181" "WDR45" "0000304215" "KMT2A" "0000304215" "WDR45" "0000375729" "WDR45" "0000378176" "WDR45" "0000378358" "WDR45" "0000411131" "NANS" "0000462538" "WDR45" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 218 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000006844" "20" "50" "X" "48938018" "48938018" "subst" "0" "00037" "WDR45_000001" "g.48938018A>G" "" "" "" "" "" "Germline" "" "" "" "" "" "g.49080359=" "" "VUS" "" "0000014809" "20" "50" "X" "48938018" "48938018" "subst" "0" "00037" "WDR45_000001" "g.48938018A>G" "" "" "" "" "" "Germline" "" "" "" "" "" "g.49080359=" "" "VUS" "" "0000040289" "0" "90" "X" "48932518" "48932518" "del" "0" "00705" "WDR45_000002" "g.48932518del" "" "{PMID:Gilissen 2014:24896178}" "" "" "" "De novo" "" "" "0" "" "" "g.49074859del" "" "pathogenic" "" "0000079404" "0" "90" "X" "48934302" "48934302" "subst" "0" "00006" "WDR45_000004" "g.48934302A>T" "" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "" "" "splice variant" "De novo" "" "" "0" "" "" "g.49076643A>T" "" "pathogenic" "" "0000079531" "0" "90" "X" "48933022" "48933022" "subst" "0" "00006" "WDR45_000003" "g.48933022C>T" "" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "" "" "splice variant" "De novo" "" "" "0" "" "" "g.49075363C>T" "" "pathogenic" "" "0000079535" "0" "90" "X" "48935752" "48935752" "subst" "0" "00006" "WDR45_000005" "g.48935752C>G" "" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "" "" "splice variant" "De novo" "" "" "0" "" "" "g.49078093C>G" "" "pathogenic" "" "0000079537" "0" "90" "X" "48935752" "48935752" "subst" "0" "00006" "WDR45_000005" "g.48935752C>G" "" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "" "" "splice variant" "De novo" "" "" "0" "" "" "g.49078093C>G" "" "pathogenic" "" "0000236476" "0" "90" "X" "48932898" "48932899" "ins" "0" "01807" "WDR45_000006" "g.48932898_48932899insGACG" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.49075239_49075240insGACG" "" "pathogenic" "" "0000254448" "0" "30" "X" "48934309" "48934309" "subst" "0" "01943" "WDR45_000018" "g.48934309A>T" "" "" "" "WDR45(NM_007075.3):c.339T>A (p.H113Q), WDR45(NM_007075.4):c.339T>A (p.H113Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.49076650A>T" "" "likely benign" "" "0000313062" "0" "30" "X" "48934434" "48934434" "subst" "0" "02325" "WDR45_000019" "g.48934434C>T" "" "" "" "WDR45(NM_007075.4):c.236-22G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.49076775C>T" "" "likely benign" "" "0000313063" "0" "30" "X" "48934174" "48934174" "subst" "0.00086789" "02325" "WDR45_000017" "g.48934174G>A" "" "" "" "WDR45(NM_007075.3):c.354C>T (p.I118=), WDR45(NM_007075.4):c.354C>T (p.I118=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.49076515G>A" "" "likely benign" "" "0000313064" "0" "30" "X" "48932581" "48932581" "subst" "1.69349E-5" "02325" "WDR45_000007" "g.48932581G>T" "" "" "" "WDR45(NM_007075.4):c.977-10C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.49074922G>T" "" "likely benign" "" "0000313708" "0" "90" "X" "48934147" "48934147" "subst" "0" "02329" "WDR45_000015" "g.48934147G>C" "" "" "" "WDR45(NM_007075.4):c.381C>G (p.Y127*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.49076488G>C" "" "pathogenic" "" "0000315396" "0" "90" "X" "48933578" "48933578" "subst" "0" "02326" "WDR45_000014" "g.48933578C>A" "" "" "" "WDR45(NM_007075.3):c.466G>T (p.E156*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.49075919C>A" "" "pathogenic" "" "0000315397" "0" "90" "X" "48933232" "48933232" "subst" "0" "02326" "WDR45_000011" "g.48933232G>A" "" "" "" "WDR45(NM_007075.3):c.700C>T (p.R234*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.49075573G>A" "" "pathogenic" "" "0000319850" "0" "50" "X" "48935526" "48935526" "subst" "0.00015741" "01943" "WDR45_000021" "g.48935526C>T" "" "" "" "WDR45(NM_001029896.1):c.100G>A (p.(Val34Met)), WDR45(NM_007075.3):c.100G>A (p.V34M), WDR45(NM_007075.4):c.100G>A (p.V34M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.49077867C>T" "" "VUS" "" "0000319851" "0" "10" "X" "48935284" "48935284" "subst" "0.0445502" "01943" "WDR45_000020" "g.48935284C>A" "" "" "" "WDR45(NM_007075.3):c.235+18G>T, WDR45(NM_007075.4):c.235+18G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.49077625C>A" "" "benign" "" "0000319852" "0" "30" "X" "48934174" "48934174" "subst" "0.00086789" "01943" "WDR45_000017" "g.48934174G>A" "" "" "" "WDR45(NM_007075.3):c.354C>T (p.I118=), WDR45(NM_007075.4):c.354C>T (p.I118=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.49076515G>A" "" "likely benign" "" "0000319853" "0" "30" "X" "48934147" "48934147" "subst" "0" "01943" "WDR45_000016" "g.48934147G>A" "" "" "" "WDR45(NM_007075.3):c.381C>T (p.Y127=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.49076488G>A" "" "likely benign" "" "0000319854" "0" "90" "X" "48933270" "48933271" "del" "0" "01943" "WDR45_000013" "g.48933270_48933271del" "" "" "" "WDR45(NM_007075.3):c.662_663delTT (p.F221*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.49075611_49075612del" "" "pathogenic" "" "0000319855" "0" "30" "X" "48933266" "48933266" "subst" "0" "01943" "WDR45_000012" "g.48933266G>A" "" "" "" "WDR45(NM_007075.3):c.666C>T (p.D222=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.49075607G>A" "" "likely benign" "" "0000319856" "0" "30" "X" "48932930" "48932930" "subst" "0.00668116" "01943" "WDR45_000010" "g.48932930C>T" "" "" "" "WDR45(NM_001029896.1):c.838G>A (p.(Val280Met)), WDR45(NM_007075.3):c.841G>A (p.V281M), WDR45(NM_007075.4):c.841G>A (p.V281M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.49075271C>T" "" "likely benign" "" "0000319857" "0" "50" "X" "48932824" "48932824" "subst" "0.000179247" "01943" "WDR45_000008" "g.48932824T>G" "" "" "" "WDR45(NM_001029896.1):c.944A>C (p.(Asn315Thr)), WDR45(NM_007075.3):c.947A>C (p.N316T), WDR45(NM_007075.4):c.947A>C (p.N316T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.49075165T>G" "" "VUS" "" "0000319858" "0" "30" "X" "48935527" "48935527" "subst" "7.30727E-5" "01943" "WDR45_000022" "g.48935527G>A" "" "" "" "WDR45(NM_007075.3):c.99C>T (p.N33=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.49077868G>A" "" "likely benign" "" "0000334052" "0" "30" "X" "48931481" "48931481" "subst" "0.00377764" "01804" "PRAF2_000001" "g.48931481G>A" "" "" "" "PRAF2(NM_007213.1):c.166C>T (p.(Leu56Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.49073822G>A" "" "likely benign" "" "0000334053" "0" "50" "X" "48932876" "48932876" "subst" "0" "01804" "WDR45_000009" "g.48932876C>T" "" "" "" "WDR45(NM_001029896.1):c.892G>A (p.(Ala298Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.49075217C>T" "" "VUS" "" "0000334054" "0" "30" "X" "48932930" "48932930" "subst" "0.00668116" "01804" "WDR45_000010" "g.48932930C>T" "" "" "" "WDR45(NM_001029896.1):c.838G>A (p.(Val280Met)), WDR45(NM_007075.3):c.841G>A (p.V281M), WDR45(NM_007075.4):c.841G>A (p.V281M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.49075271C>T" "" "likely benign" "" "0000334055" "0" "50" "X" "48935526" "48935526" "subst" "0.00015741" "01804" "WDR45_000021" "g.48935526C>T" "" "" "" "WDR45(NM_001029896.1):c.100G>A (p.(Val34Met)), WDR45(NM_007075.3):c.100G>A (p.V34M), WDR45(NM_007075.4):c.100G>A (p.V34M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.49077867C>T" "" "VUS" "" "0000338320" "0" "70" "X" "48930091" "48930091" "subst" "0" "02327" "PRAF2_000002" "g.48930091C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.49072432C>T" "" "likely pathogenic" "" "0000338321" "0" "10" "X" "48935284" "48935284" "subst" "0.0445502" "02327" "WDR45_000020" "g.48935284C>A" "" "" "" "WDR45(NM_007075.3):c.235+18G>T, WDR45(NM_007075.4):c.235+18G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.49077625C>A" "" "benign" "" "0000339148" "0" "90" "X" "48933107" "48933111" "dup" "0" "02327" "WDR45_000026" "g.48933107_48933111dup" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.49075448_49075452dup" "" "pathogenic" "" "0000349856" "0" "70" "X" "48934399" "48934399" "subst" "0" "02327" "WDR45_000029" "g.48934399C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.49076740C>T" "" "likely pathogenic" "" "0000351243" "0" "70" "X" "48932941" "48932941" "subst" "0" "02327" "WDR45_000023" "g.48932941C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.49075282C>T" "" "likely pathogenic" "" "0000351244" "0" "90" "X" "48933021" "48933021" "subst" "0" "02327" "WDR45_000024" "g.48933021A>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.49075362A>T" "" "pathogenic" "" "0000351721" "0" "70" "X" "48933524" "48933524" "subst" "0" "01741" "WDR45_000031" "g.48933524C>T" "" "" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.49075865C>T" "" "likely pathogenic" "" "0000398631" "0" "90" "X" "48933033" "48933081" "del" "0" "01807" "WDR45_000032" "g.48933033_48933081delinsAGA" "" "" "" "772_820delAGTGATAAGGGTACTGTCCATATCTTTGCCAAGGATACCCGCCTCAACCinsTCT" "" "Unknown" "" "" "0" "" "" "g.49075374_49075422delinsAGA" "" "pathogenic" "" "0000404717" "0" "90" "X" "48933232" "48933232" "subst" "0" "00006" "WDR45_000011" "g.48933232G>A" "" "{PMID:Tumienė 2018:29286531}" "" "697C>T" "" "De novo" "" "" "0" "" "" "g.49075573G>A" "" "pathogenic" "ACMG" "0000576309" "0" "30" "X" "48932824" "48932824" "subst" "0.000179247" "01804" "WDR45_000008" "g.48932824T>G" "" "" "" "WDR45(NM_001029896.1):c.944A>C (p.(Asn315Thr)), WDR45(NM_007075.3):c.947A>C (p.N316T), WDR45(NM_007075.4):c.947A>C (p.N316T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.49075165T>G" "" "likely benign" "" "0000576310" "0" "90" "X" "48933104" "48933106" "del" "0" "01804" "WDR45_000025" "g.48933104_48933106del" "" "" "" "WDR45(NM_001029896.1):c.749_751delCCT (p.(Ser251del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.49075445_49075447del" "" "pathogenic" "" "0000576311" "0" "70" "X" "48933234" "48933234" "subst" "5.59785E-6" "02327" "WDR45_000033" "g.48933234C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.49075575C>T" "" "likely pathogenic" "" "0000576312" "0" "70" "X" "48933235" "48933235" "subst" "0" "02327" "WDR45_000034" "g.48933235G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.49075576G>A" "" "likely pathogenic" "" "0000576313" "0" "90" "X" "48933311" "48933312" "dup" "0" "01943" "WDR45_000035" "g.48933311_48933312dup" "" "" "" "WDR45(NM_007075.3):c.620_621dupTA (p.V208*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.49075652_49075653dup" "" "pathogenic" "" "0000576314" "0" "30" "X" "48933340" "48933340" "subst" "0" "02327" "WDR45_000036" "g.48933340A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.49075681A>G" "" "likely benign" "" "0000576315" "0" "50" "X" "48934079" "48934079" "subst" "5.61111E-5" "01943" "WDR45_000037" "g.48934079G>A" "" "" "" "WDR45(NM_007075.3):c.439+10C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.49076420G>A" "" "VUS" "" "0000576317" "0" "10" "X" "48934174" "48934174" "subst" "0.00086789" "02326" "WDR45_000017" "g.48934174G>A" "" "" "" "WDR45(NM_007075.3):c.354C>T (p.I118=), WDR45(NM_007075.4):c.354C>T (p.I118=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.49076515G>A" "" "benign" "" "0000576318" "0" "50" "X" "48934353" "48934353" "subst" "1.1458E-5" "02327" "WDR45_000038" "g.48934353C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.49076694C>G" "" "VUS" "" "0000576319" "0" "50" "X" "48935390" "48935390" "subst" "0" "01943" "WDR45_000039" "g.48935390G>A" "" "" "" "WDR45(NM_007075.3):c.147C>T (p.G49=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.49077731G>A" "" "VUS" "" "0000576320" "0" "50" "X" "48935544" "48935544" "subst" "0" "01943" "WDR45_000040" "g.48935544C>T" "" "" "" "WDR45(NM_007075.3):c.82G>A (p.G28S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.49077885C>T" "" "VUS" "" "0000619647" "0" "30" "X" "48934071" "48934071" "subst" "1.12425E-5" "02326" "WDR45_000041" "g.48934071G>A" "" "" "" "WDR45(NM_007075.3):c.439+18C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.49076412G>A" "" "likely benign" "" "0000619648" "0" "10" "X" "48935284" "48935284" "subst" "0.0445502" "02329" "WDR45_000020" "g.48935284C>A" "" "" "" "WDR45(NM_007075.3):c.235+18G>T, WDR45(NM_007075.4):c.235+18G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.49077625C>A" "" "benign" "" "0000659346" "0" "50" "X" "48933033" "48933033" "subst" "0" "01943" "WDR45_000042" "g.48933033G>A" "" "" "" "WDR45(NM_001029896.1):c.817C>T (p.(Arg273Cys)), WDR45(NM_007075.3):c.820C>T (p.R274C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.49075374G>A" "" "VUS" "" "0000667206" "0" "70" "X" "48935699" "48935699" "subst" "0" "01164" "WDR45_000067" "g.48935699C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.49078040C>T" "" "likely pathogenic" "" "0000667254" "0" "90" "X" "48932542" "48932543" "del" "0" "00006" "WDR45_000045" "g.48932542_48932543del" "" "{PMID:Haack 2012:23176820}" "" "" "" "De novo" "" "" "0" "" "" "g.49074883_49074884del" "" "pathogenic (dominant)" "" "0000667255" "0" "90" "X" "48935717" "48935717" "subst" "0" "00006" "WDR45_000069" "g.48935717C>G" "" "{PMID:Haack 2012:23176820}" "" "" "" "De novo" "" "" "0" "" "" "g.49078058C>G" "" "pathogenic (dominant)" "" "0000667256" "0" "90" "X" "48935752" "48935757" "del" "0" "00006" "WDR45_000072" "g.48935752_48935757del" "" "{PMID:Haack 2012:23176820}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.49078093_49078098del" "" "pathogenic (dominant)" "" "0000667257" "0" "90" "X" "48934355" "48934355" "subst" "0" "00006" "WDR45_000061" "g.48934355A>G" "" "{PMID:Haack 2012:23176820}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.49076696A>G" "" "pathogenic (dominant)" "" "0000667258" "0" "90" "X" "48933568" "48933568" "del" "0" "00006" "WDR45_000053" "g.48933568del" "" "{PMID:Haack 2012:23176820}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.49075909del" "" "pathogenic (dominant)" "" "0000667259" "0" "90" "X" "48935736" "48935736" "subst" "0" "00006" "WDR45_000070" "g.48935736G>A" "" "{PMID:Haack 2012:23176820}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.49078077G>A" "" "pathogenic (dominant)" "" "0000667260" "0" "90" "X" "48935571" "48935571" "subst" "0" "00006" "WDR45_000066" "g.48935571C>T" "" "{PMID:Haack 2012:23176820}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.49077912C>T" "" "pathogenic (dominant)" "" "0000667261" "0" "90" "X" "48933232" "48933232" "subst" "0" "00006" "WDR45_000011" "g.48933232G>A" "" "{PMID:Haack 2012:23176820}" "" "" "" "De novo" "" "" "0" "" "" "g.49075573G>A" "" "pathogenic (dominant)" "" "0000667262" "0" "90" "X" "48934128" "48934128" "subst" "0" "00006" "WDR45_000057" "g.48934128G>A" "" "{PMID:Haack 2012:23176820}" "" "" "" "De novo" "" "" "0" "" "" "g.49076469G>A" "" "pathogenic (dominant)" "" "0000667263" "0" "90" "X" "48935311" "48935312" "del" "0" "00006" "WDR45_000063" "g.48935311_48935312del" "" "{PMID:Haack 2012:23176820}" "" "" "" "De novo" "" "" "0" "" "" "g.49077652_49077653del" "" "pathogenic (dominant)" "" "0000667264" "0" "90" "X" "48934119" "48934123" "del" "0" "00006" "WDR45_000056" "g.48934119_48934123del" "" "{PMID:Haack 2012:23176820}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.49076460_49076464del" "" "pathogenic (dominant)" "" "0000667265" "0" "90" "X" "48934169" "48934169" "dup" "0" "00006" "WDR45_000058" "g.48934169dup" "" "{PMID:Haack 2012:23176820}" "" "" "" "De novo" "" "" "0" "" "" "g.49076510dup" "" "pathogenic (dominant)" "" "0000667266" "0" "90" "X" "48933022" "48933022" "subst" "0" "00006" "WDR45_000003" "g.48933022C>T" "" "{PMID:Haack 2012:23176820}" "" "" "" "De novo" "" "" "0" "" "" "g.49075363C>T" "" "pathogenic (dominant)" "" "0000667267" "0" "90" "X" "48935736" "48935736" "dup" "0" "00006" "WDR45_000071" "g.48935736dup" "" "{PMID:Haack 2012:23176820}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.49078077dup" "" "pathogenic (dominant)" "" "0000667268" "0" "90" "X" "48935301" "48935301" "subst" "0" "00006" "WDR45_000062" "g.48935301C>T" "" "{PMID:Haack 2012:23176820}, {PMID:Ingrassia 2017:28261264}" "" "" "" "De novo" "" "" "0" "" "" "g.49077642C>T" "" "pathogenic (dominant)" "" "0000667269" "0" "90" "X" "48932542" "48932543" "del" "0" "00006" "WDR45_000045" "g.48932542_48932543del" "" "{PMID:Haack 2012:23176820}" "" "" "" "De novo" "" "" "0" "" "" "g.49074883_49074884del" "" "pathogenic (dominant)" "" "0000667270" "0" "90" "X" "48933232" "48933241" "del" "0" "00006" "WDR45_000048" "g.48933232_48933241del" "" "{PMID:Haack 2012:23176820}" "" "" "" "De novo" "" "" "0" "" "" "g.49075573_49075582del" "" "pathogenic (dominant)" "" "0000667271" "0" "90" "X" "48935354" "48935354" "subst" "0" "00006" "WDR45_000065" "g.48935354G>T" "" "{PMID:Haack 2012:23176820}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.49077695G>T" "" "pathogenic (dominant)" "" "0000667272" "0" "90" "X" "48932514" "48932523" "delins" "0" "00006" "WDR45_000044" "g.48932514_48932523delinsAAATATGT" "" "{PMID:Haack 2012:23176820}" "" "" "" "Somatic" "" "" "0" "" "" "g.49074855_49074864delinsAAATATGT" "" "pathogenic (dominant)" "" "0000667273" "0" "10" "X" "0" "0" "" "0" "00006" "USP9X_000005" "g.?" "" "{PMID:Haack 2012:23176820}" "" "" "" "Germline" "" "" "0" "" "" "" "" "benign" "" "0000667275" "0" "90" "X" "48934088" "48934088" "subst" "0" "00006" "WDR45_000054" "g.48934088C>A" "" "{PMID:Saitsu 2013:23435086}" "" "" "" "De novo" "" "" "0" "normal allele inactivated in lymphoblastoid cell lines" "" "g.49076429C>A" "" "pathogenic (dominant)" "" "0000667276" "0" "90" "X" "48933525" "48933525" "subst" "0" "00006" "WDR45_000051" "g.48933525C>G" "" "{PMID:Saitsu 2013:23435086}" "" "516G>C" "" "De novo" "" "" "0" "normal allele inactivated in lymphoblastoid cell lines" "" "g.49075866C>G" "" "pathogenic (dominant)" "" "0000667277" "0" "90" "X" "48934092" "48934092" "dup" "0" "00006" "WDR45_000055" "g.48934092dup" "" "{PMID:Saitsu 2013:23435086}" "" "437dupA" "" "De novo" "" "" "0" "normal expression both alleles in lymphoblastoid cell lines" "" "g.49076433dup" "" "pathogenic (dominant)" "" "0000667278" "0" "90" "X" "48933295" "48933295" "subst" "0" "00006" "WDR45_000049" "g.48933295G>A" "" "{PMID:Saitsu 2013:23435086}" "" "" "" "De novo" "" "" "0" "normal allele inactivated in lymphoblastoid cell lines" "" "g.49075636G>A" "" "pathogenic (dominant)" "" "0000667279" "0" "90" "X" "48932514" "48932515" "dup" "0" "00006" "WDR45_000043" "g.48932514_48932515dup" "" "{PMID:Saitsu 2013:23435086}" "" "1033_1034dupAA" "" "De novo" "" "" "0" "normal allele inactivated in lymphoblastoid cell lines" "" "g.49074855_49074856dup" "" "pathogenic (dominant)" "" "0000667280" "0" "90" "X" "48935699" "48935699" "subst" "0" "00006" "WDR45_000068" "g.48935699C>G" "" "{PMID:Hayflick 2013:23435086}" "" "" "" "De novo" "" "" "0" "" "" "g.49078040C>G" "" "pathogenic (dominant)" "" "0000667281" "0" "90" "X" "48933021" "48933021" "subst" "0" "00006" "WDR45_000047" "g.48933021A>G" "" "{PMID:Hayflick 2013:23435086}" "" "" "" "De novo" "" "" "0" "" "" "g.49075362A>G" "" "pathogenic (dominant)" "" "0000667282" "0" "90" "X" "48935754" "48935754" "subst" "0" "00006" "WDR45_000073" "g.48935754T>C" "" "{PMID:Hayflick 2013:23435086}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.49078095T>C" "" "pathogenic (dominant)" "" "0000667283" "0" "90" "X" "48935352" "48935352" "del" "0" "00006" "WDR45_000064" "g.48935352del" "" "{PMID:Hayflick 2013:23435086}" "" "186delT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.49077693del" "" "pathogenic (dominant)" "" "0000667284" "0" "90" "X" "48933270" "48933271" "del" "0" "00006" "WDR45_000013" "g.48933270_48933271del" "" "{PMID:Verhoeven 2014:24368176}" "" "" "" "De novo" "" "" "0" "" "" "g.49075611_49075612del" "" "pathogenic (dominant)" "" "0000667285" "0" "90" "X" "48933104" "48933106" "del" "0" "00006" "WDR45_000025" "g.48933104_48933106del" "" "{PMID:Verhoeven 2014:24368176}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.49075445_49075447del" "" "pathogenic (dominant)" "" "0000667286" "0" "90" "X" "48932518" "48932518" "del" "0" "00006" "WDR45_000002" "g.48932518del" "" "{PMID:Verhoeven 2014:24368176}" "" "" "" "De novo" "" "" "0" "" "" "g.49074859del" "" "pathogenic (dominant)" "" "0000667287" "0" "90" "X" "48934185" "48934185" "subst" "0" "00006" "WDR45_000059" "g.48934185T>G" "" "{PMID:Rathore 2014:24610255}" "" "NM_001029896.1:c.342-2A>C" "" "De novo" "" "" "0" "" "" "g.49076526T>G" "" "pathogenic (dominant)" "" "0000667288" "0" "90" "X" "48933022" "48933022" "subst" "0" "00006" "WDR45_000003" "g.48933022C>T" "" "{PMID:Ohba 2014:24621584}" "" "" "" "De novo" "" "" "0" "" "" "g.49075363C>T" "" "pathogenic (dominant)" "" "0000667289" "0" "90" "X" "48933525" "48933527" "del" "0" "00006" "WDR45_000050" "g.48933525_48933527del" "" "{PMID:Ichinose 2014:24790802}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.49075866_49075868del" "" "pathogenic (dominant)" "" "0000667290" "0" "90" "X" "48934328" "48934328" "del" "0" "00006" "WDR45_000060" "g.48934328del" "" "{PMID:Ozawa 2014:25044655}" "" "" "" "De novo" "" "" "0" "" "" "g.49076669del" "" "pathogenic (dominant)" "" "0000667291" "0" "90" "X" "48932903" "48932903" "subst" "0" "00006" "WDR45_000046" "g.48932903G>A" "" "{PMID:Okamoto 2014:25263061}" "" "" "" "De novo" "" "" "0" "96:4 skewed X-inactivation" "" "g.49075244G>A" "" "pathogenic (dominant)" "" "0000667292" "0" "90" "X" "48933558" "48933558" "del" "0" "00006" "WDR45_000052" "g.48933558del" "" "{PMID:Van Goethem 2015:25301227}" "" "" "" "De novo" "" "" "0" "" "" "g.49075899del" "" "pathogenic (dominant)" "" "0000667316" "0" "70" "X" "48935736" "48935736" "subst" "0" "00006" "WDR45_000070" "g.48935736G>A" "" "{PMID:Hamdan 2015:25356899}" "" "" "" "De novo" "" "" "0" "" "" "g.49078077G>A" "" "pathogenic (dominant)" "" "0000667321" "0" "90" "X" "48933306" "48933306" "subst" "0" "00006" "WDR45_000083" "g.48933306G>T" "" "{PMID:Tschentscher 2015:25592411}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.49075647G>T" "" "pathogenic (dominant)" "" "0000667322" "0" "90" "X" "48933345" "48933346" "del" "0" "00006" "WDR45_000074" "g.48933345_48933346del" "" "{PMID:Khalifa 2015:26096995}, comment {PMID:Thiffault 2016:27535217}" "" "" "" "De novo" "" "" "0" "" "" "g.49075686_49075687del" "" "pathogenic (dominant)" "" "0000667326" "0" "90" "X" "48933232" "48933241" "del" "0" "00006" "WDR45_000048" "g.48933232_48933241del" "" "{PMID:Paudel 2015:26123052}" "" "694_703delCTGCGCCGAG" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.49075573_49075582del" "" "pathogenic (dominant)" "" "0000667327" "0" "90" "X" "48922335" "48942321" "del" "0" "00006" "WDR45_000075" "g.(48915437_48922335)_(48942321_48967391)del" "" "{PMID:Abidi 2016:26173968}" "" "hg18 g.(48802381_48809279)_(48829265_48854335)del" "19.9 Kb deletion involving WDR45, CCDC120 and PRAF2" "De novo" "" "" "0" "" "" "g.(49057906_49064804)_(49085409_49110453)del" "" "pathogenic (dominant)" "" "0000667328" "0" "90" "X" "48932802" "48932802" "dup" "0" "00006" "WDR45_000106" "g.48932802dup" "" "{PMID:Nishioka 2015:25744623}" "" "969_970insT" "" "De novo" "" "" "0" "preferential expression variant allele" "" "g.49075143dup" "" "pathogenic (dominant)" "" "0000667329" "0" "90" "X" "48933345" "48933346" "del" "0" "00006" "WDR45_000074" "g.48933345_48933346del" "" "{PMID:Nishioka 2015:25744623}" "" "587_588delTA" "" "De novo" "" "" "0" "even expression both alleles" "" "g.49075686_49075687del" "" "pathogenic (dominant)" "" "0000667330" "0" "90" "X" "48934115" "48934120" "del" "0" "00006" "WDR45_000124" "g.48934115_48934120del" "" "{PMID:Nishioka 2015:25744623}" "" "414_419delGTTTGA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.49076456_49076461del" "" "pathogenic (dominant)" "" "0000667331" "0" "90" "X" "48933304" "48933304" "subst" "0" "00006" "WDR45_000115" "g.48933304A>G" "" "{PMID:Nishioka 2015:25744623}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.49075645A>G" "" "pathogenic (dominant)" "" "0000667332" "0" "90" "X" "48934128" "48934128" "subst" "0" "00006" "WDR45_000057" "g.48934128G>A" "" "{PMID:Nishioka 2015:25744623}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.49076469G>A" "" "pathogenic (dominant)" "" "0000667333" "0" "90" "X" "48933345" "48933346" "del" "0" "00006" "WDR45_000074" "g.48933345_48933346del" "" "{PMID:Nishioka 2015:25744623}" "" "587_588delTA" "" "De novo" "" "" "0" "even expression both alleles" "" "g.49075686_49075687del" "" "pathogenic (dominant)" "" "0000667334" "0" "90" "X" "48934355" "48934355" "subst" "0" "00006" "WDR45_000061" "g.48934355A>G" "" "{PMID:Nishioka 2015:25744623}" "" "" "" "Germline/De novo (untested)" "" "" "0" "preferential expression variant allele" "" "g.49076696A>G" "" "pathogenic (dominant)" "" "0000667335" "0" "90" "X" "48934184" "48934184" "subst" "0" "00006" "WDR45_000127" "g.48934184C>T" "" "{PMID:Ryu 2015:26022463}" "" "" "" "De novo" "" "" "0" "" "" "g.49076525C>T" "" "pathogenic (dominant)" "" "0000667336" "0" "90" "X" "48934397" "48934397" "subst" "0" "00006" "WDR45_000076" "g.48934397T>C" "" "{PMID:Long 2015:26240209}" "" "" "father not available" "Germline/De novo (untested)" "" "" "0" "" "" "g.49076738T>C" "" "pathogenic (dominant)" "" "0000667337" "0" "90" "X" "48932941" "48932941" "subst" "0" "00006" "WDR45_000077" "g.48932941C>G" "" "{PMID:Takano 2016:26481852}" "" "" "" "De novo" "" "" "0" "" "" "g.49075282C>G" "" "pathogenic (dominant)" "" "0000667340" "21" "90" "X" "48935377" "48935379" "del" "0" "00006" "WDR45_000078" "g.48935377_48935379del" "" "{PMID:Zarate 2016:26577041}, {DOI:Zarate 2016:10.1038/ejhg.2015.242}" "" "161_163delTGG" "mother mosaic" "Germline" "" "" "0" "" "" "g.49077718_49077720del" "{CV-SCV:000223914}" "pathogenic (dominant)" "" "0000667341" "0" "90" "X" "48934128" "48934128" "subst" "0" "00006" "WDR45_000057" "g.48934128G>A" "" "{PMID:Xixis 2015:26609730}" "" "" "" "De novo" "" "" "0" "" "" "g.49076469G>A" "" "pathogenic (dominant)" "" "0000667342" "0" "90" "X" "48933606" "48933606" "subst" "0" "00006" "WDR45_000079" "g.48933606T>C" "" "{PMID:Hoffjan 2016:26790960}" "" "" "" "De novo" "" "" "0" "" "" "g.49075947T>C" "" "pathogenic (dominant)" "" "0000667343" "0" "90" "X" "48933021" "48933021" "subst" "0" "00006" "WDR45_000047" "g.48933021A>G" "" "{PMID:Morisada 2016:27349085}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.49075362A>G" "" "pathogenic (dominant)" "" "0000667344" "0" "90" "X" "48932542" "48932543" "del" "0" "00006" "WDR45_000045" "g.48932542_48932543del" "" "{PMID:Spiegel 2016:27681470}" "" "1007_1008delAT" "lymphocytes 97.6% variant allele" "Somatic" "" "" "0" "" "" "g.49074883_49074884del" "" "pathogenic (dominant)" "" "0000667345" "0" "90" "X" "48933339" "48933340" "del" "0" "00006" "WDR45_000080" "g.48933339_48933340del" "" "{PMID:Wynn 2016:27957548}" "" "" "" "De novo" "" "" "0" "" "" "g.49075680_49075681del" "" "pathogenic (dominant)" "" "0000667346" "0" "90" "X" "48933525" "48933527" "del" "0" "00006" "WDR45_000081" "g.48933525_48933527del" "" "{PMID:Ingrassia 2017:28261264}" "" "Val173del" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.49075866_49075868del" "" "pathogenic (dominant)" "" "0000667347" "0" "90" "X" "48933598" "48933599" "del" "0" "00006" "WDR45_000082" "g.48933598_48933599del" "" "{PMID:Araújo 2017:28361255}" "" "" "" "De novo" "" "" "0" "" "" "g.49075939_49075940del" "" "pathogenic (dominant)" "" "0000667348" "0" "90" "X" "48933104" "48933106" "del" "0" "00006" "WDR45_000025" "g.48933104_48933106del" "" "{PMID:Redon 2017:28371320}" "" "752_754delCCT" "" "De novo" "" "" "0" "" "" "g.49075445_49075447del" "" "pathogenic (dominant)" "" "0000667352" "0" "90" "X" "48932941" "48932941" "subst" "0" "00006" "WDR45_000077" "g.48932941C>G" "" "{PMID:Morikawa 2017:28551038}" "" "" "" "De novo" "" "" "0" "" "" "g.49075282C>G" "" "pathogenic (dominant)" "" "0000667353" "0" "90" "X" "48933306" "48933306" "subst" "0" "00006" "WDR45_000083" "g.48933306G>T" "" "{PMID:Hattingen 2017:28643035}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.49075647G>T" "" "likely pathogenic (dominant)" "" "0000667354" "0" "90" "X" "48933022" "48933022" "subst" "0" "00006" "WDR45_000003" "g.48933022C>T" "" "{PMID:Takano 2018:28711740}" "" "" "no somatic mosaicims in blood" "De novo" "" "" "0" "" "" "g.49075363C>T" "" "pathogenic (dominant)" "" "0000667355" "0" "90" "X" "48935565" "48935565" "del" "0" "00006" "WDR45_000084" "g.48935565del" "" "{PMID:Fonderico 2017:28878728}" "" "64DeIT" "" "De novo" "" "" "0" "" "" "g.49077906del" "" "pathogenic (dominant)" "" "0000667356" "0" "90" "X" "48933232" "48933232" "subst" "0" "00006" "WDR45_000011" "g.48933232G>A" "" "{PMID:Endo 2017:28932395}" "" "" "" "De novo" "" "" "0" "" "" "g.49075573G>A" "" "pathogenic (dominant)" "" "0000667357" "0" "90" "X" "48933060" "48933060" "del" "0" "00006" "WDR45_000085" "g.48933060del" "" "{PMID:Burger 2017:29075622}" "" "795delT" "" "De novo" "" "" "0" "" "" "g.49075401del" "" "pathogenic (dominant)" "" "0000667359" "0" "90" "X" "48932461" "48935772" "del" "0" "00006" "WDR45_000086" "g.(?_48932461)_(48935772_?)del" "" "{PMID:Hermann 2017:29082105}" "" "del ex 3-8, 10, 12" "" "De novo" "" "" "0" "" "" "g.(?_49074802)_(49078113_?)del" "" "pathogenic (dominant)" "" "0000667367" "0" "70" "X" "48934328" "48934329" "del" "0" "00006" "WDR45_000087" "g.48934328_48934329del" "" "{PMID:Kulikovskaja 2018:29600274}" "" "319_320delCT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.49076669_49076670del" "" "likely pathogenic (dominant)" "" "0000667370" "0" "50" "X" "48935735" "48935735" "subst" "3.91782E-5" "00006" "WDR45_000088" "g.48935735C>T" "" "{PMID:Kulikovskaja 2018:29600274}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.49078076C>T" "" "likely benign" "" "0000667374" "0" "90" "X" "48934430" "48934430" "subst" "0" "00006" "WDR45_000089" "g.48934430T>C" "" "{PMID:Willoughby 2018:29681108}" "" "" "" "De novo" "" "" "0" "" "" "g.49076771T>C" "" "pathogenic (dominant)" "" "0000667387" "0" "90" "X" "48933303" "48933303" "del" "0" "00006" "WDR45_000095" "g.48933303del" "" "{PMID:Carvill 2018:29171013}" "" "629delG (S210X)" "" "De novo" "" "" "0" "mild X-inactivation 84:16" "" "g.49075644del" "" "pathogenic (dominant)" "" "0000667388" "0" "90" "X" "48932542" "48932543" "del" "0" "00006" "WDR45_000045" "g.48932542_48932543del" "" "{PMID:Carvill 2018:29171013}" "" "" "" "De novo" "" "" "0" "" "" "g.49074883_49074884del" "" "pathogenic (dominant)" "" "0000667389" "0" "90" "X" "48933232" "48933232" "subst" "0" "00006" "WDR45_000011" "g.48933232G>A" "" "{PMID:Carvill 2018:29171013}" "" "" "" "De novo" "" "" "0" "nromal X-inactivation 49:50" "" "g.49075573G>A" "" "pathogenic (dominant)" "" "0000667390" "0" "90" "X" "48933306" "48933306" "del" "0" "00006" "WDR45_000116" "g.48933306del" "" "{PMID:Carvill 2018:29171013}" "" "" "" "De novo" "" "" "0" "skewed X-inactivation 92:8" "" "g.49075647del" "" "pathogenic (dominant)" "" "0000667391" "0" "90" "X" "48933590" "48933590" "del" "0" "00006" "WDR45_000094" "g.48933590del" "" "{PMID:Carvill 2018:29171013}" "" "454delT" "" "De novo" "" "" "0" "" "" "g.49075931del" "" "pathogenic (dominant)" "" "0000667392" "0" "90" "X" "48933206" "48933206" "subst" "0" "00006" "WDR45_000113" "g.48933206G>C" "" "{PMID:Carvill 2018:29171013}" "" "" "" "De novo" "" "" "0" "" "" "g.49075547G>C" "" "pathogenic (dominant)" "" "0000667393" "0" "90" "X" "48933318" "48933318" "subst" "0" "00006" "WDR45_000117" "g.48933318C>T" "" "{PMID:Carvill 2018:29171013}" "" "" "" "De novo" "" "" "0" "no skewed X-inactivation 34:66" "" "g.49075659C>T" "" "pathogenic (dominant)" "" "0000667394" "0" "90" "X" "48935407" "48935407" "subst" "0" "00006" "WDR45_000090" "g.48935407C>T" "" "{PMID:Nakashima 2016:27030146}" "" "" ">99% variant allele in blood leukocytes, saliva, hair root and nail" "De novo" "" "" "0" "" "" "g.49077748C>T" "" "pathogenic (dominant)" "" "0000667395" "0" "90" "X" "48934400" "48934400" "subst" "0" "00006" "WDR45_000131" "g.48934400C>T" "" "{PMID:Nakashima 2016:27030146}" "" "" ">99% variant allele in blood leukocytes, saliva, hair root and nail" "De novo" "" "" "0" "" "" "g.49076741C>T" "" "pathogenic (dominant)" "" "0000667396" "0" "90" "X" "48934128" "48934128" "subst" "0" "00006" "WDR45_000057" "g.48934128G>A" "" "{PMID:Nakashima 2016:27030146}" "" "" "low level somatic mosaicism nails mother" "Germline/De novo (untested)" "" "" "0" "" "" "g.49076469G>A" "" "pathogenic (dominant)" "" "0000667398" "0" "90" "X" "48933381" "48933381" "del" "0" "00006" "WDR45_000118" "g.48933381del" "" "{PMID:Srivastava 2018:29322350}" "" "551delC" "" "De novo" "" "" "0" "" "" "g.49075722del" "" "pathogenic (dominant)" "" "0000667405" "0" "90" "X" "48935301" "48935301" "subst" "0" "00006" "WDR45_000091" "g.48935301C>A" "" "{PMID:Percy 2018:29682453}" "" "" "" "De novo" "" "" "0" "random X-inactivation" "" "g.49077642C>A" "" "pathogenic (dominant)" "" "0000667410" "0" "90" "X" "48935313" "48935313" "subst" "0" "00006" "WDR45_000092" "g.48935313G>T" "" "{PMID:Ishiyama 2018:29695595}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.49077654G>T" "" "pathogenic (dominant)" "" "0000667411" "0" "90" "X" "48935501" "48935501" "dup" "0" "00006" "WDR45_000093" "g.48935501dup" "" "{PMID:Ishiyama 2018:29695595}" "" "125dupA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.49077842dup" "" "pathogenic (dominant)" "" "0000667412" "0" "90" "X" "48934399" "48934399" "subst" "0" "00006" "WDR45_000029" "g.48934399C>T" "" "{PMID:Lim 2018:29860786}" "" "" "" "Germline" "" "" "0" "" "" "g.49076740C>T" "" "pathogenic (dominant)" "" "0000667413" "0" "90" "X" "48935736" "48935736" "subst" "0" "00006" "WDR45_000070" "g.48935736G>A" "" "{PMID:Chen 2019:29981852}" "" "" "" "De novo" "" "" "0" "" "" "g.49078077G>A" "" "pathogenic (dominant)" "" "0000667414" "0" "90" "X" "48934127" "48934127" "subst" "0" "00006" "WDR45_000126" "g.48934127C>G" "" "{PMID:Chen 2019:29981852}" "" "" "" "De novo" "" "" "0" "" "" "g.49076468C>G" "" "pathogenic (dominant)" "" "0000667415" "0" "90" "X" "48933541" "48933541" "subst" "0" "00006" "WDR45_000120" "g.48933541C>T" "" "{PMID:Chen 2019:29981852}" "" "" "" "De novo" "" "" "0" "" "" "g.49075882C>T" "" "pathogenic (dominant)" "" "0000667416" "0" "90" "X" "48933232" "48933232" "subst" "0" "00006" "WDR45_000011" "g.48933232G>A" "" "{PMID:Chen 2019:29981852}" "" "" "" "De novo" "" "" "0" "" "" "g.49075573G>A" "" "pathogenic (dominant)" "" "0000667417" "0" "90" "X" "48932859" "48932859" "del" "0" "00006" "WDR45_000109" "g.48932859del" "" "{PMID:Chen 2019:29981852}" "" "" "912delT" "De novo" "" "" "0" "" "" "g.49075200del" "" "pathogenic (dominant)" "" "0000667418" "0" "90" "X" "48932492" "48932492" "subst" "0" "00006" "WDR45_000096" "g.48932492G>C" "" "{PMID:Uchino 2015:30713893}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.49074833G>C" "" "pathogenic (dominant)" "" "0000667420" "0" "90" "X" "48933525" "48933527" "del" "0" "00006" "WDR45_000050" "g.48933525_48933527del" "" "{PMID:Seibler 2018:30169597}" "" "519+1_519+3delGTG" "" "Germline/De novo (untested)" "" "" "0" "skewed X-inactivation blood (88:12)" "" "g.49075866_49075868del" "" "pathogenic (dominant)" "" "0000667422" "0" "90" "X" "48934087" "48934087" "subst" "0" "00006" "WDR45_000123" "g.48934087A>C" "" "{PMID:Rohani 2019:30455156}" "" "" "" "De novo" "" "" "0" "" "" "g.49076428A>C" "" "pathogenic (dominant)" "" "0000667423" "0" "90" "X" "48934119" "48934119" "dup" "0" "00006" "WDR45_000101" "g.48934119dup" "" "{PMID:Rohani 2019:30455156}" "" "412insT" "" "De novo" "" "" "0" "" "" "g.49076460dup" "" "pathogenic (dominant)" "" "0000667424" "0" "90" "X" "48933126" "48933126" "subst" "0" "00006" "WDR45_000111" "g.48933126T>C" "" "{PMID:Rohani 2019:30455156}" "" "" "" "De novo" "" "" "0" "" "" "g.49075467T>C" "" "pathogenic (dominant)" "" "0000667425" "0" "90" "X" "48932572" "48932572" "subst" "0" "00006" "WDR45_000097" "g.48932572C>T" "" "{PMID:Liu 2018:30539914}" "" "977-1C>T" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.49074913C>T" "" "pathogenic (dominant)" "" "0000667426" "0" "90" "X" "48932850" "48932850" "del" "0" "00006" "WDR45_000108" "g.48932850del" "" "{PMID:Russo 2018:30746416}" "" "921delA" "" "De novo" "" "" "0" "" "" "g.49075191del" "" "pathogenic (dominant)" "" "0000667427" "0" "90" "X" "48933565" "48933565" "subst" "0" "00006" "WDR45_000121" "g.48933565A>C" "" "{PMID:Russo 2018:30746416}" "" "" "" "De novo" "" "" "0" "" "" "g.49075906A>C" "" "pathogenic (dominant)" "" "0000667428" "0" "90" "X" "48934397" "48934397" "del" "0" "00006" "WDR45_000130" "g.48934397del" "" "{PMID:Russo 2018:30746416}" "" "251delA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.49076738del" "" "pathogenic (dominant)" "" "0000667429" "0" "90" "X" "48934303" "48934303" "subst" "0" "00006" "WDR45_000128" "g.48934303C>T" "" "{PMID:Russo 2018:30746416}" "" "" "" "De novo" "" "" "0" "" "" "g.49076644C>T" "" "pathogenic (dominant)" "" "0000667430" "0" "50" "X" "48935526" "48935526" "subst" "0.00015741" "00006" "WDR45_000021" "g.48935526C>T" "" "{PMID:Russo 2018:30746416}" "" "" "" "De novo" "" "" "0" "" "" "g.49077867C>T" "" "VUS" "" "0000667445" "0" "90" "X" "48932511" "48932512" "del" "0" "00006" "WDR45_000098" "g.48932511_48932512del" "" "Xiao 2018, {PMID:Xiong 2019:31332960}" "" "" "" "De novo" "" "" "0" "" "" "g.49074852_49074853del" "" "pathogenic (dominant)" "" "0000667446" "0" "90" "X" "48935340" "48935340" "subst" "0" "00006" "WDR45_000099" "g.48935340A>T" "" "{PMID:Khoury 2019:31466010}" "" "" "" "De novo" "" "" "0" "" "" "g.49077681A>T" "" "pathogenic (dominant)" "" "0000667447" "0" "90" "X" "48932903" "48932903" "subst" "0" "00006" "WDR45_000046" "g.48932903G>A" "" "{PMID:Kaleka 2019:31632858}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.49075244G>A" "" "pathogenic (dominant)" "" "0000667448" "0" "90" "X" "48934299" "48934299" "subst" "0" "00006" "WDR45_000100" "g.48934299C>T" "" "{PMID:Özgün 2020:32253879}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.49076640C>T" "" "pathogenic (dominant)" "" "0000667449" "0" "90" "X" "48934119" "48934119" "dup" "0" "00006" "WDR45_000101" "g.48934119dup" "" "{PMID:Sato 2020:32307390}" "" "411dupT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.49076460dup" "" "pathogenic (dominant)" "" "0000667450" "21" "90" "X" "48933022" "48933022" "subst" "0" "00006" "WDR45_000003" "g.48933022C>T" "" "{PMID:Adang 2020:32387008}" "" "" "inherited from reportedly asymptomatic mother" "Germline" "" "" "0" "" "" "g.49075363C>T" "" "pathogenic (dominant)" "" "0000667451" "0" "90" "X" "48932525" "48932528" "del" "0" "00006" "WDR45_000105" "g.48932525_48932528del" "" "{PMID:Adang 2020:32387008}" "" "1020_1023delTGAT" "" "De novo" "" "" "0" "" "" "g.49074866_49074869del" "" "pathogenic (dominant)" "" "0000667452" "0" "90" "X" "48933232" "48933232" "subst" "0" "00006" "WDR45_000011" "g.48933232G>A" "" "{PMID:Adang 2020:32387008}" "" "" "" "De novo" "" "" "0" "" "" "g.49075573G>A" "" "pathogenic (dominant)" "" "0000667453" "0" "90" "X" "48933523" "48933523" "subst" "0" "00006" "WDR45_000119" "g.48933523A>G" "" "{PMID:Adang 2020:32387008}" "" "" "" "De novo" "" "" "0" "" "" "g.49075864A>G" "" "pathogenic (dominant)" "" "0000667454" "0" "90" "X" "48934349" "48934349" "subst" "0" "00006" "WDR45_000129" "g.48934349A>G" "" "{PMID:Adang 2020:32387008}" "" "chrX:48934349 A>G (Phe100Ser)" "" "De novo" "" "" "0" "" "" "g.49076690A>G" "" "pathogenic (dominant)" "" "0000667455" "0" "90" "X" "48933202" "48933202" "subst" "0" "00006" "WDR45_000112" "g.48933202A>T" "" "{PMID:Adang 2020:32387008}" "" "" "" "De novo" "" "" "0" "" "" "g.49075543A>T" "" "pathogenic (dominant)" "" "0000667456" "0" "90" "X" "48933125" "48933125" "subst" "0" "00006" "WDR45_000110" "g.48933125C>T" "" "{PMID:Adang 2020:32387008}" "" "" "" "De novo" "" "" "0" "" "" "g.49075466C>T" "" "pathogenic (dominant)" "" "0000667457" "21" "90" "X" "48935736" "48935736" "subst" "0" "00006" "WDR45_000070" "g.48935736G>A" "" "{PMID:Adang 2020:32387008}" "" "" "inherited from reportedly asymptomatic mother" "Germline" "" "" "0" "" "" "g.49078077G>A" "" "pathogenic (dominant)" "" "0000667458" "0" "90" "X" "48935753" "48935753" "subst" "0" "00006" "WDR45_000135" "g.48935753A>T" "" "{PMID:Adang 2020:32387008}" "" "" "" "De novo" "" "" "0" "" "" "g.49078094A>T" "" "pathogenic (dominant)" "" "0000667459" "21" "90" "X" "48933599" "48933603" "del" "0" "00006" "WDR45_000122" "g.48933599_48933603del" "" "{PMID:Adang 2020:32387008}" "" "442_446delCTCTG" "inherited from reportedly asymptomatic mother" "Germline" "" "" "0" "" "" "g.49075940_49075944del" "" "pathogenic (dominant)" "" "0000667460" "0" "90" "X" "48932820" "48932829" "del" "0" "00006" "WDR45_000107" "g.48932820_48932829del" "" "{PMID:Adang 2020:32387008}" "" "" "" "De novo" "" "" "0" "" "" "g.49075161_49075170del" "" "pathogenic (dominant)" "" "0000667461" "0" "90" "X" "48933022" "48933022" "subst" "0" "00006" "WDR45_000003" "g.48933022C>T" "" "{PMID:Adang 2020:32387008}" "" "" "" "De novo" "" "" "0" "" "" "g.49075363C>T" "" "pathogenic (dominant)" "" "0000667462" "0" "90" "X" "48934116" "48934116" "subst" "0" "00006" "WDR45_000125" "g.48934116C>A" "" "{PMID:Adang 2020:32387008}" "" "" "" "De novo" "" "" "0" "" "" "g.49076457C>A" "" "pathogenic (dominant)" "" "0000667463" "21" "90" "X" "48935735" "48935741" "dup" "0" "00006" "WDR45_000134" "g.48935735_48935741dup" "" "{PMID:Adang 2020:32387008}" "" "14_20dupCACTTCG" "inherited from reportedly asymptomatic mother" "Germline" "" "" "0" "" "" "g.49078076_49078082dup" "" "pathogenic (dominant)" "" "0000667464" "0" "90" "X" "48935703" "48935703" "subst" "0" "00006" "WDR45_000132" "g.48935703G>A" "" "{PMID:Adang 2020:32387008}" "" "" "" "De novo" "" "" "0" "" "" "g.49078044G>A" "" "pathogenic (dominant)" "" "0000667465" "0" "90" "X" "48933214" "48933214" "dup" "0" "00006" "WDR45_000114" "g.48933214dup" "" "{PMID:Adang 2020:32387008}" "" "718dupA" "" "De novo" "" "" "0" "" "" "g.49075555dup" "" "pathogenic (dominant)" "" "0000667466" "21" "90" "X" "48933125" "48933125" "subst" "0" "00006" "WDR45_000110" "g.48933125C>T" "" "{PMID:Adang 2020:32387008}" "" "" "inherited from reportedly asymptomatic mother" "Germline" "" "" "0" "" "" "g.49075466C>T" "" "pathogenic (dominant)" "" "0000667467" "0" "90" "X" "48932542" "48932543" "del" "0" "00006" "WDR45_000045" "g.48932542_48932543del" "" "{PMID:Stige 2018:29445477}" "" "" "" "De novo" "" "" "0" "" "" "g.49074883_49074884del" "" "pathogenic (dominant)" "" "0000667471" "0" "90" "X" "48933073" "48933073" "del" "0" "00006" "WDR45_000102" "g.48933073del" "" "{PMID:Fieremans 2016:27159028}" "" "NM_001029896.1:c.777delT" "RNA expression only variant allele" "De novo" "" "" "0" "skewed X-inactivation 1:0, skewed X-inactivation (7:93 pat:mat)" "" "g.49075414del" "" "pathogenic" "" "0000667551" "0" "90" "X" "48933232" "48933232" "subst" "0" "00006" "WDR45_000011" "g.48933232G>A" "" "{PMID:Helbig 2016:26795593}" "" "" "" "De novo" "" "" "0" "" "" "g.49075573G>A" "" "pathogenic (dominant)" "ACMG" "0000667579" "0" "90" "X" "48935709" "48935709" "subst" "0" "00006" "WDR45_000133" "g.48935709G>A" "" "{PMID:Helbig 2016:26795593}" "" "" "likely de novo" "Germline/De novo (untested)" "" "" "0" "" "" "g.49078050G>A" "" "pathogenic (dominant)" "ACMG" "0000667640" "1" "50" "X" "0" "0" "" "0" "00006" "WDR45_000103" "g.pter_48958100delins[NC_000011.9:118359082_qterinv]" "" "{PMID:Brassesco 2018:30553463}" "" "" "" "Somatic" "" "" "0" "" "t(X;11)(p11.2;q23)" "" "" "VUS" "" "0000667644" "1" "50" "X" "0" "0" "" "0" "00006" "WDR45_000104" "g.[NC_000017.10:36871301_qter]delins[NC_000011.9:118353384_118359081];pter_48958100inv" "" "{PMID:Brassesco 2018:30553463}" "" "" "" "DUPLICATE record" "" "" "0" "" "t(X;11;17)(p11.2;q23;q12)" "" "" "VUS" "" "0000682481" "0" "30" "X" "48933363" "48933363" "subst" "0.000107981" "01943" "WDR45_000136" "g.48933363T>C" "" "" "" "WDR45(NM_001029896.2):c.566A>G (p.(Asn189Ser)), WDR45(NM_007075.3):c.569A>G (p.N190S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000682482" "0" "90" "X" "48933525" "48933527" "del" "0" "01804" "WDR45_000050" "g.48933525_48933527del" "" "" "" "WDR45(NM_001029896.1):c.516+1_516+3delGTG (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000693631" "0" "30" "X" "48930139" "48930139" "subst" "0" "01943" "WDR45_000137" "g.48930139G>A" "" "" "" "PRAF2(NM_007213.3):c.350C>T (p.A117V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000728980" "0" "30" "X" "48932824" "48932824" "subst" "0.000179247" "02325" "WDR45_000008" "g.48932824T>G" "" "" "" "WDR45(NM_001029896.1):c.944A>C (p.(Asn315Thr)), WDR45(NM_007075.3):c.947A>C (p.N316T), WDR45(NM_007075.4):c.947A>C (p.N316T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000728981" "0" "90" "X" "48935407" "48935407" "subst" "0" "02327" "WDR45_000138" "g.48935407C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000787080" "0" "90" "X" "48932542" "48932543" "del" "0" "00006" "WDR45_000045" "g.48932542_48932543del" "" "{PMID:Ganapathy 2019:31069529}" "" "" "" "Germline" "" "" "0" "" "" "g.49074883_49074884del" "" "pathogenic" "" "0000788903" "0" "70" "X" "48933381" "48933381" "del" "0" "00006" "WDR45_000118" "g.48933381del" "" "{PMID:Srivastava 2014:25131622}" "" "551delC" "" "De novo" "" "" "0" "" "" "g.49075722del" "" "likely pathogenic" "" "0000790855" "0" "50" "X" "48933326" "48933326" "subst" "0" "01741" "WDR45_000139" "g.48933326G>T" "" "" "" "" "" "Germline/De novo (untested)" "" "" "" "" "" "" "" "VUS" "" "0000791109" "0" "90" "X" "48933558" "48933558" "del" "0" "01164" "WDR45_000052" "g.48933558del" "" "" "" "" "ACMG: PVS1, PS2, PM2_SUP (PMID:25301227)" "Germline/De novo (untested)" "?" "" "0" "" "" "g.49075899del" "" "pathogenic (dominant)" "ACMG" "0000810463" "0" "50" "X" "48935414" "48935414" "subst" "5.84689E-5" "01943" "WDR45_000140" "g.48935414G>T" "" "" "" "WDR45(NM_007075.3):c.131-8C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000823740" "0" "50" "X" "48932790" "48932790" "subst" "0" "02494" "WDR45_000141" "g.48932790C>T" "" "" "" "" "" "De novo" "" "" "" "" "" "" "" "VUS" "" "0000856661" "0" "50" "X" "48931605" "48931605" "subst" "2.95118E-5" "01943" "WDR45_000142" "g.48931605G>T" "" "" "" "PRAF2(NM_007213.3):c.42C>A (p.D14E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000856663" "0" "90" "X" "48935354" "48935354" "subst" "0" "02327" "WDR45_000065" "g.48935354G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000867419" "0" "30" "X" "48932500" "48932500" "subst" "5.5929E-6" "01943" "WDR45_000143" "g.48932500C>T" "" "" "" "WDR45(NM_007075.3):c.1048G>A (p.D350N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000867420" "0" "30" "X" "48932832" "48932832" "subst" "0.00031919" "01943" "WDR45_000144" "g.48932832G>A" "" "" "" "WDR45(NM_007075.3):c.939C>T (p.F313=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000869042" "0" "70" "X" "48932867" "48932871" "del" "0" "00006" "WDR45_000145" "g.48932867_48932871del" "" "{PMID:Schuermans 2022:35606766}" "" "" "ACMG PVS1, PP3, PM2" "De novo" "" "" "0" "" "" "g.49075208_49075212del" "" "likely pathogenic (recessive)" "" "0000904848" "1" "70" "X" "48932941" "48932941" "subst" "0" "00006" "WDR45_000023" "g.48932941C>T" "" "{PMID:Al-Kasbi 2022:36344539}" "" "" "" "Germline" "" "" "0" "" "" "g.49075282C>T" "" "likely pathogenic (dominant)" "" "0000908898" "0" "70" "X" "48933018" "48933018" "subst" "0" "00006" "WDR45_000146" "g.48933018C>G" "" "{PMID:Bournazos 2022:34906502}" "" "" "intron retention, cryptic splice donor" "Germline/De novo (untested)" "" "" "0" "" "" "g.49075359C>G" "" "likely pathogenic (dominant)" "" "0000933175" "21" "50" "X" "48932930" "48932930" "subst" "0.00668116" "00006" "WDR45_000010" "g.48932930C>T" "" "{PMID:Masunaga 2022:36224347}" "" "" "" "Germline" "" "" "0" "" "" "g.49075271C>T" "" "VUS" "" "0000984724" "0" "30" "X" "48933363" "48933363" "subst" "0.000107981" "01804" "WDR45_000136" "g.48933363T>C" "" "" "" "WDR45(NM_001029896.2):c.566A>G (p.(Asn189Ser)), WDR45(NM_007075.3):c.569A>G (p.N190S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000984725" "0" "30" "X" "48934417" "48934417" "subst" "0" "02325" "WDR45_000147" "g.48934417G>T" "" "" "" "WDR45(NM_007075.4):c.236-5C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001006801" "0" "50" "X" "48930134" "48930134" "subst" "0" "01804" "WDR45_000148" "g.48930134C>G" "" "" "" "PRAF2(NM_007213.1):c.355G>C (p.(Gly119Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001006802" "0" "30" "X" "48931576" "48931576" "subst" "0" "01804" "WDR45_000149" "g.48931576G>A" "" "" "" "PRAF2(NM_007213.1):c.71C>T (p.(Ala24Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001006803" "0" "50" "X" "48932526" "48932526" "subst" "0" "01804" "WDR45_000150" "g.48932526T>C" "" "" "" "WDR45(NM_001029896.1):c.1019A>G (p.(Asp340Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001006804" "0" "30" "X" "48932811" "48932811" "subst" "1.12164E-5" "02325" "WDR45_000151" "g.48932811G>A" "" "" "" "WDR45(NM_007075.4):c.960C>T (p.N320=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001006805" "0" "10" "X" "48932930" "48932930" "subst" "0.00668116" "02329" "WDR45_000010" "g.48932930C>T" "" "" "" "WDR45(NM_001029896.1):c.838G>A (p.(Val280Met)), WDR45(NM_007075.3):c.841G>A (p.V281M), WDR45(NM_007075.4):c.841G>A (p.V281M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001006806" "0" "50" "X" "48933033" "48933033" "subst" "0" "01804" "WDR45_000042" "g.48933033G>A" "" "" "" "WDR45(NM_001029896.1):c.817C>T (p.(Arg273Cys)), WDR45(NM_007075.3):c.820C>T (p.R274C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001006807" "0" "30" "X" "48934309" "48934309" "subst" "0" "02325" "WDR45_000018" "g.48934309A>T" "" "" "" "WDR45(NM_007075.3):c.339T>A (p.H113Q), WDR45(NM_007075.4):c.339T>A (p.H113Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001006808" "0" "30" "X" "48935335" "48935335" "subst" "0" "01804" "WDR45_000152" "g.48935335C>T" "" "" "" "WDR45(NM_001029896.1):c.202G>A (p.(Gly68Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001011982" "0" "90" "X" "48934128" "48934128" "subst" "0" "00006" "WDR45_000057" "g.48934128G>A" "" "{PMID:Salinas 2020:33084218}" "" "NM_001029896:c400C>T" "" "Unknown" "" "" "0" "" "" "g.49076469G>A" "SUB7803621" "pathogenic" "" "0001017795" "20" "70" "X" "48933288" "48933288" "subst" "0" "03544" "WDR45_000153" "g.48933288C>A" "" "" "" "" "identified as de novo X-linked variant in hemizygous state in male" "De novo" "-" "" "0" "" "" "g.49075629C>A" "{CV:3383969}" "likely pathogenic" "ACMG" "0001022065" "0" "70" "X" "48935390" "48935390" "subst" "0" "04796" "WDR45_000039" "g.48935390G>A" "" "" "" "" "effect on RNA exon skipping" "Germline/De novo (untested)" "" "" "0" "" "" "g.49077731G>A" "" "likely pathogenic" "" "0001027510" "0" "50" "X" "48935526" "48935526" "subst" "0.00015741" "02325" "WDR45_000021" "g.48935526C>T" "" "" "" "WDR45(NM_001029896.1):c.100G>A (p.(Val34Met)), WDR45(NM_007075.3):c.100G>A (p.V34M), WDR45(NM_007075.4):c.100G>A (p.V34M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001044372" "0" "70" "X" "48932791" "48932791" "del" "0" "01804" "WDR45_000154" "g.48932791del" "" "" "" "WDR45(NM_001029896.2):c.973+4del" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001044373" "0" "50" "X" "48935365" "48935365" "subst" "0" "01804" "WDR45_000155" "g.48935365G>A" "" "" "" "WDR45(NM_001029896.2):c.172C>T (p.(His58Tyr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes WDR45 ## Count = 218 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000006844" "00000550" "50" "-17" "-2247" "-17" "-2247" "c.-17-2247T>C" "r.(=)" "p.(=)" "" "0000014809" "00000550" "50" "-17" "-2247" "-17" "-2247" "c.-17-2247T>C" "r.(=)" "p.(=)" "" "0000040289" "00000550" "90" "1030" "0" "1030" "0" "c.1030del" "r.(?)" "p.(Cys344Alafs*67)" "9" "0000079404" "00000550" "00" "344" "2" "344" "2" "c.344+2T>A" "r.spl?" "p.?" "" "0000079531" "00000550" "00" "830" "1" "830" "1" "c.830+1G>A" "r.spl?" "p.?" "" "0000079535" "00000550" "00" "3" "0" "3" "0" "c.3G>C" "r.(?)" "p.(Met1?)" "" "0000079537" "00000550" "00" "3" "0" "3" "0" "c.3G>C" "r.(?)" "p.(Met1?)" "" "0000236476" "00000550" "90" "875" "0" "876" "0" "c.875_876insCCGT" "r.(?)" "p.(Asp293Argfs*15)" "" "0000254448" "00000550" "30" "339" "0" "339" "0" "c.339T>A" "r.(?)" "p.(His113Gln)" "" "0000313062" "00000550" "30" "236" "-22" "236" "-22" "c.236-22G>A" "r.(=)" "p.(=)" "" "0000313063" "00000550" "30" "354" "0" "354" "0" "c.354C>T" "r.(?)" "p.(Ile118=)" "" "0000313064" "00000550" "30" "977" "-10" "977" "-10" "c.977-10C>A" "r.(=)" "p.(=)" "" "0000313708" "00000550" "90" "381" "0" "381" "0" "c.381C>G" "r.(?)" "p.(Tyr127Ter)" "" "0000315396" "00000550" "90" "466" "0" "466" "0" "c.466G>T" "r.(?)" "p.(Glu156Ter)" "" "0000315397" "00000550" "90" "700" "0" "700" "0" "c.700C>T" "r.(?)" "p.(Arg234Ter)" "" "0000319850" "00000550" "50" "100" "0" "100" "0" "c.100G>A" "r.(?)" "p.(Val34Met)" "" "0000319851" "00000550" "10" "235" "18" "235" "18" "c.235+18G>T" "r.(=)" "p.(=)" "" "0000319852" "00000550" "30" "354" "0" "354" "0" "c.354C>T" "r.(?)" "p.(Ile118=)" "" "0000319853" "00000550" "30" "381" "0" "381" "0" "c.381C>T" "r.(?)" "p.(Tyr127=)" "" "0000319854" "00000550" "90" "662" "0" "663" "0" "c.662_663del" "r.(?)" "p.(Phe221Ter)" "" "0000319855" "00000550" "30" "666" "0" "666" "0" "c.666C>T" "r.(?)" "p.(Asp222=)" "" "0000319856" "00000550" "30" "841" "0" "841" "0" "c.841G>A" "r.(?)" "p.(Val281Met)" "" "0000319857" "00000550" "50" "947" "0" "947" "0" "c.947A>C" "r.(?)" "p.(Asn316Thr)" "" "0000319858" "00000550" "30" "99" "0" "99" "0" "c.99C>T" "r.(?)" "p.(Asn33=)" "" "0000334052" "00000550" "30" "2067" "0" "2067" "0" "c.*981C>T" "r.(=)" "p.(=)" "" "0000334053" "00000550" "50" "895" "0" "895" "0" "c.895G>A" "r.(?)" "p.(Ala299Thr)" "" "0000334054" "00000550" "30" "841" "0" "841" "0" "c.841G>A" "r.(?)" "p.(Val281Met)" "" "0000334055" "00000550" "50" "100" "0" "100" "0" "c.100G>A" "r.(?)" "p.(Val34Met)" "" "0000338320" "00000550" "70" "3457" "0" "3457" "0" "c.*2371G>A" "r.(=)" "p.(=)" "" "0000338321" "00000550" "10" "235" "18" "235" "18" "c.235+18G>T" "r.(=)" "p.(=)" "" "0000339148" "00000550" "90" "743" "0" "747" "0" "c.743_747dup" "r.(?)" "p.(Ser250ThrfsTer40)" "" "0000349856" "00000550" "70" "249" "0" "249" "0" "c.249G>A" "r.(?)" "p.(Trp83Ter)" "" "0000351243" "00000550" "70" "831" "-1" "831" "-1" "c.831-1G>A" "r.spl?" "p.?" "" "0000351244" "00000550" "90" "830" "2" "830" "2" "c.830+2T>A" "r.spl?" "p.?" "" "0000351721" "00000550" "70" "519" "1" "519" "1" "c.519+1G>A" "r.spl" "p.?" "8i" "0000398631" "00000550" "90" "772" "0" "820" "0" "c.772_820delinsTCT" "r.(?)" "p.(Asp258Serfs*15)" "" "0000404717" "00000550" "90" "700" "0" "700" "0" "c.700C>T" "r.(?)" "p.(Arg234*)" "9" "0000576309" "00000550" "30" "947" "0" "947" "0" "c.947A>C" "r.(?)" "p.(Asn316Thr)" "" "0000576310" "00000550" "90" "752" "0" "754" "0" "c.752_754del" "r.(?)" "p.(Ser251del)" "" "0000576311" "00000550" "70" "698" "0" "698" "0" "c.698G>A" "r.(?)" "p.(Arg233His)" "" "0000576312" "00000550" "70" "697" "0" "697" "0" "c.697C>T" "r.(?)" "p.(Arg233Cys)" "" "0000576313" "00000550" "90" "620" "0" "621" "0" "c.620_621dup" "r.(?)" "p.(Val208Ter)" "" "0000576314" "00000550" "30" "592" "0" "592" "0" "c.592T>C" "r.(?)" "p.(Cys198Arg)" "" "0000576315" "00000550" "50" "439" "10" "439" "10" "c.439+10C>T" "r.(=)" "p.(=)" "" "0000576317" "00000550" "10" "354" "0" "354" "0" "c.354C>T" "r.(?)" "p.(Ile118=)" "" "0000576318" "00000550" "50" "295" "0" "295" "0" "c.295G>C" "r.(?)" "p.(Glu99Gln)" "" "0000576319" "00000550" "50" "147" "0" "147" "0" "c.147C>T" "r.(?)" "p.(Gly49=)" "" "0000576320" "00000550" "50" "82" "0" "82" "0" "c.82G>A" "r.(?)" "p.(Gly28Ser)" "" "0000619647" "00000550" "30" "439" "18" "439" "18" "c.439+18C>T" "r.(=)" "p.(=)" "" "0000619648" "00000550" "10" "235" "18" "235" "18" "c.235+18G>T" "r.(=)" "p.(=)" "" "0000659346" "00000550" "50" "820" "0" "820" "0" "c.820C>T" "r.(?)" "p.(Arg274Cys)" "" "0000667206" "00000550" "70" "55" "1" "55" "1" "c.55+1G>A" "r.spl" "p.(?)" "" "0000667254" "00000550" "90" "1007" "0" "1008" "0" "c.1007_1008del" "r.(?)" "p.(Tyr336Cysfs*5)" "" "0000667255" "00000550" "90" "38" "0" "38" "0" "c.38G>C" "r.[(38g>c,-17_55del)]" "p.[(Arg13Pro,Thr2_Met25del)]" "" "0000667256" "00000550" "90" "-1" "0" "5" "0" "c.-1_5del" "r.(?)" "p.0?" "" "0000667257" "00000550" "90" "293" "0" "293" "0" "c.293T>C" "r.(?)" "p.(Leu98Pro)" "" "0000667258" "00000550" "90" "476" "0" "476" "0" "c.476del" "r.(?)" "p.(Leu159Argfs*2)" "" "0000667259" "00000550" "90" "19" "0" "19" "0" "c.19C>T" "r.(?)" "p.(Arg7*)" "" "0000667260" "00000550" "90" "56" "-1" "56" "-1" "c.56-1G>A" "r.spl" "p.?" "" "0000667261" "00000550" "90" "700" "0" "700" "0" "c.700C>T" "r.(?)" "p.(Arg234*)" "" "0000667262" "00000550" "90" "400" "0" "400" "0" "c.400C>T" "r.(?)" "p.(Arg134*)" "" "0000667263" "00000550" "90" "228" "0" "229" "0" "c.228_229del" "r.(?)" "p.(Glu76Aspfs*38)" "" "0000667264" "00000550" "90" "405" "0" "409" "0" "c.405_409del" "r.(?)" "p.(Lys135Asnfs*2)" "" "0000667265" "00000550" "90" "359" "0" "359" "0" "c.359dup" "r.(?)" "p.(Lys121Glufs*18)" "" "0000667266" "00000550" "90" "830" "1" "830" "1" "c.830+1G>A" "r.spl" "p.?" "" "0000667267" "00000550" "90" "19" "0" "19" "0" "c.19dup" "r.(?)" "p.(Arg7Profs*64)" "" "0000667268" "00000550" "90" "235" "1" "235" "1" "c.235+1G>A" "r.spl" "p.?" "" "0000667269" "00000550" "90" "1007" "0" "1008" "0" "c.1007_1008del" "r.(?)" "p.(Tyr336Cysfs*5)" "" "0000667270" "00000550" "90" "694" "0" "703" "0" "c.694_703del" "r.(?)" "p.(Leu232Alafs*53)" "" "0000667271" "00000550" "90" "183" "0" "183" "0" "c.183C>A" "r.(?)" "p.(Asn61Lys)" "" "0000667272" "00000550" "90" "1025" "0" "1034" "0" "c.1025_1034delinsACATATTT" "r.(?)" "p.(Gly342Aspfs*12)" "" "0000667273" "00000550" "10" "763" "0" "763" "0" "c.763G>T" "r.(?)" "p.(Ala255Ser)" "" "0000667275" "00000550" "90" "439" "1" "439" "1" "c.439+1G>T" "r.439_440ins[u;439+2_439+24]" "p.[al147_Leu148ins8" "" "0000667276" "00000550" "90" "519" "0" "519" "0" "c.519G>C" "r.519_520ins519+1_519+22" "p.Asp174Valfs*29" "" "0000667277" "00000550" "90" "437" "0" "437" "0" "c.437dup" "r.437dup" "p.Leu148Alafs*3" "" "0000667278" "00000550" "90" "637" "0" "637" "0" "c.637C>T" "r.637c>u" "p.Gln213*" "" "0000667279" "00000550" "90" "1033" "0" "1034" "0" "c.1033_1034dup" "r.1033_1034dup" "p.Asn345Lysfs*67" "" "0000667280" "00000550" "90" "55" "1" "55" "1" "c.55+1G>C" "r.spl" "p.?" "" "0000667281" "00000550" "90" "830" "2" "830" "2" "c.830+2T>C" "r.spl" "p.?" "" "0000667282" "00000550" "90" "1" "0" "1" "0" "c.1A>G" "r.(?)" "p.0?" "" "0000667283" "00000550" "90" "186" "0" "186" "0" "c.186del" "r.(?)" "p.(Leu63Trpfs*19)" "" "0000667284" "00000550" "90" "662" "0" "663" "0" "c.662_663del" "r.(?)" "p.(Phe221*)" "" "0000667285" "00000550" "90" "752" "0" "754" "0" "c.752_754del" "r.(?)" "p.(Ser251del)" "" "0000667286" "00000550" "90" "1030" "0" "1030" "0" "c.1030del" "r.(?)" "p.Cys344fs" "" "0000667287" "00000550" "90" "345" "-2" "345" "-2" "c.345-2A>C" "r.spl?" "p.?" "" "0000667288" "00000550" "90" "830" "1" "830" "1" "c.830+1G>A" "r.830_831ins[a;830+2_831-1]" "p.Leu278*" "" "0000667289" "00000550" "90" "519" "1" "519" "3" "c.519+1_519+3del" "r.spl" "p.?" "" "0000667290" "00000550" "90" "322" "0" "322" "0" "c.322del" "r.(?)" "p.(Ser108Leufs*10)" "" "0000667291" "00000550" "90" "868" "0" "868" "0" "c.868C>T" "r.(?)" "p.(Gln290*)" "" "0000667292" "00000550" "90" "488" "0" "488" "0" "c.488del" "r.(?)" "p.(Pro163Argfs*34)" "" "0000667316" "00000550" "70" "19" "0" "19" "0" "c.19C>T" "r.(?)" "p.(Arg7*)" "" "0000667321" "00000550" "90" "626" "0" "626" "0" "c.626C>A" "r.(?)" "p.(Ala209Asp)" "" "0000667322" "00000550" "90" "587" "0" "588" "0" "c.587_588del" "r.(?)" "p.(Ile196Serfs*26)" "" "0000667326" "00000550" "90" "694" "0" "703" "0" "c.694_703del" "r.(?)" "p.(Leu232Alafs*53)" "" "0000667327" "00000550" "90" "0" "0" "0" "0" "c.-439_*370[0]" "r.0" "p.0" "_1_12_" "0000667328" "00000550" "90" "969" "0" "969" "0" "c.969dup" "r.969dup" "p.Val324Cysfs*18" "" "0000667329" "00000550" "90" "587" "0" "588" "0" "c.587_588del" "r.587_588del" "p.Ile196Serfs*26" "" "0000667330" "00000550" "90" "414" "0" "419" "0" "c.414_419del" "r.(?)" "p.(Glu138_Phe139del)" "" "0000667331" "00000550" "90" "628" "0" "628" "0" "c.628T>C" "r.(?)" "p.(Ser210Pro)" "" "0000667332" "00000550" "90" "400" "0" "400" "0" "c.400C>T" "r.(?)" "p.(Arg134*)" "" "0000667333" "00000550" "90" "587" "0" "588" "0" "c.587_588del" "r.587_588del" "p.Ile196Serfs*26" "" "0000667334" "00000550" "90" "293" "0" "293" "0" "c.293T>C" "r.293u>c" "p.Leu98Pro" "" "0000667335" "00000550" "90" "345" "-1" "345" "-1" "c.345-1G>A" "r.345_439del" "p.Ile116Alafs*3" "" "0000667336" "00000550" "90" "251" "0" "251" "0" "c.251A>G" "r.(?)" "p.(Asp84Gly)" "" "0000667337" "00000550" "90" "831" "-1" "831" "-1" "c.831-1G>C" "r.[830_831ins[830+1-831-1;c],831_976del]" "p.?" "" "0000667340" "00000550" "90" "161" "0" "163" "0" "c.161_163del" "r.(?)" "p.(Val54del)" "" "0000667341" "00000550" "90" "400" "0" "400" "0" "c.400C>T" "r.(?)" "p.(Arg134*)" "" "0000667342" "00000550" "90" "440" "-2" "440" "-2" "c.440-2A>G" "r.spl" "p.?" "" "0000667343" "00000550" "90" "830" "2" "830" "2" "c.830+2T>C" "r.spl?" "p.?" "" "0000667344" "00000550" "90" "1007" "0" "1008" "0" "c.1007_1008del" "r.(?)" "p.(Tyr336Cysfs*5)" "" "0000667345" "00000550" "90" "597" "0" "598" "0" "c.597_598del" "r.(?)" "p.(Leu201Lysfs*21)" "" "0000667346" "00000550" "90" "519" "1" "519" "3" "c.519+1_519+3del" "r.spl?" "p.?" "" "0000667347" "00000550" "90" "447" "0" "448" "0" "c.447_448del" "r.(?)" "p.(Cys149*)" "" "0000667348" "00000550" "90" "752" "0" "754" "0" "c.752_754del" "r.(?)" "p.(Ser251del)" "" "0000667352" "00000550" "90" "831" "-1" "831" "-1" "c.831-1G>C" "r.spl" "p.?" "" "0000667353" "00000550" "90" "626" "0" "626" "0" "c.626C>A" "r.(?)" "p.(Ala209Asp)" "" "0000667354" "00000550" "90" "830" "1" "830" "1" "c.830+1G>A" "r.830_831ins[a;830+2_831-1]" "p.Leu278*" "" "0000667355" "00000550" "90" "64" "0" "64" "0" "c.64del" "r.(?)" "p.(Cys22Alafs*16)" "" "0000667356" "00000550" "90" "700" "0" "700" "0" "c.700C>T" "r.(?)" "p.(Arg234*)" "" "0000667357" "00000550" "90" "795" "0" "795" "0" "c.795del" "r.(?)" "p.(Phe265Leufs*23)" "" "0000667359" "00000550" "90" "-17" "-1" "1087" "0" "c.(?_-17-1)_(*1_?)del" "r.0?" "p.0?" "" "0000667367" "00000550" "70" "319" "0" "320" "0" "c.319_320del" "r.(?)" "p.(Leu107Phefs*7)" "" "0000667370" "00000550" "50" "20" "0" "20" "0" "c.20G>A" "r.(?)" "p.(Arg7Gln)" "" "0000667374" "00000550" "90" "236" "-18" "236" "-18" "c.236-18A>G" "r.[131_235del;235_236ins236-17_236-1]" "p.(=)" "" "0000667387" "00000550" "90" "629" "0" "629" "0" "c.629del" "r.(?)" "p.(Ser210*)" "" "0000667388" "00000550" "90" "1007" "0" "1008" "0" "c.1007_1008del" "r.(?)" "p.(Tyr336Cysfs*5)" "" "0000667389" "00000550" "90" "700" "0" "700" "0" "c.700C>T" "r.(?)" "p.(Arg234*)" "" "0000667390" "00000550" "90" "627" "0" "627" "0" "c.627del" "r.(?)" "p.(Ser210Glnfs*78)" "" "0000667391" "00000550" "90" "454" "0" "454" "0" "c.454del" "r.(?)" "p.(Cys152Alafs*9)" "" "0000667392" "00000550" "90" "726" "0" "726" "0" "c.726C>G" "r.(?)" "p.(Tyr242*)" "" "0000667393" "00000550" "90" "614" "0" "614" "0" "c.614G>A" "r.(?)" "p.(Gly205Asp)" "" "0000667394" "00000550" "90" "131" "-1" "131" "-1" "c.131-1G>A" "r.131_141del" "p.Asp44Glyfs*23" "" "0000667395" "00000550" "90" "248" "0" "248" "0" "c.248G>A" "r.(?)" "p.(Trp83*)" "" "0000667396" "00000550" "90" "400" "0" "400" "0" "c.400C>T" "r.(?)" "p.(Arg134*)" "" "0000667398" "00000550" "90" "551" "0" "551" "0" "c.551del" "r.(?)" "p.(Ser184Leufs*13)" "" "0000667405" "00000550" "90" "235" "1" "235" "1" "c.235+1G>T" "r.spl" "p.?" "" "0000667410" "00000550" "90" "224" "0" "224" "0" "c.224C>A" "r.(?)" "p.(Ser75*)" "" "0000667411" "00000550" "90" "125" "0" "125" "0" "c.125dup" "r.(?)" "p.(His42Glnfs*29)" "" "0000667412" "00000550" "90" "249" "0" "249" "0" "c.249G>A" "r.(?)" "p.(Trp83*)" "" "0000667413" "00000550" "90" "19" "0" "19" "0" "c.19C>T" "r.(?)" "p.(Arg7*)" "" "0000667414" "00000550" "90" "401" "0" "401" "0" "c.401G>C" "r.(?)" "p.(Arg134Pro)" "" "0000667415" "00000550" "90" "503" "0" "503" "0" "c.503G>A" "r.(?)" "p.(Gly168Glu)" "" "0000667416" "00000550" "90" "700" "0" "700" "0" "c.700C>T" "r.(?)" "p.(Arg234*)" "" "0000667417" "00000550" "90" "912" "0" "912" "0" "c.912del" "r.(?)" "p.(Ala305Leufs*25)" "" "0000667418" "00000550" "90" "1056" "0" "1056" "0" "c.1056C>G" "r.(?)" "p.(Tyr352*)" "" "0000667420" "00000550" "90" "519" "1" "519" "3" "c.519+1_519+3del" "r.519_520ins519+4_519+22" "p.Asp174Serfs*28" "" "0000667422" "00000550" "90" "439" "2" "439" "2" "c.439+2T>G" "r.spl" "p.?" "" "0000667423" "00000550" "90" "411" "0" "411" "0" "c.411dup" "r.(?)" "p.(Glu138*)" "" "0000667424" "00000550" "90" "729" "-2" "729" "-2" "c.729-2A>G" "r.spl" "p.?" "" "0000667425" "00000550" "90" "977" "-1" "977" "-1" "c.977-1G>A" "r.spl" "p.?" "" "0000667426" "00000550" "90" "921" "0" "921" "0" "c.921del" "r.(?)" "p.(Ala308Leufs*22)" "" "0000667427" "00000550" "90" "479" "0" "479" "0" "c.479T>G" "r.(?)" "p.(Leu160Arg)" "" "0000667428" "00000550" "90" "251" "0" "251" "0" "c.251del" "r.(?)" "p.(Asp84Alafs*34)" "" "0000667429" "00000550" "90" "344" "1" "344" "1" "c.344+1G>A" "r.spl" "p.?" "" "0000667430" "00000550" "50" "100" "0" "100" "0" "c.100G>A" "r.(?)" "p.(Val34Met)" "" "0000667445" "00000550" "90" "1040" "0" "1041" "0" "c.1040_1041del" "r.(?)" "p.(Glu347Glyfs*7)" "" "0000667446" "00000550" "90" "197" "0" "197" "0" "c.197T>A" "r.(?)" "p.(Val66Glu)" "" "0000667447" "00000550" "90" "868" "0" "868" "0" "c.868C>T" "r.(?)" "p.(Gln290*)" "" "0000667448" "00000550" "90" "344" "5" "344" "5" "c.344+5G>A" "r.spl?" "p.?" "" "0000667449" "00000550" "90" "411" "0" "411" "0" "c.411dup" "r.(?)" "p.(Glu138*)" "" "0000667450" "00000550" "90" "830" "1" "830" "1" "c.830+1G>A" "r.spl" "p.?" "" "0000667451" "00000550" "90" "1020" "0" "1023" "0" "c.1020_1023del" "r.(?)" "p.(Asp341Glufs*69)" "" "0000667452" "00000550" "90" "700" "0" "700" "0" "c.700C>T" "r.(?)" "p.(Arg234*)" "" "0000667453" "00000550" "90" "519" "2" "519" "2" "c.519+2T>C" "r.spl" "p.?" "" "0000667454" "00000550" "90" "299" "0" "299" "0" "c.299T>C" "r.(?)" "p.(Phe100Ser)" "" "0000667455" "00000550" "90" "728" "2" "728" "2" "c.728+2T>A" "r.spl" "p.?" "" "0000667456" "00000550" "90" "729" "-1" "729" "-1" "c.729-1G>A" "r.spl" "p.?" "" "0000667457" "00000550" "90" "19" "0" "19" "0" "c.19C>T" "r.(?)" "p.(Arg7*)" "" "0000667458" "00000550" "90" "2" "0" "2" "0" "c.2T>A" "r.(?)" "p.0?" "" "0000667459" "00000550" "90" "442" "0" "446" "0" "c.442_446del" "r.(?)" "p.(Leu148*)" "" "0000667460" "00000550" "90" "944" "0" "953" "0" "c.944_953del" "r.(?)" "p.(Arg315Profs*12)" "" "0000667461" "00000550" "90" "830" "1" "830" "1" "c.830+1G>A" "r.spl" "p.?" "" "0000667462" "00000550" "90" "412" "0" "412" "0" "c.412G>T" "r.(?)" "p.(Glu138*)" "" "0000667463" "00000550" "90" "14" "0" "20" "0" "c.14_20dup" "r.(?)" "p.(Gly8Thrfs*65)" "" "0000667464" "00000550" "90" "52" "0" "52" "0" "c.52C>T" "r.(?)" "p.(Gln18*)" "" "0000667465" "00000550" "90" "718" "0" "718" "0" "c.718dup" "r.(?)" "p.(Thr240Asnfs*6)" "" "0000667466" "00000550" "90" "729" "-1" "729" "-1" "c.729-1G>A" "r.spl" "p.?" "" "0000667467" "00000550" "90" "1007" "0" "1008" "0" "c.1007_1008del" "r.(?)" "p.(Tyr336Cysfs*5)" "" "0000667471" "00000550" "90" "780" "0" "780" "0" "c.780del" "r.780del" "p.Thr261Leufs*27" "" "0000667551" "00000550" "90" "700" "0" "700" "0" "c.700C>T" "r.(?)" "p.(Arg234*)" "" "0000667579" "00000550" "90" "46" "0" "46" "0" "c.46C>T" "r.(?)" "p.(Gln16*)" "" "0000667640" "00000550" "50" "0" "0" "0" "0" "-" "r.?" "p.?" "_1" "0000667644" "00000550" "50" "0" "0" "0" "0" "-" "r.?" "p.?" "_1" "0000682481" "00000550" "30" "569" "0" "569" "0" "c.569A>G" "r.(?)" "p.(Asn190Ser)" "" "0000682482" "00000550" "90" "519" "1" "519" "3" "c.519+1_519+3del" "r.spl?" "p.?" "" "0000693631" "00000550" "30" "3409" "0" "3409" "0" "c.*2323C>T" "r.(=)" "p.(=)" "" "0000728980" "00000550" "30" "947" "0" "947" "0" "c.947A>C" "r.(?)" "p.(Asn316Thr)" "" "0000728981" "00000550" "90" "131" "-1" "131" "-1" "c.131-1G>C" "r.spl?" "p.?" "" "0000787080" "00000550" "90" "1007" "0" "1008" "0" "c.1007_1008del" "r.(?)" "p.(Tyr336CysfsTer5)" "12" "0000788903" "00000550" "70" "551" "0" "551" "0" "c.551delC" "r.(?)" "p.(Ser184LeufsTer13)" "" "0000790855" "00000550" "50" "606" "0" "606" "0" "c.606C>A" "r.(?)" "p.(Asn202Lys)" "" "0000791109" "00000550" "90" "488" "0" "488" "0" "c.488del" "r.(?)" "p.(Pro163Argfs*34)" "" "0000810463" "00000550" "50" "131" "-8" "131" "-8" "c.131-8C>A" "r.(=)" "p.(=)" "" "0000823740" "00000550" "50" "976" "5" "976" "5" "c.976+5G>A" "r.spl?" "p.?" "" "0000856661" "00000550" "50" "1943" "0" "1943" "0" "c.*857C>A" "r.(=)" "p.(=)" "" "0000856663" "00000550" "90" "183" "0" "183" "0" "c.183C>A" "r.(?)" "p.(Asn61Lys)" "" "0000867419" "00000550" "30" "1048" "0" "1048" "0" "c.1048G>A" "r.(?)" "p.(Asp350Asn)" "" "0000867420" "00000550" "30" "939" "0" "939" "0" "c.939C>T" "r.(?)" "p.(Phe313=)" "" "0000869042" "00000550" "70" "902" "0" "906" "0" "c.902_906del" "r.(?)" "p.(Phe301CysfsTer4)" "" "0000904848" "00000550" "70" "831" "-1" "831" "-1" "c.831-1G>A" "r.spl" "p.?" "" "0000908898" "00000550" "70" "830" "5" "830" "5" "c.830+5G>C" "r.[830_831ins[gugac;830+6_831-1],779_830del]" "p.[Leu278*,Thr261Trpfs*10]" "" "0000933175" "00000550" "50" "841" "0" "841" "0" "c.841G>A" "r.(?)" "p.(Val281Met)" "" "0000984724" "00000550" "30" "569" "0" "569" "0" "c.569A>G" "r.(?)" "p.(Asn190Ser)" "" "0000984725" "00000550" "30" "236" "-5" "236" "-5" "c.236-5C>A" "r.spl?" "p.?" "" "0001006801" "00000550" "50" "3414" "0" "3414" "0" "c.*2328G>C" "r.(=)" "p.(=)" "" "0001006802" "00000550" "30" "1972" "0" "1972" "0" "c.*886C>T" "r.(=)" "p.(=)" "" "0001006803" "00000550" "50" "1022" "0" "1022" "0" "c.1022A>G" "r.(?)" "p.(Asp341Gly)" "" "0001006804" "00000550" "30" "960" "0" "960" "0" "c.960C>T" "r.(?)" "p.(=)" "" "0001006805" "00000550" "10" "841" "0" "841" "0" "c.841G>A" "r.(?)" "p.(Val281Met)" "" "0001006806" "00000550" "50" "820" "0" "820" "0" "c.820C>T" "r.(?)" "p.(Arg274Cys)" "" "0001006807" "00000550" "30" "339" "0" "339" "0" "c.339T>A" "r.(?)" "p.(His113Gln)" "" "0001006808" "00000550" "30" "202" "0" "202" "0" "c.202G>A" "r.(?)" "p.(Gly68Ser)" "" "0001011982" "00000550" "90" "400" "0" "400" "0" "c.400C>T" "r.(?)" "p.(Arg134Ter)" "" "0001017795" "00000550" "70" "644" "0" "644" "0" "c.644G>T" "r.(?)" "p.(Gly215Val)" "9" "0001022065" "00000550" "70" "147" "0" "147" "0" "c.147C>T" "r.[131_235del,=]" "p.[Asp44_Ser78del,Gly49=]" "4" "0001027510" "00000550" "50" "100" "0" "100" "0" "c.100G>A" "r.(?)" "p.(Val34Met)" "" "0001044372" "00000550" "70" "976" "4" "976" "4" "c.976+4del" "r.spl?" "p.?" "" "0001044373" "00000550" "50" "172" "0" "172" "0" "c.172C>T" "r.(?)" "p.(His58Tyr)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 155 "{{screeningid}}" "{{variantid}}" "0000000209" "0000006844" "0000000210" "0000014809" "0000019833" "0000040289" "0000050424" "0000079404" "0000050551" "0000079531" "0000050555" "0000079535" "0000050557" "0000079537" "0000145363" "0000236476" "0000152882" "0000351721" "0000175761" "0000398631" "0000181081" "0000404717" "0000303810" "0000667206" "0000303852" "0000667254" "0000303853" "0000667255" "0000303854" "0000667256" "0000303855" "0000667257" "0000303856" "0000667258" "0000303857" "0000667259" "0000303858" "0000667260" "0000303859" "0000667261" "0000303860" "0000667262" "0000303861" "0000667263" "0000303862" "0000667264" "0000303863" "0000667265" "0000303864" "0000667266" "0000303865" "0000667267" "0000303866" "0000667268" "0000303867" "0000667269" "0000303868" "0000667270" "0000303869" "0000667271" "0000303870" "0000667272" "0000303871" "0000667273" "0000303873" "0000667275" "0000303874" "0000667276" "0000303875" "0000667277" "0000303876" "0000667278" "0000303877" "0000667279" "0000303878" "0000667280" "0000303879" "0000667281" "0000303880" "0000667282" "0000303881" "0000667283" "0000303882" "0000667284" "0000303883" "0000667285" "0000303884" "0000667286" "0000303885" "0000667287" "0000303886" "0000667288" "0000303887" "0000667289" "0000303888" "0000667290" "0000303889" "0000667291" "0000303890" "0000667292" "0000303914" "0000667316" "0000303935" "0000667321" "0000303936" "0000667322" "0000303937" "0000667326" "0000303938" "0000667327" "0000303939" "0000667328" "0000303940" "0000667329" "0000303941" "0000667330" "0000303942" "0000667331" "0000303943" "0000667332" "0000303944" "0000667333" "0000303945" "0000667334" "0000303946" "0000667335" "0000303947" "0000667336" "0000303948" "0000667337" "0000303951" "0000667340" "0000303952" "0000667341" "0000303953" "0000667342" "0000303954" "0000667343" "0000303955" "0000667344" "0000303956" "0000667345" "0000303957" "0000667346" "0000303958" "0000667347" "0000303959" "0000667348" "0000303962" "0000667352" "0000303963" "0000667353" "0000303964" "0000667354" "0000303965" "0000667355" "0000303966" "0000667356" "0000303967" "0000667357" "0000303969" "0000667359" "0000303976" "0000667367" "0000303980" "0000667370" "0000303981" "0000667374" "0000303996" "0000667387" "0000303997" "0000667388" "0000303998" "0000667389" "0000303999" "0000667390" "0000304000" "0000667391" "0000304001" "0000667392" "0000304002" "0000667393" "0000304003" "0000667394" "0000304004" "0000667395" "0000304005" "0000667396" "0000304007" "0000667398" "0000304014" "0000667405" "0000304019" "0000667410" "0000304020" "0000667411" "0000304021" "0000667412" "0000304022" "0000667413" "0000304023" "0000667414" "0000304024" "0000667415" "0000304025" "0000667416" "0000304026" "0000667417" "0000304028" "0000667418" "0000304029" "0000667420" "0000304030" "0000667422" "0000304031" "0000667423" "0000304032" "0000667424" "0000304033" "0000667425" "0000304034" "0000667426" "0000304035" "0000667427" "0000304036" "0000667428" "0000304037" "0000667429" "0000304037" "0000667430" "0000304047" "0000667445" "0000304048" "0000667446" "0000304049" "0000667447" "0000304050" "0000667448" "0000304051" "0000667449" "0000304052" "0000667450" "0000304053" "0000667451" "0000304054" "0000667452" "0000304055" "0000667453" "0000304056" "0000667454" "0000304057" "0000667455" "0000304058" "0000667456" "0000304059" "0000667457" "0000304060" "0000667458" "0000304061" "0000667459" "0000304062" "0000667460" "0000304063" "0000667461" "0000304064" "0000667462" "0000304065" "0000667463" "0000304066" "0000667464" "0000304067" "0000667465" "0000304068" "0000667466" "0000304069" "0000667467" "0000304073" "0000667471" "0000304153" "0000667551" "0000304181" "0000667579" "0000304215" "0000667640" "0000304215" "0000667644" "0000375729" "0000787080" "0000376848" "0000788903" "0000378176" "0000790855" "0000378358" "0000791109" "0000393120" "0000823740" "0000411131" "0000933175" "0000411805" "0000869042" "0000427488" "0000904848" "0000429425" "0000908898" "0000457479" "0001011982" "0000459697" "0001017795" "0000462538" "0001022065"