### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ###
## Filter: (gene_public = XYLT1)
# charset = UTF-8

## Genes ## Do not remove or alter this header ##
## Count = 1
"{{id}}"	"{{name}}"	"{{chromosome}}"	"{{chrom_band}}"	"{{imprinting}}"	"{{refseq_genomic}}"	"{{refseq_UD}}"	"{{reference}}"	"{{url_homepage}}"	"{{url_external}}"	"{{allow_download}}"	"{{id_hgnc}}"	"{{id_entrez}}"	"{{id_omim}}"	"{{show_hgmd}}"	"{{show_genecards}}"	"{{show_genetests}}"	"{{show_orphanet}}"	"{{note_index}}"	"{{note_listing}}"	"{{refseq}}"	"{{refseq_url}}"	"{{disclaimer}}"	"{{disclaimer_text}}"	"{{header}}"	"{{header_align}}"	"{{footer}}"	"{{footer_align}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"	"{{updated_by}}"	"{{updated_date}}"
"XYLT1"	"xylosyltransferase I"	"16"	"p12"	"unknown"	"NG_015843.1"	"UD_132118491713"	""	"http://www.LOVD.nl/XYLT1"	""	"1"	"15516"	"64131"	"608124"	"1"	"1"	"1"	"1"	"Establishment of this gene variant database (LSDB) was supported by the <a href=\'http://www.LUMC.nl\' target=\'_blank\'>Leiden University Medical Center (LUMC)</a>, Leiden, Nederland."	""	"g"	"http://databases.lovd.nl/shared/refseq/XYLT1_codingDNA.html"	"1"	""	""	"-1"	""	"-1"	"00001"	"2013-05-03 00:00:00"	"00006"	"2015-12-02 07:24:53"	"00000"	"2025-11-01 13:22:20"


## Transcripts ## Do not remove or alter this header ##
## Count = 1
"{{id}}"	"{{geneid}}"	"{{name}}"	"{{id_mutalyzer}}"	"{{id_ncbi}}"	"{{id_ensembl}}"	"{{id_protein_ncbi}}"	"{{id_protein_ensembl}}"	"{{id_protein_uniprot}}"	"{{remarks}}"	"{{position_c_mrna_start}}"	"{{position_c_mrna_end}}"	"{{position_c_cds_end}}"	"{{position_g_mrna_start}}"	"{{position_g_mrna_end}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"
"00022949"	"XYLT1"	"xylosyltransferase I"	"001"	"NM_022166.3"	""	"NP_071449.1"	""	""	""	"-85"	"9251"	"2880"	"17564738"	"17196181"	""	"0000-00-00 00:00:00"	""	""


## Diseases ## Do not remove or alter this header ##
## Count = 7
"{{id}}"	"{{symbol}}"	"{{name}}"	"{{inheritance}}"	"{{id_omim}}"	"{{tissues}}"	"{{features}}"	"{{remarks}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"
"00000"	"Healthy/Control"	"Healthy individual / control"	""	""	""	""	""	"00000"	"2012-07-26 17:29:43"	""	""
"00198"	"?"	"unclassified / mixed"	""	""	""	""	""	"00006"	"2013-09-13 14:21:47"	"00006"	"2024-11-23 09:38:12"
"00397"	"DBQD2"	"dysplasia, Desbuquois, type 2 (DBQD-2)"	"AR"	"615777"	""	""	""	"00006"	"2014-06-03 13:15:44"	"00006"	"2021-12-10 21:51:32"
"02035"	"PXE"	"pseudoxanthoma elasticum (PXE)"	"AR"	"264800"	""	""	""	"00006"	"2014-09-25 23:29:40"	"00006"	"2021-12-10 21:51:32"
"05541"	"DBQD"	"dysplasia, Desbuquois (DBQD)"	""	""	""	""	""	"00006"	"2018-12-25 13:35:59"	""	""
"05542"	"BSS"	"Baratela-Scott syndrome (BSS)"	""	"300881"	""	"autosomal recessive"	""	"00006"	"2018-12-25 16:52:39"	"00006"	"2021-12-10 21:51:32"
"05611"	"NDD"	"neurodevelopmental disorder (NDD)"	""	""	""	""	""	"00006"	"2019-06-19 12:27:20"	"00006"	"2024-12-13 11:12:21"


## Genes_To_Diseases ## Do not remove or alter this header ##
## Count = 4
"{{geneid}}"	"{{diseaseid}}"
"XYLT1"	"00397"
"XYLT1"	"02035"
"XYLT1"	"05541"
"XYLT1"	"05542"


## Individuals ## Do not remove or alter this header ##
## Count = 44
"{{id}}"	"{{fatherid}}"	"{{motherid}}"	"{{panelid}}"	"{{panel_size}}"	"{{license}}"	"{{owned_by}}"	"{{Individual/Reference}}"	"{{Individual/Remarks}}"	"{{Individual/Gender}}"	"{{Individual/Consanguinity}}"	"{{Individual/Origin/Geographic}}"	"{{Individual/Age_of_death}}"	"{{Individual/VIP}}"	"{{Individual/Data_av}}"	"{{Individual/Treatment}}"	"{{Individual/Origin/Population}}"	"{{Individual/Individual_ID}}"
"00016858"	""	""	""	"2"	""	"00705"	"{PMID:Bui 2014:24581741}"	"2-generation family, 2 affecteds (F,  M), unaffected heterozygous carrier parents"	"F"	"yes"	"Tunisia"	""	"0"	""	""	"Tunisian"	""
"00016859"	""	""	"00016858"	"1"	""	"00705"	"{PMID:Bui 2014:24581741}"	"brother of 24581741-Fam1.1"	"M"	"yes"	"Tunisia"	""	"0"	""	""	"Tunisian"	""
"00016881"	""	""	""	"1"	""	"00705"	"{PMID:Bui 2014:24581741}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents (1st cousins)"	"F"	"yes"	"Mauritius"	""	"0"	""	""	"Mauritian"	""
"00016882"	""	""	""	"1"	""	"00705"	"{PMID:Bui 2014:24581741}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents (1st cousins)"	"M"	"yes"	"(Belgium)"	""	"0"	""	""	"Belgian"	""
"00016883"	""	""	""	"1"	""	"00705"	"{PMID:Bui 2014:24581741}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents (1st cousins)"	"?"	"yes"	"Turkey"	""	"0"	""	""	"Turkish"	""
"00016887"	""	""	""	"1"	""	"00705"	"{PMID:Bui 2014:24581741}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents (1st cousins)"	"?"	"yes"	"Turkey"	""	"0"	""	""	"Turkish"	""
"00016888"	""	""	""	"1"	""	"00705"	"{PMID:Bui 2014:24581741}"	"2-generation family, 1 affected , unaffected heterozygous carrier parents (from same village)"	"?"	"?"	"Turkey"	""	"0"	""	""	"Turkish"	""
"00054880"	""	""	""	"1"	""	"01709"	"{PMID:Silveira 2016:27481334}"	""	"F"	"yes"	"(Brazil)"	""	"0"	""	""	""	"Pat"
"00108467"	""	""	""	"1"	""	"01239"	"{PMID:Hendee 2017:28722276}, {DOI:Hendee 2017:10.1002/humu.23299}"	"3-generation family, 10 affecteds (6F, 4M), PatIII3"	"M"	""	"United States"	""	"0"	""	""	"white"	"28722276-FamPatIII3"
"00210011"	""	""	""	"2"	""	"00006"	"{PMID:Schreml 2014:23982343}"	"3-generation family, affected sister/brother, unaffected heterozygous carrier parents"	"F;M"	"yes"	"Turkey"	""	"0"	""	""	""	"23982343-Fam"
"00210012"	""	""	""	"1"	""	"00006"	"{PMID:Jamsheer 2016:27030147}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	""	"no"	"Poland"	""	"0"	""	""	""	"27030147-Pat"
"00210013"	""	""	""	"1"	""	"00006"	"{PMID:Guo 2017:27881841}"	"2-generation family, affected sisters, unaffected heterozygous carrier parents"	"F"	""	"Turkey"	""	"0"	""	""	""	"27881841-Fam1"
"00210014"	""	""	""	"1"	""	"00006"	"{PMID:Guo 2017:27881841}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	"F"	""	"Turkey"	""	"0"	""	""	""	"27881841-Fam2"
"00210015"	""	""	""	"1"	""	"00006"	"{PMID:Van Koningsbruggen 2016:26601923}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	"M"	"no"	"Netherlands"	""	"0"	""	""	""	"26601923-FamPat"
"00210016"	""	""	""	"1"	""	"00006"	"{PMID:Al-Jezawi 2017:28462984}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents (cousins)"	"M"	"yes"	"United Arab Emirates"	""	"0"	""	""	""	"28462984"
"00210017"	""	""	""	"1"	""	"00006"	"{PMID:Schön 2006:16571645}"	"analysis 64 PXE cases"	""	""	"Germany"	""	"0"	""	""	""	"16571645-Pats"
"00210018"	""	""	""	"6"	""	"00006"	"{PMID:Schön 2006:16571645}"	"analysis 64 PXE cases"	""	""	"Germany"	""	"0"	""	""	""	"16571645-Pats"
"00210019"	""	""	""	"10"	""	"00006"	"{PMID:Schön 2006:16571645}"	"analysis 64 PXE cases"	""	""	"Germany"	""	"0"	""	""	""	"16571645-Pats"
"00210020"	""	""	""	"1"	""	"00006"	"{PMID:Schön 2006:16571645}"	"analysis 64 PXE cases"	""	""	"Germany"	""	"0"	""	""	""	"16571645-Pats"
"00210021"	""	""	""	"21"	""	"00006"	"{PMID:Schön 2006:16571645}"	"analysis 64 PXE cases"	""	""	"Germany"	""	"0"	""	""	""	"16571645-Pats"
"00210022"	""	""	""	"56"	""	"00006"	"{PMID:Schön 2006:16571645}"	"analysis 64 PXE cases"	""	""	"Germany"	""	"0"	""	""	""	"16571645-Pats"
"00210023"	""	""	""	"1"	""	"00006"	"{PMID:Schön 2006:16571645}"	"analysis 64 PXE cases"	""	""	"Germany"	""	"0"	""	""	""	"16571645-Pats"
"00210024"	""	""	""	"17"	""	"00006"	"{PMID:Schön 2006:16571645}"	"analysis 64 PXE cases"	""	""	"Germany"	""	"0"	""	""	""	"16571645-Pats"
"00210039"	""	""	""	"1"	""	"00006"	"{PMID:LaCroix 2018:30554721}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	"M"	""	""	""	"0"	""	""	""	"30554721-Fam01Pat1"
"00210040"	""	""	""	"1"	""	"00006"	"{PMID:LaCroix 2018:30554721}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	"M"	""	""	""	"0"	""	""	""	"30554721-Fam02Pat1"
"00210041"	""	""	""	"1"	""	"00006"	"{PMID:LaCroix 2018:30554721}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	"M"	""	""	""	"0"	""	""	""	"30554721-Fam03Pat1"
"00210042"	""	""	""	"1"	""	"00006"	"{PMID:LaCroix 2018:30554721}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	"M"	""	""	""	"0"	""	""	""	"30554721-Fam04Pat1"
"00210043"	""	""	""	"2"	""	"00006"	"{PMID:LaCroix 2018:30554721}"	"2-generation family, affected brothers, unaffected heterozygous carrier parents"	"M"	""	""	""	"0"	""	""	""	"30554721-Fam05Pat1"
"00210044"	""	""	"00210043"	"1"	""	"00006"	"{PMID:LaCroix 2018:30554721}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	"M"	""	""	""	"0"	""	""	""	"30554721-Fam05Pat4"
"00210045"	""	""	""	"1"	""	"00006"	"{PMID:LaCroix 2018:30554721}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	"F"	""	""	""	"0"	""	""	""	"30554721-Fam06Pat1"
"00210046"	""	""	""	"2"	""	"00006"	"{PMID:LaCroix 2018:30554721}"	"2-generation family, affected brothers, unaffected heterozygous carrier parents"	"M"	""	""	""	"0"	""	""	""	"30554721-Fam07Pat1"
"00210047"	""	""	"00210046"	"1"	""	"00006"	"{PMID:LaCroix 2018:30554721}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	"M"	""	""	""	"0"	""	""	""	"30554721-Fam07Pat4"
"00210048"	""	""	""	"1"	""	"00006"	"{PMID:LaCroix 2018:30554721}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	"M"	""	""	""	"0"	""	""	""	"30554721-Fam08Pat1"
"00210049"	""	""	""	"1"	""	"00006"	"{PMID:LaCroix 2018:30554721}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	"M"	""	""	""	"0"	""	""	""	"30554721-Fam09Pat1"
"00210050"	""	""	""	"1"	""	"00006"	"{PMID:LaCroix 2018:30554721}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	"M"	""	""	""	"0"	""	""	""	"30554721-Fam10Pat1"
"00210719"	""	""	""	"70"	""	"00006"	"{PMID:Faust 2014:25480529}"	"analysis 100 controls"	"F;M"	""	"Germany"	""	"0"	""	""	""	"25480529-con"
"00210720"	""	""	""	"26"	""	"00006"	"{PMID:Faust 2014:25480529}"	"100 controls"	"F;M"	""	"Germany"	""	"0"	""	""	""	"25480529-con"
"00210721"	""	""	""	"6"	""	"00006"	"{PMID:Faust 2014:25480529}"	"100 controls"	"F;M"	""	"Germany"	""	"0"	""	""	""	"25480529-con"
"00291396"	""	""	""	"4"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00291397"	""	""	""	"20"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00304504"	""	""	""	"1"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00427729"	""	""	""	"2"	""	"00006"	"{PMID:Palmer 2022:36385166}"	"2-generation family, affected brother/sister, asymptomatic carrier mother"	"M"	""	""	""	"0"	""	""	"Europe;white"	"C1"
"00465849"	""	""	""	"1"	""	"00006"	"{PMID:Ranza 2017:28229453}"	"patient, no family history"	""	"yes"	"Turkey"	""	"0"	""	""	""	"Pat5"
"00465850"	""	""	""	"1"	""	"00006"	"{PMID:Ranza 2017:28229453}"	"patient, no family history"	""	""	"Turkey"	""	"0"	""	""	""	"Pat6"


## Individuals_To_Diseases ## Do not remove or alter this header ##
## Count = 45
"{{individualid}}"	"{{diseaseid}}"
"00016858"	"00397"
"00016859"	"00397"
"00016881"	"00397"
"00016882"	"00397"
"00016883"	"00397"
"00016887"	"00397"
"00016888"	"00397"
"00054880"	"00397"
"00108467"	"00198"
"00210011"	"05541"
"00210012"	"05541"
"00210013"	"05541"
"00210014"	"05541"
"00210015"	"05541"
"00210016"	"05541"
"00210017"	"02035"
"00210018"	"02035"
"00210019"	"02035"
"00210020"	"02035"
"00210021"	"02035"
"00210022"	"02035"
"00210023"	"02035"
"00210024"	"02035"
"00210039"	"05542"
"00210040"	"05542"
"00210041"	"05542"
"00210042"	"05542"
"00210043"	"05542"
"00210044"	"05542"
"00210045"	"05542"
"00210046"	"05542"
"00210047"	"05542"
"00210048"	"05542"
"00210049"	"05542"
"00210050"	"05542"
"00210719"	"00000"
"00210720"	"00000"
"00210721"	"00000"
"00291396"	"00198"
"00291397"	"00198"
"00304504"	"00198"
"00427729"	"05541"
"00427729"	"05611"
"00465849"	"00198"
"00465850"	"00198"


## Phenotypes ## Do not remove or alter this header ##
## Note: Only showing Phenotype columns active for Diseases 00000, 00198, 00397, 02035, 05541, 05542, 05611
## Count = 30
"{{id}}"	"{{diseaseid}}"	"{{individualid}}"	"{{owned_by}}"	"{{Phenotype/Inheritance}}"	"{{Phenotype/Age}}"	"{{Phenotype/Additional}}"	"{{Phenotype/Age/Onset}}"	"{{Phenotype/Age/Diagnosis}}"	"{{Phenotype/Onset}}"	"{{Phenotype/Protein}}"	"{{Phenotype/Tumor/MSI}}"	"{{Phenotype/Enzyme/CPK}}"	"{{Phenotype/Heart/Myocardium}}"	"{{Phenotype/Lung}}"	"{{Phenotype/Diagnosis/Definite}}"	"{{Phenotype/Diagnosis/Initial}}"	"{{Phenotype/Diagnosis/Criteria}}"
"0000015260"	"00397"	"00016858"	"00705"	"Familial, autosomal recessive"	"24y"	"birth heigth 37cm; hyperlaxity, respiratory distress, hypotonia, flat face, monkey wrench of the femoral neck, epiphyseal dysplasia, knee dislocation, advanced carpal bone age; 24y heigth 111.5 cm (<-6), mild intellectual disability"	""	""	""	""	""	""	""	""	""	""	""
"0000015261"	"00397"	"00016859"	"00705"	"Familial, autosomal recessive"	"20y"	"birth heigth 41 cm; hypotonia, narrow, thorax, hip dislocation, flat face, monkey wrench femoral neck, epiphyseal dysplasia, knee dislocation, advanced carpal bone age; 20y height 121 cm \r\n(<-6), intellectual disability"	""	""	""	""	""	""	""	""	""	""	""
"0000015262"	"00397"	"00016881"	"00705"	"Familial, autosomal recessive"	"13y"	"birth weight 2000g, lower limb deformity, multiple dislocations (hip, knee), monkey wrench femoral neck, brachymetacarpy, epiphyseal dysplasia; 13y weight 35 kg (-1), height 98 cm (<-6), flessum hips/knees, valgus deformation lower limbs, patella instability, multiple surgeries, toe deformations, mild intellectual disability"	""	""	""	""	""	""	""	""	""	""	""
"0000015263"	"00397"	"00016882"	"00705"	"Familial, autosomal recessive"	"12y09m"	"birth at term, weight 2570g, height 39cm, OFC 33 cm; transient\r\nrespiratory problems neonatal period, flat face, low nasal bridge, blue sclerae, cleft palate, short neck, narrow thorax, short limbs, coronal clefts neonatal period thereafter mild platyspondyly, shortening tubular bones, absent ossification distal femoral epiphyses at birth; 12y9m weight 23.7kg  (-3.5), height 109.5cm (-6), span 111cm, OFC 50.8cm (-2), flat face, prominent eyes, low nasal bridge, pectus carinatum, narrow thorax, hyperlaxity of fingers/knees (genua valga), broad feet, toe clinodactyly, intellectual disability"	""	""	""	""	""	""	""	""	""	""	""
"0000015264"	"00397"	"00016883"	"00705"	"Familial, autosomal recessive"	"05y06m"	"birth term, heigth 44cm; 3.5m height 48.5cm; head control-2m, hip dislocation (right), knee dislocation, simian creases, hypermobile fingers, flat face, blue sclerae; neonatal period advanced carpal ossification, right hip and bilateral knee dislocation; 8m advanced bone age, elbow dislocation; 11m height 56cm; 5y6m height 84cm (-5.5), coarse and round face, full cheek, long philtrum, mild micrognathia, hypermobile fingers, moderate truncal obesity, pectus excavatum; sit-9m, walk-3y"	""	""	""	""	""	""	""	""	""	""	""
"0000015265"	"00397"	"00016887"	"00705"	"Familial, autosomal recessive"	"13y"	"brith term, heigth 43 cm; 52d height 46 cm, round and flat face, epicanthal folds, short extremities and hands, bilateral simian crease; neonatal period monkey wrench, advanced carpal ossification, short metacarpals and phalanges, widened anterior ribs; 9y patella and elbow subluxation, short iliac wings; 13m height 59 cm; 9y height 99 cm; 13y height 109 cm (-9)\r\nOFC 53 cm, coarse and round face, blue sclera, proptotic eyes, short extremities, increased lumbar lordosis, hypermobile joints, pectus excavatum, pes planus, truncal obesity; mild intellectual disability, sit-8m, walk-2y"	""	""	""	""	""	""	""	""	""	""	""
"0000015266"	"00397"	"00016888"	"00705"	"Familial, autosomal recessive"	"02y"	"born 36w, heigth 33 cm, weight, 1200 g; cleft palate, subluxation right knee, monkey wrench, advanced carpal ossification, tarsal extra ossification, double proximal femoral epiphyses, short phalanges with short 1st metacarpal; 12m height 50 cm (<-6), hypermobile joints; first 2m respiratory problems; 2y normal motor development"	""	""	""	""	""	""	""	""	""	""	""
"0000041559"	"00397"	"00054880"	"00760"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	""	""
"0000086063"	"00198"	"00108467"	"01239"	"Familial, autosomal dominant"	""	"Congenital glaucoma\r\nAxenfeld-Rieger anomaly\r\nmyopia\r\nsensorineural hearing loss\r\ncongenital hypothyroidism\r\narterial tortuosity\r\nmicrocephaly\r\ndelayed eruption of permanent teeth\r\nfemoral retroversion"	""	""	""	""	""	""	""	""	""	""	""
"0000158607"	"05541"	"00210012"	"00006"	"Familial, autosomal recessive"	""	"see paper; severe short stature of prenatal onset, joint laxity, psychomotor retardation, multiple radiological abnormalities including short metacarpals, advanced bone age, exaggerated trochanters, ..."	""	""	""	""	""	""	""	""	"DBQD-2"	""	""
"0000158608"	"05541"	"00210013"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"DBQD-2"	""	""
"0000158609"	"05541"	"00210011"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"DBQD-2"	"short stature"	""
"0000158610"	"05541"	"00210014"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"DBQD-2"	""	""
"0000158611"	"05541"	"00210015"	"00006"	"Familial, autosomal recessive"	""	"see paper; neonatal short limb skeletal dysplasia with serious medical complication, ..."	""	""	""	""	""	""	""	""	"DBQD-2"	""	""
"0000158612"	"05541"	"00210016"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"DBQD-2"	""	""
"0000158613"	"05542"	"00210039"	"00006"	"Familial, autosomal recessive"	""	"see paper; short stature, facial dysmorphisms, developmental delay, skeletal dysplasia, …"	""	""	""	""	""	""	""	""	"BSS"	""	""
"0000158614"	"05542"	"00210040"	"00006"	"Familial, autosomal recessive"	""	"see paper; short stature, facial dysmorphisms, developmental delay, skeletal dysplasia, …"	""	""	""	""	""	""	""	""	"BSS"	""	""
"0000158615"	"05542"	"00210041"	"00006"	"Familial, autosomal recessive"	""	"see paper; short stature, facial dysmorphisms, developmental delay, skeletal dysplasia, …"	""	""	""	""	""	""	""	""	"BSS"	""	""
"0000158616"	"05542"	"00210042"	"00006"	"Familial, autosomal recessive"	""	"see paper; short stature, facial dysmorphisms, developmental delay, skeletal dysplasia, …"	""	""	""	""	""	""	""	""	"BSS"	""	""
"0000158617"	"05542"	"00210043"	"00006"	"Familial, autosomal recessive"	""	"see paper; short stature, facial dysmorphisms, developmental delay, skeletal dysplasia, …"	""	""	""	""	""	""	""	""	"BSS"	""	""
"0000158618"	"05542"	"00210044"	"00006"	"Familial, autosomal recessive"	""	"see paper; short stature, facial dysmorphisms, developmental delay, skeletal dysplasia, …"	""	""	""	""	""	""	""	""	"BSS"	""	""
"0000158619"	"05542"	"00210045"	"00006"	"Familial, autosomal recessive"	""	"see paper; short stature, facial dysmorphisms, developmental delay, skeletal dysplasia, …"	""	""	""	""	""	""	""	""	"BSS"	""	""
"0000158620"	"05542"	"00210046"	"00006"	"Familial, autosomal recessive"	""	"see paper; short stature, facial dysmorphisms, developmental delay, skeletal dysplasia, …"	""	""	""	""	""	""	""	""	"BSS"	""	""
"0000158621"	"05542"	"00210047"	"00006"	"Familial, autosomal recessive"	""	"see paper; short stature, facial dysmorphisms, developmental delay, skeletal dysplasia, …"	""	""	""	""	""	""	""	""	"BSS"	""	""
"0000158622"	"05542"	"00210048"	"00006"	"Familial, autosomal recessive"	""	"see paper; short stature, facial dysmorphisms, developmental delay, skeletal dysplasia, …"	""	""	""	""	""	""	""	""	"BSS"	""	""
"0000158623"	"05542"	"00210049"	"00006"	"Familial, autosomal recessive"	""	"see paper; short stature, facial dysmorphisms, developmental delay, skeletal dysplasia, …"	""	""	""	""	""	""	""	""	"BSS"	""	""
"0000158624"	"05542"	"00210050"	"00006"	"Familial, autosomal recessive"	""	"see paper; short stature, facial dysmorphisms, developmental delay, skeletal dysplasia, …"	""	""	""	""	""	""	""	""	"BSS"	""	""
"0000318743"	"05611"	"00427729"	"00006"	"Familial, X-linked"	"09y"	"see paper; ..., mild-moderate intellectual disability; Infantile hypotonia; recurrent otitis media, hearing aides; normal vision; Not described.; delayed speech; features on the autism spectrum and obsessiveness; 3m-onset seizures, mixed semiology focal, febrile and non febrile associated, and atonic (drop) attacks; MRI brain normal; height <0.4th centile; OFC 0.4-3rd centile; consistent with desbuquois dysplasia. almond shaped eyes, short upturned nose; constipation; short stature secondary to desbuquois dysplasia; sister has also cleft palate"	""	""	""	""	""	""	""	""	"MRXSRC;DBDQ2"	"neurodevelopmental delay, Desbuquois dysplasia"	""
"0000351298"	"00198"	"00465849"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..., short stature (-7 SD); ; advanced bone age; joint dislocations genu varus, joint limitations (elbows, knees, hips, ankles); hands short hands, brachytelephalangy, brachymetacarpy iv-v, brachydactyly, transverse palmar creases; short feet, narrow lumbar canal, cervical fusions C2–C3–C4, rhizomely; obesity; coarse face, anteverted nares, white sparsed hair; intellectual disability"	""	""	""	""	""	""	""	""	"DBQD2"	"Desbuquois dysplasia"	""
"0000351299"	"00198"	"00465850"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..., intrauterine growth retadation; short stature (-6.5 SD); advanced bone age; joint dislocations hips, right knee; hands short phalanges with short first metacarpal; Swedish key appearance, double proximal femoral epiphyses, tarsal extra ossification; respiratory distress initially; prominent eyes; intellectual disability"	""	""	""	""	""	""	""	""	"DBQD2"	"Desbuquois dysplasia"	""


## Screenings ## Do not remove or alter this header ##
## Count = 58
"{{id}}"	"{{individualid}}"	"{{variants_found}}"	"{{owned_by}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"	"{{Screening/Technique}}"	"{{Screening/Template}}"	"{{Screening/Tissue}}"	"{{Screening/Remarks}}"
"0000016826"	"00016858"	"1"	"00705"	"00705"	"2014-06-03 20:10:07"	"00006"	"2015-12-02 06:58:55"	"SEQ"	"DNA"	""	""
"0000016827"	"00016859"	"1"	"00705"	"00705"	"2014-06-04 15:02:35"	"00006"	"2015-12-02 06:46:38"	"SEQ"	"DNA"	""	""
"0000016850"	"00016881"	"1"	"00705"	"00705"	"2014-06-05 10:04:44"	""	""	"SEQ"	"DNA"	""	""
"0000016851"	"00016882"	"1"	"00705"	"00705"	"2014-06-05 10:14:42"	""	""	"SEQ"	"DNA"	""	""
"0000016853"	"00016883"	"1"	"00705"	"00705"	"2014-06-05 10:30:04"	""	""	"SEQ"	"DNA"	""	""
"0000016856"	"00016887"	"1"	"00705"	"00705"	"2014-06-05 11:06:44"	""	""	"SEQ"	"DNA"	""	""
"0000016857"	"00016888"	"1"	"00705"	"00705"	"2014-06-05 11:18:39"	""	""	"SEQ"	"DNA"	""	""
"0000054832"	"00054880"	"1"	"01709"	"01709"	"2015-11-30 18:49:22"	""	""	"SEQ"	"DNA"	""	""
"0000108935"	"00108467"	"1"	"01239"	"01239"	"2017-07-24 23:44:33"	"00006"	"2017-07-29 21:50:15"	"PCR;SEQ"	"DNA"	""	"WES"
"0000211068"	"00210011"	"1"	"00006"	"00006"	"2018-12-25 13:22:58"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000211069"	"00210012"	"1"	"00006"	"00006"	"2018-12-25 13:38:54"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000211070"	"00210013"	"1"	"00006"	"00006"	"2018-12-25 13:45:04"	""	""	"RT-PCRq;SEQ-NG"	"DNA"	""	""
"0000211071"	"00210014"	"1"	"00006"	"00006"	"2018-12-25 13:49:24"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000211072"	"00210015"	"1"	"00006"	"00006"	"2018-12-25 13:55:18"	"00006"	"2018-12-25 14:10:18"	"arrayCGH;RT-PCR;SEQ"	"DNA;RNA"	""	""
"0000211073"	"00210016"	"1"	"00006"	"00006"	"2018-12-25 14:17:11"	""	""	"SEQ"	"DNA"	""	"WES"
"0000211074"	"00210017"	"1"	"00006"	"00006"	"2018-12-25 15:48:09"	""	""	"DHPLC;SEQ"	"DNA"	""	""
"0000211075"	"00210018"	"1"	"00006"	"00006"	"2018-12-25 15:48:09"	""	""	"DHPLC;SEQ"	"DNA"	""	""
"0000211076"	"00210019"	"1"	"00006"	"00006"	"2018-12-25 15:48:09"	""	""	"DHPLC;SEQ"	"DNA"	""	""
"0000211077"	"00210020"	"1"	"00006"	"00006"	"2018-12-25 15:48:09"	""	""	"DHPLC;SEQ"	"DNA"	""	""
"0000211078"	"00210021"	"1"	"00006"	"00006"	"2018-12-25 15:48:09"	""	""	"DHPLC;SEQ"	"DNA"	""	""
"0000211079"	"00210022"	"1"	"00006"	"00006"	"2018-12-25 15:48:09"	""	""	"DHPLC;SEQ"	"DNA"	""	""
"0000211080"	"00210023"	"1"	"00006"	"00006"	"2018-12-25 15:48:09"	""	""	"DHPLC;SEQ"	"DNA"	""	""
"0000211081"	"00210024"	"1"	"00006"	"00006"	"2018-12-25 15:48:09"	""	""	"DHPLC;SEQ"	"DNA"	""	""
"0000211096"	"00210039"	"1"	"00006"	"00006"	"2018-12-25 17:20:36"	""	""	"arraySNP;SEQ;PCR"	"DNA"	""	""
"0000211097"	"00210040"	"1"	"00006"	"00006"	"2018-12-25 17:20:36"	"00006"	"2018-12-26 15:52:14"	"arraySNP;PCR;RT-PCR;SEQ"	"DNA;RNA"	""	""
"0000211098"	"00210041"	"1"	"00006"	"00006"	"2018-12-25 17:20:36"	""	""	"arraySNP;SEQ;PCR"	"DNA"	""	""
"0000211099"	"00210042"	"1"	"00006"	"00006"	"2018-12-25 17:20:36"	""	""	"arraySNP;SEQ;PCR"	"DNA"	""	""
"0000211100"	"00210043"	"1"	"00006"	"00006"	"2018-12-25 17:20:36"	""	""	"arraySNP;SEQ;PCR"	"DNA"	""	""
"0000211101"	"00210044"	"1"	"00006"	"00006"	"2018-12-25 17:20:36"	""	""	"arraySNP;SEQ;PCR"	"DNA"	""	""
"0000211102"	"00210045"	"1"	"00006"	"00006"	"2018-12-25 17:20:36"	""	""	"arraySNP;SEQ;PCR"	"DNA"	""	""
"0000211103"	"00210046"	"1"	"00006"	"00006"	"2018-12-25 17:20:36"	"00006"	"2018-12-26 16:22:56"	"Southern"	"DNA"	""	""
"0000211105"	"00210048"	"1"	"00006"	"00006"	"2018-12-25 17:20:36"	"00006"	"2018-12-26 16:25:25"	"Southern"	"DNA"	""	""
"0000211106"	"00210049"	"1"	"00006"	"00006"	"2018-12-25 17:20:36"	"00006"	"2018-12-26 09:34:44"	"arraySNP;PCR;RT-PCR;SEQ"	"DNA;RNA"	""	""
"0000211107"	"00210050"	"1"	"00006"	"00006"	"2018-12-25 17:20:36"	""	""	"arraySNP;SEQ;PCR"	"DNA"	""	""
"0000211119"	"00210044"	"1"	"00006"	"00006"	"2018-12-26 10:55:05"	""	""	"PCRdig"	"DNA"	""	""
"0000211120"	"00210039"	"1"	"00006"	"00006"	"2018-12-26 10:59:58"	""	""	"PCRdig;PCRms"	"DNA"	""	""
"0000211121"	"00210040"	"1"	"00006"	"00006"	"2018-12-26 11:02:41"	"00006"	"2018-12-26 15:43:56"	"PCRdig;PCRms"	"DNA"	""	""
"0000211122"	"00210048"	"1"	"00006"	"00006"	"2018-12-26 11:20:59"	""	""	"PCRms"	"DNA"	""	""
"0000211123"	"00210046"	"1"	"00006"	"00006"	"2018-12-26 11:23:36"	""	""	"PCRms"	"DNA"	""	""
"0000211124"	"00210047"	"1"	"00006"	"00006"	"2018-12-26 11:25:19"	""	""	"PCRms"	"DNA"	""	""
"0000211125"	"00210042"	"1"	"00006"	"00006"	"2018-12-26 11:28:37"	""	""	"PCRms"	"DNA"	""	""
"0000211126"	"00210045"	"1"	"00006"	"00006"	"2018-12-26 11:30:31"	""	""	"PCRms"	"DNA"	""	""
"0000211127"	"00210041"	"1"	"00006"	"00006"	"2018-12-26 11:33:50"	""	""	"PCRms"	"DNA"	""	""
"0000211128"	"00210043"	"1"	"00006"	"00006"	"2018-12-26 11:35:56"	""	""	"PCRms"	"DNA"	""	""
"0000211129"	"00210044"	"1"	"00006"	"00006"	"2018-12-26 11:37:35"	""	""	"PCRms"	"DNA"	""	""
"0000211130"	"00210040"	"1"	"00006"	"00006"	"2018-12-26 16:05:40"	""	""	"Southern"	"DNA"	""	""
"0000211131"	"00210042"	"1"	"00006"	"00006"	"2018-12-26 16:09:22"	""	""	"Southern"	"DNA"	""	""
"0000211132"	"00210045"	"1"	"00006"	"00006"	"2018-12-26 16:14:32"	""	""	"Southern"	"DNA"	""	""
"0000211133"	"00210047"	"1"	"00006"	"00006"	"2018-12-26 16:17:23"	""	""	"Southern"	"DNA"	""	""
"0000211797"	"00210719"	"1"	"00006"	"00006"	"2018-12-29 13:56:40"	""	""	"SEQ"	"DNA"	""	""
"0000211798"	"00210720"	"1"	"00006"	"00006"	"2018-12-29 14:05:43"	""	""	"SEQ"	"DNA"	""	""
"0000211799"	"00210721"	"1"	"00006"	"00006"	"2018-12-29 14:10:07"	""	""	"SEQ"	"DNA"	""	""
"0000292564"	"00291396"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000292565"	"00291397"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000305633"	"00304504"	"1"	"03575"	"00006"	"2020-06-24 11:55:42"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000429052"	"00427729"	"1"	"00006"	"00006"	"2022-12-12 19:44:10"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000467500"	"00465849"	"1"	"00006"	"00006"	"2025-06-07 14:19:00"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000467501"	"00465850"	"1"	"00006"	"00006"	"2025-06-07 14:19:00"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"


## Screenings_To_Genes ## Do not remove or alter this header ##
## Count = 54
"{{screeningid}}"	"{{geneid}}"
"0000016826"	"SMC1B"
"0000016826"	"XYLT1"
"0000016827"	"SMC1B"
"0000016827"	"XYLT1"
"0000016850"	"XYLT1"
"0000016851"	"XYLT1"
"0000016853"	"XYLT1"
"0000016856"	"XYLT1"
"0000016857"	"XYLT1"
"0000054832"	"XYLT1"
"0000108935"	"ADAMTSL1"
"0000211068"	"XYLT1"
"0000211069"	"XYLT1"
"0000211070"	"XYLT1"
"0000211071"	"XYLT1"
"0000211072"	"XYLT1"
"0000211073"	"XYLT1"
"0000211074"	"XYLT1"
"0000211075"	"XYLT1"
"0000211076"	"XYLT1"
"0000211077"	"XYLT1"
"0000211078"	"XYLT1"
"0000211079"	"XYLT1"
"0000211080"	"XYLT1"
"0000211081"	"XYLT1"
"0000211096"	"XYLT1"
"0000211097"	"XYLT1"
"0000211098"	"XYLT1"
"0000211099"	"XYLT1"
"0000211100"	"XYLT1"
"0000211101"	"XYLT1"
"0000211102"	"XYLT1"
"0000211103"	"XYLT1"
"0000211105"	"XYLT1"
"0000211106"	"XYLT1"
"0000211107"	"XYLT1"
"0000211119"	"XYLT1"
"0000211120"	"XYLT1"
"0000211121"	"XYLT1"
"0000211122"	"XYLT1"
"0000211123"	"XYLT1"
"0000211124"	"XYLT1"
"0000211125"	"XYLT1"
"0000211126"	"XYLT1"
"0000211127"	"XYLT1"
"0000211128"	"XYLT1"
"0000211129"	"XYLT1"
"0000211130"	"XYLT1"
"0000211131"	"XYLT1"
"0000211132"	"XYLT1"
"0000211133"	"XYLT1"
"0000211797"	"XYLT1"
"0000211798"	"XYLT1"
"0000211799"	"XYLT1"


## Variants_On_Genome ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Count = 152
"{{id}}"	"{{allele}}"	"{{effectid}}"	"{{chromosome}}"	"{{position_g_start}}"	"{{position_g_end}}"	"{{type}}"	"{{average_frequency}}"	"{{owned_by}}"	"{{VariantOnGenome/DBID}}"	"{{VariantOnGenome/DNA}}"	"{{VariantOnGenome/Frequency}}"	"{{VariantOnGenome/Reference}}"	"{{VariantOnGenome/Restriction_site}}"	"{{VariantOnGenome/Published_as}}"	"{{VariantOnGenome/Remarks}}"	"{{VariantOnGenome/Genetic_origin}}"	"{{VariantOnGenome/Segregation}}"	"{{VariantOnGenome/dbSNP}}"	"{{VariantOnGenome/VIP}}"	"{{VariantOnGenome/Methylation}}"	"{{VariantOnGenome/ISCN}}"	"{{VariantOnGenome/DNA/hg38}}"	"{{VariantOnGenome/ClinVar}}"	"{{VariantOnGenome/ClinicalClassification}}"	"{{VariantOnGenome/ClinicalClassification/Method}}"
"0000036726"	"3"	"75"	"16"	"17228565"	"17228565"	"subst"	"0"	"00705"	"XYLT1_000001"	"g.17228565G>A"	""	"{PMID:Bui 2014:24581741}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.17134708G>A"	""	"likely pathogenic"	""
"0000036727"	"3"	"90"	"16"	"17228565"	"17228565"	"subst"	"0"	"00705"	"XYLT1_000001"	"g.17228565G>A"	""	"{PMID:Bui 2014:24581741}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.17134708G>A"	""	"pathogenic"	""
"0000036775"	"3"	"90"	"16"	"17353319"	"17353319"	"subst"	"0"	"00705"	"XYLT1_000002"	"g.17353319G>A"	"1/19 cases"	"{PMID:Bui 2014:24581741}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.17259462G>A"	""	"pathogenic"	""
"0000036776"	"3"	"90"	"16"	"17564382"	"17564382"	"dup"	"0"	"00705"	"XYLT1_000003"	"g.17564382dup"	"1/19 cases"	"{PMID:Bui 2014:24581741}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.17470525dup"	""	"pathogenic"	""
"0000036781"	"3"	"75"	"16"	"17232391"	"17232391"	"subst"	"0.0018083"	"00705"	"XYLT1_000005"	"g.17232391G>A"	"1/19 cases"	"{PMID:Bui 2014:24581741}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.17138534G>A"	""	"likely pathogenic"	""
"0000036782"	"3"	"70"	"16"	"17252768"	"17252768"	"subst"	"0"	"00705"	"XYLT1_000006"	"g.17252768T>G"	"1/19 cases"	"{PMID:Bui 2014:24581741}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.17158911T>G"	""	"likely pathogenic"	""
"0000036783"	"3"	"95"	"16"	"17252768"	"17252768"	"subst"	"0"	"00705"	"XYLT1_000006"	"g.17252768T>G"	"1/19 cases"	"{PMID:Bui 2014:24581741}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.17158911T>G"	""	"pathogenic"	""
"0000084862"	"3"	"70"	"16"	"17232325"	"17232325"	"subst"	"8.12176E-6"	"01709"	"XYLT1_000004"	"g.17232325G>A"	"1/100"	"{PMID:Silveira 2016:27481334}"	""	""	"not in 100 control chromosomes tested"	"Germline"	"yes"	""	"0"	""	""	"g.17138468G>A"	""	"likely pathogenic"	""
"0000177871"	"21"	"90"	"16"	"17202749"	"17202749"	"subst"	"0"	"00006"	"XYLT1_000007"	"g.17202749C>T"	""	"{PMID:Hendee 2017:28722276}, {DOI:Hendee 2017:10.1002/humu.23299}"	""	""	"variant not associated with phenotype"	"Germline"	"yes"	""	"0"	""	""	"g.17108892C>T"	""	"pathogenic"	""
"0000442486"	"3"	"90"	"16"	"17235156"	"17235156"	"subst"	"0"	"00006"	"XYLT1_000008"	"g.17235156G>A"	""	"{PMID:Schreml 2014:23982343}"	""	"C1441T"	"homozygosity mapping; normal XT1 protein levels, altered glycosylation of secreted decorin core protein containing PGs"	"Germline"	"yes"	""	"0"	""	""	"g.17141299G>A"	""	"pathogenic (recessive)"	""
"0000442487"	"21"	"90"	"16"	"17353163"	"17353163"	"subst"	"0"	"00006"	"XYLT1_000009"	"g.17353163G>A"	""	"{PMID:Jamsheer 2016:27030147}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.17259306G>A"	""	"pathogenic (recessive)"	""
"0000442488"	"10"	"90"	"16"	"17232325"	"17232325"	"subst"	"8.12176E-6"	"00006"	"XYLT1_000004"	"g.17232325G>A"	""	"{PMID:Jamsheer 2016:27030147}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.17138468G>A"	""	"pathogenic (recessive)"	""
"0000442489"	"3"	"90"	"16"	"17228567"	"17228567"	"del"	"0"	"00006"	"XYLT1_000010"	"g.17228567del"	""	"{PMID:Guo 2017:27881841}"	""	"1792delC"	""	"Germline"	"yes"	""	"0"	""	""	"g.17134710del"	""	"pathogenic (recessive)"	""
"0000442490"	"3"	"90"	"16"	"17252768"	"17252768"	"subst"	"0"	"00006"	"XYLT1_000006"	"g.17252768T>G"	""	"{PMID:Guo 2017:27881841}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.17158911T>G"	""	"pathogenic (recessive)"	""
"0000442491"	"11"	"90"	"16"	"17232381"	"17232398"	"del"	"0"	"00006"	"XYLT1_000011"	"g.17232381_17232398del"	""	"{PMID:Van Koningsbruggen 2016:26601923}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.17138524_17138541del"	""	"pathogenic (recessive)"	""
"0000442492"	"21"	"90"	"16"	"15355329"	"18692057"	"del"	"0"	"00006"	"XYLT1_000012"	"g.(15300000_15355329)_(18692057_18800000)del"	""	"{PMID:Van Koningsbruggen 2016:26601923}"	""	""	"3.3 Mb deletion incl. KIAA0430, NDE1, MYH11, ABCC1, ABCC6, NOMO3 , XYLT1, NOMO2 "	"Germline"	""	""	"0"	""	"arr[hg19] 16p13.11p12.3(15,355,329–18,692,057)x1"	""	""	"pathogenic (recessive)"	""
"0000442493"	"3"	"90"	"16"	"17221582"	"17221582"	"dup"	"0"	"00006"	"XYLT1_000013"	"g.17221582dup"	""	"{PMID:Al-Jezawi 2017:28462984}"	""	"2169dupA"	""	"Germline"	""	""	"0"	""	""	"g.17127725dup"	""	"pathogenic (recessive)"	""
"0000442494"	"0"	"10"	"16"	"0"	"0"	""	"0"	"00006"	"XYLT1_000000"	"g.17451912A?"	""	"{PMID:Schön 2006:16571645}"	""	"IVS1-5C>G"	""	"Germline"	""	""	"0"	""	""	""	""	"benign"	""
"0000442495"	"0"	"10"	"16"	"17564311"	"17564311"	"subst"	"0.0285132"	"00006"	"XYLT1_000014"	"g.17564311C>A"	"6/130 chromosomes"	"{PMID:Schön 2006:16571645}"	""	""	"significantly increased serum XT-I activity (homo/heterozygous), associated with severe PXE (skin lesions)"	"Germline"	""	""	"0"	""	""	"g.17470454C>A"	""	"benign (!)"	""
"0000442496"	"0"	"10"	"16"	"17294348"	"17294348"	"subst"	"0.0197353"	"00006"	"XYLT1_000015"	"g.17294348G>A"	"10/130 chromosomes"	"{PMID:Schön 2006:16571645}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.17200491G>A"	""	"benign"	""
"0000442497"	"0"	"10"	"16"	"17292142"	"17292142"	"subst"	"7.72421E-5"	"00006"	"XYLT1_000016"	"g.17292142G>A"	"1/130 chromosomes"	"{PMID:Schön 2006:16571645}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.17198285G>A"	""	"benign"	""
"0000442498"	"0"	"10"	"16"	"17292074"	"17292074"	"subst"	"0.136427"	"00006"	"XYLT1_000017"	"g.17292074G>C"	"21/130 chromosomes"	"{PMID:Schön 2006:16571645}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.17198217G>C"	""	"benign"	""
"0000442499"	"0"	"10"	"16"	"17228368"	"17228368"	"subst"	"0.562824"	"00006"	"XYLT1_000018"	"g.17228368G>A"	"87/130 chromosomes"	"{PMID:Schön 2006:16571645}"	""	"1989T>C"	""	"Germline"	""	"rs12708815"	"0"	""	""	"g.17134511G>A"	""	"benign"	""
"0000442500"	"0"	"10"	"16"	"17228363"	"17228363"	"subst"	"0.0149507"	"00006"	"XYLT1_000019"	"g.17228363G>A"	"1/130 chromosomes"	"{PMID:Schön 2006:16571645}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.17134506G>A"	""	"benign"	""
"0000442501"	"0"	"10"	"16"	"17211699"	"17211699"	"subst"	"0"	"00006"	"XYLT1_000020"	"g.17211699G>A"	"17/130 chromosomes"	"{PMID:Schön 2006:16571645}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.17117842G>A"	""	"benign"	""
"0000442516"	"21"	"90"	"16"	"17564354"	"17564379"	"del"	"0"	"00006"	"XYLT1_000024"	"g.17564354_17564379del"	""	"{PMID:LaCroix 2018:30554721}"	""	""	"variant appeared homozygous (other allele not amplified)"	"Germline"	""	""	"0"	""	""	"g.17470497_17470522del"	""	"pathogenic (recessive)"	""
"0000442517"	"1"	"90"	"16"	"17564335"	"17564335"	"subst"	"0"	"00006"	"XYLT1_000023"	"g.17564335C>A"	""	"{PMID:LaCroix 2018:30554721}"	""	""	"variant appeared homozygous (other allele not amplified)"	"Germline"	""	""	"0"	""	""	"g.17470478C>A"	""	"pathogenic (recessive)"	""
"0000442518"	"11"	"90"	"16"	"15300000"	"18400000"	"del"	"0"	"00006"	"XYLT1_000000"	"g.(?_15300000)_(18400000_?)del"	""	"{PMID:LaCroix 2018:30554721}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000442519"	"10"	"90"	"16"	"15300000"	"18400000"	"del"	"0"	"00006"	"XYLT1_000000"	"g.(?_15300000)_(18400000_?)del"	""	"{PMID:LaCroix 2018:30554721}"	""	""	"3.1 Mb deletion"	"De novo"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000442520"	"11"	"90"	"16"	"15300000"	"18400000"	"del"	"0"	"00006"	"XYLT1_000000"	"g.(?_15300000)_(18400000_?)del"	""	"{PMID:LaCroix 2018:30554721}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000442521"	"11"	"90"	"16"	"15300000"	"18400000"	"del"	"0"	"00006"	"XYLT1_000000"	"g.(?_15300000)_(18400000_?)del"	""	"{PMID:LaCroix 2018:30554721}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000442522"	"11"	"90"	"16"	"15300000"	"18400000"	"del"	"0"	"00006"	"XYLT1_000000"	"g.(?_15300000)_(18400000_?)del"	""	"{PMID:LaCroix 2018:30554721}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000442523"	"3"	"90"	"16"	"17562591"	"17565182"	"ins"	"0"	"00006"	"XYLT1_000033"	"g.(17562591_17565182)insN[?]"	""	"{PMID:LaCroix 2018:30554721}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000442525"	"3"	"90"	"16"	"17562591"	"17565182"	"ins"	"0"	"00006"	"XYLT1_000033"	"g.(17562591_17565182)insN[?]"	""	"{PMID:LaCroix 2018:30554721}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000442526"	"3"	"90"	"16"	"17252767"	"17252767"	"subst"	"0"	"00006"	"XYLT1_000021"	"g.17252767C>T"	""	"{PMID:LaCroix 2018:30554721}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.17158910C>T"	""	"pathogenic (recessive)"	""
"0000442527"	"3"	"90"	"16"	"17232244"	"17232247"	"dup"	"0"	"00006"	"XYLT1_000022"	"g.17232244_17232247dup"	""	"{PMID:LaCroix 2018:30554721}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.17138387_17138390dup"	""	"pathogenic (recessive)"	""
"0000442551"	"21"	"10"	"16"	"17564658"	"17564658"	"subst"	"0.20317"	"00006"	"XYLT1_000025"	"g.17564658G>C"	""	"{PMID:LaCroix 2018:30554721}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.17470801G>C"	""	"benign"	""
"0000442552"	"21"	"10"	"16"	"17564658"	"17564658"	"subst"	"0.20317"	"00006"	"XYLT1_000025"	"g.17564658G>C"	""	"{PMID:LaCroix 2018:30554721}"	""	""	""	"Germline"	""	"rs117041807"	"0"	""	""	"g.17470801G>C"	""	"benign"	""
"0000442553"	"21"	"10"	"16"	"17564668"	"17564669"	""	"0"	"00006"	"XYLT1_000026"	"g.17564668_17564669|gom"	""	"{PMID:LaCroix 2018:30554721}"	""	""	""	"Somatic"	""	""	"0"	"BsrF1 digestion, PCR"	""	""	""	"benign"	""
"0000442554"	"11"	"10"	"16"	"17564668"	"17564669"	""	"0"	"00006"	"XYLT1_000026"	"g.17564668_17564669|gom"	""	"{PMID:LaCroix 2018:30554721}"	""	""	""	"Somatic"	""	""	"0"	"BsrF1 digestion and PCR"	""	""	""	"benign"	""
"0000442555"	"2"	"10"	"16"	"17564668"	"17564669"	""	"0"	"00006"	"XYLT1_000026"	"g.17564668_17564669|gom"	""	"{PMID:LaCroix 2018:30554721}"	""	""	""	"Somatic"	""	""	"0"	"BsrF1 digestion and PCR"	""	""	""	"benign"	""
"0000442556"	"3"	"10"	"16"	"17564140"	"17564583"	""	"0"	"00006"	"XYLT1_000027"	"g.17564140_17564583|gom"	""	"{PMID:LaCroix 2018:30554721}"	""	""	""	"Somatic"	""	""	"0"	"bisulfite sequencing"	""	""	""	"benign"	""
"0000442557"	"3"	"10"	"16"	"17564140"	"17564583"	""	"0"	"00006"	"XYLT1_000027"	"g.17564140_17564583|gom"	""	"{PMID:LaCroix 2018:30554721}"	""	""	""	"Somatic"	""	""	"0"	"bisulfite sequencing"	""	""	""	"benign"	""
"0000442558"	"3"	"10"	"16"	"17564140"	"17564583"	""	"0"	"00006"	"XYLT1_000027"	"g.17564140_17564583|gom"	""	"{PMID:LaCroix 2018:30554721}"	""	""	""	"Somatic"	""	""	"0"	"bisulfite sequencing"	""	""	""	"benign"	""
"0000442559"	"21"	"10"	"16"	"17564178"	"17564560"	""	"0"	"00006"	"XYLT1_000027"	"g.17564178_17564560|gom"	""	"{PMID:LaCroix 2018:30554721}"	""	""	""	"Somatic"	""	""	"0"	"bisulfite sequencing"	""	""	""	"benign"	""
"0000442560"	"21"	"10"	"16"	"17564178"	"17564560"	""	"0"	"00006"	"XYLT1_000027"	"g.17564178_17564560|gom"	""	"{PMID:LaCroix 2018:30554721}"	""	""	""	"Somatic"	""	""	"0"	"bisulfite sequencing"	""	""	""	"benign"	""
"0000442561"	"21"	"10"	"16"	"17564178"	"17564560"	""	"0"	"00006"	"XYLT1_000027"	"g.17564178_17564560|gom"	""	"{PMID:LaCroix 2018:30554721}"	""	""	""	"Somatic"	""	""	"0"	"bisulfite sequencing"	""	""	""	"benign"	""
"0000442562"	"21"	"10"	"16"	"17564178"	"17564560"	""	"0"	"00006"	"XYLT1_000027"	"g.17564178_17564560|gom"	""	"{PMID:LaCroix 2018:30554721}"	""	""	""	"Somatic"	""	""	"0"	"bisulfite sequencing"	""	""	""	"benign"	""
"0000442563"	"21"	"10"	"16"	"17564178"	"17564560"	""	"0"	"00006"	"XYLT1_000027"	"g.17564178_17564560|gom"	""	"{PMID:LaCroix 2018:30554721}"	""	""	""	"Somatic"	""	""	"0"	"bisulfite sequencing"	""	""	""	"benign"	""
"0000442564"	"11"	"10"	"16"	"17564178"	"17564560"	""	"0"	"00006"	"XYLT1_000027"	"g.17564178_17564560|gom"	""	"{PMID:LaCroix 2018:30554721}"	""	""	""	"Somatic"	""	""	"0"	""	""	""	""	"benign"	""
"0000442565"	"2"	"10"	"16"	"17564178"	"17564560"	""	"0"	"00006"	"XYLT1_000027"	"g.17564178_17564560|gom"	""	"{PMID:LaCroix 2018:30554721}"	""	""	""	"Somatic"	""	""	"0"	"bisulfite sequencing"	""	""	""	"benign"	""
"0000442566"	"2"	"90"	"16"	"17562591"	"17565182"	"ins"	"0"	"00006"	"XYLT1_000028"	"g.(17562591_17565182)insN[(300_2500)]"	""	"{PMID:LaCroix 2018:30554721}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000442567"	"21"	"90"	"16"	"17562591"	"17565182"	"ins"	"0"	"00006"	"XYLT1_000029"	"g.(17562591_17565182)insN[(2200_2500)]"	""	"{PMID:LaCroix 2018:30554721}"	""	""	"expanded maternal allele (ins300 > 2200_2500)"	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000442568"	"21"	"90"	"16"	"17562591"	"17565182"	"ins"	"0"	"00006"	"XYLT1_000030"	"g.(17562591_17565182)insN[300]"	""	"{PMID:LaCroix 2018:30554721}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000442569"	"11"	"90"	"16"	"17562591"	"17565182"	"ins"	"0"	"00006"	"XYLT1_000031"	"g.(17562591_17565182)insN[2500]"	""	"{PMID:LaCroix 2018:30554721}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000442570"	"21"	"90"	"16"	"17562591"	"17565182"	"ins"	"0"	"00006"	"XYLT1_000032"	"g.(17562591_17565182)insN[(2200_2800)]"	""	"{PMID:LaCroix 2018:30554721}"	""	""	"expanded maternal allele (ins500-700 > 2200_2800)"	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000443412"	"3"	"11"	"16"	"17564778"	"17564779"	"ins"	"0"	"00006"	"XYLT1_000034"	"g.17564778_17564779insN[238]"	""	"{PMID:Faust 2014:25480529}"	""	""	"error in reference sequence, missing 238 nucleotides (CGCCGCGCGGGCCAGGCGCCCGCCCCTCCCTGCGCGCCCCGTCCCCGAGCGCGCGCCCGGCGCCCCCCTCCGCGGCCTCCCCGCTCCCGCCTCCCGCCTTCTCCTCCTCCTGGTGACGTCCGGGTCCCTGCCCGTCTGAAAACTCCGCGCCGCGGCGGTGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCAGCGGCGGCGGCGGCGGCGGAGGAGGAGCAGCGGCGAGCCGAGGCGGCG)"	"Germline"	"-"	""	"0"	""	""	""	""	"benign"	""
"0000443413"	"1"	"11"	"16"	"17564818"	"17564818"	"subst"	"0"	"00006"	"XYLT1_000035"	"g.17564818G>A"	"70/200 chromosomes"	"{PMID:Faust 2014:25480529}"	""	"-403C>T"	""	"Germline"	"-"	"rs118030014"	"0"	""	""	"g.17470961G>A"	""	"benign"	""
"0000443414"	"1"	"50"	"16"	"17565503"	"17565503"	"subst"	"0"	"00006"	"XYLT1_000036"	"g.17565503G>T"	"70/200 chromosomes"	"{PMID:Faust 2014:25480529}"	""	"-1088C>A"	""	"Germline"	"-"	"rs59423557"	"0"	""	""	"g.17471646G>T"	""	"VUS"	""
"0000443415"	"1"	"11"	"16"	"17564818"	"17564818"	"subst"	"0"	"00006"	"XYLT1_000035"	"g.17564818G>A"	"26/200 chromosomes"	"{PMID:Faust 2014:25480529}"	""	""	"reference sequence at -850 (-1088)"	"Germline"	"-"	"rs118030014"	"0"	""	""	"g.17470961G>A"	""	"benign"	""
"0000443416"	"1"	"50"	"16"	"17565503"	"17565503"	"subst"	"0"	"00006"	"XYLT1_000036"	"g.17565503G>T"	"6/200 chromosomes"	"{PMID:Faust 2014:25480529}"	""	"-1088C>A"	"reference sequence at -165 (-403)"	"Germline"	"-"	"rs59423557"	"0"	""	""	"g.17471646G>T"	""	"VUS"	""
"0000443417"	"3"	"90"	"16"	"17565503"	"17565503"	"subst"	"0"	"00006"	"XYLT1_000036"	"g.17565503G>T"	""	"{PMID:Faust 2014:25480529}"	""	"-1088C>A"	"expression cloning luciferase promoter activity shows 0.5 reduced activity; serum XT activity unchanged"	"In vitro (cloned)"	"-"	"rs59423557"	"0"	""	""	"g.17471646G>T"	""	"NA"	""
"0000443418"	"3"	"10"	"16"	"17564818"	"17564818"	"subst"	"0"	"00006"	"XYLT1_000035"	"g.17564818G>A"	""	"{PMID:Faust 2014:25480529}"	""	"-403C>T"	"expression cloning luciferase promoter activity unchanged"	"In vitro (cloned)"	"-"	"rs118030014"	"0"	""	""	"g.17470961G>A"	""	"NA"	""
"0000443419"	"0"	"30"	"16"	"17564778"	"17564779"	"ins"	"0"	"00006"	"XYLT1_000037"	"g.17564778_17564779insN[235]"	"2/45"	"{PMID:Faust 2014:25480529}"	""	"-3bp"	""	"Germline"	"-"	""	"0"	""	""	""	""	"benign"	""
"0000443420"	"0"	"30"	"16"	"17564778"	"17564779"	"ins"	"0"	"00006"	"XYLT1_000038"	"g.17564778_17564779insN[244]"	"1/45"	"{PMID:Faust 2014:25480529}"	""	"+6bp"	""	"Germline"	"-"	""	"0"	""	""	""	""	"benign"	""
"0000443421"	"0"	"30"	"16"	"17564778"	"17564779"	"ins"	"0"	"00006"	"XYLT1_000039"	"g.17564778_17564779insN[232]"	"9/45"	"{PMID:Faust 2014:25480529}"	""	"-6bp"	""	"Germline"	"-"	""	"0"	""	""	""	""	"benign"	""
"0000443422"	"0"	"30"	"16"	"17564778"	"17564779"	"ins"	"0"	"00006"	"XYLT1_000040"	"g.17564778_17564779insN[220]"	"1/45"	"{PMID:Faust 2014:25480529}"	""	"-18bp"	""	"Germline"	"-"	""	"0"	""	""	""	""	"benign"	""
"0000443423"	"0"	"30"	"16"	"17564778"	"17564779"	"ins"	"0"	"00006"	"XYLT1_000041"	"g.17564778_17564779insN[241]"	"5/45"	"{PMID:Faust 2014:25480529}"	""	"+3bp"	""	"Germline"	"-"	""	"0"	""	""	""	""	"benign"	""
"0000443424"	"0"	"30"	"16"	"17564778"	"17564779"	"ins"	"0"	"00006"	"XYLT1_000042"	"g.17564778_17564779insN[211]"	""	"{PMID:Faust 2014:25480529}"	""	"-27bp"	""	"Germline"	"-"	""	"0"	""	""	""	""	"benign"	""
"0000556997"	"0"	"30"	"16"	"17202757"	"17202757"	"subst"	"0.0449419"	"01804"	"XYLT1_000043"	"g.17202757C>T"	""	""	""	"XYLT1(NM_022166.3):c.2675G>A (p.(Arg892Gln))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.17108900C>T"	""	"likely benign"	""
"0000556998"	"0"	"30"	"16"	"17211545"	"17211545"	"subst"	"0.0153173"	"01804"	"XYLT1_000044"	"g.17211545C>T"	""	""	""	"XYLT1(NM_022166.3):c.2515G>A (p.(Val839Ile))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.17117688C>T"	""	"likely benign"	""
"0000556999"	"0"	"30"	"16"	"17221661"	"17221661"	"subst"	"0"	"01804"	"XYLT1_000045"	"g.17221661G>C"	""	""	""	"XYLT1(NM_022166.3):c.2085C>G (p.(Phe695Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.17127804G>C"	""	"likely benign"	""
"0000557000"	"0"	"30"	"16"	"17221704"	"17221704"	"subst"	"1.22222E-5"	"01804"	"XYLT1_000046"	"g.17221704C>A"	""	""	""	"XYLT1(NM_022166.3):c.2042G>T (p.(Gly681Val))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.17127847C>A"	""	"likely benign"	""
"0000557001"	"0"	"30"	"16"	"17232350"	"17232350"	"subst"	"0.000747232"	"01943"	"XYLT1_000047"	"g.17232350G>A"	""	""	""	"XYLT1(NM_022166.3):c.1626C>T (p.C542=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.17138493G>A"	""	"likely benign"	""
"0000557003"	"0"	"50"	"16"	"17235168"	"17235168"	"subst"	"4.06279E-6"	"02325"	"XYLT1_000048"	"g.17235168G>A"	""	""	""	"XYLT1(NM_022166.4):c.1429C>T (p.(Arg477Cys), p.R477C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.17141311G>A"	""	"VUS"	""
"0000557004"	"0"	"30"	"16"	"17353012"	"17353012"	"subst"	"8.49343E-6"	"01804"	"XYLT1_000049"	"g.17353012G>T"	""	""	""	"XYLT1(NM_022166.3):c.746C>A (p.(Thr249Asn))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.17259155G>T"	""	"likely benign"	""
"0000557009"	"0"	"30"	"16"	"17564311"	"17564311"	"subst"	"0.0285132"	"01804"	"XYLT1_000014"	"g.17564311C>A"	""	""	""	"XYLT1(NM_022166.3):c.343G>T (p.(Ala115Ser)), XYLT1(NM_022166.4):c.343G>T (p.A115S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.17470454C>A"	""	"likely benign"	""
"0000557010"	"0"	"90"	"16"	"17564555"	"17564556"	"del"	"0"	"02325"	"XYLT1_000050"	"g.17564555_17564556del"	""	""	""	"XYLT1(NM_022166.4):c.98_99delGG (p.W33*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.17470698_17470699del"	""	"pathogenic"	""
"0000615809"	"0"	"30"	"16"	"17232272"	"17232272"	"subst"	"0.00051978"	"01943"	"XYLT1_000051"	"g.17232272G>A"	""	""	""	"XYLT1(NM_022166.3):c.1704C>T (p.I568=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.17138415G>A"	""	"likely benign"	""
"0000615810"	"0"	"30"	"16"	"17294495"	"17294495"	"subst"	"4.884E-5"	"01943"	"XYLT1_000053"	"g.17294495G>A"	""	""	""	"XYLT1(NM_022166.3):c.930C>T (p.N310=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.17200638G>A"	""	"likely benign"	""
"0000615811"	"0"	"30"	"16"	"17564500"	"17564500"	"subst"	"0.00115236"	"01804"	"XYLT1_000054"	"g.17564500C>T"	""	""	""	"XYLT1(NM_022166.3):c.154G>A (p.(Gly52Ser))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.17470643C>T"	""	"likely benign"	""
"0000615812"	"0"	"30"	"16"	"17564537"	"17564537"	"subst"	"0"	"01943"	"XYLT1_000055"	"g.17564537G>A"	""	""	""	"XYLT1(NM_022166.3):c.117C>T (p.D39=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.17470680G>A"	""	"likely benign"	""
"0000623389"	"0"	"50"	"16"	"17232374"	"17232374"	"subst"	"0.000406898"	"01943"	"XYLT1_000052"	"g.17232374C>T"	""	""	""	"XYLT1(NM_022166.3):c.1602G>A (p.T534=), XYLT1(NM_022166.4):c.1602G>A (p.(Thr534=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.17138517C>T"	""	"VUS"	""
"0000649253"	"1"	"50"	"16"	"17353337"	"17353337"	"subst"	"0.000693299"	"03575"	"XYLT1_000056"	"g.17353337G>A"	"4/2795 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"4 heterozygous, no homozygous; {DB:CLININrs74993523}"	"Germline"	""	"rs74993523"	"0"	""	""	"g.17259480G>A"	""	"VUS"	""
"0000649254"	"1"	"10"	"16"	"17564311"	"17564311"	"subst"	"0.0285132"	"03575"	"XYLT1_000014"	"g.17564311C>A"	"20/2774 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"20 heterozygous; {DB:CLININrs61758388}"	"Germline"	""	"rs61758388"	"0"	""	""	"g.17470454C>A"	""	"benign"	""
"0000657760"	"0"	"30"	"16"	"17564347"	"17564347"	"subst"	"0"	"01943"	"XYLT1_000057"	"g.17564347C>T"	""	""	""	"XYLT1(NM_022166.3):c.307G>A (p.G103R, p.(Gly103Arg))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.17470490C>T"	""	"likely benign"	""
"0000669321"	"3"	"10"	"16"	"17564311"	"17564311"	"subst"	"0.0285132"	"03575"	"XYLT1_000014"	"g.17564311C>A"	"1/2774 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"1 homozygous; {DB:CLININrs61758388}"	"Germline"	""	"rs61758388"	"0"	""	""	"g.17470454C>A"	""	"benign"	""
"0000680432"	"0"	"30"	"16"	"17211505"	"17211505"	"subst"	"0.000236808"	"01804"	"XYLT1_000058"	"g.17211505G>C"	""	""	""	"XYLT1(NM_022166.3):c.2555C>G (p.P852R, p.(Pro852Arg))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000680433"	"0"	"50"	"16"	"17352862"	"17352862"	"subst"	"0"	"01943"	"XYLT1_000059"	"g.17352862C>G"	""	""	""	"XYLT1(NM_022166.3):c.896G>C (p.R299P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000680434"	"0"	"30"	"16"	"17353090"	"17353090"	"subst"	"0.0125386"	"01804"	"XYLT1_000060"	"g.17353090G>C"	""	""	""	"XYLT1(NM_022166.3):c.668C>G (p.(Ala223Gly))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000691956"	"0"	"50"	"16"	"17232234"	"17232234"	"subst"	"0.00114215"	"01943"	"XYLT1_000061"	"g.17232234G>A"	""	""	""	"XYLT1(NM_022166.3):c.1742C>T (p.P581L, p.(Pro581Leu)), XYLT1(NM_022166.4):c.1742C>T (p.P581L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000691957"	"0"	"30"	"16"	"17232391"	"17232391"	"subst"	"0.0018083"	"01943"	"XYLT1_000005"	"g.17232391G>A"	""	""	""	"XYLT1(NM_022166.3):c.1588-3C>T (p.?), XYLT1(NM_022166.4):c.1588-3C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000725492"	"0"	"30"	"16"	"17202564"	"17202564"	"subst"	"0"	"01943"	"XYLT1_000062"	"g.17202564G>A"	""	""	""	"XYLT1(NM_022166.3):c.2868C>T (p.G956=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000725493"	"0"	"30"	"16"	"17228363"	"17228363"	"subst"	"0.0149507"	"01804"	"XYLT1_000019"	"g.17228363G>A"	""	""	""	"XYLT1(NM_022166.3):c.1994C>T (p.(Thr665Met))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000725494"	"0"	"90"	"16"	"17232278"	"17232281"	"dup"	"0"	"02329"	"XYLT1_000063"	"g.17232278_17232281dup"	""	""	""	"XYLT1(NM_022166.4):c.1697_1700dupAGCA (p.H567Qfs*13)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000725495"	"0"	"50"	"16"	"17235168"	"17235168"	"subst"	"4.06279E-6"	"02329"	"XYLT1_000048"	"g.17235168G>A"	""	""	""	"XYLT1(NM_022166.4):c.1429C>T (p.(Arg477Cys), p.R477C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000725496"	"0"	"30"	"16"	"17292204"	"17292204"	"subst"	"0.00315846"	"01943"	"XYLT1_000064"	"g.17292204G>A"	""	""	""	"XYLT1(NM_022166.3):c.1154C>T (p.P385L, p.(Pro385Leu)), XYLT1(NM_022166.4):c.1154C>T (p.P385L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000725497"	"0"	"50"	"16"	"17451891"	"17451891"	"subst"	"2.44343E-5"	"01943"	"XYLT1_000065"	"g.17451891G>A"	""	""	""	"XYLT1(NM_022166.3):c.380C>T (p.P127L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000725498"	"0"	"30"	"16"	"17564397"	"17564397"	"subst"	"0"	"01943"	"XYLT1_000066"	"g.17564397C>T"	""	""	""	"XYLT1(NM_022166.3):c.257G>A (p.G86E)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000725499"	"0"	"50"	"16"	"17564419"	"17564421"	"dup"	"0"	"01943"	"XYLT1_000067"	"g.17564419_17564421dup"	""	""	""	"XYLT1(NM_022166.3):c.246_248dupAGG (p.G90dup)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000807119"	"0"	"30"	"16"	"17228351"	"17228351"	"subst"	"1.22107E-5"	"01804"	"XYLT1_000068"	"g.17228351G>A"	""	""	""	"XYLT1(NM_022166.3):c.2006C>T (p.(Thr669Met))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000807120"	"0"	"30"	"16"	"17294381"	"17294381"	"subst"	"0.000207171"	"01943"	"XYLT1_000069"	"g.17294381G>A"	""	""	""	"XYLT1(NM_022166.3):c.1044C>T (p.A348=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000807122"	"0"	"30"	"16"	"17564438"	"17564438"	"subst"	"0"	"02329"	"XYLT1_000070"	"g.17564438G>A"	""	""	""	"XYLT1(NM_022166.4):c.216C>T (p.A72=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000854307"	"0"	"50"	"16"	"17211505"	"17211505"	"subst"	"0.000236808"	"01943"	"XYLT1_000058"	"g.17211505G>C"	""	""	""	"XYLT1(NM_022166.3):c.2555C>G (p.P852R, p.(Pro852Arg))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000854308"	"0"	"30"	"16"	"17211844"	"17211845"	"del"	"0.000112949"	"02329"	"XYLT1_000072"	"g.17211844_17211845del"	""	""	""	"XYLT1(NM_022166.4):c.2224-9_2224-8delCT"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000854309"	"0"	"30"	"16"	"17232391"	"17232391"	"subst"	"0.0018083"	"01804"	"XYLT1_000005"	"g.17232391G>A"	""	""	""	"XYLT1(NM_022166.3):c.1588-3C>T (p.?), XYLT1(NM_022166.4):c.1588-3C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000854310"	"0"	"10"	"16"	"17292204"	"17292204"	"subst"	"0.00315846"	"02329"	"XYLT1_000064"	"g.17292204G>A"	""	""	""	"XYLT1(NM_022166.3):c.1154C>T (p.P385L, p.(Pro385Leu)), XYLT1(NM_022166.4):c.1154C>T (p.P385L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000864345"	"0"	"30"	"16"	"17211723"	"17211723"	"subst"	"1.62444E-5"	"02329"	"XYLT1_000071"	"g.17211723G>T"	""	""	""	"XYLT1(NM_022166.4):c.2337C>A (p.T779=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000864346"	"0"	"50"	"16"	"17232384"	"17232384"	"subst"	"0"	"01943"	"XYLT1_000073"	"g.17232384A>G"	""	""	""	"XYLT1(NM_022166.3):c.1592T>C (p.F531S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000864347"	"0"	"30"	"16"	"17292204"	"17292204"	"subst"	"0.00315846"	"01804"	"XYLT1_000064"	"g.17292204G>A"	""	""	""	"XYLT1(NM_022166.3):c.1154C>T (p.P385L, p.(Pro385Leu)), XYLT1(NM_022166.4):c.1154C>T (p.P385L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000864348"	"0"	"30"	"16"	"17564347"	"17564347"	"subst"	"0"	"01804"	"XYLT1_000057"	"g.17564347C>T"	""	""	""	"XYLT1(NM_022166.3):c.307G>A (p.G103R, p.(Gly103Arg))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000892589"	"0"	"10"	"16"	"17202776"	"17202776"	"subst"	"0.00241848"	"02329"	"XYLT1_000074"	"g.17202776C>A"	""	""	""	"XYLT1(NM_022166.3):c.2656G>T (p.(Ala886Ser)), XYLT1(NM_022166.4):c.2656G>T (p.A886S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000892590"	"0"	"10"	"16"	"17221733"	"17221733"	"subst"	"0.00293823"	"02329"	"XYLT1_000075"	"g.17221733G>A"	""	""	""	"XYLT1(NM_022166.4):c.2028-15C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000892591"	"0"	"50"	"16"	"17292147"	"17292147"	"subst"	"2.03219E-5"	"01804"	"XYLT1_000076"	"g.17292147C>T"	""	""	""	"XYLT1(NM_022166.3):c.1211G>A (p.(Ser404Asn))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000892592"	"0"	"50"	"16"	"17294394"	"17294394"	"subst"	"8.12269E-6"	"01804"	"XYLT1_000077"	"g.17294394C>T"	""	""	""	"XYLT1(NM_022166.3):c.1031G>A (p.(Arg344His))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000908721"	"1"	"90"	"16"	"17211737"	"17211737"	"subst"	"0"	"00006"	"XYLT1_000078"	"g.17211737C>A"	""	"{PMID:Palmer 2022:36385166}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.17117880C>A"	""	"pathogenic (recessive)"	""
"0000908722"	"2"	"90"	"16"	"17196181"	"17564738"	"del"	"0"	"00006"	"XYLT1_000012"	"g.(?_17196181)_(17564738_?)del"	""	"{PMID:Palmer 2022:36385166}"	""	""	"57Kb XYTL1 deletion"	"Germline"	""	""	"0"	""	""	"g.(?_17102324)_(17470881_?)del"	""	"pathogenic (recessive)"	""
"0000914494"	"0"	"30"	"16"	"17232391"	"17232391"	"subst"	"0.0018083"	"02329"	"XYLT1_000005"	"g.17232391G>A"	""	""	""	"XYLT1(NM_022166.3):c.1588-3C>T (p.?), XYLT1(NM_022166.4):c.1588-3C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000914495"	"0"	"30"	"16"	"17235184"	"17235184"	"subst"	"6.50195E-5"	"02329"	"XYLT1_000079"	"g.17235184G>A"	""	""	""	"XYLT1(NM_022166.4):c.1413C>T (p.C471=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000926155"	"0"	"30"	"16"	"17202776"	"17202776"	"subst"	"0.00241848"	"01804"	"XYLT1_000074"	"g.17202776C>A"	""	""	""	"XYLT1(NM_022166.3):c.2656G>T (p.(Ala886Ser)), XYLT1(NM_022166.4):c.2656G>T (p.A886S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000930514"	"0"	"30"	"16"	"17211834"	"17211834"	"subst"	"0.00152453"	"01804"	"XYLT1_000080"	"g.17211834G>A"	""	""	""	"XYLT1(NM_022166.3):c.2226C>T (p.(Val742=)), XYLT1(NM_022166.4):c.2226C>T (p.V742=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000950530"	"0"	"30"	"16"	"17353101"	"17353101"	"subst"	"0.000329076"	"02329"	"XYLT1_000081"	"g.17353101G>A"	""	""	""	"XYLT1(NM_022166.4):c.657C>T (p.P219=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000968139"	"0"	"30"	"16"	"17211702"	"17211702"	"subst"	"0.000284248"	"02329"	"XYLT1_000083"	"g.17211702A>G"	""	""	""	"XYLT1(NM_022166.4):c.2358T>C (p.D786=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000968140"	"0"	"30"	"16"	"17211834"	"17211834"	"subst"	"0.00152453"	"02329"	"XYLT1_000080"	"g.17211834G>A"	""	""	""	"XYLT1(NM_022166.3):c.2226C>T (p.(Val742=)), XYLT1(NM_022166.4):c.2226C>T (p.V742=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000968141"	"0"	"30"	"16"	"17232234"	"17232234"	"subst"	"0.00114215"	"02329"	"XYLT1_000061"	"g.17232234G>A"	""	""	""	"XYLT1(NM_022166.3):c.1742C>T (p.P581L, p.(Pro581Leu)), XYLT1(NM_022166.4):c.1742C>T (p.P581L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000968142"	"0"	"30"	"16"	"17292609"	"17292609"	"subst"	"0"	"02329"	"XYLT1_000084"	"g.17292609A>G"	""	""	""	"XYLT1(NM_022166.4):c.1087-338T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000968143"	"0"	"10"	"16"	"17353152"	"17353152"	"subst"	"0.00163239"	"02329"	"XYLT1_000085"	"g.17353152T>C"	""	""	""	"XYLT1(NM_022166.4):c.606A>G (p.K202=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000981662"	"0"	"50"	"16"	"17228418"	"17228418"	"subst"	"1.2184E-5"	"01804"	"XYLT1_000086"	"g.17228418C>T"	""	""	""	"XYLT1(NM_022166.4):c.1939G>A (p.(Val647Met))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000981663"	"0"	"50"	"16"	"17228503"	"17228503"	"subst"	"0.000519797"	"01804"	"XYLT1_000087"	"g.17228503C>A"	""	""	""	"XYLT1(NM_022166.4):c.1854G>T (p.(Gly618=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000981664"	"0"	"50"	"16"	"17232220"	"17232220"	"subst"	"0.000239999"	"01804"	"XYLT1_000088"	"g.17232220G>A"	""	""	""	"XYLT1(NM_022166.4):c.1756C>T (p.(Arg586Cys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000981665"	"0"	"50"	"16"	"17235168"	"17235168"	"subst"	"4.06279E-6"	"01804"	"XYLT1_000048"	"g.17235168G>A"	""	""	""	"XYLT1(NM_022166.4):c.1429C>T (p.(Arg477Cys), p.R477C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000981666"	"0"	"50"	"16"	"17292213"	"17292213"	"subst"	"1.21947E-5"	"01804"	"XYLT1_000089"	"g.17292213C>T"	""	""	""	"XYLT1(NM_022166.4):c.1145G>A (p.(Arg382His))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000981667"	"0"	"50"	"16"	"17294451"	"17294451"	"subst"	"2.43694E-5"	"01804"	"XYLT1_000090"	"g.17294451G>A"	""	""	""	"XYLT1(NM_022166.4):c.974C>T (p.(Pro325Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000981668"	"0"	"30"	"16"	"17451862"	"17451862"	"subst"	"0"	"01804"	"XYLT1_000091"	"g.17451862T>C"	""	""	""	"XYLT1(NM_022166.4):c.402+7A>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001001976"	"0"	"10"	"16"	"17211690"	"17211690"	"subst"	"0.000958337"	"02329"	"XYLT1_000092"	"g.17211690G>T"	""	""	""	"XYLT1(NM_022166.4):c.2370C>A (p.V790=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0001001977"	"0"	"30"	"16"	"17232234"	"17232234"	"subst"	"0.00114215"	"01804"	"XYLT1_000061"	"g.17232234G>A"	""	""	""	"XYLT1(NM_022166.3):c.1742C>T (p.P581L, p.(Pro581Leu)), XYLT1(NM_022166.4):c.1742C>T (p.P581L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001001978"	"0"	"10"	"16"	"17292086"	"17292086"	"subst"	"0.00131579"	"02329"	"XYLT1_000093"	"g.17292086C>T"	""	""	""	"XYLT1(NM_022166.4):c.1272G>A (p.A424=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0001001979"	"0"	"30"	"16"	"17292229"	"17292229"	"subst"	"3.25431E-5"	"01804"	"XYLT1_000094"	"g.17292229G>C"	""	""	""	"XYLT1(NM_022166.3):c.1129C>G (p.(Gln377Glu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001001980"	"0"	"30"	"16"	"17564475"	"17564475"	"subst"	"0"	"01804"	"XYLT1_000095"	"g.17564475G>A"	""	""	""	"XYLT1(NM_022166.3):c.179C>T (p.(Ala60Val))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001015309"	"0"	"30"	"16"	"17228350"	"17228350"	"subst"	"0.000793858"	"02329"	"XYLT1_000096"	"g.17228350C>T"	""	""	""	"XYLT1(NM_022166.4):c.2007G>A (p.T669=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001026579"	"0"	"30"	"16"	"17294435"	"17294435"	"subst"	"0"	"02329"	"XYLT1_000097"	"g.17294435A>G"	""	""	""	"XYLT1(NM_022166.4):c.990T>C (p.F330=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001040850"	"0"	"50"	"16"	"17228388"	"17228388"	"subst"	"8.12506E-6"	"01804"	"XYLT1_000098"	"g.17228388G>A"	""	""	""	"XYLT1(NM_022166.4):c.1969C>T (p.(Arg657Cys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001040851"	"0"	"50"	"16"	"17228448"	"17228448"	"subst"	"4.06111E-6"	"01804"	"XYLT1_000099"	"g.17228448C>T"	""	""	""	"XYLT1(NM_022166.4):c.1909G>A (p.(Glu637Lys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001040852"	"0"	"50"	"16"	"17232324"	"17232324"	"subst"	"3.65473E-5"	"01804"	"XYLT1_000100"	"g.17232324C>T"	""	""	""	"XYLT1(NM_022166.4):c.1652G>A (p.(Arg551His))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001040853"	"0"	"50"	"16"	"17232361"	"17232361"	"subst"	"0.000101549"	"01804"	"XYLT1_000101"	"g.17232361T>C"	""	""	""	"XYLT1(NM_022166.4):c.1615A>G (p.(Ser539Gly))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001040854"	"0"	"30"	"16"	"17232374"	"17232374"	"subst"	"0.000406898"	"01804"	"XYLT1_000052"	"g.17232374C>T"	""	""	""	"XYLT1(NM_022166.3):c.1602G>A (p.T534=), XYLT1(NM_022166.4):c.1602G>A (p.(Thr534=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001040855"	"0"	"50"	"16"	"17564419"	"17564421"	"del"	"0"	"01804"	"XYLT1_000102"	"g.17564419_17564421del"	""	""	""	"XYLT1(NM_022166.4):c.246_248del (p.(Gly90del))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001045312"	"3"	"90"	"16"	"17228331"	"17228331"	"subst"	"0"	"00006"	"XYLT1_000103"	"g.17228331G>A"	""	"{PMID:Ranza 2017:28229453}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.17134474G>A"	""	"pathogenic (recessive)"	""
"0001045313"	"3"	"90"	"16"	"17252768"	"17252768"	"subst"	"0"	"00006"	"XYLT1_000006"	"g.17252768T>G"	""	"{PMID:Ranza 2017:28229453}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.17158911T>G"	""	"pathogenic (recessive)"	""
"0001046537"	"0"	"50"	"16"	"17564311"	"17564311"	"subst"	"0.0285132"	"02325"	"XYLT1_000014"	"g.17564311C>A"	""	""	""	"XYLT1(NM_022166.3):c.343G>T (p.(Ala115Ser)), XYLT1(NM_022166.4):c.343G>T (p.A115S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001055464"	"0"	"50"	"16"	"17228597"	"17228597"	"subst"	"0"	"01804"	"XYLT1_000104"	"g.17228597A>G"	""	""	""	"XYLT1(NM_022166.4):c.1765-5T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001055465"	"0"	"30"	"16"	"17564478"	"17564478"	"subst"	"0"	"01804"	"XYLT1_000105"	"g.17564478G>A"	""	""	""	"XYLT1(NM_022166.4):c.176C>T (p.(Pro59Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""


## Variants_On_Transcripts ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Note: Only showing Variants_On_Transcript columns active for Genes XYLT1
## Count = 152
"{{id}}"	"{{transcriptid}}"	"{{effectid}}"	"{{position_c_start}}"	"{{position_c_start_intron}}"	"{{position_c_end}}"	"{{position_c_end_intron}}"	"{{VariantOnTranscript/DNA}}"	"{{VariantOnTranscript/RNA}}"	"{{VariantOnTranscript/Protein}}"	"{{VariantOnTranscript/Exon}}"	"{{VariantOnTranscript/Haplotype}}"
"0000036726"	"00022949"	"90"	"1792"	"0"	"1792"	"0"	"c.1792C>T"	"r.(?)"	"p.(Arg598Cys)"	"9"	""
"0000036727"	"00022949"	"90"	"1792"	"0"	"1792"	"0"	"c.1792C>T"	"r.(?)"	"p.(Arg598Cys)"	"9"	""
"0000036775"	"00022949"	"90"	"439"	"0"	"439"	"0"	"c.439C>T"	"r.(?)"	"p.(Arg147*)"	"3"	""
"0000036776"	"00022949"	"90"	"276"	"0"	"276"	"0"	"c.276dup"	"r.(?)"	"p.(Pro93Alafs*69)"	"1"	""
"0000036781"	"00022949"	"70"	"1588"	"-3"	"1588"	"-3"	"c.1588-3C>T"	"r.spl?"	"p.(?)"	"7i"	""
"0000036782"	"00022949"	"90"	"1290"	"-2"	"1290"	"-2"	"c.1290-2A>C"	"r.spl?"	"p.?"	"5i"	""
"0000036783"	"00022949"	"90"	"1290"	"-2"	"1290"	"-2"	"c.1290-2A>C"	"r.spl?"	"p.?"	"5i"	""
"0000084862"	"00022949"	"70"	"1651"	"0"	"1651"	"0"	"c.1651C>T"	"r.(?)"	"p.(Arg551Cys)"	"8"	""
"0000177871"	"00022949"	"90"	"2683"	"0"	"2683"	"0"	"c.2683G>A"	"r.(?)"	"p.(Ala895Thr)"	"12"	""
"0000442486"	"00022949"	"90"	"1441"	"0"	"1441"	"0"	"c.1441C>T"	"r.(?)"	"p.(Arg481Trp)"	"7"	""
"0000442487"	"00022949"	"90"	"595"	"0"	"595"	"0"	"c.595C>T"	"r.(?)"	"p.(Gln199*)"	""	""
"0000442488"	"00022949"	"90"	"1651"	"0"	"1651"	"0"	"c.1651C>T"	"r.(?)"	"p.(Arg551Cys)"	""	""
"0000442489"	"00022949"	"90"	"1792"	"0"	"1792"	"0"	"c.1792del"	"r.(?)"	"p.(Arg598Alafs*7)"	""	""
"0000442490"	"00022949"	"90"	"1290"	"-2"	"1290"	"-2"	"c.1290-2A>C"	"r.spl"	"p.?"	""	""
"0000442491"	"00022949"	"90"	"1588"	"-10"	"1595"	"0"	"c.1588-10_1595del"	"r.[1588_1611del,1588_1616del,1587_1588ins1588-45_1588-11,1587_1588ins1588-100_1588-11]"	"p.?"	"7i_8"	""
"0000442492"	"00022949"	"90"	"0"	"0"	"0"	"0"	"c.-85_*6371{0}"	"r.0"	"p.0"	"_1_12_"	""
"0000442493"	"00022949"	"90"	"2169"	"0"	"2169"	"0"	"c.2169dup"	"r.(?)"	"p.(Val724Serfs*10)"	""	""
"0000442494"	"00022949"	"10"	"364"	"-5"	"364"	"-5"	"c.364-5?"	"r.(?)"	"p.(=)"	""	""
"0000442495"	"00022949"	"10"	"343"	"0"	"343"	"0"	"c.343G>T"	"r.(?)"	"p.(Ala115Ser)"	""	""
"0000442496"	"00022949"	"10"	"1077"	"0"	"1077"	"0"	"c.1077C>T"	"r.(=)"	"p.(=)"	""	""
"0000442497"	"00022949"	"10"	"1216"	"0"	"1216"	"0"	"c.1216C>T"	"r.(?)"	"p.(Arg406Trp)"	""	""
"0000442498"	"00022949"	"10"	"1284"	"0"	"1284"	"0"	"c.1284C>G"	"r.(=)"	"p.(=)"	""	""
"0000442499"	"00022949"	"10"	"1989"	"0"	"1989"	"0"	"c.1989C>T"	"r.(=)"	"p.(=)"	""	""
"0000442500"	"00022949"	"10"	"1994"	"0"	"1994"	"0"	"c.1994C>T"	"r.(?)"	"p.(Thr665Met)"	""	""
"0000442501"	"00022949"	"10"	"2361"	"0"	"2361"	"0"	"c.2361C>T"	"r.(=)"	"p.(=)"	""	""
"0000442516"	"00022949"	"90"	"281"	"0"	"306"	"0"	"c.281_306del"	"r.(?)"	"p.(Gln94Argfs*59)"	""	""
"0000442517"	"00022949"	"90"	"319"	"0"	"319"	"0"	"c.319G>T"	"r.319g>u"	"p.Gly107*"	""	""
"0000442518"	"00022949"	"90"	"0"	"0"	"0"	"0"	"c.-85_*6371{0}"	"r.0"	"p.0"	"_1_12_"	""
"0000442519"	"00022949"	"90"	"0"	"0"	"0"	"0"	"c.-85_*6371{0}"	"r.0"	"p.0"	"_1_12_"	""
"0000442520"	"00022949"	"90"	"0"	"0"	"0"	"0"	"c.-85_*6371{0}"	"r.0"	"p.0"	"_1_12_"	""
"0000442521"	"00022949"	"90"	"0"	"0"	"0"	"0"	"c.-85_*6371{0}"	"r.0"	"p.0"	"_1_12_"	""
"0000442522"	"00022949"	"90"	"0"	"0"	"0"	"0"	"c.-85_*6371{0}"	"r.0"	"p.0"	"_1_12_"	""
"0000442523"	"00022949"	"90"	"-529"	"0"	"363"	"1700"	"c.(-529_363+1700)insN[?]"	"r.0"	"p.0"	"1"	""
"0000442525"	"00022949"	"90"	"-529"	"0"	"363"	"1700"	"c.(-529_363+1700)insN[?]"	"r.0"	"p.0"	"1"	""
"0000442526"	"00022949"	"90"	"1290"	"-1"	"1290"	"-1"	"c.1290-1G>A"	"r.1290_1370del"	"p.?"	""	""
"0000442527"	"00022949"	"90"	"1730"	"0"	"1733"	"0"	"c.1730_1733dup"	"r.(?)"	"p.(Asp578Glufs*2)"	""	""
"0000442551"	"00022949"	"10"	"-5"	"0"	"-5"	"0"	"c.-5C>G"	"r.(=)"	"p.(=)"	"1"	""
"0000442552"	"00022949"	"10"	"-5"	"0"	"-5"	"0"	"c.-5C>G"	"r.(=)"	"p.(=)"	"1"	""
"0000442553"	"00022949"	"10"	"-16"	"0"	"-15"	"0"	"c.-16_-15="	"-"	"-"	"1"	""
"0000442554"	"00022949"	"10"	"-16"	"0"	"-15"	"0"	"c.-16_-15="	"-"	"-"	"1"	""
"0000442555"	"00022949"	"10"	"-16"	"0"	"-15"	"0"	"c.-16_-15="	"-"	"-"	"1"	""
"0000442556"	"00022949"	"10"	"0"	"0"	"0"	"0"	"-"	"-"	"-"	"1_1i"	""
"0000442557"	"00022949"	"10"	"0"	"0"	"0"	"0"	"-"	"-"	"-"	"1_1i"	""
"0000442558"	"00022949"	"10"	"0"	"0"	"0"	"0"	"-"	"-"	"-"	"1_1i"	""
"0000442559"	"00022949"	"10"	"0"	"0"	"0"	"0"	"-"	"-"	"-"	"1_1i"	""
"0000442560"	"00022949"	"10"	"0"	"0"	"0"	"0"	"-"	"-"	"-"	"1_1i"	""
"0000442561"	"00022949"	"10"	"0"	"0"	"0"	"0"	"-"	"-"	"-"	"1_1i"	""
"0000442562"	"00022949"	"10"	"0"	"0"	"0"	"0"	"-"	"-"	"-"	"1_1i"	""
"0000442563"	"00022949"	"10"	"0"	"0"	"0"	"0"	"-"	"-"	"-"	"1_1i"	""
"0000442564"	"00022949"	"10"	"0"	"0"	"0"	"0"	"-"	"-"	"-"	""	""
"0000442565"	"00022949"	"10"	"0"	"0"	"0"	"0"	"-"	"-"	"-"	""	""
"0000442566"	"00022949"	"90"	"-529"	"0"	"363"	"1700"	"c.(-529_363+1700)ins[(300_2500)]"	"r.0"	"p.0"	"1"	""
"0000442567"	"00022949"	"90"	"-529"	"0"	"363"	"1700"	"c.(-529_363+1700)ins[(2200_2500)]"	"r.0"	"p.0"	"1"	""
"0000442568"	"00022949"	"90"	"-529"	"0"	"363"	"1700"	"c.(-529_363+1700)insN[300]"	"r.0"	"p.0"	"1"	""
"0000442569"	"00022949"	"90"	"-529"	"0"	"363"	"1700"	"c.(-529_363+1700)insN[2500]"	"r.0"	"p.0"	"1"	""
"0000442570"	"00022949"	"90"	"-529"	"0"	"363"	"1700"	"c.(-529_363+1700)ins[(2200_2800)]"	"r.0"	"p.0"	"1"	""
"0000443412"	"00022949"	"11"	"-126"	"0"	"-125"	"0"	"c.-126_-125insN[238]"	"-"	"-"	"_1"	"GCG[8]GCA[1]GCG[6]"
"0000443413"	"00022949"	"11"	"-165"	"0"	"-165"	"0"	"c.-165C>T"	"-"	"-"	"_1"	""
"0000443414"	"00022949"	"50"	"-850"	"0"	"-850"	"0"	"c.-850C>A"	"-"	"-"	"_1"	""
"0000443415"	"00022949"	"11"	"-165"	"0"	"-165"	"0"	"c.-165C>T"	"-"	"-"	"_1"	""
"0000443416"	"00022949"	"50"	"-850"	"0"	"-850"	"0"	"c.-850C>A"	"-"	"-"	"_1"	""
"0000443417"	"00022949"	"90"	"-850"	"0"	"-850"	"0"	"c.-850C>A"	"r.=|[0.5]"	"p.(=)"	"_1"	""
"0000443418"	"00022949"	"10"	"-165"	"0"	"-165"	"0"	"c.-165C>T"	"r.="	"p.="	"_1"	""
"0000443419"	"00022949"	"30"	"-126"	"0"	"-125"	"0"	"c.-126_-125insN[235]"	"-"	"-"	"_1"	"GCG[7]GCA[1]GCG[6]"
"0000443420"	"00022949"	"30"	"-126"	"0"	"-125"	"0"	"c.-126_-125insN[244]"	"-"	"-"	"_1"	"GCG[10]GCA[1]GCG[6]"
"0000443421"	"00022949"	"30"	"-126"	"0"	"-125"	"0"	"c.-126_-125insN[232]"	"-"	"-"	"_1"	"GCG[6]GCA[1]GCG[6]"
"0000443422"	"00022949"	"30"	"-126"	"0"	"-125"	"0"	"c.-126_-125insN[220]"	"-"	"-"	"_1"	"GCG[9]"
"0000443423"	"00022949"	"30"	"-126"	"0"	"-125"	"0"	"c.-126_-125insN[241]"	"-"	"-"	"_1"	"GCG[6]GCA[1]GCG[9]"
"0000443424"	"00022949"	"30"	"-126"	"0"	"-125"	"0"	"c.-126_-125insN[211]"	"-"	"-"	"_1"	"GCG[6]"
"0000556997"	"00022949"	"30"	"2675"	"0"	"2675"	"0"	"c.2675G>A"	"r.(?)"	"p.(Arg892Gln)"	""	""
"0000556998"	"00022949"	"30"	"2515"	"0"	"2515"	"0"	"c.2515G>A"	"r.(?)"	"p.(Val839Ile)"	""	""
"0000556999"	"00022949"	"30"	"2085"	"0"	"2085"	"0"	"c.2085C>G"	"r.(?)"	"p.(Phe695Leu)"	""	""
"0000557000"	"00022949"	"30"	"2042"	"0"	"2042"	"0"	"c.2042G>T"	"r.(?)"	"p.(Gly681Val)"	""	""
"0000557001"	"00022949"	"30"	"1626"	"0"	"1626"	"0"	"c.1626C>T"	"r.(?)"	"p.(Cys542=)"	""	""
"0000557003"	"00022949"	"50"	"1429"	"0"	"1429"	"0"	"c.1429C>T"	"r.(?)"	"p.(Arg477Cys)"	""	""
"0000557004"	"00022949"	"30"	"746"	"0"	"746"	"0"	"c.746C>A"	"r.(?)"	"p.(Thr249Asn)"	""	""
"0000557009"	"00022949"	"30"	"343"	"0"	"343"	"0"	"c.343G>T"	"r.(?)"	"p.(Ala115Ser)"	""	""
"0000557010"	"00022949"	"90"	"98"	"0"	"99"	"0"	"c.98_99del"	"r.(?)"	"p.(Trp33Ter)"	""	""
"0000615809"	"00022949"	"30"	"1704"	"0"	"1704"	"0"	"c.1704C>T"	"r.(?)"	"p.(Ile568=)"	""	""
"0000615810"	"00022949"	"30"	"930"	"0"	"930"	"0"	"c.930C>T"	"r.(?)"	"p.(Asn310=)"	""	""
"0000615811"	"00022949"	"30"	"154"	"0"	"154"	"0"	"c.154G>A"	"r.(?)"	"p.(Gly52Ser)"	""	""
"0000615812"	"00022949"	"30"	"117"	"0"	"117"	"0"	"c.117C>T"	"r.(?)"	"p.(Asp39=)"	""	""
"0000623389"	"00022949"	"50"	"1602"	"0"	"1602"	"0"	"c.1602G>A"	"r.(?)"	"p.(Thr534=)"	""	""
"0000649253"	"00022949"	"50"	"421"	"0"	"421"	"0"	"c.421C>T"	"r.(?)"	"p.(Arg141Trp)"	""	""
"0000649254"	"00022949"	"10"	"343"	"0"	"343"	"0"	"c.343G>T"	"r.(?)"	"p.(Ala115Ser)"	""	""
"0000657760"	"00022949"	"30"	"307"	"0"	"307"	"0"	"c.307G>A"	"r.(?)"	"p.(Gly103Arg)"	""	""
"0000669321"	"00022949"	"10"	"343"	"0"	"343"	"0"	"c.343G>T"	"r.(?)"	"p.(Ala115Ser)"	""	""
"0000680432"	"00022949"	"30"	"2555"	"0"	"2555"	"0"	"c.2555C>G"	"r.(?)"	"p.(Pro852Arg)"	""	""
"0000680433"	"00022949"	"50"	"896"	"0"	"896"	"0"	"c.896G>C"	"r.(?)"	"p.(Arg299Pro)"	""	""
"0000680434"	"00022949"	"30"	"668"	"0"	"668"	"0"	"c.668C>G"	"r.(?)"	"p.(Ala223Gly)"	""	""
"0000691956"	"00022949"	"50"	"1742"	"0"	"1742"	"0"	"c.1742C>T"	"r.(?)"	"p.(Pro581Leu)"	""	""
"0000691957"	"00022949"	"30"	"1588"	"-3"	"1588"	"-3"	"c.1588-3C>T"	"r.spl?"	"p.?"	""	""
"0000725492"	"00022949"	"30"	"2868"	"0"	"2868"	"0"	"c.2868C>T"	"r.(?)"	"p.(Gly956=)"	""	""
"0000725493"	"00022949"	"30"	"1994"	"0"	"1994"	"0"	"c.1994C>T"	"r.(?)"	"p.(Thr665Met)"	""	""
"0000725494"	"00022949"	"90"	"1697"	"0"	"1700"	"0"	"c.1697_1700dup"	"r.(?)"	"p.(His567Glnfs*13)"	""	""
"0000725495"	"00022949"	"50"	"1429"	"0"	"1429"	"0"	"c.1429C>T"	"r.(?)"	"p.(Arg477Cys)"	""	""
"0000725496"	"00022949"	"30"	"1154"	"0"	"1154"	"0"	"c.1154C>T"	"r.(?)"	"p.(Pro385Leu)"	""	""
"0000725497"	"00022949"	"50"	"380"	"0"	"380"	"0"	"c.380C>T"	"r.(?)"	"p.(Pro127Leu)"	""	""
"0000725498"	"00022949"	"30"	"257"	"0"	"257"	"0"	"c.257G>A"	"r.(?)"	"p.(Gly86Glu)"	""	""
"0000725499"	"00022949"	"50"	"246"	"0"	"248"	"0"	"c.246_248dup"	"r.(?)"	"p.(Gly90dup)"	""	""
"0000807119"	"00022949"	"30"	"2006"	"0"	"2006"	"0"	"c.2006C>T"	"r.(?)"	"p.(Thr669Met)"	""	""
"0000807120"	"00022949"	"30"	"1044"	"0"	"1044"	"0"	"c.1044C>T"	"r.(?)"	"p.(Ala348=)"	""	""
"0000807122"	"00022949"	"30"	"216"	"0"	"216"	"0"	"c.216C>T"	"r.(?)"	"p.(Ala72=)"	""	""
"0000854307"	"00022949"	"50"	"2555"	"0"	"2555"	"0"	"c.2555C>G"	"r.(?)"	"p.(Pro852Arg)"	""	""
"0000854308"	"00022949"	"30"	"2224"	"-9"	"2224"	"-8"	"c.2224-9_2224-8del"	"r.(=)"	"p.(=)"	""	""
"0000854309"	"00022949"	"30"	"1588"	"-3"	"1588"	"-3"	"c.1588-3C>T"	"r.spl?"	"p.?"	""	""
"0000854310"	"00022949"	"10"	"1154"	"0"	"1154"	"0"	"c.1154C>T"	"r.(?)"	"p.(Pro385Leu)"	""	""
"0000864345"	"00022949"	"30"	"2337"	"0"	"2337"	"0"	"c.2337C>A"	"r.(?)"	"p.(Thr779=)"	""	""
"0000864346"	"00022949"	"50"	"1592"	"0"	"1592"	"0"	"c.1592T>C"	"r.(?)"	"p.(Phe531Ser)"	""	""
"0000864347"	"00022949"	"30"	"1154"	"0"	"1154"	"0"	"c.1154C>T"	"r.(?)"	"p.(Pro385Leu)"	""	""
"0000864348"	"00022949"	"30"	"307"	"0"	"307"	"0"	"c.307G>A"	"r.(?)"	"p.(Gly103Arg)"	""	""
"0000892589"	"00022949"	"10"	"2656"	"0"	"2656"	"0"	"c.2656G>T"	"r.(?)"	"p.(Ala886Ser)"	""	""
"0000892590"	"00022949"	"10"	"2028"	"-15"	"2028"	"-15"	"c.2028-15C>T"	"r.(=)"	"p.(=)"	""	""
"0000892591"	"00022949"	"50"	"1211"	"0"	"1211"	"0"	"c.1211G>A"	"r.(?)"	"p.(Ser404Asn)"	""	""
"0000892592"	"00022949"	"50"	"1031"	"0"	"1031"	"0"	"c.1031G>A"	"r.(?)"	"p.(Arg344His)"	""	""
"0000908721"	"00022949"	"90"	"2323"	"0"	"2323"	"0"	"c.2323G>T"	"r.(?)"	"p.(Gly775*)"	""	""
"0000908722"	"00022949"	"90"	"0"	"0"	"0"	"0"	"c.-85_*6371{0}"	"r.0?"	"p.0?"	"_1_12_"	""
"0000914494"	"00022949"	"30"	"1588"	"-3"	"1588"	"-3"	"c.1588-3C>T"	"r.spl?"	"p.?"	""	""
"0000914495"	"00022949"	"30"	"1413"	"0"	"1413"	"0"	"c.1413C>T"	"r.(?)"	"p.(Cys471=)"	""	""
"0000926155"	"00022949"	"30"	"2656"	"0"	"2656"	"0"	"c.2656G>T"	"r.(?)"	"p.(Ala886Ser)"	""	""
"0000930514"	"00022949"	"30"	"2226"	"0"	"2226"	"0"	"c.2226C>T"	"r.(?)"	"p.(=)"	""	""
"0000950530"	"00022949"	"30"	"657"	"0"	"657"	"0"	"c.657C>T"	"r.(?)"	"p.(=)"	""	""
"0000968139"	"00022949"	"30"	"2358"	"0"	"2358"	"0"	"c.2358T>C"	"r.(?)"	"p.(=)"	""	""
"0000968140"	"00022949"	"30"	"2226"	"0"	"2226"	"0"	"c.2226C>T"	"r.(?)"	"p.(=)"	""	""
"0000968141"	"00022949"	"30"	"1742"	"0"	"1742"	"0"	"c.1742C>T"	"r.(?)"	"p.(Pro581Leu)"	""	""
"0000968142"	"00022949"	"30"	"1087"	"-338"	"1087"	"-338"	"c.1087-338T>C"	"r.(=)"	"p.(=)"	""	""
"0000968143"	"00022949"	"10"	"606"	"0"	"606"	"0"	"c.606A>G"	"r.(?)"	"p.(=)"	""	""
"0000981662"	"00022949"	"50"	"1939"	"0"	"1939"	"0"	"c.1939G>A"	"r.(?)"	"p.(Val647Met)"	""	""
"0000981663"	"00022949"	"50"	"1854"	"0"	"1854"	"0"	"c.1854G>T"	"r.(?)"	"p.(=)"	""	""
"0000981664"	"00022949"	"50"	"1756"	"0"	"1756"	"0"	"c.1756C>T"	"r.(?)"	"p.(Arg586Cys)"	""	""
"0000981665"	"00022949"	"50"	"1429"	"0"	"1429"	"0"	"c.1429C>T"	"r.(?)"	"p.(Arg477Cys)"	""	""
"0000981666"	"00022949"	"50"	"1145"	"0"	"1145"	"0"	"c.1145G>A"	"r.(?)"	"p.(Arg382His)"	""	""
"0000981667"	"00022949"	"50"	"974"	"0"	"974"	"0"	"c.974C>T"	"r.(?)"	"p.(Pro325Leu)"	""	""
"0000981668"	"00022949"	"30"	"402"	"7"	"402"	"7"	"c.402+7A>G"	"r.(=)"	"p.(=)"	""	""
"0001001976"	"00022949"	"10"	"2370"	"0"	"2370"	"0"	"c.2370C>A"	"r.(?)"	"p.(=)"	""	""
"0001001977"	"00022949"	"30"	"1742"	"0"	"1742"	"0"	"c.1742C>T"	"r.(?)"	"p.(Pro581Leu)"	""	""
"0001001978"	"00022949"	"10"	"1272"	"0"	"1272"	"0"	"c.1272G>A"	"r.(?)"	"p.(=)"	""	""
"0001001979"	"00022949"	"30"	"1129"	"0"	"1129"	"0"	"c.1129C>G"	"r.(?)"	"p.(Gln377Glu)"	""	""
"0001001980"	"00022949"	"30"	"179"	"0"	"179"	"0"	"c.179C>T"	"r.(?)"	"p.(Ala60Val)"	""	""
"0001015309"	"00022949"	"30"	"2007"	"0"	"2007"	"0"	"c.2007G>A"	"r.(?)"	"p.(=)"	""	""
"0001026579"	"00022949"	"30"	"990"	"0"	"990"	"0"	"c.990T>C"	"r.(?)"	"p.(=)"	""	""
"0001040850"	"00022949"	"50"	"1969"	"0"	"1969"	"0"	"c.1969C>T"	"r.(?)"	"p.(Arg657Cys)"	""	""
"0001040851"	"00022949"	"50"	"1909"	"0"	"1909"	"0"	"c.1909G>A"	"r.(?)"	"p.(Glu637Lys)"	""	""
"0001040852"	"00022949"	"50"	"1652"	"0"	"1652"	"0"	"c.1652G>A"	"r.(?)"	"p.(Arg551His)"	""	""
"0001040853"	"00022949"	"50"	"1615"	"0"	"1615"	"0"	"c.1615A>G"	"r.(?)"	"p.(Ser539Gly)"	""	""
"0001040854"	"00022949"	"30"	"1602"	"0"	"1602"	"0"	"c.1602G>A"	"r.(?)"	"p.(Thr534=)"	""	""
"0001040855"	"00022949"	"50"	"246"	"0"	"248"	"0"	"c.246_248del"	"r.(?)"	"p.(Gly90del)"	""	""
"0001045312"	"00022949"	"90"	"2026"	"0"	"2026"	"0"	"c.2026C>T"	"r.(?)"	"p.(Arg676Ter)"	""	""
"0001045313"	"00022949"	"90"	"1290"	"-2"	"1290"	"-2"	"c.1290-2A>C"	"r.spl"	"p.?"	""	""
"0001046537"	"00022949"	"50"	"343"	"0"	"343"	"0"	"c.343G>T"	"r.(?)"	"p.(Ala115Ser)"	""	""
"0001055464"	"00022949"	"50"	"1765"	"-5"	"1765"	"-5"	"c.1765-5T>C"	"r.spl?"	"p.?"	""	""
"0001055465"	"00022949"	"30"	"176"	"0"	"176"	"0"	"c.176C>T"	"r.(?)"	"p.(Pro59Leu)"	""	""


## Screenings_To_Variants ## Do not remove or alter this header ##
## Count = 67
"{{screeningid}}"	"{{variantid}}"
"0000016826"	"0000036726"
"0000016827"	"0000036727"
"0000016850"	"0000036775"
"0000016851"	"0000036776"
"0000016853"	"0000036781"
"0000016856"	"0000036782"
"0000016857"	"0000036783"
"0000054832"	"0000084862"
"0000108935"	"0000177871"
"0000211068"	"0000442486"
"0000211069"	"0000442487"
"0000211069"	"0000442488"
"0000211070"	"0000442489"
"0000211071"	"0000442490"
"0000211072"	"0000442491"
"0000211072"	"0000442492"
"0000211073"	"0000442493"
"0000211074"	"0000442494"
"0000211075"	"0000442495"
"0000211076"	"0000442496"
"0000211077"	"0000442497"
"0000211078"	"0000442498"
"0000211079"	"0000442499"
"0000211080"	"0000442500"
"0000211081"	"0000442501"
"0000211096"	"0000442516"
"0000211097"	"0000442517"
"0000211098"	"0000442518"
"0000211099"	"0000442519"
"0000211100"	"0000442520"
"0000211100"	"0000442551"
"0000211101"	"0000442521"
"0000211101"	"0000442552"
"0000211102"	"0000442522"
"0000211103"	"0000442523"
"0000211105"	"0000442525"
"0000211106"	"0000442526"
"0000211107"	"0000442527"
"0000211119"	"0000442553"
"0000211120"	"0000442554"
"0000211120"	"0000442564"
"0000211121"	"0000442555"
"0000211121"	"0000442565"
"0000211122"	"0000442556"
"0000211123"	"0000442557"
"0000211124"	"0000442558"
"0000211125"	"0000442559"
"0000211126"	"0000442560"
"0000211127"	"0000442561"
"0000211128"	"0000442562"
"0000211129"	"0000442563"
"0000211130"	"0000442566"
"0000211131"	"0000442567"
"0000211132"	"0000442568"
"0000211133"	"0000442569"
"0000211133"	"0000442570"
"0000211797"	"0000443413"
"0000211797"	"0000443414"
"0000211798"	"0000443415"
"0000211799"	"0000443416"
"0000292564"	"0000649253"
"0000292565"	"0000649254"
"0000305633"	"0000669321"
"0000429052"	"0000908721"
"0000429052"	"0000908722"
"0000467500"	"0001045312"
"0000467501"	"0001045313"