### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = YPEL2) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "YPEL2" "yippee-like 2 (Drosophila)" "17" "q23" "unknown" "NC_000017.10" "UD_136095345172" "" "https://www.LOVD.nl/YPEL2" "" "1" "18326" "388403" "609723" "1" "1" "1" "1" "NOTE: this gene is associated with the RP17 disease phenotype caused by rearrangements in the chromosome 17 region NC_000017.10:g.57295000_57522000 / NC_000017.11:g.59217639_59444639.\r\nEstablishment of this gene variant database (LSDB) was performed by Johan den Dunnen, supported by Global Variome." "" "g" "https://databases.lovd.nl/shared/refseq/YPEL2_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2023-08-14 11:15:25" "04542" "2025-08-04 09:22:27" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00022978" "YPEL2" "yippee-like 2 (Drosophila)" "001" "NM_001005404.3" "" "NP_001005404.1" "" "" "" "-328" "4904" "360" "57409053" "57479095" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 2 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00112" "RP" "retinitis pigmentosa (RP)" "" "268000" "" "" "" "00001" "2013-02-21 17:12:36" "00006" "2021-01-18 09:53:26" "02318" "RP17" "retinitis pigmentosa, type 17 (RP17)" "AD" "600852" "" "" "" "00006" "2014-09-25 23:29:40" "04542" "2023-11-06 16:13:11" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 1 "{{geneid}}" "{{diseaseid}}" "YPEL2" "02318" ## Individuals ## Do not remove or alter this header ## ## Count = 28 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00436090" "" "" "" "37" "" "04542" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "4-generation family, 37 affected (20F, 17M)" "F;M" "" "Netherlands" "" "0" "" "" "" "FamNL1" "00436091" "" "" "" "11" "" "04542" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "5-generation family, 11 affected (6F, 5M)" "F;M" "" "Netherlands" "" "0" "" "" "" "FamNL2" "00436092" "" "" "" "25" "" "04542" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "5-generation family, 25 affected (15F, 10M)" "F;M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "FamUK13" "00436093" "" "" "" "51" "" "04542" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "8-generation family, 51 affected (29F, 22M)" "F;M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "FamUK1" "00436094" "" "" "" "7" "" "04542" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "4-generation family, 7 affected (6F, M)" "F;M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "FamUK2" "00436095" "" "" "" "4" "" "04542" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "4-generation family, 4 affected (2F, 2M)" "F;M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "FamUK3" "00436096" "" "" "" "4" "" "04542" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "4-generation family, 4 affected (3F, M)" "F;M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "FamUK4" "00436097" "" "" "" "8" "" "04542" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "5-generation family, 8 affected (3F, 5M)" "F;M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "FamUK5" "00436098" "" "" "" "10" "" "04542" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "7-generation family, 10 affected (6F, 4M)" "F;M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "FamUK6" "00436099" "" "" "" "2" "" "04542" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "2-generation family, 2 affected sisters" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "FamUK7" "00436100" "" "" "" "2" "" "04542" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "2-generation family, affected father and son" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "FamUK8" "00436101" "" "" "" "10" "" "04542" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "4-generation family, 10 affected (9F, M)" "F;M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "FamUK9" "00436102" "" "" "" "5" "" "04542" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "5-generation family, 5 affected (3F, 2M)" "F;M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "FamUK10" "00436103" "" "" "" "5" "" "04542" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "4-generation family, 5 affected (5F)" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "FamUK11" "00436104" "" "" "" "7" "" "04542" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "5-generation family, 7 affected (3F, 4M)" "F;M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "FamUK12" "00436105" "" "" "" "42" "" "04542" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "5-generation family, 42 affected (22F, 19M, 1?)" "F;M" "" "Canada" "" "0" "" "" "" "FamCA1" "00436106" "" "" "" "60" "" "04542" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "7-generation family, 60 affected (27F, 33M)" "F;M" "" "South Africa" "" "0" "" "" "" "FamSA1" "00436107" "" "" "" "25" "" "04542" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "5-generation family, 25 affected (14F, 11M)" "F;M" "" "South Africa" "" "0" "" "" "" "FamSA2" "00436108" "" "" "" "6" "" "04542" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "4-generation family, 6 affected (2F, 4M)" "F;M" "" "South Africa" "" "0" "" "" "" "FamSA3" "00436109" "" "" "" "9" "" "04542" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "5-generation family, 9 affected (3F, 6M)" "F;M" "" "South Africa" "" "0" "" "" "" "FamSA4" "00436110" "" "" "" "2" "" "04542" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "4-generation family, 2 affected sisters" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "FamUK14" "00436111" "" "" "" "12" "" "04542" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "5 generation family, 12 affected (8F, 4M)" "F;M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "FamUK15" "00436142" "" "" "" "1" "" "04542" "{PMID:Panneman 2023:36819107}" "" "F" "-" "United Kingdom (Great Britain)" "" "0" "" "" "" "067984" "00456020" "" "" "" "6" "" "04542" "{DOI:de Bruijn 2024:10.3389/fgene.2024.1469686}" "6-generation family, 6 affected (2F, 4M)" "F;M" "" "Australia" "" "0" "" "" "" "FamAU1" "00456021" "" "" "" "7" "" "04542" "{DOI:de Bruijn 2024:10.3389/fgene.2024.1469686}" "4-generation family, 7 affected (2F, 5M)" "F;M" "" "Australia" "" "0" "" "" "" "FamAU2" "00456022" "" "" "" "13" "" "04542" "{DOI:de Bruijn 2024:10.3389/fgene.2024.1469686}" "5-generation family, 13 affected (11F, 2M)" "F;M" "" "Australia" "" "0" "" "" "" "FamAU3" "00456023" "" "" "" "4" "" "04542" "{DOI:de Bruijn 2024:10.3389/fgene.2024.1469686}" "3-generation family, 4 affected (4F)" "F" "" "Germany" "" "0" "" "" "" "FamDE1" "00456024" "" "" "" "16" "" "04542" "{DOI:de Bruijn 2024:10.3389/fgene.2024.1469686}" "6-generation family, 16 affected (9M, 7F)" "F;M" "" "United States" "" "0" "" "" "" "FamUS1" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 28 "{{individualid}}" "{{diseaseid}}" "00436090" "00112" "00436091" "00112" "00436092" "00112" "00436093" "00112" "00436094" "00112" "00436095" "00112" "00436096" "00112" "00436097" "00112" "00436098" "00112" "00436099" "00112" "00436100" "00112" "00436101" "00112" "00436102" "00112" "00436103" "00112" "00436104" "00112" "00436105" "00112" "00436106" "00112" "00436107" "00112" "00436108" "00112" "00436109" "00112" "00436110" "00112" "00436111" "00112" "00436142" "00112" "00456020" "00112" "00456021" "00112" "00456022" "00112" "00456023" "00112" "00456024" "00112" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00112, 02318 ## Count = 28 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "0000326274" "00112" "00436090" "04542" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" "0000326275" "00112" "00436091" "04542" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" "0000326276" "00112" "00436092" "04542" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" "0000326277" "00112" "00436093" "04542" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" "0000326278" "00112" "00436094" "04542" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" "0000326279" "00112" "00436095" "04542" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" "0000326280" "00112" "00436096" "04542" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" "0000326281" "00112" "00436097" "04542" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" "0000326282" "00112" "00436098" "04542" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" "0000326283" "00112" "00436099" "04542" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" "0000326284" "00112" "00436100" "04542" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" "0000326285" "00112" "00436101" "04542" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" "0000326286" "00112" "00436102" "04542" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" "0000326287" "00112" "00436103" "04542" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" "0000326288" "00112" "00436104" "04542" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" "0000326289" "00112" "00436105" "04542" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" "0000326290" "00112" "00436106" "04542" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" "0000326291" "00112" "00436107" "04542" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" "0000326292" "00112" "00436108" "04542" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" "0000326293" "00112" "00436109" "04542" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" "0000326294" "00112" "00436110" "04542" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" "0000326295" "00112" "00436111" "04542" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" "0000326326" "02318" "00436142" "04542" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" "0000344540" "00112" "00456020" "04542" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" "0000344541" "00112" "00456021" "04542" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" "0000344542" "00112" "00456022" "04542" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" "0000344543" "00112" "00456023" "04542" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" "0000344544" "00112" "00456024" "04542" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "RP17" "retinitis pigmentosa" ## Screenings ## Do not remove or alter this header ## ## Count = 28 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000437571" "00436090" "1" "04542" "00006" "2023-07-21 17:25:31" "" "" "arrayCGH;SEQ-NG" "DNA" "" "WES, WGS" "0000437572" "00436091" "1" "04542" "00006" "2023-07-21 17:40:20" "" "" "SEQ-NG" "DNA" "" "WES, WGS" "0000437573" "00436092" "1" "04542" "00006" "2023-07-21 18:01:50" "" "" "SEQ-NG" "DNA" "" "WES, WGS" "0000437574" "00436093" "1" "04542" "00006" "2023-07-21 19:44:40" "" "" "arraySNP;SEQ-NG" "DNA" "" "WES, WGS" "0000437575" "00436094" "1" "04542" "00006" "2023-07-21 19:44:40" "" "" "arraySNP;SEQ-NG" "DNA" "" "WES, WGS" "0000437576" "00436095" "1" "04542" "00006" "2023-07-21 19:44:40" "" "" "arraySNP;SEQ-NG" "DNA" "" "WES, WGS" "0000437577" "00436096" "1" "04542" "00006" "2023-07-21 19:44:40" "" "" "arraySNP;SEQ-NG" "DNA" "" "WES, WGS" "0000437578" "00436097" "1" "04542" "00006" "2023-07-21 19:44:40" "" "" "arraySNP;SEQ-NG" "DNA" "" "WES, WGS" "0000437579" "00436098" "1" "04542" "00006" "2023-07-21 19:44:40" "" "" "arraySNP;SEQ-NG" "DNA" "" "WES, WGS" "0000437580" "00436099" "1" "04542" "00006" "2023-07-21 19:44:40" "" "" "arraySNP;SEQ-NG" "DNA" "" "WES, WGS" "0000437581" "00436100" "1" "04542" "00006" "2023-07-21 19:44:40" "" "" "arraySNP;SEQ-NG" "DNA" "" "WES, WGS" "0000437582" "00436101" "1" "04542" "00006" "2023-07-21 19:44:40" "" "" "arraySNP;SEQ-NG" "DNA" "" "WES, WGS" "0000437583" "00436102" "1" "04542" "00006" "2023-07-21 19:44:40" "" "" "arraySNP;SEQ-NG" "DNA" "" "WES, WGS" "0000437584" "00436103" "1" "04542" "00006" "2023-07-21 19:44:40" "" "" "arraySNP;SEQ-NG" "DNA" "" "WES, WGS" "0000437585" "00436104" "1" "04542" "00006" "2023-07-21 19:44:40" "" "" "arraySNP;SEQ-NG" "DNA" "" "WES, WGS" "0000437586" "00436105" "1" "04542" "00006" "2023-07-21 20:28:43" "" "" "SEQ-NG" "DNA" "" "WES, WGS" "0000437587" "00436106" "1" "04542" "00006" "2023-07-21 22:00:47" "" "" "SEQ-NG" "DNA" "" "WES, WGS" "0000437588" "00436107" "1" "04542" "00006" "2023-07-21 22:00:47" "" "" "SEQ-NG" "DNA" "" "WES, WGS" "0000437589" "00436108" "1" "04542" "00006" "2023-07-21 22:00:47" "" "" "SEQ-NG" "DNA" "" "WES, WGS" "0000437590" "00436109" "1" "04542" "00006" "2023-07-21 22:00:47" "" "" "SEQ-NG" "DNA" "" "WES, WGS" "0000437591" "00436110" "1" "04542" "00006" "2023-07-22 09:09:54" "" "" "SEQ;SEQ-NG" "DNA" "" "WES, WGS" "0000437592" "00436111" "1" "04542" "00006" "2023-07-22 09:12:03" "" "" "SEQ-NG" "DNA" "" "WES, WGS" "0000437623" "00436142" "1" "04542" "04542" "2023-08-17 14:45:15" "" "" "MIPsm" "DNA" "" "" "0000457636" "00456020" "1" "04542" "04542" "2024-10-22 16:17:57" "" "" "MIPsm;SEQ-NG-I" "DNA" "" "" "0000457637" "00456021" "1" "04542" "04542" "2024-10-22 16:29:58" "" "" "MIPsm;SEQ-NG-I" "DNA" "" "" "0000457638" "00456022" "1" "04542" "04542" "2024-10-22 16:33:57" "" "" "MIPsm;SEQ-NG-I" "DNA" "" "" "0000457639" "00456023" "1" "04542" "04542" "2024-10-22 16:37:34" "" "" "PCRq;SEQ-NG-I" "DNA" "" "" "0000457640" "00456024" "1" "04542" "04542" "2024-10-22 16:45:11" "" "" "MIPsm;SEQ-NG-I" "DNA" "" "" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 0 ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 28 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000932874" "1" "90" "17" "57291915" "57518137" "dup" "0" "04542" "GDPD1_000001" "g.57291915_57518137dup" "" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "" "RP17_SV1" "" "Germline" "yes" "" "0" "" "" "g.59214554_59440776dup" "" "pathogenic (dominant)" "" "0000932875" "1" "90" "17" "57260521" "57515862" "dup" "0" "04542" "GDPD1_000005" "g.57260521_57515862dup" "" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "" "RP17_SV5" "" "Germline" "yes" "" "0" "" "" "g.59183160_59438501dup" "" "pathogenic (dominant)" "" "0000932876" "1" "90" "17" "57324706" "57324707" "ins" "0" "04542" "GDPD1_000006" "g.57324706_57324707ins[A;57440106_57510754;57295982_57510754;57295982_57324706]" "" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}, {DOI:de Bruijn 2024:10.3389/fgene.2024.1469686}" "" "RP17_SV6" "" "Germline" "yes" "" "0" "" "" "g.59247345_59247346ins[A;59362745_59433393;59218621_59433393;59218621_59247345]" "" "pathogenic (dominant)" "" "0000932877" "1" "90" "17" "57456111" "57468959" "delins" "0" "04542" "GDPD1_000002" "g.57456111_57468959delins[57275839_57559111inv;AGGCTGGTC]" "" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "" "RP17_SV2" "" "Germline" "yes" "" "0" "" "" "g.59378750_59391598delins[59198478_59481750inv;AGGCTGGTC]" "" "pathogenic (dominant)" "" "0000932878" "1" "90" "17" "57456111" "57468959" "delins" "0" "04542" "GDPD1_000002" "g.57456111_57468959delins[57275839_57559111inv;AGGCTGGTC]" "" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "" "RP17_SV2" "" "Germline" "yes" "" "0" "" "" "g.59378750_59391598delins[59198478_59481750inv;AGGCTGGTC]" "" "pathogenic (dominant)" "" "0000932879" "1" "90" "17" "57456111" "57468959" "delins" "0" "04542" "GDPD1_000002" "g.57456111_57468959delins[57275839_57559111inv;AGGCTGGTC]" "" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "" "RP17_SV2" "" "Germline" "yes" "" "0" "" "" "g.59378750_59391598delins[59198478_59481750inv;AGGCTGGTC]" "" "pathogenic (dominant)" "" "0000932880" "1" "90" "17" "57456111" "57468959" "delins" "0" "04542" "GDPD1_000002" "g.57456111_57468959delins[57275839_57559111inv;AGGCTGGTC]" "" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "" "RP17_SV2" "" "Germline" "yes" "" "0" "" "" "g.59378750_59391598delins[59198478_59481750inv;AGGCTGGTC]" "" "pathogenic (dominant)" "" "0000932881" "1" "90" "17" "57456111" "57468959" "delins" "0" "04542" "GDPD1_000002" "g.57456111_57468959delins[57275839_57559111inv;AGGCTGGTC]" "" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "" "RP17_SV2" "" "Germline" "yes" "" "0" "" "" "g.59378750_59391598delins[59198478_59481750inv;AGGCTGGTC]" "" "pathogenic (dominant)" "" "0000932882" "1" "90" "17" "57456111" "57468959" "delins" "0" "04542" "GDPD1_000002" "g.57456111_57468959delins[57275839_57559111inv;AGGCTGGTC]" "" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "" "RP17_SV2" "" "Germline" "yes" "" "0" "" "" "g.59378750_59391598delins[59198478_59481750inv;AGGCTGGTC]" "" "pathogenic (dominant)" "" "0000932883" "1" "90" "17" "57456111" "57468959" "delins" "0" "04542" "GDPD1_000002" "g.57456111_57468959delins[57275839_57559111inv;AGGCTGGTC]" "" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "" "RP17_SV2" "" "Germline" "yes" "" "0" "" "" "g.59378750_59391598delins[59198478_59481750inv;AGGCTGGTC]" "" "pathogenic (dominant)" "" "0000932884" "1" "90" "17" "57456111" "57468959" "delins" "0" "04542" "GDPD1_000002" "g.57456111_57468959delins[57275839_57559111inv;AGGCTGGTC]" "" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "" "RP17_SV2" "" "Germline" "yes" "" "0" "" "" "g.59378750_59391598delins[59198478_59481750inv;AGGCTGGTC]" "" "pathogenic (dominant)" "" "0000932885" "1" "90" "17" "57456111" "57468959" "delins" "0" "04542" "GDPD1_000002" "g.57456111_57468959delins[57275839_57559111inv;AGGCTGGTC]" "" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "" "RP17_SV2" "" "Germline" "yes" "" "0" "" "" "g.59378750_59391598delins[59198478_59481750inv;AGGCTGGTC]" "" "pathogenic (dominant)" "" "0000932886" "1" "90" "17" "57456111" "57468959" "delins" "0" "04542" "GDPD1_000002" "g.57456111_57468959delins[57275839_57559111inv;AGGCTGGTC]" "" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "" "RP17_SV2" "" "Germline" "yes" "" "0" "" "" "g.59378750_59391598delins[59198478_59481750inv;AGGCTGGTC]" "" "pathogenic (dominant)" "" "0000932887" "1" "90" "17" "57456111" "57468959" "delins" "0" "04542" "GDPD1_000002" "g.57456111_57468959delins[57275839_57559111inv;AGGCTGGTC]" "" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "" "RP17_SV2" "" "Germline" "yes" "" "0" "" "" "g.59378750_59391598delins[59198478_59481750inv;AGGCTGGTC]" "" "pathogenic (dominant)" "" "0000932888" "1" "90" "17" "57456111" "57468959" "delins" "0" "04542" "GDPD1_000002" "g.57456111_57468959delins[57275839_57559111inv;AGGCTGGTC]" "" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "" "RP17_SV2" "" "Germline" "yes" "" "0" "" "" "g.59378750_59391598delins[59198478_59481750inv;AGGCTGGTC]" "" "pathogenic (dominant)" "" "0000932889" "1" "90" "17" "57280008" "57483883" "delins" "0" "04542" "GDPD1_000004" "g.57280008_57483883delins[57233035_57634900inv;TAAGCA]" "" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "" "RP17_SV4" "" "Germline" "yes" "" "0" "" "" "g.59202647_59406522delins[59155674_59557539inv;TAAGCA]" "" "pathogenic (dominant)" "" "0000932890" "1" "90" "17" "57516678" "57516679" "ins" "0" "04542" "GDPD1_000003" "g.57516678_57516679ins[AAAAAAAACTTGAAAAAGAAGTTTG;57247620_57391675;57516683_57612715inv;GGTCCAGATTGTG;57499214_57516678]" "" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "" "RP17_SV3" "" "Germline" "yes" "" "0" "" "" "g.59439317_59439318ins[AAAAAAAACTTGAAAAAGAAGTTTG;59170259_59314314;59439322_59535354inv;GGTCCAGATTGTG;59421853_59439317]" "" "pathogenic (dominant)" "" "0000932891" "1" "90" "17" "57516678" "57516679" "ins" "0" "04542" "GDPD1_000003" "g.57516678_57516679ins[AAAAAAAACTTGAAAAAGAAGTTTG;57247620_57391675;57516683_57612715inv;GGTCCAGATTGTG;57499214_57516678]" "" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "" "RP17_SV3" "" "Germline" "yes" "" "0" "" "" "g.59439317_59439318ins[AAAAAAAACTTGAAAAAGAAGTTTG;59170259_59314314;59439322_59535354inv;GGTCCAGATTGTG;59421853_59439317]" "" "pathogenic (dominant)" "" "0000932892" "1" "90" "17" "57516678" "57516679" "ins" "0" "04542" "GDPD1_000003" "g.57516678_57516679ins[AAAAAAAACTTGAAAAAGAAGTTTG;57247620_57391675;57516683_57612715inv;GGTCCAGATTGTG;57499214_57516678]" "" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "" "RP17_SV3" "" "Germline" "yes" "" "0" "" "" "g.59439317_59439318ins[AAAAAAAACTTGAAAAAGAAGTTTG;59170259_59314314;59439322_59535354inv;GGTCCAGATTGTG;59421853_59439317]" "" "pathogenic (dominant)" "" "0000932893" "1" "90" "17" "57516678" "57516679" "ins" "0" "04542" "GDPD1_000003" "g.57516678_57516679ins[AAAAAAAACTTGAAAAAGAAGTTTG;57247620_57391675;57516683_57612715inv;GGTCCAGATTGTG;57499214_57516678]" "" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "" "RP17_SV3" "" "Germline" "yes" "" "0" "" "" "g.59439317_59439318ins[AAAAAAAACTTGAAAAAGAAGTTTG;59170259_59314314;59439322_59535354inv;GGTCCAGATTGTG;59421853_59439317]" "" "pathogenic (dominant)" "" "0000932894" "1" "90" "17" "57326235" "57413152" "delins" "0" "04542" "GDPD1_000008" "g.57326235_57413152delins[CT;57277347_57631659inv]" "" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "" "RP17_SV8" "" "Germline" "yes" "" "0" "" "" "g.59248874_59335791delins[CT;59199986_59554298inv]" "" "pathogenic (dominant)" "" "0000932895" "1" "90" "17" "57453631" "57468930" "delins" "0" "04542" "GDPD1_000007" "g.57453631_57468930delins[57259525_57710821inv;TT]" "" "{PMID:De Bruijn 2020:33022222}, {DOI:De Bruijn 2020:10.1016/j.ajhg.2020.09.002}" "" "RP17_SV7" "" "Germline" "yes" "" "0" "" "" "g.59376270_59391569delins[59182164_59633460inv;TT]" "" "pathogenic (dominant)" "" "0000932959" "1" "90" "17" "57456111" "57468959" "delins" "0" "04542" "GDPD1_000002" "g.57456111_57468959delins[57275839_57559111inv;AGGCTGGTC]" "" "{PMID:Panneman 2023:36819107}, {DOI:Panneman 2023:10.3389/fcell.2023.1112270}" "" "RP17_SV2" "" "Germline" "yes" "" "0" "" "" "g.59378750_59391598delins[59198478_59481750inv;AGGCTGGTC]" "" "pathogenic (dominant)" "" "0001012177" "1" "90" "17" "57456111" "57468959" "delins" "0" "04542" "GDPD1_000002" "g.57456111_57468959delins[57275839_57559111inv;AGGCTGGTC]" "" "{DOI:de Bruijn 2024:10.3389/fgene.2024.1469686}" "" "RP17_SV2" "" "Germline" "" "" "0" "" "" "g.59378750_59391598delins[59198478_59481750inv;AGGCTGGTC]" "" "pathogenic (dominant)" "" "0001012178" "1" "90" "17" "57516678" "57516679" "ins" "0" "04542" "GDPD1_000003" "g.57516678_57516679ins[AAAAAAAACTTGAAAAAGAAGTTTG;57247620_57391675;57516683_57612715inv;GGTCCAGATTGTG;57499214_57516678]" "" "{DOI:de Bruijn 2024:10.3389/fgene.2024.1469686}" "" "RP17_SV3" "" "Germline" "" "" "0" "" "" "g.59439317_59439318ins[AAAAAAAACTTGAAAAAGAAGTTTG;59170259_59314314;59439322_59535354inv;GGTCCAGATTGTG;59421853_59439317]" "" "pathogenic (dominant)" "" "0001012179" "1" "90" "17" "57516678" "57516679" "ins" "0" "04542" "GDPD1_000003" "g.57516678_57516679ins[AAAAAAAACTTGAAAAAGAAGTTTG;57247620_57391675;57516683_57612715inv;GGTCCAGATTGTG;57499214_57516678]" "" "{DOI:de Bruijn 2024:10.3389/fgene.2024.1469686}" "" "RP17_SV3" "" "Germline" "" "" "0" "" "" "g.59439317_59439318ins[AAAAAAAACTTGAAAAAGAAGTTTG;59170259_59314314;59439322_59535354inv;GGTCCAGATTGTG;59421853_59439317]" "" "pathogenic (dominant)" "" "0001012180" "1" "90" "17" "57626499" "57626500" "ins" "0" "04542" "GDPD1_000010" "g.57626499_57626500ins[57413643_57623126inv;57264682_57626499]" "" "{DOI:de Bruijn 2024:10.3389/fgene.2024.1469686}" "" "RP17_SV9" "" "Germline" "yes" "" "0" "" "" "g.59549138_59549139ins[59336282_59545765inv;59187321_59549138]" "" "likely pathogenic (dominant)" "" "0001012181" "1" "90" "17" "57365657" "57439922" "delins" "0" "04542" "GDPD1_000011" "g.57365657_57439922delins[57297473_57555520inv;A]" "" "{DOI:de Bruijn 2024:10.3389/fgene.2024.1469686}" "" "RP17_SV10" "" "Germline" "yes" "" "0" "" "" "g.59288296_59362561delins[59220112_59478159inv;A]" "" "pathogenic (dominant)" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes YPEL2 ## Count = 28 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000932874" "00022978" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000932875" "00022978" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000932876" "00022978" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000932877" "00022978" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000932878" "00022978" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000932879" "00022978" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000932880" "00022978" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000932881" "00022978" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000932882" "00022978" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000932883" "00022978" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000932884" "00022978" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000932885" "00022978" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000932886" "00022978" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000932887" "00022978" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000932888" "00022978" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000932889" "00022978" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000932890" "00022978" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000932891" "00022978" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000932892" "00022978" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000932893" "00022978" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000932894" "00022978" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000932895" "00022978" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000932959" "00022978" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0001012177" "00022978" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0001012178" "00022978" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0001012179" "00022978" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0001012180" "00022978" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0001012181" "00022978" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 28 "{{screeningid}}" "{{variantid}}" "0000437571" "0000932874" "0000437572" "0000932875" "0000437573" "0000932876" "0000437574" "0000932877" "0000437575" "0000932878" "0000437576" "0000932879" "0000437577" "0000932880" "0000437578" "0000932881" "0000437579" "0000932882" "0000437580" "0000932883" "0000437581" "0000932884" "0000437582" "0000932885" "0000437583" "0000932886" "0000437584" "0000932887" "0000437585" "0000932888" "0000437586" "0000932889" "0000437587" "0000932890" "0000437588" "0000932891" "0000437589" "0000932892" "0000437590" "0000932893" "0000437591" "0000932895" "0000437592" "0000932894" "0000437623" "0000932959" "0000457636" "0001012177" "0000457637" "0001012178" "0000457638" "0001012179" "0000457639" "0001012180" "0000457640" "0001012181"