### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ###
## Filter: (gene_public = ZFHX3)
# charset = UTF-8

## Genes ## Do not remove or alter this header ##
## Count = 1
"{{id}}"	"{{name}}"	"{{chromosome}}"	"{{chrom_band}}"	"{{imprinting}}"	"{{refseq_genomic}}"	"{{refseq_UD}}"	"{{reference}}"	"{{url_homepage}}"	"{{url_external}}"	"{{allow_download}}"	"{{id_hgnc}}"	"{{id_entrez}}"	"{{id_omim}}"	"{{show_hgmd}}"	"{{show_genecards}}"	"{{show_genetests}}"	"{{show_orphanet}}"	"{{note_index}}"	"{{note_listing}}"	"{{refseq}}"	"{{refseq_url}}"	"{{disclaimer}}"	"{{disclaimer_text}}"	"{{header}}"	"{{header_align}}"	"{{footer}}"	"{{footer_align}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"	"{{updated_by}}"	"{{updated_date}}"
"ZFHX3"	"zinc finger homeobox 3"	"16"	"q22.3"	"unknown"	"NG_013211.2"	"UD_132118914041"	""	"https://www.LOVD.nl/ZFHX3"	""	"1"	"777"	"463"	"104155"	"1"	"1"	"1"	"1"	"Establishment of this gene variant database (LSDB) was performed by Johan den Dunnen, supported by <a href=\'http://www.variome.org\' target=\'_blank\'>Global Variome</a>."	""	"g"	"https://databases.lovd.nl/shared/refseq/ZFHX3_codingDNA.html"	"1"	""	""	"-1"	""	"-1"	"00001"	"2013-05-03 00:00:00"	"00006"	"2022-05-30 15:12:09"	"00000"	"2026-01-20 18:57:21"


## Transcripts ## Do not remove or alter this header ##
## Count = 1
"{{id}}"	"{{geneid}}"	"{{name}}"	"{{id_mutalyzer}}"	"{{id_ncbi}}"	"{{id_ensembl}}"	"{{id_protein_ncbi}}"	"{{id_protein_ensembl}}"	"{{id_protein_uniprot}}"	"{{remarks}}"	"{{position_c_mrna_start}}"	"{{position_c_mrna_end}}"	"{{position_c_cds_end}}"	"{{position_g_mrna_start}}"	"{{position_g_mrna_end}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"
"00023135"	"ZFHX3"	"transcript variant A"	"002"	"NM_006885.3"	""	"NP_008816.3"	""	""	""	"-673"	"15391"	"11112"	"73082274"	"72816784"	""	"0000-00-00 00:00:00"	""	""


## Diseases ## Do not remove or alter this header ##
## Count = 8
"{{id}}"	"{{symbol}}"	"{{name}}"	"{{inheritance}}"	"{{id_omim}}"	"{{tissues}}"	"{{features}}"	"{{remarks}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"
"00000"	"Healthy/Control"	"Healthy individual / control"	""	""	""	""	""	"00000"	"2012-07-26 17:29:43"	""	""
"00198"	"?"	"unclassified / mixed"	""	""	""	""	""	"00006"	"2013-09-13 14:21:47"	"00006"	"2024-11-23 09:38:12"
"00291"	"ADHD"	"attention deficit-hyperactivity disorder (ADHD)"	"AD"	"143465"	""	""	""	"00006"	"2013-12-20 10:47:26"	"00006"	"2021-12-10 21:51:32"
"01524"	"cancer, prostate"	"cancer, prostate"	"AD;SMu"	"176807"	""	""	""	"00006"	"2014-09-25 23:29:40"	"00006"	"2021-12-10 21:51:32"
"04167"	"SCA"	"ataxia, spinocerebellar (SCA)"	""	""	""	""	""	"00006"	"2014-12-24 11:54:32"	"00006"	"2015-12-08 23:59:30"
"05611"	"NDD"	"neurodevelopmental disorder (NDD)"	""	""	""	""	""	"00006"	"2019-06-19 12:27:20"	"00006"	"2024-12-13 11:12:21"
"07071"	"SCA4"	"ataxia, spinocerebellar, type 4"	"AD"	"600223"	""	""	""	"00006"	"2024-03-06 19:58:38"	""	""
"07072"	"ATFB8"	"fibrillation, atrial, familial, type 8, susceptibility to"	"AD"	"613055"	""	""	""	"00006"	"2024-03-06 20:00:12"	"00006"	"2024-03-06 20:01:29"


## Genes_To_Diseases ## Do not remove or alter this header ##
## Count = 4
"{{geneid}}"	"{{diseaseid}}"
"ZFHX3"	"01524"
"ZFHX3"	"05611"
"ZFHX3"	"07071"
"ZFHX3"	"07072"


## Individuals ## Do not remove or alter this header ##
## Count = 80
"{{id}}"	"{{fatherid}}"	"{{motherid}}"	"{{panelid}}"	"{{panel_size}}"	"{{license}}"	"{{owned_by}}"	"{{Individual/Reference}}"	"{{Individual/Remarks}}"	"{{Individual/Gender}}"	"{{Individual/Consanguinity}}"	"{{Individual/Origin/Geographic}}"	"{{Individual/Age_of_death}}"	"{{Individual/VIP}}"	"{{Individual/Data_av}}"	"{{Individual/Treatment}}"	"{{Individual/Origin/Population}}"	"{{Individual/Individual_ID}}"
"00271474"	""	""	""	"1"	""	"02061"	""	""	""	""	"Saudi Arabia"	""	"0"	""	""	"Arab"	""
"00410915"	""	""	""	"1"	""	"00006"	"del Rocío Perez Baca BeSHG2022, AbsT25, {PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	"M"	""	""	""	"0"	""	""	""	"Pat1"
"00410916"	""	""	""	"1"	""	"00006"	"del Rocío Perez Baca BeSHG2022, AbsT25, {PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	"F"	""	""	""	"0"	""	""	""	"Pat2"
"00410917"	""	""	""	"1"	""	"00006"	"del Rocío Perez Baca BeSHG2022, AbsT25, {PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	"M"	""	""	""	"0"	""	""	""	"Pat3"
"00410918"	""	""	""	"1"	""	"00006"	"del Rocío Perez Baca BeSHG2022, AbsT25, {PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	"F"	""	""	""	"0"	""	""	""	"Pat4"
"00410919"	""	""	""	"1"	""	"00006"	"del Rocío Perez Baca BeSHG2022, AbsT25, {PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	"M"	""	""	""	"0"	""	""	""	"Pat5"
"00410920"	""	""	""	"1"	""	"00006"	"del Rocío Perez Baca BeSHG2022, AbsT25, {PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	"F"	""	""	""	"0"	""	""	""	"Pat6"
"00410921"	""	""	""	"1"	""	"00006"	"del Rocío Perez Baca BeSHG2022, AbsT25, {PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	"M"	""	""	""	"0"	""	""	""	"Pat7"
"00410922"	""	""	""	"1"	""	"00006"	"del Rocío Perez Baca BeSHG2022, AbsT25, {PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	""	""	""	""	"0"	""	""	""	"Pat8"
"00410923"	""	""	""	"1"	""	"00006"	"del Rocío Perez Baca BeSHG2022, AbsT25, {PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	""	""	""	""	"0"	""	""	""	"Pat9"
"00410924"	""	""	""	"3"	""	"00006"	"del Rocío Perez Baca BeSHG2022, AbsT25, {PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	"family, affected son, sister and father"	"M"	""	""	""	"0"	""	""	""	"Pat10"
"00410925"	""	""	""	"1"	""	"00006"	"del Rocío Perez Baca BeSHG2022, AbsT25, {PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	"M"	""	""	""	"0"	""	""	""	"Pat11"
"00410926"	""	""	""	"1"	""	"00006"	"del Rocío Perez Baca BeSHG2022, AbsT25, {PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	"M"	""	""	""	"0"	""	""	""	"Pat12"
"00410927"	""	""	""	"1"	""	"00006"	"del Rocío Perez Baca BeSHG2022, AbsT25, {PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	"F"	""	""	""	"0"	""	""	""	"Pat13"
"00410928"	""	""	""	"1"	""	"00006"	"del Rocío Perez Baca BeSHG2022, AbsT25, {PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	"M"	""	""	""	"0"	""	""	""	"Pat14"
"00445168"	""	""	""	"1935"	""	"00006"	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	"anlysis 2300 normal alleles"	""	""	""	""	"0"	""	""	""	"control"
"00445169"	""	""	""	"78"	""	"00006"	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	"anlysis 2300 normal alleles"	""	""	""	""	"0"	""	""	""	"control"
"00445170"	""	""	""	"64"	""	"00006"	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	"anlysis 2300 normal alleles"	""	""	""	""	"0"	""	""	""	"control"
"00445171"	""	""	""	"59"	""	"00006"	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	"anlysis 2300 normal alleles"	""	""	""	""	"0"	""	""	""	"control"
"00445172"	""	""	""	"36"	""	"00006"	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	"anlysis 2300 normal alleles"	""	""	""	""	"0"	""	""	""	"control"
"00445173"	""	""	""	"24"	""	"00006"	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	"anlysis 2300 normal alleles"	""	""	""	""	"0"	""	""	""	"control"
"00445174"	""	""	""	"22"	""	"00006"	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	"anlysis 2300 normal alleles"	""	""	""	""	"0"	""	""	""	"control"
"00445175"	""	""	""	"21"	""	"00006"	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	"anlysis 2300 normal alleles"	""	""	""	""	"0"	""	""	""	"control"
"00445176"	""	""	""	"11"	""	"00006"	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	"anlysis 2300 normal alleles"	""	""	""	""	"0"	""	""	""	"control"
"00445177"	""	""	""	"10"	""	"00006"	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	"anlysis 2300 normal alleles"	""	""	""	""	"0"	""	""	""	"control"
"00445178"	""	""	""	"6"	""	"00006"	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	"anlysis 2300 normal alleles"	""	""	""	""	"0"	""	""	""	"control"
"00445179"	""	""	""	"5"	""	"00006"	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	"anlysis 2300 normal alleles"	""	""	""	""	"0"	""	""	""	"control"
"00445180"	""	""	""	"5"	""	"00006"	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	"anlysis 2300 normal alleles"	""	""	""	""	"0"	""	""	""	"control"
"00445181"	""	""	""	"3"	""	"00006"	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	"anlysis 2300 normal alleles"	""	""	""	""	"0"	""	""	""	"control"
"00445182"	""	""	""	"3"	""	"00006"	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	"anlysis 2300 normal alleles"	""	""	""	""	"0"	""	""	""	"control"
"00445183"	""	""	""	"3"	""	"00006"	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	"anlysis 2300 normal alleles"	""	""	""	""	"0"	""	""	""	"control"
"00445184"	""	""	""	"2"	""	"00006"	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	"anlysis 2300 normal alleles"	""	""	""	""	"0"	""	""	""	"control"
"00445185"	""	""	""	"2"	""	"00006"	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	"anlysis 2300 normal alleles"	""	""	""	""	"0"	""	""	""	"control"
"00445186"	""	""	""	"2"	""	"00006"	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	"anlysis 2300 normal alleles"	""	""	""	""	"0"	""	""	""	"control"
"00445187"	""	""	""	"1"	""	"00006"	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	"anlysis 2300 normal alleles"	""	""	""	""	"0"	""	""	""	"control"
"00445188"	""	""	""	"1"	""	"00006"	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	"anlysis 2300 normal alleles"	""	""	""	""	"0"	""	""	""	"control"
"00445189"	""	""	""	"1"	""	"00006"	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	"anlysis 2300 normal alleles"	""	""	""	""	"0"	""	""	""	"control"
"00445190"	""	""	""	"1"	""	"00006"	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	"anlysis 2300 normal alleles"	""	""	""	""	"0"	""	""	""	"control"
"00445191"	""	""	""	"1"	""	"00006"	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	"anlysis 2300 normal alleles"	""	""	""	""	"0"	""	""	""	"control"
"00445192"	""	""	""	"1"	""	"00006"	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	"anlysis 2300 normal alleles"	""	""	""	""	"0"	""	""	""	"control"
"00445193"	""	""	""	"1"	""	"00006"	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	"anlysis 2300 normal alleles"	""	""	""	""	"0"	""	""	""	"control"
"00445194"	""	""	""	"1"	""	"00006"	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	"anlysis 2300 normal alleles"	""	""	""	""	"0"	""	""	""	"control"
"00445195"	""	""	""	"18"	""	"00006"	"{PMID:Wictorin 2014:24787759}, {PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	"5-generation family, 18 affected"	"F"	""	"Sweden"	""	"0"	""	""	""	"Fam1PatIII1"
"00445196"	""	""	""	"7"	""	"00006"	"{PMID:Wictorin 2014:24787759}, {PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	"4-generation family, 7 affected (F, 6M)"	"M"	""	"Sweden"	""	"0"	""	""	""	"Fam2PatIV1"
"00445197"	""	""	""	"4"	""	"00006"	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	"4-generation family, 4 affected (F, 3M)"	"M"	""	""	""	"0"	""	""	""	"Fam3PatIII1"
"00445198"	""	""	""	"7"	""	"00006"	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	"4-generation family, 7 affected (5F,2M)"	"F"	""	""	""	"0"	""	""	""	"Fam4PatIV1"
"00445199"	""	""	""	"2"	""	"00006"	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	"3-generation family, affected father/daughter"	"F"	""	"Sweden"	""	"0"	""	""	""	"Fam5PatIII1"
"00445200"	""	""	""	"2"	""	"00006"	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	"nephew"	"M"	""	"Sweden"	""	"0"	""	""	""	"Fam1PatIII2"
"00445201"	""	""	""	"2"	""	"00006"	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	"son PatIII2"	"M"	""	"Sweden"	"28y"	"0"	""	""	""	"Fam1PatIV1"
"00445202"	""	""	""	"2"	""	"00006"	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	"granddaughter PatIII1"	"F"	""	"Sweden"	""	"0"	""	""	""	"Fam1PatV1"
"00445203"	""	""	""	"2"	""	"00006"	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	"granddaughter PatIII1. sister III1"	"F"	""	"Sweden"	""	"0"	""	""	""	"Fam1PatV2"
"00445204"	""	""	""	"2"	""	"00006"	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	"son PatIII2"	"M"	""	"Sweden"	""	"0"	""	""	""	"Fam3PatIV1"
"00448082"	""	""	""	"1"	""	"00006"	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	"F"	""	""	""	"0"	""	""	""	"Pat15"
"00448083"	""	""	""	"1"	""	"00006"	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	"M"	""	""	""	"0"	""	""	""	"Pat16"
"00448084"	""	""	""	"1"	""	"00006"	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	"F"	""	""	""	"0"	""	""	""	"Pat17"
"00448085"	""	""	""	"1"	""	"00006"	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	"M"	""	""	""	"0"	""	""	""	"Pat18"
"00448086"	""	""	""	"1"	""	"00006"	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	"patient"	""	""	""	""	"0"	""	""	""	"Pat19"
"00448087"	""	""	""	"1"	""	"00006"	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	"2-generation family, 1 affected, unaffected heterozygous parents"	"M"	""	""	""	"0"	""	""	""	"Pat20"
"00448088"	""	""	""	"1"	""	"00006"	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	"2-generation family, 1 affected, unaffected heterozygous parents"	"F"	""	""	""	"0"	""	""	""	"Pat21"
"00448089"	""	""	""	"1"	""	"00006"	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	"2-generation family, 1 affected, unaffected heterozygous parents"	"F"	""	""	""	"0"	""	""	""	"Pat22"
"00448090"	""	""	""	"1"	""	"00006"	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	"2-generation family, 1 affected, unaffected heterozygous parents"	"F"	""	""	""	"0"	""	""	""	"Pat23"
"00448091"	""	""	""	"1"	""	"00006"	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	"2-generation family, 1 affected, unaffected heterozygous parents"	"F"	""	""	""	"0"	""	""	""	"Pat24"
"00448092"	""	""	""	"1"	""	"00006"	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	"2-generation family, 1 affected, unaffected heterozygous parents"	""	""	""	""	"0"	""	""	""	"Pat25"
"00448093"	""	""	""	"1"	""	"00006"	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	"2-generation family, 1 affected, unaffected heterozygous parents"	"F"	""	""	""	"0"	""	""	""	"Pat26"
"00448094"	""	""	""	"1"	""	"00006"	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	"2-generation family, 1 affected, unaffected heterozygous parents"	"M"	""	""	""	"0"	""	""	""	"Pat27"
"00448095"	""	""	""	"1"	""	"00006"	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	"2-generation family, 1 affected, unaffected heterozygous parents"	"F"	""	""	""	"0"	""	""	""	"Pat28"
"00448096"	""	""	""	"1"	""	"00006"	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	"2-generation family, 1 affected, unaffected heterozygous parents"	"M"	""	""	""	"0"	""	""	""	"Pat29"
"00448097"	""	""	""	"1"	""	"00006"	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	"patient"	"F"	""	""	""	"0"	""	""	""	"Pat30"
"00448098"	""	""	""	"1"	""	"00006"	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	"2-generation family, 1 affected, unaffected heterozygous parents"	"M"	""	""	""	"0"	""	""	""	"Pat31"
"00448099"	""	""	""	"1"	""	"00006"	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	"2-generation family, 1 affected, unaffected heterozygous parents"	"M"	""	""	""	"0"	""	""	""	"Pat32"
"00448100"	""	""	""	"1"	""	"00006"	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	"2-generation family, 1 affected, unaffected heterozygous parents"	"F"	""	""	""	"0"	""	""	""	"Pat33"
"00448101"	""	""	""	"1"	""	"00006"	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	"2-generation family, 1 affected, unaffected heterozygous parents"	"M"	""	""	""	"0"	""	""	""	"Pat34"
"00448102"	""	""	""	"1"	""	"00006"	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	"2-generation family, 1 affected, unaffected heterozygous parents"	"F"	""	""	""	"0"	""	""	""	"Pat35"
"00448103"	""	""	""	"1"	""	"00006"	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	"2-generation family, 1 affected, unaffected heterozygous parents"	"M"	""	""	""	"0"	""	""	""	"Pat36"
"00448104"	""	""	""	"5"	""	"00006"	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	"family, 5 affected, patient, father, first cousin, paternal aunt, grandmother"	"M"	""	""	""	"0"	""	""	""	"Pat37"
"00448105"	""	""	""	"1"	""	"00006"	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	"family, 5 affected"	"M"	""	""	""	"0"	""	""	""	"Pat38"
"00448106"	""	""	""	"1"	""	"00006"	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	"2-generation family, 1 affected, unaffected heterozygous parents"	"M"	""	""	""	"0"	""	""	""	"Pat39"
"00448107"	""	""	""	"1"	""	"00006"	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	"2-generation family, 1 affected, unaffected heterozygous parents"	"M"	""	""	""	"0"	""	""	""	"Pat40"
"00448108"	""	""	""	"1"	""	"00006"	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	"patient"	"M"	""	""	""	"0"	""	""	""	"Pat41"
"00448109"	""	""	""	"1"	""	"00006"	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	"patient"	"M"	""	""	""	"0"	""	""	""	"Pat42"


## Individuals_To_Diseases ## Do not remove or alter this header ##
## Count = 80
"{{individualid}}"	"{{diseaseid}}"
"00271474"	"00291"
"00410915"	"05611"
"00410916"	"05611"
"00410917"	"05611"
"00410918"	"05611"
"00410919"	"05611"
"00410920"	"05611"
"00410921"	"05611"
"00410922"	"05611"
"00410923"	"05611"
"00410924"	"05611"
"00410925"	"05611"
"00410926"	"05611"
"00410927"	"05611"
"00410928"	"05611"
"00445168"	"00000"
"00445169"	"00000"
"00445170"	"00000"
"00445171"	"00000"
"00445172"	"00000"
"00445173"	"00000"
"00445174"	"00000"
"00445175"	"00000"
"00445176"	"00000"
"00445177"	"00000"
"00445178"	"00000"
"00445179"	"00000"
"00445180"	"00000"
"00445181"	"00000"
"00445182"	"00000"
"00445183"	"00000"
"00445184"	"00000"
"00445185"	"00000"
"00445186"	"00000"
"00445187"	"00000"
"00445188"	"00000"
"00445189"	"00000"
"00445190"	"00000"
"00445191"	"00000"
"00445192"	"00000"
"00445193"	"00000"
"00445194"	"00000"
"00445195"	"04167"
"00445196"	"04167"
"00445197"	"04167"
"00445198"	"04167"
"00445199"	"04167"
"00445200"	"04167"
"00445201"	"04167"
"00445202"	"00198"
"00445203"	"00198"
"00445204"	"04167"
"00448082"	"05611"
"00448083"	"05611"
"00448084"	"05611"
"00448085"	"05611"
"00448086"	"05611"
"00448087"	"05611"
"00448088"	"05611"
"00448089"	"05611"
"00448090"	"05611"
"00448091"	"05611"
"00448092"	"05611"
"00448093"	"05611"
"00448094"	"05611"
"00448095"	"05611"
"00448096"	"05611"
"00448097"	"05611"
"00448098"	"05611"
"00448099"	"05611"
"00448100"	"05611"
"00448101"	"05611"
"00448102"	"05611"
"00448103"	"05611"
"00448104"	"05611"
"00448105"	"05611"
"00448106"	"05611"
"00448107"	"05611"
"00448108"	"05611"
"00448109"	"05611"


## Phenotypes ## Do not remove or alter this header ##
## Note: Only showing Phenotype columns active for Diseases 00000, 00198, 00291, 01524, 04167, 05611, 07071, 07072
## Count = 52
"{{id}}"	"{{diseaseid}}"	"{{individualid}}"	"{{owned_by}}"	"{{Phenotype/Inheritance}}"	"{{Phenotype/Age}}"	"{{Phenotype/Additional}}"	"{{Phenotype/Age/Onset}}"	"{{Phenotype/Age/Diagnosis}}"	"{{Phenotype/Onset}}"	"{{Phenotype/Protein}}"	"{{Phenotype/Tumor/MSI}}"	"{{Phenotype/Enzyme/CPK}}"	"{{Phenotype/Heart/Myocardium}}"	"{{Phenotype/Lung}}"	"{{Phenotype/Diagnosis/Definite}}"	"{{Phenotype/Diagnosis/Initial}}"	"{{Phenotype/Diagnosis/Criteria}}"
"0000303006"	"05611"	"00410915"	"00006"	"Isolated (sporadic)"	""	"see paper; ..., (mild)  intellectual disability, postnatal growth retardation, feeding difficulties, facial dysmorphism"	""	""	""	""	""	""	""	""	""	"syndromic intellectual disability"	""
"0000303007"	"05611"	"00410916"	"00006"	"Isolated (sporadic)"	""	"see paper; ..., (mild)  intellectual disability, postnatal growth retardation, feeding difficulties, facial dysmorphism"	""	""	""	""	""	""	""	""	""	"syndromic intellectual disability"	""
"0000303008"	"05611"	"00410917"	"00006"	"Isolated (sporadic)"	""	"see paper; ..., (mild)  intellectual disability, postnatal growth retardation, feeding difficulties, facial dysmorphism"	""	""	""	""	""	""	""	""	""	"syndromic intellectual disability"	""
"0000303009"	"05611"	"00410918"	"00006"	"Isolated (sporadic)"	""	"see paper; ..., (mild)  intellectual disability, postnatal growth retardation, feeding difficulties, facial dysmorphism"	""	""	""	""	""	""	""	""	""	"syndromic intellectual disability"	""
"0000303010"	"05611"	"00410919"	"00006"	"Isolated (sporadic)"	""	"see paper; ..., (mild)  intellectual disability, postnatal growth retardation, feeding difficulties, facial dysmorphism"	""	""	""	""	""	""	""	""	""	"syndromic intellectual disability"	""
"0000303011"	"05611"	"00410920"	"00006"	"Isolated (sporadic)"	""	"see paper; ..., (mild)  intellectual disability, postnatal growth retardation, feeding difficulties, facial dysmorphism"	""	""	""	""	""	""	""	""	""	"syndromic intellectual disability"	""
"0000303012"	"05611"	"00410921"	"00006"	"Isolated (sporadic)"	""	"see paper; ..., (mild)  intellectual disability, postnatal growth retardation, feeding difficulties, facial dysmorphism"	""	""	""	""	""	""	""	""	""	"syndromic intellectual disability"	""
"0000303013"	"05611"	"00410922"	"00006"	"Isolated (sporadic)"	""	"see paper; ..., (mild)  intellectual disability, postnatal growth retardation, feeding difficulties, facial dysmorphism"	""	""	""	""	""	""	""	""	""	"syndromic intellectual disability"	""
"0000303014"	"05611"	"00410923"	"00006"	"Isolated (sporadic)"	""	"see paper; ..., (mild)  intellectual disability, postnatal growth retardation, feeding difficulties, facial dysmorphism"	""	""	""	""	""	""	""	""	""	"syndromic intellectual disability"	""
"0000303015"	"05611"	"00410924"	"00006"	"Isolated (sporadic)"	""	"see paper; ..., (mild)  intellectual disability, postnatal growth retardation, feeding difficulties, facial dysmorphism"	""	""	""	""	""	""	""	""	""	"syndromic intellectual disability"	""
"0000303016"	"05611"	"00410925"	"00006"	"Isolated (sporadic)"	""	"see paper; ..., (mild)  intellectual disability, postnatal growth retardation, feeding difficulties, facial dysmorphism"	""	""	""	""	""	""	""	""	""	"syndromic intellectual disability"	""
"0000303017"	"05611"	"00410926"	"00006"	"Isolated (sporadic)"	""	"see paper; ..., (mild)  intellectual disability, postnatal growth retardation, feeding difficulties, facial dysmorphism"	""	""	""	""	""	""	""	""	""	"syndromic intellectual disability"	""
"0000303018"	"05611"	"00410927"	"00006"	"Isolated (sporadic)"	""	"see paper; ..., (mild)  intellectual disability, postnatal growth retardation, feeding difficulties, facial dysmorphism"	""	""	""	""	""	""	""	""	""	"syndromic intellectual disability"	""
"0000303019"	"05611"	"00410928"	"00006"	"Isolated (sporadic)"	""	"see paper; ..., (mild)  intellectual disability, postnatal growth retardation, feeding difficulties, facial dysmorphism"	""	""	""	""	""	""	""	""	""	"syndromic intellectual disability"	""
"0000334422"	"04167"	"00445195"	"00006"	"Familial, autosomal dominant"	"66y"	"see paper; ..., balance disturbance; wheelchair bound; severe dysarthria; dysphagia; slow ocular saccades; no paresthesia; sensory impairment in extremities; areflexia; involuntary leg jerks and facial twitching; 57y-MRI severe cerebellar atrophy; EMG sensory neuropathy; fluctuating blood pressure; constipation; recurring urinary-tract infections; unintended weight loss (BMI <18)"	"37y"	""	"balance disturbance"	""	""	""	""	""	"SCA4"	"spinocerebellar ataxia"	""
"0000334423"	"04167"	"00445196"	"00006"	"Familial, autosomal dominant"	"46y"	"see paper; ..., balance disturbance; wheelchair bound; severe dysarthria; no dysphagia; slow ocular saccades; NA; sensory impairment in extremities; areflexia; involuntary facial twitching, familial basal ganglia calcification; 37y-MRI cerebellar atrophy; orthostatic hypotension; bowel urgency, diarrhea; no urinary symptoms; unintended weight loss (BMI <18)"	"25y"	""	"balance disturbance"	""	""	""	""	""	"SCA4"	"spinocerebellar ataxia"	""
"0000334424"	"04167"	"00445197"	"00006"	"Familial, autosomal dominant"	"80y"	"see paper; ..., balance disturbance; wheelchair bound; dysarthria; dysphagia; slow ocular saccades; no paresthesia; sensory impairment in extremities; areflexia; restless legs; EMG sensorimotor neuropathy; constipation; urinary symptoms; no unintended weight loss"	"57y"	""	"balance disturbance"	""	""	""	""	""	"SCA4"	"spinocerebellar ataxia"	""
"0000334425"	"04167"	"00445198"	"00006"	"Familial, autosomal dominant"	"51y"	"see paper; ..., gait ataxia, limb ataxia; requires walking support; dysarthria; dysphagia; slow ocular saccades; no paresthesia; sensory impairment in extremities; hyporeflexia; anxiety, painful leg cramps; 43y-MRI cerebellar atrophy; orthostatic hypotension; alternating constipation, diarrhea; urinary symptoms urgency; unintended weight loss (BMI <18)"	"43y"	""	"gait ataxia, limb ataxia"	""	""	""	""	""	"SCA4"	"spinocerebellar ataxia"	""
"0000334426"	"04167"	"00445199"	"00006"	"Familial, autosomal dominant"	"50y"	"see paper; ..., balance disturbance; walking sticks; no dysarthria; dysphagia; paresthesia; sensory impairment in extremities; areflexia; flushes, restless legs; EMG sensory neuropathy; orthostatic hypotension; constipation; urinary symptoms urgency; no unintended weight loss"	"40y"	""	"balance disturbance"	""	""	""	""	""	"SCA4"	"spinocerebellar ataxia"	""
"0000334427"	"04167"	"00445200"	"00006"	"Familial, autosomal dominant"	"57y"	"see paper; ..., balance disturbance; wheelchair bound; dysarthria; no dysphagia; slow ocular saccades; tingling sensation in feet; sensory impairment in extremities; areflexia; fasciculations; 43y-MRI cerebellar atrophy; EMG sensorimotor neuropathy; no orthostatic hypotension; bowel urgency; no urinary symptoms, no sexual dysfunction; no unintended weight loss"	"45y"	""	"balance disturbance"	""	""	""	""	""	"SCA4"	"spinocerebellar ataxia"	""
"0000334428"	"04167"	"00445201"	"00006"	"Familial, autosomal dominant"	"28y"	"see paper; ..., 28y-deceased; balance disturbance; walker at home, wheelchair outside; dysarthria; dysphagia; slow ocular saccades; sensory impairment in extremities; areflexia; profuse sweating, cough, excessive airway mucus production, involuntary facial twitching, atypical autism; 20y-MRI no cerebellar atrophy; EMG sensorimotor neuropathy; orthostatic hypotension; constipation; urinary retention; unintended weight loss (BMI <18)"	"15y"	""	"balance disturbance"	""	""	""	""	""	"SCA4"	"spinocerebellar ataxia"	""
"0000334429"	"00198"	"00445202"	"00006"	"Unknown"	"8y"	"see paper; ..., delayed psycho-motor development; walker aid; dysarthria; dysphagia; no slow ocular saccades; pain in legs; no sensory impairment in extremities; normal deep tendon reflexes; hypotonic infant, hyperlaxity, myoclonic jerks, behavioral problems, everted foot posture; 2y-MRI severe cerebellar atrophy; EMG normal; no orthostatic hypotension; incontinence and constipation; incontinence; no unintended weight loss"	"6m"	""	"delayed psycho-motor development"	""	""	""	""	""	""	"neurodevelopmental delay"	""
"0000334430"	"00198"	"00445203"	"00006"	"Unknown"	"4y"	"see paper; ..., abnormal gait, limb ataxia; ambulant; dysarthria; no dysphagia; no slow ocular saccades; tingling sensation in feet, pain in legs; no sensory impairment in extremities; hyporeflexia; hyperlaxity, myoclonic jerks, attention deficit; 2y-MRI cerebellar atrophy; no orthostatic hypotension; constipation; incontinence; no unintended weight loss"	"1y6m"	""	"abnormal gait, limb ataxia"	""	""	""	""	""	""	"neurodevelopmental delay"	""
"0000334431"	"04167"	"00445204"	"00006"	"Familial, autosomal dominant"	"50y"	"see paper; ..., balance disturbance; ambulant; dysarthria; no dysphagia; slow ocular saccades; no paresthesia; no sensory impairment in extremities; areflexia; neuralgia, subjective cranial sensation; 49y-MRI cerebellar atrophy; no orthostatic hypotension; no bowel symptoms; no urinary symptoms; no unintended weight loss"	"44y"	""	"balance disturbance"	""	""	""	""	""	"SCA4"	"spinocerebellar ataxia"	""
"0000337274"	"05611"	"00448082"	"00006"	"Isolated (sporadic)"	""	"see paper; ..., (mild)  intellectual disability, postnatal growth retardation, feeding difficulties, facial dysmorphism"	""	""	""	""	""	""	""	""	""	"syndromic intellectual disability"	""
"0000337275"	"05611"	"00448083"	"00006"	"Isolated (sporadic)"	""	"see paper; ..., (mild)  intellectual disability, postnatal growth retardation, feeding difficulties, facial dysmorphism"	""	""	""	""	""	""	""	""	""	"syndromic intellectual disability"	""
"0000337276"	"05611"	"00448084"	"00006"	"Isolated (sporadic)"	""	"see paper; ..., (mild)  intellectual disability, postnatal growth retardation, feeding difficulties, facial dysmorphism"	""	""	""	""	""	""	""	""	""	"syndromic intellectual disability"	""
"0000337277"	"05611"	"00448085"	"00006"	"Isolated (sporadic)"	""	"see paper; ..., (mild)  intellectual disability, postnatal growth retardation, feeding difficulties, facial dysmorphism"	""	""	""	""	""	""	""	""	""	"syndromic intellectual disability"	""
"0000337278"	"05611"	"00448086"	"00006"	"Unknown"	""	"(mild) intellectual disability and/or behavioural problems, postnatal growth retardation, feeding difficulties, facial characteristics"	""	""	""	""	""	""	""	""	""	"neurodevelopmental disorder"	""
"0000337279"	"05611"	"00448087"	"00006"	"Isolated (sporadic)"	""	"(mild) intellectual disability and/or behavioural problems, postnatal growth retardation, feeding difficulties, facial characteristics"	""	""	""	""	""	""	""	""	""	"neurodevelopmental disorder"	""
"0000337280"	"05611"	"00448088"	"00006"	"Isolated (sporadic)"	""	"(mild) intellectual disability and/or behavioural problems, postnatal growth retardation, feeding difficulties, facial characteristics"	""	""	""	""	""	""	""	""	""	"neurodevelopmental disorder"	""
"0000337281"	"05611"	"00448089"	"00006"	"Isolated (sporadic)"	""	"(mild) intellectual disability and/or behavioural problems, postnatal growth retardation, feeding difficulties, facial characteristics"	""	""	""	""	""	""	""	""	""	"neurodevelopmental disorder"	""
"0000337282"	"05611"	"00448090"	"00006"	"Isolated (sporadic)"	""	"(mild) intellectual disability and/or behavioural problems, postnatal growth retardation, feeding difficulties, facial characteristics"	""	""	""	""	""	""	""	""	""	"neurodevelopmental disorder"	""
"0000337283"	"05611"	"00448091"	"00006"	"Isolated (sporadic)"	""	"(mild) intellectual disability and/or behavioural problems, postnatal growth retardation, feeding difficulties, facial characteristics"	""	""	""	""	""	""	""	""	""	"neurodevelopmental disorder"	""
"0000337284"	"05611"	"00448092"	"00006"	"Isolated (sporadic)"	""	"(mild) intellectual disability and/or behavioural problems, postnatal growth retardation, feeding difficulties, facial characteristics"	""	""	""	""	""	""	""	""	""	"neurodevelopmental disorder"	""
"0000337285"	"05611"	"00448093"	"00006"	"Isolated (sporadic)"	""	"(mild) intellectual disability and/or behavioural problems, postnatal growth retardation, feeding difficulties, facial characteristics"	""	""	""	""	""	""	""	""	""	"neurodevelopmental disorder"	""
"0000337286"	"05611"	"00448094"	"00006"	"Isolated (sporadic)"	""	"(mild) intellectual disability and/or behavioural problems, postnatal growth retardation, feeding difficulties, facial characteristics"	""	""	""	""	""	""	""	""	""	"neurodevelopmental disorder"	""
"0000337287"	"05611"	"00448095"	"00006"	"Isolated (sporadic)"	""	"(mild) intellectual disability and/or behavioural problems, postnatal growth retardation, feeding difficulties, facial characteristics"	""	""	""	""	""	""	""	""	""	"neurodevelopmental disorder"	""
"0000337288"	"05611"	"00448096"	"00006"	"Isolated (sporadic)"	""	"(mild) intellectual disability and/or behavioural problems, postnatal growth retardation, feeding difficulties, facial characteristics"	""	""	""	""	""	""	""	""	""	"neurodevelopmental disorder"	""
"0000337289"	"05611"	"00448097"	"00006"	"Unknown"	""	"(mild) intellectual disability and/or behavioural problems, postnatal growth retardation, feeding difficulties, facial characteristics"	""	""	""	""	""	""	""	""	""	"neurodevelopmental disorder"	""
"0000337290"	"05611"	"00448098"	"00006"	"Isolated (sporadic)"	""	"(mild) intellectual disability and/or behavioural problems, postnatal growth retardation, feeding difficulties, facial characteristics"	""	""	""	""	""	""	""	""	""	"neurodevelopmental disorder"	""
"0000337291"	"05611"	"00448099"	"00006"	"Isolated (sporadic)"	""	"(mild) intellectual disability and/or behavioural problems, postnatal growth retardation, feeding difficulties, facial characteristics"	""	""	""	""	""	""	""	""	""	"neurodevelopmental disorder"	""
"0000337292"	"05611"	"00448100"	"00006"	"Isolated (sporadic)"	""	"(mild) intellectual disability and/or behavioural problems, postnatal growth retardation, feeding difficulties, facial characteristics"	""	""	""	""	""	""	""	""	""	"neurodevelopmental disorder"	""
"0000337293"	"05611"	"00448101"	"00006"	"Isolated (sporadic)"	""	"(mild) intellectual disability and/or behavioural problems, postnatal growth retardation, feeding difficulties, facial characteristics"	""	""	""	""	""	""	""	""	""	"neurodevelopmental disorder"	""
"0000337294"	"05611"	"00448102"	"00006"	"Isolated (sporadic)"	""	"(mild) intellectual disability and/or behavioural problems, postnatal growth retardation, feeding difficulties, facial characteristics"	""	""	""	""	""	""	""	""	""	"neurodevelopmental disorder"	""
"0000337295"	"05611"	"00448103"	"00006"	"Isolated (sporadic)"	""	"(mild) intellectual disability and/or behavioural problems, postnatal growth retardation, feeding difficulties, facial characteristics"	""	""	""	""	""	""	""	""	""	"neurodevelopmental disorder"	""
"0000337296"	"05611"	"00448104"	"00006"	"Unknown"	""	"(mild) intellectual disability and/or behavioural problems, postnatal growth retardation, feeding difficulties, facial characteristics"	""	""	""	""	""	""	""	""	""	"neurodevelopmental disorder"	""
"0000337297"	"05611"	"00448105"	"00006"	"Familial, autosomal dominant"	""	"(mild) intellectual disability and/or behavioural problems, postnatal growth retardation, feeding difficulties, facial characteristics"	""	""	""	""	""	""	""	""	""	"neurodevelopmental disorder"	""
"0000337298"	"05611"	"00448106"	"00006"	"Isolated (sporadic)"	""	"(mild) intellectual disability and/or behavioural problems, postnatal growth retardation, feeding difficulties, facial characteristics"	""	""	""	""	""	""	""	""	""	"neurodevelopmental disorder"	""
"0000337299"	"05611"	"00448107"	"00006"	"Isolated (sporadic)"	""	"(mild) intellectual disability and/or behavioural problems, postnatal growth retardation, feeding difficulties, facial characteristics"	""	""	""	""	""	""	""	""	""	"neurodevelopmental disorder"	""
"0000337300"	"05611"	"00448108"	"00006"	"Unknown"	""	"(mild) intellectual disability and/or behavioural problems, postnatal growth retardation, feeding difficulties, facial characteristics"	""	""	""	""	""	""	""	""	""	"neurodevelopmental disorder"	""
"0000337301"	"05611"	"00448109"	"00006"	"Unknown"	""	"(mild) intellectual disability and/or behavioural problems, postnatal growth retardation, feeding difficulties, facial characteristics"	""	""	""	""	""	""	""	""	""	"neurodevelopmental disorder"	""


## Screenings ## Do not remove or alter this header ##
## Count = 80
"{{id}}"	"{{individualid}}"	"{{variants_found}}"	"{{owned_by}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"	"{{Screening/Technique}}"	"{{Screening/Template}}"	"{{Screening/Tissue}}"	"{{Screening/Remarks}}"
"0000272628"	"00271474"	"1"	"02061"	"02061"	"2019-12-19 17:31:04"	""	""	"SEQ-NG-IT"	"DNA"	""	"WES"
"0000412180"	"00410915"	"1"	"00006"	"00006"	"2022-05-30 15:55:31"	""	""	"arraySNP"	"DNA"	""	""
"0000412181"	"00410916"	"1"	"00006"	"00006"	"2022-05-30 15:55:31"	""	""	"arraySNP"	"DNA"	""	""
"0000412182"	"00410917"	"1"	"00006"	"00006"	"2022-05-30 15:55:31"	""	""	"arraySNP"	"DNA"	""	""
"0000412183"	"00410918"	"1"	"00006"	"00006"	"2022-05-30 15:55:31"	""	""	"arraySNP"	"DNA"	""	""
"0000412184"	"00410919"	"1"	"00006"	"00006"	"2022-05-30 15:55:31"	""	""	"arraySNP"	"DNA"	""	""
"0000412185"	"00410920"	"1"	"00006"	"00006"	"2022-05-30 15:55:31"	""	""	"arraySNP"	"DNA"	""	""
"0000412186"	"00410921"	"1"	"00006"	"00006"	"2022-05-30 15:55:31"	""	""	"arraySNP"	"DNA"	""	""
"0000412187"	"00410922"	"1"	"00006"	"00006"	"2022-05-30 15:55:31"	""	""	"arraySNP"	"DNA"	""	""
"0000412188"	"00410923"	"1"	"00006"	"00006"	"2022-05-30 15:55:31"	""	""	"arraySNP"	"DNA"	""	""
"0000412189"	"00410924"	"1"	"00006"	"00006"	"2022-05-30 15:55:31"	""	""	"arraySNP"	"DNA"	""	""
"0000412190"	"00410925"	"1"	"00006"	"00006"	"2022-05-30 15:55:31"	""	""	"arraySNP"	"DNA"	""	""
"0000412191"	"00410926"	"1"	"00006"	"00006"	"2022-05-30 15:55:31"	""	""	"arraySNP"	"DNA"	""	""
"0000412192"	"00410927"	"1"	"00006"	"00006"	"2022-05-30 15:55:31"	""	""	"arraySNP"	"DNA"	""	""
"0000412193"	"00410928"	"1"	"00006"	"00006"	"2022-05-30 15:55:31"	""	""	"arraySNP"	"DNA"	""	""
"0000446739"	"00445168"	"1"	"00006"	"00006"	"2024-01-05 16:30:26"	""	""	"SEQ"	"DNA"	""	""
"0000446740"	"00445169"	"1"	"00006"	"00006"	"2024-01-05 16:30:26"	""	""	"SEQ"	"DNA"	""	""
"0000446741"	"00445170"	"1"	"00006"	"00006"	"2024-01-05 16:30:26"	""	""	"SEQ"	"DNA"	""	""
"0000446742"	"00445171"	"1"	"00006"	"00006"	"2024-01-05 16:30:26"	""	""	"SEQ"	"DNA"	""	""
"0000446743"	"00445172"	"1"	"00006"	"00006"	"2024-01-05 16:30:26"	""	""	"SEQ"	"DNA"	""	""
"0000446744"	"00445173"	"1"	"00006"	"00006"	"2024-01-05 16:30:26"	""	""	"SEQ"	"DNA"	""	""
"0000446745"	"00445174"	"1"	"00006"	"00006"	"2024-01-05 16:30:26"	""	""	"SEQ"	"DNA"	""	""
"0000446746"	"00445175"	"1"	"00006"	"00006"	"2024-01-05 16:30:26"	""	""	"SEQ"	"DNA"	""	""
"0000446747"	"00445176"	"1"	"00006"	"00006"	"2024-01-05 16:30:26"	""	""	"SEQ"	"DNA"	""	""
"0000446748"	"00445177"	"1"	"00006"	"00006"	"2024-01-05 16:30:26"	""	""	"SEQ"	"DNA"	""	""
"0000446749"	"00445178"	"1"	"00006"	"00006"	"2024-01-05 16:30:26"	""	""	"SEQ"	"DNA"	""	""
"0000446750"	"00445179"	"1"	"00006"	"00006"	"2024-01-05 16:30:26"	""	""	"SEQ"	"DNA"	""	""
"0000446751"	"00445180"	"1"	"00006"	"00006"	"2024-01-05 16:30:26"	""	""	"SEQ"	"DNA"	""	""
"0000446752"	"00445181"	"1"	"00006"	"00006"	"2024-01-05 16:30:26"	""	""	"SEQ"	"DNA"	""	""
"0000446753"	"00445182"	"1"	"00006"	"00006"	"2024-01-05 16:30:26"	""	""	"SEQ"	"DNA"	""	""
"0000446754"	"00445183"	"1"	"00006"	"00006"	"2024-01-05 16:30:26"	""	""	"SEQ"	"DNA"	""	""
"0000446755"	"00445184"	"1"	"00006"	"00006"	"2024-01-05 16:30:26"	""	""	"SEQ"	"DNA"	""	""
"0000446756"	"00445185"	"1"	"00006"	"00006"	"2024-01-05 16:30:26"	""	""	"SEQ"	"DNA"	""	""
"0000446757"	"00445186"	"1"	"00006"	"00006"	"2024-01-05 16:30:26"	""	""	"SEQ"	"DNA"	""	""
"0000446758"	"00445187"	"1"	"00006"	"00006"	"2024-01-05 16:30:26"	""	""	"SEQ"	"DNA"	""	""
"0000446759"	"00445188"	"1"	"00006"	"00006"	"2024-01-05 16:30:26"	""	""	"SEQ"	"DNA"	""	""
"0000446760"	"00445189"	"1"	"00006"	"00006"	"2024-01-05 16:30:26"	""	""	"SEQ"	"DNA"	""	""
"0000446761"	"00445190"	"1"	"00006"	"00006"	"2024-01-05 16:30:26"	""	""	"SEQ"	"DNA"	""	""
"0000446762"	"00445191"	"1"	"00006"	"00006"	"2024-01-05 16:30:26"	""	""	"SEQ"	"DNA"	""	""
"0000446763"	"00445192"	"1"	"00006"	"00006"	"2024-01-05 16:30:26"	""	""	"SEQ"	"DNA"	""	""
"0000446764"	"00445193"	"1"	"00006"	"00006"	"2024-01-05 16:30:26"	""	""	"SEQ"	"DNA"	""	""
"0000446765"	"00445194"	"1"	"00006"	"00006"	"2024-01-05 16:30:26"	""	""	"SEQ"	"DNA"	""	""
"0000446766"	"00445195"	"1"	"00006"	"00006"	"2024-01-05 19:40:44"	""	""	"SEQ;SEQ-PB"	"DNA"	""	"WGS"
"0000446767"	"00445196"	"1"	"00006"	"00006"	"2024-01-05 19:40:44"	""	""	"SEQ"	"DNA"	""	"WGS"
"0000446768"	"00445197"	"1"	"00006"	"00006"	"2024-01-05 19:40:44"	""	""	"SEQ"	"DNA"	""	"WGS"
"0000446769"	"00445198"	"1"	"00006"	"00006"	"2024-01-05 19:40:44"	""	""	"SEQ"	"DNA"	""	"WGS"
"0000446770"	"00445199"	"1"	"00006"	"00006"	"2024-01-05 19:40:44"	""	""	"SEQ"	"DNA"	""	"WGS"
"0000446771"	"00445200"	"1"	"00006"	"00006"	"2024-01-05 19:40:44"	""	""	"SEQ"	"DNA"	""	"WGS"
"0000446772"	"00445201"	"1"	"00006"	"00006"	"2024-01-05 19:40:44"	""	""	"SEQ;SEQ-PB"	"DNA"	""	"WGS"
"0000446773"	"00445202"	"1"	"00006"	"00006"	"2024-01-05 19:40:44"	""	""	"SEQ"	"DNA"	""	"WGS"
"0000446774"	"00445203"	"1"	"00006"	"00006"	"2024-01-05 19:40:44"	""	""	"SEQ"	"DNA"	""	"WGS"
"0000446775"	"00445204"	"1"	"00006"	"00006"	"2024-01-05 19:40:44"	""	""	"SEQ"	"DNA"	""	"WGS"
"0000449655"	"00448082"	"1"	"00006"	"00006"	"2024-02-15 15:20:42"	""	""	"arraySNP"	"DNA"	""	""
"0000449656"	"00448083"	"1"	"00006"	"00006"	"2024-02-15 15:27:00"	""	""	"arraySNP"	"DNA"	""	""
"0000449657"	"00448084"	"1"	"00006"	"00006"	"2024-02-15 15:30:53"	""	""	"arraySNP"	"DNA"	""	""
"0000449658"	"00448085"	"1"	"00006"	"00006"	"2024-02-15 15:34:14"	""	""	"arraySNP"	"DNA"	""	""
"0000449659"	"00448086"	"1"	"00006"	"00006"	"2024-02-15 17:03:45"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000449660"	"00448087"	"1"	"00006"	"00006"	"2024-02-15 17:03:45"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000449661"	"00448088"	"1"	"00006"	"00006"	"2024-02-15 17:03:45"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000449662"	"00448089"	"1"	"00006"	"00006"	"2024-02-15 17:03:45"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000449663"	"00448090"	"1"	"00006"	"00006"	"2024-02-15 17:03:45"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000449664"	"00448091"	"1"	"00006"	"00006"	"2024-02-15 17:03:45"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000449665"	"00448092"	"1"	"00006"	"00006"	"2024-02-15 17:03:45"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000449666"	"00448093"	"1"	"00006"	"00006"	"2024-02-15 17:03:45"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000449667"	"00448094"	"1"	"00006"	"00006"	"2024-02-15 17:03:45"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000449668"	"00448095"	"1"	"00006"	"00006"	"2024-02-15 17:03:45"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000449669"	"00448096"	"1"	"00006"	"00006"	"2024-02-15 17:03:45"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000449670"	"00448097"	"1"	"00006"	"00006"	"2024-02-15 17:03:45"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000449671"	"00448098"	"1"	"00006"	"00006"	"2024-02-15 17:03:45"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000449672"	"00448099"	"1"	"00006"	"00006"	"2024-02-15 17:03:45"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000449673"	"00448100"	"1"	"00006"	"00006"	"2024-02-15 17:03:45"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000449674"	"00448101"	"1"	"00006"	"00006"	"2024-02-15 17:03:45"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000449675"	"00448102"	"1"	"00006"	"00006"	"2024-02-15 17:03:45"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000449676"	"00448103"	"1"	"00006"	"00006"	"2024-02-15 17:03:45"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000449677"	"00448104"	"1"	"00006"	"00006"	"2024-02-15 17:03:45"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000449678"	"00448105"	"1"	"00006"	"00006"	"2024-02-15 17:03:45"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000449679"	"00448106"	"1"	"00006"	"00006"	"2024-02-15 17:03:45"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000449680"	"00448107"	"1"	"00006"	"00006"	"2024-02-15 17:03:45"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000449681"	"00448108"	"1"	"00006"	"00006"	"2024-02-15 17:03:45"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000449682"	"00448109"	"1"	"00006"	"00006"	"2024-02-15 17:03:45"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"


## Screenings_To_Genes ## Do not remove or alter this header ##
## Count = 37
"{{screeningid}}"	"{{geneid}}"
"0000446739"	"ZFHX3"
"0000446740"	"ZFHX3"
"0000446741"	"ZFHX3"
"0000446742"	"ZFHX3"
"0000446743"	"ZFHX3"
"0000446744"	"ZFHX3"
"0000446745"	"ZFHX3"
"0000446746"	"ZFHX3"
"0000446747"	"ZFHX3"
"0000446748"	"ZFHX3"
"0000446749"	"ZFHX3"
"0000446750"	"ZFHX3"
"0000446751"	"ZFHX3"
"0000446752"	"ZFHX3"
"0000446753"	"ZFHX3"
"0000446754"	"ZFHX3"
"0000446755"	"ZFHX3"
"0000446756"	"ZFHX3"
"0000446757"	"ZFHX3"
"0000446758"	"ZFHX3"
"0000446759"	"ZFHX3"
"0000446760"	"ZFHX3"
"0000446761"	"ZFHX3"
"0000446762"	"ZFHX3"
"0000446763"	"ZFHX3"
"0000446764"	"ZFHX3"
"0000446765"	"ZFHX3"
"0000446766"	"ZFHX3"
"0000446767"	"ZFHX3"
"0000446768"	"ZFHX3"
"0000446769"	"ZFHX3"
"0000446770"	"ZFHX3"
"0000446771"	"ZFHX3"
"0000446772"	"ZFHX3"
"0000446773"	"ZFHX3"
"0000446774"	"ZFHX3"
"0000446775"	"ZFHX3"


## Variants_On_Genome ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Count = 272
"{{id}}"	"{{allele}}"	"{{effectid}}"	"{{chromosome}}"	"{{position_g_start}}"	"{{position_g_end}}"	"{{type}}"	"{{average_frequency}}"	"{{owned_by}}"	"{{VariantOnGenome/DBID}}"	"{{VariantOnGenome/DNA}}"	"{{VariantOnGenome/Frequency}}"	"{{VariantOnGenome/Reference}}"	"{{VariantOnGenome/Restriction_site}}"	"{{VariantOnGenome/Published_as}}"	"{{VariantOnGenome/Remarks}}"	"{{VariantOnGenome/Genetic_origin}}"	"{{VariantOnGenome/Segregation}}"	"{{VariantOnGenome/dbSNP}}"	"{{VariantOnGenome/VIP}}"	"{{VariantOnGenome/Methylation}}"	"{{VariantOnGenome/ISCN}}"	"{{VariantOnGenome/DNA/hg38}}"	"{{VariantOnGenome/ClinVar}}"	"{{VariantOnGenome/ClinicalClassification}}"	"{{VariantOnGenome/ClinicalClassification/Method}}"
"0000018000"	"2"	"55"	"16"	"72822581"	"72822586"	"del"	"0"	"00006"	"ZFHX3_000001"	"g.72822581_72822586del"	""	""	""	""	"variant marked as interesting (probably affects the function of the gene with phenotypic consequences) from an exome analysis. Please contact me."	"Unknown"	""	""	"1"	""	""	"g.72788682_72788687del"	""	"VUS"	""
"0000018001"	"2"	"55"	"16"	"72832634"	"72832634"	"dup"	"0"	"00006"	"ZFHX3_000002"	"g.72832634dup"	""	""	""	""	"variant marked as interesting (probably affects the function of the gene with phenotypic consequences) from an exome analysis. Please contact me."	"Unknown"	""	""	"1"	""	""	"g.72798735dup"	""	"VUS"	""
"0000253896"	"0"	"10"	"16"	"72832634"	"72832634"	"del"	"0"	"01943"	"ZFHX3_000033"	"g.72832634del"	""	""	""	"ZFHX3(NM_006885.3):c.3968-6delT"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.72798735del"	""	"benign"	""
"0000254300"	"0"	"30"	"16"	"72992176"	"72992176"	"subst"	"9.74841E-5"	"01943"	"ZFHX3_000052"	"g.72992176A>T"	""	""	""	"ZFHX3(NM_006885.3):c.1869T>A (p.A623=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.72958277A>T"	""	"likely benign"	""
"0000254501"	"0"	"30"	"16"	"72832117"	"72832117"	"subst"	"1.625E-5"	"01943"	"ZFHX3_000029"	"g.72832117A>G"	""	""	""	"ZFHX3(NM_006885.3):c.4464T>C (p.I1488=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.72798218A>G"	""	"likely benign"	""
"0000254535"	"0"	"30"	"16"	"72993097"	"72993097"	"subst"	"0.00149026"	"01943"	"ZFHX3_000053"	"g.72993097A>G"	""	""	""	"ZFHX3(NM_006885.3):c.948T>C (p.I316=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.72959198A>G"	""	"likely benign"	""
"0000320129"	"0"	"10"	"16"	"72821960"	"72821960"	"subst"	"0.00253939"	"01943"	"ZFHX3_000014"	"g.72821960G>C"	""	""	""	"ZFHX3(NM_006885.3):c.10215C>G (p.P3405=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.72788061G>C"	""	"benign"	""
"0000320130"	"0"	"50"	"16"	"72821656"	"72821656"	"subst"	"0"	"01943"	"ZFHX3_000012"	"g.72821656C>T"	""	""	""	"ZFHX3(NM_006885.3):c.10519G>A (p.G3507S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.72787757C>T"	""	"VUS"	""
"0000320133"	"0"	"10"	"16"	"72821609"	"72821617"	"del"	"0"	"01943"	"ZFHX3_000005"	"g.72821609_72821617del"	""	""	""	"ZFHX3(NM_006885.3):c.10573_10581delGGCGGCGGC (p.G3525_G3527del), ZFHX3(NM_006885.4):c.10573_10581delGGCGGCGGC (p.G3525_G3527del)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.72787710_72787718del"	""	"benign"	""
"0000320134"	"0"	"50"	"16"	"72821358"	"72821358"	"subst"	"0.000553364"	"01943"	"ZFHX3_000004"	"g.72821358G>T"	""	""	""	"ZFHX3(NM_001164766.1):c.8075C>A (p.(Ser2692Tyr)), ZFHX3(NM_006885.3):c.10817C>A (p.S3606Y), ZFHX3(NM_006885.4):c.10817C>A (p.S3606Y)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.72787459G>T"	""	"VUS"	""
"0000320135"	"0"	"30"	"16"	"72821321"	"72821321"	"subst"	"0.000177993"	"01943"	"ZFHX3_000003"	"g.72821321C>G"	""	""	""	"ZFHX3(NM_006885.3):c.10854G>C (p.P3618=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.72787422C>G"	""	"likely benign"	""
"0000320136"	"0"	"50"	"16"	"72992628"	"72992632"	"del"	"0"	"01943"	"ZFHX3_000046"	"g.72992628_72992632del"	""	""	""	"ZFHX3(NM_006885.3):c.1413_1417delGGCGG (p.A472Gfs*28)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.72958729_72958733del"	""	"VUS"	""
"0000320137"	"0"	"50"	"16"	"72991931"	"72991931"	"subst"	"0"	"01943"	"ZFHX3_000044"	"g.72991931T>C"	""	""	""	"ZFHX3(NM_006885.3):c.2114A>G (p.K705R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.72958032T>C"	""	"VUS"	""
"0000320138"	"0"	"50"	"16"	"72991886"	"72991886"	"subst"	"1.629E-5"	"01943"	"ZFHX3_000043"	"g.72991886G>A"	""	""	""	"ZFHX3(NM_006885.3):c.2159C>T (p.T720M), ZFHX3(NM_006885.4):c.2159C>T (p.(Thr720Met))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.72957987G>A"	""	"VUS"	""
"0000320139"	"0"	"30"	"16"	"72991711"	"72991731"	"del"	"0"	"01943"	"ZFHX3_000041"	"g.72991711_72991731del"	""	""	""	"ZFHX3(NM_006885.3):c.2328_2348delGGTGGCTGCGGCGGCGGCGGC (p.V777_A783del)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.72957812_72957832del"	""	"likely benign"	""
"0000320140"	"0"	"10"	"16"	"72993799"	"72993799"	"subst"	"0.00336955"	"01943"	"ZFHX3_000049"	"g.72993799G>A"	""	""	""	"ZFHX3(NM_006885.3):c.246C>T (p.N82=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.72959900G>A"	""	"benign"	""
"0000320141"	"0"	"30"	"16"	"72923700"	"72923700"	"subst"	"0.00108588"	"01943"	"ZFHX3_000036"	"g.72923700C>T"	""	""	""	"ZFHX3(NM_006885.3):c.3378G>A (p.K1126=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.72889801C>T"	""	"likely benign"	""
"0000320142"	"0"	"50"	"16"	"72863681"	"72863681"	"subst"	"0.000215239"	"01943"	"ZFHX3_000035"	"g.72863681C>T"	""	""	""	"ZFHX3(NM_006885.3):c.3526G>A (p.G1176R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.72829782C>T"	""	"VUS"	""
"0000320145"	"0"	"30"	"16"	"72993580"	"72993580"	"subst"	"2.45024E-5"	"01943"	"ZFHX3_000047"	"g.72993580G>A"	""	""	""	"ZFHX3(NM_006885.3):c.465C>T (p.G155=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.72959681G>A"	""	"likely benign"	""
"0000320146"	"0"	"50"	"16"	"72830160"	"72830160"	"subst"	"1.22024E-5"	"01943"	"ZFHX3_000027"	"g.72830160G>A"	""	""	""	"ZFHX3(NM_006885.3):c.6421C>T (p.L2141F)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.72796261G>A"	""	"VUS"	""
"0000320147"	"0"	"30"	"16"	"72829468"	"72829468"	"subst"	"2.03074E-5"	"01943"	"ZFHX3_000026"	"g.72829468G>A"	""	""	""	"ZFHX3(NM_006885.3):c.7113C>T (p.A2371=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.72795569G>A"	""	"likely benign"	""
"0000320148"	"0"	"10"	"16"	"72828304"	"72828304"	"subst"	"0.00249246"	"01943"	"ZFHX3_000025"	"g.72828304C>A"	""	""	""	"ZFHX3(NM_006885.3):c.8277G>T (p.Q2759H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.72794405C>A"	""	"benign"	""
"0000320149"	"0"	"10"	"16"	"72828265"	"72828265"	"subst"	"0.00576785"	"01943"	"ZFHX3_000024"	"g.72828265G>A"	""	""	""	"ZFHX3(NM_006885.3):c.8316C>T (p.H2772=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.72794366G>A"	""	"benign"	""
"0000320150"	"0"	"30"	"16"	"72827984"	"72827984"	"subst"	"2.43661E-5"	"01943"	"ZFHX3_000023"	"g.72827984T>C"	""	""	""	"ZFHX3(NM_006885.3):c.8597A>G (p.K2866R, p.(Lys2866Arg))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.72794085T>C"	""	"likely benign"	""
"0000320151"	"0"	"50"	"16"	"72827874"	"72827874"	"subst"	"0.00186802"	"01943"	"ZFHX3_000022"	"g.72827874T>C"	""	""	""	"ZFHX3(NM_006885.3):c.8707A>G (p.S2903G)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.72793975T>C"	""	"VUS"	""
"0000320152"	"0"	"50"	"16"	"72827589"	"72827589"	"subst"	"0"	"01943"	"ZFHX3_000021"	"g.72827589G>A"	""	""	""	"ZFHX3(NM_006885.3):c.8992C>T (p.R2998W)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.72793690G>A"	""	"VUS"	""
"0000320153"	"0"	"10"	"16"	"72822645"	"72822645"	"subst"	"0.00680553"	"01943"	"ZFHX3_000020"	"g.72822645G>A"	""	""	""	"ZFHX3(NM_006885.3):c.9530C>T (p.S3177L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.72788746G>A"	""	"benign"	""
"0000320154"	"0"	"50"	"16"	"72822471"	"72822471"	"subst"	"3.24863E-5"	"01943"	"ZFHX3_000019"	"g.72822471T>C"	""	""	""	"ZFHX3(NM_006885.3):c.9704A>G (p.K3235R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.72788572T>C"	""	"VUS"	""
"0000320155"	"0"	"30"	"16"	"72822392"	"72822392"	"subst"	"2.84262E-5"	"01943"	"ZFHX3_000018"	"g.72822392T>C"	""	""	""	"ZFHX3(NM_006885.3):c.9783A>G (p.K3261=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.72788493T>C"	""	"likely benign"	""
"0000324886"	"0"	"30"	"16"	"72821358"	"72821358"	"subst"	"0.000553364"	"01804"	"ZFHX3_000004"	"g.72821358G>T"	""	""	""	"ZFHX3(NM_001164766.1):c.8075C>A (p.(Ser2692Tyr)), ZFHX3(NM_006885.3):c.10817C>A (p.S3606Y), ZFHX3(NM_006885.4):c.10817C>A (p.S3606Y)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.72787459G>T"	""	"likely benign"	""
"0000324887"	"0"	"50"	"16"	"72821620"	"72821637"	"del"	"0"	"01804"	"ZFHX3_000006"	"g.72821620_72821637del"	""	""	""	"ZFHX3(NM_001164766.1):c.7815_7832del (p.(Gly2608_Gly2613del))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.72787721_72787738del"	""	"VUS"	""
"0000324888"	"0"	"50"	"16"	"72821618"	"72821632"	"del"	"0"	"01804"	"ZFHX3_000007"	"g.72821618_72821632del"	""	""	""	"ZFHX3(NM_001164766.1):c.7815_7829del (p.(Gly2609_Gly2613del))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.72787719_72787733del"	""	"VUS"	""
"0000324889"	"0"	"50"	"16"	"72821618"	"72821620"	"del"	"0"	"01804"	"ZFHX3_000009"	"g.72821618_72821620del"	""	""	""	"ZFHX3(NM_001164766.1):c.7815_7817del (p.?)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.72787719_72787721del"	""	"VUS"	""
"0000324890"	"0"	"50"	"16"	"72821633"	"72821635"	"del"	"0"	"01804"	"ZFHX3_000011"	"g.72821633_72821635del"	""	""	""	"ZFHX3(NM_001164766.1):c.7812_7814del (p.(Gly2606del))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.72787734_72787736del"	""	"VUS"	""
"0000324892"	"0"	"50"	"16"	"72821806"	"72821806"	"subst"	"4.10482E-6"	"01804"	"ZFHX3_000013"	"g.72821806T>C"	""	""	""	"ZFHX3(NM_001164766.1):c.7627A>G (p.(Ile2543Val))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.72787907T>C"	""	"VUS"	""
"0000324893"	"0"	"50"	"16"	"72822003"	"72822023"	"del"	"0"	"01804"	"ZFHX3_000015"	"g.72822003_72822023del"	""	""	""	"ZFHX3(NM_001164766.1):c.7424_7444del (p.?)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.72788104_72788124del"	""	"VUS"	""
"0000324894"	"0"	"50"	"16"	"72822280"	"72822280"	"subst"	"5.6874E-5"	"01804"	"ZFHX3_000016"	"g.72822280G>A"	""	""	""	"ZFHX3(NM_001164766.1):c.7153C>T (p.(Pro2385Ser))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.72788381G>A"	""	"VUS"	""
"0000324895"	"0"	"50"	"16"	"72822351"	"72822351"	"subst"	"0.000381834"	"01804"	"ZFHX3_000017"	"g.72822351G>A"	""	""	""	"ZFHX3(NM_001164766.1):c.7082C>T (p.(Pro2361Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.72788452G>A"	""	"VUS"	""
"0000324896"	"0"	"50"	"16"	"72831495"	"72831495"	"del"	"0"	"01804"	"ZFHX3_000028"	"g.72831495del"	""	""	""	"ZFHX3(NM_001164766.1):c.2345del (p.?)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.72797596del"	""	"VUS"	""
"0000324898"	"0"	"30"	"16"	"72845583"	"72845583"	"subst"	"1.62582E-5"	"01804"	"ZFHX3_000034"	"g.72845583G>A"	""	""	""	"ZFHX3(NM_001164766.1):c.1015C>T (p.(Arg339Cys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.72811684G>A"	""	"likely benign"	""
"0000324899"	"0"	"50"	"16"	"72984661"	"72984661"	"subst"	"0"	"01804"	"ZFHX3_000037"	"g.72984661C>A"	""	""	""	"ZFHX3(NM_001164766.1):c.181G>T (p.?)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.72950762C>A"	""	"VUS"	""
"0000324900"	"0"	"30"	"16"	"72984739"	"72984739"	"subst"	"0.00156433"	"01804"	"ZFHX3_000038"	"g.72984739C>T"	""	""	""	"ZFHX3(NM_001164766.1):c.103G>A (p.(Val35Ile))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.72950840C>T"	""	"likely benign"	""
"0000324901"	"0"	"50"	"16"	"72991395"	"72991395"	"subst"	"0.00134123"	"01804"	"ZFHX3_000039"	"g.72991395C>G"	""	""	""	"ZFHX3(NM_001164766.1):c.-23-6531G>C (p.(=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.72957496C>G"	""	"VUS"	""
"0000324902"	"0"	"50"	"16"	"72991708"	"72991710"	"dup"	"0"	"01804"	"ZFHX3_000040"	"g.72991708_72991710dup"	""	""	""	"ZFHX3(NM_001164766.1):c.-23-6833_-23-6832insGGC (p.(=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.72957809_72957811dup"	""	"VUS"	""
"0000324903"	"0"	"50"	"16"	"72991885"	"72991885"	"subst"	"0.000553967"	"01804"	"ZFHX3_000042"	"g.72991885C>T"	""	""	""	"ZFHX3(NM_001164766.1):c.-23-7021G>A (p.(=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.72957986C>T"	""	"VUS"	""
"0000324904"	"0"	"50"	"16"	"72992608"	"72992610"	"dup"	"0"	"01804"	"ZFHX3_000045"	"g.72992608_72992610dup"	""	""	""	"ZFHX3(NM_006885.3):c.1445_1446insGGA (p.(Glu482dup))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.72958709_72958711dup"	""	"VUS"	""
"0000339171"	"0"	"50"	"16"	"72831936"	"72831936"	"subst"	"6.90322E-5"	"02327"	"ZFHX3_000050"	"g.72831936C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.72798037C>T"	""	"VUS"	""
"0000559072"	"0"	"50"	"16"	"72821244"	"72821244"	"subst"	"0"	"01943"	"ZFHX3_000054"	"g.72821244C>A"	""	""	""	"ZFHX3(NM_006885.3):c.10931G>T (p.S3644I)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.72787345C>A"	""	"VUS"	""
"0000559076"	"0"	"50"	"16"	"72821618"	"72821620"	"dup"	"0"	"01943"	"ZFHX3_000057"	"g.72821618_72821620dup"	""	""	""	"ZFHX3(NM_006885.3):c.10557_10559dupTGG (p.G3527dup)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.72787719_72787721dup"	""	"VUS"	""
"0000559078"	"0"	"10"	"16"	"72821630"	"72821635"	"dup"	"0"	"01943"	"ZFHX3_000059"	"g.72821630_72821635dup"	""	""	""	"ZFHX3(NM_006885.3):c.10551_10556dupCGGCGG (p.G3526_G3527dup)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.72787731_72787736dup"	""	"benign"	""
"0000559079"	"0"	"30"	"16"	"72822716"	"72822716"	"subst"	"5.75467E-5"	"01943"	"ZFHX3_000060"	"g.72822716A>G"	""	""	""	"ZFHX3(NM_006885.3):c.9459T>C (p.G3153=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.72788817A>G"	""	"likely benign"	""
"0000559080"	"0"	"30"	"16"	"72828279"	"72828279"	"subst"	"0.000543901"	"01943"	"ZFHX3_000061"	"g.72828279T>A"	""	""	""	"ZFHX3(NM_006885.3):c.8302A>T (p.T2768S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.72794380T>A"	""	"likely benign"	""
"0000559082"	"0"	"30"	"16"	"72831820"	"72831820"	"subst"	"0.000292538"	"01943"	"ZFHX3_000063"	"g.72831820G>C"	""	""	""	"ZFHX3(NM_006885.3):c.4761C>G (p.P1587=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.72797921G>C"	""	"likely benign"	""
"0000559083"	"0"	"30"	"16"	"72832633"	"72832634"	"dup"	"0"	"01943"	"ZFHX3_000064"	"g.72832633_72832634dup"	""	""	""	"ZFHX3(NM_006885.3):c.3968-7_3968-6dupTT"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.72798734_72798735dup"	""	"likely benign"	""
"0000559086"	"0"	"10"	"16"	"72832634"	"72832634"	"dup"	"0"	"01943"	"ZFHX3_000065"	"g.72832634dup"	""	""	""	"ZFHX3(NM_006885.3):c.3968-6dupT"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.72798735dup"	""	"benign"	""
"0000559087"	"0"	"50"	"16"	"72923711"	"72923711"	"subst"	"1.62639E-5"	"01943"	"ZFHX3_000066"	"g.72923711G>A"	""	""	""	"ZFHX3(NM_006885.3):c.3367C>T (p.R1123W)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.72889812G>A"	""	"VUS"	""
"0000559088"	"0"	"50"	"16"	"72984791"	"72984791"	"subst"	"0.00245588"	"01943"	"ZFHX3_000067"	"g.72984791G>A"	""	""	""	"ZFHX3(NM_006885.3):c.2793C>T (p.G931=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.72950892G>A"	""	"VUS"	""
"0000559091"	"0"	"50"	"16"	"72991721"	"72991721"	"subst"	"0"	"01943"	"ZFHX3_000070"	"g.72991721G>A"	""	""	""	"ZFHX3(NM_006885.3):c.2324C>T (p.A775V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.72957822G>A"	""	"VUS"	""
"0000559093"	"0"	"30"	"16"	"72993847"	"72993847"	"subst"	"0.00159855"	"01943"	"ZFHX3_000072"	"g.72993847C>T"	""	""	""	"ZFHX3(NM_006885.3):c.198G>A (p.A66=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.72959948C>T"	""	"likely benign"	""
"0000616123"	"0"	"30"	"16"	"72828631"	"72828631"	"subst"	"2.84282E-5"	"01943"	"ZFHX3_000074"	"g.72828631C>T"	""	""	""	"ZFHX3(NM_006885.3):c.7950G>A (p.P2650=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.72794732C>T"	""	"likely benign"	""
"0000616124"	"0"	"30"	"16"	"72830796"	"72830796"	"subst"	"0"	"01943"	"ZFHX3_000075"	"g.72830796G>T"	""	""	""	"ZFHX3(NM_006885.3):c.5785C>A (p.P1929T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.72796897G>T"	""	"likely benign"	""
"0000623523"	"0"	"30"	"16"	"72821612"	"72821617"	"dup"	"0"	"02330"	"ZFHX3_000073"	"g.72821612_72821617dup"	""	""	""	"ZFHX3(NM_006885.3):c.10576_10581dupGGCGGC (p.G3526_G3527dup)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.72787713_72787718dup"	""	"likely benign"	""
"0000626567"	"11"	"50"	"16"	"72829896"	"72829896"	"subst"	"4.0623E-5"	"02061"	"ZFHX3_000076"	"g.72829896G>C"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.72795997G>C"	""	"VUS"	""
"0000657929"	"0"	"50"	"16"	"72991757"	"72991757"	"dup"	"0"	"01804"	"ZFHX3_000077"	"g.72991757dup"	""	""	""	"ZFHX3(NM_006885.3):c.2288dup (p.(Gln764AlafsTer25))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.72957858dup"	""	"VUS"	""
"0000680653"	"0"	"10"	"16"	"72821642"	"72821644"	"del"	"0"	"02325"	"ZFHX3_000078"	"g.72821642_72821644del"	""	""	""	"ZFHX3(NM_006885.4):c.10533_10535delTGG (p.G3512del)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000680654"	"0"	"30"	"16"	"72822368"	"72822368"	"subst"	"1.62452E-5"	"01943"	"ZFHX3_000079"	"g.72822368T>C"	""	""	""	"ZFHX3(NM_006885.3):c.9807A>G (p.A3269=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000680655"	"0"	"30"	"16"	"72993708"	"72993708"	"subst"	"0.0207556"	"01804"	"ZFHX3_000080"	"g.72993708C>T"	""	""	""	"ZFHX3(NM_006885.3):c.337G>A (p.(Ala113Thr))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000692130"	"0"	"50"	"16"	"72991764"	"72991764"	"dup"	"0"	"02327"	"ZFHX3_000081"	"g.72991764dup"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000725956"	"0"	"50"	"16"	"72830397"	"72830397"	"subst"	"5.40482E-5"	"01943"	"ZFHX3_000082"	"g.72830397G>C"	""	""	""	"ZFHX3(NM_006885.3):c.6184C>G (p.P2062A)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000725957"	"0"	"50"	"16"	"72831988"	"72831988"	"subst"	"0"	"01943"	"ZFHX3_000083"	"g.72831988G>C"	""	""	""	"ZFHX3(NM_006885.3):c.4593C>G (p.P1531=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000807583"	"0"	"30"	"16"	"72991663"	"72991663"	"subst"	"0.000534162"	"01943"	"ZFHX3_000084"	"g.72991663C>T"	""	""	""	"ZFHX3(NM_006885.3):c.2382G>A (p.S794=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000807584"	"0"	"30"	"16"	"72994024"	"72994024"	"subst"	"0.000159852"	"01943"	"ZFHX3_000085"	"g.72994024G>A"	""	""	""	"ZFHX3(NM_006885.3):c.21C>T (p.P7=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000854631"	"0"	"30"	"16"	"72827589"	"72827589"	"subst"	"0"	"01943"	"ZFHX3_000086"	"g.72827589G>T"	""	""	""	"ZFHX3(NM_006885.3):c.8992C>A (p.R2998=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000854632"	"0"	"30"	"16"	"72993859"	"72993859"	"subst"	"5.422E-5"	"01943"	"ZFHX3_000088"	"g.72993859C>T"	""	""	""	"ZFHX3(NM_006885.3):c.186G>A (p.A62=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000864929"	"0"	"50"	"16"	"72845592"	"72845592"	"subst"	"1.21921E-5"	"01943"	"ZFHX3_000087"	"g.72845592G>A"	""	""	""	"ZFHX3(NM_006885.3):c.3748C>T (p.P1250S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000869438"	"0"	"90"	"16"	"71779150"	"73038609"	"del"	"0"	"00006"	"ZFHX3_000129"	"g.(?_71779150)_(73038609_?)del"	""	"del Rocío Perez Baca BeSHG2022, AbsT25, {PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.(?_71745247)_(73004710_?)del"	""	"pathogenic"	""
"0000869439"	"0"	"90"	"16"	"71866881"	"73157076"	"del"	"0"	"00006"	"ZFHX3_000089"	"g.(?_71866881)_(73157076_?)del"	""	"del Rocío Perez Baca BeSHG2022, AbsT25, {PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.(?_71832978)_(73123177_?)del"	""	"pathogenic"	""
"0000869440"	"0"	"90"	"16"	"72125903"	"80637770"	"del"	"0"	"00006"	"ZFHX3_000089"	"g.(?_72125903)_(80637770_?)del"	""	"del Rocío Perez Baca BeSHG2022, AbsT25, {PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.(?_72092004)_(80603873_?)del"	""	"pathogenic"	""
"0000869441"	"0"	"90"	"16"	"72335275"	"73317238"	"del"	"0"	"00006"	"ZFHX3_000089"	"g.(?_72335275)_(73317238_?)del"	""	"del Rocío Perez Baca BeSHG2022, AbsT25, {PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.(?_72301376)_(73283339_?)del"	""	"pathogenic"	""
"0000869442"	"0"	"90"	"16"	"72457850"	"73110449"	"del"	"0"	"00006"	"ZFHX3_000089"	"g.(?_72457850)_(73110449_?)del"	""	"del Rocío Perez Baca BeSHG2022, AbsT25, {PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.(?_72423951)_(73076550_?)del"	""	"pathogenic"	""
"0000869443"	"0"	"90"	"16"	"72526011"	"72947737"	"del"	"0"	"00006"	"CRYM_000000"	"g.(?_72526011)_(72947737_?)del"	""	"del Rocío Perez Baca BeSHG2022, AbsT25, {PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.(?_72492112)_(72913838_?)del"	""	"pathogenic"	""
"0000869444"	"0"	"90"	"16"	"72632024"	"72895614"	"del"	"0"	"00006"	"ZFHX3_000130"	"g.(?_72632024)_(72895614_?)del"	""	"del Rocío Perez Baca BeSHG2022, AbsT25, {PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.(?_72598125)_(72861715_?)del"	""	"pathogenic"	""
"0000869445"	"0"	"90"	"16"	"72643701"	"72935574"	"del"	"0"	"00006"	"CRYM_000000"	"g.(?_72643701)_(72935574_?)del"	""	"del Rocío Perez Baca BeSHG2022, AbsT25, {PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.(?_72609802)_(72901675_?)del"	""	"pathogenic"	""
"0000869446"	"0"	"90"	"16"	"72720896"	"72901328"	"del"	"0"	"00006"	"ZFHX3_000130"	"g.(?_72720896)_(72901328_?)del"	""	"del Rocío Perez Baca BeSHG2022, AbsT25, {PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.(?_72686997)_(72867429_?)del"	""	"pathogenic"	""
"0000869447"	"0"	"90"	"16"	"72737477"	"72931085"	"del"	"0"	"00006"	"ZFHX3_000131"	"g.(?_72737477)_(72931085_?)del"	""	"del Rocío Perez Baca BeSHG2022, AbsT25, {PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.(?_72703578)_(72897186_?)del"	""	"pathogenic"	""
"0000869448"	"0"	"90"	"16"	"72798946"	"72851994"	"del"	"0"	"00006"	"ZFHX3_000130"	"g.(?_72798946)_(72851994_?)del"	""	"del Rocío Perez Baca BeSHG2022, AbsT25, {PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	""	"variant not in mother"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.(?_72765047)_(72818095_?)del"	""	"pathogenic"	""
"0000869449"	"0"	"90"	"16"	"72821017"	"72984913"	"del"	"0"	"00006"	"ZFHX3_000132"	"g.(?_72821017)_(72984913_?)del"	""	"del Rocío Perez Baca BeSHG2022, AbsT25, {PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.(?_72787118)_(72951014_?)del"	""	"pathogenic"	""
"0000869450"	"0"	"90"	"16"	"72821017"	"72994051"	"del"	"0"	"00006"	"ZFHX3_000133"	"g.(?_72821017)_(72994051_?)del"	""	"del Rocío Perez Baca BeSHG2022, AbsT25, {PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.(?_72787118)_(72960152_?)del"	""	"pathogenic"	""
"0000869451"	"0"	"90"	"16"	"72832074"	"72900087"	"del"	"0"	"00006"	"ZFHX3_000134"	"g.(?_72832074)_(72900087_?)del"	""	"del Rocío Perez Baca BeSHG2022, AbsT25, {PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.(?_72798175)_(72866188_?)del"	""	"pathogenic"	""
"0000914686"	"0"	"50"	"16"	"72822026"	"72822049"	"del"	"0"	"02325"	"ZFHX3_000090"	"g.72822026_72822049del"	""	""	""	"ZFHX3(NM_006885.4):c.10142_10165delGGCAACTACAGCAGCAGCAGCAGC (p.R3381_Q3388del)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000950726"	"0"	"30"	"16"	"72821632"	"72821633"	"ins"	"0"	"02325"	"ZFHX3_000091"	"g.72821632_72821633insACT"	""	""	""	"ZFHX3(NM_006885.4):c.10542_10543insAGT (p.G3514_G3515insS)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000950727"	"0"	"70"	"16"	"72832384"	"72832384"	"subst"	"0"	"02329"	"ZFHX3_000092"	"g.72832384G>C"	""	""	""	"ZFHX3(NM_001386735.1):c.4197C>G (p.Y1399*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000955105"	"1"	"10"	"16"	"72821594"	"72821656"	"repeat"	"0"	"00006"	"ZFHX3_000093"	"g.72821594_72821656GCC[8]ACC[1]GCC[5]ACTGCCACC[1]GCC[4]"	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[21]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757GCC[8]ACC[1]GCC[5]ACTGCCACC[1]GCC[4]"	""	"benign"	""
"0000955106"	"1"	"10"	"16"	"72821594"	"72821656"	"repeat"	"0"	"00006"	"ZFHX3_000094"	"g.72821594_72821656GCC[8]ACC[1]GCC[2]GTC[1]GCC[2]ACTGCCACC[1]GCC[4]"	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[21]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757GCC[8]ACC[1]GCC[2]GTC[1]GCC[2]ACTGCCACC[1]GCC[4]"	""	"benign"	""
"0000955107"	"1"	"10"	"16"	"72821594"	"72821656"	"repeat"	"0"	"00006"	"ZFHX3_000095"	"g.72821594_72821656GCC[9]ACC[1]GCC[5]ACTGCCACC[1]GCC[4]"	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[22]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757GCC[9]ACC[1]GCC[5]ACTGCCACC[1]GCC[4]"	""	"benign"	""
"0000955108"	"1"	"10"	"16"	"72821594"	"72821656"	"repeat"	"0"	"00006"	"ZFHX3_000096"	"g.72821594_72821656GCC[5]ACC[1]GCC[5]ACTGCCACC[1]GCC[4]"	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[18]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757GCC[5]ACC[1]GCC[5]ACTGCCACC[1]GCC[4]"	""	"benign"	""
"0000955109"	"1"	"10"	"16"	"72821594"	"72821656"	"repeat"	"0"	"00006"	"ZFHX3_000097"	"g.72821594_72821656GCC[10]ACC[1]GCC[5]ACTGCCACC[1]GCC[4]"	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[23]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757GCC[10]ACC[1]GCC[5]ACTGCCACC[1]GCC[4]"	""	"benign"	""
"0000955110"	"1"	"10"	"16"	"72821594"	"72821656"	"repeat"	"0"	"00006"	"ZFHX3_000098"	"g.72821594_72821656GCC[14]ACTGCCACC[1]GCC[4]"	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[21]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757GCC[14]ACTGCCACC[1]GCC[4]"	""	"benign"	""
"0000955111"	"1"	"10"	"16"	"72821594"	"72821656"	"repeat"	"0"	"00006"	"ZFHX3_000099"	"g.72821594_72821656GCC[8]ACC[1]GCC[5]ACTGCCACC[1]GCC[3]GCG[1]"	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[21]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757GCC[8]ACC[1]GCC[5]ACTGCCACC[1]GCC[3]GCG[1]"	""	"benign"	""
"0000955112"	"1"	"10"	"16"	"72821594"	"72821656"	"repeat"	"0"	"00006"	"ZFHX3_000100"	"g.72821594_72821656GCC[8]ACC[1]GCC[5]ACT[1]GCC[5]"	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[20]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757GCC[8]ACC[1]GCC[5]ACT[1]GCC[5]"	""	"benign"	""
"0000955113"	"1"	"10"	"16"	"72821594"	"72821656"	"repeat"	"0"	"00006"	"ZFHX3_000101"	"g.72821594_72821656GCC[12]ACTGCCACC[1]GCC[4]"	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[19]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757GCC[12]ACTGCCACC[1]GCC[4]"	""	"benign"	""
"0000955114"	"1"	"10"	"16"	"72821594"	"72821656"	"repeat"	"0"	"00006"	"ZFHX3_000102"	"g.72821594_72821656GCC[8]ACC[1]GCC[4]ACTGCCACC[1]GCC[4]"	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[20]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757GCC[8]ACC[1]GCC[4]ACTGCCACC[1]GCC[4]"	""	"benign"	""
"0000955115"	"1"	"10"	"16"	"72821594"	"72821656"	"repeat"	"0"	"00006"	"ZFHX3_000103"	"g.72821594_72821656GCC[11]ACTGCCACC[1]GCC[4]"	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[18]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757GCC[11]ACTGCCACC[1]GCC[4]"	""	"benign"	""
"0000955116"	"1"	"10"	"16"	"72821594"	"72821656"	"repeat"	"0"	"00006"	"ZFHX3_000104"	"g.72821594_72821656GCC[8]ACC[1]GCC[3]ACT[1]GCC[5]"	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[18]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757GCC[8]ACC[1]GCC[3]ACT[1]GCC[5]"	""	"benign"	""
"0000955117"	"1"	"10"	"16"	"72821594"	"72821656"	"repeat"	"0"	"00006"	"ZFHX3_000105"	"g.72821594_72821656GCC[8]ACC[1]GCC[7]"	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[16]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757GCC[8]ACC[1]GCC[7]"	""	"benign"	""
"0000955118"	"1"	"10"	"16"	"72821594"	"72821656"	"repeat"	"0"	"00006"	"ZFHX3_000106"	"g.72821594_72821656GCC[8]ACC[1]GCC[5]ACTGCC[2]ACC[1]GCC[4]"	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[23]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757GCC[8]ACC[1]GCC[5]ACTGCC[2]ACC[1]GCC[4]"	""	"benign"	""
"0000955119"	"1"	"10"	"16"	"72821594"	"72821656"	"repeat"	"0"	"00006"	"ZFHX3_000107"	"g.72821594_72821656ACC[5]GCC[8]ACC[1]GCC[5]ACTGCCACC[1]GCC[4]"	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[26]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757ACC[5]GCC[8]ACC[1]GCC[5]ACTGCCACC[1]GCC[4]"	""	"benign"	""
"0000955120"	"1"	"10"	"16"	"72821594"	"72821656"	"repeat"	"0"	"00006"	"ZFHX3_000108"	"g.72821594_72821656GCC[8]ACC[1]GCC[5]ACCGCCACC[1]GCC[4]"	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[21]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757GCC[8]ACC[1]GCC[5]ACCGCCACC[1]GCC[4]"	""	"benign"	""
"0000955121"	"1"	"10"	"16"	"72821594"	"72821656"	"repeat"	"0"	"00006"	"ZFHX3_000109"	"g.72821594_72821656GCC[7]ACTGCCACC[1]GCC[4]"	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[14]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757GCC[7]ACTGCCACC[1]GCC[4]"	""	"benign"	""
"0000955122"	"1"	"10"	"16"	"72821594"	"72821656"	"repeat"	"0"	"00006"	"ZFHX3_000110"	"g.72821594_72821656GCC[7]ACC[1]GCC[5]ACTGCCACC[1]GCC[4]"	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[20]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757GCC[7]ACC[1]GCC[5]ACTGCCACC[1]GCC[4]"	""	"benign"	""
"0000955123"	"1"	"10"	"16"	"72821594"	"72821656"	"repeat"	"0"	"00006"	"ZFHX3_000111"	"g.72821594_72821656GCC[8]ACC[1]GCC[5]"	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[14]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757GCC[8]ACC[1]GCC[5]"	""	"benign"	""
"0000955124"	"1"	"10"	"16"	"72821594"	"72821656"	"repeat"	"0"	"00006"	"ZFHX3_000112"	"g.72821594_72821656GCC[8]ACC[1]GCC[5]ACT[1]GCC[6]"	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[21]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757GCC[8]ACC[1]GCC[5]ACT[1]GCC[6]"	""	"benign"	""
"0000955125"	"1"	"10"	"16"	"72821594"	"72821656"	"repeat"	"0"	"00006"	"ZFHX3_000113"	"g.72821594_72821656GCC[10]ACC[1]GCC[5]ACTGCCACC[1]GCC[3]GCG[1]"	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[23]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757GCC[10]ACC[1]GCC[5]ACTGCCACC[1]GCC[3]GCG[1]"	""	"benign"	""
"0000955126"	"1"	"10"	"16"	"72821594"	"72821656"	"repeat"	"0"	"00006"	"ZFHX3_000114"	"g.72821594_72821656GCC[8]ACC[1]GCC[5]ACTGCCACC[1]GCC[6]"	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[23]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757GCC[8]ACC[1]GCC[5]ACTGCCACC[1]GCC[6]"	""	"benign"	""
"0000955127"	"1"	"10"	"16"	"72821594"	"72821656"	"repeat"	"0"	"00006"	"ZFHX3_000115"	"g.72821594_72821656GCC[8]ACC[1]GCC[5]ACTGCCACC[1]GCC[3]"	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[20]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757GCC[8]ACC[1]GCC[5]ACTGCCACC[1]GCC[3]"	""	"benign"	""
"0000955128"	"1"	"10"	"16"	"72821594"	"72821656"	"repeat"	"0"	"00006"	"ZFHX3_000116"	"g.72821594_72821656GCC[7]ACC[1]GCC[2]GTC[1]GCC[2]ACTGCCACC[1]GCC[4]"	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[20]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757GCC[7]ACC[1]GCC[2]GTC[1]GCC[2]ACTGCCACC[1]GCC[4]"	""	"benign"	""
"0000955129"	"1"	"10"	"16"	"72821594"	"72821656"	"repeat"	"0"	"00006"	"ZFHX3_000117"	"g.72821594_72821656GCC[6]ACC[1]GCC[5]ACTGCCACC[1]GCC[4]"	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[19]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757GCC[6]ACC[1]GCC[5]ACTGCCACC[1]GCC[4]"	""	"benign"	""
"0000955130"	"1"	"10"	"16"	"72821594"	"72821656"	"repeat"	"0"	"00006"	"ZFHX3_000118"	"g.72821594_72821656GCC[16]ACC[1]GCC[6]"	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[23]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757GCC[16]ACC[1]GCC[6]"	""	"benign"	""
"0000955131"	"1"	"10"	"16"	"72821594"	"72821656"	"repeat"	"0"	"00006"	"ZFHX3_000119"	"g.72821594_72821656GCC[15]ACC[1]GCC[6]"	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[22]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757GCC[15]ACC[1]GCC[6]"	""	"benign"	""
"0000955132"	"21"	"90"	"16"	"72821594"	"72821656"	"repeat"	"0"	"00006"	"ZFHX3_000120"	"g.72821594_72821656GCC[108]"	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[57]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757GCC[108]"	""	"pathogenic (dominant)"	""
"0000955133"	"11"	"90"	"16"	"72821594"	"72821656"	"repeat"	"0"	"00006"	"ZFHX3_000121"	"g.72821594_72821656GCC[153]"	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[72]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757GCC[153]"	""	"pathogenic (dominant)"	""
"0000955134"	"21"	"90"	"16"	"72821594"	"72821656"	"repeat"	"0"	"00006"	"ZFHX3_000122"	"g.72821594_72821656GCC[75]"	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[46]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757GCC[75]"	""	"pathogenic (dominant)"	""
"0000955135"	"21"	"90"	"16"	"72821594"	"72821656"	"repeat"	"0"	"00006"	"ZFHX3_000123"	"g.72821594_72821656GCC[105]"	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[56]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757GCC[105]"	""	"pathogenic (dominant)"	""
"0000955136"	"11"	"90"	"16"	"72821594"	"72821656"	"repeat"	"0"	"00006"	"ZFHX3_000124"	"g.72821594_72821656GCC[114]"	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[59]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757GCC[114]"	""	"pathogenic (dominant)"	""
"0000955137"	"11"	"90"	"16"	"72821594"	"72821656"	"repeat"	"0"	"00006"	"ZFHX3_000125"	"g.72821594_72821656GCC[63]"	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[42]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757GCC[63]"	""	"pathogenic (dominant)"	""
"0000955138"	"11"	"90"	"16"	"72821594"	"72821656"	"repeat"	"0"	"00006"	"ZFHX3_000126"	"g.72821594_72821656GCC[159]"	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[74]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757GCC[159]"	""	"pathogenic (dominant)"	""
"0000955139"	"1"	"10"	"16"	"72821594"	"72821656"	"="	"0"	"00006"	"ZFHX3_000127"	"g.72821594_72821656="	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[21]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757="	""	"benign"	""
"0000955140"	"1"	"10"	"16"	"72821594"	"72821656"	"="	"0"	"00006"	"ZFHX3_000127"	"g.72821594_72821656="	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[21]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757="	""	"benign"	""
"0000955141"	"11"	"90"	"16"	"72821594"	"72821656"	"repeat"	"0"	"00006"	"ZFHX3_000123"	"g.72821594_72821656GCC[105]"	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[56]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757GCC[105]"	""	"pathogenic (dominant)"	""
"0000955142"	"11"	"10"	"16"	"72821594"	"72821656"	"="	"0"	"00006"	"ZFHX3_000127"	"g.72821594_72821656="	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[21]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757="	""	"benign"	""
"0000955143"	"21"	"10"	"16"	"72821594"	"72821656"	"="	"0"	"00006"	"ZFHX3_000127"	"g.72821594_72821656="	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[21]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757="	""	"benign"	""
"0000955144"	"11"	"10"	"16"	"72821594"	"72821656"	"="	"0"	"00006"	"ZFHX3_000127"	"g.72821594_72821656="	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[21]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757="	""	"benign"	""
"0000955145"	"11"	"10"	"16"	"72821594"	"72821656"	"="	"0"	"00006"	"ZFHX3_000127"	"g.72821594_72821656="	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[21]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757="	""	"benign"	""
"0000955146"	"21"	"10"	"16"	"72821594"	"72821656"	"="	"0"	"00006"	"ZFHX3_000127"	"g.72821594_72821656="	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[21]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757="	""	"benign"	""
"0000955147"	"21"	"10"	"16"	"72821594"	"72821656"	"="	"0"	"00006"	"ZFHX3_000127"	"g.72821594_72821656="	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[21]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757="	""	"benign"	""
"0000955148"	"21"	"10"	"16"	"72821594"	"72821656"	"del"	"0"	"00006"	"ZFHX3_000128"	"g.72821594_72821656delN[9]"	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[18]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757delN[9]"	""	"benign"	""
"0000955149"	"2"	"10"	"16"	"72821594"	"72821656"	"="	"0"	"00006"	"ZFHX3_000127"	"g.72821594_72821656="	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[21]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757="	""	"benign"	""
"0000955150"	"2"	"10"	"16"	"72821594"	"72821656"	"="	"0"	"00006"	"ZFHX3_000127"	"g.72821594_72821656="	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[21]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757="	""	"benign"	""
"0000955151"	"21"	"10"	"16"	"72821594"	"72821656"	"del"	"0"	"00006"	"ZFHX3_000128"	"g.72821594_72821656delN[9]"	""	"{PMID:Wallenius 2024:38035881}, {DOI:Wallenius 2024:10.1016/j.ajhg.2023.11.008}"	""	"rep[18]"	""	"Germline"	""	""	"0"	""	""	"g.72787695_72787757delN[9]"	""	"benign"	""
"0000960092"	"0"	"90"	"16"	"72845138"	"75626026"	"del"	"0"	"00006"	"ZFHX3_000146"	"g.(?_72845138)_(75626026_?)del"	""	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.(?_72811239)_(75592128_?)del"	""	"pathogenic"	""
"0000960093"	"0"	"90"	"16"	"72905761"	"72955667"	"del"	"0"	"00006"	"ZFHX3_000150"	"g.(?_72905761)_(72955667_?)del"	""	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.(?_72871862)_(72921767_?)del"	""	"pathogenic"	""
"0000960094"	"0"	"90"	"16"	"72921364"	"73127669"	"del"	"0"	"00006"	"ZFHX3_000151"	"g.(?_72921364)_(73127669_?)del"	""	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.(?_72887465)_(73093770_?)del"	""	"pathogenic"	""
"0000960095"	"0"	"90"	"16"	"72960445"	"73148126"	""	"0"	"00006"	"ZFHX3_000135"	"g.(?_72960445)_(73148126_?)del"	""	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.(?_72926546)_(73114227_?)del"	""	"pathogenic"	""
"0000960096"	"0"	"70"	"16"	"72993408"	"72993408"	"subst"	"0"	"00006"	"ZFHX3_000154"	"g.72993408G>A"	""	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	""	"ACMG PM2, PVS1_PS, PM6_PP"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.72959509G>A"	""	"likely pathogenic (dominant)"	""
"0000960097"	"0"	"70"	"16"	"72992322"	"72992325"	""	"0"	"00006"	"CRYM_000000"	"g.72992322_72992325del"	""	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	"1722_1725delTGAG"	"ACMG PM2, PVS1_PS, PS2_PP"	"De novo"	""	""	"0"	""	""	"g.72958423_72958426del"	""	"likely pathogenic (dominant)"	""
"0000960098"	"0"	"70"	"16"	"72992268"	"72992268"	"subst"	"0"	"00006"	"ZFHX3_000153"	"g.72992268C>A"	""	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	""	"ACMG PM2, PVS1_PS, PS2_PP"	"De novo"	""	""	"0"	""	""	"g.72958369C>A"	""	"likely pathogenic (dominant)"	""
"0000960099"	"0"	"70"	"16"	"72991861"	"72991861"	""	"0"	"00006"	"CRYM_000000"	"g.72991861G>T"	""	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	""	"ACMG PM2, PVS1_PS, PS2_PP"	"De novo"	""	""	"0"	""	""	"g.72957962G>T"	""	"likely pathogenic (dominant)"	""
"0000960100"	"0"	"70"	"16"	"72991788"	"72991788"	""	"0"	"00006"	"CRYM_000000"	"g.72991788del"	""	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	"2258delA"	"ACMG PM2, PVS1_PS, PS2_PP"	"De novo"	""	""	"0"	""	""	"g.72957889del"	""	"likely pathogenic (dominant)"	""
"0000960101"	"0"	"70"	"16"	"72991764"	"72991764"	"dup"	"0"	"00006"	"ZFHX3_000077"	"g.72991764dup"	""	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	""	"ACMG PM2, PVS1_PS, PS2_PP"	"De novo"	""	""	"0"	""	""	"g.72957865dup"	""	"likely pathogenic (dominant)"	""
"0000960102"	"0"	"70"	"16"	"72984846"	"72984846"	""	"0"	"00006"	"CRYM_000000"	"g.72984846del"	""	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	"2738delT"	"ACMG PM2, PVS1_PS, PS2_PP"	"De novo"	""	""	"0"	""	""	"g.72950947del"	""	"likely pathogenic (dominant)"	""
"0000960103"	"0"	"70"	"16"	"72984708"	"72984708"	""	"0"	"00006"	"CRYM_000000"	"g.72984708del"	""	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	""	"ACMG PM2, PVS1_PS, PS2_PP"	"De novo"	""	""	"0"	""	""	"g.72950809del"	""	"likely pathogenic (dominant)"	""
"0000960104"	"0"	"70"	"16"	"72923723"	"72923723"	"subst"	"0"	"00006"	"ZFHX3_000152"	"g.72923723G>A"	""	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	""	"ACMG PM2, PVS1_PS, PS2_PP"	"De novo"	""	""	"0"	""	""	"g.72889824G>A"	""	"likely pathogenic (dominant)"	""
"0000960105"	"0"	"70"	"16"	"72845839"	"72845839"	"subst"	"0"	"00006"	"ZFHX3_000149"	"g.72845839G>A"	""	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	""	"ACMG PM2, PVS1_PS, PS2_PP"	"De novo"	""	""	"0"	""	""	"g.72811940G>A"	""	"likely pathogenic (dominant)"	""
"0000960106"	"0"	"70"	"16"	"72845607"	"72845607"	"subst"	"0"	"00006"	"ZFHX3_000148"	"g.72845607G>A"	""	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	""	"ACMG PM2, PVS1_PS, PS2_PP"	"De novo"	""	""	"0"	""	""	"g.72811708G>A"	""	"likely pathogenic (dominant)"	""
"0000960107"	"0"	"70"	"16"	"72845578"	"72845578"	"dup"	"0"	"00006"	"ZFHX3_000147"	"g.72845578dup"	""	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	"3766dupC"	"ACMG PM2, PS4_PP, PVS1_PS, PM6_PP"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.72811679dup"	""	"likely pathogenic (dominant)"	""
"0000960108"	"0"	"70"	"16"	"72845578"	"72845578"	"dup"	"0"	"00006"	"ZFHX3_000147"	"g.72845578dup"	""	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	"3766dupC"	"ACMG PM2, PS4_PP, PVS1_PS, PS2_PP"	"De novo"	""	""	"0"	""	""	"g.72811679dup"	""	"likely pathogenic (dominant)"	""
"0000960109"	"0"	"70"	"16"	"72832521"	"72832522"	"del"	"0"	"00006"	"ZFHX3_000145"	"g.72832521_72832522del"	""	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	""	"ACMG PM2, PVS1_PS, PS2_PP"	"De novo"	""	""	"0"	""	""	"g.72798622_72798623del"	""	"likely pathogenic (dominant)"	""
"0000960110"	"0"	"70"	"16"	"72832363"	"72832363"	""	"0"	"00006"	"CRYM_000000"	"g.72832363dup"	""	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	""	"ACMG PM2, PVS1_PS, PS2_PP"	"De novo"	""	""	"0"	""	""	"g.72798464dup"	""	"likely pathogenic (dominant)"	""
"0000960111"	"0"	"70"	"16"	"72832072"	"72832073"	"del"	"0"	"00006"	"ZFHX3_000144"	"g.72832072_72832073del"	""	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	""	"ACMG PM2, PVS1_PS, PS2_PP"	"De novo"	""	""	"0"	""	""	"g.72798173_72798174del"	""	"likely pathogenic (dominant)"	""
"0000960112"	"0"	"70"	"16"	"72830832"	"72830832"	"subst"	"0"	"00006"	"ZFHX3_000143"	"g.72830832C>A"	""	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	""	"ACMG PM2, PVS1_PS, PS2_PP"	"De novo"	""	""	"0"	""	""	"g.72796933C>A"	""	"likely pathogenic (dominant)"	""
"0000960113"	"0"	"70"	"16"	"72830577"	"72830577"	"subst"	"0"	"00006"	"ZFHX3_000142"	"g.72830577G>A"	""	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	""	"ACMG PM2, PVS1_PS, PS2_PP"	"De novo"	""	""	"0"	""	""	"g.72796678G>A"	""	"likely pathogenic (dominant)"	""
"0000960114"	"0"	"70"	"16"	"72830541"	"72830541"	"subst"	"0"	"00006"	"ZFHX3_000141"	"g.72830541G>A"	""	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	""	"ACMG PM2, PVS1_PS, PP1_PM"	"Germline"	""	""	"0"	""	""	"g.72796642G>A"	""	"likely pathogenic (dominant)"	""
"0000960115"	"1"	"70"	"16"	"72829977"	"72829977"	"subst"	"0"	"00006"	"ZFHX3_000140"	"g.72829977G>A"	""	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	""	"ACMG PM2, PVS1_PS, PS2_PP"	"De novo"	"yes"	""	"0"	""	""	"g.72796078G>A"	""	"likely pathogenic (dominant)"	""
"0000960116"	"0"	"70"	"16"	"72829757"	"72829758"	"del"	"0"	"00006"	"ZFHX3_000138"	"g.72829757_72829758del"	""	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	""	"ACMG PM2, PVS1_PS, PS2_PP"	"De novo"	""	""	"0"	""	""	"g.72795858_72795859del"	""	"likely pathogenic (dominant)"	""
"0000960117"	"0"	"70"	"16"	"72828922"	"72828922"	"del"	"0"	"00006"	"ZFHX3_000139"	"g.72828922del"	""	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	""	"ACMG PM2, PVS1_PS, PS2_PP"	"De novo"	""	""	"0"	""	""	"g.72795023del"	""	"likely pathogenic (dominant)"	""
"0000960118"	"0"	"70"	"16"	"72828579"	"72828579"	"subst"	"0"	"00006"	"ZFHX3_000137"	"g.72828579G>A"	""	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	""	"ACMG PM2, PVS1_PS, PM6_PP"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.72794680G>A"	""	"likely pathogenic (dominant)"	""
"0000960119"	"0"	"70"	"16"	"72827880"	"72827880"	"del"	"0"	"00006"	"ZFHX3_000136"	"g.72827880del"	""	"{PMID:Del Rocio Perez Baca 2023:37292950}, {PMID:Del Rocio Perez Baca 2024:38412861}"	""	"8704delT"	"ACMG PM2, PVS1_PS, PM6_PP"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.72793981del"	""	"likely pathogenic (dominant)"	""
"0000968498"	"0"	"30"	"16"	"72821606"	"72821617"	"del"	"0"	"02329"	"ZFHX3_000156"	"g.72821606_72821617del"	""	""	""	"ZFHX3(NM_006885.4):c.10570_10581delGGCGGCGGCGGC (p.G3524_G3527del)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000968499"	"0"	"30"	"16"	"72821612"	"72821617"	"dup"	"0"	"02329"	"ZFHX3_000073"	"g.72821612_72821617dup"	""	""	""	"ZFHX3(NM_006885.4):c.10576_10581dupGGCGGC (p.G3526_G3527dup)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000968501"	"0"	"50"	"16"	"72821615"	"72821617"	"dup"	"0"	"02325"	"ZFHX3_000157"	"g.72821615_72821617dup"	""	""	""	"ZFHX3(NM_006885.4):c.10579_10581dupGGC (p.G3527dup)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000968502"	"0"	"50"	"16"	"72822584"	"72822586"	"dup"	"0"	"01804"	"ZFHX3_000158"	"g.72822584_72822586dup"	""	""	""	"ZFHX3(NM_001164766.1):c.6869_6870insGCA (p.(Gln2290dup))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000968503"	"0"	"50"	"16"	"72822586"	"72822587"	"ins"	"2.05574E-5"	"01804"	"ZFHX3_000159"	"g.72822586_72822587insCT"	""	""	""	"ZFHX3(NM_001164766.1):c.6846_6847insAG (p.(Gln2283SerfsTer45))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000968504"	"0"	"50"	"16"	"72822591"	"72822591"	"subst"	"9.84858E-5"	"01804"	"ZFHX3_000160"	"g.72822591G>A"	""	""	""	"ZFHX3(NM_001164766.1):c.6842C>T (p.(Pro2281Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000968505"	"0"	"50"	"16"	"72822591"	"72822592"	"ins"	"2.05179E-5"	"01804"	"ZFHX3_000161"	"g.72822591_72822592insA"	""	""	""	"ZFHX3(NM_001164766.1):c.6841_6842insT (p.(Pro2281LeufsTer44))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000968506"	"0"	"50"	"16"	"72830205"	"72830205"	"subst"	"0.000533205"	"02325"	"ZFHX3_000162"	"g.72830205C>T"	""	""	""	"ZFHX3(NM_006885.4):c.6376G>A (p.A2126T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000968507"	"0"	"10"	"16"	"72831385"	"72831387"	"dup"	"0"	"02329"	"ZFHX3_000163"	"g.72831385_72831387dup"	""	""	""	"ZFHX3(NM_001386735.1):c.5221_5223dupCAA (p.Q1741dup)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000982046"	"0"	"50"	"16"	"72821187"	"72821187"	"subst"	"0"	"01804"	"ZFHX3_000164"	"g.72821187T>C"	""	""	""	"ZFHX3(NM_006885.4):c.10988A>G (p.(Glu3663Gly))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000982047"	"0"	"50"	"16"	"72821198"	"72821198"	"subst"	"0"	"01804"	"ZFHX3_000165"	"g.72821198G>C"	""	""	""	"ZFHX3(NM_006885.4):c.10977C>G (p.(Asp3659Glu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000982048"	"0"	"50"	"16"	"72821358"	"72821358"	"subst"	"0.000553364"	"02325"	"ZFHX3_000004"	"g.72821358G>T"	""	""	""	"ZFHX3(NM_001164766.1):c.8075C>A (p.(Ser2692Tyr)), ZFHX3(NM_006885.3):c.10817C>A (p.S3606Y), ZFHX3(NM_006885.4):c.10817C>A (p.S3606Y)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000982049"	"0"	"30"	"16"	"72821609"	"72821617"	"del"	"0"	"02325"	"ZFHX3_000005"	"g.72821609_72821617del"	""	""	""	"ZFHX3(NM_006885.3):c.10573_10581delGGCGGCGGC (p.G3525_G3527del), ZFHX3(NM_006885.4):c.10573_10581delGGCGGCGGC (p.G3525_G3527del)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000982050"	"0"	"50"	"16"	"72821612"	"72821617"	"del"	"0"	"01804"	"ZFHX3_000166"	"g.72821612_72821617del"	""	""	""	"ZFHX3(NM_006885.4):c.10576_10581del (p.(Gly3526_Gly3527del))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000982051"	"0"	"50"	"16"	"72821617"	"72821618"	"ins"	"0"	"01804"	"ZFHX3_000167"	"g.72821617_72821618insGCCACCGCC"	""	""	""	"ZFHX3(NM_006885.4):c.10562_10563insTGGCGGCGG (p.(Gly3525_Gly3527dup))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000982052"	"0"	"30"	"16"	"72821652"	"72821657"	"del"	"0"	"01804"	"ZFHX3_000168"	"g.72821652_72821657del"	""	""	""	"ZFHX3(NM_006885.4):c.10527_10532del (p.(Gly3511_Gly3512del))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000982053"	"0"	"50"	"16"	"72821773"	"72821773"	"subst"	"4.93543E-5"	"02325"	"ZFHX3_000169"	"g.72821773G>A"	""	""	""	"ZFHX3(NM_006885.4):c.10402C>T (p.R3468C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000982054"	"0"	"30"	"16"	"72821920"	"72821920"	"subst"	"4.53078E-5"	"01804"	"ZFHX3_000170"	"g.72821920G>T"	""	""	""	"ZFHX3(NM_006885.4):c.10255C>A (p.(Pro3419Thr))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000982055"	"0"	"30"	"16"	"72822023"	"72822025"	"del"	"0"	"01804"	"ZFHX3_000171"	"g.72822023_72822025del"	""	""	""	"ZFHX3(NM_006885.4):c.10164_10166del (p.(Gln3389del))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000982056"	"0"	"30"	"16"	"72822047"	"72822049"	"dup"	"0"	"01804"	"ZFHX3_000172"	"g.72822047_72822049dup"	""	""	""	"ZFHX3(NM_006885.4):c.10139_10141dup (p.(Gln3380dup))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000982057"	"0"	"30"	"16"	"72822149"	"72822149"	"subst"	"6.92786E-5"	"01804"	"ZFHX3_000173"	"g.72822149G>C"	""	""	""	"ZFHX3(NM_006885.4):c.10026C>G (p.(Phe3342Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000982058"	"0"	"50"	"16"	"72822220"	"72822220"	"subst"	"0"	"01804"	"ZFHX3_000174"	"g.72822220A>G"	""	""	""	"ZFHX3(NM_006885.4):c.9955T>C (p.(Tyr3319His))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000982059"	"0"	"50"	"16"	"72822246"	"72822246"	"subst"	"3.25309E-5"	"01804"	"ZFHX3_000175"	"g.72822246T>G"	""	""	""	"ZFHX3(NM_006885.4):c.9929A>C (p.(Tyr3310Ser))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000982060"	"0"	"50"	"16"	"72822584"	"72822586"	"del"	"0"	"01804"	"ZFHX3_000176"	"g.72822584_72822586del"	""	""	""	"ZFHX3(NM_006885.4):c.9609_9611del (p.(Gln3204del))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000982061"	"0"	"50"	"16"	"72822714"	"72822714"	"subst"	"0"	"01804"	"ZFHX3_000177"	"g.72822714A>C"	""	""	""	"ZFHX3(NM_006885.3):c.9461T>G (p.(Leu3154Arg))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000982062"	"0"	"30"	"16"	"72828890"	"72828890"	"subst"	"0.000702612"	"01804"	"ZFHX3_000178"	"g.72828890T>C"	""	""	""	"ZFHX3(NM_006885.4):c.7691A>G (p.(Gln2564Arg))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000982063"	"0"	"30"	"16"	"72831295"	"72831295"	"subst"	"4.15593E-5"	"01804"	"ZFHX3_000179"	"g.72831295T>A"	""	""	""	"ZFHX3(NM_006885.4):c.5286A>T (p.(Gln1762His), p.Q1762H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000982064"	"0"	"50"	"16"	"72831446"	"72831446"	"subst"	"4.06243E-6"	"01804"	"ZFHX3_000180"	"g.72831446C>A"	""	""	""	"ZFHX3(NM_006885.4):c.5135G>T (p.(Arg1712Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000982065"	"0"	"50"	"16"	"72832031"	"72832031"	"subst"	"0.00030468"	"01804"	"ZFHX3_000181"	"g.72832031G>A"	""	""	""	"ZFHX3(NM_006885.4):c.4550C>T (p.(Ser1517Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000982066"	"0"	"30"	"16"	"72832205"	"72832205"	"subst"	"9.34587E-5"	"01804"	"ZFHX3_000182"	"g.72832205T>C"	""	""	""	"ZFHX3(NM_006885.4):c.4376A>G (p.(Asp1459Gly))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000982067"	"0"	"30"	"16"	"72991712"	"72991714"	"dup"	"0"	"01804"	"ZFHX3_000183"	"g.72991712_72991714dup"	""	""	""	"ZFHX3(NM_006885.4):c.2331_2333dup (p.(Ala784dup))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000982068"	"0"	"50"	"16"	"72991715"	"72991717"	"del"	"0"	"01804"	"ZFHX3_000184"	"g.72991715_72991717del"	""	""	""	"ZFHX3(NM_006885.4):c.2330_2332del (p.(Val777del))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000982069"	"0"	"30"	"16"	"72992847"	"72992847"	"subst"	"0.000510659"	"01804"	"ZFHX3_000185"	"g.72992847G>A"	""	""	""	"ZFHX3(NM_006885.4):c.1198C>T (p.(Leu400=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000982070"	"0"	"50"	"16"	"72993018"	"72993018"	"subst"	"4.06088E-6"	"01804"	"ZFHX3_000186"	"g.72993018T>C"	""	""	""	"ZFHX3(NM_006885.4):c.1027A>G (p.(Lys343Glu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001002541"	"0"	"30"	"16"	"72821110"	"72821110"	"subst"	"0.000767874"	"01804"	"ZFHX3_000187"	"g.72821110T>C"	""	""	""	"ZFHX3(NM_006885.3):c.11065A>G (p.(Lys3689Glu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001002542"	"0"	"50"	"16"	"72821151"	"72821151"	"subst"	"1.62435E-5"	"01804"	"ZFHX3_000188"	"g.72821151G>A"	""	""	""	"ZFHX3(NM_006885.3):c.11024C>T (p.(Pro3675Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001002543"	"0"	"50"	"16"	"72821625"	"72821637"	"del"	"0"	"01804"	"ZFHX3_000189"	"g.72821625_72821637del"	""	""	""	"ZFHX3(NM_006885.3):c.10538_10550delGTGGCGGCGGCGG (p.(Ser3513fs))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001002544"	"0"	"30"	"16"	"72821631"	"72821631"	"subst"	"0"	"01804"	"ZFHX3_000190"	"g.72821631C>G"	""	""	""	"ZFHX3(NM_006885.3):c.10544G>C (p.(Gly3515Ala))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001002545"	"0"	"30"	"16"	"72821638"	"72821638"	"subst"	"0"	"01804"	"ZFHX3_000191"	"g.72821638T>C"	""	""	""	"ZFHX3(NM_006885.3):c.10537A>G (p.(Ser3513Gly))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001002546"	"0"	"30"	"16"	"72821820"	"72821820"	"subst"	"8.20621E-6"	"01804"	"ZFHX3_000192"	"g.72821820A>T"	""	""	""	"ZFHX3(NM_006885.3):c.10355T>A (p.(Leu3452His))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001002547"	"0"	"50"	"16"	"72821880"	"72821880"	"subst"	"1.23473E-5"	"01804"	"ZFHX3_000193"	"g.72821880G>A"	""	""	""	"ZFHX3(NM_006885.3):c.10295C>T (p.(Ser3432Phe))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001002548"	"0"	"50"	"16"	"72822083"	"72822091"	"del"	"0"	"01804"	"ZFHX3_000194"	"g.72822083_72822091del"	""	""	""	"ZFHX3(NM_006885.3):c.10089_10097delGTACCAGCA (p.(Tyr3364_Gln3366del))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001002549"	"0"	"50"	"16"	"72822685"	"72822685"	"subst"	"0"	"01804"	"ZFHX3_000195"	"g.72822685G>A"	""	""	""	"ZFHX3(NM_006885.3):c.9490C>T (p.(Leu3164Phe))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001002550"	"0"	"50"	"16"	"72827937"	"72827937"	"subst"	"0"	"01804"	"ZFHX3_000196"	"g.72827937C>T"	""	""	""	"ZFHX3(NM_006885.3):c.8644G>A (p.(Ala2882Thr))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001002551"	"0"	"30"	"16"	"72827984"	"72827984"	"subst"	"2.43661E-5"	"01804"	"ZFHX3_000023"	"g.72827984T>C"	""	""	""	"ZFHX3(NM_006885.3):c.8597A>G (p.K2866R, p.(Lys2866Arg))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001002552"	"0"	"50"	"16"	"72828389"	"72828389"	"subst"	"2.03231E-5"	"01804"	"ZFHX3_000197"	"g.72828389C>T"	""	""	""	"ZFHX3(NM_006885.3):c.8192G>A (p.(Arg2731Gln))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001002553"	"0"	"50"	"16"	"72828683"	"72828683"	"subst"	"0"	"01804"	"ZFHX3_000198"	"g.72828683G>T"	""	""	""	"ZFHX3(NM_006885.3):c.7898C>A (p.(Thr2633Lys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001002554"	"0"	"50"	"16"	"72829008"	"72829008"	"subst"	"0"	"01804"	"ZFHX3_000199"	"g.72829008G>A"	""	""	""	"ZFHX3(NM_006885.3):c.7573C>T (p.(Pro2525Ser))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001002555"	"0"	"50"	"16"	"72829025"	"72829025"	"subst"	"0"	"01804"	"ZFHX3_000200"	"g.72829025T>C"	""	""	""	"ZFHX3(NM_006885.3):c.7556A>G (p.(Gln2519Arg))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001002556"	"0"	"50"	"16"	"72829928"	"72829928"	"subst"	"0"	"01804"	"ZFHX3_000201"	"g.72829928C>T"	""	""	""	"ZFHX3(NM_006885.3):c.6653G>A (p.(Ser2218Asn))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001002557"	"0"	"50"	"16"	"72829973"	"72829973"	"subst"	"4.06128E-6"	"01804"	"ZFHX3_000202"	"g.72829973C>T"	""	""	""	"ZFHX3(NM_006885.3):c.6608G>A (p.(Arg2203His))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001002558"	"0"	"30"	"16"	"72830360"	"72830360"	"subst"	"8.24974E-6"	"01804"	"ZFHX3_000203"	"g.72830360G>C"	""	""	""	"ZFHX3(NM_006885.3):c.6221C>G (p.(Pro2074Arg))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001002559"	"0"	"30"	"16"	"72830370"	"72830370"	"subst"	"4.32627E-6"	"01804"	"ZFHX3_000204"	"g.72830370T>G"	""	""	""	"ZFHX3(NM_006885.3):c.6211A>C (p.(Ile2071Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001002560"	"0"	"50"	"16"	"72830644"	"72830644"	"subst"	"0"	"01804"	"ZFHX3_000205"	"g.72830644G>C"	""	""	""	"ZFHX3(NM_006885.3):c.5937C>G (p.(Asn1979Lys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001002561"	"0"	"30"	"16"	"72831132"	"72831132"	"subst"	"0.00110011"	"01804"	"ZFHX3_000206"	"g.72831132C>A"	""	""	""	"ZFHX3(NM_006885.3):c.5449G>T (p.(Val1817Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001002562"	"0"	"50"	"16"	"72831208"	"72831210"	"dup"	"0"	"01804"	"ZFHX3_000207"	"g.72831208_72831210dup"	""	""	""	"ZFHX3(NM_006885.3):c.5382_5384dupGCA (p.(Gln1794dup))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001002563"	"0"	"50"	"16"	"72831261"	"72831261"	"subst"	"0"	"01804"	"ZFHX3_000208"	"g.72831261G>T"	""	""	""	"ZFHX3(NM_006885.3):c.5320C>A (p.(Pro1774Thr))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001002564"	"0"	"30"	"16"	"72831600"	"72831600"	"subst"	"0"	"01804"	"ZFHX3_000209"	"g.72831600T>C"	""	""	""	"ZFHX3(NM_006885.3):c.4981A>G (p.(Asn1661Asp))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001002565"	"0"	"50"	"16"	"72831834"	"72831834"	"subst"	"1.62592E-5"	"01804"	"ZFHX3_000210"	"g.72831834C>T"	""	""	""	"ZFHX3(NM_006885.3):c.4747G>A (p.(Gly1583Ser))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001002566"	"0"	"50"	"16"	"72832536"	"72832544"	"del"	"0"	"01804"	"ZFHX3_000211"	"g.72832536_72832544del"	""	""	""	"ZFHX3(NM_006885.3):c.4038_4046delATCCCCTGC (p.(Ser1347_Ala1349del))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001002567"	"0"	"50"	"16"	"72845616"	"72845616"	"subst"	"8.13193E-6"	"01804"	"ZFHX3_000212"	"g.72845616C>A"	""	""	""	"ZFHX3(NM_006885.3):c.3724G>T (p.(Ala1242Ser))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001002568"	"0"	"50"	"16"	"72923722"	"72923722"	"subst"	"0"	"01804"	"ZFHX3_000213"	"g.72923722C>T"	""	""	""	"ZFHX3(NM_006885.3):c.3356G>A (p.(Arg1119Gln))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001002569"	"0"	"30"	"16"	"72984481"	"72984481"	"subst"	"9.34033E-5"	"01804"	"ZFHX3_000214"	"g.72984481C>T"	""	""	""	"ZFHX3(NM_006885.3):c.3103G>A (p.(Gly1035Ser))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001002570"	"0"	"30"	"16"	"72991637"	"72991637"	"subst"	"3.67644E-5"	"01804"	"ZFHX3_000215"	"g.72991637G>A"	""	""	""	"ZFHX3(NM_006885.3):c.2408C>T (p.(Thr803Ile)), ZFHX3(NM_006885.4):c.2408C>T (p.T803I)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001002571"	"0"	"50"	"16"	"72991667"	"72991667"	"subst"	"0"	"01804"	"ZFHX3_000216"	"g.72991667G>A"	""	""	""	"ZFHX3(NM_006885.3):c.2378C>T (p.(Pro793Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001002572"	"0"	"50"	"16"	"72991799"	"72991799"	"subst"	"0"	"01804"	"ZFHX3_000217"	"g.72991799T>C"	""	""	""	"ZFHX3(NM_006885.3):c.2246A>G (p.(Lys749Arg))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001002573"	"0"	"30"	"16"	"72992305"	"72992305"	"subst"	"4.06062E-6"	"01804"	"ZFHX3_000218"	"g.72992305A>T"	""	""	""	"ZFHX3(NM_006885.3):c.1740T>A (p.(Asn580Lys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001002574"	"0"	"50"	"16"	"72992319"	"72992319"	"subst"	"4.06095E-5"	"01804"	"ZFHX3_000219"	"g.72992319C>A"	""	""	""	"ZFHX3(NM_006885.3):c.1726G>T (p.(Gly576Cys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001002575"	"0"	"30"	"16"	"72992611"	"72992625"	"dup"	"0"	"01804"	"ZFHX3_000220"	"g.72992611_72992625dup"	""	""	""	"ZFHX3(NM_006885.3):c.1434_1448dupAGAGGAGGAGGAAGA (p.(Glu479_Glu483dup))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001002576"	"0"	"30"	"16"	"72992819"	"72992819"	"subst"	"2.13981E-5"	"01804"	"ZFHX3_000221"	"g.72992819G>A"	""	""	""	"ZFHX3(NM_006885.3):c.1226C>T (p.(Ser409Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001002577"	"0"	"50"	"16"	"72993557"	"72993557"	"subst"	"0"	"01804"	"ZFHX3_000222"	"g.72993557C>T"	""	""	""	"ZFHX3(NM_006885.3):c.488G>A (p.(Ser163Asn))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001002578"	"0"	"50"	"16"	"72993731"	"72993731"	"subst"	"0.000273034"	"01804"	"ZFHX3_000223"	"g.72993731G>A"	""	""	""	"ZFHX3(NM_006885.3):c.314C>T (p.(Pro105Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001002579"	"0"	"50"	"16"	"72993837"	"72993837"	"subst"	"4.45244E-6"	"01804"	"ZFHX3_000224"	"g.72993837G>C"	""	""	""	"ZFHX3(NM_006885.3):c.208C>G (p.(Pro70Ala))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001015426"	"0"	"50"	"16"	"72828129"	"72828129"	"subst"	"0"	"02325"	"ZFHX3_000225"	"g.72828129T>C"	""	""	""	"ZFHX3(NM_006885.4):c.8452A>G (p.M2818V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001015427"	"0"	"50"	"16"	"72831295"	"72831295"	"subst"	"4.15593E-5"	"02325"	"ZFHX3_000179"	"g.72831295T>A"	""	""	""	"ZFHX3(NM_006885.4):c.5286A>T (p.(Gln1762His), p.Q1762H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001015428"	"0"	"50"	"16"	"72991451"	"72991451"	"subst"	"0.000625386"	"02325"	"ZFHX3_000226"	"g.72991451T>C"	""	""	""	"ZFHX3(NM_006885.4):c.2594A>G (p.(Tyr865Cys), p.Y865C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001026758"	"0"	"50"	"16"	"72984595"	"72984595"	"subst"	"0.011513"	"01943"	"ZFHX3_000227"	"g.72984595C>A"	""	""	""	"ZFHX3(NM_006885.3):c.2989G>T (p.A997S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001026759"	"0"	"50"	"16"	"72991637"	"72991637"	"subst"	"3.67644E-5"	"02325"	"ZFHX3_000215"	"g.72991637G>A"	""	""	""	"ZFHX3(NM_006885.3):c.2408C>T (p.(Thr803Ile)), ZFHX3(NM_006885.4):c.2408C>T (p.T803I)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001041335"	"0"	"50"	"16"	"72821609"	"72821617"	"dup"	"0"	"01804"	"ZFHX3_000228"	"g.72821609_72821617dup"	""	""	""	"ZFHX3(NM_006885.4):c.10573_10581dup (p.(Gly3525_Gly3527dup))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001041336"	"0"	"50"	"16"	"72821652"	"72821657"	"dup"	"0"	"01804"	"ZFHX3_000229"	"g.72821652_72821657dup"	""	""	""	"ZFHX3(NM_006885.4):c.10527_10532dup (p.(Gly3511_Gly3512dup))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001041337"	"0"	"30"	"16"	"72827316"	"72827316"	"subst"	"2.84269E-5"	"01804"	"ZFHX3_000230"	"g.72827316C>T"	""	""	""	"ZFHX3(NM_006885.4):c.9265G>A (p.(Glu3089Lys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001041338"	"0"	"30"	"16"	"72828024"	"72828024"	"subst"	"7.30917E-5"	"01804"	"ZFHX3_000231"	"g.72828024C>T"	""	""	""	"ZFHX3(NM_006885.4):c.8557G>A (p.(Ala2853Thr))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001041339"	"0"	"50"	"16"	"72830175"	"72830175"	"subst"	"0"	"01804"	"ZFHX3_000232"	"g.72830175G>A"	""	""	""	"ZFHX3(NM_006885.4):c.6406C>T (p.(Leu2136Phe))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001041340"	"0"	"50"	"16"	"72831381"	"72831382"	"ins"	"0"	"01804"	"ZFHX3_000233"	"g.72831381_72831382insCTGTTG"	""	""	""	"ZFHX3(NM_006885.4):c.5204_5205insGCAACA (p.(Gln1740_Gln1741dup))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001041341"	"0"	"30"	"16"	"72831382"	"72831387"	"dup"	"0"	"01804"	"ZFHX3_000234"	"g.72831382_72831387dup"	""	""	""	"ZFHX3(NM_006885.4):c.5218_5223dup (p.(Gln1740_Gln1741dup))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001041342"	"0"	"30"	"16"	"72923623"	"72923623"	"subst"	"2.05917E-5"	"01804"	"ZFHX3_000235"	"g.72923623C>T"	""	""	""	"ZFHX3(NM_006885.4):c.3448+7G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001041343"	"0"	"30"	"16"	"72991451"	"72991451"	"subst"	"0.000625386"	"01804"	"ZFHX3_000226"	"g.72991451T>C"	""	""	""	"ZFHX3(NM_006885.4):c.2594A>G (p.(Tyr865Cys), p.Y865C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001041344"	"0"	"30"	"16"	"72991763"	"72991763"	"subst"	"0.000164177"	"01804"	"ZFHX3_000236"	"g.72991763C>G"	""	""	""	"ZFHX3(NM_006885.4):c.2282G>C (p.(Gly761Ala))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001041345"	"0"	"30"	"16"	"72991886"	"72991886"	"subst"	"1.629E-5"	"01804"	"ZFHX3_000043"	"g.72991886G>A"	""	""	""	"ZFHX3(NM_006885.3):c.2159C>T (p.T720M), ZFHX3(NM_006885.4):c.2159C>T (p.(Thr720Met))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001041346"	"0"	"30"	"16"	"72992087"	"72992087"	"subst"	"8.13352E-6"	"01804"	"ZFHX3_000237"	"g.72992087C>T"	""	""	""	"ZFHX3(NM_006885.4):c.1958G>A (p.(Arg653His))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001055657"	"0"	"30"	"16"	"72821547"	"72821547"	"subst"	"8.27007E-6"	"01804"	"ZFHX3_000238"	"g.72821547G>C"	""	""	""	"ZFHX3(NM_006885.4):c.10628C>G (p.(Ala3543Gly))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001055658"	"0"	"30"	"16"	"72821709"	"72821709"	"subst"	"3.72643E-5"	"01804"	"ZFHX3_000239"	"g.72821709A>C"	""	""	""	"ZFHX3(NM_006885.4):c.10466T>G (p.(Phe3489Cys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001055659"	"0"	"50"	"16"	"72821916"	"72821916"	"subst"	"4.11455E-6"	"01804"	"ZFHX3_000240"	"g.72821916T>G"	""	""	""	"ZFHX3(NM_006885.4):c.10259A>C (p.(Lys3420Thr))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001055660"	"0"	"50"	"16"	"72827531"	"72827531"	"subst"	"4.87274E-5"	"01804"	"ZFHX3_000241"	"g.72827531G>A"	""	""	""	"ZFHX3(NM_006885.4):c.9050C>T (p.(Thr3017Met))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001055661"	"0"	"70"	"16"	"72828936"	"72828936"	"del"	"0"	"01804"	"ZFHX3_000242"	"g.72828936del"	""	""	""	"ZFHX3(NM_006885.4):c.7645del (p.(Gln2549Serfs*6))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0001055662"	"0"	"30"	"16"	"72831447"	"72831447"	"subst"	"6.4992E-5"	"01804"	"ZFHX3_000243"	"g.72831447G>A"	""	""	""	"ZFHX3(NM_006885.4):c.5134C>T (p.(Arg1712Trp))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001055663"	"0"	"50"	"16"	"72832395"	"72832395"	"subst"	"8.12453E-6"	"01804"	"ZFHX3_000244"	"g.72832395G>A"	""	""	""	"ZFHX3(NM_006885.4):c.4186C>T (p.(Arg1396Cys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001055664"	"0"	"50"	"16"	"72923665"	"72923665"	"subst"	"4.0788E-6"	"01804"	"ZFHX3_000245"	"g.72923665A>T"	""	""	""	"ZFHX3(NM_006885.4):c.3413T>A (p.(Ile1138Asn))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001055665"	"0"	"70"	"16"	"72984851"	"72984851"	"del"	"0"	"01804"	"ZFHX3_000246"	"g.72984851del"	""	""	""	"ZFHX3(NM_006885.4):c.2737del (p.(Leu913*))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0001055666"	"0"	"50"	"16"	"72991457"	"72991457"	"subst"	"0"	"01804"	"ZFHX3_000247"	"g.72991457T>C"	""	""	""	"ZFHX3(NM_006885.4):c.2588A>G (p.(Gln863Arg))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001055667"	"0"	"50"	"16"	"72991551"	"72991551"	"subst"	"8.13676E-6"	"01804"	"ZFHX3_000248"	"g.72991551T>C"	""	""	""	"ZFHX3(NM_006885.4):c.2494A>G (p.(Met832Val))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001055668"	"0"	"30"	"16"	"72993366"	"72993366"	"subst"	"0.000255833"	"01804"	"ZFHX3_000249"	"g.72993366C>T"	""	""	""	"ZFHX3(NM_006885.4):c.679G>A (p.(Val227Ile))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001066531"	"0"	"50"	"16"	"72822741"	"72822741"	"subst"	"3.48582E-5"	"02325"	"ZFHX3_000250"	"g.72822741G>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001066532"	"0"	"50"	"16"	"72830369"	"72830369"	"subst"	"0"	"01804"	"ZFHX3_000251"	"g.72830369A>G"	""	""	""	"ZFHX3(NM_006885.4):c.6212T>C (p.(Ile2071Thr))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001066533"	"0"	"30"	"16"	"72832550"	"72832550"	"subst"	"0.0002403"	"02325"	"ZFHX3_000252"	"g.72832550A>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""


## Variants_On_Transcripts ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Note: Only showing Variants_On_Transcript columns active for Genes ZFHX3
## Count = 272
"{{id}}"	"{{transcriptid}}"	"{{effectid}}"	"{{position_c_start}}"	"{{position_c_start_intron}}"	"{{position_c_end}}"	"{{position_c_end_intron}}"	"{{VariantOnTranscript/DNA}}"	"{{VariantOnTranscript/RNA}}"	"{{VariantOnTranscript/Protein}}"	"{{VariantOnTranscript/Exon}}"	"{{VariantOnTranscript/Haplotype}}"
"0000018000"	"00023135"	"55"	"9606"	"0"	"9611"	"0"	"c.9606_9611del"	"r.(?)"	"p.(Gln3203_Gln3204del)"	"?"	""
"0000018001"	"00023135"	"55"	"3968"	"-6"	"3968"	"-6"	"c.3968-6dup"	"r.(=)"	"p.(=)"	"?"	""
"0000253896"	"00023135"	"10"	"3968"	"-6"	"3968"	"-6"	"c.3968-6del"	"r.(=)"	"p.(=)"	""	""
"0000254300"	"00023135"	"30"	"1869"	"0"	"1869"	"0"	"c.1869T>A"	"r.(?)"	"p.(Ala623=)"	""	""
"0000254501"	"00023135"	"30"	"4464"	"0"	"4464"	"0"	"c.4464T>C"	"r.(?)"	"p.(Ile1488=)"	""	""
"0000254535"	"00023135"	"30"	"948"	"0"	"948"	"0"	"c.948T>C"	"r.(?)"	"p.(Ile316=)"	""	""
"0000320129"	"00023135"	"10"	"10215"	"0"	"10215"	"0"	"c.10215C>G"	"r.(?)"	"p.(Pro3405=)"	""	""
"0000320130"	"00023135"	"50"	"10519"	"0"	"10519"	"0"	"c.10519G>A"	"r.(?)"	"p.(Gly3507Ser)"	""	""
"0000320133"	"00023135"	"10"	"10573"	"0"	"10581"	"0"	"c.10573_10581del"	"r.(?)"	"p.(Gly3525_Gly3527del)"	""	""
"0000320134"	"00023135"	"50"	"10817"	"0"	"10817"	"0"	"c.10817C>A"	"r.(?)"	"p.(Ser3606Tyr)"	""	""
"0000320135"	"00023135"	"30"	"10854"	"0"	"10854"	"0"	"c.10854G>C"	"r.(?)"	"p.(Pro3618=)"	""	""
"0000320136"	"00023135"	"50"	"1413"	"0"	"1417"	"0"	"c.1413_1417del"	"r.(?)"	"p.(Ala472GlyfsTer28)"	""	""
"0000320137"	"00023135"	"50"	"2114"	"0"	"2114"	"0"	"c.2114A>G"	"r.(?)"	"p.(Lys705Arg)"	""	""
"0000320138"	"00023135"	"50"	"2159"	"0"	"2159"	"0"	"c.2159C>T"	"r.(?)"	"p.(Thr720Met)"	""	""
"0000320139"	"00023135"	"30"	"2328"	"0"	"2348"	"0"	"c.2328_2348del"	"r.(?)"	"p.(Val777_Ala783del)"	""	""
"0000320140"	"00023135"	"10"	"246"	"0"	"246"	"0"	"c.246C>T"	"r.(?)"	"p.(Asn82=)"	""	""
"0000320141"	"00023135"	"30"	"3378"	"0"	"3378"	"0"	"c.3378G>A"	"r.(?)"	"p.(Lys1126=)"	""	""
"0000320142"	"00023135"	"50"	"3526"	"0"	"3526"	"0"	"c.3526G>A"	"r.(?)"	"p.(Gly1176Arg)"	""	""
"0000320145"	"00023135"	"30"	"465"	"0"	"465"	"0"	"c.465C>T"	"r.(?)"	"p.(Gly155=)"	""	""
"0000320146"	"00023135"	"50"	"6421"	"0"	"6421"	"0"	"c.6421C>T"	"r.(?)"	"p.(Leu2141Phe)"	""	""
"0000320147"	"00023135"	"30"	"7113"	"0"	"7113"	"0"	"c.7113C>T"	"r.(?)"	"p.(Ala2371=)"	""	""
"0000320148"	"00023135"	"10"	"8277"	"0"	"8277"	"0"	"c.8277G>T"	"r.(?)"	"p.(Gln2759His)"	""	""
"0000320149"	"00023135"	"10"	"8316"	"0"	"8316"	"0"	"c.8316C>T"	"r.(?)"	"p.(His2772=)"	""	""
"0000320150"	"00023135"	"30"	"8597"	"0"	"8597"	"0"	"c.8597A>G"	"r.(?)"	"p.(Lys2866Arg)"	""	""
"0000320151"	"00023135"	"50"	"8707"	"0"	"8707"	"0"	"c.8707A>G"	"r.(?)"	"p.(Ser2903Gly)"	""	""
"0000320152"	"00023135"	"50"	"8992"	"0"	"8992"	"0"	"c.8992C>T"	"r.(?)"	"p.(Arg2998Trp)"	""	""
"0000320153"	"00023135"	"10"	"9530"	"0"	"9530"	"0"	"c.9530C>T"	"r.(?)"	"p.(Ser3177Leu)"	""	""
"0000320154"	"00023135"	"50"	"9704"	"0"	"9704"	"0"	"c.9704A>G"	"r.(?)"	"p.(Lys3235Arg)"	""	""
"0000320155"	"00023135"	"30"	"9783"	"0"	"9783"	"0"	"c.9783A>G"	"r.(?)"	"p.(Lys3261=)"	""	""
"0000324886"	"00023135"	"30"	"10817"	"0"	"10817"	"0"	"c.10817C>A"	"r.(?)"	"p.(Ser3606Tyr)"	""	""
"0000324887"	"00023135"	"50"	"10557"	"0"	"10574"	"0"	"c.10557_10574del"	"r.(?)"	"p.(Gly3522_Gly3527del)"	""	""
"0000324888"	"00023135"	"50"	"10557"	"0"	"10571"	"0"	"c.10557_10571del"	"r.(?)"	"p.(Gly3523_Gly3527del)"	""	""
"0000324889"	"00023135"	"50"	"10557"	"0"	"10559"	"0"	"c.10557_10559del"	"r.(?)"	"p.(Gly3527del)"	""	""
"0000324890"	"00023135"	"50"	"10554"	"0"	"10556"	"0"	"c.10554_10556del"	"r.(?)"	"p.(Gly3527del)"	""	""
"0000324892"	"00023135"	"50"	"10369"	"0"	"10369"	"0"	"c.10369A>G"	"r.(?)"	"p.(Ile3457Val)"	""	""
"0000324893"	"00023135"	"50"	"10166"	"0"	"10186"	"0"	"c.10166_10186del"	"r.(?)"	"p.(Gln3389_Gln3395del)"	""	""
"0000324894"	"00023135"	"50"	"9895"	"0"	"9895"	"0"	"c.9895C>T"	"r.(?)"	"p.(Pro3299Ser)"	""	""
"0000324895"	"00023135"	"50"	"9824"	"0"	"9824"	"0"	"c.9824C>T"	"r.(?)"	"p.(Pro3275Leu)"	""	""
"0000324896"	"00023135"	"50"	"5087"	"0"	"5087"	"0"	"c.5087del"	"r.(?)"	"p.(Pro1696LeufsTer23)"	""	""
"0000324898"	"00023135"	"30"	"3757"	"0"	"3757"	"0"	"c.3757C>T"	"r.(?)"	"p.(Arg1253Cys)"	""	""
"0000324899"	"00023135"	"50"	"2923"	"0"	"2923"	"0"	"c.2923G>T"	"r.(?)"	"p.(Glu975Ter)"	""	""
"0000324900"	"00023135"	"30"	"2845"	"0"	"2845"	"0"	"c.2845G>A"	"r.(?)"	"p.(Val949Ile)"	""	""
"0000324901"	"00023135"	"50"	"2650"	"0"	"2650"	"0"	"c.2650G>C"	"r.(?)"	"p.(Ala884Pro)"	""	""
"0000324902"	"00023135"	"50"	"2346"	"0"	"2348"	"0"	"c.2346_2348dup"	"r.(?)"	"p.(Ala784dup)"	""	""
"0000324903"	"00023135"	"50"	"2160"	"0"	"2160"	"0"	"c.2160G>A"	"r.(?)"	"p.(Thr720=)"	""	""
"0000324904"	"00023135"	"50"	"1443"	"0"	"1445"	"0"	"c.1443_1445dup"	"r.(?)"	"p.(Glu487dup)"	""	""
"0000339171"	"00023135"	"50"	"4645"	"0"	"4645"	"0"	"c.4645G>A"	"r.(?)"	"p.(Val1549Ile)"	""	""
"0000559072"	"00023135"	"50"	"10931"	"0"	"10931"	"0"	"c.10931G>T"	"r.(?)"	"p.(Ser3644Ile)"	""	""
"0000559076"	"00023135"	"50"	"10557"	"0"	"10559"	"0"	"c.10557_10559dup"	"r.(?)"	"p.(Gly3527dup)"	""	""
"0000559078"	"00023135"	"10"	"10551"	"0"	"10556"	"0"	"c.10551_10556dup"	"r.(?)"	"p.(Gly3526_Gly3527dup)"	""	""
"0000559079"	"00023135"	"30"	"9459"	"0"	"9459"	"0"	"c.9459T>C"	"r.(?)"	"p.(Gly3153=)"	""	""
"0000559080"	"00023135"	"30"	"8302"	"0"	"8302"	"0"	"c.8302A>T"	"r.(?)"	"p.(Thr2768Ser)"	""	""
"0000559082"	"00023135"	"30"	"4761"	"0"	"4761"	"0"	"c.4761C>G"	"r.(?)"	"p.(Pro1587=)"	""	""
"0000559083"	"00023135"	"30"	"3968"	"-7"	"3968"	"-6"	"c.3968-7_3968-6dup"	"r.(=)"	"p.(=)"	""	""
"0000559086"	"00023135"	"10"	"3968"	"-6"	"3968"	"-6"	"c.3968-6dup"	"r.(=)"	"p.(=)"	""	""
"0000559087"	"00023135"	"50"	"3367"	"0"	"3367"	"0"	"c.3367C>T"	"r.(?)"	"p.(Arg1123Trp)"	""	""
"0000559088"	"00023135"	"50"	"2793"	"0"	"2793"	"0"	"c.2793C>T"	"r.(?)"	"p.(Gly931=)"	""	""
"0000559091"	"00023135"	"50"	"2324"	"0"	"2324"	"0"	"c.2324C>T"	"r.(?)"	"p.(Ala775Val)"	""	""
"0000559093"	"00023135"	"30"	"198"	"0"	"198"	"0"	"c.198G>A"	"r.(?)"	"p.(Ala66=)"	""	""
"0000616123"	"00023135"	"30"	"7950"	"0"	"7950"	"0"	"c.7950G>A"	"r.(?)"	"p.(Pro2650=)"	""	""
"0000616124"	"00023135"	"30"	"5785"	"0"	"5785"	"0"	"c.5785C>A"	"r.(?)"	"p.(Pro1929Thr)"	""	""
"0000623523"	"00023135"	"30"	"10576"	"0"	"10581"	"0"	"c.10576_10581dup"	"r.(?)"	"p.(Gly3526_Gly3527dup)"	""	""
"0000626567"	"00023135"	"50"	"6685"	"0"	"6685"	"0"	"c.6685C>G"	"r.(?)"	"p.(Pro2229Ala)"	""	""
"0000657929"	"00023135"	"50"	"2288"	"0"	"2288"	"0"	"c.2288dup"	"r.(?)"	"p.(Gln764AlafsTer25)"	""	""
"0000680653"	"00023135"	"10"	"10533"	"0"	"10535"	"0"	"c.10533_10535del"	"r.(?)"	"p.(Gly3512del)"	""	""
"0000680654"	"00023135"	"30"	"9807"	"0"	"9807"	"0"	"c.9807A>G"	"r.(?)"	"p.(Ala3269=)"	""	""
"0000680655"	"00023135"	"30"	"337"	"0"	"337"	"0"	"c.337G>A"	"r.(?)"	"p.(Ala113Thr)"	""	""
"0000692130"	"00023135"	"50"	"2287"	"0"	"2287"	"0"	"c.2287dup"	"r.(?)"	"p.(Glu763GlyfsTer26)"	""	""
"0000725956"	"00023135"	"50"	"6184"	"0"	"6184"	"0"	"c.6184C>G"	"r.(?)"	"p.(Pro2062Ala)"	""	""
"0000725957"	"00023135"	"50"	"4593"	"0"	"4593"	"0"	"c.4593C>G"	"r.(?)"	"p.(Pro1531=)"	""	""
"0000807583"	"00023135"	"30"	"2382"	"0"	"2382"	"0"	"c.2382G>A"	"r.(?)"	"p.(Ser794=)"	""	""
"0000807584"	"00023135"	"30"	"21"	"0"	"21"	"0"	"c.21C>T"	"r.(?)"	"p.(Pro7=)"	""	""
"0000854631"	"00023135"	"30"	"8992"	"0"	"8992"	"0"	"c.8992C>A"	"r.(?)"	"p.(Arg2998=)"	""	""
"0000854632"	"00023135"	"30"	"186"	"0"	"186"	"0"	"c.186G>A"	"r.(?)"	"p.(Ala62=)"	""	""
"0000864929"	"00023135"	"50"	"3748"	"0"	"3748"	"0"	"c.3748C>T"	"r.(?)"	"p.(Pro1250Ser)"	""	""
"0000869438"	"00023135"	"90"	"0"	"0"	"0"	"0"	"c.(?_-49-1)_*4279{0}"	"r.0"	"p.0"	"_2_10_"	""
"0000869439"	"00023135"	"90"	"0"	"0"	"0"	"0"	"c.-673_*4279{0}"	"r.0"	"p.0"	"_1_10_"	""
"0000869440"	"00023135"	"90"	"0"	"0"	"0"	"0"	"c.-673_*4279{0}"	"r.0"	"p.0"	"_1_10_"	""
"0000869441"	"00023135"	"90"	"0"	"0"	"0"	"0"	"c.-673_*4279{0}"	"r.0"	"p.0"	"_1_10_"	""
"0000869442"	"00023135"	"90"	"0"	"0"	"0"	"0"	"c.-673_*4279{0}"	"r.0?"	"p.0?"	"_1_10_"	""
"0000869443"	"00023135"	"90"	"0"	"0"	"0"	"0"	"c.(3216+1_3217-1)_*4279{0}"	"r.0?"	"p.0?"	"3i_10_"	""
"0000869444"	"00023135"	"90"	"0"	"0"	"0"	"0"	"c.(3448+1_3449-1)_*4279{0}"	"r.?"	"p.?"	"4i_10_"	""
"0000869445"	"00023135"	"90"	"0"	"0"	"0"	"0"	"c.(3216+1_3217-1)_*4279{0}"	"r.?"	"p.?"	"3i_10_"	""
"0000869446"	"00023135"	"90"	"0"	"0"	"0"	"0"	"c.(3448+1_3449-1)_*4279{0}"	"r.?"	"p.?"	"4i_10_"	""
"0000869447"	"00023135"	"90"	"0"	"0"	"0"	"0"	"c.(3216+1_3217-1)_*4279{0}"	"r.?"	"p.?"	"3i_10_"	""
"0000869448"	"00023135"	"90"	"0"	"0"	"0"	"0"	"c.(3448+1_3449-1)_*4279{0}"	"r.?"	"p.?"	"4i_10_"	""
"0000869449"	"00023135"	"90"	"3217"	"-1"	"9427"	"1"	"c.(3216+1_3217-1)_(9427+1_9428-1)del"	"r.?"	"p.?"	"3i_9i"	""
"0000869450"	"00023135"	"90"	"-49"	"-1"	"9427"	"1"	"c.(-50+1_-49-1)_(9427+1_9428-1)del"	"r.?"	"p.?"	"_2_10_"	""
"0000869451"	"00023135"	"90"	"0"	"0"	"0"	"0"	"c.(3448+1_3449-1)_(3967+1_3968-1){0}"	"r.?"	"p.?"	"4i_9_"	""
"0000914686"	"00023135"	"50"	"10142"	"0"	"10165"	"0"	"c.10142_10165del"	"r.(?)"	"p.(Arg3381_Gln3388del)"	""	""
"0000950726"	"00023135"	"30"	"10542"	"0"	"10543"	"0"	"c.10542_10543insAGT"	"r.(?)"	"p.(Gly3514_Gly3515insSer)"	""	""
"0000950727"	"00023135"	"70"	"4197"	"0"	"4197"	"0"	"c.4197C>G"	"r.(?)"	"p.(Tyr1399*)"	""	""
"0000955105"	"00023135"	"10"	"10519"	"0"	"10581"	"0"	"c.10519_10581GGC[4]GGTGGCAGT[1]GGC[5]GGT[1]GGC[8]"	"r.(?)"	"p.?"	"10"	"21-GGC[4]GGTGGCAGT[1]GGC[5]GGT[1]GGC[8]"
"0000955106"	"00023135"	"10"	"10519"	"0"	"10581"	"0"	"c.10519_10581GGC[4]GGTGGCAGT[1]GGC[2]GAC[1]GGC[2]GGT[1]GGC[8]"	"r.(?)"	"p.?"	"10"	"21-GGC[4]GGTGGCAGT[1]GGC[2]GAC[1]GGC[2]GGT[1]GGC[8]"
"0000955107"	"00023135"	"10"	"10519"	"0"	"10581"	"0"	"c.10519_10581GGC[4]GGTGGCAGT[1]GGC[5]GGT[1]GGC[9]"	"r.(?)"	"p.?"	"10"	"22-GGC[4]GGTGGCAGT[1]GGC[5]GGT[1]GGC[9]"
"0000955108"	"00023135"	"10"	"10519"	"0"	"10581"	"0"	"c.10519_10581GGC[4]GGTGGCAGT[1]GGC[5]GGT[1]GGC[5]"	"r.(?)"	"p.?"	"10"	"18-GGC[4]GGTGGCAGT[1]GGC[5]GGT[1]GGC[5]"
"0000955109"	"00023135"	"10"	"10519"	"0"	"10581"	"0"	"c.10519_10581GGC[4]GGTGGCAGT[1]GGC[5]GGT[1]GGC[10]"	"r.(?)"	"p.?"	"10"	"23-GGC[4]GGTGGCAGT[1]GGC[5]GGT[1]GGC[10]"
"0000955110"	"00023135"	"10"	"10519"	"0"	"10581"	"0"	"c.10519_10581GGC[4]GGTGGCAGT[1]GGC[14]"	"r.(?)"	"p.?"	"10"	"21-GGC[4]GGTGGCAGT[1]GGC[14]"
"0000955111"	"00023135"	"10"	"10519"	"0"	"10581"	"0"	"c.10519_10581CGC[1]GGC[3]GGTGGCAGT[1]GGC[5]GGT[1]GGC[8]"	"r.(?)"	"p.?"	"10"	"21-CGC[1]GGC[3]GGTGGCAGT[1]GGC[5]GGT[1]GGC[8]"
"0000955112"	"00023135"	"10"	"10519"	"0"	"10581"	"0"	"c.10519_10581GGC[5]AGT[1]GGC[5]GGT[1]GGC[8]"	"r.(?)"	"p.?"	"10"	"20-GGC[5]AGT[1]GGC[5]GGT[1]GGC[8]"
"0000955113"	"00023135"	"10"	"10519"	"0"	"10581"	"0"	"c.10519_10581GGC[4]GGTGGCAGT[1]GGC[12]"	"r.(?)"	"p.?"	"10"	"19-GGC[4]GGTGGCAGT[1]GGC[12]"
"0000955114"	"00023135"	"10"	"10519"	"0"	"10581"	"0"	"c.10519_10581GGC[4]GGTGGCAGT[1]GGC[4]GGT[1]GGC[8]"	"r.(?)"	"p.?"	"10"	"20-GGC[4]GGTGGCAGT[1]GGC[4]GGT[1]GGC[8]"
"0000955115"	"00023135"	"10"	"10519"	"0"	"10581"	"0"	"c.10519_10581GGC[4]GGTGGCAGT[1]GGC[11]"	"r.(?)"	"p.?"	"10"	"18-GGC[4]GGTGGCAGT[1]GGC[11]"
"0000955116"	"00023135"	"10"	"10519"	"0"	"10581"	"0"	"c.10519_10581GGC[5]AGT[1]GGC[3]GGT[1]GGC[8]"	"r.(?)"	"p.?"	"10"	"18-GGC[5]AGT[1]GGC[3]GGT[1]GGC[8]"
"0000955117"	"00023135"	"10"	"10519"	"0"	"10581"	"0"	"c.10519_10581GGC[7]GGT[1]GGC[8]"	"r.(?)"	"p.?"	"10"	"16-GGC[7]GGT[1]GGC[8]"
"0000955118"	"00023135"	"10"	"10519"	"0"	"10581"	"0"	"c.10519_10581GGC[4]GGT[1]GGCAGT[2]GGC[5]GGT[1]GGC[8]"	"r.(?)"	"p.?"	"10"	"23-GGC[4]GGT[1]GGCAGT[2]GGC[5]GGT[1]GGC[8]"
"0000955119"	"00023135"	"10"	"10519"	"0"	"10581"	"0"	"c.10519_10581GGC[4]GGTGGCAGT[1]GGC[5]GGT[1]GGC[8]GGT[5]"	"r.(?)"	"p.?"	"10"	"26-GGC[4]GGTGGCAGT[1]GGC[5]GGT[1]GGC[8]GGT[5]"
"0000955120"	"00023135"	"10"	"10519"	"0"	"10581"	"0"	"c.10519_10581GGC[4]GGTGGCGGT[1]GGC[5]GGT[1]GGC[8]"	"r.(?)"	"p.?"	"10"	"21-GGC[4]GGTGGCGGT[1]GGC[5]GGT[1]GGC[8]"
"0000955121"	"00023135"	"10"	"10519"	"0"	"10581"	"0"	"c.10519_10581GGC[4]GGTGGCAGT[1]GGC[7]"	"r.(?)"	"p.?"	"10"	"14-GGC[4]GGTGGCAGT[1]GGC[7]"
"0000955122"	"00023135"	"10"	"10519"	"0"	"10581"	"0"	"c.10519_10581GGC[4]GGTGGCAGT[1]GGC[5]GGT[1]GGC[7]"	"r.(?)"	"p.?"	"10"	"20-GGC[4]GGTGGCAGT[1]GGC[5]GGT[1]GGC[7]"
"0000955123"	"00023135"	"10"	"10519"	"0"	"10581"	"0"	"c.10519_10581GGC[5]GGT[1]GGC[8]"	"r.(?)"	"p.?"	"10"	"14-GGC[5]GGT[1]GGC[8]"
"0000955124"	"00023135"	"10"	"10519"	"0"	"10581"	"0"	"c.10519_10581GGC[6]AGT[1]GGC[5]GGT[1]GGC[8]"	"r.(?)"	"p.?"	"10"	"21-GGC[6]AGT[1]GGC[5]GGT[1]GGC[8]"
"0000955125"	"00023135"	"10"	"10519"	"0"	"10581"	"0"	"c.10519_10581CGC[1]GGC[3]GGTGGCAGT[1]GGC[5]GGT[1]GGC[10]"	"r.(?)"	"p.?"	"10"	"23-CGC[1]GGC[3]GGTGGCAGT[1]GGC[5]GGT[1]GGC[10]"
"0000955126"	"00023135"	"10"	"10519"	"0"	"10581"	"0"	"c.10519_10581GGC[6]GGTGGCAGT[1]GGC[5]GGT[1]GGC[8]"	"r.(?)"	"p.?"	"10"	"23-GGC[6]GGTGGCAGT[1]GGC[5]GGT[1]GGC[8]"
"0000955127"	"00023135"	"10"	"10519"	"0"	"10581"	"0"	"c.10519_10581GGC[3]GGTGGCAGT[1]GGC[5]GGT[1]GGC[8]"	"r.(?)"	"p.?"	"10"	"20-GGC[3]GGTGGCAGT[1]GGC[5]GGT[1]GGC[8]"
"0000955128"	"00023135"	"10"	"10519"	"0"	"10581"	"0"	"c.10519_10581GGC[4]GGTGGCAGT[1]GGC[2]GAC[1]GGC[2]GGT[1]GGC[7]"	"r.(?)"	"p.?"	"10"	"20-GGC[4]GGTGGCAGT[1]GGC[2]GAC[1]GGC[2]GGT[1]GGC[7]"
"0000955129"	"00023135"	"10"	"10519"	"0"	"10581"	"0"	"c.10519_10581GGC[4]GGTGGCAGT[1]GGC[5]GGT[1]GGC[6]"	"r.(?)"	"p.?"	"10"	"19-GGC[4]GGTGGCAGT[1]GGC[5]GGT[1]GGC[6]"
"0000955130"	"00023135"	"10"	"10519"	"0"	"10581"	"0"	"c.10519_10581GGC[6]GGT[1]GGC[16]"	"r.(?)"	"p.?"	"10"	"23-GGC[6]GGT[1]GGC[16]"
"0000955131"	"00023135"	"10"	"10519"	"0"	"10581"	"0"	"c.10519_10581GGC[6]GGT[1]GGC[15]"	"r.(?)"	"p.?"	"10"	"22-GGC[6]GGT[1]GGC[15]"
"0000955132"	"00023135"	"90"	"10519"	"0"	"10581"	"0"	"c.10519_10581GGC[57]"	"r.?"	"p.(Gly3507_Gly3527insX[36])"	"10"	"57-GGC[57]"
"0000955133"	"00023135"	"90"	"10519"	"0"	"10581"	"0"	"c.10519_10581GGC[72]"	"r.?"	"p.(Gly3507_Gly3527insX[51])"	"10"	"72-GGC[72]"
"0000955134"	"00023135"	"90"	"10519"	"0"	"10581"	"0"	"c.10519_10581GGC[46]"	"r.?"	"p.(Gly3507_Gly3527insX[25])"	"10"	"46-GGC[46]"
"0000955135"	"00023135"	"90"	"10519"	"0"	"10581"	"0"	"c.10519_10581GGC[56]"	"r.?"	"p.(Gly3507_Gly3527insX[35])"	"10"	"56-GGC[56]"
"0000955136"	"00023135"	"90"	"10519"	"0"	"10581"	"0"	"c.10519_10581GGC[59]"	"r.?"	"p.(Gly3507_Gly3527insX[38])"	"10"	"59-GGC[59]"
"0000955137"	"00023135"	"90"	"10519"	"0"	"10581"	"0"	"c.10519_10581GGC[42]"	"r.?"	"p.(Gly3507_Gly3527insX[21])"	"10"	"42-GGC[42]"
"0000955138"	"00023135"	"90"	"10519"	"0"	"10581"	"0"	"c.10519_10581GGC[74]"	"r.?"	"p.(Gly3507_Gly3527insX[53])"	"10"	"74-GGC[74]"
"0000955139"	"00023135"	"10"	"10519"	"0"	"10581"	"0"	"c.10519_10581="	"r.(=)"	"p.(=)"	"10"	"21"
"0000955140"	"00023135"	"10"	"10519"	"0"	"10581"	"0"	"c.10519_10581="	"r.(=)"	"p.(=)"	"10"	"21"
"0000955141"	"00023135"	"90"	"10519"	"0"	"10581"	"0"	"c.10519_10581GGC[56]"	"r.?"	"p.(Gly3507_Gly3527insX[35])"	"10"	"56-GGC[56]"
"0000955142"	"00023135"	"10"	"10519"	"0"	"10581"	"0"	"c.10519_10581="	"r.(=)"	"p.(=)"	"10"	"21"
"0000955143"	"00023135"	"10"	"10519"	"0"	"10581"	"0"	"c.10519_10581="	"r.(=)"	"p.(=)"	"10"	"21"
"0000955144"	"00023135"	"10"	"10519"	"0"	"10581"	"0"	"c.10519_10581="	"r.(=)"	"p.(=)"	"10"	"21"
"0000955145"	"00023135"	"10"	"10519"	"0"	"10581"	"0"	"c.10519_10581="	"r.(=)"	"p.(=)"	"10"	"21"
"0000955146"	"00023135"	"10"	"10519"	"0"	"10581"	"0"	"c.10519_10581="	"r.(=)"	"p.(=)"	"10"	"21"
"0000955147"	"00023135"	"10"	"10519"	"0"	"10581"	"0"	"c.10519_10581="	"r.(=)"	"p.(=)"	"10"	"21"
"0000955148"	"00023135"	"10"	"10519"	"0"	"10581"	"0"	"c.10519_10581delN[9]"	"r.(?)"	"p.(Gly3507_Gly3527delX[3])"	"10"	"18"
"0000955149"	"00023135"	"10"	"10519"	"0"	"10581"	"0"	"c.10519_10581="	"r.(=)"	"p.(=)"	"10"	"21"
"0000955150"	"00023135"	"10"	"10519"	"0"	"10581"	"0"	"c.10519_10581="	"r.(=)"	"p.(=)"	"10"	"21"
"0000955151"	"00023135"	"10"	"10519"	"0"	"10581"	"0"	"c.10519_10581delN[9]"	"r.(?)"	"p.(Gly3507_Gly3527delX[3])"	"10"	"18"
"0000960092"	"00023135"	"90"	"0"	"0"	"0"	"0"	"c.-673_(3864+1_3865-1){0}"	"r.?"	"p.?"	"_1_7i"	""
"0000960093"	"00023135"	"90"	"0"	"0"	"0"	"0"	"c.(3216+1_3217-1)_(3448+1_3449-1){0}"	"r.?"	"p.?"	"3i_4i"	""
"0000960094"	"00023135"	"90"	"0"	"0"	"0"	"0"	"c.-673_(3448+1_3449-1){0}"	"r.0"	"p.0"	"_1_4i"	""
"0000960095"	"00023135"	"90"	"0"	"0"	"0"	"0"	"c.-673_(3216+1_3217-1){0}"	"r.0"	"p.0"	"_1_3i"	""
"0000960096"	"00023135"	"70"	"637"	"0"	"637"	"0"	"c.637C>T"	"r.(?)"	"p.(Gln213Ter)"	"2"	""
"0000960097"	"00023135"	"70"	"1722"	"0"	"1725"	"0"	"c.1722_1725del"	"r.(?)"	"p.(Ser574ArgfsTer85)"	"2"	""
"0000960098"	"00023135"	"70"	"1777"	"0"	"1777"	"0"	"c.1777G>T"	"r.(?)"	"p.(Glu593Ter)"	"2"	""
"0000960099"	"00023135"	"70"	"2184"	"0"	"2184"	"0"	"c.2184C>A"	"r.(?)"	"p.(Cys728Ter)"	"2"	""
"0000960100"	"00023135"	"70"	"2258"	"0"	"2258"	"0"	"c.2258del"	"r.(?)"	"p.(Asn753ThrfsTer71)"	"2"	""
"0000960101"	"00023135"	"70"	"2287"	"0"	"2287"	"0"	"c.2287dup"	"r.(?)"	"p.(Glu763GlyfsTer26)"	"2"	""
"0000960102"	"00023135"	"70"	"2738"	"0"	"2738"	"0"	"c.2738del"	"r.(?)"	"p.(Leu913GlnfsTer15)"	"3"	""
"0000960103"	"00023135"	"70"	"2876"	"0"	"2876"	"0"	"c.2876del"	"r.(?)"	"p.(Asp959AlafsTer7)"	"3"	""
"0000960104"	"00023135"	"70"	"3355"	"0"	"3355"	"0"	"c.3355C>T"	"r.(?)"	"p.(Arg1119Ter)"	"4"	""
"0000960105"	"00023135"	"70"	"3628"	"0"	"3628"	"0"	"c.3628C>T"	"r.(?)"	"p.(Arg1210Ter)"	"6"	""
"0000960106"	"00023135"	"70"	"3733"	"0"	"3733"	"0"	"c.3733C>T"	"r.(?)"	"p.(Gln1245Ter)"	"7"	""
"0000960107"	"00023135"	"70"	"3766"	"0"	"3766"	"0"	"c.3766dup"	"r.(?)"	"p.(Leu1256ProfsTer25)"	"7"	""
"0000960108"	"00023135"	"70"	"3766"	"0"	"3766"	"0"	"c.3766dup"	"r.(?)"	"p.(Leu1256ProfsTer25)"	"7"	""
"0000960109"	"00023135"	"70"	"4061"	"0"	"4062"	"0"	"c.4061_4062del"	"r.(?)"	"p.(Val1354GlufsTer28)"	"9"	""
"0000960110"	"00023135"	"70"	"4218"	"0"	"4218"	"0"	"c.4218dup"	"r.(?)"	"p.(Ser1407Ter)"	"9"	""
"0000960111"	"00023135"	"70"	"4510"	"0"	"4511"	"0"	"c.4510_4511del"	"r.(?)"	"p.(Ser1504ProfsTer5)"	"9"	""
"0000960112"	"00023135"	"70"	"5749"	"0"	"5749"	"0"	"c.5749G>T"	"r.(?)"	"p.(Glu1917Ter)"	"9"	""
"0000960113"	"00023135"	"70"	"6004"	"0"	"6004"	"0"	"c.6004C>T"	"r.(?)"	"p.(Gln2002Ter)"	"9"	""
"0000960114"	"00023135"	"70"	"6040"	"0"	"6040"	"0"	"c.6040C>T"	"r.(?)"	"p.(Gln2014Ter)"	"9"	""
"0000960115"	"00023135"	"70"	"6604"	"0"	"6604"	"0"	"c.6604C>T"	"r.(?)"	"p.(Gln2202Ter)"	"9"	""
"0000960116"	"00023135"	"70"	"6827"	"0"	"6828"	"0"	"c.6827_6828del"	"r.(?)"	"p.(Ser2276Ter)"	"9"	""
"0000960117"	"00023135"	"70"	"7660"	"0"	"7660"	"0"	"c.7660del"	"r.(?)"	"p.(Leu2554Ter)"	"9"	""
"0000960118"	"00023135"	"70"	"8002"	"0"	"8002"	"0"	"c.8002C>T"	"r.(?)"	"p.(Arg2668Ter)"	"9"	""
"0000960119"	"00023135"	"70"	"8704"	"0"	"8704"	"0"	"c.8704del"	"r.(?)"	"p.(Tyr2902IlefsTer52)"	"9"	""
"0000968498"	"00023135"	"30"	"10570"	"0"	"10581"	"0"	"c.10570_10581del"	"r.(?)"	"p.(Gly3524_Gly3527del)"	""	""
"0000968499"	"00023135"	"30"	"10576"	"0"	"10581"	"0"	"c.10576_10581dup"	"r.(?)"	"p.(Gly3526_Gly3527dup)"	""	""
"0000968501"	"00023135"	"50"	"10579"	"0"	"10581"	"0"	"c.10579_10581dup"	"r.(?)"	"p.(Gly3527dup)"	""	""
"0000968502"	"00023135"	"50"	"9609"	"0"	"9611"	"0"	"c.9609_9611dup"	"r.(?)"	"p.(Gln3204dup)"	""	""
"0000968503"	"00023135"	"50"	"9588"	"0"	"9589"	"0"	"c.9588_9589insAG"	"r.(?)"	"p.(Gln3197Serfs*45)"	""	""
"0000968504"	"00023135"	"50"	"9584"	"0"	"9584"	"0"	"c.9584C>T"	"r.(?)"	"p.(Pro3195Leu)"	""	""
"0000968505"	"00023135"	"50"	"9583"	"0"	"9584"	"0"	"c.9583_9584insT"	"r.(?)"	"p.(Pro3195Leufs*44)"	""	""
"0000968506"	"00023135"	"50"	"6376"	"0"	"6376"	"0"	"c.6376G>A"	"r.(?)"	"p.(Ala2126Thr)"	""	""
"0000968507"	"00023135"	"10"	"5221"	"0"	"5223"	"0"	"c.5221_5223dup"	"r.(?)"	"p.(Gln1741dup)"	""	""
"0000982046"	"00023135"	"50"	"10988"	"0"	"10988"	"0"	"c.10988A>G"	"r.(?)"	"p.(Glu3663Gly)"	""	""
"0000982047"	"00023135"	"50"	"10977"	"0"	"10977"	"0"	"c.10977C>G"	"r.(?)"	"p.(Asp3659Glu)"	""	""
"0000982048"	"00023135"	"50"	"10817"	"0"	"10817"	"0"	"c.10817C>A"	"r.(?)"	"p.(Ser3606Tyr)"	""	""
"0000982049"	"00023135"	"30"	"10573"	"0"	"10581"	"0"	"c.10573_10581del"	"r.(?)"	"p.(Gly3525_Gly3527del)"	""	""
"0000982050"	"00023135"	"50"	"10576"	"0"	"10581"	"0"	"c.10576_10581del"	"r.(?)"	"p.(Gly3526_Gly3527del)"	""	""
"0000982051"	"00023135"	"50"	"10562"	"0"	"10563"	"0"	"c.10562_10563insTGGCGGCGG"	"r.(?)"	"p.(Gly3525_Gly3527dup)"	""	""
"0000982052"	"00023135"	"30"	"10527"	"0"	"10532"	"0"	"c.10527_10532del"	"r.(?)"	"p.(Gly3511_Gly3512del)"	""	""
"0000982053"	"00023135"	"50"	"10402"	"0"	"10402"	"0"	"c.10402C>T"	"r.(?)"	"p.(Arg3468Cys)"	""	""
"0000982054"	"00023135"	"30"	"10255"	"0"	"10255"	"0"	"c.10255C>A"	"r.(?)"	"p.(Pro3419Thr)"	""	""
"0000982055"	"00023135"	"30"	"10164"	"0"	"10166"	"0"	"c.10164_10166del"	"r.(?)"	"p.(Gln3389del)"	""	""
"0000982056"	"00023135"	"30"	"10139"	"0"	"10141"	"0"	"c.10139_10141dup"	"r.(?)"	"p.(Gln3380dup)"	""	""
"0000982057"	"00023135"	"30"	"10026"	"0"	"10026"	"0"	"c.10026C>G"	"r.(?)"	"p.(Phe3342Leu)"	""	""
"0000982058"	"00023135"	"50"	"9955"	"0"	"9955"	"0"	"c.9955T>C"	"r.(?)"	"p.(Tyr3319His)"	""	""
"0000982059"	"00023135"	"50"	"9929"	"0"	"9929"	"0"	"c.9929A>C"	"r.(?)"	"p.(Tyr3310Ser)"	""	""
"0000982060"	"00023135"	"50"	"9609"	"0"	"9611"	"0"	"c.9609_9611del"	"r.(?)"	"p.(Gln3204del)"	""	""
"0000982061"	"00023135"	"50"	"9461"	"0"	"9461"	"0"	"c.9461T>G"	"r.(?)"	"p.(Leu3154Arg)"	""	""
"0000982062"	"00023135"	"30"	"7691"	"0"	"7691"	"0"	"c.7691A>G"	"r.(?)"	"p.(Gln2564Arg)"	""	""
"0000982063"	"00023135"	"30"	"5286"	"0"	"5286"	"0"	"c.5286A>T"	"r.(?)"	"p.(Gln1762His)"	""	""
"0000982064"	"00023135"	"50"	"5135"	"0"	"5135"	"0"	"c.5135G>T"	"r.(?)"	"p.(Arg1712Leu)"	""	""
"0000982065"	"00023135"	"50"	"4550"	"0"	"4550"	"0"	"c.4550C>T"	"r.(?)"	"p.(Ser1517Leu)"	""	""
"0000982066"	"00023135"	"30"	"4376"	"0"	"4376"	"0"	"c.4376A>G"	"r.(?)"	"p.(Asp1459Gly)"	""	""
"0000982067"	"00023135"	"30"	"2331"	"0"	"2333"	"0"	"c.2331_2333dup"	"r.(?)"	"p.(Ala784dup)"	""	""
"0000982068"	"00023135"	"50"	"2330"	"0"	"2332"	"0"	"c.2330_2332del"	"r.(?)"	"p.(Val777del)"	""	""
"0000982069"	"00023135"	"30"	"1198"	"0"	"1198"	"0"	"c.1198C>T"	"r.(?)"	"p.(=)"	""	""
"0000982070"	"00023135"	"50"	"1027"	"0"	"1027"	"0"	"c.1027A>G"	"r.(?)"	"p.(Lys343Glu)"	""	""
"0001002541"	"00023135"	"30"	"11065"	"0"	"11065"	"0"	"c.11065A>G"	"r.(?)"	"p.(Lys3689Glu)"	""	""
"0001002542"	"00023135"	"50"	"11024"	"0"	"11024"	"0"	"c.11024C>T"	"r.(?)"	"p.(Pro3675Leu)"	""	""
"0001002543"	"00023135"	"50"	"10538"	"0"	"10550"	"0"	"c.10538_10550del"	"r.(?)"	"p.(Ser3513Thrfs*28)"	""	""
"0001002544"	"00023135"	"30"	"10544"	"0"	"10544"	"0"	"c.10544G>C"	"r.(?)"	"p.(Gly3515Ala)"	""	""
"0001002545"	"00023135"	"30"	"10537"	"0"	"10537"	"0"	"c.10537A>G"	"r.(?)"	"p.(Ser3513Gly)"	""	""
"0001002546"	"00023135"	"30"	"10355"	"0"	"10355"	"0"	"c.10355T>A"	"r.(?)"	"p.(Leu3452His)"	""	""
"0001002547"	"00023135"	"50"	"10295"	"0"	"10295"	"0"	"c.10295C>T"	"r.(?)"	"p.(Ser3432Phe)"	""	""
"0001002548"	"00023135"	"50"	"10089"	"0"	"10097"	"0"	"c.10089_10097del"	"r.(?)"	"p.(Tyr3367_Gln3369del)"	""	""
"0001002549"	"00023135"	"50"	"9490"	"0"	"9490"	"0"	"c.9490C>T"	"r.(?)"	"p.(Leu3164Phe)"	""	""
"0001002550"	"00023135"	"50"	"8644"	"0"	"8644"	"0"	"c.8644G>A"	"r.(?)"	"p.(Ala2882Thr)"	""	""
"0001002551"	"00023135"	"30"	"8597"	"0"	"8597"	"0"	"c.8597A>G"	"r.(?)"	"p.(Lys2866Arg)"	""	""
"0001002552"	"00023135"	"50"	"8192"	"0"	"8192"	"0"	"c.8192G>A"	"r.(?)"	"p.(Arg2731Gln)"	""	""
"0001002553"	"00023135"	"50"	"7898"	"0"	"7898"	"0"	"c.7898C>A"	"r.(?)"	"p.(Thr2633Lys)"	""	""
"0001002554"	"00023135"	"50"	"7573"	"0"	"7573"	"0"	"c.7573C>T"	"r.(?)"	"p.(Pro2525Ser)"	""	""
"0001002555"	"00023135"	"50"	"7556"	"0"	"7556"	"0"	"c.7556A>G"	"r.(?)"	"p.(Gln2519Arg)"	""	""
"0001002556"	"00023135"	"50"	"6653"	"0"	"6653"	"0"	"c.6653G>A"	"r.(?)"	"p.(Ser2218Asn)"	""	""
"0001002557"	"00023135"	"50"	"6608"	"0"	"6608"	"0"	"c.6608G>A"	"r.(?)"	"p.(Arg2203His)"	""	""
"0001002558"	"00023135"	"30"	"6221"	"0"	"6221"	"0"	"c.6221C>G"	"r.(?)"	"p.(Pro2074Arg)"	""	""
"0001002559"	"00023135"	"30"	"6211"	"0"	"6211"	"0"	"c.6211A>C"	"r.(?)"	"p.(Ile2071Leu)"	""	""
"0001002560"	"00023135"	"50"	"5937"	"0"	"5937"	"0"	"c.5937C>G"	"r.(?)"	"p.(Asn1979Lys)"	""	""
"0001002561"	"00023135"	"30"	"5449"	"0"	"5449"	"0"	"c.5449G>T"	"r.(?)"	"p.(Val1817Leu)"	""	""
"0001002562"	"00023135"	"50"	"5382"	"0"	"5384"	"0"	"c.5382_5384dup"	"r.(?)"	"p.(Gln1794dup)"	""	""
"0001002563"	"00023135"	"50"	"5320"	"0"	"5320"	"0"	"c.5320C>A"	"r.(?)"	"p.(Pro1774Thr)"	""	""
"0001002564"	"00023135"	"30"	"4981"	"0"	"4981"	"0"	"c.4981A>G"	"r.(?)"	"p.(Asn1661Asp)"	""	""
"0001002565"	"00023135"	"50"	"4747"	"0"	"4747"	"0"	"c.4747G>A"	"r.(?)"	"p.(Gly1583Ser)"	""	""
"0001002566"	"00023135"	"50"	"4038"	"0"	"4046"	"0"	"c.4038_4046del"	"r.(?)"	"p.(Ser1347_Ala1349del)"	""	""
"0001002567"	"00023135"	"50"	"3724"	"0"	"3724"	"0"	"c.3724G>T"	"r.(?)"	"p.(Ala1242Ser)"	""	""
"0001002568"	"00023135"	"50"	"3356"	"0"	"3356"	"0"	"c.3356G>A"	"r.(?)"	"p.(Arg1119Gln)"	""	""
"0001002569"	"00023135"	"30"	"3103"	"0"	"3103"	"0"	"c.3103G>A"	"r.(?)"	"p.(Gly1035Ser)"	""	""
"0001002570"	"00023135"	"30"	"2408"	"0"	"2408"	"0"	"c.2408C>T"	"r.(?)"	"p.(Thr803Ile)"	""	""
"0001002571"	"00023135"	"50"	"2378"	"0"	"2378"	"0"	"c.2378C>T"	"r.(?)"	"p.(Pro793Leu)"	""	""
"0001002572"	"00023135"	"50"	"2246"	"0"	"2246"	"0"	"c.2246A>G"	"r.(?)"	"p.(Lys749Arg)"	""	""
"0001002573"	"00023135"	"30"	"1740"	"0"	"1740"	"0"	"c.1740T>A"	"r.(?)"	"p.(Asn580Lys)"	""	""
"0001002574"	"00023135"	"50"	"1726"	"0"	"1726"	"0"	"c.1726G>T"	"r.(?)"	"p.(Gly576Cys)"	""	""
"0001002575"	"00023135"	"30"	"1449"	"0"	"1463"	"0"	"c.1449_1463dup"	"r.(?)"	"p.(Glu483_Glu487dup)"	""	""
"0001002576"	"00023135"	"30"	"1226"	"0"	"1226"	"0"	"c.1226C>T"	"r.(?)"	"p.(Ser409Leu)"	""	""
"0001002577"	"00023135"	"50"	"488"	"0"	"488"	"0"	"c.488G>A"	"r.(?)"	"p.(Ser163Asn)"	""	""
"0001002578"	"00023135"	"50"	"314"	"0"	"314"	"0"	"c.314C>T"	"r.(?)"	"p.(Pro105Leu)"	""	""
"0001002579"	"00023135"	"50"	"208"	"0"	"208"	"0"	"c.208C>G"	"r.(?)"	"p.(Pro70Ala)"	""	""
"0001015426"	"00023135"	"50"	"8452"	"0"	"8452"	"0"	"c.8452A>G"	"r.(?)"	"p.(Met2818Val)"	""	""
"0001015427"	"00023135"	"50"	"5286"	"0"	"5286"	"0"	"c.5286A>T"	"r.(?)"	"p.(Gln1762His)"	""	""
"0001015428"	"00023135"	"50"	"2594"	"0"	"2594"	"0"	"c.2594A>G"	"r.(?)"	"p.(Tyr865Cys)"	""	""
"0001026758"	"00023135"	"50"	"2989"	"0"	"2989"	"0"	"c.2989G>T"	"r.(?)"	"p.(Ala997Ser)"	""	""
"0001026759"	"00023135"	"50"	"2408"	"0"	"2408"	"0"	"c.2408C>T"	"r.(?)"	"p.(Thr803Ile)"	""	""
"0001041335"	"00023135"	"50"	"10573"	"0"	"10581"	"0"	"c.10573_10581dup"	"r.(?)"	"p.(Gly3525_Gly3527dup)"	""	""
"0001041336"	"00023135"	"50"	"10527"	"0"	"10532"	"0"	"c.10527_10532dup"	"r.(?)"	"p.(Gly3511_Gly3512dup)"	""	""
"0001041337"	"00023135"	"30"	"9265"	"0"	"9265"	"0"	"c.9265G>A"	"r.(?)"	"p.(Glu3089Lys)"	""	""
"0001041338"	"00023135"	"30"	"8557"	"0"	"8557"	"0"	"c.8557G>A"	"r.(?)"	"p.(Ala2853Thr)"	""	""
"0001041339"	"00023135"	"50"	"6406"	"0"	"6406"	"0"	"c.6406C>T"	"r.(?)"	"p.(Leu2136Phe)"	""	""
"0001041340"	"00023135"	"50"	"5204"	"0"	"5205"	"0"	"c.5204_5205insGCAACA"	"r.(?)"	"p.(Gln1740_Gln1741dup)"	""	""
"0001041341"	"00023135"	"30"	"5218"	"0"	"5223"	"0"	"c.5218_5223dup"	"r.(?)"	"p.(Gln1740_Gln1741dup)"	""	""
"0001041342"	"00023135"	"30"	"3448"	"7"	"3448"	"7"	"c.3448+7G>A"	"r.(=)"	"p.(=)"	""	""
"0001041343"	"00023135"	"30"	"2594"	"0"	"2594"	"0"	"c.2594A>G"	"r.(?)"	"p.(Tyr865Cys)"	""	""
"0001041344"	"00023135"	"30"	"2282"	"0"	"2282"	"0"	"c.2282G>C"	"r.(?)"	"p.(Gly761Ala)"	""	""
"0001041345"	"00023135"	"30"	"2159"	"0"	"2159"	"0"	"c.2159C>T"	"r.(?)"	"p.(Thr720Met)"	""	""
"0001041346"	"00023135"	"30"	"1958"	"0"	"1958"	"0"	"c.1958G>A"	"r.(?)"	"p.(Arg653His)"	""	""
"0001055657"	"00023135"	"30"	"10628"	"0"	"10628"	"0"	"c.10628C>G"	"r.(?)"	"p.(Ala3543Gly)"	""	""
"0001055658"	"00023135"	"30"	"10466"	"0"	"10466"	"0"	"c.10466T>G"	"r.(?)"	"p.(Phe3489Cys)"	""	""
"0001055659"	"00023135"	"50"	"10259"	"0"	"10259"	"0"	"c.10259A>C"	"r.(?)"	"p.(Lys3420Thr)"	""	""
"0001055660"	"00023135"	"50"	"9050"	"0"	"9050"	"0"	"c.9050C>T"	"r.(?)"	"p.(Thr3017Met)"	""	""
"0001055661"	"00023135"	"70"	"7645"	"0"	"7645"	"0"	"c.7645del"	"r.(?)"	"p.(Gln2549Serfs*6)"	""	""
"0001055662"	"00023135"	"30"	"5134"	"0"	"5134"	"0"	"c.5134C>T"	"r.(?)"	"p.(Arg1712Trp)"	""	""
"0001055663"	"00023135"	"50"	"4186"	"0"	"4186"	"0"	"c.4186C>T"	"r.(?)"	"p.(Arg1396Cys)"	""	""
"0001055664"	"00023135"	"50"	"3413"	"0"	"3413"	"0"	"c.3413T>A"	"r.(?)"	"p.(Ile1138Asn)"	""	""
"0001055665"	"00023135"	"70"	"2737"	"0"	"2737"	"0"	"c.2737del"	"r.(?)"	"p.(Leu913*)"	""	""
"0001055666"	"00023135"	"50"	"2588"	"0"	"2588"	"0"	"c.2588A>G"	"r.(?)"	"p.(Gln863Arg)"	""	""
"0001055667"	"00023135"	"50"	"2494"	"0"	"2494"	"0"	"c.2494A>G"	"r.(?)"	"p.(Met832Val)"	""	""
"0001055668"	"00023135"	"30"	"679"	"0"	"679"	"0"	"c.679G>A"	"r.(?)"	"p.(Val227Ile)"	""	""
"0001066531"	"00023135"	"50"	"9434"	"0"	"9434"	"0"	"c.9434C>T"	"r.(?)"	"p.(Thr3145Met)"	""	""
"0001066532"	"00023135"	"50"	"6212"	"0"	"6212"	"0"	"c.6212T>C"	"r.(?)"	"p.(Ile2071Thr)"	""	""
"0001066533"	"00023135"	"30"	"4031"	"0"	"4031"	"0"	"c.4031T>G"	"r.(?)"	"p.(Leu1344Trp)"	""	""


## Screenings_To_Variants ## Do not remove or alter this header ##
## Count = 90
"{{screeningid}}"	"{{variantid}}"
"0000272628"	"0000626567"
"0000412180"	"0000869438"
"0000412181"	"0000869439"
"0000412182"	"0000869440"
"0000412183"	"0000869441"
"0000412184"	"0000869442"
"0000412185"	"0000869443"
"0000412186"	"0000869444"
"0000412187"	"0000869445"
"0000412188"	"0000869446"
"0000412189"	"0000869447"
"0000412190"	"0000869448"
"0000412191"	"0000869449"
"0000412192"	"0000869450"
"0000412193"	"0000869451"
"0000446739"	"0000955105"
"0000446740"	"0000955106"
"0000446741"	"0000955107"
"0000446742"	"0000955108"
"0000446743"	"0000955109"
"0000446744"	"0000955110"
"0000446745"	"0000955111"
"0000446746"	"0000955112"
"0000446747"	"0000955113"
"0000446748"	"0000955114"
"0000446749"	"0000955115"
"0000446750"	"0000955116"
"0000446751"	"0000955117"
"0000446752"	"0000955118"
"0000446753"	"0000955119"
"0000446754"	"0000955120"
"0000446755"	"0000955121"
"0000446756"	"0000955122"
"0000446757"	"0000955123"
"0000446758"	"0000955124"
"0000446759"	"0000955125"
"0000446760"	"0000955126"
"0000446761"	"0000955127"
"0000446762"	"0000955128"
"0000446763"	"0000955129"
"0000446764"	"0000955130"
"0000446765"	"0000955131"
"0000446766"	"0000955132"
"0000446766"	"0000955142"
"0000446767"	"0000955133"
"0000446767"	"0000955143"
"0000446768"	"0000955134"
"0000446768"	"0000955144"
"0000446769"	"0000955135"
"0000446769"	"0000955145"
"0000446770"	"0000955136"
"0000446770"	"0000955146"
"0000446771"	"0000955137"
"0000446771"	"0000955147"
"0000446772"	"0000955138"
"0000446772"	"0000955148"
"0000446773"	"0000955139"
"0000446773"	"0000955149"
"0000446774"	"0000955140"
"0000446774"	"0000955150"
"0000446775"	"0000955141"
"0000446775"	"0000955151"
"0000449655"	"0000960092"
"0000449656"	"0000960093"
"0000449657"	"0000960094"
"0000449658"	"0000960095"
"0000449659"	"0000960096"
"0000449660"	"0000960097"
"0000449661"	"0000960098"
"0000449662"	"0000960099"
"0000449663"	"0000960100"
"0000449664"	"0000960101"
"0000449665"	"0000960102"
"0000449666"	"0000960103"
"0000449667"	"0000960104"
"0000449668"	"0000960105"
"0000449669"	"0000960106"
"0000449670"	"0000960107"
"0000449671"	"0000960108"
"0000449672"	"0000960109"
"0000449673"	"0000960110"
"0000449674"	"0000960111"
"0000449675"	"0000960112"
"0000449676"	"0000960113"
"0000449677"	"0000960114"
"0000449678"	"0000960115"
"0000449679"	"0000960116"
"0000449680"	"0000960117"
"0000449681"	"0000960118"
"0000449682"	"0000960119"