### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = ZIC2) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "ZIC2" "Zic family member 2" "13" "q32" "unknown" "NG_007085.3" "UD_132118600031" "" "https://www.LOVD.nl/ZIC2" "" "1" "12873" "7546" "603073" "1" "1" "1" "1" "We gratefully acknowledge Aimée Paulussen for acting as a curator until 2016. Establishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "" "" "" "1" "" "" "-1" "" "-1" "00000" "2012-09-13 00:00:00" "00006" "2019-01-21 12:38:22" "00000" "2025-11-01 13:22:20" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00000899" "ZIC2" "Zic family member 2" "001" "NM_007129.3" "" "NP_009060.2" "" "" "" "-293" "2682" "1599" "100634026" "100639019" "00000" "2012-09-13 12:58:06" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 5 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00139" "ID" "intellectual disability (ID)" "" "" "" "" "" "00084" "2013-06-04 18:18:07" "00006" "2015-02-09 10:02:49" "00438" "HPE" "holoprosencephaly (HPE)" "" "236100" "" "" "" "00662" "2014-06-30 10:33:45" "00006" "2015-12-04 07:41:19" "01157" "CHTE" "Hypothyroidism, central, testicular enlargement (CHTE)" "XLR" "300888" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "02867" "HPE5" "holoprosencephaly, type 5 (HPE-5)" "AD" "609637" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "04270" "epilepsy" "epilepsy" "" "" "" "" "" "00006" "2015-05-14 16:00:06" "00006" "2017-09-07 14:25:59" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 3 "{{geneid}}" "{{diseaseid}}" "ZIC2" "00139" "ZIC2" "00438" "ZIC2" "02867" ## Individuals ## Do not remove or alter this header ## ## Count = 3 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00000208" "" "" "" "1" "" "00037" "{PMID:Sun 2011:23143598}, {DOI:Sun 2011:10.1038/ng.2453}" "" "M" "no" "Netherlands" "" "0" "" "" "" "" "00000209" "" "" "" "1" "" "00037" "{PMID:Sun 2011:23143598}, {DOI:Sun 2011:10.1038/ng.2453}" "" "M" "no" "Netherlands" "" "0" "" "" "" "" "00362022" "" "" "" "1" "" "00006" "{PMID:Courage 2021:33798445}, {DOI:Courage 2021:10.1016/j.ajhg.2021.03.013}" "" "" "" "" "" "0" "" "" "" "PME_FI_F07" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 3 "{{individualid}}" "{{diseaseid}}" "00000208" "01157" "00000209" "01157" "00362022" "04270" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00139, 00438, 01157, 02867, 04270 ## Count = 3 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "0000038983" "01157" "00000208" "00006" "Familial, X-linked recessive" "" "central hypothyroidism (FT4 0.50-0.99of lower limit normal), no prolactin deficiency, age sonographic determination testicular volume 17.64y, testicular volume right/left 21/20 (7.3–16ml)" "" "3w" "" "" "" "" "" "" "" "0000038984" "01157" "00000209" "00006" "Familial, X-linked recessive" "" "central hypothyroidism (FT4 0.50-0.99of lower limit normal), prolactin deficiency, age sonographic determination testicular volume 21.36y, testicular volume right/left 30/26 (8.5–18.3ml)" "" "07y04m" "" "" "" "" "" "" "" "0000257436" "04270" "00362022" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "progressive myoclonus epilepsy" ## Screenings ## Do not remove or alter this header ## ## Count = 3 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000000209" "00000208" "1" "00037" "00001" "2012-09-13 12:02:03" "" "" "SEQ-NG-I" "DNA" "" "" "0000000210" "00000209" "1" "00037" "00001" "2012-09-13 12:09:36" "" "" "SEQ-NG-I" "DNA" "" "" "0000363250" "00362022" "1" "00006" "00006" "2021-04-14 11:32:13" "" "" "SEQ-NG" "DNA" "" "WES" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 0 ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 74 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000005335" "0" "50" "13" "100637102" "100637102" "subst" "0" "00037" "ZIC2_000002" "g.100637102T>C" "" "" "" "" "" "Germline" "" "" "" "" "" "g.99984848T>C" "" "VUS" "" "0000013277" "0" "50" "13" "100635377" "100635377" "subst" "0.0812055" "00037" "ZIC2_000004" "g.100635377C>T" "" "" "" "" "" "Germline" "" "" "" "" "" "g.99983123C>T" "" "VUS" "" "0000013278" "3" "50" "13" "100635606" "100635606" "subst" "0" "00037" "ZIC2_000001" "g.100635606G>A" "" "" "" "" "" "Germline" "" "" "" "" "" "g.99983352G>A" "" "VUS" "" "0000013279" "3" "50" "13" "100637102" "100637102" "subst" "0" "00037" "ZIC2_000002" "g.100637102T>C" "" "" "" "" "" "Germline" "" "" "" "" "" "g.99984848T>C" "" "VUS" "" "0000313147" "0" "50" "13" "100635028" "100635036" "del" "0" "02325" "ZIC2_000010" "g.100635028_100635036del" "" "" "" "ZIC2(NM_007129.3):c.710_718delACCACCACC (p.(His237_His239del)), ZIC2(NM_007129.4):c.710_718delACCACCACC (p.H237_H239del), ZIC2(NM_007129.5):c.710_7..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99982774_99982782del" "" "VUS" "" "0000313148" "0" "30" "13" "100635034" "100635036" "del" "0" "02325" "ZIC2_000008" "g.100635034_100635036del" "" "" "" "ZIC2(NM_007129.4):c.716_718delACC (p.H239del), ZIC2(NM_007129.5):c.716_718delACC (p.H239del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99982780_99982782del" "" "likely benign" "" "0000320197" "0" "30" "13" "100637710" "100637710" "subst" "0" "01943" "ZIC2_000012" "g.100637710C>T" "" "" "" "ZIC2(NM_007129.4):c.1373C>T (p.A458V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99985456C>T" "" "likely benign" "" "0000320198" "0" "30" "13" "100634531" "100634531" "subst" "0.00050001" "01943" "ZIC2_000005" "g.100634531G>A" "" "" "" "ZIC2(NM_007129.4):c.213G>A (p.P71=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99982277G>A" "" "likely benign" "" "0000320199" "0" "30" "13" "100635197" "100635197" "subst" "0.000199087" "01943" "ZIC2_000011" "g.100635197C>T" "" "" "" "ZIC2(NM_007129.4):c.879C>T (p.G293=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99982943C>T" "" "likely benign" "" "0000323457" "0" "50" "13" "100635016" "100635016" "subst" "0" "01804" "ZIC2_000025" "g.100635016A>C" "" "" "" "ZIC2(NM_007129.3):c.698A>C (p.(His233Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99982762A>C" "" "VUS" "" "0000323458" "0" "50" "13" "100635019" "100635019" "subst" "0" "01804" "ZIC2_000026" "g.100635019A>C" "" "" "" "ZIC2(NM_007129.3):c.701A>C (p.(His234Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99982765A>C" "" "VUS" "" "0000323459" "0" "50" "13" "100635031" "100635031" "subst" "0" "01804" "ZIC2_000031" "g.100635031A>C" "" "" "" "ZIC2(NM_007129.3):c.713A>C (p.(His238Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99982777A>C" "" "VUS" "" "0000549600" "0" "50" "13" "100634255" "100634255" "subst" "0" "02327" "ZIC2_000014" "g.100634255C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99982001C>G" "" "VUS" "" "0000549601" "0" "10" "13" "100634531" "100634531" "subst" "0.00050001" "02327" "ZIC2_000005" "g.100634531G>A" "" "" "" "ZIC2(NM_007129.4):c.213G>A (p.P71=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99982277G>A" "" "benign" "" "0000549602" "0" "30" "13" "100634715" "100634715" "subst" "0" "01943" "ZIC2_000015" "g.100634715G>A" "" "" "" "ZIC2(NM_007129.4):c.397G>A (p.G133S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99982461G>A" "" "likely benign" "" "0000549603" "0" "90" "13" "100634797" "100634797" "del" "0" "02327" "ZIC2_000016" "g.100634797del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99982543del" "" "pathogenic" "" "0000549604" "0" "70" "13" "100634870" "100634870" "del" "0" "02327" "ZIC2_000017" "g.100634870del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99982616del" "" "likely pathogenic" "" "0000549606" "0" "50" "13" "100634899" "100634899" "subst" "0" "02327" "ZIC2_000019" "g.100634899A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99982645A>G" "" "VUS" "" "0000549607" "0" "50" "13" "100634970" "100634970" "subst" "0" "01804" "ZIC2_000020" "g.100634970A>G" "" "" "" "ZIC2(NM_007129.3):c.652A>G (p.(Asn218Asp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99982716A>G" "" "VUS" "" "0000549610" "0" "50" "13" "100635012" "100635012" "subst" "0" "02325" "ZIC2_000023" "g.100635012C>A" "" "" "" "ZIC2(NM_007129.5):c.694C>A (p.H232N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99982758C>A" "" "VUS" "" "0000549612" "0" "50" "13" "100635022" "100635022" "subst" "0" "01804" "ZIC2_000027" "g.100635022A>C" "" "" "" "ZIC2(NM_007129.3):c.704A>C (p.(His235Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99982768A>C" "" "VUS" "" "0000549613" "0" "50" "13" "100635025" "100635025" "subst" "0" "01804" "ZIC2_000028" "g.100635025A>C" "" "" "" "ZIC2(NM_007129.3):c.707A>C (p.(His236Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99982771A>C" "" "VUS" "" "0000549614" "0" "30" "13" "100635025" "100635036" "del" "0" "01943" "ZIC2_000029" "g.100635025_100635036del" "" "" "" "ZIC2(NM_007129.4):c.707_718delACCACCACCACC (p.H236_H239del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99982771_99982782del" "" "likely benign" "" "0000549615" "0" "50" "13" "100635028" "100635028" "subst" "0" "01804" "ZIC2_000030" "g.100635028A>C" "" "" "" "ZIC2(NM_007129.3):c.710A>C (p.(His237Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99982774A>C" "" "VUS" "" "0000549616" "0" "50" "13" "100635028" "100635036" "del" "0" "01943" "ZIC2_000010" "g.100635028_100635036del" "" "" "" "ZIC2(NM_007129.3):c.710_718delACCACCACC (p.(His237_His239del)), ZIC2(NM_007129.4):c.710_718delACCACCACC (p.H237_H239del), ZIC2(NM_007129.5):c.710_7..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99982774_99982782del" "" "VUS" "" "0000549617" "0" "50" "13" "100635034" "100635034" "subst" "0" "01804" "ZIC2_000032" "g.100635034A>C" "" "" "" "ZIC2(NM_007129.3):c.716A>C (p.(His239Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99982780A>C" "" "VUS" "" "0000549618" "0" "10" "13" "100635034" "100635036" "dup" "0" "02326" "ZIC2_000033" "g.100635034_100635036dup" "" "" "" "ZIC2(NM_007129.5):c.716_718dupACC (p.H239dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99982780_99982782dup" "" "benign" "" "0000549620" "0" "70" "13" "100635175" "100635175" "subst" "0" "02327" "ZIC2_000035" "g.100635175A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99982921A>G" "" "likely pathogenic" "" "0000549621" "0" "50" "13" "100635343" "100635343" "subst" "0" "02327" "ZIC2_000036" "g.100635343A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99983089A>G" "" "VUS" "" "0000549622" "0" "90" "13" "100637214" "100637214" "subst" "0" "02327" "ZIC2_000037" "g.100637214C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99984960C>T" "" "pathogenic" "" "0000549623" "0" "10" "13" "100637381" "100637381" "subst" "0.00468437" "02327" "ZIC2_000038" "g.100637381G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99985127G>A" "" "benign" "" "0000549624" "0" "90" "13" "100637666" "100637666" "del" "0" "02327" "ZIC2_000039" "g.100637666del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99985412del" "" "pathogenic" "" "0000549625" "0" "50" "13" "100637673" "100637673" "subst" "0" "02327" "ZIC2_000040" "g.100637673G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99985419G>A" "" "VUS" "" "0000549626" "0" "30" "13" "100637714" "100637719" "dup" "0" "01943" "ZIC2_000041" "g.100637714_100637719dup" "" "" "" "ZIC2(NM_007129.3):c.1377_1382dupAGCGGC (p.(Ala460_Ala461dup)), ZIC2(NM_007129.4):c.1377_1382dupAGCGGC (p.A469_A470dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99985460_99985465dup" "" "likely benign" "" "0000549627" "0" "30" "13" "100637714" "100637725" "del" "0" "01943" "ZIC2_000042" "g.100637714_100637725del" "" "" "" "ZIC2(NM_007129.4):c.1377_1388delAGCGGCGGCGGC (p.A467_A470del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99985460_99985471del" "" "likely benign" "" "0000549628" "0" "50" "13" "100637714" "100637743" "del" "0" "01804" "ZIC2_000043" "g.100637714_100637743del" "" "" "" "ZIC2(NM_007129.3):c.1377_1406delAGCGGCGGCGGCGGCTGCGGCGGCGGCGGC (p.(Ala460_Ala469del)), ZIC2(NM_007129.4):c.1377_1406delAGCGGCGGCGGCGGCTGCGGCGGCGGCG..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99985460_99985489del" "" "VUS" "" "0000549631" "0" "30" "13" "100637738" "100637743" "dup" "0" "01943" "ZIC2_000046" "g.100637738_100637743dup" "" "" "" "ZIC2(NM_007129.4):c.1401_1406dupGGCGGC (p.A469_A470dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99985484_99985489dup" "" "likely benign" "" "0000549633" "0" "50" "13" "100637785" "100637785" "subst" "0" "02327" "ZIC2_000048" "g.100637785G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99985531G>A" "" "VUS" "" "0000549634" "0" "30" "13" "100637817" "100637864" "del" "0" "01804" "ZIC2_000049" "g.100637817_100637864del" "" "" "" "ZIC2(NM_007129.3):c.1468_1515del (p.(Ser493_Gly508del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99985563_99985610del" "" "likely benign" "" "0000549636" "0" "50" "13" "100637838" "100637861" "del" "0" "01804" "ZIC2_000051" "g.100637838_100637861del" "" "" "" "ZIC2(NM_007129.3):c.1486_1509del (p.(Gly499_Gly506del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99985584_99985607del" "" "VUS" "" "0000549637" "0" "90" "13" "100637845" "100637857" "del" "0" "02327" "ZIC2_000052" "g.100637845_100637857del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99985591_99985603del" "" "pathogenic" "" "0000614455" "0" "30" "13" "100634408" "100634410" "dup" "0" "02325" "ZIC2_000053" "g.100634408_100634410dup" "" "" "" "ZIC2(NM_007129.4):c.90_92dupGGC (p.A33dup), ZIC2(NM_007129.5):c.90_92dup (p.(Ala33dup)), ZIC2(NM_007129.5):c.90_92dupGGC (p.A33dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99982154_99982156dup" "" "likely benign" "" "0000614456" "0" "50" "13" "100634911" "100634911" "subst" "0" "01943" "ZIC2_000054" "g.100634911C>T" "" "" "" "ZIC2(NM_007129.4):c.593C>T (p.A198V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99982657C>T" "" "VUS" "" "0000614457" "0" "30" "13" "100635034" "100635036" "del" "0" "01943" "ZIC2_000008" "g.100635034_100635036del" "" "" "" "ZIC2(NM_007129.4):c.716_718delACC (p.H239del), ZIC2(NM_007129.5):c.716_718delACC (p.H239del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99982780_99982782del" "" "likely benign" "" "0000614458" "0" "50" "13" "100635034" "100635036" "dup" "0" "02327" "ZIC2_000033" "g.100635034_100635036dup" "" "" "" "ZIC2(NM_007129.5):c.716_718dupACC (p.H239dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99982780_99982782dup" "" "VUS" "" "0000614459" "0" "50" "13" "100637714" "100637743" "del" "0" "01943" "ZIC2_000043" "g.100637714_100637743del" "" "" "" "ZIC2(NM_007129.3):c.1377_1406delAGCGGCGGCGGCGGCTGCGGCGGCGGCGGC (p.(Ala460_Ala469del)), ZIC2(NM_007129.4):c.1377_1406delAGCGGCGGCGGCGGCTGCGGCGGCGGCG..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99985460_99985489del" "" "VUS" "" "0000614460" "0" "90" "13" "100637714" "100637743" "dup" "0" "02327" "ZIC2_000055" "g.100637714_100637743dup" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99985460_99985489dup" "" "pathogenic" "" "0000657219" "0" "50" "13" "100634408" "100634410" "dup" "0" "01943" "ZIC2_000053" "g.100634408_100634410dup" "" "" "" "ZIC2(NM_007129.4):c.90_92dupGGC (p.A33dup), ZIC2(NM_007129.5):c.90_92dup (p.(Ala33dup)), ZIC2(NM_007129.5):c.90_92dupGGC (p.A33dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99982154_99982156dup" "" "VUS" "" "0000657220" "0" "30" "13" "100635203" "100635203" "subst" "5.28039E-5" "01943" "ZIC2_000056" "g.100635203G>A" "" "" "" "ZIC2(NM_007129.4):c.885G>A (p.P295=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99982949G>A" "" "likely benign" "" "0000657221" "0" "70" "13" "100637734" "100637748" "del" "0" "01943" "ZIC2_000057" "g.100637734_100637748del" "" "" "" "ZIC2(NM_007129.4):c.1397_1411delCGGCGGCGGCCGCGG (p.A466_A470del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99985480_99985494del" "" "likely pathogenic" "" "0000657222" "0" "50" "13" "100637842" "100637853" "del" "0" "01943" "ZIC2_000058" "g.100637842_100637853del" "" "" "" "ZIC2(NM_007129.4):c.1505_1516delCGGGCGGCGGGG (p.A502_G505del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99985588_99985599del" "" "VUS" "" "0000679700" "0" "30" "13" "100634777" "100634777" "subst" "0.000135339" "02325" "ZIC2_000059" "g.100634777G>T" "" "" "" "ZIC2(NM_007129.5):c.459G>T (p.A153=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000679701" "0" "50" "13" "100637720" "100637728" "del" "0" "01943" "ZIC2_000060" "g.100637720_100637728del" "" "" "" "ZIC2(NM_007129.4):c.1383_1391delGGCGGCGGC (p.A468_A470del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000691454" "0" "70" "13" "100635322" "100635322" "subst" "0" "02325" "ZIC2_000061" "g.100635322G>T" "" "" "" "ZIC2(NM_007129.5):c.1004G>T (p.C335F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000724315" "0" "30" "13" "100634783" "100634783" "subst" "0" "01943" "ZIC2_000062" "g.100634783C>G" "" "" "" "ZIC2(NM_007129.4):c.465C>G (p.G155=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000724316" "0" "10" "13" "100635034" "100635036" "dup" "0" "02325" "ZIC2_000033" "g.100635034_100635036dup" "" "" "" "ZIC2(NM_007129.5):c.716_718dupACC (p.H239dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000724317" "0" "50" "13" "100637714" "100637725" "dup" "0" "02329" "ZIC2_000063" "g.100637714_100637725dup" "" "" "" "ZIC2(NM_007129.5):c.1377_1388dupAGCGGCGGCGGC (p.A467_A470dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000763828" "0" "70" "13" "100635052" "100635052" "subst" "0" "00006" "ZIC2_000064" "g.100635052G>C" "" "{PMID:Courage 2021:33798445}, {DOI:Courage 2021:10.1016/j.ajhg.2021.03.013}" "" "734G>C (Arg245Pro)" "ACMG PS2, PM1, PM2, PP2, PP3" "De novo" "" "" "0" "" "" "g.99982798G>C" "" "likely pathogenic" "ACMG" "0000805990" "0" "90" "13" "100634520" "100634520" "subst" "0" "02329" "ZIC2_000065" "g.100634520G>T" "" "" "" "ZIC2(NM_007129.5):c.202G>T (p.E68*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000853563" "0" "30" "13" "100634964" "100634964" "subst" "4.25152E-6" "01943" "ZIC2_000067" "g.100634964C>T" "" "" "" "ZIC2(NM_007129.4):c.646C>T (p.P216S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000863164" "0" "50" "13" "100634515" "100634515" "subst" "0" "01943" "ZIC2_000066" "g.100634515C>T" "" "" "" "ZIC2(NM_007129.4):c.197C>T (p.A66V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000890852" "0" "50" "13" "100634856" "100634856" "subst" "0" "02325" "ZIC2_000068" "g.100634856C>A" "" "" "" "ZIC2(NM_007129.5):c.538C>A (p.R180S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000980524" "0" "50" "13" "100634735" "100634735" "subst" "0" "01804" "ZIC2_000069" "g.100634735C>G" "" "" "" "ZIC2(NM_007129.5):c.417C>G (p.(Phe139Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000980525" "0" "30" "13" "100637369" "100637369" "subst" "8.12836E-6" "01804" "ZIC2_000070" "g.100637369A>G" "" "" "" "ZIC2(NM_007129.5):c.1239+6A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000980526" "0" "30" "13" "100637729" "100637729" "subst" "0" "01804" "ZIC2_000071" "g.100637729T>G" "" "" "" "ZIC2(NM_007129.5):c.1392T>G (p.(Ala464=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001000385" "0" "30" "13" "100634512" "100634512" "subst" "0" "01804" "ZIC2_000072" "g.100634512G>C" "" "" "" "ZIC2(NM_007129.3):c.194G>C (p.(Gly65Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001000386" "0" "30" "13" "100634625" "100634625" "subst" "0" "01804" "ZIC2_000073" "g.100634625G>A" "" "" "" "ZIC2(NM_007129.3):c.307G>A (p.(Ala103Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001000387" "0" "30" "13" "100635028" "100635036" "del" "0" "01804" "ZIC2_000010" "g.100635028_100635036del" "" "" "" "ZIC2(NM_007129.3):c.710_718delACCACCACC (p.(His237_His239del)), ZIC2(NM_007129.4):c.710_718delACCACCACC (p.H237_H239del), ZIC2(NM_007129.5):c.710_7..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001000388" "0" "30" "13" "100637714" "100637719" "dup" "0" "01804" "ZIC2_000041" "g.100637714_100637719dup" "" "" "" "ZIC2(NM_007129.3):c.1377_1382dupAGCGGC (p.(Ala460_Ala461dup)), ZIC2(NM_007129.4):c.1377_1382dupAGCGGC (p.A469_A470dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001000389" "0" "50" "13" "100637751" "100637759" "dup" "0" "01804" "ZIC2_000074" "g.100637751_100637759dup" "" "" "" "ZIC2(NM_007129.3):c.1414_1422dupTCCGCGGTG (p.(Ser472_Val474dup))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001026238" "0" "30" "13" "100634374" "100634374" "subst" "0" "02327" "ZIC2_000075" "g.100634374G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001039537" "0" "50" "13" "100634901" "100634901" "subst" "0" "01804" "ZIC2_000076" "g.100634901C>T" "" "" "" "ZIC2(NM_007129.5):c.583C>T (p.(Arg195Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001046401" "0" "50" "13" "100637729" "100637740" "del" "0" "02325" "ZIC2_000077" "g.100637729_100637740del" "" "" "" "ZIC2(NM_007129.5):c.1392_1403delTGCGGCGGCGGC (p.A467_A470del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001054699" "0" "30" "13" "100634408" "100634410" "dup" "0" "01804" "ZIC2_000053" "g.100634408_100634410dup" "" "" "" "ZIC2(NM_007129.4):c.90_92dupGGC (p.A33dup), ZIC2(NM_007129.5):c.90_92dup (p.(Ala33dup)), ZIC2(NM_007129.5):c.90_92dupGGC (p.A33dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes ZIC2 ## Count = 74 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "{{VariantOnTranscript/Variant/Type}}" "0000005335" "00000899" "50" "1076" "-98" "1076" "-98" "c.1076-98T>C" "r.(=)" "p.(=)" "" "" "0000013277" "00000899" "50" "1059" "0" "1059" "0" "c.1059C>T" "r.(?)" "p.(=)" "" "" "0000013278" "00000899" "50" "1075" "213" "1075" "213" "c.1075+213G>A" "r.(=)" "p.(=)" "" "" "0000013279" "00000899" "50" "1076" "-98" "1076" "-98" "c.1076-98T>C" "r.(=)" "p.(=)" "" "" "0000313147" "00000899" "50" "710" "0" "718" "0" "c.710_718del" "r.(?)" "p.(His237_His239del)" "" "" "0000313148" "00000899" "30" "716" "0" "718" "0" "c.716_718del" "r.(?)" "p.(His239del)" "" "" "0000320197" "00000899" "30" "1373" "0" "1373" "0" "c.1373C>T" "r.(?)" "p.(Ala458Val)" "" "" "0000320198" "00000899" "30" "213" "0" "213" "0" "c.213G>A" "r.(?)" "p.(Pro71=)" "" "" "0000320199" "00000899" "30" "879" "0" "879" "0" "c.879C>T" "r.(?)" "p.(Gly293=)" "" "" "0000323457" "00000899" "50" "698" "0" "698" "0" "c.698A>C" "r.(?)" "p.(His233Pro)" "" "" "0000323458" "00000899" "50" "701" "0" "701" "0" "c.701A>C" "r.(?)" "p.(His234Pro)" "" "" "0000323459" "00000899" "50" "713" "0" "713" "0" "c.713A>C" "r.(?)" "p.(His238Pro)" "" "" "0000549600" "00000899" "50" "-64" "0" "-64" "0" "c.-64C>G" "r.(?)" "p.(=)" "" "" "0000549601" "00000899" "10" "213" "0" "213" "0" "c.213G>A" "r.(?)" "p.(Pro71=)" "" "" "0000549602" "00000899" "30" "397" "0" "397" "0" "c.397G>A" "r.(?)" "p.(Gly133Ser)" "" "" "0000549603" "00000899" "90" "479" "0" "479" "0" "c.479del" "r.(?)" "p.(Pro160ArgfsTer58)" "" "" "0000549604" "00000899" "70" "552" "0" "552" "0" "c.552del" "r.(?)" "p.(Gly185AlafsTer33)" "" "" "0000549606" "00000899" "50" "581" "0" "581" "0" "c.581A>G" "r.(?)" "p.(Tyr194Cys)" "" "" "0000549607" "00000899" "50" "652" "0" "652" "0" "c.652A>G" "r.(?)" "p.(Asn218Asp)" "" "" "0000549610" "00000899" "50" "694" "0" "694" "0" "c.694C>A" "r.(?)" "p.(His232Asn)" "" "" "0000549612" "00000899" "50" "704" "0" "704" "0" "c.704A>C" "r.(?)" "p.(His235Pro)" "" "" "0000549613" "00000899" "50" "707" "0" "707" "0" "c.707A>C" "r.(?)" "p.(His236Pro)" "" "" "0000549614" "00000899" "30" "707" "0" "718" "0" "c.707_718del" "r.(?)" "p.(His236_His239del)" "" "" "0000549615" "00000899" "50" "710" "0" "710" "0" "c.710A>C" "r.(?)" "p.(His237Pro)" "" "" "0000549616" "00000899" "50" "710" "0" "718" "0" "c.710_718del" "r.(?)" "p.(His237_His239del)" "" "" "0000549617" "00000899" "50" "716" "0" "716" "0" "c.716A>C" "r.(?)" "p.(His239Pro)" "" "" "0000549618" "00000899" "10" "716" "0" "718" "0" "c.716_718dup" "r.(?)" "p.(His239dup)" "" "" "0000549620" "00000899" "70" "857" "0" "857" "0" "c.857A>G" "r.(?)" "p.(His286Arg)" "" "" "0000549621" "00000899" "50" "1025" "0" "1025" "0" "c.1025A>G" "r.(?)" "p.(Lys342Arg)" "" "" "0000549622" "00000899" "90" "1090" "0" "1090" "0" "c.1090C>T" "r.(?)" "p.(Gln364Ter)" "" "" "0000549623" "00000899" "10" "1239" "18" "1239" "18" "c.1239+18G>A" "r.(=)" "p.(=)" "" "" "0000549624" "00000899" "90" "1329" "0" "1329" "0" "c.1329del" "r.(?)" "p.(Ser444AlafsTer111)" "" "" "0000549625" "00000899" "50" "1336" "0" "1336" "0" "c.1336G>A" "r.(?)" "p.(Glu446Lys)" "" "" "0000549626" "00000899" "30" "1377" "0" "1382" "0" "c.1377_1382dup" "r.(?)" "p.(Ala469_Ala470dup)" "" "" "0000549627" "00000899" "30" "1377" "0" "1388" "0" "c.1377_1388del" "r.(?)" "p.(Ala467_Ala470del)" "" "" "0000549628" "00000899" "50" "1377" "0" "1406" "0" "c.1377_1406del" "r.(?)" "p.(Ala461_Ala470del)" "" "" "0000549631" "00000899" "30" "1401" "0" "1406" "0" "c.1401_1406dup" "r.(?)" "p.(Ala469_Ala470dup)" "" "" "0000549633" "00000899" "50" "1448" "0" "1448" "0" "c.1448G>A" "r.(?)" "p.(Gly483Asp)" "" "" "0000549634" "00000899" "30" "1480" "0" "1527" "0" "c.1480_1527del" "r.(?)" "p.(Gly494_Ser509del)" "" "" "0000549636" "00000899" "50" "1501" "0" "1524" "0" "c.1501_1524del" "r.(?)" "p.(Gly501_Gly508del)" "" "" "0000549637" "00000899" "90" "1508" "0" "1520" "0" "c.1508_1520del" "r.(?)" "p.(Gly503AlafsTer48)" "" "" "0000614455" "00000899" "30" "90" "0" "92" "0" "c.90_92dup" "r.(?)" "p.(Ala33dup)" "" "" "0000614456" "00000899" "50" "593" "0" "593" "0" "c.593C>T" "r.(?)" "p.(Ala198Val)" "" "" "0000614457" "00000899" "30" "716" "0" "718" "0" "c.716_718del" "r.(?)" "p.(His239del)" "" "" "0000614458" "00000899" "50" "716" "0" "718" "0" "c.716_718dup" "r.(?)" "p.(His239dup)" "" "" "0000614459" "00000899" "50" "1377" "0" "1406" "0" "c.1377_1406del" "r.(?)" "p.(Ala461_Ala470del)" "" "" "0000614460" "00000899" "90" "1377" "0" "1406" "0" "c.1377_1406dup" "r.(?)" "p.(Ala461_Ala470dup)" "" "" "0000657219" "00000899" "50" "90" "0" "92" "0" "c.90_92dup" "r.(?)" "p.(Ala33dup)" "" "" "0000657220" "00000899" "30" "885" "0" "885" "0" "c.885G>A" "r.(?)" "p.(Pro295=)" "" "" "0000657221" "00000899" "70" "1397" "0" "1411" "0" "c.1397_1411del" "r.(?)" "p.(Ala466_Ala470del)" "" "" "0000657222" "00000899" "50" "1505" "0" "1516" "0" "c.1505_1516del" "r.(?)" "p.(Ala502_Gly505del)" "" "" "0000679700" "00000899" "30" "459" "0" "459" "0" "c.459G>T" "r.(?)" "p.(Ala153=)" "" "" "0000679701" "00000899" "50" "1383" "0" "1391" "0" "c.1383_1391del" "r.(?)" "p.(Ala468_Ala470del)" "" "" "0000691454" "00000899" "70" "1004" "0" "1004" "0" "c.1004G>T" "r.(?)" "p.(Cys335Phe)" "" "" "0000724315" "00000899" "30" "465" "0" "465" "0" "c.465C>G" "r.(?)" "p.(Gly155=)" "" "" "0000724316" "00000899" "10" "716" "0" "718" "0" "c.716_718dup" "r.(?)" "p.(His239dup)" "" "" "0000724317" "00000899" "50" "1377" "0" "1388" "0" "c.1377_1388dup" "r.(?)" "p.(Ala467_Ala470dup)" "" "" "0000763828" "00000899" "70" "734" "0" "734" "0" "c.734G>C" "r.(?)" "p.(Arg245Pro)" "" "" "0000805990" "00000899" "90" "202" "0" "202" "0" "c.202G>T" "r.(?)" "p.(Glu68*)" "" "" "0000853563" "00000899" "30" "646" "0" "646" "0" "c.646C>T" "r.(?)" "p.(Pro216Ser)" "" "" "0000863164" "00000899" "50" "197" "0" "197" "0" "c.197C>T" "r.(?)" "p.(Ala66Val)" "" "" "0000890852" "00000899" "50" "538" "0" "538" "0" "c.538C>A" "r.(?)" "p.(Arg180Ser)" "" "" "0000980524" "00000899" "50" "417" "0" "417" "0" "c.417C>G" "r.(?)" "p.(Phe139Leu)" "" "" "0000980525" "00000899" "30" "1239" "6" "1239" "6" "c.1239+6A>G" "r.(=)" "p.(=)" "" "" "0000980526" "00000899" "30" "1392" "0" "1392" "0" "c.1392T>G" "r.(?)" "p.(=)" "" "" "0001000385" "00000899" "30" "194" "0" "194" "0" "c.194G>C" "r.(?)" "p.(Gly65Ala)" "" "" "0001000386" "00000899" "30" "307" "0" "307" "0" "c.307G>A" "r.(?)" "p.(Ala103Thr)" "" "" "0001000387" "00000899" "30" "710" "0" "718" "0" "c.710_718del" "r.(?)" "p.(His237_His239del)" "" "" "0001000388" "00000899" "30" "1377" "0" "1382" "0" "c.1377_1382dup" "r.(?)" "p.(Ala469_Ala470dup)" "" "" "0001000389" "00000899" "50" "1414" "0" "1422" "0" "c.1414_1422dup" "r.(?)" "p.(Ser472_Val474dup)" "" "" "0001026238" "00000899" "30" "56" "0" "56" "0" "c.56G>A" "r.(?)" "p.(Arg19His)" "" "" "0001039537" "00000899" "50" "583" "0" "583" "0" "c.583C>T" "r.(?)" "p.(Arg195Cys)" "" "" "0001046401" "00000899" "50" "1392" "0" "1403" "0" "c.1392_1403del" "r.(?)" "p.(Ala467_Ala470del)" "" "" "0001054699" "00000899" "30" "90" "0" "92" "0" "c.90_92dup" "r.(?)" "p.(Ala33dup)" "" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 5 "{{screeningid}}" "{{variantid}}" "0000000209" "0000005335" "0000000210" "0000013277" "0000000210" "0000013278" "0000000210" "0000013279" "0000363250" "0000763828"