Individual #00088069

ID_report -
Reference -
Remarks 4 families, 5 Patients / father and mother heterozygous carriers
Gender M
Consanguinity ?
Country Germany
Population -
Age/Death -
Data_av -
Treatment -
Panel size 4
Diseases Ectopia lentis, isolated autosomal recessive
Owner name Andreas Laner


Ectopia lentis, isolated autosomal recessive (-)   Add phenotype for this disease

AscendingPhenotype ID     

Phenotype details     









0000067575 Ectopia lentis - - Familial - 3y 3y - - Andreas Laner


AscendingScreening ID     





Genes screened     

Variants found     

0000088209 DNA SEQ - - ADAMTSL4 1 Andreas Laner


1 entry on 1 page. Showing entry 1.




AscendingDNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


ClinVar ID     

dbSNP ID     









Codon change     

IDbase Accession Number     





DNA change (cDNA)     



RNA change     
















Enzyme activity     

mRNA level     



Protein level     
1 Unknown +/+ g.150526234_150526253del - c.767_786delAGGCCTCTGGCACAGAGCCC; p.(Gln256ProfsX38) - ADAMTSL4_000001 - PubMed: Neuhann 2011 - - Germline - - - 0 - Andreas Laner ADAMTSL4 - - - - - 6 NM_019032.4:c.767_786del - pathogenic r.(?) p.(Gln256Profs*38) - - - - - - - - - - - - - - - - - - -