Individual #00088084

ID_report -
Reference -
Remarks -
Gender F
Consanguinity ?
Country Germany
Population german
Age/Death -
Data_av -
Treatment -
Panel size 1
Diseases Ectopia lentis, isolated autosomal recessive
Owner name Andreas Laner


Ectopia lentis, isolated autosomal recessive (-)   Add phenotype for this disease

AscendingPhenotype ID     

Phenotype details     









0000067590 ectopia lentis, cerebral aneurysm - - Unknown - 49 45y - - Andreas Laner


AscendingScreening ID     





Genes screened     

Variants found     

0000088224 DNA;RNA SEQ - - ADAMTSL4 2 Andreas Laner


2 entries on 1 page. Showing entries 1 - 2.




AscendingDNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


ClinVar ID     

dbSNP ID     









Codon change     

IDbase Accession Number     





DNA change (cDNA)     



RNA change     
















Enzyme activity     

mRNA level     



Protein level     
1 Unknown +/+ g.150525431G>A - - - ADAMTSL4_000016 cDNA analysis on PAX-RNA and lymphocyte culture +/- puromycin confirmed complex splicing aberration, cryptic SD and SA site is used r.134_344del. RNA stable, no NMD detecte in RNA prepared without puromycin and in PAX-RNA - - - Unknown - - - 0 - Andreas Laner ADAMTSL4 - - - - - 2 NM_019032.4:c.136G>A - - r.(?) p.(Val46Ile) - - - - - - - - - - - - - - - - - - -
1 Unknown +/+ g.150526234_150526253del - c.767_786delAGGCCTCTGGCACAGAGCCC; p.(Gln256ProfsX38) - ADAMTSL4_000001 Foundermutation (Neuhann (2011) Invest Ophthalmol Vis Sci 52: 695) - - - Germline - - mgz-muenchen-al 0 - Andreas Laner ADAMTSL4 - - - - - 6 NM_019032.4:c.767_786del - - r.(?) p.(Gln256Profs*38) - - - - - - - - - - - - - - - - - - -