Individual #00172984

ID_report 19377476-Pat?
Reference PubMed: Tarpey 2009
Remarks -
Gender M
Consanguinity -
Country -
Population -
Age at death -
Data_av for details contact Lucy Raymond (flr24 @
Treatment -
Panel size 2
Diseases MRX
Owner name Lucy Raymond


mental retardation, X-linked (MRX, intellectual disability (IDX)) (MRX;IDX)   Add phenotype for this disease

AscendingPhenotype ID     

Phenotype details     










0000137848 - MRX - Familial, X-linked - - - - - - Lucy Raymond


AscendingScreening ID     





Genes screened     

Variants found     

0000173867 DNA SEQ - - ACTRT1 1 Lucy Raymond


1 entry on 1 page. Showing entry 1.




Classification method     

Clinical classification     

AscendingDNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


ClinVar ID     

dbSNP ID     









Codon change     

IDbase Accession Number     





DNA change (cDNA)     


RNA change     
















Enzyme activity     

mRNA level     



Protein level     
X Unknown ?/. - - g.112022618_112022644del - 1511_1537delTTGCTGTTGCTGCTGCTGCTGCTCCAG;V504_A513>A - AMOT_000006 variant and/or predicted effect could not be not confirmed by curators PubMed: Tarpey 2009 - - Germline - 2/208 cases - 0 - Lucy Raymond AMOT - - - - - - NM_133265.2:c.1511_1537del - r.(?) p.(Val504_Pro512del) - - - - - - - - - - - - - - - - - - -