Individual #00224052
| ID_report |
- |
| Reference |
unpublished |
| Remarks |
proband has TSC1 5'UTR variant c.-16G>A and TSC2 splice variant c.5252_5259+19del; parents not tested; intron 40 sequence inserted = CTCAGCGGGGTGTGCTGGCTGCCCAAGCTGTGGGGCGGGTGTGTGGGCAGAGCGGTTGCCACGCCTCCCAGACTTACTGCCCAAGCCGCCTCTGCCTTCAG; amino acids inserted = QRGVLAAQAVGRVCGQSGCHASQTYCPSRLCLQ |
| Gender |
? |
| Consanguinity |
- |
| Country |
- |
| Population |
- |
| Age at death |
- |
| VIP |
- |
| Data_av |
- |
| Treatment |
- |
| Panel size |
1 |
| Diseases |
TSC |
| Owner name |
Rosemary Ekong |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
Rosemary Ekong |
| Date created |
2013-02-08 20:15:16 +01:00 (CET) |
| Date last edited |
2015-03-19 03:19:23 +01:00 (CET) |
Phenotypes
tuberous sclerosis (TSC) Add phenotype for this disease
Screenings
Variants
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|