ATP-binding cassette, sub-family A (ABC1), member 12 (ABCA12) - coding DNA reference sequence

(used for variant description)

(last modified August 17, 2014)


This file was created to facilitate the description of sequence variants on transcript NM_173076.2 in the ABCA12 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_007074.1, covering ABCA12 transcript NM_173076.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                     .         .         .         .                g.5040
                     gaagagttgattgagaagtgcctcttggttaaggattaac       c.-181

 .         .         .         .         .         .                g.5100
 cacagggaaaaatccagcagaaacagaagaactgtgggtttcttaccccagccctcaagg       c.-121

 .         .         .         .         .         .                g.5160
 aagctatgccgtgaaaggggtactgatacactgacatacagcaagttggacggggcatca       c.-61

 .         .         .         .         .         .                g.5220
 gttcttcatttgtggagtggagaaaagaagaggaaatctctcatttggggcatttgaagg       c.-1

          .         .         .         .         .         .       g.5280
 ATGGCTTCCCTGTTTCATCAGCTTCAGATCCTGGTCTGGAAAAATTGGCTAGGTGTAAAA       c.60
 M  A  S  L  F  H  Q  L  Q  I  L  V  W  K  N  W  L  G  V  K         p.20

           | 02        .         .         .         .         .    g.31789
 AGGCAGCCG | CTTTGGACACTTGTCTTGATCTTATGGCCAGTCATTATTTTCATAATTTTG    c.120
 R  Q  P   | L  W  T  L  V  L  I  L  W  P  V  I  I  F  I  I  L      p.40

          .         .         .         .    | 03    .         .    g.79226
 GCTATTACTCGGACCAAATTTCCTCCAACTGCAAAACCAACTT | GTTACCTCGCACCTCGA    c.180
 A  I  T  R  T  K  F  P  P  T  A  K  P  T  C |   Y  L  A  P  R      p.60

          .         .         .         .         .         .       g.79286
 AACCTTCCTAGTACTGGATTCTTTCCATTCCTGCAGACCCTACTCTGTGACACAGACTCT       c.240
 N  L  P  S  T  G  F  F  P  F  L  Q  T  L  L  C  D  T  D  S         p.80

          .         .         .         .         .         .       g.79346
 AAATGCAAAGACACACCCTATGGCCCACAAGATCTGCTTCGTAGGAAAGGAATTGATGAT       c.300
 K  C  K  D  T  P  Y  G  P  Q  D  L  L  R  R  K  G  I  D  D         p.100

          .        | 04.         .         .         .         .    g.88806
 GCACTATTTAAAGACAG | TGAGATTCTGAGAAAGTCATCCAACCTGGATAAGGACAGCAGT    c.360
 A  L  F  K  D  S  |  E  I  L  R  K  S  S  N  L  D  K  D  S  S      p.120

          .         .         .         .          | 05        .    g.90854
 TTATCATTCCAGAGCACCCAAGTTCCAGAAAGAAGGCATGCATCACTAG | CCACAGTATTT    c.420
 L  S  F  Q  S  T  Q  V  P  E  R  R  H  A  S  L  A |   T  V  F      p.140

          .         .         .         .         .         .       g.90914
 CCCAGTCCAAGTTCTGATTTGGAAATCCCCGGAACATATACTTTCAATGGCAGTCAAGTG       c.480
 P  S  P  S  S  D  L  E  I  P  G  T  Y  T  F  N  G  S  Q  V         p.160

          .         .        | 06.         .         .         .    g.93649
 CTCGCACGAATTCTTGGCTTGGAAAAG | CTGTTAAAGCAAAATTCAACTTCAGAAGATATA    c.540
 L  A  R  I  L  G  L  E  K   | L  L  K  Q  N  S  T  S  E  D  I      p.180

          .         .         .         .         .         .       g.93709
 CGAAGAGAACTATGTGACAGCTATTCAGGATACATTGTGGATGATGCCTTCTCTTGGACC       c.600
 R  R  E  L  C  D  S  Y  S  G  Y  I  V  D  D  A  F  S  W  T         p.200

          .         .         .         .         .         .       g.93769
 TTTCTAGGAAGAAATGTTTTTAACAAATTTTGCCTTTCTAACATGACCCTTTTAGAGTCT       c.660
 F  L  G  R  N  V  F  N  K  F  C  L  S  N  M  T  L  L  E  S         p.220

          .         .         .    | 07    .         .         .    g.97439
 TCTCTCCAAGAACTAAACAAACAGTTCTCCCAG | CTATCCAGTGACCCCAACAATCAGAAG    c.720
 S  L  Q  E  L  N  K  Q  F  S  Q   | L  S  S  D  P  N  N  Q  K      p.240

          .         .         .         .         .         .       g.97499
 ATAGTGTTTCAGGAAATAGTCAGAATGCTGTCTTTCTTCTCACAAGTGCAAGAGCAGAAA       c.780
 I  V  F  Q  E  I  V  R  M  L  S  F  F  S  Q  V  Q  E  Q  K         p.260

          .         .         .         .         .         .       g.97559
 GCTGTGTGGCAGCTTCTGTCTAGTTTTCCAAATGTGTTTCAGAATGACACATCACTAAGC       c.840
 A  V  W  Q  L  L  S  S  F  P  N  V  F  Q  N  D  T  S  L  S         p.280

          .         .         .   | 08     .         .         .    g.106390
 AATCTATTTGATGTTCTTCGAAAGGCAAACAG | TGTGCTGCTGGTTGTGCAGAAGGTTTAT    c.900
 N  L  F  D  V  L  R  K  A  N  S  |  V  L  L  V  V  Q  K  V  Y      p.300

          .         .         .         .         .         .       g.106450
 CCACGTTTTGCAACTAACGAAGGTTTCAGAACCCTCCAGAAGTCTGTTAAACATCTGCTG       c.960
 P  R  F  A  T  N  E  G  F  R  T  L  Q  K  S  V  K  H  L  L         p.320

          .         .      | 09  .         .         .         .    g.111566
 TACACTCTGGACTCCCCAGCTCAAG | GTGACTCCGATAATATAACGCATGTGTGGAATGAG    c.1020
 Y  T  L  D  S  P  A  Q  G |   D  S  D  N  I  T  H  V  W  N  E      p.340

          .         .         .         .  | 10      .         .    g.116508
 GATGATGGACAGACCTTATCTCCAAGCAGTCTGGCTGCACA | GCTCCTAATTCTGGAAAAC    c.1080
 D  D  G  Q  T  L  S  P  S  S  L  A  A  Q  |  L  L  I  L  E  N      p.360

          .         .         .         .         .         .       g.116568
 TTTGAAGATGCCCTCTTAAATATATCAGCAAATAGTCCTTATATTCCTTACTTGGCATGT       c.1140
 F  E  D  A  L  L  N  I  S  A  N  S  P  Y  I  P  Y  L  A  C         p.380

          .         .         .         . | 11       .         .    g.117668
 GTGAGAAATGTGACTGACAGTTTGGCCAGAGGTTCACCAG | AAAATCTAAGACTCCTGCAG    c.1200
 V  R  N  V  T  D  S  L  A  R  G  S  P  E |   N  L  R  L  L  Q      p.400

          .         .         .         .         .         .       g.117728
 TCCACAATACGATTTAAAAAATCTTTTCTTCGCAATGGTTCCTATGAAGATTACTTTCCT       c.1260
 S  T  I  R  F  K  K  S  F  L  R  N  G  S  Y  E  D  Y  F  P         p.420

          .         .        | 12.         .         .         .    g.123664
 CCAGTTCCTGAAGTCCTAAAATCAAAA | CTGTCTCAACTTCGAAACTTGACCGAACTTCTT    c.1320
 P  V  P  E  V  L  K  S  K   | L  S  Q  L  R  N  L  T  E  L  L      p.440

          .         .         .         .         .         .       g.123724
 TGTGAATCTGAAACTTTCAGTTTGATAGAGAAGTCATGCCAGCTCTCTGATATGAGCTTT       c.1380
 C  E  S  E  T  F  S  L  I  E  K  S  C  Q  L  S  D  M  S  F         p.460

          .         .         .         .         .         .       g.123784
 GGGAGCCTGTGTGAAGAAAGTGAGTTTGATCTGCAACTCCTCGAAGCGGCAGAGCTGGGC       c.1440
 G  S  L  C  E  E  S  E  F  D  L  Q  L  L  E  A  A  E  L  G         p.480

          .         .         .         .         .         .       g.123844
 ACCGAAATAGCAGCCAGCTTACTGTACCATGACAATGTCATATCTAAAAAAGTGAGAGAT       c.1500
 T  E  I  A  A  S  L  L  Y  H  D  N  V  I  S  K  K  V  R  D         p.500

          .         .         .         .     | 13   .         .    g.123995
 TTGCTGACTGGAGATCCAAGCAAAATTAATTTAAATATGGATCA | GTTTCTAGAACAGGCA    c.1560
 L  L  T  G  D  P  S  K  I  N  L  N  M  D  Q  |  F  L  E  Q  A      p.520

          .         .         .         .         .         .       g.124055
 CTGCAAATGAATTACTTGGAAAATATCACTCAGTTAATACCGATCATAGAAGCCATGCTG       c.1620
 L  Q  M  N  Y  L  E  N  I  T  Q  L  I  P  I  I  E  A  M  L         p.540

          .         .         .        | 14.         .         .    g.125318
 CATGTCAATAACAGTGCAGATGCTTCTGAAAAGCCAG | GTCAGTTACTAGAAATGTTTAAA    c.1680
 H  V  N  N  S  A  D  A  S  E  K  P  G |   Q  L  L  E  M  F  K      p.560

          .         .         .         .         .         .       g.125378
 AATGTTGAAGAGCTGAAAGAAGATTTAAGGAGAACAACAGGAATGTCCAACAGGACTATT       c.1740
 N  V  E  E  L  K  E  D  L  R  R  T  T  G  M  S  N  R  T  I         p.580

          .         .         .         .   | 15     .         .    g.127782
 GACAAGTTGCTGGCCATTCCCATCCCTGATAATAGAGCTGAG | ATTATTTCTCAGGTGTTC    c.1800
 D  K  L  L  A  I  P  I  P  D  N  R  A  E   | I  I  S  Q  V  F      p.600

          .         .         .         .         .         .       g.127842
 TGGCTGCATTCCTGTGATACTAATATCACCACTCCCAAACTAGAAGATGCAATGAAAGAA       c.1860
 W  L  H  S  C  D  T  N  I  T  T  P  K  L  E  D  A  M  K  E         p.620

          .         .         .         .         .         .       g.127902
 TTCTGCAACCTGTCTCTTTCAGAGAGATCCCGGCAGTCTTACCTCATCGGACTCACCCTT       c.1920
 F  C  N  L  S  L  S  E  R  S  R  Q  S  Y  L  I  G  L  T  L         p.640

          .         .         .       | 16 .         .         .    g.131316
 CTGCACTACTTAAACATTTACAACTTCACATACAAG | GTGTTTTTCCCGAGGAAAGATCAA    c.1980
 L  H  Y  L  N  I  Y  N  F  T  Y  K   | V  F  F  P  R  K  D  Q      p.660

          .         .         .         .         .         .       g.131376
 AAGCCAGTAGAAAAGATGATGGAGCTCTTCATAAGACTAAAAGAGATTCTCAATCAGATG       c.2040
 K  P  V  E  K  M  M  E  L  F  I  R  L  K  E  I  L  N  Q  M         p.680

          .         .         .         .         .         .       g.131436
 GCTTCTGGCACACATCCGCTGCTAGACAAAATGAGATCCCTGAAGCAAATGCATCTGCCC       c.2100
 A  S  G  T  H  P  L  L  D  K  M  R  S  L  K  Q  M  H  L  P         p.700

          .         .  | 17      .         .         .         .    g.131817
 AGAAGTGTTCCATTAACACAG | GCAATGTACAGAAGCAACCGAATGAACACACCACAAGGA    c.2160
 R  S  V  P  L  T  Q   | A  M  Y  R  S  N  R  M  N  T  P  Q  G      p.720

          .         .         .         .         .         .       g.131877
 TCATTTAGCACCATCTCCCAAGCATTATGTTCTCAAGGAATTACCACTGAATATTTAACT       c.2220
 S  F  S  T  I  S  Q  A  L  C  S  Q  G  I  T  T  E  Y  L  T         p.740

          .         .         .         .         .         .       g.131937
 GCCATGCTGCCCTCTTCCCAGAGGCCAAAAGGCAACCACACCAAGGATTTTTTGACTTAT       c.2280
 A  M  L  P  S  S  Q  R  P  K  G  N  H  T  K  D  F  L  T  Y         p.760

          .         .         .         .         .   | 18     .    g.132965
 AAATTAACTAAAGAGCAAATTGCTTCAAAATATGGAATTCCCATAAATTCCA | CACCATTT    c.2340
 K  L  T  K  E  Q  I  A  S  K  Y  G  I  P  I  N  S  T |   P  F      p.780

          .         .         .         .         .         .       g.133025
 TGCTTCTCCCTTTATAAAGACATCATTAACATGCCCGCTGGACCTGTGATTTGGGCTTTC       c.2400
 C  F  S  L  Y  K  D  I  I  N  M  P  A  G  P  V  I  W  A  F         p.800

          .         .         .         .         .         .       g.133085
 TTGAAACCTATGTTGTTGGGAAGAATTTTGTATGCACCATATAACCCAGTCACAAAGGCA       c.2460
 L  K  P  M  L  L  G  R  I  L  Y  A  P  Y  N  P  V  T  K  A         p.820

          .   | 19     .         .         .         .         .    g.135629
 ATAATGGAAAAG | TCCAATGTAACTCTGAGACAGCTGGCGGAATTAAGAGAAAAATCTCAA    c.2520
 I  M  E  K   | S  N  V  T  L  R  Q  L  A  E  L  R  E  K  S  Q      p.840

          .         .         .         .         .         .       g.135689
 GAGTGGATGGATAAGTCGCCACTTTTCATGAATTCCTTCCATCTGTTAAACCAGGCAATT       c.2580
 E  W  M  D  K  S  P  L  F  M  N  S  F  H  L  L  N  Q  A  I         p.860

          .   | 20     .         .         .         .         .    g.139176
 CCAATGCTCCAG | AATACTCTAAGGAACCCTTTTGTGCAAGTTTTTGTAAAGTTCTCCGTG    c.2640
 P  M  L  Q   | N  T  L  R  N  P  F  V  Q  V  F  V  K  F  S  V      p.880

          .         .         .         .    | 21    .         .    g.141707
 GGACTCGATGCTGTTGAACTATTGAAACAGATAGATGAACTCG | ATATTCTAAGACTGAAA    c.2700
 G  L  D  A  V  E  L  L  K  Q  I  D  E  L  D |   I  L  R  L  K      p.900

          .         .         .         .         .         .       g.141767
 TTAGAGAACAACATTGACATCATCGATCAGCTTAACACACTATCTTCCCTGACAGTAAAT       c.2760
 L  E  N  N  I  D  I  I  D  Q  L  N  T  L  S  S  L  T  V  N         p.920

          .         .         .         .         .         .       g.141827
 ATTTCCTCTTGTGTATTATATGACCGTATTCAGGCAGCAAAAACCATAGATGAAATGGAG       c.2820
 I  S  S  C  V  L  Y  D  R  I  Q  A  A  K  T  I  D  E  M  E         p.940

          .         .         .         .    | 22    .         .    g.142424
 AGAGAGGCTAAAAGGCTCTACAAAAGCAACGAACTCTTTGGAA | GTGTTATTTTTAAGCTT    c.2880
 R  E  A  K  R  L  Y  K  S  N  E  L  F  G  S |   V  I  F  K  L      p.960

          .         .         .         .         .         .       g.142484
 CCTTCTAACAGAAGCTGGCACAGAGGCTATGACTCTGGAAATGTCTTTCTTCCTCCTGTC       c.2940
 P  S  N  R  S  W  H  R  G  Y  D  S  G  N  V  F  L  P  P  V         p.980

          .         .         .         .         .         .       g.142544
 ATAAAATATACCATCCGGATGAGTCTCAAGACCGCACAGACCACAAGAAGCCTAAGAACC       c.3000
 I  K  Y  T  I  R  M  S  L  K  T  A  Q  T  T  R  S  L  R  T         p.1000

          .         .         .         .         .         .       g.142604
 AAGATTTGGGCTCCAGGGCCACACAATTCTCCATCACACAACCAGATCTATGGCAGGGCT       c.3060
 K  I  W  A  P  G  P  H  N  S  P  S  H  N  Q  I  Y  G  R  A         p.1020

          .         .         .         .         .         .       g.142664
 TTTATTTATTTACAGGATAGTATTGAAAGAGCAATCATTGAATTGCAAACTGGAAGGAAC       c.3120
 F  I  Y  L  Q  D  S  I  E  R  A  I  I  E  L  Q  T  G  R  N         p.1040

          .         .         .         .         .          | 23    g.145619
 TCCCAGGAAATAGCAGTCCAGGTTCAAGCAATTCCTTATCCCTGCTTCATGAAAGACAA | C    c.3180
 S  Q  E  I  A  V  Q  V  Q  A  I  P  Y  P  C  F  M  K  D  N  |      p.1060

          .         .         .         .         .         .       g.145679
 TTCCTAACCAGTGTCTCTTATTCTCTTCCAATTGTGCTTATGGTTGCCTGGGTTGTATTT       c.3240
 F  L  T  S  V  S  Y  S  L  P  I  V  L  M  V  A  W  V  V  F         p.1080

          .         .         .         .         .     | 24   .    g.152402
 ATAGCTGCCTTTGTAAAAAAGCTTGTCTATGAGAAAGACCTCCGGCTTCATGAG | TACATG    c.3300
 I  A  A  F  V  K  K  L  V  Y  E  K  D  L  R  L  H  E   | Y  M      p.1100

          .         .         .         .         .         .       g.152462
 AAGATGATGGGTGTGAACTCCTGCAGCCATTTCTTTGCCTGGCTTATAGAGAGTGTTGGA       c.3360
 K  M  M  G  V  N  S  C  S  H  F  F  A  W  L  I  E  S  V  G         p.1120

          .         .         .         .         .         .       g.152522
 TTTTTACTGGTTACCATCGTGATCCTCATCATTATACTCAAGTTTGGCAATATTCTTCCT       c.3420
 F  L  L  V  T  I  V  I  L  I  I  I  L  K  F  G  N  I  L  P         p.1140

          .         .         .         .         .         .       g.152582
 AAAACAAATGGGTTCATTTTGTTCCTGTATTTTTCGGACTACAGCTTCTCGGTTATTGCC       c.3480
 K  T  N  G  F  I  L  F  L  Y  F  S  D  Y  S  F  S  V  I  A         p.1160

          .         .         .         .         .         .       g.152642
 ATGAGCTATCTTATCAGTGTCTTCTTCAACAACACCAACATTGCAGCTCTGATCGGAAGC       c.3540
 M  S  Y  L  I  S  V  F  F  N  N  T  N  I  A  A  L  I  G  S         p.1180

          .         .         .         .         .         .       g.152702
 CTCATCTACATCATTGCCTTCTTTCCATTTATTGTTCTGGTTACAGTGGAGAATGAGTTG       c.3600
 L  I  Y  I  I  A  F  F  P  F  I  V  L  V  T  V  E  N  E  L         p.1200

          .         .     | 25   .         .         .         .    g.153842
 AGCTATGTATTGAAAGTGTTCATG | AGCCTGCTGTCCCCAACAGCATTCAGCTATGCAAGC    c.3660
 S  Y  V  L  K  V  F  M   | S  L  L  S  P  T  A  F  S  Y  A  S      p.1220

          .         .         .     | 26   .         .         .    g.153990
 CAATACATTGCACGATACGAAGAACAGGGCATTG | GTCTTCAGTGGGAAAATATGTACACC    c.3720
 Q  Y  I  A  R  Y  E  E  Q  G  I  G |   L  Q  W  E  N  M  Y  T      p.1240

          .         .         .         .         .         .       g.154050
 TCCCCGGTTCAGGATGACACCACCTCATTTGGCTGGCTGTGCTGTCTAATCCTAGCTGAC       c.3780
 S  P  V  Q  D  D  T  T  S  F  G  W  L  C  C  L  I  L  A  D         p.1260

          .         .         .         .          | 27        .    g.155645
 TCTTTCATTTATTTCCTTATTGCTTGGTATGTCAGGAATGTCTTCCCAG | GGACATACGGT    c.3840
 S  F  I  Y  F  L  I  A  W  Y  V  R  N  V  F  P  G |   T  Y  G      p.1280

          .         .         .         .         .         .       g.155705
 ATGGCAGCTCCCTGGTATTTTCCAATTCTTCCTTCCTATTGGAAGGAGCGATTTGGGTGT       c.3900
 M  A  A  P  W  Y  F  P  I  L  P  S  Y  W  K  E  R  F  G  C         p.1300

          .         .         .         .         .         .       g.155765
 GCAGAGGTGAAGCCTGAGAAGAGCAATGGCCTCATGTTTACTAACATCATGATGCAGAAC       c.3960
 A  E  V  K  P  E  K  S  N  G  L  M  F  T  N  I  M  M  Q  N         p.1320

          .       | 28 .         .         .         .         .    g.156743
 ACCAACCCATCTGCCA | GTCCTGAATACATGTTTTCCTCTAACATCGAGCCTGAACCTAAA    c.4020
 T  N  P  S  A  S |   P  E  Y  M  F  S  S  N  I  E  P  E  P  K      p.1340

          .         .         .         .         .         .       g.156803
 GATCTCACAGTCGGGGTTGCCCTGCATGGGGTCACAAAGATCTATGGCTCAAAAGTTGCT       c.4080
 D  L  T  V  G  V  A  L  H  G  V  T  K  I  Y  G  S  K  V  A         p.1360

          .         .         .         .         .         .       g.156863
 GTTGATAACCTCAATCTGAACTTTTATGAAGGGCATATTACTTCATTGCTGGGGCCCAAT       c.4140
 V  D  N  L  N  L  N  F  Y  E  G  H  I  T  S  L  L  G  P  N         p.1380

          .         .    | 29    .         .         .         .    g.159599
 GGAGCTGGGAAAACTACTACCAT | TTCCATGTTAACTGGGCTGTTTGGGGCCTCAGCAGGC    c.4200
 G  A  G  K  T  T  T  I  |  S  M  L  T  G  L  F  G  A  S  A  G      p.1400

          .         .         .         .         .         .       g.159659
 ACCATTTTTGTATATGGAAAAGATATCAAAACAGACCTACACACGGTACGGAAGAACATG       c.4260
 T  I  F  V  Y  G  K  D  I  K  T  D  L  H  T  V  R  K  N  M         p.1420

          .         .         .         .         .         .       g.159719
 GGAGTCTGTATGCAGCACGACGTCTTGTTCAGTTACCTCACTACTAAGGAGCACCTTCTC       c.4320
 G  V  C  M  Q  H  D  V  L  F  S  Y  L  T  T  K  E  H  L  L         p.1440

          .         .         .         .         .         .       g.159779
 CTATATGGTTCCATCAAAGTTCCTCACTGGACTAAAAAGCAGCTCCACGAGGAAGTAAAA       c.4380
 L  Y  G  S  I  K  V  P  H  W  T  K  K  Q  L  H  E  E  V  K         p.1460

    | 30     .         .         .         .         .         .    g.161102
 AG | GACTTTAAAAGATACTGGACTATATAGCCATCGTCATAAGAGAGTTGGAACACTGTCA    c.4440
 R  |  T  L  K  D  T  G  L  Y  S  H  R  H  K  R  V  G  T  L  S      p.1480

          .         .         .         .         .         .       g.161162
 GGAGGCATGAAGAGGAAGTTATCTATATCCATAGCTCTCATTGGTGGATCAAGGGTAGTA       c.4500
 G  G  M  K  R  K  L  S  I  S  I  A  L  I  G  G  S  R  V  V         p.1500

          .         .         .         .         .         .       g.161222
 ATTTTGGATGAACCATCTACTGGAGTTGACCCATGTTCTCGCCGAAGTATATGGGATGTT       c.4560
 I  L  D  E  P  S  T  G  V  D  P  C  S  R  R  S  I  W  D  V         p.1520

          .          | 31        .         .         .         .    g.162825
 ATATCCAAGAACAAAACTG | CCAGAACAATCATTCTGTCAACGCACCACTTGGACGAGGCT    c.4620
 I  S  K  N  K  T  A |   R  T  I  I  L  S  T  H  H  L  D  E  A      p.1540

          .         .         .         .         .         .       g.162885
 GAAGTGCTGAGTGACCGCATCGCCTTCCTGGAGCAGGGTGGGCTTAGGTGCTGTGGGTCC       c.4680
 E  V  L  S  D  R  I  A  F  L  E  Q  G  G  L  R  C  C  G  S         p.1560

          .         .         .         .         .         .       g.162945
 CCATTTTACCTCAAGGAAGCCTTTGGCGATGGGTATCACCTCACGCTTACCAAGAAGAAG       c.4740
 P  F  Y  L  K  E  A  F  G  D  G  Y  H  L  T  L  T  K  K  K         p.1580

  | 32       .         .         .         .         .         .    g.164447
  | AGTCCAAATTTAAATGCAAATGCAGTATGTGACACCATGGCCGTGACAGCAATGATCCAA    c.4800
  | S  P  N  L  N  A  N  A  V  C  D  T  M  A  V  T  A  M  I  Q      p.1600

          .         .         .         .         .         .       g.164507
 TCACATCTCCCCGAAGCCTACCTCAAGGAGGATATTGGGGGAGAGCTTGTTTATGTACTT       c.4860
 S  H  L  P  E  A  Y  L  K  E  D  I  G  G  E  L  V  Y  V  L         p.1620

          .         .         .         .         .         .       g.164567
 CCTCCATTCAGCACCAAAGTCTCAGGGGCCTACCTGTCACTCCTACGGGCACTCGACAAT       c.4920
 P  P  F  S  T  K  V  S  G  A  Y  L  S  L  L  R  A  L  D  N         p.1640

          .         .         .         .         .        | 33.    g.164964
 GGCATGGGTGACCTCAACATCGGGTGCTACGGCATTTCAGATACCACCGTGGAGGAG | GTC    c.4980
 G  M  G  D  L  N  I  G  C  Y  G  I  S  D  T  T  V  E  E   | V      p.1660

          .         .         .         .         .         .       g.165024
 TTTCTGAACTTGACCAAAGAGTCACAAAAAAATAGTGCTATGAGTCTTGAGCACTTAACA       c.5040
 F  L  N  L  T  K  E  S  Q  K  N  S  A  M  S  L  E  H  L  T         p.1680

          .         .         .         .         .         .       g.165084
 CAAAAGAAAATTGGGAATTCCAATGCCAATGGCATCTCAACTCCTGACGATTTATCTGTG       c.5100
 Q  K  K  I  G  N  S  N  A  N  G  I  S  T  P  D  D  L  S  V         p.1700

          .         .         | 34         .         .         .    g.167422
 AGCAGCAGCAATTTCACAGACAGAGATG | ACAAAATCCTGACAAGAGGAGAGAGGCTGGAT    c.5160
 S  S  S  N  F  T  D  R  D  D |   K  I  L  T  R  G  E  R  L  D      p.1720

          .         .         .         .         .         .       g.167482
 GGCTTTGGACTGTTGCTGAAGAAGATCATGGCTATACTCATCAAGAGGTTCCACCACACC       c.5220
 G  F  G  L  L  L  K  K  I  M  A  I  L  I  K  R  F  H  H  T         p.1740

          .         .         .         .         .         .       g.167542
 CGCAGGAACTGGAAAGGTCTCATTGCTCAGGTTATCCTCCCCATCGTCTTTGTTACCACT       c.5280
 R  R  N  W  K  G  L  I  A  Q  V  I  L  P  I  V  F  V  T  T         p.1760

          .         .         .         .         .         .       g.167602
 GCCATGGGCCTTGGCACACTGAGAAATTCCAGCAACAGTTATCCAGAGATTCAGATCTCC       c.5340
 A  M  G  L  G  T  L  R  N  S  S  N  S  Y  P  E  I  Q  I  S         p.1780

          .         .         .         .  | 35      .         .    g.168582
 CCCTCTCTTTATGGTACCTCCGAACAGACAGCCTTCTATGC | TAATTATCACCCGAGCACG    c.5400
 P  S  L  Y  G  T  S  E  Q  T  A  F  Y  A  |  N  Y  H  P  S  T      p.1800

          .         .         .         .         .         .       g.168642
 GAAGCACTTGTCTCAGCAATGTGGGACTTCCCTGGAATTGACAACATGTGTCTGAACACC       c.5460
 E  A  L  V  S  A  M  W  D  F  P  G  I  D  N  M  C  L  N  T         p.1820

          | 36         .         .         .         .         .    g.169437
 AGTGATCT | ACAGTGTTTAAACAAAGACAGTCTGGAAAAATGGAACACCAGTGGAGAACCC    c.5520
 S  D  L  |  Q  C  L  N  K  D  S  L  E  K  W  N  T  S  G  E  P      p.1840

          .         .         .         .   | 37     .         .    g.173045
 ATCACTAATTTTGGTGTTTGCTCCTGCTCAGAAAATGTCCAG | GAATGTCCTAAATTTAAC    c.5580
 I  T  N  F  G  V  C  S  C  S  E  N  V  Q   | E  C  P  K  F  N      p.1860

          .         .         .         .         .         .       g.173105
 TATTCCCCACCGCACAGAAGAACTTACTCATCCCAGGTAATTTATAACCTCACTGGGCAA       c.5640
 Y  S  P  P  H  R  R  T  Y  S  S  Q  V  I  Y  N  L  T  G  Q         p.1880

          .         .         .         .         . | 38       .    g.174630
 CGAGTGGAAAATTATCTTATATCAACTGCAAATGAGTTTGTCCAAAAAAG | ATATGGAGGT    c.5700
 R  V  E  N  Y  L  I  S  T  A  N  E  F  V  Q  K  R  |  Y  G  G      p.1900

          .         .         .         .         .         .       g.174690
 TGGAGTTTTGGGCTGCCTTTGACAAAAGACCTTCGTTTTGATATAACAGGAGTCCCTGCC       c.5760
 W  S  F  G  L  P  L  T  K  D  L  R  F  D  I  T  G  V  P  A         p.1920

          .         | 39         .         .         .         .    g.176516
 AATAGAACACTTGCCAAG | GTATGGTATGATCCAGAAGGCTATCACTCCCTTCCAGCTTAC    c.5820
 N  R  T  L  A  K   | V  W  Y  D  P  E  G  Y  H  S  L  P  A  Y      p.1940

          .         .         .         .         .         .       g.176576
 CTCAACAGCCTGAATAATTTCCTTCTGCGAGTTAACATGTCAAAATACGATGCTGCCCGA       c.5880
 L  N  S  L  N  N  F  L  L  R  V  N  M  S  K  Y  D  A  A  R         p.1960

      | 40   .         .         .         .         .          | 41 g.184974
 CATG | GCATCATCATGTATAGCCATCCTTATCCAGGAGTGCAAGACCAAGAACAAGCCAC | A c.5940
 H  G |   I  I  M  Y  S  H  P  Y  P  G  V  Q  D  Q  E  Q  A  T  |   p.1980

          .         .         .         .         .         .       g.185034
 ATCAGCAGTTTAATCGATATTTTAGTGGCACTGTCTATCTTGATGGGCTACTCTGTCACC       c.6000
 I  S  S  L  I  D  I  L  V  A  L  S  I  L  M  G  Y  S  V  T         p.2000

          .         .         .         .         .         .       g.185094
 ACCGCCAGCTTTGTCACCTATGTTGTAAGGGAACATCAAACCAAAGCCAAACAGTTGCAG       c.6060
 T  A  S  F  V  T  Y  V  V  R  E  H  Q  T  K  A  K  Q  L  Q         p.2020

          .         .         .         .         .        | 42.    g.186652
 CACATTTCAGGCATTGGCGTGACATGCTACTGGGTAACAAACTTCATTTATGACATG | GTT    c.6120
 H  I  S  G  I  G  V  T  C  Y  W  V  T  N  F  I  Y  D  M   | V      p.2040

          .         .         .         .         .         .       g.186712
 TTCTACTTGGTGCCTGTAGCGTTTTCAATTGGTATCATTGCGATTTTCAAATTACCTGCA       c.6180
 F  Y  L  V  P  V  A  F  S  I  G  I  I  A  I  F  K  L  P  A         p.2060

          .         .         .         .         .    | 43    .    g.188073
 TTCTACAGTGAAAACAACCTAGGCGCTGTATCTCTCCTACTTCTCCTGTTTGG | GTATGCA    c.6240
 F  Y  S  E  N  N  L  G  A  V  S  L  L  L  L  L  F  G  |  Y  A      p.2080

          .         .         .         .         .         .       g.188133
 ACATTTTCCTGGATGTACTTGCTGGCTGGGCTCTTCCATGAAACAGGAATGGCCTTCATC       c.6300
 T  F  S  W  M  Y  L  L  A  G  L  F  H  E  T  G  M  A  F  I         p.2100

          .         .         .         .         .         .       g.188193
 ACTTACGTCTGTGTCAACTTGTTTTTTGGCATTAATTCCATTGTTTCCCTGTCAGTGGTA       c.6360
 T  Y  V  C  V  N  L  F  F  G  I  N  S  I  V  S  L  S  V  V         p.2120

          .         .         .    | 44    .         .         .    g.189347
 TACTTTCTTTCCAAGGAAAAGCCTAATGATCCG | ACTTTAGAACTTATTTCTGAAACCCTC    c.6420
 Y  F  L  S  K  E  K  P  N  D  P   | T  L  E  L  I  S  E  T  L      p.2140

          .         .         .         .         .         .       g.189407
 AAGCGCATTTTCCTGATTTTCCCACAATTCTGTTTTGGCTACGGTTTGATTGAACTTTCT       c.6480
 K  R  I  F  L  I  F  P  Q  F  C  F  G  Y  G  L  I  E  L  S         p.2160

          .         .         .         .         .         .       g.189467
 CAACAACAGTCGGTCCTAGACTTCTTAAAAGCATATGGAGTGGAATACCCAAATGAAACC       c.6540
 Q  Q  Q  S  V  L  D  F  L  K  A  Y  G  V  E  Y  P  N  E  T         p.2180

          .         .         .         .         .         .       g.189527
 TTTGAGATGAATAAACTAGGTGCAATGTTTGTGGCTTTGGTTTCTCAGGGCACCATGTTT       c.6600
 F  E  M  N  K  L  G  A  M  F  V  A  L  V  S  Q  G  T  M  F         p.2200

          .         .         .         .        | 45.         .    g.192357
 TTTTCCTTGCGACTCTTAATCAACGAATCCCTGATAAAGAAACTCAG | GCTTTTCTTCAGA    c.6660
 F  S  L  R  L  L  I  N  E  S  L  I  K  K  L  R  |  L  F  F  R      p.2220

          .         .         .         .         .         .       g.192417
 AAATTTAATTCTTCACATGTAAGGGAGACAATAGATGAGGATGAAGATGTGCGGGCTGAG       c.6720
 K  F  N  S  S  H  V  R  E  T  I  D  E  D  E  D  V  R  A  E         p.2240

          .         .         .         .         .         .       g.192477
 AGATTAAGAGTTGAGAGTGGTGCAGCTGAATTTGACTTGGTCCAACTTTATTGTCTCACA       c.6780
 R  L  R  V  E  S  G  A  A  E  F  D  L  V  Q  L  Y  C  L  T         p.2260

          .         .         .         .         .         .       g.192537
 AAGACCTACCAACTTATCCACAAAAAGATTATAGCTGTAAACAACATCAGCATTGGGATA       c.6840
 K  T  Y  Q  L  I  H  K  K  I  I  A  V  N  N  I  S  I  G  I         p.2280

          .   | 46     .         .         .         .         .    g.194326
 CCTGCTGGAGAG | TGTTTTGGGCTTCTTGGAGTGAATGGAGCAGGAAAGACCACTATATTC    c.6900
 P  A  G  E   | C  F  G  L  L  G  V  N  G  A  G  K  T  T  I  F      p.2300

          .         .         .         .         .         .       g.194386
 AAGATGCTGACAGGAGACATCATTCCTTCAAGTGGAAACATTCTGATCAGAAATAAGACC       c.6960
 K  M  L  T  G  D  I  I  P  S  S  G  N  I  L  I  R  N  K  T         p.2320

    | 47     .         .         .         .         .         .    g.194748
 GG | ATCTCTGGGTCACGTTGATTCTCACAGCTCATTAGTTGGCTACTGTCCTCAGGAAGAT    c.7020
 G  |  S  L  G  H  V  D  S  H  S  S  L  V  G  Y  C  P  Q  E  D      p.2340

          .         .         .         .         .         .       g.194808
 GCCTTAGATGACCTGGTAACTGTGGAAGAACATTTGTATTTCTATGCCAGGGTACATGGA       c.7080
 A  L  D  D  L  V  T  V  E  E  H  L  Y  F  Y  A  R  V  H  G         p.2360

          .         .     | 48   .         .         .         .    g.195907
 ATTCCAGAAAAGGATATTAAAGAA | ACTGTTCATAAACTCCTTAGGAGACTTCACCTGATG    c.7140
 I  P  E  K  D  I  K  E   | T  V  H  K  L  L  R  R  L  H  L  M      p.2380

          .         .         .         .         .         .       g.195967
 CCCTTCAAGGACAGAGCTACCTCTATGTGCAGTTATGGCACAAAAAGAAAATTATCCACT       c.7200
 P  F  K  D  R  A  T  S  M  C  S  Y  G  T  K  R  K  L  S  T         p.2400

          .         .         .          | 49        .         .    g.198344
 GCACTGGCCTTGATAGGGAAACCTTCCATTCTACTGCTG | GATGAGCCGAGCTCTGGCATG    c.7260
 A  L  A  L  I  G  K  P  S  I  L  L  L   | D  E  P  S  S  G  M      p.2420

          .         .         .         .         .         .       g.198404
 GATCCGAAGTCGAAACGGCACCTCTGGAAGATCATTTCAGAAGAAGTACAGAACAAATGT       c.7320
 D  P  K  S  K  R  H  L  W  K  I  I  S  E  E  V  Q  N  K  C         p.2440

          .         .    | 50    .         .         .         .    g.200447
 TCCGTCATCCTCACATCTCACAG | CATGGAAGAATGTGAAGCTCTCTGTACCAGGTTGGCC    c.7380
 S  V  I  L  T  S  H  S  |  M  E  E  C  E  A  L  C  T  R  L  A      p.2460

          .         .         .         .         .       | 51 .    g.205816
 ATTATGGTGAATGGAAAGTTTCAATGTATTGGATCTTTGCAGCACATAAAGAGCAG | GTTT    c.7440
 I  M  V  N  G  K  F  Q  C  I  G  S  L  Q  H  I  K  S  R  |  F      p.2480

          .         .         .         .         .         .       g.205876
 GGACGAGGATTTACTGTCAAAGTTCACTTGAAGAATAACAAAGTGACCATGGAGACCCTC       c.7500
 G  R  G  F  T  V  K  V  H  L  K  N  N  K  V  T  M  E  T  L         p.2500

          .         .         .         .   | 52     .         .    g.209230
 ACAAAGTTCATGCAGCTGCACTTTCCAAAAACATACTTAAAA | GATCAGCACCTCAGCATG    c.7560
 T  K  F  M  Q  L  H  F  P  K  T  Y  L  K   | D  Q  H  L  S  M      p.2520

          .         .         .         .         .         .       g.209290
 CTAGAGTATCATGTACCAGTCACAGCAGGAGGAGTCGCAAACATTTTTGATCTGCTGGAA       c.7620
 L  E  Y  H  V  P  V  T  A  G  G  V  A  N  I  F  D  L  L  E         p.2540

          .         .         .         .         .         .       g.209350
 ACCAACAAGACTGCTTTAAATATTACAAATTTCTTAGTGAGTCAGACCACTCTGGAAGAG       c.7680
 T  N  K  T  A  L  N  I  T  N  F  L  V  S  Q  T  T  L  E  E         p.2560

  | 53       .         .         .         .         .         .    g.210746
  | GTTTTCATCAACTTTGCCAAAGACCAGAAGTCCTATGAAACTGCTGATACCAGCAGCCAA    c.7740
  | V  F  I  N  F  A  K  D  Q  K  S  Y  E  T  A  D  T  S  S  Q      p.2580

          .         .         .         .                           g.210794
 GGTTCCACTATAAGTGTTGACTCACAAGATGACCAGATGGAGTCTTAA                   c.7788
 G  S  T  I  S  V  D  S  Q  D  D  Q  M  E  S  X                     p.2595

          .         .         .         .         .         .       g.210854
 cacttccagcaaactcaatctcagcgtgtgaccaatggcttcattttgaagaaaagccac       c.*60

          .         .         .         .         .         .       g.210914
 agaagatacacttccgcaagatatcttcattttaaagtaaagtaatatactgtatggaaa       c.*120

          .         .         .         .         .         .       g.210974
 gttacaactgtgttagactaacaagtaattataaaaggaaatttttccttctaaggtcag       c.*180

          .         .         .         .         .         .       g.211034
 tgagtgttgttgctactgaaatgaattcctgtatactcaacactgtgagcatgctaatgt       c.*240

          .         .         .         .         .         .       g.211094
 atatgctggtgattcttatgcaaaggtgaagccacctcaagatgaatatcttaatttatt       c.*300

          .         .         .         .         .         .       g.211154
 actttcaataaaaagacagtttaaaaggcatggattttggtagttgaaatataagagtgg       c.*360

          .         .         .         .         .         .       g.211214
 agaagaaaagtcagatggtttgtggcaggtgccaccgggcaagcagacaacataatttat       c.*420

          .         .         .         .         .         .       g.211274
 ttccagaaaacaacagaatgaacatcatcatgaatacatgaatcggctgtgatgtgtgaa       c.*480

          .         .         .         .         .         .       g.211334
 ctgctaagggccaaatgaacgtttgcagagcagtgggcacaatgtttacaatgtatgtgt       c.*540

          .         .         .         .         .         .       g.211394
 atgtcactttcggtacctgtgaatgcatggggacgtgctgaacccgaaaaaaagtgcctt       c.*600

          .         .         .         .         .         .       g.211454
 tccataaggactgcaatagagagggcaatttaccctggtggtacacggaacctagattca       c.*660

          .         .         .         .         .         .       g.211514
 ctcctgccatgccttgccaatagtaagctgcagggtggaacaagaaatcacttgctctgg       c.*720

          .         .         .         .         .         .       g.211574
 ggggaagggaggggggaatgggtgtgtcagctgggtagatacaaaccctgaaaagagaat       c.*780

          .         .         .         .         .         .       g.211634
 ccatgtgctactggcaggcaacattttttaaagctctttcagaaaccctcatatttgggg       c.*840

          .         .         .         .         .         .       g.211694
 tttcttttcaggaaacattcctgtggagggaaaacgaatatgaagataattttcagctaa       c.*900

          .         .         .         .         .         .       g.211754
 ttatctgggtgacccagaatcgtgtatatggctataggatagacttcttaataatggcaa       c.*960

          .         .         .         .         .         .       g.211814
 gtgacgtggccctggggaaaggtgctttatgtaccgtgtgtgcgtgtatgtgtgtgtatc       c.*1020

          .         .         .         .         .         .       g.211874
 tatacaagtttgtcagctttggcatgactgtttgtctcgaaaaccaataaactcaaagtt       c.*1080

          .                                                         g.211886
 tagaaaaactca                                                       c.*1092

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The ATP-binding cassette, sub-family A (ABC1), member 12 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 11
©2004-2014 Leiden University Medical Center