ATP-binding cassette, sub-family B (MDR/TAP), member 11 (ABCB11) - coding DNA reference sequence

(used for variant description)

(last modified May 30, 2018)


This file was created to facilitate the description of sequence variants on transcript NM_003742.2 in the ABCB11 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_007374.1, covering ABCB11 transcript NM_003742.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                                    g.5006
                                                       gaatga       c.-121

 .         .         .         .         .         .                g.5066
 tgaaaaccgaggttggaaaaggttgtgaaaccttttaactctccacagtggagtccatta       c.-61

 .         .         .         .   | 02     .         .             g.18198
 tttcctctggcttcctcaaattcatattcacag | ggtcgttggctgtgggttgcaattacc    c.-1

          .         .         .         .         .         .       g.18258
 ATGTCTGACTCAGTAATTCTTCGAAGTATAAAGAAATTTGGAGAGGAGAATGATGGTTTT       c.60
 M  S  D  S  V  I  L  R  S  I  K  K  F  G  E  E  N  D  G  F         p.20

          .       | 03 .         .         | 04         .         . g.21991
 GAGTCAGATAAATCAT | ATAATAATGATAAGAAATCAAG | GTTACAAGATGAGAAGAAAGGT c.120
 E  S  D  K  S  Y |   N  N  D  K  K  S  R  |  L  Q  D  E  K  K  G   p.40

          .         .         . | 05       .         .         .    g.22843
 GATGGCGTTAGAGTTGGCTTCTTTCAATTG | TTTCGGTTTTCTTCATCAACTGACATTTGG    c.180
 D  G  V  R  V  G  F  F  Q  L   | F  R  F  S  S  S  T  D  I  W      p.60

          .         .         .         .         .         .       g.22903
 CTGATGTTTGTGGGAAGTTTGTGTGCATTTCTCCATGGAATAGCCCAGCCAGGCGTGCTA       c.240
 L  M  F  V  G  S  L  C  A  F  L  H  G  I  A  Q  P  G  V  L         p.80

          .         .         .         .         .         .       g.22963
 CTCATTTTTGGCACAATGACAGATGTTTTTATTGACTACGACGTTGAGTTACAAGAACTC       c.300
 L  I  F  G  T  M  T  D  V  F  I  D  Y  D  V  E  L  Q  E  L         p.100

          .         .         .         .         .         .       g.23023
 CAGATTCCAGGAAAAGCATGTGTGAATAACACCATTGTATGGACTAACAGTTCCCTCAAC       c.360
 Q  I  P  G  K  A  C  V  N  N  T  I  V  W  T  N  S  S  L  N         p.120

          .         .          | 06        .         .         .    g.39632
 CAGAACATGACAAATGGAACACGTTGTGG | GTTGCTGAACATCGAGAGCGAAATGATCAAA    c.420
 Q  N  M  T  N  G  T  R  C  G  |  L  L  N  I  E  S  E  M  I  K      p.140

          .         .         .         .         .        | 07.    g.40844
 TTTGCCAGTTACTATGCTGGAATTGCTGTCGCAGTACTTATCACAGGATATATTCAA | ATA    c.480
 F  A  S  Y  Y  A  G  I  A  V  A  V  L  I  T  G  Y  I  Q   | I      p.160

          .         .         .         .         .         .       g.40904
 TGCTTTTGGGTCATTGCCGCAGCTCGTCAGATACAGAAAATGAGAAAATTTTACTTTAGG       c.540
 C  F  W  V  I  A  A  A  R  Q  I  Q  K  M  R  K  F  Y  F  R         p.180

          .         .         .         .         .         .       g.40964
 AGAATAATGAGAATGGAAATAGGGTGGTTTGACTGCAATTCAGTGGGGGAGCTGAATACA       c.600
 R  I  M  R  M  E  I  G  W  F  D  C  N  S  V  G  E  L  N  T         p.200

          .  | 08      .         .         .         .         .    g.42490
 AGATTCTCTGA | TGATATTAATAAAATCAATGATGCCATAGCTGACCAAATGGCCCTTTTC    c.660
 R  F  S  D  |  D  I  N  K  I  N  D  A  I  A  D  Q  M  A  L  F      p.220

          .         .         .         .         .         .       g.42550
 ATTCAGCGCATGACCTCGACCATCTGTGGTTTCCTGTTGGGATTTTTCAGGGGTTGGAAA       c.720
 I  Q  R  M  T  S  T  I  C  G  F  L  L  G  F  F  R  G  W  K         p.240

          .         .         .         .         .         .       g.42610
 CTGACCTTGGTTATTATTTCTGTCAGCCCTCTCATTGGGATTGGAGCAGCCACCATTGGT       c.780
 L  T  L  V  I  I  S  V  S  P  L  I  G  I  G  A  A  T  I  G         p.260

     | 09    .         .         .         .         .         .    g.45455
 CTG | AGTGTGTCCAAGTTTACGGACTATGAGCTGAAGGCCTATGCCAAAGCAGGGGTGGTG    c.840
 L   | S  V  S  K  F  T  D  Y  E  L  K  A  Y  A  K  A  G  V  V      p.280

          .         .         .         .         .         .       g.45515
 GCTGATGAAGTCATTTCATCAATGAGAACAGTGGCTGCTTTTGGTGGTGAGAAAAGAGAG       c.900
 A  D  E  V  I  S  S  M  R  T  V  A  A  F  G  G  E  K  R  E         p.300

          | 10         .         .         .         .         .    g.50091
 GTTGAAAG | GTATGAGAAAAATCTTGTGTTCGCCCAGCGTTGGGGAATTAGAAAAGGAATA    c.960
 V  E  R  |  Y  E  K  N  L  V  F  A  Q  R  W  G  I  R  K  G  I      p.320

          .         .         .         .         .         .       g.50151
 GTGATGGGATTCTTTACTGGATTCGTGTGGTGTCTCATCTTTTTGTGTTATGCACTGGCC       c.1020
 V  M  G  F  F  T  G  F  V  W  C  L  I  F  L  C  Y  A  L  A         p.340

          .         .         .         .         .         .       g.50211
 TTCTGGTACGGCTCCACACTTGTCCTGGATGAAGGAGAATATACACCAGGAACCCTTGTC       c.1080
 F  W  Y  G  S  T  L  V  L  D  E  G  E  Y  T  P  G  T  L  V         p.360

     | 11    .         .         .         .         .         .    g.56401
 CAG | ATTTTCCTCAGTGTCATAGTAGGAGCTTTAAATCTTGGCAATGCCTCTCCTTGTTTG    c.1140
 Q   | I  F  L  S  V  I  V  G  A  L  N  L  G  N  A  S  P  C  L      p.380

          .         .         .         .         .        | 12.    g.59639
 GAAGCCTTTGCAACTGGACGTGCAGCAGCCACCAGCATTTTTGAGACAATAGACAGG | AAA    c.1200
 E  A  F  A  T  G  R  A  A  A  T  S  I  F  E  T  I  D  R   | K      p.400

          .         .         .         .         .         .       g.59699
 CCCATCATTGACTGCATGTCAGAAGATGGTTACAAGTTGGATCGAATCAAGGGTGAAATT       c.1260
 P  I  I  D  C  M  S  E  D  G  Y  K  L  D  R  I  K  G  E  I         p.420

          .         .         .         .         | 13         .    g.62495
 GAATTCCATAATGTGACCTTCCATTATCCTTCCAGACCAGAGGTGAAG | ATTCTAAATGAC    c.1320
 E  F  H  N  V  T  F  H  Y  P  S  R  P  E  V  K   | I  L  N  D      p.440

          .         .         .         .         .         .       g.62555
 CTCAACATGGTCATTAAACCAGGGGAAATGACAGCTCTGGTAGGACCCAGTGGAGCTGGA       c.1380
 L  N  M  V  I  K  P  G  E  M  T  A  L  V  G  P  S  G  A  G         p.460

          .         .         .         .         .     | 14   .    g.64279
 AAAAGTACAGCACTGCAACTCATTCAGCGATTCTATGACCCCTGTGAAGGAATG | GTGACC    c.1440
 K  S  T  A  L  Q  L  I  Q  R  F  Y  D  P  C  E  G  M   | V  T      p.480

          .         .         .         .         .         .       g.64339
 GTGGATGGCCATGACATTCGCTCTCTTAACATTCAGTGGCTTAGAGATCAGATTGGGATA       c.1500
 V  D  G  H  D  I  R  S  L  N  I  Q  W  L  R  D  Q  I  G  I         p.500

          .         .         .         .         .         .       g.64399
 GTGGAGCAAGAGCCAGTTCTGTTCTCTACCACCATTGCAGAAAATATTCGCTATGGCAGA       c.1560
 V  E  Q  E  P  V  L  F  S  T  T  I  A  E  N  I  R  Y  G  R         p.520

          .         .         .         .         .         .       g.64459
 GAAGATGCAACAATGGAAGACATAGTCCAAGCTGCCAAGGAGGCCAATGCCTACAACTTC       c.1620
 E  D  A  T  M  E  D  I  V  Q  A  A  K  E  A  N  A  Y  N  F         p.540

          .         | 15         .         .         .         .    g.66150
 ATCATGGACCTGCCACAG | CAATTTGACACCCTTGTTGGAGAAGGAGGAGGCCAGATGAGT    c.1680
 I  M  D  L  P  Q   | Q  F  D  T  L  V  G  E  G  G  G  Q  M  S      p.560

          .         .         .         .         .         .       g.66210
 GGTGGCCAGAAACAAAGGGTAGCTATCGCCAGAGCCCTCATCCGAAATCCCAAGATTCTG       c.1740
 G  G  Q  K  Q  R  V  A  I  A  R  A  L  I  R  N  P  K  I  L         p.580

          .         .         .         .         .         .       g.66270
 CTTTTGGACATGGCCACCTCAGCTCTGGACAATGAGAGTGAAGCCATGGTGCAAGAAGTG       c.1800
 L  L  D  M  A  T  S  A  L  D  N  E  S  E  A  M  V  Q  E  V         p.600

           | 16        .         .         .         .         .    g.66823
 CTGAGTAAG | ATTCAGCATGGGCACACAATCATTTCAGTTGCTCATCGCTTGTCTACGGTC    c.1860
 L  S  K   | I  Q  H  G  H  T  I  I  S  V  A  H  R  L  S  T  V      p.620

          .         .         .         .         .         .       g.66883
 AGAGCTGCAGATACCATCATTGGTTTTGAACATGGCACTGCAGTGGAAAGAGGGACCCAT       c.1920
 R  A  A  D  T  I  I  G  F  E  H  G  T  A  V  E  R  G  T  H         p.640

          .         .         .         .         .         .       g.66943
 GAAGAATTACTGGAAAGGAAAGGTGTTTACTTCACTCTAGTGACTTTGCAAAGCCAGGGA       c.1980
 E  E  L  L  E  R  K  G  V  Y  F  T  L  V  T  L  Q  S  Q  G         p.660

          .         .         .  | 17      .         .         .    g.67862
 AATCAAGCTCTTAATGAAGAGGACATAAAGG | ATGCAACTGAAGATGACATGCTTGCGAGG    c.2040
 N  Q  A  L  N  E  E  D  I  K  D |   A  T  E  D  D  M  L  A  R      p.680

          .         .         .      | 18  .         .         .    g.72040
 ACCTTTAGCAGAGGGAGCTACCAGGATAGTTTAAG | GGCTTCCATCCGGCAACGCTCCAAG    c.2100
 T  F  S  R  G  S  Y  Q  D  S  L  R  |  A  S  I  R  Q  R  S  K      p.700

          .         .         .         .         .         .       g.72100
 TCTCAGCTTTCTTACCTGGTGCACGAACCTCCATTAGCTGTTGTAGATCATAAGTCTACC       c.2160
 S  Q  L  S  Y  L  V  H  E  P  P  L  A  V  V  D  H  K  S  T         p.720

          .         | 19         .         .         .         .    g.78237
 TATGAAGAAGATAGAAAG | GACAAGGACATTCCTGTGCAGGAAGAAGTTGAACCTGCCCCA    c.2220
 Y  E  E  D  R  K   | D  K  D  I  P  V  Q  E  E  V  E  P  A  P      p.740

          .         .         .         .         .         .       g.78297
 GTTAGGAGGATTCTGAAATTCAGTGCTCCAGAATGGCCCTACATGCTGGTAGGGTCTGTG       c.2280
 V  R  R  I  L  K  F  S  A  P  E  W  P  Y  M  L  V  G  S  V         p.760

          .         .         .         .         .         .       g.78357
 GGTGCAGCTGTGAACGGGACAGTCACACCCTTGTATGCCTTTTTATTCAGCCAGATTCTT       c.2340
 G  A  A  V  N  G  T  V  T  P  L  Y  A  F  L  F  S  Q  I  L         p.780

     | 20    .         .         .         .         .         .    g.91419
 GGG | ACTTTTTCAATTCCTGATAAAGAGGAACAAAGGTCACAGATCAATGGTGTGTGCCTA    c.2400
 G   | T  F  S  I  P  D  K  E  E  Q  R  S  Q  I  N  G  V  C  L      p.800

          .         .         .         .         | 21         .    g.91569
 CTTTTTGTAGCAATGGGCTGTGTATCTCTTTTCACCCAATTTCTACAG | GGATATGCCTTT    c.2460
 L  F  V  A  M  G  C  V  S  L  F  T  Q  F  L  Q   | G  Y  A  F      p.820

          .         .         .         .         .         .       g.91629
 GCTAAATCTGGGGAGCTCCTAACAAAAAGGCTACGTAAATTTGGTTTCAGGGCAATGCTG       c.2520
 A  K  S  G  E  L  L  T  K  R  L  R  K  F  G  F  R  A  M  L         p.840

          .         .         .         .         .         .       g.91689
 GGGCAAGATATTGCCTGGTTTGATGACCTCAGAAATAGCCCTGGAGCATTGACAACAAGA       c.2580
 G  Q  D  I  A  W  F  D  D  L  R  N  S  P  G  A  L  T  T  R         p.860

          .         .         . | 22       .         .         .    g.99920
 CTTGCTACAGATGCTTCCCAAGTTCAAGGG | GCTGCCGGCTCTCAGATCGGGATGATAGTC    c.2640
 L  A  T  D  A  S  Q  V  Q  G   | A  A  G  S  Q  I  G  M  I  V      p.880

          .         .         .         .         .         .       g.99980
 AATTCCTTCACTAACGTCACTGTGGCCATGATCATTGCCTTCTCCTTTAGCTGGAAGCTG       c.2700
 N  S  F  T  N  V  T  V  A  M  I  I  A  F  S  F  S  W  K  L         p.900

          .         .         .         .         .         .       g.100040
 AGCCTGGTCATCTTGTGCTTCTTCCCCTTCTTGGCTTTATCAGGAGCCACACAGACCAGG       c.2760
 S  L  V  I  L  C  F  F  P  F  L  A  L  S  G  A  T  Q  T  R         p.920

          .         .         .         .         .     | 23   .    g.100904
 ATGTTGACAGGATTTGCCTCTCGAGATAAGCAGGCCCTGGAGATGGTGGGACAG | ATTACA    c.2820
 M  L  T  G  F  A  S  R  D  K  Q  A  L  E  M  V  G  Q   | I  T      p.940

          .         .         .         .         .         .       g.100964
 AATGAAGCCCTCAGTAACATCCGCACTGTTGCTGGAATTGGAAAGGAGAGGCGGTTCATT       c.2880
 N  E  A  L  S  N  I  R  T  V  A  G  I  G  K  E  R  R  F  I         p.960

          .         .         .         .         .         .       g.101024
 GAAGCACTTGAGACTGAGCTGGAGAAGCCCTTCAAGACAGCCATTCAGAAAGCCAATATT       c.2940
 E  A  L  E  T  E  L  E  K  P  F  K  T  A  I  Q  K  A  N  I         p.980

          .         .         .         .         .         .       g.101084
 TACGGATTCTGCTTTGCCTTTGCCCAGTGCATCATGTTTATTGCGAATTCTGCTTCCTAC       c.3000
 Y  G  F  C  F  A  F  A  Q  C  I  M  F  I  A  N  S  A  S  Y         p.1000

          .         .         .         .         .       | 24 .    g.103794
 AGATATGGAGGTTACTTAATCTCCAATGAGGGGCTCCATTTCAGCTATGTGTTCAG | GGTG    c.3060
 R  Y  G  G  Y  L  I  S  N  E  G  L  H  F  S  Y  V  F  R  |  V      p.1020

          .         .         .         .         .         .       g.103854
 ATCTCTGCAGTTGTACTGAGTGCAACAGCTCTTGGAAGAGCCTTCTCTTACACCCCAAGT       c.3120
 I  S  A  V  V  L  S  A  T  A  L  G  R  A  F  S  Y  T  P  S         p.1040

          .         .         .         .         .         .       g.103914
 TATGCAAAAGCTAAAATATCAGCTGCACGCTTTTTTCAACTGCTGGACCGACAACCCCCA       c.3180
 Y  A  K  A  K  I  S  A  A  R  F  F  Q  L  L  D  R  Q  P  P         p.1060

          .         .         .    | 25    .         .         .    g.105488
 ATCAGTGTATACAATACTGCAGGTGAAAAATGG | GACAACTTCCAGGGGAAGATTGATTTT    c.3240
 I  S  V  Y  N  T  A  G  E  K  W   | D  N  F  Q  G  K  I  D  F      p.1080

          .         .         .         .         .         .       g.105548
 GTTGATTGTAAATTTACATATCCTTCTCGACCTGACTCGCAAGTTCTGAATGGTCTCTCA       c.3300
 V  D  C  K  F  T  Y  P  S  R  P  D  S  Q  V  L  N  G  L  S         p.1100

          .         .         .         .         .         .       g.105608
 GTGTCGATTAGTCCAGGGCAGACACTGGCGTTTGTTGGGAGCAGTGGATGTGGCAAAAGC       c.3360
 V  S  I  S  P  G  Q  T  L  A  F  V  G  S  S  G  C  G  K  S         p.1120

          .         .         .         .         .  | 26      .    g.108970
 ACTAGCATTCAGCTGTTGGAACGTTTCTATGATCCTGATCAAGGGAAGGTG | ATGATAGAT    c.3420
 T  S  I  Q  L  L  E  R  F  Y  D  P  D  Q  G  K  V   | M  I  D      p.1140

          .         .         .         .         .         .       g.109030
 GGTCATGACAGCAAAAAAGTAAATGTCCAGTTCCTCCGCTCAAACATTGGAATTGTTTCC       c.3480
 G  H  D  S  K  K  V  N  V  Q  F  L  R  S  N  I  G  I  V  S         p.1160

          .         .         .         .         .         .       g.109090
 CAGGAACCAGTGTTGTTTGCCTGTAGCATAATGGACAATATCAAGTATGGAGACAACACC       c.3540
 Q  E  P  V  L  F  A  C  S  I  M  D  N  I  K  Y  G  D  N  T         p.1180

          .         .         .         .         .         .       g.109150
 AAAGAAATTCCCATGGAAAGAGTCATAGCAGCTGCAAAACAGGCTCAGCTGCATGATTTT       c.3600
 K  E  I  P  M  E  R  V  I  A  A  A  K  Q  A  Q  L  H  D  F         p.1200

          .         | 27         .         .         .         .    g.111562
 GTCATGTCACTCCCAGAG | AAATATGAAACTAACGTTGGGTCCCAGGGGTCTCAACTCTCT    c.3660
 V  M  S  L  P  E   | K  Y  E  T  N  V  G  S  Q  G  S  Q  L  S      p.1220

          .         .         .         .         .         .       g.111622
 AGAGGGGAGAAACAACGCATTGCTATTGCTCGGGCCATTGTACGAGATCCTAAAATCTTG       c.3720
 R  G  E  K  Q  R  I  A  I  A  R  A  I  V  R  D  P  K  I  L         p.1240

          .         .         .         .      | 28  .         .    g.112516
 CTACTAGATGAAGCCACTTCTGCCTTAGACACAGAAAGTGAAAAG | ACGGTGCAGGTTGCT    c.3780
 L  L  D  E  A  T  S  A  L  D  T  E  S  E  K   | T  V  Q  V  A      p.1260

          .         .         .         .         .         .       g.112576
 CTAGACAAAGCCAGAGAGGGTCGGACCTGCATTGTCATTGCCCATCGCTTGTCCACCATC       c.3840
 L  D  K  A  R  E  G  R  T  C  I  V  I  A  H  R  L  S  T  I         p.1280

          .         .         .         .         .         .       g.112636
 CAGAACGCGGATATCATTGCTGTCATGGCACAGGGGGTGGTGATTGAAAAGGGGACCCAT       c.3900
 Q  N  A  D  I  I  A  V  M  A  Q  G  V  V  I  E  K  G  T  H         p.1300

          .         .         .         .         .         .       g.112696
 GAAGAACTGATGGCCCAAAAAGGAGCCTACTACAAACTAGTCACCACTGGATCCCCCATC       c.3960
 E  E  L  M  A  Q  K  G  A  Y  Y  K  L  V  T  T  G  S  P  I         p.1320

                                                                    g.112702
 AGTTGA                                                             c.3966
 S  X                                                               p.1321

          .         .         .         .         .         .       g.112762
 cccaatgcaagaatctcagacacacatgacgcaccagttacaggggttgtttttaaagaa       c.*60

          .         .         .         .         .         .       g.112822
 aaaaacaatcccagcaggagggattgctgggattgttttttctttaaagaagaatgttaa       c.*120

          .         .         .         .         .         .       g.112882
 tattttacttttacagtcattttcctacatcggaatccaagctaatttctaatggccttc       c.*180

          .         .         .         .         .         .       g.112942
 cataataattctgctttagatgtgtatacagaaaatgaaagaaactagggtccatatgag       c.*240

          .         .         .         .         .         .       g.113002
 ggaaaacccaatgtcaagtggcagctcagccaccactcagtgcttctctgtgcaggagcc       c.*300

          .         .         .         .         .         .       g.113062
 agtcctgattaatatgtgggaattagtgagacatcagggagtaagtgacactttgaactc       c.*360

          .         .         .         .         .         .       g.113122
 ctcaagggcagagaactgtctttcatttttgaaccctcggtgtacacagaggcgggtcta       c.*420

          .         .         .         .         .         .       g.113182
 taacaggcaatcaacaaacgtttcttgagctagaccaaggtcagatttgaaaagaacaga       c.*480

          .         .         .         .         .         .       g.113242
 aggactgaagaccagctgtgtttcttaactaaatttgtctttcaagtgaaaccagcttcc       c.*540

          .         .         .         .         .         .       g.113302
 ttcatctctaaggctaaggatagggaaagggtggatgctctcaggctgagggaggcagaa       c.*600

          .         .         .         .         .         .       g.113362
 agggaaagtattagcatgagctttccagttagggctgttgatttatgctttaacttcaga       c.*660

          .         .                                               g.113385
 gtgagtgtaggggtggtgatgct                                            c.*683

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The ATP-binding cassette, sub-family B (MDR/TAP), member 11 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 21
©2004-2018 Leiden University Medical Center