ATP-binding cassette, sub-family B (MDR/TAP), member 4 (ABCB4) - coding DNA reference sequence

(used for variant description)

(last modified November 25, 2015)


This file was created to facilitate the description of sequence variants on transcript NM_018849.2 in the ABCB4 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_007118.1, covering ABCB4 transcript NM_018849.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                   .                g.9745
                                             caaagtccaggcccct       c.-61

 .         .         .         .         .         .    | 02        g.9967
 ctgctgcagcgcccgcgcgtccagaggccctgccagacacgcgcgaggttcgag | gctgag    c.-1

          .         .         .         .         .         .       g.10027
 ATGGATCTTGAGGCGGCAAAGAACGGAACAGCCTGGCGCCCCACGAGCGCGGAGGGCGAC       c.60
 M  D  L  E  A  A  K  N  G  T  A  W  R  P  T  S  A  E  G  D         p.20

          .         . | 03       .         .         .         .    g.12797
 TTTGAACTGGGCATCAGCAG | CAAACAAAAAAGGAAAAAAACGAAGACAGTGAAAATGATT    c.120
 F  E  L  G  I  S  S  |  K  Q  K  R  K  K  T  K  T  V  K  M  I      p.40

          .      | 04  .         .         .         .         .    g.22569
 GGAGTATTAACATTG | TTTCGATACTCCGATTGGCAGGATAAATTGTTTATGTCGCTGGGT    c.180
 G  V  L  T  L   | F  R  Y  S  D  W  Q  D  K  L  F  M  S  L  G      p.60

          .         .         .         .         .         .       g.22629
 ACCATCATGGCCATAGCTCACGGATCAGGTCTCCCCCTCATGATGATAGTATTTGGAGAG       c.240
 T  I  M  A  I  A  H  G  S  G  L  P  L  M  M  I  V  F  G  E         p.80

          .         .         .         .       | 05 .         .    g.30854
 ATGACTGACAAATTTGTTGATACTGCAGGAAACTTCTCCTTTCCAG | TGAACTTTTCCTTG    c.300
 M  T  D  K  F  V  D  T  A  G  N  F  S  F  P  V |   N  F  S  L      p.100

          .         .         .         .     | 06   .         .    g.32313
 TCGCTGCTAAATCCAGGCAAAATTCTGGAAGAAGAAATGACTAG | ATATGCATATTACTAC    c.360
 S  L  L  N  P  G  K  I  L  E  E  E  M  T  R  |  Y  A  Y  Y  Y      p.120

          .         .         .         .         .         .       g.32373
 TCAGGATTGGGTGCTGGAGTTCTTGTTGCTGCCTATATACAAGTTTCATTTTGGACTTTG       c.420
 S  G  L  G  A  G  V  L  V  A  A  Y  I  Q  V  S  F  W  T  L         p.140

          .         .         .         .         .         .       g.32433
 GCAGCTGGTCGACAGATCAGGAAAATTAGGCAGAAGTTTTTTCATGCTATTCTACGACAG       c.480
 A  A  G  R  Q  I  R  K  I  R  Q  K  F  F  H  A  I  L  R  Q         p.160

          .         .         .         .         .       | 07 .    g.33642
 GAAATAGGATGGTTTGACATCAACGACACCACTGAACTCAATACGCGGCTAACAGA | TGAC    c.540
 E  I  G  W  F  D  I  N  D  T  T  E  L  N  T  R  L  T  D  |  D      p.180

          .         .         .         .         .         .       g.33702
 ATCTCCAAAATCAGTGAAGGAATTGGTGACAAGGTTGGAATGTTCTTTCAAGCAGTAGCC       c.600
 I  S  K  I  S  E  G  I  G  D  K  V  G  M  F  F  Q  A  V  A         p.200

          .         .         .         .         .         .       g.33762
 ACGTTTTTTGCAGGATTCATAGTGGGATTCATCAGAGGATGGAAGCTCACCCTTGTGATA       c.660
 T  F  F  A  G  F  I  V  G  F  I  R  G  W  K  L  T  L  V  I         p.220

          .         .         .         .         | 08         .    g.35352
 ATGGCCATCAGCCCTATTCTAGGACTCTCTGCAGCCGTTTGGGCAAAG | ATACTCTCGGCA    c.720
 M  A  I  S  P  I  L  G  L  S  A  A  V  W  A  K   | I  L  S  A      p.240

          .         .         .         .         .         .       g.35412
 TTTAGTGACAAAGAACTAGCTGCTTATGCAAAAGCAGGCGCCGTGGCAGAAGAGGCTCTG       c.780
 F  S  D  K  E  L  A  A  Y  A  K  A  G  A  V  A  E  E  A  L         p.260

          .         .         .         .         .    | 09    .    g.38234
 GGGGCCATCAGGACTGTGATAGCTTTCGGGGGCCAGAACAAAGAGCTGGAAAG | GTATCAG    c.840
 G  A  I  R  T  V  I  A  F  G  G  Q  N  K  E  L  E  R  |  Y  Q      p.280

          .         .         .         .         .         .       g.38294
 AAACATTTAGAAAATGCCAAAGAGATTGGAATTAAAAAAGCTATTTCAGCAAACATTTCC       c.900
 K  H  L  E  N  A  K  E  I  G  I  K  K  A  I  S  A  N  I  S         p.300

          .         .         .         .         .         .       g.38354
 ATGGGTATTGCCTTCCTGTTAATATATGCATCATATGCACTGGCCTTCTGGTATGGATCC       c.960
 M  G  I  A  F  L  L  I  Y  A  S  Y  A  L  A  F  W  Y  G  S         p.320

          .         .         .         .      | 10  .         .    g.40472
 ACTCTAGTCATATCAAAAGAATATACTATTGGAAATGCAATGACA | GTTTTTTTTTCAATC    c.1020
 T  L  V  I  S  K  E  Y  T  I  G  N  A  M  T   | V  F  F  S  I      p.340

          .         .         .         .         .         .       g.40532
 CTAATTGGAGCTTTCAGTGTTGGCCAGGCTGCCCCATGTATTGATGCTTTTGCCAATGCA       c.1080
 L  I  G  A  F  S  V  G  Q  A  A  P  C  I  D  A  F  A  N  A         p.360

          .         .         .          | 11        .         .    g.41680
 AGAGGAGCAGCATATGTGATCTTTGATATTATTGATAAT | AATCCTAAAATTGACAGTTTT    c.1140
 R  G  A  A  Y  V  I  F  D  I  I  D  N   | N  P  K  I  D  S  F      p.380

          .         .         .         .         .         .       g.41740
 TCAGAGAGAGGACACAAACCAGACAGCATCAAAGGGAATTTGGAGTTCAATGATGTTCAC       c.1200
 S  E  R  G  H  K  P  D  S  I  K  G  N  L  E  F  N  D  V  H         p.400

          .         .         . | 12       .         .         .    g.42018
 TTTTCTTACCCTTCTCGAGCTAACGTCAAG | ATCTTGAAGGGCCTCAACCTGAAGGTGCAG    c.1260
 F  S  Y  P  S  R  A  N  V  K   | I  L  K  G  L  N  L  K  V  Q      p.420

          .         .         .         .         .         .       g.42078
 AGTGGGCAGACGGTGGCCCTGGTTGGAAGTAGTGGCTGTGGGAAGAGCACAACGGTCCAG       c.1320
 S  G  Q  T  V  A  L  V  G  S  S  G  C  G  K  S  T  T  V  Q         p.440

          .         .         .       | 13 .         .         .    g.45054
 CTGATACAGAGGCTCTATGACCCTGATGAGGGCACA | ATTAACATTGATGGGCAGGATATT    c.1380
 L  I  Q  R  L  Y  D  P  D  E  G  T   | I  N  I  D  G  Q  D  I      p.460

          .         .         .         .         .         .       g.45114
 AGGAACTTTAATGTAAACTATCTGAGGGAAATCATTGGTGTGGTGAGTCAGGAGCCGGTG       c.1440
 R  N  F  N  V  N  Y  L  R  E  I  I  G  V  V  S  Q  E  P  V         p.480

          .         .         .         .         .         .       g.45174
 CTGTTTTCCACCACAATTGCTGAAAATATTTGTTATGGCCGTGGAAATGTAACCATGGAT       c.1500
 L  F  S  T  T  I  A  E  N  I  C  Y  G  R  G  N  V  T  M  D         p.500

          .         .         .         .         .         .       g.45234
 GAGATAAAGAAAGCTGTCAAAGAGGCCAACGCCTATGAGTTTATCATGAAATTACCACAG       c.1560
 E  I  K  K  A  V  K  E  A  N  A  Y  E  F  I  M  K  L  P  Q         p.520

  | 14       .         .         .         .         .         .    g.45655
  | AAATTTGACACCCTGGTTGGAGAGAGAGGGGCCCAGCTGAGTGGTGGGCAGAAGCAGAGG    c.1620
  | K  F  D  T  L  V  G  E  R  G  A  Q  L  S  G  G  Q  K  Q  R      p.540

          .         .         .         .         .         .       g.45715
 ATCGCCATTGCACGTGCCCTGGTTCGCAACCCCAAGATCCTTCTGCTGGATGAGGCCACG       c.1680
 I  A  I  A  R  A  L  V  R  N  P  K  I  L  L  L  D  E  A  T         p.560

          .         .         .         .         .  | 15      .    g.53876
 TCAGCATTGGACACAGAAAGTGAAGCTGAGGTACAGGCAGCTCTGGATAAG | GCCAGAGAA    c.1740
 S  A  L  D  T  E  S  E  A  E  V  Q  A  A  L  D  K   | A  R  E      p.580

          .         .         .         .         .         .       g.53936
 GGCCGGACCACCATTGTGATAGCACACCGACTGTCTACGGTCCGAAATGCAGATGTCATC       c.1800
 G  R  T  T  I  V  I  A  H  R  L  S  T  V  R  N  A  D  V  I         p.600

          .         .         .         .         .         .       g.53996
 GCTGGGTTTGAGGATGGAGTAATTGTGGAGCAAGGAAGCCACAGCGAACTGATGAAGAAG       c.1860
 A  G  F  E  D  G  V  I  V  E  Q  G  S  H  S  E  L  M  K  K         p.620

          .         .         .    | 16    .         .         .    g.58539
 GAAGGGGTGTACTTCAAACTTGTCAACATGCAG | ACATCAGGAAGCCAGATCCAGTCAGAA    c.1920
 E  G  V  Y  F  K  L  V  N  M  Q   | T  S  G  S  Q  I  Q  S  E      p.640

          .         .         .         .         .         .       g.58599
 GAATTTGAACTAAATGATGAAAAGGCTGCCACTAGAATGGCCCCAAATGGCTGGAAATCT       c.1980
 E  F  E  L  N  D  E  K  A  A  T  R  M  A  P  N  G  W  K  S         p.660

          .         .         .         .         .         .       g.58659
 CGCCTATTTAGGCATTCTACTCAGAAAAACCTTAAAAATTCACAAATGTGTCAGAAGAGC       c.2040
 R  L  F  R  H  S  T  Q  K  N  L  K  N  S  Q  M  C  Q  K  S         p.680

          .         .     | 17   .         .         .         .    g.61416
 CTTGATGTGGAAACCGATGGACTT | GAAGCAAATGTGCCACCAGTGTCCTTTCTGAAGGTC    c.2100
 L  D  V  E  T  D  G  L   | E  A  N  V  P  P  V  S  F  L  K  V      p.700

          .         .         .         .         .         .       g.61476
 CTGAAACTGAATAAAACAGAATGGCCCTACTTTGTCGTGGGAACAGTATGTGCCATTGCC       c.2160
 L  K  L  N  K  T  E  W  P  Y  F  V  V  G  T  V  C  A  I  A         p.720

          .         .         .         .         .  | 18      .    g.63216
 AATGGGGGGCTTCAGCCGGCATTTTCAGTCATATTCTCAGAGATCATAGCG | ATTTTTGGA    c.2220
 N  G  G  L  Q  P  A  F  S  V  I  F  S  E  I  I  A   | I  F  G      p.740

          .         .         .         .         .         .       g.63276
 CCAGGCGATGATGCAGTGAAGCAGCAGAAGTGCAACATATTCTCTTTGATTTTCTTATTT       c.2280
 P  G  D  D  A  V  K  Q  Q  K  C  N  I  F  S  L  I  F  L  F         p.760

          .         .         .       | 19 .         .         .    g.65381
 CTGGGAATTATTTCTTTTTTTACTTTCTTCCTTCAG | GGTTTCACGTTTGGGAAAGCTGGC    c.2340
 L  G  I  I  S  F  F  T  F  F  L  Q   | G  F  T  F  G  K  A  G      p.780

          .         .         .         .         .     | 20   .    g.66818
 GAGATCCTCACCAGAAGACTGCGGTCAATGGCTTTTAAAGCAATGCTAAGACAG | GACATG    c.2400
 E  I  L  T  R  R  L  R  S  M  A  F  K  A  M  L  R  Q   | D  M      p.800

          .         .         .         .         .         .       g.66878
 AGCTGGTTTGATGACCATAAAAACAGTACTGGTGCACTTTCTACAAGACTTGCCACAGAT       c.2460
 S  W  F  D  D  H  K  N  S  T  G  A  L  S  T  R  L  A  T  D         p.820

          .         | 21         .         .         .         .    g.67959
 GCTGCCCAAGTCCAAGGA | GCCACAGGAACCAGGTTGGCTTTAATTGCACAGAATATAGCT    c.2520
 A  A  Q  V  Q  G   | A  T  G  T  R  L  A  L  I  A  Q  N  I  A      p.840

          .         .         .         .         .         .       g.68019
 AACCTTGGAACTGGTATTATCATATCATTTATCTACGGTTGGCAGTTAACCCTATTGCTA       c.2580
 N  L  G  T  G  I  I  I  S  F  I  Y  G  W  Q  L  T  L  L  L         p.860

          .         .         .         .         .         .       g.68079
 TTAGCAGTTGTTCCAATTATTGCTGTGTCAGGAATTGTTGAAATGAAATTGTTGGCTGGA       c.2640
 L  A  V  V  P  I  I  A  V  S  G  I  V  E  M  K  L  L  A  G         p.880

          .         .         .         .   | 22     .         .    g.71733
 AATGCCAAAAGAGATAAAAAAGAACTGGAAGCTGCTGGAAAG | ATTGCAACAGAGGCAATA    c.2700
 N  A  K  R  D  K  K  E  L  E  A  A  G  K   | I  A  T  E  A  I      p.900

          .         .         .         .         .         .       g.71793
 GAAAATATTAGGACAGTTGTGTCTTTGACCCAGGAAAGAAAATTTGAATCAATGTATGTT       c.2760
 E  N  I  R  T  V  V  S  L  T  Q  E  R  K  F  E  S  M  Y  V         p.920

          .         .    | 23    .         .         .         .    g.73436
 GAAAAATTGTATGGACCTTACAG | GAATTCTGTGCAGAAGGCACACATCTATGGAATTACT    c.2820
 E  K  L  Y  G  P  Y  R  |  N  S  V  Q  K  A  H  I  Y  G  I  T      p.940

          .         .         .         .         .         .       g.73496
 TTTAGTATCTCACAAGCATTTATGTATTTTTCCTATGCCGGTTGTTTTCGATTTGGTGCA       c.2880
 F  S  I  S  Q  A  F  M  Y  F  S  Y  A  G  C  F  R  F  G  A         p.960

          .         .         .         .     | 24   .         .    g.76056
 TATCTCATTGTGAATGGACATATGCGCTTCAGAGATGTTATTCT | GGTGTTTTCTGCAATT    c.2940
 Y  L  I  V  N  G  H  M  R  F  R  D  V  I  L  |  V  F  S  A  I      p.980

          .         .         .         .         .         .       g.76116
 GTATTTGGTGCAGTGGCTCTAGGACATGCCAGTTCATTTGCTCCAGACTATGCTAAAGCT       c.3000
 V  F  G  A  V  A  L  G  H  A  S  S  F  A  P  D  Y  A  K  A         p.1000

          .         .         .         .         .         .       g.76176
 AAGCTGTCTGCAGCCCACTTATTCATGCTGTTTGAAAGACAACCTCTGATTGACAGCTAC       c.3060
 K  L  S  A  A  H  L  F  M  L  F  E  R  Q  P  L  I  D  S  Y         p.1020

          .         .  | 25      .         .         .         .    g.77237
 AGTGAAGAGGGGCTGAAGCCT | GATAAATTTGAAGGAAATATAACATTTAATGAAGTCGTG    c.3120
 S  E  E  G  L  K  P   | D  K  F  E  G  N  I  T  F  N  E  V  V      p.1040

          .         .         .         .         .         .       g.77297
 TTCAACTATCCCACCCGAGCAAACGTGCCAGTGCTTCAGGGGCTGAGCCTGGAGGTGAAG       c.3180
 F  N  Y  P  T  R  A  N  V  P  V  L  Q  G  L  S  L  E  V  K         p.1060

          .         .         .         .         .         .       g.77357
 AAAGGCCAGACACTAGCCCTGGTGGGCAGCAGTGGCTGTGGGAAGAGCACGGTGGTCCAG       c.3240
 K  G  Q  T  L  A  L  V  G  S  S  G  C  G  K  S  T  V  V  Q         p.1080

          .         .         .          | 26        .         .    g.78938
 CTCCTGGAGCGGTTCTACGACCCCTTGGCGGGGACAGTG | TTTGTGGACTTTGGTTTTCAG    c.3300
 L  L  E  R  F  Y  D  P  L  A  G  T  V   | F  V  D  F  G  F  Q      p.1100

          .         .         .         .         .         .       g.78998
 CTTCTCGATGGTCAAGAAGCAAAGAAACTCAATGTCCAGTGGCTCAGAGCTCAACTCGGA       c.3360
 L  L  D  G  Q  E  A  K  K  L  N  V  Q  W  L  R  A  Q  L  G         p.1120

          .         .         .         .         .         .       g.79058
 ATCGTGTCTCAGGAGCCTATCCTATTTGACTGCAGCATTGCCGAGAATATTGCCTATGGA       c.3420
 I  V  S  Q  E  P  I  L  F  D  C  S  I  A  E  N  I  A  Y  G         p.1140

          .         .         .         .         .         .       g.79118
 GACAACAGCCGGGTTGTATCACAGGATGAAATTGTGAGTGCAGCCAAAGCTGCCAACATA       c.3480
 D  N  S  R  V  V  S  Q  D  E  I  V  S  A  A  K  A  A  N  I         p.1160

          .         .        | 27.         .         .         .    g.82184
 CATCCTTTCATCGAGACGTTACCCCAC | AAATATGAAACAAGAGTGGGAGATAAGGGGACT    c.3540
 H  P  F  I  E  T  L  P  H   | K  Y  E  T  R  V  G  D  K  G  T      p.1180

          .         .         .         .         .         .       g.82244
 CAGCTCTCAGGAGGTCAAAAACAGAGGATTGCTATTGCCCGAGCCCTCATCAGACAACCT       c.3600
 Q  L  S  G  G  Q  K  Q  R  I  A  I  A  R  A  L  I  R  Q  P         p.1200

          .         .         .         .         .     | 28   .    g.83136
 CAAATCCTCCTGTTGGATGAAGCTACATCAGCTCTGGATACTGAAAGTGAAAAG | GTTGTC    c.3660
 Q  I  L  L  L  D  E  A  T  S  A  L  D  T  E  S  E  K   | V  V      p.1220

          .         .         .         .         .         .       g.83196
 CAAGAAGCCCTGGACAAAGCCAGAGAAGGCCGCACCTGCATTGTGATTGCTCACCGCCTG       c.3720
 Q  E  A  L  D  K  A  R  E  G  R  T  C  I  V  I  A  H  R  L         p.1240

          .         .         .         .         .         .       g.83256
 TCCACCATCCAGAATGCAGACTTAATAGTGGTGTTTCAGAATGGGAGAGTCAAGGAGCAT       c.3780
 S  T  I  Q  N  A  D  L  I  V  V  F  Q  N  G  R  V  K  E  H         p.1260

          .         .         .         .         .         .       g.83316
 GGCACGCATCAGCAGCTGCTGGCACAGAAAGGCATCTATTTTTCAATGGTCAGTGTCCAG       c.3840
 G  T  H  Q  Q  L  L  A  Q  K  G  I  Y  F  S  M  V  S  V  Q         p.1280

          .         .                                               g.83337
 GCTGGGACACAGAACTTATGA                                              c.3861
 A  G  T  Q  N  L  X                                                p.1286

          .         .         .         .         .                 g.83388
 acttttgctacagtatattttaaaaataaattcaaattattctaccatttt                c.*51

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The ATP-binding cassette, sub-family B (MDR/TAP), member 4 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 14
©2004-2015 Leiden University Medical Center