ATP-binding cassette, sub-family C (CFTR/MRP), member 11 (ABCC11) - coding DNA reference sequence

(used for variant description)

(last modified June 21, 2017)


This file was created to facilitate the description of sequence variants on transcript NM_032583.3 in the ABCC11 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_011522.1, covering ABCC11 transcript NM_032583.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                                    g.5004
                                                         gtgt       c.-61

 .         .         .         .         .  | 02      .             g.8256
 atttgaataaaccaggttggcaaatcatactatagctgaaag | aattggcaggaactgaaa    c.-1

          .         .         .         .         .         .       g.8316
 ATGACTAGGAAGAGGACATACTGGGTGCCCAACTCTTCTGGTGGCCTCGTGAATCGTGGC       c.60
 M  T  R  K  R  T  Y  W  V  P  N  S  S  G  G  L  V  N  R  G         p.20

          .         .         .          | 03        .         .    g.9625
 ATCGACATAGGCGATGACATGGTTTCAGGACTTATTTAT | AAAACCTATACTCTCCAAGAT    c.120
 I  D  I  G  D  D  M  V  S  G  L  I  Y   | K  T  Y  T  L  Q  D      p.40

          .         .         .         .         .         .       g.9685
 GGCCCCTGGAGTCAGCAAGAGAGAAATCCTGAGGCTCCAGGGAGGGCAGCTGTCCCACCG       c.180
 G  P  W  S  Q  Q  E  R  N  P  E  A  P  G  R  A  A  V  P  P         p.60

          .         .         .         .         .       | 04 .    g.12217
 TGGGGGAAGTATGATGCTGCCTTGAGAACCATGATTCCCTTCCGTCCCAAGCCGAG | GTTT    c.240
 W  G  K  Y  D  A  A  L  R  T  M  I  P  F  R  P  K  P  R  |  F      p.80

          .         .         .         .         .         .       g.12277
 CCTGCCCCCCAGCCCCTGGACAATGCTGGCCTGTTCTCCTACCTCACCGTGTCATGGCTC       c.300
 P  A  P  Q  P  L  D  N  A  G  L  F  S  Y  L  T  V  S  W  L         p.100

          .         .         .         .         .         .       g.12337
 ACCCCGCTCATGATCCAAAGCTTACGGAGTCGCTTAGATGAGAACACCATCCCTCCACTG       c.360
 T  P  L  M  I  Q  S  L  R  S  R  L  D  E  N  T  I  P  P  L         p.120

          .         .         .      | 05  .         .         .    g.15773
 TCAGTCCATGATGCCTCAGACAAAAATGTCCAAAG | GCTTCACCGCCTTTGGGAAGAAGAA    c.420
 S  V  H  D  A  S  D  K  N  V  Q  R  |  L  H  R  L  W  E  E  E      p.140

          .         .         .         .         .         .       g.15833
 GTCTCAAGGCGAGGGATTGAAAAAGCTTCAGTGCTTCTGGTGATGCTGAGGTTCCAGAGA       c.480
 V  S  R  R  G  I  E  K  A  S  V  L  L  V  M  L  R  F  Q  R         p.160

          .         .         .         .         .         .       g.15893
 ACAAGGTTGATTTTCGATGCACTTCTGGGCATCTGCTTCTGCATTGCCAGTGTACTCGGG       c.540
 T  R  L  I  F  D  A  L  L  G  I  C  F  C  I  A  S  V  L  G         p.180

     | 06    .         .         .         .         .         .    g.17403
 CCA | ATATTGATTATACCAAAGATCCTGGAATATTCAGAAGAGCAGTTGGGGAATGTTGTC    c.600
 P   | I  L  I  I  P  K  I  L  E  Y  S  E  E  Q  L  G  N  V  V      p.200

          .         .         .         .         .         .       g.17463
 CATGGAGTGGGACTCTGCTTTGCCCTTTTTCTCTCCGAATGTGTGAAGTCTCTGAGTTTC       c.660
 H  G  V  G  L  C  F  A  L  F  L  S  E  C  V  K  S  L  S  F         p.220

          .         .         .         .         .         .       g.17523
 TCCTCCAGTTGGATCATCAACCAACGCACAGCCATCAGGTTCCGAGCAGCTGTTTCCTCC       c.720
 S  S  S  W  I  I  N  Q  R  T  A  I  R  F  R  A  A  V  S  S         p.240

          .         .         .         .         .        | 07.    g.23893
 TTTGCCTTTGAGAAGCTCATCCAATTTAAGTCTGTAATACACATCACCTCAGGAGAG | GCC    c.780
 F  A  F  E  K  L  I  Q  F  K  S  V  I  H  I  T  S  G  E   | A      p.260

          .         .         .         .         .         .       g.23953
 ATCAGCTTCTTCACCGGTGATGTAAACTACCTGTTTGAAGGGGTGTGCTATGGACCCCTA       c.840
 I  S  F  F  T  G  D  V  N  Y  L  F  E  G  V  C  Y  G  P  L         p.280

          .         .         .         .         .         .       g.24013
 GTACTGATCACCTGCGCATCGCTGGTCATCTGCAGCATTTCTTCCTACTTCATTATTGGA       c.900
 V  L  I  T  C  A  S  L  V  I  C  S  I  S  S  Y  F  I  I  G         p.300

          .         .         .         .         .  | 08      .    g.24842
 TACACTGCATTTATTGCCATCTTATGCTATCTCCTGGTTTTCCCACTGGCG | GTATTCATG    c.960
 Y  T  A  F  I  A  I  L  C  Y  L  L  V  F  P  L  A   | V  F  M      p.320

          .         .         .         .         .         .       g.24902
 ACAAGAATGGCTGTGAAGGCTCAGCATCACACATCTGAGGTCAGCGACCAGCGCATCCGT       c.1020
 T  R  M  A  V  K  A  Q  H  H  T  S  E  V  S  D  Q  R  I  R         p.340

          .         .         .         .         .         .       g.24962
 GTGACCAGTGAAGTTCTCACTTGCATTAAGCTGATTAAAATGTACACATGGGAGAAACCA       c.1080
 V  T  S  E  V  L  T  C  I  K  L  I  K  M  Y  T  W  E  K  P         p.360

          .          | 09        .         .         .         .    g.25189
 TTTGCAAAAATCATTGAAG | ACCTAAGAAGGAAGGAAAGGAAACTATTGGAGAAGTGCGGG    c.1140
 F  A  K  I  I  E  D |   L  R  R  K  E  R  K  L  L  E  K  C  G      p.380

          .         .         .         .         .         .       g.25249
 CTTGTCCAGAGCCTGACAAGTATAACCTTGTTCATCATCCCCACAGTGGCCACAGCGGTC       c.1200
 L  V  Q  S  L  T  S  I  T  L  F  I  I  P  T  V  A  T  A  V         p.400

          .         .         .         .         | 10         .    g.26639
 TGGGTTCTCATCCACACATCCTTAAAGCTGAAACTCACAGCGTCAATG | GCCTTCAGCATG    c.1260
 W  V  L  I  H  T  S  L  K  L  K  L  T  A  S  M   | A  F  S  M      p.420

          .         .         .         .         .         .       g.26699
 CTGGCCTCCTTGAATCTCCTTCGGCTGTCAGTGTTCTTTGTGCCTATTGCAGTCAAAGGT       c.1320
 L  A  S  L  N  L  L  R  L  S  V  F  F  V  P  I  A  V  K  G         p.440

          .         .         .       | 11 .         .         .    g.29002
 CTCACGAATTCCAAGTCTGCAGTGATGAGGTTCAAG | AAGTTTTTCCTCCAGGAGAGCCCT    c.1380
 L  T  N  S  K  S  A  V  M  R  F  K   | K  F  F  L  Q  E  S  P      p.460

          .         .         .         .         .         .       g.29062
 GTTTTCTATGTCCAGACATTACAAGACCCCAGCAAAGCTCTGGTCTTTGAGGAGGCCACC       c.1440
 V  F  Y  V  Q  T  L  Q  D  P  S  K  A  L  V  F  E  E  A  T         p.480

          .         .         .         .         .         .       g.29122
 TTGTCATGGCAACAGACCTGTCCCGGGATCGTCAATGGGGCACTGGAGCTGGAGAGGAAC       c.1500
 L  S  W  Q  Q  T  C  P  G  I  V  N  G  A  L  E  L  E  R  N         p.500

          .         .         .         .         .         .       g.29182
 GGGCATGCTTCTGAGGGGATGACCAGGCCTAGAGATGCCCTCGGGCCAGAGGAAGAAGGG       c.1560
 G  H  A  S  E  G  M  T  R  P  R  D  A  L  G  P  E  E  E  G         p.520

          .         .         .         .         | 12         .    g.31693
 AACAGCCTGGGCCCAGAGTTGCACAAGATCAACCTGGTGGTGTCCAAG | GGGATGATGTTA    c.1620
 N  S  L  G  P  E  L  H  K  I  N  L  V  V  S  K   | G  M  M  L      p.540

          .         .         .         .         .         .       g.31753
 GGGGTCTGCGGCAACACGGGGAGTGGTAAGAGCAGCCTGTTGTCAGCCATCCTGGAGGAG       c.1680
 G  V  C  G  N  T  G  S  G  K  S  S  L  L  S  A  I  L  E  E         p.560

  | 13       .         .         .         .         .         .    g.34700
  | ATGCACTTGCTCGAGGGCTCGGTGGGGGTGCAGGGAAGCCTGGCCTATGTCCCCCAGCAG    c.1740
  | M  H  L  L  E  G  S  V  G  V  Q  G  S  L  A  Y  V  P  Q  Q      p.580

          .         .         .         .         .         .       g.34760
 GCCTGGATCGTCAGCGGGAACATCAGGGAGAACATCCTCATGGGAGGCGCATATGACAAG       c.1800
 A  W  I  V  S  G  N  I  R  E  N  I  L  M  G  G  A  Y  D  K         p.600

       | 14  .         .         .         .         .         .    g.36932
 GCCCG | ATACCTCCAGGTGCTCCACTGCTGCTCCCTGAATCGGGACCTGGAACTTCTGCCC    c.1860
 A  R  |  Y  L  Q  V  L  H  C  C  S  L  N  R  D  L  E  L  L  P      p.620

          .         | 15         .         .         .         .    g.39740
 TTTGGAGACATGACAGAG | ATTGGAGAGCGGGGCCTCAACCTCTCTGGGGGGCAGAAACAG    c.1920
 F  G  D  M  T  E   | I  G  E  R  G  L  N  L  S  G  G  Q  K  Q      p.640

          .         .         .         .         .         .       g.39800
 AGGATCAGCCTGGCCCGCGCCGTCTATTCCGACCGTCAGATCTACCTGCTGGACGACCCC       c.1980
 R  I  S  L  A  R  A  V  Y  S  D  R  Q  I  Y  L  L  D  D  P         p.660

          .         .         .         .         .         .       g.39860
 CTGTCTGCTGTGGACGCCCACGTGGGGAAGCACATTTTTGAGGAGTGCATTAAGAAGACA       c.2040
 L  S  A  V  D  A  H  V  G  K  H  I  F  E  E  C  I  K  K  T         p.680

          .         .         .         .   | 16     .         .    g.41920
 CTCAGGGGGAAGACGGTCGTCCTGGTGACCCACCAGCTGCAG | TACTTAGAATTTTGTGGC    c.2100
 L  R  G  K  T  V  V  L  V  T  H  Q  L  Q   | Y  L  E  F  C  G      p.700

          .         .         .         .         .         .       g.41980
 CAGATCATTTTGTTGGAAAATGGGAAAATCTGTGAAAATGGAACTCACAGTGAGTTAATG       c.2160
 Q  I  I  L  L  E  N  G  K  I  C  E  N  G  T  H  S  E  L  M         p.720

          .         .         .         .         .        | 17.    g.42113
 CAGAAAAAGGGGAAATATGCCCAACTTATCCAGAAGATGCACAAGGAAGCCACTTCG | GAC    c.2220
 Q  K  K  G  K  Y  A  Q  L  I  Q  K  M  H  K  E  A  T  S   | D      p.740

          .         .         .         .         .         .       g.42173
 ATGTTGCAGGACACAGCAAAGATAGCAGAGAAGCCAAAGGTAGAAAGTCAGGCTCTGGCC       c.2280
 M  L  Q  D  T  A  K  I  A  E  K  P  K  V  E  S  Q  A  L  A         p.760

          .         .         .     | 18   .         .         .    g.43882
 ACCTCCCTGGAAGAGTCTCTCAACGGAAATGCTG | TGCCGGAGCATCAGCTCACACAGGAG    c.2340
 T  S  L  E  E  S  L  N  G  N  A  V |   P  E  H  Q  L  T  Q  E      p.780

          .         .         .         .         .         .       g.43942
 GAGGAGATGGAAGAAGGCTCCTTGAGTTGGAGGGTCTACCACCACTACATCCAGGCAGCT       c.2400
 E  E  M  E  E  G  S  L  S  W  R  V  Y  H  H  Y  I  Q  A  A         p.800

      | 19   .         .         .         .         .         .    g.46251
 GGAG | GTTACATGGTCTCTTGCATAATTTTCTTCTTCGTGGTGCTGATCGTCTTCTTAACG    c.2460
 G  G |   Y  M  V  S  C  I  I  F  F  F  V  V  L  I  V  F  L  T      p.820

          .         .         .         .         | 20         .    g.47472
 ATCTTCAGCTTCTGGTGGCTGAGCTACTGGTTGGAGCAGGGCTCGGGG | ACCAATAGCAGC    c.2520
 I  F  S  F  W  W  L  S  Y  W  L  E  Q  G  S  G   | T  N  S  S      p.840

          .         .         .         .         .         .       g.47532
 CGAGAGAGCAATGGAACCATGGCAGACCTGGGCAACATTGCAGACAATCCTCAACTGTCC       c.2580
 R  E  S  N  G  T  M  A  D  L  G  N  I  A  D  N  P  Q  L  S         p.860

          .         .         .         .         .         .       g.47592
 TTCTACCAGCTGGTGTACGGGCTCAACGCCCTGCTCCTCATCTGTGTGGGGGTCTGCTCC       c.2640
 F  Y  Q  L  V  Y  G  L  N  A  L  L  L  I  C  V  G  V  C  S         p.880

          .         .         .         .         .         .       g.47652
 TCAGGGATTTTCACCAAGGTCACGAGGAAGGCATCCACGGCCCTGCACAACAAGCTCTTC       c.2700
 S  G  I  F  T  K  V  T  R  K  A  S  T  A  L  H  N  K  L  F         p.900

        | 21 .         .         .         .         .         .    g.52804
 AACAAG | GTTTTCCGCTGCCCCATGAGTTTCTTTGACACCATCCCAATAGGCCGGCTTTTG    c.2760
 N  K   | V  F  R  C  P  M  S  F  F  D  T  I  P  I  G  R  L  L      p.920

          .         .         .         .         .         .       g.52864
 AACTGCTTCGCAGGGGACTTGGAACAGCTGGACCAGCTCTTGCCCATCTTTTCAGAGCAG       c.2820
 N  C  F  A  G  D  L  E  Q  L  D  Q  L  L  P  I  F  S  E  Q         p.940

          .         .         .         .         .         .       g.52924
 TTCCTGGTCCTGTCCTTAATGGTGATCGCCGTCCTGTTGATTGTCAGTGTGCTGTCTCCA       c.2880
 F  L  V  L  S  L  M  V  I  A  V  L  L  I  V  S  V  L  S  P         p.960

          .         .         .         .         .    | 22    .    g.53094
 TATATCCTGTTAATGGGAGCCATAATCATGGTTATTTGCTTCATTTATTATAT | GATGTTC    c.2940
 Y  I  L  L  M  G  A  I  I  M  V  I  C  F  I  Y  Y  M  |  M  F      p.980

          .         .         .         .         .         .       g.53154
 AAGAAGGCCATCGGTGTGTTCAAGAGACTGGAGAACTATAGCCGGTCTCCTTTATTCTCC       c.3000
 K  K  A  I  G  V  F  K  R  L  E  N  Y  S  R  S  P  L  F  S         p.1000

          .         .         .         .         .         .       g.53214
 CACATCCTCAATTCTCTGCAAGGCCTGAGCTCCATCCATGTCTATGGAAAAACTGAAGAC       c.3060
 H  I  L  N  S  L  Q  G  L  S  S  I  H  V  Y  G  K  T  E  D         p.1020

          .  | 23      .         .         .         .         .    g.55600
 TTCATCAGCCA | GTTTAAGAGGCTGACTGATGCGCAGAATAACTACCTGCTGTTGTTTCTA    c.3120
 F  I  S  Q  |  F  K  R  L  T  D  A  Q  N  N  Y  L  L  L  F  L      p.1040

          .         .         .         .         .         .       g.55660
 TCTTCCACACGATGGATGGCATTGAGGCTGGAGATCATGACCAACCTTGTGACCTTGGCT       c.3180
 S  S  T  R  W  M  A  L  R  L  E  I  M  T  N  L  V  T  L  A         p.1060

          .         .         .         .         .         .       g.55720
 GTTGCCCTGTTCGTGGCTTTTGGCATTTCCTCCACCCCCTACTCCTTTAAAGTCATGGCT       c.3240
 V  A  L  F  V  A  F  G  I  S  S  T  P  Y  S  F  K  V  M  A         p.1080

          .         | 24         .         .         .         .    g.61533
 GTCAACATCGTGCTGCAG | CTGGCGTCCAGCTTCCAGGCCACTGCCCGGATTGGCTTGGAG    c.3300
 V  N  I  V  L  Q   | L  A  S  S  F  Q  A  T  A  R  I  G  L  E      p.1100

          .         .         .         .         | 25         .    g.63076
 ACAGAGGCACAGTTCACGGCTGTAGAGAGGATACTGCAGTACATGAAG | ATGTGTGTCTCG    c.3360
 T  E  A  Q  F  T  A  V  E  R  I  L  Q  Y  M  K   | M  C  V  S      p.1120

          .         .         .         .         .         .       g.63136
 GAAGCTCCTTTACACATGGAAGGCACAAGTTGTCCCCAGGGGTGGCCACAGCATGGGGAA       c.3420
 E  A  P  L  H  M  E  G  T  S  C  P  Q  G  W  P  Q  H  G  E         p.1140

          .         .         .         .         .         .       g.63196
 ATCATATTTCAGGATTATCACATGAAATACAGAGACAACACACCCACCGTGCTTCACGGC       c.3480
 I  I  F  Q  D  Y  H  M  K  Y  R  D  N  T  P  T  V  L  H  G         p.1160

          .         .         .         .         .         | 26    g.64762
 ATCAACCTGACCATCCGCGGCCACGAAGTGGTGGGCATCGTGGGAAGGACGGGCTCTG | GG    c.3540
 I  N  L  T  I  R  G  H  E  V  V  G  I  V  G  R  T  G  S  G |       p.1180

          .         .         .         .         .         .       g.64822
 AAGTCCTCCTTGGGCATGGCTCTCTTCCGCCTGGTGGAGCCCATGGCAGGCCGGATTCTC       c.3600
 K  S  S  L  G  M  A  L  F  R  L  V  E  P  M  A  G  R  I  L         p.1200

          .         .         .         .         .         .       g.64882
 ATTGACGGCGTGGACATTTGCAGCATCGGCCTGGAGGACTTGCGGTCCAAGCTCTCAGTG       c.3660
 I  D  G  V  D  I  C  S  I  G  L  E  D  L  R  S  K  L  S  V         p.1220

          .         .         .         | 27         .         .    g.69232
 ATCCCTCAAGATCCAGTGCTGCTCTCAGGAACCATCAG | ATTCAACCTAGATCCCTTTGAC    c.3720
 I  P  Q  D  P  V  L  L  S  G  T  I  R  |  F  N  L  D  P  F  D      p.1240

          .         .         .         .         .        | 28.    g.69962
 CGTCACACTGACCAGCAGATCTGGGATGCCTTGGAGAGGACATTCCTGACCAAGGCC | ATC    c.3780
 R  H  T  D  Q  Q  I  W  D  A  L  E  R  T  F  L  T  K  A   | I      p.1260

          .         .         .         .         .         .       g.70022
 TCAAAGTTCCCCAAAAAGCTGCATACAGATGTGGTGGAAAACGGTGGAAACTTCTCTGTG       c.3840
 S  K  F  P  K  K  L  H  T  D  V  V  E  N  G  G  N  F  S  V         p.1280

          .         .         .         .         .  | 29      .    g.72526
 GGGGAGAGGCAGCTGCTCTGCATTGCCAGGGCTGTGCTTCGCAACTCCAAG | ATCATCCTT    c.3900
 G  E  R  Q  L  L  C  I  A  R  A  V  L  R  N  S  K   | I  I  L      p.1300

          .         .         .         .         .         .       g.72586
 ATCGATGAAGCCACAGCCTCCATTGACATGGAGACAGACACCCTGATCCAGCGCACAATC       c.3960
 I  D  E  A  T  A  S  I  D  M  E  T  D  T  L  I  Q  R  T  I         p.1320

          .         .         .         .         .         .       g.72646
 CGTGAAGCCTTCCAGGGCTGCACCGTGCTCGTCATTGCCCACCGTGTCACCACTGTGCTG       c.4020
 R  E  A  F  Q  G  C  T  V  L  V  I  A  H  R  V  T  T  V  L         p.1340

          .         .         .       | 30 .         .         .    g.72835
 AACTGTGACCACATCCTGGTTATGGGCAATGGGAAG | GTGGTAGAATTTGATCGGCCGGAG    c.4080
 N  C  D  H  I  L  V  M  G  N  G  K   | V  V  E  F  D  R  P  E      p.1360

          .         .         .         .         .         .       g.72895
 GTACTGCGGAAGAAGCCTGGGTCATTGTTCGCAGCCCTCATGGCCACAGCCACTTCTTCA       c.4140
 V  L  R  K  K  P  G  S  L  F  A  A  L  M  A  T  A  T  S  S         p.1380

                                                                    g.72904
 CTGAGATAA                                                          c.4149
 L  R  X                                                            p.1382

          .         .         .         .         .         .       g.72964
 ggagatgtggagacttcatggaggctggcagctgagctcagaggttcacacaggtgcagc       c.*60

          .         .         .         .         .         .       g.73024
 ttcgaggcccacagtctgcgaccttcttgtttggagatgagaacttctcctggaagcagg       c.*120

          .         .         .         .         .         .       g.73084
 ggtaaatgtagggggggtggggattgctggatggaaaccctggaataggctacttgatgg       c.*180

          .         .         .         .         .         .       g.73144
 ctctcaagaccttagaaccccagaaccatctaagacatgggattcagtgatcatgtggtt       c.*240

          .         .         .         .         .         .       g.73204
 ctccttttaacttacatgctgaataattttataataaggtaaaagcttatagttttctga       c.*300

          .         .         .         .         .         .       g.73264
 tctgtgttagaagtgttgcaaatgctgtactgactttgtaaaatataaaactaaggaaaa       c.*360

                                                                    g.73267
 ctc                                                                c.*363

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The ATP-binding cassette, sub-family C (CFTR/MRP), member 11 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 19
©2004-2017 Leiden University Medical Center