actin, alpha 1, skeletal muscle (ACTA1) - upstream reference sequence


                                               g.1              g.5
                                               c.-5105 ttctt    c.-5101

.         .         .         .         .         .             g.65
gacctttttttttttatcacccctcctgaggagcctttttagacagtttttcctaatcac    c.-5041

.         .         .         .         .         .             g.125
ctcccactccaaagaaagtgtaataccacagacctactatatatcattcattcattcatt    c.-4981

.         .         .         .         .         .             g.185
cattcattcattcattcatttggaaatggagtcttgctctgtcacccaggctggagtgca    c.-4921

.         .         .         .         .         .             g.245
gtggcgcgatcttggctcgctgcaacctctgcctcctgggttcaagcaattctcctgcct    c.-4861

.         .         .         .         .         .             g.305
cagcctcccgagtagctgggattacaggcacccgccatcatgcctggctaatttttgtat    c.-4801

.         .         .         .         .         .             g.365
ttttaatagagacagggtttcaccatgttggccaggctggtctagaactcctgacctcag    c.-4741

.         .         .         .         .         .             g.425
gtgatctgcctgcctcggcctcccaaagtgctgggattataggcgtgagccaccacactt    c.-4681

.         .         .         .         .         .             g.485
ggccgactatcttttaaatgtactgtggcctttggaagccataaaccattgtactatctg    c.-4621

.         .         .         .         .         .             g.545
aatttttttcactctctaagaaccaagttttccccctttgagaatgcccatcttaattat    c.-4561

.         .         .         .         .         .             g.605
tatttagaatacaatgttttaaatgcgtgatactttaccatatggcagaaccataattaa    c.-4501

.         .         .         .         .         .             g.665
tgtaacagcccttattctcttgctgtagctctctctcaaaagacacatttttttgaccat    c.-4441

.         .         .         .         .         .             g.725
tttaaataatgctagaataaatctttgtacaaaaatctttatgccctccaaatacggtga    c.-4381

.         .         .         .         .         .             g.785
acatgacattgactctccttgctcagttgcagtgacattgatgtgtgtatactgagcagg    c.-4321

.         .         .         .         .         .             g.845
ccaatgactttaatgttcttttctcaccttttctgccactgcactgtgtgcacctgcccc    c.-4261

.         .         .         .         .         .             g.905
aagcccttagtcattggaagcaagacatggcaccatgtgctgaatgtttcatatgtctta    c.-4201

.         .         .         .         .         .             g.965
ggtactcacctagtttgttgttttgtttttggttttggttttggttttttgagacggagt    c.-4141

.         .         .         .         .         .             g.1025
cttgctctgttcctaggctggagtgcagtagcgcaatctcagctcactgcagcctgtctc    c.-4081

.         .         .         .         .         .             g.1085
ttgggttcaagagattctcctgcctcagcctccctagtagctgggattacaggcacccgc    c.-4021

.         .         .         .         .         .             g.1145
caccatgcccagctaatttttttgtatttttagtagagaccaggtttcaccatgttggcc    c.-3961

.         .         .         .         .         .             g.1205
aggctggtgttgaactcctgacctcaagtgatctgtccacctgggcctcccaaagtgctg    c.-3901

.         .         .         .         .         .             g.1265
ggattacagacgtgagccaccgcactcagctctcacctggttttaatcctcagatcagtc    c.-3841

.         .         .         .         .         .             g.1325
ttaaggagtattgtgagttgagaatgctttctggaaagtcacttgtccaagatcacatag    c.-3781

.         .         .         .         .         .             g.1385
ccagtcagaggggaaggtaaatgcagctctgcttgattccagaatgcaagctcctaacca    c.-3721

.         .         .         .         .         .             g.1445
gttcatgatattctgggtataaagaatgttgaagagagggcactgctccaatgaatcatc    c.-3661

.         .         .         .         .         .             g.1505
aggttcttagaggtggccatgagtgcaaaaaccaccagcttcaggaggaggaaaaagtag    c.-3601

.         .         .         .         .         .             g.1565
aaaatccaagcccaagccctttctttgggctgccaggagttgactcaacttttttttttt    c.-3541

.         .         .         .         .         .             g.1625
ttttttttttgagatggagtctctctctgttgcccaggcctggcgtgcagtggtgggatc    c.-3481

.         .         .         .         .         .             g.1685
tcggctcactgcaacctctgcctcccaggttcaagtgattctcctgtctcagcctcccga    c.-3421

.         .         .         .         .         .             g.1745
gtagctgggattataggtgtgcaccaccacgcctggctaatttttgtgtttttagtagag    c.-3361

.         .         .         .         .         .             g.1805
acggggtttcaccatgttggccaggctggtcttgaactcctgacctcaagtgatccacca    c.-3301

.         .         .         .         .         .             g.1865
gcctcggcttcccaaagtgctgggattacaggcatgggccaccgcgcctggccgacccga    c.-3241

.         .         .         .         .         .             g.1925
cgtttttaagtagcttgtgagaatgagttggtctttgtctaccctgttcctggaatatct    c.-3181

.         .         .         .         .         .             g.1985
ctaacttggagtgcccagccagcccctcaaagctgagtttctggggaagctacggctttt    c.-3121

.         .         .         .         .         .             g.2045
catgtcaggatgtctttggctcattactgggaaagatccctcaagggcctgttctgtttc    c.-3061

.         .         .         .         .         .             g.2105
gaactgtacccagtgttggtgaggattagagagaagcagcagtccttgccctccctggcc    c.-3001

.         .         .         .         .         .             g.2165
actggcagtagaaggaaggacagcccaagcccgtctcctccactggctgctgtggaacct    c.-2941

.         .         .         .         .         .             g.2225
ggggtgtgttttagctcattaagcctcagttttctttaaaaaagaaaaaaaactggaatg    c.-2881

.         .         .         .         .         .             g.2285
agtaatacctatcttatttaccttaggatagttaaacggttaattgaaacacgaaagcat    c.-2821

.         .         .         .         .         .             g.2345
attataaagtgttttaccaattcctgtttaaattgataggaaacacagtaggaagactgg    c.-2761

.         .         .         .         .         .             g.2405
aactgagcaagattggggtacgggtgtgtggagtgttgaggggcacaattggagagaagg    c.-2701

.         .         .         .         .         .             g.2465
gaagtgtgaacacaccggggtagtggtagcagaagggcccggtcagggtatgaagagctg    c.-2641

.         .         .         .         .         .             g.2525
aggctgcacctgaaaacttagaagcaggaactccctgtcaagcataccctacatggctga    c.-2581

.         .         .         .         .         .             g.2585
cctttacttagtgacagttctcaaaaggcggagcagggcgccgctgcgctcccccaaaac    c.-2521

.         .         .         .         .         .             g.2645
atacatgtatggagacgtggctctgccacccaccattcagtctattctctaagccaatga    c.-2461

.         .         .         .         .         .             g.2705
gaatgcaacaagaccagaatgggactgagggtggcctgtggtgacctgtcagggactatt    c.-2401

.         .         .         .         .         .             g.2765
taaaccagccgcaaatcatgtgggcagggaacagatgcctggctggccacctcaggggcc    c.-2341

.         .         .         .         .         .             g.2825
atctcccacagtttgctgtactagcaggtctctgttcgcttgtgagtgtttttaatcatg    c.-2281

.         .         .         .         .         .             g.2885
gtcagcttttagtgtgggtttgaatgtaacagactgagcttagaaaagctttctgtaagg    c.-2221

.         .         .         .         .         .             g.2945
aaaggtaagagttgaactgagcaagagttttgaaaaatagtgacaatcccattctccttt    c.-2161

.         .         .         .         .         .             g.3005
ggaatgcgcacaaatattgaggtatccagtgaacggcagcaaatttcctaccttcaaggc    c.-2101

.         .         .         .         .         .             g.3065
ccaaatgtaagctagtccccttacgttacatgcagctcatttgctaagtggtttttttct    c.-2041

.         .         .         .         .         .             g.3125
agtatctccactactcgctgacacaggaggacacaggatgttaaaaaggaaatacagttc    c.-1981

.         .         .         .         .         .             g.3185
tgtcaattattcacttactctccaaaatacttggaagaactaaatatggaaccataggag    c.-1921

.         .         .         .         .         .             g.3245
actttatcctcaccgcatagtccctatactagtcaaactccttattttttaattgatcat    c.-1861

.         .         .         .         .         .             g.3305
ttttaggaaggtagcattttattcactagaacatttttgttaatacttgtttatttttgg    c.-1801

.         .         .         .         .         .             g.3365
gatgaactgccatgatgtgggctacagaggagggtcgcatatgcttccatccccctttta    c.-1741

.         .         .         .         .         .             g.3425
gagaatccacacctgtcccagttgctgggttccactaccaaaagtgaattgcaactattt    c.-1681

.         .         .         .         .         .             g.3485
taggagcacttaagcacatccgaaaaatgagtgattctgttctggcccacaccacatcac    c.-1621

.         .         .         .         .         .             g.3545
tgatgtacccccttaaagcatgtccctgagttcatcacagaagactgctcctcctgtgcc    c.-1561

.         .         .         .         .         .             g.3605
ctccacaaggttagaactgtccttgtcttagggaaaaaggagagagagagagagagagag    c.-1501

.         .         .         .         .         .             g.3665
agagagagagagagagagagagagagagagggacaggcaccaactgggtaacctctgctg    c.-1441

.         .         .         .         .         .             g.3725
acccccactctactttaccataagtagctccaaatccttctagaaaatctgaaaggcata    c.-1381

.         .         .         .         .         .             g.3785
gccccatatatcagtgatataaatagaacctgcagcaggctctggtaaatgatgactaca    c.-1321

.         .         .         .         .         .             g.3845
aggtggactgggaggcagcccggccttggcaggcatcatcctctaaatataaagatgagt    c.-1261

.         .         .         .         .         .             g.3905
ttgttcagcctttgcagaaggaaaaactgccacccatcctagagtgccgcgtccttgtcc    c.-1201

.         .         .         .         .         .             g.3965
ccccaccccctccaatttattgggaggaaggaccagctaagcctcatctaggaagagccc    c.-1141

.         .         .         .         .         .             g.4025
ctcacccatctccacctccactccaggtctagccagtcctgggttgtgacccttgtcttt    c.-1081

.         .         .         .         .         .             g.4085
cagccccaggagagggacacacatagtgccaccaaagaggctgggggagggcctcagccc    c.-1021

.         .         .         .         .         .             g.4145
accaaaacctggggccagtgcgtcctacaggaggggaaccctcaccccttcaatcccttt    c.-961

.         .         .         .         .         .             g.4205
aggagacccaagggcgctgcgcgtccctgaggcggacagctccgtgtgctcaggctttgc    c.-901

.         .         .         .         .         .             g.4265
gcctgacaggcctatccccgggagcccccgcgcctcctccccggcgctccgccctcgcct    c.-841

.         .         .         .         .         .             g.4325
ccccccgccagttgtctatcctgcgacagctgcgcgccctccggccgccggtggccctct    c.-781

.         .         .         .         .         .             g.4385
gtgcggtgggggaaggggtcgacgtggctcagctttttggattcagggagctcgggggtg    c.-721

.         .         .         .         .         .             g.4445
ggaagagagaaatggagttccaggggcgtaaaggagagggagttcgccttccttcccttc    c.-661

.         .         .         .         .         .             g.4505
ctgagactcaggagtgactgcttctccaatcctcccaagcccaccactccacacgactcc    c.-601

.         .         .         .         .         .             g.4565
ctcttcccggtagtcgcaagtgggagtttggggatctgagcaaagaacccgaagaggagt    c.-541

.         .         .         .         .         .             g.4625
tgaaatattggaagtcagcagtcaggcaccttcccgagcgcccagggcgctcagagtgga    c.-481

.         .         .         .         .         .             g.4685
catggttggggaggcctttgggacaggtgcggttcccggagcgcaggcgcacacatgcac    c.-421

.         .         .         .         .         .             g.4745
ccaccggcgaacgcggtgaccctcgccccaccccatcccctccggcgggcaactgggtcg    c.-361

.         .         .         .         .         .             g.4805
ggtcaggaggggcaaacccgctagggagacactccatatacggcccggcccgcgttacct    c.-301

.         .         .         .         .         .             g.4865
gggaccgggccaacccgctccttctttggtcaacgcaggggacccgggcgggggcccagg    c.-241

.         .         .         .         .         .             g.4925
ccgcgaaccggccgagggagggggctctagtgcccaacacccaaatatggctcgagaagg    c.-181

.         .         .         .         .         .             g.4985
gcagcgacattcctgcggggtggcgcggagggaatgcccgcgggctatataaaacctgag    c.-121

.         .            .         .         .         .          g.5045
cagagggacaagcgg \ ccaccgcagcggacagcgccaagtgaagcctcgcttcccctccgc c.-61


Powered by LOVD v.3.0 Build 19
©2004-2017 Leiden University Medical Center