ADAM metallopeptidase with thrombospondin type 1 motif, 10 (ADAMTS10) - 401 nt intron 08 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.18778
gtgaggggacaggagaggtctaggactggggctgagaaaacagatggtccagggaaccat  c.1040+60

         .         .         .         .         .         .  g.18838
gagagtccaaacagagatcacttctgctagggtcaggaggagcagagaagtttgggctgc  c.1040+120

         .         .         .         .         .         .  g.18898
ccatgagggagccagggatggggaggggctgcttgagaataatgggtaagggaggtttgg  c.1040+180

         .         .   g.18919
gaccatttgggcaccgatgcc  c.1040+201

--------------------- middle of intron ---------------------
                            g.18920     .         .           g.18939
                            c.1041-200  ctcattcacttattctccca  c.1041-181

.         .         .         .         .         .           g.18999
ctcatgcatgcatgcatgcattcattcattcatgtggtcagtcactcctgtatgcagctt  c.1041-121

.         .         .         .         .         .           g.19059
caggtgagaggcagatggcgcctccaaggcaggactcaacccccagagctgggcatggtg  c.1041-61

.         .         .         .         .         .           g.19119
gcatcagcagggcttagggagacagcccagccccctcactgaccctgtctccttttacag  c.1041-1


Powered by LOVD v.3.0 Build 25b
©2004-2020 Leiden University Medical Center