ADAM metallopeptidase with thrombospondin type 1 motif, 2 (ADAMTS2) - 1726 nt intron 12 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.212722
gtgagcccttctgggaggcatcagtgggggctcagcaggcaggccctagggtgggcaggg  c.1951+60

         .         .         .         .         .         .  g.212782
tgggggcttgtgcctctgatcctgcatggggcaaggctgccgcgaccctgggctggcagg  c.1951+120

         .         .         .         .         .         .  g.212842
agagcccaccctggctggtgtggctgccctggcccactcctgggtggggcattaaagttc  c.1951+180

         .         .         .         .         .         .  g.212902
ctagcagggctgcaatcccagagcaccagaacaccccagagtagctgaggacatggaaga  c.1951+240

         .         .         .         .         .         .  g.212962
ggtggccgggctgcgggctcggcaggggccgggctcctgcagttcaccgtgggtggacga  c.1951+300

         .         .         .         .         .         .  g.213022
ggcttgagctgtgtggtcagctcagggctgaggccagggctgaccctgccaaggaatctg  c.1951+360

         .         .         .         .         .         .  g.213082
gtgacctctgaccttctctattagtcgggactctcagttgcgagtgtcagaaagttgact  c.1951+420

         .         .         .         .         .         .  g.213142
ccaaccggtttcagcactagaaggcatttattggctcagggacctgaggagtctggtggc  c.1951+480

         .         .         .         .         .         .  g.213202
cttgggcatggcagtgcttgtgtggcagctggggaccctcctgggacggactgtaaacac  c.1951+540

         .         .         .         .         .         .  g.213262
agtccttgtttctcctccatggctgttgccctagcccagcagctgctgcctcatgtgggc  c.1951+600

         .         .         .         .         .         .  g.213322
cagtgcagggttggaggtgacacagcagatggggtccccctctggcggaggccacagtct  c.1951+660

         .         .         .         .         .         .  g.213382
gggggcccagcgttttagttgcctcagataaaggctgagaagggaaggttccagggacct  c.1951+720

         .         .         .         .         .         .  g.213442
gagtctgaatcgaggcaggctggcctcattctggatttcagagattgactgaaaaggatt  c.1951+780

         .         .         .         .         .         .  g.213502
atttactttttttttttttgagacggagtctcactctgttgcccaggctggagtgcagtg  c.1951+840

         .         .     g.213525
gcgtgatctctgctcactgcaac  c.1951+863

--------------------- middle of intron ---------------------
                         g.213526       .         .           g.213548
                         c.1952-863  ctctgcctcccaggttcaagcta  c.1952-841

.         .         .         .         .         .           g.213608
ttctcctgcctcagcctcctgagtagctgggacttcaggcgcacgccaccacacccggct  c.1952-781

.         .         .         .         .         .           g.213668
aaatttttgcattttttgtagagacagggtttcaccatgttagccaggatggtctccatc  c.1952-721

.         .         .         .         .         .           g.213728
tcctgacgtcatgatccgcctgcctcggcctcccaaagtgctgggattacaggcatgagc  c.1952-661

.         .         .         .         .         .           g.213788
cactgctcctggcctttttttttttttttttgagatggagtcttgctccgtcacccaggc  c.1952-601

.         .         .         .         .         .           g.213848
tggagtgcagtgtgcagtggcgcagtcttggctcactgcaagctcggcctcctgggttca  c.1952-541

.         .         .         .         .         .           g.213908
agcgattctcctgcctcagcctcccaagtatctgggattacaggcgctcaccaccacacc  c.1952-481

.         .         .         .         .         .           g.213968
cagctaatttttgtatttttagtagagacgggtttcaccatgttggccaggctggtctgg  c.1952-421

.         .         .         .         .         .           g.214028
aactcctgacctcaagtgatccacctgcctctgcctcccaaagcgctgggattacaggtg  c.1952-361

.         .         .         .         .         .           g.214088
tgagccatcttgcctggcctgaaaagggttctttagatagcaacccagcaaacagacatt  c.1952-301

.         .         .         .         .         .           g.214148
tgcagcctcggaggtctccaagcggggcctcggggatgtgagagccgggctgcaccaaca  c.1952-241

.         .         .         .         .         .           g.214208
gcctggctggcttggttgggaaaagctcttccaaagtccacaaccaccagggtcaaaggc  c.1952-181

.         .         .         .         .         .           g.214268
ttaggagacacagagacaggaagggggctgctgtcacccacccctttccctctctgtctg  c.1952-121

.         .         .         .         .         .           g.214328
ccctggagggtgggccacgtggggacccttgtggaaatttctcctgcttggtgcctcctt  c.1952-61

.         .         .         .         .         .           g.214388
tgcacacacatggggaagccatcagggctccttgcagacccccagctgcttcccttccag  c.1952-1


Powered by LOVD v.3.0 Build 25b
©2004-2020 Leiden University Medical Center