amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase (AGL) - coding DNA reference sequence

(used for variant description)

(last modified May 19, 2016)


This file was created to facilitate the description of sequence variants on transcript NM_000642.2 in the AGL gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_012865.1, covering AGL transcript NM_000642.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                     .         .         .         .                g.5040
                     cccggaagtgggccagaggtacggtccgctcccacctggg       c.-361

 .         .         .         .         .         .                g.5100
 gcgagtgcgcgcacggccaggttgggtaccgggtgcgcccaggaacccgcgcgaggcgaa       c.-301

 .         .         .         .         .         .                g.5160
 gtcgctgagactctgcctgcttctcacccagctgcctcggcgctgccccggtcgctcgcc       c.-241

 .         .         .         .         .         .                g.5220
 gcccctccctttgcccttcacggcgcccggccctccttgggctgcggcttctgtgcgagg       c.-181

 .         .         .         .         .         .                g.5280
 ctgggcagccagcccttccccttctgtttctccccgtcccctccccccgaccgtagcacc       c.-121

 .         .         .         .         .         .  | 02          g.5899
 agagtcgcgggtcctgcagtgccccagaagccgcacgtataactccctcggc | gggtaact    c.-61

 .         .         .         .         .         .                g.5959
 cattcgactgtggagttcttttaattcttatgaaagatttcaaatcctctagaagccaaa       c.-1

          .         .         .         .         .         .       g.6019
 ATGGGACACAGTAAACAGATTCGAATTTTACTTCTGAACGAAATGGAGAAACTGGAAAAG       c.60
 M  G  H  S  K  Q  I  R  I  L  L  L  N  E  M  E  K  L  E  K         p.20

          .         .   | 03     .         .         .         .    g.16457
 ACCCTCTTCAGACTTGAACAAG | GGTATGAGCTACAGTTCCGATTAGGCCCAACTTTACAG    c.120
 T  L  F  R  L  E  Q  G |   Y  E  L  Q  F  R  L  G  P  T  L  Q      p.40

          .         .         .         .         .         .       g.16517
 GGAAAAGCAGTTACCGTGTATACAAATTACCCATTTCCTGGAGAAACATTTAATAGAGAA       c.180
 G  K  A  V  T  V  Y  T  N  Y  P  F  P  G  E  T  F  N  R  E         p.60

          .         .         .         .         .         .       g.16577
 AAATTCCGTTCTCTGGATTGGGAAAATCCAACAGAAAGAGAAGATGATTCTGATAAATAC       c.240
 K  F  R  S  L  D  W  E  N  P  T  E  R  E  D  D  S  D  K  Y         p.80

          .         .         .         .         .    | 04    .    g.17180
 TGTAAACTTAATCTGCAACAATCTGGTTCATTTCAGTATTATTTCCTTCAAGG | AAATGAG    c.300
 C  K  L  N  L  Q  Q  S  G  S  F  Q  Y  Y  F  L  Q  G  |  N  E      p.100

          .         .         .         .         .         .       g.17240
 AAAAGTGGTGGAGGTTACATAGTTGTGGACCCCATTTTACGTGTTGGTGCTGATAATCAT       c.360
 K  S  G  G  G  Y  I  V  V  D  P  I  L  R  V  G  A  D  N  H         p.120

          .         .         .         .         .         .       g.17300
 GTGCTACCCTTGGACTGTGTTACTCTTCAGACATTTTTAGCTAAGTGTTTGGGACCTTTT       c.420
 V  L  P  L  D  C  V  T  L  Q  T  F  L  A  K  C  L  G  P  F         p.140

          .         .         .         . | 05       .         .    g.19322
 GATGAATGGGAAAGCAGACTTAGGGTTGCAAAAGAATCAG | GCTACAACATGATTCATTTT    c.480
 D  E  W  E  S  R  L  R  V  A  K  E  S  G |   Y  N  M  I  H  F      p.160

          .         .         .         .         .         .       g.19382
 ACCCCATTGCAGACTCTTGGACTATCTAGGTCATGCTACTCCCTTGCCAATCAGTTAGAA       c.540
 T  P  L  Q  T  L  G  L  S  R  S  C  Y  S  L  A  N  Q  L  E         p.180

          .         .         .         .         .         .       g.19442
 TTAAATCCTGACTTTTCAAGACCTAATAGAAAGTATACCTGGAATGATGTTGGACAGCTA       c.600
 L  N  P  D  F  S  R  P  N  R  K  Y  T  W  N  D  V  G  Q  L         p.200

          .         .         .         .         .         .       g.19502
 GTGGAAAAATTAAAAAAGGAATGGAATGTTATTTGTATTACTGATGTTGTCTACAATCAT       c.660
 V  E  K  L  K  K  E  W  N  V  I  C  I  T  D  V  V  Y  N  H         p.220

      | 06   .         .         .         .         .         .    g.25372
 ACTG | CTGCTAATAGTAAATGGATCCAGGAACATCCAGAATGTGCCTATAATCTTGTGAAT    c.720
 T  A |   A  N  S  K  W  I  Q  E  H  P  E  C  A  Y  N  L  V  N      p.240

          .         .         .         .         .         .       g.25432
 TCTCCACACTTAAAACCTGCCTGGGTCTTAGACAGAGCACTTTGGCGTTTCTCCTGTGAT       c.780
 S  P  H  L  K  P  A  W  V  L  D  R  A  L  W  R  F  S  C  D         p.260

          .         .         .         .         .         .       g.25492
 GTTGCAGAAGGGAAATACAAAGAAAAGGGAATACCTGCTTTGATTGAAAATGATCACCAT       c.840
 V  A  E  G  K  Y  K  E  K  G  I  P  A  L  I  E  N  D  H  H         p.280

        | 07 .         .         .         .         .         .    g.25728
 ATGAAT | TCCATCCGAAAAATAATTTGGGAGGATATTTTTCCAAAGCTTAAACTCTGGGAA    c.900
 M  N   | S  I  R  K  I  I  W  E  D  I  F  P  K  L  K  L  W  E      p.300

          .         .         .         .         .         | 08    g.29605
 TTTTTCCAAGTAGATGTCAACAAAGCGGTTGAGCAATTTAGAAGACTTCTTACACAAG | AA    c.960
 F  F  Q  V  D  V  N  K  A  V  E  Q  F  R  R  L  L  T  Q  E |       p.320

          .         .         .         .         .         .       g.29665
 AATAGGCGAGTAACCAAGTCTGATCCAAACCAACACCTTACGATTATTCAAGATCCTGAA       c.1020
 N  R  R  V  T  K  S  D  P  N  Q  H  L  T  I  I  Q  D  P  E         p.340

          .         .         .         .         .         .       g.29725
 TACAGACGGTTTGGCTGTACTGTAGATATGAACATTGCACTAACGACTTTCATACCACAT       c.1080
 Y  R  R  F  G  C  T  V  D  M  N  I  A  L  T  T  F  I  P  H         p.360

    | 09     .         .         .         .         .         .    g.30128
 GA | CAAGGGGCCAGCAGCAATTGAAGAATGCTGTAATTGGTTTCATAAAAGAATGGAGGAA    c.1140
 D  |  K  G  P  A  A  I  E  E  C  C  N  W  F  H  K  R  M  E  E      p.380

          .         .         .         .      | 10  .         .    g.30289
 TTAAATTCAGAGAAGCATCGACTCATTAACTATCATCAGGAACAG | GCAGTTAATTGCCTT    c.1200
 L  N  S  E  K  H  R  L  I  N  Y  H  Q  E  Q   | A  V  N  C  L      p.400

          .         .         .         .         .         .       g.30349
 TTGGGAAATGTGTTTTATGAACGACTGGCTGGCCATGGTCCAAAACTAGGACCTGTCACT       c.1260
 L  G  N  V  F  Y  E  R  L  A  G  H  G  P  K  L  G  P  V  T         p.420

          .         .    | 11    .         .         .         .    g.31411
 AGAAAGCATCCTTTAGTTACCAG | GTATTTTACTTTCCCATTTGAAGAGATAGACTTCTCC    c.1320
 R  K  H  P  L  V  T  R  |  Y  F  T  F  P  F  E  E  I  D  F  S      p.440

          .         .         .         .         .         .       g.31471
 ATGGAAGAATCTATGATTCATCTGCCAAATAAAGCTTGTTTTCTGATGGCACACAATGGA       c.1380
 M  E  E  S  M  I  H  L  P  N  K  A  C  F  L  M  A  H  N  G         p.460

          .         .         .         .    | 12    .         .    g.32574
 TGGGTAATGGGAGATGATCCTCTTCGAAACTTTGCTGAACCGG | GTTCAGAAGTTTACCTA    c.1440
 W  V  M  G  D  D  P  L  R  N  F  A  E  P  G |   S  E  V  Y  L      p.480

          .         .         .         .         .         .       g.32634
 AGGAGAGAACTTATTTGCTGGGGAGACAGTGTTAAATTACGCTATGGGAATAAACCAGAG       c.1500
 R  R  E  L  I  C  W  G  D  S  V  K  L  R  Y  G  N  K  P  E         p.500

          .         .         .         .         .         .       g.32694
 GACTGTCCTTATCTCTGGGCACACATGAAAAAATACACTGAAATAACTGCAACTTATTTC       c.1560
 D  C  P  Y  L  W  A  H  M  K  K  Y  T  E  I  T  A  T  Y  F         p.520

          .         .         .         .         .  | 13      .    g.34848
 CAGGGAGTACGTCTTGATAACTGCCACTCAACACCTCTTCACGTAGCTGAG | TACATGTTG    c.1620
 Q  G  V  R  L  D  N  C  H  S  T  P  L  H  V  A  E   | Y  M  L      p.540

          .         .         .         .         .         .       g.34908
 GATGCTGCTAGGAATTTGCAACCCAATTTATATGTAGTAGCTGAACTGTTCACAGGAAGT       c.1680
 D  A  A  R  N  L  Q  P  N  L  Y  V  V  A  E  L  F  T  G  S         p.560

          .         .         .         .         .      | 14  .    g.35553
 GAAGATCTGGACAATGTCTTTGTTACTAGACTGGGCATTAGTTCCTTAATAAGAG | AGGCA    c.1740
 E  D  L  D  N  V  F  V  T  R  L  G  I  S  S  L  I  R  E |   A      p.580

          .         .         .         .         .         .       g.35613
 ATGAGTGCATATAATAGTCATGAAGAGGGCAGATTAGTTTACCGATATGGAGGAGAACCT       c.1800
 M  S  A  Y  N  S  H  E  E  G  R  L  V  Y  R  Y  G  G  E  P         p.600

          .         .         .         .         .         .       g.35673
 GTTGGATCCTTTGTTCAGCCCTGTTTGAGGCCTTTAATGCCAGCTATTGCACATGCCCTG       c.1860
 V  G  S  F  V  Q  P  C  L  R  P  L  M  P  A  I  A  H  A  L         p.620

          .         .         .          | 15        .         .    g.36013
 TTTATGGATATTACGCATGATAATGAGTGTCCTATTGTG | CATAGATCAGCGTATGATGCT    c.1920
 F  M  D  I  T  H  D  N  E  C  P  I  V   | H  R  S  A  Y  D  A      p.640

          .         .         .         .         .         .       g.36073
 CTTCCAAGTACTACAATTGTTTCTATGGCATGTTGTGCTAGTGGAAGTACAAGAGGCTAT       c.1980
 L  P  S  T  T  I  V  S  M  A  C  C  A  S  G  S  T  R  G  Y         p.660

          .         .  | 16      .         .         .         .    g.36247
 GATGAATTAGTGCCTCATCAG | ATTTCAGTGGTTTCTGAAGAACGGTTTTACACTAAGTGG    c.2040
 D  E  L  V  P  H  Q   | I  S  V  V  S  E  E  R  F  Y  T  K  W      p.680

          .         .         .         .         .         .       g.36307
 AATCCTGAAGCATTGCCTTCAAACACAGGTGAAGTTAATTTCCAAAGCGGCATTATTGCA       c.2100
 N  P  E  A  L  P  S  N  T  G  E  V  N  F  Q  S  G  I  I  A         p.700

          .         .         .         .         .        | 17.    g.36460
 GCCAGGTGTGCTATCAGTAAACTTCATCAGGAGCTTGGAGCCAAGGGTTTTATTCAG | GTG    c.2160
 A  R  C  A  I  S  K  L  H  Q  E  L  G  A  K  G  F  I  Q   | V      p.720

          .         .         .         .         .         .       g.36520
 TATGTGGATCAAGTTGATGAAGACATAGTGGCAGTAACAAGACACTCACCTAGCATCCAT       c.2220
 Y  V  D  Q  V  D  E  D  I  V  A  V  T  R  H  S  P  S  I  H         p.740

          .         .         .         .         .         .       g.36580
 CAGTCTGTTGTGGCTGTATCTAGAACTGCTTTCAGGAATCCCAAGACTTCATTTTACAGC       c.2280
 Q  S  V  V  A  V  S  R  T  A  F  R  N  P  K  T  S  F  Y  S         p.760

          .         .         | 18         .         .         .    g.39068
 AAGGAAGTGCCTCAAATGTGCATCCCTG | GCAAAATTGAAGAAGTAGTTCTTGAAGCTAGA    c.2340
 K  E  V  P  Q  M  C  I  P  G |   K  I  E  E  V  V  L  E  A  R      p.780

          .         .         .         .         .         .       g.39128
 ACTATTGAGAGAAACACGAAACCTTATAGGAAGGATGAGAATTCAATCAATGGAACACCA       c.2400
 T  I  E  R  N  T  K  P  Y  R  K  D  E  N  S  I  N  G  T  P         p.800

          .         .         .    | 19    .         .         .    g.39282
 GATATCACAGTAGAAATTAGAGAACATATTCAG | CTTAATGAAAGTAAAATTGTTAAACAA    c.2460
 D  I  T  V  E  I  R  E  H  I  Q   | L  N  E  S  K  I  V  K  Q      p.820

          .         .         .         .         .         .       g.39342
 GCTGGAGTTGCCACAAAAGGGCCCAATGAATATATTCAAGAAATAGAATTTGAAAACTTG       c.2520
 A  G  V  A  T  K  G  P  N  E  Y  I  Q  E  I  E  F  E  N  L         p.840

          .         .       | 20 .         .         .         .    g.39519
 TCTCCAGGAAGTGTTATTATATTCAG | AGTTAGTCTTGATCCACATGCACAAGTCGCTGTT    c.2580
 S  P  G  S  V  I  I  F  R  |  V  S  L  D  P  H  A  Q  V  A  V      p.860

          .         .         .         .         .         .       g.39579
 GGAATTCTTCGAAATCATCTGACACAATTCAGTCCTCACTTTAAATCTGGCAGCCTAGCT       c.2640
 G  I  L  R  N  H  L  T  Q  F  S  P  H  F  K  S  G  S  L  A         p.880

          .         .         .         .  | 21      .         .    g.42913
 GTTGACAATGCAGATCCTATATTAAAAATTCCTTTTGCTTC | TCTTGCCTCCAGATTAACT    c.2700
 V  D  N  A  D  P  I  L  K  I  P  F  A  S  |  L  A  S  R  L  T      p.900

          .         .         .         .         .         .       g.42973
 TTGGCTGAGCTAAATCAGATCCTTTACCGATGTGAATCAGAAGAAAAGGAAGATGGTGGA       c.2760
 L  A  E  L  N  Q  I  L  Y  R  C  E  S  E  E  K  E  D  G  G         p.920

          .         .         .         .         .   | 22     .    g.46144
 GGGTGCTATGACATACCAAACTGGTCAGCCCTTAAATATGCAGGTCTTCAAG | GTTTAATG    c.2820
 G  C  Y  D  I  P  N  W  S  A  L  K  Y  A  G  L  Q  G |   L  M      p.940

          .         .         .         .         .         .       g.46204
 TCTGTATTGGCAGAAATAAGACCAAAGAATGACTTGGGGCATCCTTTTTGTAATAATTTG       c.2880
 S  V  L  A  E  I  R  P  K  N  D  L  G  H  P  F  C  N  N  L         p.960

          .         .         .         .         .         .       g.46264
 AGATCTGGAGATTGGATGATTGACTATGTCAGTAACCGGCTTATTTCACGATCAGGAACT       c.2940
 R  S  G  D  W  M  I  D  Y  V  S  N  R  L  I  S  R  S  G  T         p.980

           | 23        .         .         .         .         .    g.46573
 ATTGCTGAA | GTTGGTAAATGGTTGCAGGCTATGTTCTTCTACCTGAAGCAGATCCCACGT    c.3000
 I  A  E   | V  G  K  W  L  Q  A  M  F  F  Y  L  K  Q  I  P  R      p.1000

          .         .         .         .         .         .       g.46633
 TACCTTATCCCATGTTACTTTGATGCTATATTAATTGGTGCATATACCACTCTTCTGGAT       c.3060
 Y  L  I  P  C  Y  F  D  A  I  L  I  G  A  Y  T  T  L  L  D         p.1020

          .         .    | 24    .         .         .         .    g.47385
 ACAGCATGGAAGCAGATGTCAAG | CTTTGTTCAGAATGGTTCAACCTTTGTGAAACACCTT    c.3120
 T  A  W  K  Q  M  S  S  |  F  V  Q  N  G  S  T  F  V  K  H  L      p.1040

          .         .         .         .         .         .       g.47445
 TCATTGGGTTCAGTTCAACTGTGTGGAGTAGGAAAATTCCCTTCCCTGCCAATTCTTTCA       c.3180
 S  L  G  S  V  Q  L  C  G  V  G  K  F  P  S  L  P  I  L  S         p.1060

          .         .         .         .         .         .       g.47505
 CCTGCCCTAATGGATGTACCTTATAGGTTAAATGAGATCACAAAAGAAAAGGAGCAATGT       c.3240
 P  A  L  M  D  V  P  Y  R  L  N  E  I  T  K  E  K  E  Q  C         p.1080

          .          | 25        .         .         .         .    g.51243
 TGTGTTTCTCTAGCTGCAG | GCTTACCTCATTTTTCTTCTGGTATTTTCCGCTGCTGGGGA    c.3300
 C  V  S  L  A  A  G |   L  P  H  F  S  S  G  I  F  R  C  W  G      p.1100

          .         .         .         .         .         .       g.51303
 AGGGATACTTTTATTGCACTTAGAGGTATACTGCTGATTACTGGACGCTATGTAGAAGCC       c.3360
 R  D  T  F  I  A  L  R  G  I  L  L  I  T  G  R  Y  V  E  A         p.1120

    | 26     .         .         .         .         .         .    g.55610
 AG | GAATATTATTTTAGCATTTGCGGGTACCCTGAGGCATGGTCTCATTCCTAATCTACTG    c.3420
 R  |  N  I  I  L  A  F  A  G  T  L  R  H  G  L  I  P  N  L  L      p.1140

          .         .         .         .         .         .       g.55670
 GGTGAAGGAATTTATGCCAGATACAATTGTCGGGATGCTGTGTGGTGGTGGCTGCAGTGT       c.3480
 G  E  G  I  Y  A  R  Y  N  C  R  D  A  V  W  W  W  L  Q  C         p.1160

          .         .         .         .         .         .       g.55730
 ATCCAGGATTACTGTAAAATGGTTCCAAATGGTCTAGACATTCTCAAGTGCCCAGTTTCC       c.3540
 I  Q  D  Y  C  K  M  V  P  N  G  L  D  I  L  K  C  P  V  S         p.1180

          .         .         .         .         | 27         .    g.57611
 AGAATGTATCCTACAGATGATTCTGCTCCTTTGCCTGCTGGCACACTG | GATCAGCCATTG    c.3600
 R  M  Y  P  T  D  D  S  A  P  L  P  A  G  T  L   | D  Q  P  L      p.1200

          .         .         .         .         .         .       g.57671
 TTTGAAGTCATACAGGAAGCAATGCAAAAACACATGCAGGGCATACAGTTCCGAGAAAGG       c.3660
 F  E  V  I  Q  E  A  M  Q  K  H  M  Q  G  I  Q  F  R  E  R         p.1220

          .         .         .         . | 28       .         .    g.65648
 AATGCTGGTCCCCAGATAGATCGAAACATGAAGGACGAAG | GTTTTAATATAACTGCAGGA    c.3720
 N  A  G  P  Q  I  D  R  N  M  K  D  E  G |   F  N  I  T  A  G      p.1240

          .         .         .         .         .         .       g.65708
 GTTGATGAAGAAACAGGATTTGTTTATGGAGGAAATCGTTTCAATTGTGGCACATGGATG       c.3780
 V  D  E  E  T  G  F  V  Y  G  G  N  R  F  N  C  G  T  W  M         p.1260

          .         .         .         .         .       | 29 .    g.67325
 GATAAAATGGGAGAAAGTGACAGAGCTAGAAACAGAGGAATCCCAGCCACACCAAG | AGAT    c.3840
 D  K  M  G  E  S  D  R  A  R  N  R  G  I  P  A  T  P  R  |  D      p.1280

          .         .         .         .         .         .       g.67385
 GGGTCTGCTGTGGAAATTGTGGGCCTGAGTAAATCTGCTGTTCGCTGGTTGCTGGAATTA       c.3900
 G  S  A  V  E  I  V  G  L  S  K  S  A  V  R  W  L  L  E  L         p.1300

          .         .         .         .          | 30        .    g.68454
 TCCAAAAAAAATATTTTCCCTTATCATGAAGTCACAGTAAAAAGACATG | GAAAGGCTATA    c.3960
 S  K  K  N  I  F  P  Y  H  E  V  T  V  K  R  H  G |   K  A  I      p.1320

          .         .         .         .         .         .       g.68514
 AAGGTCTCATATGATGAGTGGAACAGAAAAATACAAGACAACTTTGAAAAGCTATTTCAT       c.4020
 K  V  S  Y  D  E  W  N  R  K  I  Q  D  N  F  E  K  L  F  H         p.1340

          .         .         .         .         .         .       g.68574
 GTTTCCGAAGACCCTTCAGATTTAAATGAAAAGCATCCAAATCTGGTTCACAAACGTGGC       c.4080
 V  S  E  D  P  S  D  L  N  E  K  H  P  N  L  V  H  K  R  G         p.1360

          .         .         .         .         .         .       g.68634
 ATATACAAAGATAGTTATGGAGCTTCAAGTCCTTGGTGTGACTATCAGCTCAGGCCTAAT       c.4140
 I  Y  K  D  S  Y  G  A  S  S  P  W  C  D  Y  Q  L  R  P  N         p.1380

          .         .  | 31      .         .         .         .    g.70344
 TTTACCATAGCAATGGTTGTG | GCCCCTGAGCTCTTTACTACAGAAAAAGCATGGAAAGCT    c.4200
 F  T  I  A  M  V  V   | A  P  E  L  F  T  T  E  K  A  W  K  A      p.1400

          .         .         .         .         .          | 32    g.71327
 TTGGAGATTGCAGAAAAAAAATTGCTTGGTCCCCTTGGCATGAAAACTTTAGATCCAGA | T    c.4260
 L  E  I  A  E  K  K  L  L  G  P  L  G  M  K  T  L  D  P  D  |      p.1420

          .         .         .         .         .         .       g.71387
 GATATGGTTTACTGTGGAATTTATGACAATGCATTAGACAATGACAACTACAATCTTGCT       c.4320
 D  M  V  Y  C  G  I  Y  D  N  A  L  D  N  D  N  Y  N  L  A         p.1440

          .         .        | 33.         .         .         .    g.71547
 AAAGGTTTCAATTATCACCAAGGACCT | GAGTGGCTGTGGCCTATTGGGTATTTTCTTCGT    c.4380
 K  G  F  N  Y  H  Q  G  P   | E  W  L  W  P  I  G  Y  F  L  R      p.1460

          .         .         .         .         .         .       g.71607
 GCAAAATTATATTTTTCCAGATTGATGGGCCCGGAGACTACTGCAAAGACTATAGTTTTG       c.4440
 A  K  L  Y  F  S  R  L  M  G  P  E  T  T  A  K  T  I  V  L         p.1480

          .         .         .         .  | 34      .         .    g.76469
 GTTAAAAATGTTCTTTCCCGACATTATGTTCATCTTGAGAG | ATCCCCTTGGAAAGGACTT    c.4500
 V  K  N  V  L  S  R  H  Y  V  H  L  E  R  |  S  P  W  K  G  L      p.1500

          .         .         .         .         .         .       g.76529
 CCAGAACTGACCAATGAGAATGCCCAGTACTGTCCTTTCAGCTGTGAAACACAAGCCTGG       c.4560
 P  E  L  T  N  E  N  A  Q  Y  C  P  F  S  C  E  T  Q  A  W         p.1520

          .         .         .                                     g.76568
 TCAATTGCTACTATTCTTGAGACACTTTATGATTTATAG                            c.4599
 S  I  A  T  I  L  E  T  L  Y  D  L  X                              p.1532

          .         .         .         .         .         .       g.76628
 tttattacagatattaagtatgcaattacttgtattataggatgcaaggtcatcatatgt       c.*60

          .         .         .         .         .         .       g.76688
 aaatgccttatatgcacaggctcaagttgttttaaaaatctcatttattataatattgat       c.*120

          .         .         .         .         .         .       g.76748
 gctcaattaggtaagattgtaaaagcattgattttttttaatgtacagaggtagatttca       c.*180

          .         .         .         .         .         .       g.76808
 atttgaatcagaaagaaatatcattaccaatgaaatgtgtttgagttcagtaagaattat       c.*240

          .         .         .         .         .         .       g.76868
 tcaaatgcctagaaatccatagtttggaaaagaaaaatcatgtcatcttctatttgtaca       c.*300

          .         .         .         .         .         .       g.76928
 gaaatgaaaataaaatatgaaaataatgaaagaaatgaaaagatagcttttaattgtggt       c.*360

          .         .         .         .         .         .       g.76988
 atatataatcttcagtaacaatacatactgaatacgctgtggttcattaatattaacacc       c.*420

          .         .         .         .         .         .       g.77048
 acgtactatagtattcttaatacagtgctcactgcatttaataaatatttaataaatgat       c.*480

          .         .         .         .         .         .       g.77108
 gaatgatagaagtttccatctacaatatatgttcctaaatggagcacagatgttcaaact       c.*540

          .         .         .         .         .         .       g.77168
 atgctttcattttttcactgatatattaatttttgtgtaatgaatgccaacagtatattt       c.*600

          .         .         .         .         .         .       g.77228
 tatatgatttacttatgtgaggaaacatgcaaagcattaggaaatttatttcctaaaaac       c.*660

          .         .         .         .         .         .       g.77288
 agttttgtaaaattagtattgagttctattgagtattataagatagcttacattttcaaa       c.*720

          .         .         .         .         .         .       g.77348
 atggaaattgtcggtcatatttctagaactttaaagaaaaaagaatgttatattagtttt       c.*780

          .         .         .         .         .         .       g.77408
 ctaaaactcaactatctttagtcatgttcaaaaatctattgctagatcatagtagatact       c.*840

          .         .         .         .         .         .       g.77468
 ggttttctattaactcaaaacctacattgacaagtttaacattgagaagaatcttaacaa       c.*900

          .         .         .         .         .         .       g.77528
 aaatatggatatgaattcagtagatatcttaaattcaataaaatcactggaagtttttca       c.*960

          .         .         .         .         .         .       g.77588
 tgataacttattttaagatgccttaaaaatcttaaagtcacaaaaggaaaaaggttttta       c.*1020

          .         .         .         .         .         .       g.77648
 acatttacatgagttaacattttttcatagaacttatttcctagatagaattttttactg       c.*1080

          .         .         .         .         .         .       g.77708
 ttttttactgttttcttaagaaaacagttaaatcattatgcattcagttggaagaaagta       c.*1140

          .         .         .         .         .         .       g.77768
 gtggcaagaattctttcattgctatataatattcagtggctcatttatacctaataaaat       c.*1200

          .         .         .         .         .         .       g.77828
 aatggtattttaaaataatgctactttcaaagtagcatttttttagttagtttacaggtt       c.*1260

          .         .         .         .         .         .       g.77888
 acatacccaaaaccttaactatgactaagaaattaaagaagaaaaccagcaaactaaaac       c.*1320

          .         .         .         .         .         .       g.77948
 ttctgggcagcaaaaatatataaatgcttcagatgtcaaatacccatgcttgaaagctcg       c.*1380

          .         .         .         .         .         .       g.78008
 tgtaatttactttaagattatctgcctgctcttcttcaaagctgaccttgctttagaaat       c.*1440

          .         .         .         .         .         .       g.78068
 agttttaactagcttagttttctggtttccaaaactaaaatagattaaatcctacaaatt       c.*1500

          .         .         .         .         .         .       g.78128
 taaggacagttgtgacagtaatctgaccactatctataaatacattggacattggtttcc       c.*1560

          .         .         .         .         .         .       g.78188
 aaatctccctttcttcttcagttccttccttgttcaatatatacccttctctaaactgtg       c.*1620

          .         .         .         .         .         .       g.78248
 cgggtaaaaggaatgactgtccttgagagaaccattagtttatcaaaggtttatgtagtt       c.*1680

          .         .         .         .         .         .       g.78308
 ttgttgctgtaccctaactttgatattcagggaggtaggaaaggtaacagaaaaccagca       c.*1740

          .         .         .         .         .         .       g.78368
 tatttaatcaaagcaagaagtaatcgctgacagttaaatgtgaccaaaaaaattaaaagt       c.*1800

          .         .         .         .         .         .       g.78428
 tcacaatttttttaatgtagccatttggggttatctctagtaaggcagatacccacgttg       c.*1860

          .         .         .         .         .         .       g.78488
 gtaaatttttaggatattgtgttgcactagaaaactaagtggttcatatttctaatgagg       c.*1920

          .         .         .         .         .         .       g.78548
 aagattaatgaaagaacattgttatattctgcgtggtatattttaaagtttaagaaggca       c.*1980

          .         .         .         .         .         .       g.78608
 tgttaaacattatttcctctatggtagttaaaatacagaattagatttttaacaggtgtc       c.*2040

          .         .         .         .         .         .       g.78668
 atttgactaaacgtttcggtagaatgcttcatacttgagtgatgctggataaggtattgt       c.*2100

          .         .         .         .         .         .       g.78728
 atttcaacaatggactatgccttggtttttcactaatcaaaatcaaaattactctttaac       c.*2160

          .         .         .         .         .         .       g.78788
 atgataaatgaatttaccagtttagtatgctgtggtattttaataagttttcaaagataa       c.*2220

          .         .         .         .         .         .       g.78848
 ttgggaaaacatgagactggtcatattgatgaatattgtaacatgtgaattgtgatccat       c.*2280

          .         .         .         .         .         .       g.78908
 ttctgatatgtcttgaactactgtgtctagtgggcaaatgtcattgttacctctgtgtgt       c.*2340

          .         .         .                                     g.78940
 taagaaaataaaaatattttctaaaggtctgt                                   c.*2372

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 15
©2004-2016 Leiden University Medical Center